Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Financial Statistics of Major U.S. Investor-Owned Electric Utilities  

Reports and Publications (EIA)

1996 - Final issue. Presents summary and detailed financial accounting data on the investor-owned electric utilities.

Information Center



Financial statistics of major US investor-owned electric utilities 1994  

SciTech Connect

The Financial Statistics of Major U.S. Investor-Owned Electric Utilities publication presents summary and detailed financial accounting data on the investor-owned electric utilities. The objective of the publication is to provide Federal and State Governments, industry, and the general public with current and historical data that can be used for making policy and decisions relating to investor-owned electric utility issues.




Financial statistics of major U.S. investor-owned electric utilities 1993  

SciTech Connect

The Financial Statistics of Major US Investor-Owned Electric Utilities publication presents summary and detailed financial accounting data on the investor-owned electric utilities. The objective of the publication is to provide Federal and State governments, industry, and the general public with current and historical data that can be used for policymaking and decisionmaking purposes related to investor-owned electric utility issues.

Not Available



Financial Impacts of Nonutility Power Purchases on Investor-Owned Electric Utilities  

Reports and Publications (EIA)

This report provides an overview of the issues surrounding the financial impacts of nonutility generation contracts (since the passage of the Public Utility Regulatory Policies Act of 1978) on investor-owned utilities.

Information Center



Financial impacts of nonutility power purchases on investor-owned electric utilities  

SciTech Connect

To assist in its these responsibilities in the area of electric power, EIA has prepared this report, Financial Impacts of Nonutility Power Purchases on Investor-Owned Electric Utilities. The primary purpose of this report is to provide an overview of the issues surrounding the financial impacts of nonutility generation contracts (since the passage of the Public Utility Regulatory Policies Act of 1978) on investor-owned utilities. The existing concern in this area is manifest in the provisions of Section 712 of the Energy Policy Act of 1992, which required State regulatory commissions to evaluate various aspects of long-term power purchase contracts, including their impact on investor-owned utilities` cost of capital and rates charged to customers. The EIA does not take positions on policy questions. The EIA`s responsibility is to provide timely, high quality information and to perform objective, credible analyses in support of the deliberations by both public and private decision-makers. Accordingly, this report does not purport to represent the policy positions of the US Department of Energy or the Administration.

Not Available



Incentive regulation of investor-owned nuclear power plants by public utility regulators. Revision 1  

Science Conference Proceedings (OSTI)

The US Nuclear Regulatory Commission (NRC) periodically surveys the Federal Energy Regulatory Commission (FERC) and state regulatory commissions that regulate utility owners of nuclear power plants. The NRC is interested in identifying states that have established economic or performance incentive programs applicable to nuclear power plants, how the programs are being implemented, and in determining the financial impact of the programs on the utilities. The NRC interest stems from the fact that such programs have the potential to adversely affect the safety of nuclear power plants. The current report is an update of NUREG/CR-5975, Incentive Regulation of Investor-Owned Nuclear Power Plants by Public Utility Regulators, published in January 1993. The information in this report was obtained from interviews conducted with each state regulatory agency that administers an incentive program and each utility that owns at least 10% of an affected nuclear power plant. The agreements, orders, and settlements that form the basis for each incentive program were reviewed as required. The interviews and supporting documentation form the basis for the individual state reports describing the structure and financial impact of each incentive program.

McKinney, M.D.; Seely, H.E.; Merritt, C.R.; Baker, D.C. [Pacific Northwest Lab., Richland, WA (United States)



Estimating potential stranded commitments for U.S. investor-owned electric utilities  

SciTech Connect

New technologies, low natural gas prices, and federal and state utility regions are restructuring the electricity industry. Yesterday`s vertically integrated utility with a retail monopoly franchise may be a very different organization in a few years. Conferences, regulatory-commission hearings, and other industry fora are dominated by debates over the extent and form of utility deintegration, wholesale competition, and retail wheeling. A key obstacle to restructuring the electricity industry is stranded commitments. Past investments, power-purchase contracts, and public-policy-driven programs that made sense in an era of cost-of-service regulation may not be cost-effective in a competitive power market. Regulators, utilities, and other parties face tough decisions concerning the mitigation and allocation of these stranded commitments. The authors developed and applied a simple method to calculate the amount of stranded commitments facing US investor-owned electric utilities. The results obtained with this method depend strongly on a few key assumptions: (1) the fraction of utility sales that is at risk with respect to competition, (2) the market price of electric generation, and (3) the number of years during which the utility would lose money because of differences between its embedded cost of production and the market price.

Baxter, L.; Hirst, E.



Incentive regulation of investor-owned nuclear power plants by public utility regulators  

Science Conference Proceedings (OSTI)

The US Nuclear Regulatory Commission (NRC) periodically surveys the Federal Energy Regulatory Commission (FERC) and state regulatory commissions that regulate utility owners of nuclear power plants. The NRC is interested in identifying states that have established economic or performance incentive programs applicable to nuclear power plants, including states with new programs, how the programs are being implemented, and in determining the financial impact of the programs on the utilities. The NRC interest stems from the fact that such programs have the potential to adversely affect the safety of nuclear power plants. The information in this report was obtained from interviews conducted with each state regulatory agency that administers an incentive program and each utility that owns at least 10% of an affected nuclear power plant. The agreements, orders, and settlements that form the basis for each incentive program were reviewed as required. The interviews and supporting documentation form the basis for the individual state reports describing the structure and financial impact of each incentive program.

McKinney, M.D.; Elliot, D.B. (Pacific Northwest Lab., Richland, WA (United States))



Vermont Energy Investors Corp | Open Energy Information  

Open Energy Info (EERE)

Vermont Energy Investors Corp Jump to: navigation, search Name Vermont Energy Investors Corp Place Burlington, Vermont Zip VT 05401-4 Sector Efficiency, Renewable Energy Product...


From Investor-owned Utility to Independent Power Producer  

E-Print Network (OSTI)

L G & E Energy Corporation Xcel Energy IPP Y N Y Y Y Y Y Y YAmerican Electric Power Co Ine Xcel Energy IPP Y Y Y N Y Y NPower Co Ine UtiliCorp United Xcel Energy American Electric

Ishii, Jun



From Investor-owned Utility to Independent Power Producer  

E-Print Network (OSTI)

generation supply, three (Duke Energy N o r t h A m e r i cCompany PG&E Exelon Duke Energy ConEd Edison InternationalDominion Resources Inc Duke Energy Public Serv Enterprise

Ishii, Jun



NREL: Technology Transfer - Clean Energy Investors Directory  

National Renewable Energy Laboratory Technology Transfer NREL is no longer maintaining the Clean Energy Investors Directory due to widely accessible ...


NREL: Technology Transfer - Clean Energy Investors Directory  

NREL is no longer maintaining the Clean Energy Investors Directory due to widely accessible online information and financing resources. For a list of ...


Buildings Performance Database Helps Building Owners, Investors...  

NLE Websites -- All DOE Office Websites (Extended Search)

Buildings Performance Database Helps Building Owners, Investors Evaluate Energy Efficient Buildings Buildings Performance Database June 2013 A new database of building features and...


Risk Neutral Investors Do Not Acquire Information¤  

E-Print Network (OSTI)

attempt to extract market information from asset price (more than investors’ market information. Market clearing orasset price omits market information. Unrelated assumptions

Muendler, Marc-Andreas



Global Energy Investors | Open Energy Information  

Open Energy Info (EERE)

Investors Investors Jump to: navigation, search Name Global Energy Investors Place Waltham, Massachusetts Zip 2451 Sector Biomass, Hydro, Solar, Wind energy Product Massachusetts-based Global Energy Investors was formed in 2009 to invest primarily in wind and solar power projects but it may also consider biomass and hydro projects. Coordinates 44.126439°, -73.213733° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.126439,"lon":-73.213733,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Do financial investors destabilize the oil price?  

Gasoline and Diesel Fuel Update (EIA)

N E 2 011 by Marco J. Lombardi and Ine Van Robays DO FINANCIAL INVESTORS DESTABILIZE THE OIL PRICE? WO R K I N G PA P E R S E R I E S N O 13 4 6 J U N E 2011 DO FINANCIAL...


Quercus Trust David Gelbaum Private investor | Open Energy Information  

Open Energy Info (EERE)

Quercus Trust David Gelbaum Private investor Quercus Trust David Gelbaum Private investor Jump to: navigation, search Name Quercus Trust / David Gelbaum (Private investor) Place Newport Beach, California Zip 92660 Product David Gelbaum is an angel investor who runs the Quercus Trust, a major donor to conservation advocacy and enviromental organisations, and takes passive stakes in public companies. References Quercus Trust / David Gelbaum (Private investor)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Quercus Trust / David Gelbaum (Private investor) is a company located in Newport Beach, California . References ↑ "Quercus Trust / David Gelbaum (Private investor)" Retrieved from "http://en.openei.org/w/index.php?title=Quercus_Trust_David_Gelbaum_Private_investor&oldid=350147"


Institutional Investors Group on Climate Change IIGCC | Open Energy  

Open Energy Info (EERE)

Institutional Investors Group on Climate Change IIGCC Institutional Investors Group on Climate Change IIGCC Jump to: navigation, search Name Institutional Investors Group on Climate Change (IIGCC) Place London, United Kingdom Zip EC1N 7WF Product The IIGCC is a forum for collaboration between pension funds and other institutional investors on issues related to climate change. References Institutional Investors Group on Climate Change (IIGCC)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Institutional Investors Group on Climate Change (IIGCC) is a company located in London, United Kingdom . References ↑ "Institutional Investors Group on Climate Change (IIGCC)" Retrieved from "http://en.openei.org/w/index.php?title=Institutional_Investors_Group_on_Climate_Change_IIGCC&oldid=346996


Solar Energy LLC Industrial Investors Group | Open Energy Information  

Open Energy Info (EERE)

LLC Industrial Investors Group LLC Industrial Investors Group Jump to: navigation, search Name Solar Energy LLC - Industrial Investors Group Place Moscow, Russian Federation Zip 119017 Sector Solar Product The company Solar Energy plans to use turnkey equipment from GT Solar and others to make silicon, ingots, wafers and cells in Russia. References Solar Energy LLC - Industrial Investors Group[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Solar Energy LLC - Industrial Investors Group is a company located in Moscow, Russian Federation . References ↑ "Solar Energy LLC - Industrial Investors Group" Retrieved from "http://en.openei.org/w/index.php?title=Solar_Energy_LLC_Industrial_Investors_Group&oldid=351271

Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Do financial investors destabilize the oil price?  

Gasoline and Diesel Fuel Update (EIA)

WO WO R K I N G PA P E R S E R I E S N O 1 3 4 6 / J U N E 2 011 by Marco J. Lombardi and Ine Van Robays DO FINANCIAL INVESTORS DESTABILIZE THE OIL PRICE? WO R K I N G PA P E R S E R I E S N O 13 4 6 / J U N E 2011 DO FINANCIAL INVESTORS DESTABILIZE THE OIL PRICE? 1 by Marco J. Lombardi 2 and Ine Van Robays 3 1 This paper was initiated when the second author was with the European Central Bank. Without implicating, we would like to thank Bahattin BĂĽyĂĽksahin, Gert Peersman, Jaap Bos, Julio Carrillo, Lutz Kilian, Punnoose Jacob, Sandra Eickmeier and an anonymous referee for their useful comments and suggestions. 2 Directorate General Economics, European Central Bank, Kaiserstrasse 29, D-60311 Frankfurt am Mai, Germany; e-mail: marco.lombardi@ecb.europa.eu 3 Department of Financial Economics, Ghent University, Woodrow Wilsonplein 5D, B-9000 Gent,


System average rates of U.S. investor-owned electric utilities : a statistical benchmark study  

E-Print Network (OSTI)

Using multiple regression methods, we have undertaken a statistical "benchmark" study comparing system average electricity rates charged by three California utilities with 96 other US utilities over the 1984-93 time period. ...

Berndt, Ernst R.



Attribution Bias, Market Condition, and Trading Behavior of Individual Investors  

E-Print Network (OSTI)

Theory predicts that attribution bias creates overconfident traders and thus causes excessive trading in the market. This paper tests this prediction by comparing the trading behavior of individual investors in different market conditions. In a bull market, investors suffer more from attribution bias and therefore should be more overconfident and trade more excessively. Using the trading records of Chinese individual investors from January 2005 to November 2008, we find that individual investors trade more excessively in a bull market than in a bear market, where excessive trading is measured following Odean (1999) and Barber and Odean (2001). Specifically, we find that in the bull market the securities bought by individual investors significantly underperform those sold in the subsequent periods of one and three months. In the bear market, however, individual investors do not make the similar suboptimal trading decisions as they do in the bull market. In addition, the poor trading decisions made in the bull market are due to poor security selection, and not due to poor market timing. Furthermore, we demonstrate that individual investors turn their portfolios more frequently and their performance measured by market abnormal returns is significantly worse in the bull market than in the bear market. Overall, these results provide strong evidence that attribution bias creates overconfident traders and thus causes excessive trading in the market. Key words: Attribution bias, individual trading behavior, bull market, and bear market.

Zhen Shi A; Na Wang B



Investor and entrepreneur visits Los Alamos for open coffee  

NLE Websites -- All DOE Office Websites (Extended Search)

Investor and entrepreneur visits for open coffee Investor and entrepreneur visits for open coffee Investor and entrepreneur visits Los Alamos for open coffee Brad Feld, a renowned early-stage investor and entrepreneur, will attend a meeting of the Open Coffee Club networking event. March 29, 2010 Los Alamos National Laboratory sits on top of a once-remote mesa in northern New Mexico with the Jemez mountains as a backdrop to research and innovation covering multi-disciplines from bioscience, sustainable energy sources, to plasma physics and new materials. Los Alamos National Laboratory sits on top of a once-remote mesa in northern New Mexico with the Jemez mountains as a backdrop to research and innovation covering multi-disciplines from bioscience, sustainable energy sources, to plasma physics and new materials.


Opportunities and obstacles for foreign investors in Turkish real estate  

E-Print Network (OSTI)

This paper examines the Turkish real estate market from the viewpoint of foreign investors contemplating entering into that market. Since 2002, the government of Turkey has been implementing an aggressive economic reform ...

Halkali, Hasan



NREL: News Feature - Bright Ideas Chase Investor Dollars at Forum  

NLE Websites -- All DOE Office Websites (Extended Search)

Bright Ideas Chase Investor Dollars at Forum Bright Ideas Chase Investor Dollars at Forum December 17, 2013 In this photo, two men in suits are in animated conversation, while two others listen in. In the background are other conference attendees in a crowded room. Enlarge image Ilan Gur (right), program director and technology-to-market senior advisor for ARPA-E, networks with company representatives and investors at NREL's 2013 Industry Growth Forum in Denver. Credit: Dennis Schroeder A company that can generate electricity using low-temperature waste heat was the big winner at the recent 26th annual Industry Growth Forum in downtown Denver, a gathering of people who have no qualms about making money while helping to build a more sustainable world. The annual gathering sponsored by the Energy Department's National


West Central Biodiesel Investors LLC | Open Energy Information  

Open Energy Info (EERE)

Investors LLC Investors LLC Jump to: navigation, search Name West Central Biodiesel Investors, LLC Place Ralston, Iowa Zip 51459 Product Iowa-based body raising capital to support the American biofuel industry. Coordinates 44.71762°, -108.864694° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.71762,"lon":-108.864694,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Energy Efficiency and Value: Opportunities for Investors | ENERGY STAR  

NLE Websites -- All DOE Office Websites (Extended Search)

Efficiency and Value: Opportunities for Investors Efficiency and Value: Opportunities for Investors Secondary menu About us Press room Contact Us Portfolio Manager Login Facility owners and managers Existing buildings Commercial new construction Industrial energy management Small business Service providers Service and product providers Verify applications for ENERGY STAR certification Design commercial buildings Energy efficiency program administrators Commercial and industrial program sponsors Associations State and local governments Federal agencies Tools and resources Training In This Section Campaigns Commercial building design Communications resources Energy management guidance Financial resources Portfolio Manager Products and purchasing Recognition Research and reports Service and product provider (SPP) resources Success stories


Investor Flows and the 2008 Boom/Bust in Oil Prices  

Gasoline and Diesel Fuel Update (EIA)

Investor Investor Flows and Speculation New Evidence on Investor Flows and Oil Prices References Investor Flows and the 2008 Boom/Bust in Oil Prices Kenneth J. Singleton Graduate School of Business Stanford University August, 2011 Introduction Investor Flows and Speculation New Evidence on Investor Flows and Oil Prices References Investor Flows, Speculation, and Oil Prices The role of speculation (broadly construed) in the dramatic rise and subsequent sharp decline in oil prices during 2008? Many attribute these swings to changes in fundamentals of supply and demand, within representative agent models. At the same time there is mounting evidence of the "financialization" of commodity markets. Objective: investigate the impact of investor flows and financial market conditions on crude-oil futures prices. Introduction Investor Flows and Speculation New Evidence on


Investor clienteles and industry factor-price exposure  

E-Print Network (OSTI)

The authors thank The Global Association of Risk Professionals (GARP) for funding. We are especially grateful to Brian Bushee for providing his data on institutional ownership classifications. We thank Paul Zarowin and seminar participants at New York University, the London Business School, INSEAD, the University of Rochester, and Southern Methodist University for helpful suggestions on an earlier version of the paper, and David Barker, Matt Billett, Brian Bushee, Eric Lie, Anand Vijh, and seminar participants at the University of Iowa for comments on this version. Minton acknowledges financial support from the Dice Center for Research in Financial Economics. Investor clienteles and industry factor-price exposure We find robust evidence of investor clienteles for industry factor-price exposure: Investor interest, measured using share turnover and the number of institutions that hold a firm’s stock, is positively associated with stocks ’ industry exposure, and institutional investors systematically overweight (underweight) high (low) industry exposure stocks in their portfolios. Clientele effects are most pronounced in industries in which return correlation with the aggregate market is low, where the benefits from learning about industry risk and from substituting investment in high-exposure stocks for investment in the industry assets are greatest. Clientele effects are

Phil Davies; Bernadette A. Minton; Catherine Schrand



Debiasing investors with decision support systems: An experimental investigation  

Science Conference Proceedings (OSTI)

This research presents evidence that decision support systems can play an important role in debiasing behaviorally-challenged investors. An empirical study involving 119 participants provides strong evidence for the existence of cognitive biases in investment ... Keywords: Cognitive biases, Decision support systems, Investment decision making

Gokul Bhandari; Khaled Hassanein; Richard Deaves



Oil and Gas Investor returns climb as oil  

E-Print Network (OSTI)

Oil and Gas Investor returns climb as oil and gas drilling ventures succeed. www Posters Posters from the Mars Exploration, depicting the landscape & much more Zazzle.com Ground Scientists Propose Paradigm Shift in Robotic Space Exploration · New Direction for Hydrogen Atom Transfers

Arizona, University of


Do Investors Forecast Fat Firms? Evidence from the Gold Mining Industry  

E-Print Network (OSTI)

Economists’ Gold Price Forecasts,” Australian Journal ofDo Investors Forecast Fat Firms? Evidence from the Gold

Borenstein, Severin; Farrell, Joseph



Estimating Civilian Owned Firearms  

E-Print Network (OSTI)

Most of the world’s firearms are privately owned. 1 They include improvised craft guns as well as handguns, rifles, shotguns, and machine guns. The legal definition of a civilian firearm varies; some states allow civilian ownership of certain firearms that are restricted to military use in other states. The word civilian is used here to refer to actual possession, not legality. In 2007, the Small Arms Survey estimated the number of civilian firearm ownership worldwide at approximately 650 million weapons out of some 875 then in existence (see Figures 1 and 2). National ownership rates range from a high of 90 firearms per every 100 people in the United States, to one firearm or less for every 100 residents in countries like South Korea and Ghana (see Table 1). With the world’s factories delivering millions of newly manufactured firearms annually, and with far fewer being destroyed, civilian ownership is growing (Small Arms Survey, 2007, p. 39). Poor record-keeping and the near absence of reporting requirements for detailed information complicate assessments of global stockpiles of small arms and light weapons. When it comes to estimating civilian firearm ownership, differences in national gun culture —each country’s unique combination of historic and current sources of supply, laws and attitudes toward firearms ownership—often have distinct effects on the classification, ownership and perception of firearms. In addition, categories of firearm holders may overlap, as some individuals may use their private firearms at work as security guards, in armed groups, or in gangs.

unknown authors



A note on super-hedging for investor-producers  

E-Print Network (OSTI)

We study the situation of an investor-producer who can trade on a financial market in continuous time and can transform some assets into others by means of a discrete time production system, in order to price and hedge derivatives on produced goods. This general framework covers the interesting case of an electricity producer who wants to hedge a financial position and can trade commodities which are also inputs for his system. This extends the framework of Bouchard and Nguyen (2011) to continuous time for concave and bounded production functions. We introduce the flexible concept of conditional sure profit along the idea of the no sure profit condition of Rasonyi (2009) and show that it allows one to provide a closedness property for the set of super-hedgeable claims in a very general setting. Using standard separation arguments, we then deduce a dual characterization of the latter.

Huu, Adrien Nguyen



No Home Like Your Own.  

E-Print Network (OSTI)

??No Home Like Your Own is a journey through my childhood memories of pre?war Socialist Yugoslavia and the war in Bosnia and Herzegovina that followed… (more)

Alibaši?, Emir



Creating an incentive for investor intermediaries to improve corporate governance  

E-Print Network (OSTI)

At the end of the 1980s, there was some speculation that leveraged buyouts (LBOs) would lead to the demise of the public company in favor of privately owned companies after a decade of the market for corporate control ...

Gershkowitz, Todd M



Analyzing the influence of overconfident investors on financial markets through agent-based model  

Science Conference Proceedings (OSTI)

In this research, we employ Agent-Based Model to analyze how asset prices are affected by investors' Behavior. This analysis places focus on the influence of overconfident investors on financial market. As a result of intensive analysis, we find that ... Keywords: agent based-model, asset pricing, behavioral economics, overconfidence

Hiroshi Takahashi; Takao Terano



Do Investment Banks' Relationships with Investors Impact Pricing? The Case of Convertible Bond Issues  

Science Conference Proceedings (OSTI)

This study examines the role of repeat interactions between placement agents (investment banks) and investors in the initial pricing of convertible bonds. Under the assumption that attracting repeat investors can reduce search frictions in primary issue ... Keywords: convertible bonds, corporate finance, securities issuance, underpricing

Brian J. Henderson; Heather Tookes



Sustainability in Real Estate- "Do Green Buildings make Investors Happy?"  

E-Print Network (OSTI)

“If you don’t join in, you have lost already!” or “Green Building is just a trend.”- Quotes like these have dominated the real estate press over the past year. Who will prove right in the end? It will soon be decided when real estate assessors and chartered surveyors start accounting for energy efficiency, the health and comfort issues of occupants as well as other sustainability aspects. Occupants are already showing interest in the sustainability issues of their real estate. According to an opinion poll completed in June 2008 among tenants of Union Investment Real Estate AG, 68 percent of tenants would be willing to pay a premium for renewable energy sources enhancing the efficiency of energy consumption in their buildings. After all, service charges will be lower with new technology and after the implementation of a coherent sustainability strategy tenants will benefit from a higher quality work environment. An even higher percentage, 72 percent of tenants, state that the degree of sustainability of the building has an influence on future decisions to rent or not to rent in a given building. Tenant preferences not only make the sustainability of real estate economically relevant but also make it key to a real estate portfolio, which is able to survive the next cycle with lower vacancy rates and higher yields as it accounts for the needs of the occupants as well as for the high standards of multinational corporations. The latter often have to show their ethical behavior in annual reports. Members of the carbon disclosure project, for instance, need to declare their CO˛- footprint regularly throughout the fiscal year. In the end the financial performance of real estate is determined by the preferences of the occupants. As such it becomes obvious why sustainable real estate is in the investor´s best interest. High ethical standards and entrepreneurial responsibility prompted Union Investment Real Estate AG to get involved and participate in the activities of the German sustainable building council (DGNB). Its goal is to develop a system for certification comparable to established international standards like LEED or BREEAM. A wide variety of interest groups within the construction and real estate industry work together with the DGNB to measure and map specific criteria and the requirements of sustainability in the German market. Union Investment Real Estate AG is convinced that "Green Building" is an irreversible development, as it results in ecologically and socially reasonable investments and demonstrates the responsible attitude of the industry in times of ever increasing energy costs, which also makes it a plain economic necessity to act sustainably.

Bode, R.


Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


An analysis of investor types in real estate capital markets : their behavior and performance from 2000 to 2006  

E-Print Network (OSTI)

This thesis explores the timing and returns of eight types of real estate investors between 2000 and 2006. The investor types considered are 1) private local, 2) private national, 3) institutional, 4) public REIT (Real ...

Morrison, John Harris, III



Who Owns Renewable Energy Certificates?  

E-Print Network (OSTI)

Who Owns Renewable Energy Certificates? Edward Holt, RyanME 04079 edholt@igc.org Renewable energy certificates (RECs)convey the attributes of a renewable energy generator and

Holt, Edward; Wiser, Ryan; Bolinger, Mark



Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


An analysis of Hong Kong REIT : current and future opportunities for investors  

E-Print Network (OSTI)

Real estate investment trust (REIT) is a valuable investment alternative for investors in many markets. Being home to a handful of world-class property developers, Hong Kong, the Asia financial hub, seemed to have met all ...

Chow, King Man



Are Investors the Bad Guys? Tenure and Neighborhood Stability in Chelsea, Massachusetts  

E-Print Network (OSTI)

In this article, we examine the role of investors and occupant-owners in an urban context during the recent housing crisis. We focus on Chelsea, Massachusetts, because it is a dense city, dominated by multifamily housing ...

Fisher, Lynn M.


Energy Deputy Secretary Poneman Tours Minority-Owned Small Business in  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Deputy Secretary Poneman Tours Minority-Owned Small Business Energy Deputy Secretary Poneman Tours Minority-Owned Small Business in Detroit Energy Deputy Secretary Poneman Tours Minority-Owned Small Business in Detroit May 22, 2012 - 10:37am Addthis Deputy Secretary of Energy Daniel Poneman meets with owners and workers at Diversified Chemical Technologies, a small business in Detroit, MI. | Energy Department photo Deputy Secretary of Energy Daniel Poneman meets with owners and workers at Diversified Chemical Technologies, a small business in Detroit, MI. | Energy Department photo Bill Gibbons Deputy Press Secretary, Office of Public Affairs What does this mean for me? During National Small Business Week, Energy Department leaders are visiting small businesses across the country as a renewed promise to help their businesses grow, hire and succeed.


Six ARPA-E Projects Illustrate Private Investors Excited About Clean Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Six ARPA-E Projects Illustrate Private Investors Excited About Six ARPA-E Projects Illustrate Private Investors Excited About Clean Energy Innovation Six ARPA-E Projects Illustrate Private Investors Excited About Clean Energy Innovation February 3, 2011 - 12:00am Addthis Washington, DC - In a little over one year, six projects that received a total of $23.6 million in seed funding from the Department of Energy's Advanced Research Project Agency - Energy (ARPA-E) have generated more than $100 million in outside private capital investment, Energy Secretary Steven Chu announced today. The six projects, which received between $750,000 and $8 million each, focus on improving solar and wind energy technologies and advanced battery storage. "This amount of private capital support indicates that the business community is hungry to invest in truly innovative solutions to the


Does green lead to green? : an exploratory study of the influence of corporate environmental reputation on investor decision making.  

E-Print Network (OSTI)

??In this dissertation, I report on the results of an exploratory study that examined the impact of corporate environmental reputation (CER) on investor decision-making. By… (more)

Pather, Rubintheran



The Online Investor: Levelling the Information Playing Field, 1st edition  

Science Conference Proceedings (OSTI)

From the Publisher:As traditional full service stockbroking and investment management gradually give way to a new breed of DIY stockmarket investor, there is a growing demand for knowledge, techniques and products. This book aims to focus on how the ...

Peter Temple



How Do Investors Respond to Green Company Awards in China?1  

E-Print Network (OSTI)

quality, China has begun taking measures to increase environmental fees, to increase reliance on renewable1 How Do Investors Respond to Green Company Awards in China?1 September, 2011 Thomas Lyon, Yao Lu, Xinzheng Shi, Qie Yin Abstract We find that firms winning Green Company Awards in China from 2008 to 2011

Lyon, Thomas P.


Firms' information security investment decisions: Stock market evidence of investors' behavior  

Science Conference Proceedings (OSTI)

In the information society, it is important for firms to manage their core information resources securely. However, the difficulty of measuring the return on an IT security investment is one of the critical obstacles for firms in making such investment ... Keywords: Abnormal returns, Event methodology, Information security investment, Investors' behavior, Market value, Sarbanes-Oxley Act (SOX)

Sangmi Chai; Minkyun Kim; H. Raghav Rao



Who Owns Renewable Energy Certificates?  

SciTech Connect

Renewable energy certificates (RECs) are tradable instruments that convey the attributes of a renewable energy generator and the right to make certain claims about energy purchases. RECs first appeared in US markets in the late 1990s and are particularly important in states that accept or require them as evidence of compliance with renewables portfolio standards (RPS). The emergence of RECs as a tradable commodity has made utilities, generators, and regulators increasingly aware of the need to specify who owns the RECs in energy transactions. In voluntary transactions, most agree that the question of REC ownership can and should be negotiated privately between the buyer and the seller, and should be clearly established by contract. Claims about purchasing or using renewable energy should only be made if REC ownership can be documented. In many other cases, however, renewable energy transactions are either mandated or encouraged through state or federal policy. Because of the recent appearance of RECs, legislation and regulation mandating the purchase of renewable energy has sometimes been silent on the disposition of the RECs associated with that generation. Furthermore, some renewable energy contracts pre-date the existence of RECs, and therefore do not address REC ownership. In both of these instances, the issue of REC ownership must often be answered by legislative or regulatory authorities. The resulting uncertainty in REC ownership has hindered the development of robust REC markets and has, in some cases, led to contention between buyers and sellers of renewable generation. This article, which is based on a longer Berkeley Lab report, reviews federal and state efforts to clarify the ownership of RECs from Qualifying Facilities (QFs) that sell their generation under the Public Utility Regulatory Policies Act (PURPA) of 1978. The full report also addresses state efforts to clarify REC ownership in two other situations, customer-owned generation that benefits from state net metering rules, and generation facilities that receive financial incentives from state or utility funds. The issue of REC ownership most often arises in states that have adopted an RPS. In such states, both parties to QF contracts have a lot at stake: either additional cost to a utility if RECs are awarded to the QF, or loss of value to the QF if RECs are awarded to the utility. As a rough estimate, QF RECs that are eligible for state RPS programs could have a value between $35 million and $175 million, so there is significant economic value riding on the ownership question.

Holt, Edward; Wiser, Ryan; Bolinger, Mark



DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


Conducting Your Own Energy Audit  

E-Print Network (OSTI)

Why should you or anyone be interested in conducting a time intensive energy audit. What equipment is needed? When should you get started? Who should do it? The answer to Why is that energy costs are cutting into a company’s profit every minute of every day. Inefficient energy usage is like having money lost or stolen. Energy costs may account for up to 25% of a company’s expenses and hundreds of thousands of dollars a year. To answer What will be discussed later in this paper. The answer to When is that the energy audit needs to be done now! Every day and month of delay is throwing money away that could be put back into the business or distributed as profit. To answer Who should do the study depends on the complexity and size of the utility bill. Large utility bills, $100,000 or more, or a large facility, 100,000 square feet or more, may indicate the skills of a professional energy engineer are required to analyze the facility’s energy consumption and recommend the proper energy conservation measures needed. Smaller facilities usually can be energy analyzed by company personnel who have some energy training. This paper is written to assist those personnel in conducting their own energy audits. Even larger facilities may decide to do an in-house energy audit before they hire outside assistance in order to get an idea of the amount and cost of energy being used and possible savings. This can be compared to the cost of the outside energy audit.

Phillips, J.



Higgs Boson -- on Your Own  

E-Print Network (OSTI)

One of the highlights of 2012 in physics is related to two papers, published by the ATLAS and the CMS Collaborations, that announced the discovery of at least one new particle in pp collisions at CERN LHC. At least one of the properties of this new particle is found to be similar to that of the Higgs boson, the last and most difficult to find building block from the Standard Model of particle physics. Physics teachers are frequently approached by their media-educated students, who inquire about the properties of the Higgs boson, but physics teachers are rarely trained to teach this elusive aspect of particle physics in elementary, middle or junior high schools. In this paper I describe a card-game, that can be considered as a hands-on and easily accessible tool that allows interested teachers, students and also motivated lay-persons to play with the properties of the newly found Higgs-like particle. This new particle was detected through its decays to directly observable, final state particles. Many of these final state particles are represented in a deck of cards, that represent elementary particles, originally invented to popularize the physics of quark matter in the so-called Quark Matter Card Games. The Higgs decay properties can be utilized, playfully, in a Higgs boson search card game. The rules of this game illustrate also the need for some luck, to complement knowledge and memory, useful skills that this game also helps to develop. The paper is organized as a handout or booklet, that directly describes how to play the Higgs boson on Your Own card game.

T. Csorgo




NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)

Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


City growth and community-owned land in Mexico City  

E-Print Network (OSTI)

Sixteen years after the promulgation of the reforms to Article 27 that regulates land tenure in Mexico, there is consensus among political authorities, public officials, private investors, and scholars that the outcomes ...

Diaz, Rodrigo, M.C.P. Massachusetts Institute of Technology



DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


Buildings*","Nongovernment-Owned Buildings",,,,"Government-Owned Buildings"  

U.S. Energy Information Administration (EIA) Indexed Site

Occupancy of Nongovernment-Owned and Government-Owned Buildings, Number of Buildings for Non-Mall Buildings, 2003" Occupancy of Nongovernment-Owned and Government-Owned Buildings, Number of Buildings for Non-Mall Buildings, 2003" ,"Number of Buildings (thousand)" ,"All Buildings*","Nongovernment-Owned Buildings",,,,"Government-Owned Buildings" ,,"Nongov- ernment- Owned Buildings","Owner Occupied","Nonowner Occupied","Unocc- upied","Govern- ment- Owned Buildings","Federal","State","Local" "All Buildings* ...............",4645,4011,1841,2029,141,635,46,164,425 "Building Floorspace" "(Square Feet)" "1,001 to 5,000 ...............",2552,2272,980,1205,87,280,"Q",77,183 "5,001 to 10,000 ..............",889,783,384,375,"Q",106,"Q","Q",87


Buildings*","Nongovernment-Owned Buildings",,,,"Government-Owned Buildings"  

U.S. Energy Information Administration (EIA) Indexed Site

8. Occupancy of Nongovernment-Owned and Government-Owned Buildings, Floorspace for Non-Mall Buildings, 2003" 8. Occupancy of Nongovernment-Owned and Government-Owned Buildings, Floorspace for Non-Mall Buildings, 2003" ,"Total Floorspace (million square feet)" ,"All Buildings*","Nongovernment-Owned Buildings",,,,"Government-Owned Buildings" ,,"Nongov- ernment- Owned Buildings","Owner Occupied","Nonowner Occupied","Unocc- upied","Govern- ment- Owned Buildings","Federal","State","Local" "All Buildings* ...............",64783,49421,23591,23914,1916,15363,1956,3808,9599 "Building Floorspace" "(Square Feet)" "1,001 to 5,000 ...............",6789,6043,2682,3162,199,746,"Q",206,498 "5,001 to 10,000 ..............",6585,5827,2858,2791,"Q",758,"Q","Q",620


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


OwnEnergy Inc | Open Energy Information  

Open Energy Info (EERE)

OwnEnergy Inc OwnEnergy Inc Jump to: navigation, search Name OwnEnergy Inc. Place Brooklyn, New York Zip 11201 Sector Wind energy Product Brooklyn-based community wind project developer focusing on projects ranging in size from 10-80MW. Coordinates 42.852755°, -89.369069° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.852755,"lon":-89.369069,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Community-Owned Projects | Open Energy Information  

Open Energy Info (EERE)

Community-Owned Projects Community-Owned Projects Jump to: navigation, search Name Community-Owned Projects Facility Community-Owned Projects Sector Wind energy Facility Type Community Wind Facility Status In Service Owner Dave Norgaard et al/John Deere Wind Energy Developer Dave Norgaard et al/John Deere Wind Energy Energy Purchaser Xcel Energy Location Buffalo Ridge MN Coordinates 44.0039°, -96.0526° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.0039,"lon":-96.0526,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



(1) Who owns energy consumption data  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Elster July 12, 2010 Reply to DOE Request for Information of May 11, 2010 Elster July 12, 2010 Reply to DOE Request for Information of May 11, 2010 regarding Data Privacy The DOE questions are restated followed by an answer. Please note that this matter is also related to the May 11, 2010 RFI on needs for utility communications. If data is provided to third parties there is a data processing and communications cost that depends on how many parties data is provided to and by how often data is communicated. These costs are minimized if an in-home display and/or smart thermostat are provided data directly from a smart meter. (1) Q. Who owns energy consumption data? A. Typically by state law the consumer owns the data. (2) Q. Who should be entitled to privacy protections relating to energy information? A. The consumer.


DOE Awards Native American, Tribally-Owned Small Business Contract...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Awards Native American, Tribally-Owned Small Business Contract for Support Services to Savannah River Operations Office DOE Awards Native American, Tribally-Owned Small Business...


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mäkinen; Jorma Tarhio



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


Energy Deputy Secretary Poneman Tours Minority-Owned Small Business...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Deputy Secretary Poneman Tours Minority-Owned Small Business in Detroit Energy Deputy Secretary Poneman Tours Minority-Owned Small Business in Detroit May 22, 2012 - 10:37am...


Federal Energy Management Program: Create Your Own Energy Action...  

NLE Websites -- All DOE Office Websites (Extended Search)

Create Your Own Energy Action Campaign to someone by E-mail Share Federal Energy Management Program: Create Your Own Energy Action Campaign on Facebook Tweet about Federal Energy...


Financial statistics of major publicly owned electric utilities, 1991  

Science Conference Proceedings (OSTI)

The Financial Statistics of Major Publicly Owned Electric Utilities publication presents summary and detailed financial accounting data on the publicly owned electric utilities. The objective of the publication is to provide Federal and State governments, industry, and the general public with data that can be used for policymaking and decisionmaking purposes relating to publicly owned electric utility issues.

Not Available



Who Owns Renewable Energy Certificates? An Exploration of  

E-Print Network (OSTI)

LBNL-59965 Who Owns Renewable Energy Certificates? An Exploration of Policy Options and Practice Laboratory is an equal opportunity employer. #12;LBNL-59965 Who Owns Renewable Energy Certificates) of the U.S. Department of Energy under Contract No. DE-AC02-05CH11231. #12;#12;Who Owns Renewable Energy


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


EETD Sustainability -- Keeping our own house in order  

NLE Websites -- All DOE Office Websites (Extended Search)

EETD Sustainability -- Keeping our own house in order NOTICE Due to the current lapse of federal funding, Berkeley Lab websites are accessible, but may not be updated until...


Tribal schools create their own biodiesel to win energy challenge...  

NLE Websites -- All DOE Office Websites (Extended Search)

Little, Danny McKinney. Not pictured: Charles Cook and Bradley Grandquist. Tribal schools create their own biodiesel to win energy challenge By Louise Lerner * July 22, 2011...


Financial statistics of major US publicly owned electric utilities 1993  

SciTech Connect

The 1993 edition of the Financial Statistics of Major U.S. Publicly Owned Electric Utilities publication presents five years (1989 to 1993) of summary financial data and current year detailed financial data on the major publicly owned electric utilities. The objective of the publication is to provide Federal and State governments, industry, and the general public with current and historical data that can be used for policymaking and decision making purposes related to publicly owned electric utility issues. Generator and nongenerator summaries are presented in this publication. The primary source of publicly owned financial data is the Form EIA-412, the Annual Report of Public Electric Utilities, filed on a fiscal basis.

Not Available



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Build Your Own Pentium III PC, 1st edition  

Science Conference Proceedings (OSTI)

From the Publisher:Build your own Pentium III PC and save a bundle!Why pay big bucks for a Pentium III system when legendary build-it-yourself guru Aubrey Pilgrim can help you construct one at home for a fraction of dealer prices? In Build Your Own Pentium ...

Aubrey Pilgrim



Green Energy Options for Consumer-Owned Business  

SciTech Connect

The goal of this project was to define, test, and prototype a replicable business model for consumer-owned cooperatives. The result is a replicable consumer-owned cooperative business model for the generation, interconnection, and distribution of renewable energy that incorporates energy conservation and efficiency improvements.

Co-opPlus of Western Massachusetts



EA-1255: Project Partnership Transportation of Foreign-Owned Enriched  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5: Project Partnership Transportation of Foreign-Owned 5: Project Partnership Transportation of Foreign-Owned Enriched Uranium from the Republic of Georgia EA-1255: Project Partnership Transportation of Foreign-Owned Enriched Uranium from the Republic of Georgia SUMMARY This EA evaluates the environmental impacts for the proposal to transport 5.26 kilograms of enriched uranium-23 5 in the form of nuclear fuel, from the Republic of Georgia to the United Kingdom. PUBLIC COMMENT OPPORTUNITIES None available at this time. DOCUMENTS AVAILABLE FOR DOWNLOAD April 30, 1998 EA-1255: Finding of No Significant Impact Project Partnership Transportation of Foreign-Owned Enriched Uranium from the Republic of Georgia April 30, 1998 EA- 1255: Finding of No Significant Impact Project Partnership Transportation of Foreign-Owned Enriched Uranium from


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


Property:Incentive/OwnRenewEnrgyCrdts | Open Energy Information  

Open Energy Info (EERE)

OwnRenewEnrgyCrdts OwnRenewEnrgyCrdts Jump to: navigation, search Property Name Incentive/OwnRenewEnrgyCrdts Property Type Text Description Ownership of Renewable Energy Credits. Pages using the property "Incentive/OwnRenewEnrgyCrdts" Showing 25 pages using this property. (previous 25) (next 25) A AEP Ohio - Renewable Energy Technology Program (Ohio) + Customers must commit RECs to AEP Ohio for 15 years. AEP SWEPCO - SMART Source Solar PV Program (Texas) + Customer-generator AEP Texas Central Company - SMART Source Solar PV Rebate Program (Texas) + Customer-generator AEP Texas North Company - SMART Source Solar PV Rebate Program (Texas) + Customer-generator APS - Renewable Energy Incentive Program (Arizona) + APS Alameda Municipal Power - Solar Photovoltaics Rebate Program (California) + Alameda Power and Telecom


Faith Enterprises Inc. A Service Disabled Veteran-Owned Small...  

NLE Websites -- All DOE Office Websites (Extended Search)

Faith Enterprises Inc. A Service Disabled Veteran-Owned Small Business Security When the Air Force asked Sandia to deliver complex security upgrades to a facility on Kirtland Air...


KPaul A Service Disabled Veteran-Owned Small Business  

NLE Websites -- All DOE Office Websites (Extended Search)

KPaul A Service Disabled Veteran-Owned Small Business Jennifer Muth's initial phone call put her in touch with Ann Riley, Sandia's Business Point of Contact. "I work with all new...

Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Women-Owned Small Business Webinar, June 20, 2013  

Energy.gov (U.S. Department of Energy (DOE))

The Office of Small and Disadvantaged Business Utilization hosted a webinar for women-owned small businesses on June 20, 2013, to provide overviews of major program offices in the Department of...


Worker owned cooperatives and the ecosystems that support them  

E-Print Network (OSTI)

By emphasizing wealth creation, communities can not only cultivate streams of income, but also build wealth. Through collectively owned and democratically governed assets, communities can build wealth. Economic development ...

Tanner, Rachael A. (Rachael Ann)



Energy Analysis Department Who Owns Renewable Energy Certificates  

E-Print Network (OSTI)

Energy Analysis Department Who Owns Renewable Energy Certificates: An Exploration of Policy Options about different approaches to clarifying the ownership of renewable energy certificates (RECs), focusing the output from certain Qualifying Facilities, including cogeneration and renewable energy generators · PURPA


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



Managing information diffusion in Name-Your-Own-Price auctions  

Science Conference Proceedings (OSTI)

In Name-Your-Own-Price auctions (NYOP) prospective buyers bid against a secret reserve price set by the seller and only win the auction at the price of their bid if it is equal or higher than the seller's reserve price. Thus, bidders who want to win ... Keywords: Decision support system, Information diffusion, Name-Your-Own-Price, Social networks, eBay Best Offer

Oliver Hinz; Martin Spann



DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

GC GUIDANCE ON BARTER TRANSACTIONS INVOLVING DOE-OWNED URANIUM GC GUIDANCE ON BARTER TRANSACTIONS INVOLVING DOE-OWNED URANIUM The Department of Energy has on a variety of occasions engaged in transactions under which it bartered uranium to which it has title for goods or services . This guidance memorializes the results of analyses previously directed to individual proposed transactions . For the reasons discussed below, we conclude that the Atomic Energy Act of 1954' , as amended, (AEA), authorizes such barter transactions. Background : DOE Barter Transactions In a number of instances, DOE has engaged in transactions involving the barter of DOE-owned uranium2 in exchange for various products or services. For example, DOE entered into a transaction with the United States Enrichment Corporation (USEC), under which USEC would


High School Students Build Their Own Supercomputer (Almost) | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

High School Students Build Their Own Supercomputer (Almost) High School Students Build Their Own Supercomputer (Almost) High School Students Build Their Own Supercomputer (Almost) September 10, 2010 - 9:47am Addthis Eric Gedenk What are the key facts? Students built a computer cluster -- a group of computers communicating with one another to operate as a single machine -- out of Mac mini CPUs. For the third straight year, students and teachers from around Appalachia gathered at Oak Ridge National Laboratory (ORNL) this summer for an interactive training with some of the world's leading computing experts. The focal point of the training was a course called "Build a Supercomputer - Well Almost." And build they did. With guidance from ORNL staff, collaborators and interns, the high-school students went about building a


Minority-Owned Business Creating Career Opportunities | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Minority-Owned Business Creating Career Opportunities Minority-Owned Business Creating Career Opportunities Minority-Owned Business Creating Career Opportunities September 15, 2010 - 2:21pm Addthis Most Catalyst Management Group employees had no previous experience with weatherization. | Photo by CMG Most Catalyst Management Group employees had no previous experience with weatherization. | Photo by CMG Lindsay Gsell What are the key facts? This Pontiac, Michigan weatherization company sees growth through Recovery Act. Catalyst Management Group will add nearly 50% more staff in the coming months. Employees new to the trade get weatherization training and mentoring. Leon Brown, an engineer by trade, started his career as a manufacturing engineer in the automobile industry in Detroit. After earning his master in business administration, and with the decline of jobs in the automobile


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



First university owned district heating system using biomass heat  

E-Print Network (OSTI)

Highlights · First university owned district heating system using biomass heat · Capacity: 15 MMBtu Main Campus District Heating Performance · Avoided: 3500 tonnes of CO2 · Particulate: less than 10 mg District Heating Goals To displace 85% of natural gas used for core campus heating. Fuel Bunker Sawmill

Northern British Columbia, University of


Save Money with Your Very Own Drapes | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

with Your Very Own Drapes with Your Very Own Drapes Save Money with Your Very Own Drapes June 11, 2012 - 2:47pm Addthis Elizabeth Spencer Communicator, National Renewable Energy Laboratory So, last winter I decided that I was going to get crafty and make my own blankets as an incentive to keep the thermostat low. It was a fun project, and it actually worked. I needed more blankets, so I made them. They were warm, so I used them all the time. And hey, I was proud of them! It feels good to make something you love. Now that it's summer, the blankets are folded up-though they're still out. I like the colors I chose, so I just hung them up in the study. So my simple project ended up being a huge success: Easy home décor, super warm winter blankets, and an easy way to save money! And now that it's summer, I want to make drapes.


Molecular motors interacting with their own tracks Max N. Artyomov  

E-Print Network (OSTI)

Molecular motors interacting with their own tracks Max N. Artyomov Department of Chemistry; published 17 April 2008 Dynamics of molecular motors that move along linear lattices and interact with them exactly solvable discrete-state "burnt- bridge" models. Molecular motors are viewed as diffusing particles


Financial statistics of major US publicly owned electric utilities 1992  

SciTech Connect

The 1992 edition of the Financial Statistics of Major US Publicly Owned Electric Utilities publication presents 4 years (1989 through 1992) of summary financial data and current year detailed financial data on the major publicly owned electric utilities. The objective of the publication is to provide Federal and State governments, industry, and the general public with current and historical data that can be used for policymaking and decisionmaking purposes related to publicly owned electric utility issues. Generator and nongenerator summaries are presented in this publication. Four years of summary financial data are provided. Summaries of generators for fiscal years ending June 30 and December 31, nongenerators for fiscal years ending June 30 and December 31, and summaries of all respondents are provided. The composite tables present aggregates of income statement and balance sheet data, as well as financial indicators. Composite tables also display electric operation and maintenance expenses, electric utility plant, number of consumers, sales of electricity, and operating revenue, and electric energy account data. The primary source of publicly owned financial data is the Form EIA-412, {open_quotes}Annual Report of Public Electric Utilities.{close_quotes} Public electric utilities file this survey on a fiscal year, rather than a calendar year basis, in conformance with their recordkeeping practices. In previous editions of this publication, data were aggregated by the two most commonly reported fiscal years, June 30 and December 31. This omitted approximately 20 percent of the respondents who operate on fiscal years ending in other months. Accordingly, the EIA undertook a review of the Form EIA-412 submissions to determine if alternative classifications of publicly owned electric utilities would permit the inclusion of all respondents.

Not Available


Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy’s National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION


Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Frostbite Theater - Static Electricity Experiments - How to Make Your Own  

NLE Websites -- All DOE Office Websites (Extended Search)

How Does a Van de Graaff Generator Work? How Does a Van de Graaff Generator Work? Previous Video (How Does a Van de Graaff Generator Work?) Frostbite Theater Main Index Next Video (Should a Person Touch 200,000 Volts?) Should a Person Touch 200,000 Volts? How to Make Your Own Electroscope! An electroscope is a simple device that you can use to do static electricity experiments. They are easy to make. Would you like to know how to build your own? We'll show you how! [ Show Transcript ] Announcer: Frostbite Theater presents... Cold Cuts! No baloney! Joanna and Steve: Just science! Joanna: Hi! I'm Joanna! Steve: And I'm Steve! Joanna: An electroscope is a simple device that you can use to do static electricity experiments. Today, Steve and I are going to show you how to make one! Steve: The electroscope is fairly simple. Ours is just made from a binder


How to Add Your Own Reading Comprehension Passage  

NLE Websites -- All DOE Office Websites (Extended Search)

Adding Your Own Reading Comprehension Passage Adding Your Own Reading Comprehension Passage Please follow these instructions for submitting a reading comprehension passage: Use a text editor or word processor to create your reading comprehension passage. Since Jefferson Lab is a basic physics research facility, passages that incorporate some aspect of science are preferred over passages that do not. Make certain that your passage is accessible to a general audience. While you are creating this passage primarily for your classes' benefit, realize that anyone on the internet will be able to view it. The passage should make sense to anyone, not just to those in your class. Check your passage for: Factual accuracy Correct spelling Correct punctuation Proper grammar Once you have your passage, place brackets ([]) around the words you


Financial statistics of major US publicly owned electric utilities 1994  

SciTech Connect

This publication presents 5 years (1990--94) of summary financial data and current year detailed financial data on the major publicly owned electric utilities. Generator and nongenerator summaries are presented. Composite tables present: Aggregates of income statement and balance sheet data, financial indicators, electric operation and maintenance expenses, electric utility plant, number of consumers, sales of electricity, and operating revenue, and electric energy account data.




Financial statistics major US publicly owned electric utilities 1996  

Science Conference Proceedings (OSTI)

The 1996 edition of The Financial Statistics of Major US Publicly Owned Electric Utilities publication presents 5 years (1992 through 1996) of summary financial data and current year detailed financial data on the major publicly owned electric utilities. The objective of the publication is to provide Federal and State governments, industry, and the general public with current and historical data that can be used for policymaking and decision making purposes related to publicly owned electric utility issues. Generator and nongenerator summaries are presented in this publication. Five years of summary financial data are provided. Summaries of generators for fiscal years ending June 30 and December 31, nongenerators for fiscal years ending June 30 and December 31, and summaries of all respondents are provided. The composite tables present aggregates of income statement and balance sheet data, as well as financial indicators. Composite tables also display electric operation and maintenance expenses, electric utility plant, number of consumers, sales of electricity, and operating revenue, and electric energy account data. 2 figs., 32 tabs.




Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



Transportation capabilities study of DOE-owned spent nuclear fuel  

Science Conference Proceedings (OSTI)

This study evaluates current capabilities for transporting spent nuclear fuel owned by the US Department of Energy. Currently licensed irradiated fuel shipping packages that have the potential for shipping the spent nuclear fuel are identified and then matched against the various spent nuclear fuel types. Also included are the results of a limited investigation into other certified packages and new packages currently under development. This study is intended to support top-level planning for the disposition of the Department of Energy`s spent nuclear fuel inventory.

Clark, G.L.; Johnson, R.A.; Smith, R.W. [Packaging Technology, Inc., Tacoma, WA (United States); Abbott, D.G.; Tyacke, M.J. [Lockheed Idaho Technologies Co., Idaho Falls, ID (United States)



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



CO{sub 2} allowance allocation in the Regional Greenhouse Gas Initiative and the effect on electricity investors  

Science Conference Proceedings (OSTI)

The Regional Greenhouse Gas Initiative (RGGI) is an effort by nine Northeast and Mid-Atlantic states to develop a regional, mandatory, market-based cap-and-trade program to reduce greenhouse gas (GHG) emissions from the electricity sector. The initiative is expected to lead to an increase in the price of electricity in the RGGI region and beyond. The implications of these changes for the value of electricity-generating assets and the market value of the firms that own them depends on the initial allocation of carbon dioxide allowances, the composition of generating assets owned by the firm, and the locations of those assets. Changes in asset values inside the RGGI region may be positive or negative, whereas changes outside of the RGGI region are almost always positive but nonetheless vary greatly. Viewing changes at the firm level aggregates and moderates both positive and negative effects on market value compared with what would be observed by looking at changes at individual facilities. Nonetheless, a particular firm's portfolio of assets is unlikely to reflect the overall composition of assets in the industry as a whole, and some firms are likely to do substantially better or worse than the industry average. 16 refs., 4 figs.

Dallas Burtraw; Danny Kahn; Karen Palmerook



DOE-owned spent nuclear fuel strategic plan. Revision 1  

SciTech Connect

The Department of Energy (DOE) is responsible for safely and efficiently managing DOE-owned spent nuclear fuel (SNF) and SNF returned to the US from foreign research reactors (FRR). The fuel will be treated where necessary, packaged suitable for repository disposal where practicable, and placed in interim dry storage. These actions will remove remaining vulnerabilities, make as much spent fuel as possible ready for ultimate disposition, and substantially reduce the cost of continued storage. The goal is to complete these actions in 10 years. This SNF Strategic Plan updates the mission, vision, objectives, and strategies for the management of DOE-owned SNF articulated by the SNF Strategic Plan issued in December 1994. The plan describes the remaining issues facing the EM SNF Program, lays out strategies for addressing these issues, and identifies success criteria by which program progress is measured. The objectives and strategies in this plan are consistent with the following Em principles described by the Assistance Secretary in his June 1996 initiative to establish a 10-year time horizon for achieving most program objectives: eliminate and manage the most serious risks; reduce mortgage and support costs to free up funds for further risk reduction; protect worker health and safety; reduce generation of wastes; create a collaborative relationship between DOE and its regulators and stakeholders; focus technology development on cost and risk reduction; and strengthen management and financial control.



Awards go to disadvantaged, veteran-owned and small businesses  

NLE Websites -- All DOE Office Websites (Extended Search)

Three small businesses recognized by DOE Three small businesses recognized by DOE Awards go to disadvantaged, veteran-owned and small businesses Three business serving LANL are recognized by DOE. April 3, 2012 Workers sample contents of LANL's Material Disposal Area B (MDA-B) before excavation Workers took direct-push samples to characterize the contents of Material Disposal Area B prior to excavation. Contact Small Business Office (505) 667-4419 Email Small businesses serving LANL receive DOE awards Three businesses that provide services to LANL received Department of Energy small business awards for fiscal year 2011 were recognized by DOE at a ceremony in Washington, D.C. on June 17, 2012. Eberline Services of Santa Fe received DOE's Small Business of the Year award. Eberline conducted environmental drilling services at LANL. The work



Office of Legacy Management (LM)

NEW ALBANY ROAD . MOORESTOWN . NEW ]ERSEY NEW ALBANY ROAD . MOORESTOWN . NEW ]ERSEY CABLE AOORIs*. HICRONIZER. MOORLblOWN. NEW ,SRIEY be returned further obliga- may desire any patent protection, provi#ed; however, that the costa in connectSo& with the pregaration;~~fillrig nnd prosecution of the same shall be entirely: at ?SG,~~e~enS.e ,of our..company. This provision, how- ever, ls.' subJect:to eny.~prlor'arra~cmont between your Institu- tion and the government with respect to inventions and p?j,tents. ,.: 3,ri 'I :: .:v:ri :!:!p, +lo.~nl.~~! ( '.'I! &f :, > ,>,' :'It'r*i&: sltibr~!the understandfng that your Instttution will ca,rry such insurance as you'may deem ndvi~able~ln aonoec- tion with this m ill or its use ~lhile :kt the UnivsF@#b v' "t -' . ' - IN,TERNATI.ONAL PULVERIZING c0RP0RAi.1~


Who owns leaded fuel vehicles: impact of the phasedown  

DOE Green Energy (OSTI)

The US Environmental Protection Agency has promulgated regulations lowering the allowable level of lead in gasoline from 1.1 g/gal to 0.1 g/gal on January 1, 1986. Impacts of this action on minority groups were assessed in this study, focusing on household ownership of leaded-fuel vehicles, and on the number of small children residing in the households. The number of vehicles requiring leaded gasoline is declining rapidly, from 67.4 million in 1981 to 28.1 million in 1986, and 18.6 million in 1988. The share of vehicle-miles traveled by these vehicles will fall from 40% in 1981 to less than 10% in 1988. Leaded-gasoline vehicles are held by all types of households; the ownership pattern for these older vehicles is very similar to the pattern for all vehicles owned by households grouped by race of householder or region.

LaBelle, S.



When it comes to Demand Response, is FERC its Own Worst Enemy?  

E-Print Network (OSTI)

July 1978, pp. 42-47. FERC, "Final Rule, Order 719,comes to Demand Response, is FERC its Own Worst Enemy? Jamesit comes to demand response, is FERC its own worst enemy? By

Bushnell, James; Hobbs, Benjamin; Wolak, Frank A.



May 23 ChallengeHER Women Owned Small Business Event in Washington...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

May 23 ChallengeHER Women Owned Small Business Event in Washington, DC May 23 ChallengeHER Women Owned Small Business Event in Washington, DC May 6, 2013 - 4:48pm Addthis John Hale...


Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



Who Owns Renewable Energy Certificates? An Exploration of Policy Options and Practice  

E-Print Network (OSTI)

Minnesota Methane owns a landfill gas facility located infor example, that wind or landfill gas energy was conveyed,

Holt, Edward A.; Wiser, Ryan; Bolinger, Mark


Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Idaho" "1. Idaho Power Co","Investor-Owned",12883563,4777822,3616109,4489632,"-" "2. Avista Corp","Investor-Owned",3388733,1179482,998465,1210786,"-" "3. PacifiCorp","Investor-Owne...


Financial statistics of selected publicly owned electric utilities 1989. [Contains glossary  

Science Conference Proceedings (OSTI)

The Financial Statistics of Selected Publicly Owned Electric Utilities publication presents summary and detailed financial accounting data on the publicly owned electric utilities. The objective of the publication is to provide the Federal and State governments, industry, and the general public with data that can be used for policymaking and decision making purposes relating to publicly owned electric utility issues. 21 tabs.

Not Available



V-033: ownCloud Cross-Site Scripting and File Upload Vulnerabilities |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3: ownCloud Cross-Site Scripting and File Upload 3: ownCloud Cross-Site Scripting and File Upload Vulnerabilities V-033: ownCloud Cross-Site Scripting and File Upload Vulnerabilities November 26, 2012 - 2:00am Addthis PROBLEM: ownCloud Cross-Site Scripting and File Upload Vulnerabilities PLATFORM: ownCloud 4.5.2, 4.5.1, 4.0.9 ABSTRACT: Multiple vulnerabilities have been reported in ownCloud REFERENCE LINKS: ownCloud Server Advisories Secunia Advisory SA51357 IMPACT ASSESSMENT: Medium DISCUSSION: 1) Input passed via the filename to apps/files_versions/js/versions.js and apps/files/js/filelist.js and event title to 3rdparty/fullcalendar/js/fullcalendar.js is not properly sanitised before being returned to the user. This can be exploited to execute arbitrary HTML and script code in a user's browser session in context of an affected site.


Vehicle Technologies Office: Fact #694: September 26, 2011 Costs of Owning  

NLE Websites -- All DOE Office Websites (Extended Search)

4: September 26, 4: September 26, 2011 Costs of Owning a Vehicle by State to someone by E-mail Share Vehicle Technologies Office: Fact #694: September 26, 2011 Costs of Owning a Vehicle by State on Facebook Tweet about Vehicle Technologies Office: Fact #694: September 26, 2011 Costs of Owning a Vehicle by State on Twitter Bookmark Vehicle Technologies Office: Fact #694: September 26, 2011 Costs of Owning a Vehicle by State on Google Bookmark Vehicle Technologies Office: Fact #694: September 26, 2011 Costs of Owning a Vehicle by State on Delicious Rank Vehicle Technologies Office: Fact #694: September 26, 2011 Costs of Owning a Vehicle by State on Digg Find More places to share Vehicle Technologies Office: Fact #694: September 26, 2011 Costs of Owning a Vehicle by State on AddThis.com...


Tell Us: Your Thoughts on a Bring Your Own Device Policy | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Tell Us: Your Thoughts on a Bring Your Own Device Policy Tell Us: Your Thoughts on a Bring Your Own Device Policy Tell Us: Your Thoughts on a Bring Your Own Device Policy October 2, 2012 - 12:25pm Addthis The Bring Your Own Device (BYOD) effort will focus on how personally owned devices could be used for government work. The Bring Your Own Device (BYOD) effort will focus on how personally owned devices could be used for government work. Peter J. Tseronis Peter J. Tseronis Chief Technology Officer What does this mean for me? You will possess fewer devices. It will help you avoiding compatibility issues. You'll experience less downtime because of updates. In May, the Administration unveiled its Digital Government Strategy, intended to "build a 21st century digital Government that delivers better digital services to the American people." This vision recognizes that


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


U.S. Electric Utility Companies and Rates: Look-up by Zipcode...  

Open Energy Info (EERE)

by NREL and Ventyx, provides average residential, commercial and industrial electricity rates by zip code for both investor owned utilities (IOU) and non-investor owned utilities....


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Corp","Investor-Owned",15992689,10452664,4185504,1346875,7646 "4. Metropolitan Edison Co","Investor-Owned",13585688,5653878,4597757,3334053,"-" "5. Pennsylvania Electric...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Power Co","Investor-Owned",10676292,3780837,2760789,4130286,4380 "3. The Potomac Edison Co","Investor-Owned",3418231,1833906,839504,744821,"-" "4. Wheeling Power...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Illinois" "1. Commonwealth Edison Co","Investor-Owned",43609598,29165528,13286378,1157692,"-" "2. Ameren Illinois Company","Investor-Owned",18479621,12339630,4731804,1389194,18993...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Co","Investor-Owned",84045146,30744336,38885857,14414953,"-" "2. Southern California Edison Co","Investor-Owned",75597423,28960709,38650369,7921618,64727 "3. Los Angeles City...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Michigan" "1. Detroit Edison Co","Investor-Owned",42490936,15726131,16565482,10199323,"-" "2. Consumers Energy Co","Investor-Owned",33290120,12968152,11260844,9061124,"-" "3....


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Electric & Power Co","Investor-Owned",81225989,32538497,39986322,8512201,188969 "5. Duke Energy Carolinas, LLC","Investor-Owned",79553460,30374862,28431959,20739589,7050...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Carolina" "1. Duke Energy Carolinas, LLC","Investor-Owned",57850382,23089681,22484849,12268802,7050 "2. Progress Energy Carolinas Inc","Investor-Owned",39075352,16820714,13892621,8...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

South Carolina Electric&Gas Co","Investor-Owned",22921978,8790593,8268383,5863002,"-" "2. Duke Energy Carolinas, LLC","Investor-Owned",21703078,7285181,5947110,8470787,"-" "3....


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Central Vermont Pub Serv Corp","Investor-Owned",2201153,979922,849639,371592,"-" "2. Green Mountain Power Corp","Investor-Owned",1912901,573807,698688,640406,"-" "3. Vermont...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Florida" "1. Florida Power & Light Co","Investor-Owned",105003376,56583308,45194918,3143476,81674 "2. Progress Energy Florida Inc","Investor-Owned",38925066,20524060,15181662,32193...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Co","Investor-Owned",12338237,4591883,5143503,2602851,"-" "4. Kenergy Corp","Cooperative",9318498,812957,332644,8172897,"-" "5. Kentucky Power Co","Investor-Owned",7348529,...

Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Alternative Fuels Data Center: Buying and Selling Pre-Owned Alternative  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Vehicles Vehicles Printable Version Share this resource Send a link to Alternative Fuels Data Center: Buying and Selling Pre-Owned Alternative Fuel and Advanced Vehicles to someone by E-mail Share Alternative Fuels Data Center: Buying and Selling Pre-Owned Alternative Fuel and Advanced Vehicles on Facebook Tweet about Alternative Fuels Data Center: Buying and Selling Pre-Owned Alternative Fuel and Advanced Vehicles on Twitter Bookmark Alternative Fuels Data Center: Buying and Selling Pre-Owned Alternative Fuel and Advanced Vehicles on Google Bookmark Alternative Fuels Data Center: Buying and Selling Pre-Owned Alternative Fuel and Advanced Vehicles on Delicious Rank Alternative Fuels Data Center: Buying and Selling Pre-Owned Alternative Fuel and Advanced Vehicles on Digg


May 23 ChallengeHER Women Owned Small Business Event in Washington, DC |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

May 23 ChallengeHER Women Owned Small Business Event in Washington, May 23 ChallengeHER Women Owned Small Business Event in Washington, DC May 23 ChallengeHER Women Owned Small Business Event in Washington, DC May 6, 2013 - 4:48pm Addthis John Hale III John Hale III Director, Office of Small and Disadvantaged Business Utilization This April, the Small Business Administration (SBA) announced the ChallengeHER Campaign. The campaign is an exciting new initiative that leverages the resources of SBA, Women Impacting Public Policy, and American Express OPEN to promote the Women-Owned Small Business Federal Contract Program and bring more women-owned firms into the federal government's supply chain. Women owned small business are invited to join us on May 23 in Washington D.C. for a ChallengeHER summit. At this event, the federal government will


Presentations, Women-Owned Small Business Forum (May 2013) | Department of  

NLE Websites -- All DOE Office Websites (Extended Search)

Presentations, Women-Owned Small Business Forum (May 2013) Presentations, Women-Owned Small Business Forum (May 2013) Presentations, Women-Owned Small Business Forum (May 2013) Below, download presentations from the Women-Owned Small Business Opportunity Forum, held in Washington DC on May 23, 2013. Presented in partnership with the U.S. Department of Energy, the Small Business Administration, Women Impacting Public Policy, and American Express OPEN, this event featured critical information for small business owners who want to do business with the Department of Energy. This event featured: Insight into potential procurements and women-owned small business set-asides in 2014. Talks from key agency procurement representatives An update on current procurement policy and the women-owned small business program. Opportunities to meet other female small business owners working


Financial Statistics of Major U.S. Publicly Owned Electric Utilities  

Reports and Publications (EIA)

2000 - Final issue. Presents summary financial data for 1994 through 2000 and detailed financial data for 2000 on major publicly owned electric utilities.

Tom Leckey



Realities of Consumer-Owned Wind Power for Rural Electric Co-operatives (Presentation)  

DOE Green Energy (OSTI)

Presentation for WindPower 2006 held June 4-7, 2006, in Pittsburgh, PA, describing consumer-owned wind power for rural electric co-operatives.

Lindenberg, S.; Green, J.



Who Owns Renewable Energy Certificates? An Exploration of Policy Options and Practice  

E-Print Network (OSTI)

2005. Emerging Markets for Renewable Energy Certificates:Challenges. National Renewable Energy Laboratory, January.less important. Who Owns Renewable Energy Certificates?

Holt, Edward A.; Wiser, Ryan; Bolinger, Mark



Who Owns Renewable Energy Certificates? An Exploration of Policy Options and Practice  

E-Print Network (OSTI)

2005. Emerging Markets for Renewable Energy Certificates:Challenges. National Renewable Energy Laboratory, January.law (Olson Who Owns Renewable Energy Certificates? On May

Holt, Edward A.; Wiser, Ryan; Bolinger, Mark



Who Owns Renewable Energy Certificates? An Exploration of Policy Options and Practice  

E-Print Network (OSTI)

2005. Emerging Markets for Renewable Energy Certificates:Challenges. National Renewable Energy Laboratory, January.state law (Olson Who Owns Renewable Energy Certificates? On

Holt, Edward A.; Wiser, Ryan; Bolinger, Mark




E-Print Network (OSTI)

NEW TERMS OF ACCOMMODATION: BENJAMIN ELMANS ON THEIR OWN TERMS AND EARLY MODERN GLOBAL NETWORK-1850, the subtitle of Benjamin Elmans On Their Terms, hardly captures the depth of the historiographic revision role to science, that the very idea that Chinese developed science ,,on their own terms

Elman, Benjamin


Improved taguchi method based contracted capacity optimization for power consumer with self-owned generating units  

Science Conference Proceedings (OSTI)

The paper proposes an improved Taguchi method to determine the best capacity contracts and dispatch the power output of the self-owned generating units from almost infinite combinations. To be achieved are savings of total power expenses of the consumers ... Keywords: capacity contracts, improved Taguchi method, self-owned generating units

Hong-Tzer Yang; Pai-Chun Peng; Chung-His Huang



SBA Expands Access to Contracting Opportunities for Women-Owned Small  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SBA Expands Access to Contracting Opportunities for Women-Owned SBA Expands Access to Contracting Opportunities for Women-Owned Small Businesses SBA Expands Access to Contracting Opportunities for Women-Owned Small Businesses January 22, 2013 - 10:42am Addthis John Hale III John Hale III Director, Office of Small and Disadvantaged Business Utilization Editor's note: This article was originally published on the Small Business Administration's website. Women-owned small businesses will have greater access to federal contracting opportunities as a result of changes included in the National Defense Authorization Act of 2013 (NDAA) to the U.S. Small Business Administration's Women-Owned Small Business Federal Contract Program. "This new law is a prime example of how the Obama Administration is embracing a more inclusive view of entrepreneurship, helping small


DOE Awards Native American, Tribally-Owned Small Business Contract for  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE Awards Native American, Tribally-Owned Small Business Contract DOE Awards Native American, Tribally-Owned Small Business Contract for Support Services to Savannah River Operations Office DOE Awards Native American, Tribally-Owned Small Business Contract for Support Services to Savannah River Operations Office September 21, 2012 - 5:16pm Addthis John Hale III John Hale III Director, Office of Small and Disadvantaged Business Utilization Editor's Note: This announcement was originally posted on the Office of Environmental Management's website. Today the Energyy Department awarded a $20 million contact (estimated value) to a Native American Tribally-Owned Section 8(a) company for administrative support services and information technology support at our Savannah River Operations Office. The company, NOVA Corp. of Window Rock, Arizona, is owned by the Navajo Nation. NOVA


DOE Awards Native American, Tribally-Owned Small Business Contract for  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE Awards Native American, Tribally-Owned Small Business Contract DOE Awards Native American, Tribally-Owned Small Business Contract for Support Services to Savannah River Operations Office DOE Awards Native American, Tribally-Owned Small Business Contract for Support Services to Savannah River Operations Office September 21, 2012 - 5:16pm Addthis John Hale III John Hale III Director, Office of Small and Disadvantaged Business Utilization Editor's Note: This announcement was originally posted on the Office of Environmental Management's website. Today the Energyy Department awarded a $20 million contact (estimated value) to a Native American Tribally-Owned Section 8(a) company for administrative support services and information technology support at our Savannah River Operations Office. The company, NOVA Corp. of Window Rock, Arizona, is owned by the Navajo Nation. NOVA



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....


City of Denver - Green Building Requirement for City-Owned Buildings |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Denver - Green Building Requirement for City-Owned Denver - Green Building Requirement for City-Owned Buildings City of Denver - Green Building Requirement for City-Owned Buildings < Back Eligibility Local Government Savings Category Heating & Cooling Home Weatherization Construction Commercial Weatherization Commercial Heating & Cooling Design & Remodeling Solar Heating Buying & Making Electricity Water Water Heating Wind Program Info State Colorado Program Type Energy Standards for Public Buildings Provider Greenprint Denver Executive Order 123, signed in October 2007, established the Greenprint Denver Office and the Sustainability Policy for the city. The Sustainability Policy includes several goals and requirements meant to increase the sustainability of Denver by having the city government lead by


Hammerfest Strom UK co owned by StatoilHydro | Open Energy Information  

Open Energy Info (EERE)

Hammerfest Strom UK co owned by StatoilHydro Hammerfest Strom UK co owned by StatoilHydro Jump to: navigation, search Name Hammerfest Strom UK co owned by StatoilHydro Address The Innovation Centre 1 Ainslie Road Hillington Business Park Place Glasgow Zip G52 4RU Sector Marine and Hydrokinetic Phone number +44 141 585 6447 Website http://www.hammerfeststrom.com Region United Kingdom LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This company is listed in the Marine and Hydrokinetic Technology Database. This company is involved in the following MHK Projects: Hammerfest Strom UK Tidal Stream Kvalsundet This article is a stub. You can help OpenEI by expanding it. Retrieved from "http://en.openei.org/w/index.php?title=Hammerfest_Strom_UK_co_owned_by_StatoilHydro&oldid=678328"


DOE Awards Native American, Tribally-Owned Small Business Contract for  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Native American, Tribally-Owned Small Business Contract Native American, Tribally-Owned Small Business Contract for Support Services to Savannah River Operations Office DOE Awards Native American, Tribally-Owned Small Business Contract for Support Services to Savannah River Operations Office September 21, 2012 - 12:00pm Addthis Media Contact Bill Taylor, DOE bill.taylor@srs.gov 803-952-8564 Aiken, SC - The U.S. Department of Energy (DOE) today awarded a set- aside contract to the NOVA Corp. of Window Rock, Arizona. NOVA will provide administrative support services and information technology support to the Savannah River Operations Office. The firm fixed-price Indefinite Delivery/Indefinite Quantity contract with an estimated value of $20 million with a two-year performance period. NOVA Corp. is a Native American Tribally-Owned (Navajo) Section 8(a)


Office of River Protection Women-Owned Small Business Contractor Receives  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

River Protection Women-Owned Small Business Contractor River Protection Women-Owned Small Business Contractor Receives One-Year Extension Office of River Protection Women-Owned Small Business Contractor Receives One-Year Extension December 19, 2012 - 10:33am Addthis Richland - - The Energy Department's Office of River Protection announced the contract for Advanced Technologies and Laboratories International Inc. (ATL) has been extended for a second one-year option. ATL, a women-owned small business, will continue to provide analytical services and testing work at the Hanford Site 222-S Laboratory through January 2, 2014. "ORP values ATL's performance and commitment to safety," said Ellen Mattlin, Tank Farm Programs Division Director. "DOE appreciates the technical and management capabilities demonstrated by the ATL workforce."

Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Family-Owned Restaurant Serves Up Huge Energy Savings | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Family-Owned Restaurant Serves Up Huge Energy Savings Family-Owned Restaurant Serves Up Huge Energy Savings Family-Owned Restaurant Serves Up Huge Energy Savings May 8, 2013 - 2:27pm Addthis Energy efficiency upgrades helped the Athenian Corner reduce its operating costs and improved the restaurant's bottom line. | Photo courtesy of BetterBuildings Lowell Energy Upgrade program. Energy efficiency upgrades helped the Athenian Corner reduce its operating costs and improved the restaurant's bottom line. | Photo courtesy of BetterBuildings Lowell Energy Upgrade program. Rebecca Matulka Rebecca Matulka Digital Communications Specialist, Office of Public Affairs What are the key facts? The Athenian Corner, a family-owned restaurant in Lowell, Massachusetts, made energy efficiency upgrades that are saving it more than


Largest Federally-Owned Wind Farm Breaks Ground at U.S. Weapons Facility |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Largest Federally-Owned Wind Farm Breaks Ground at U.S. Weapons Largest Federally-Owned Wind Farm Breaks Ground at U.S. Weapons Facility Largest Federally-Owned Wind Farm Breaks Ground at U.S. Weapons Facility August 13, 2013 - 10:54am Addthis News Media Contact (202) 586-4940 WASHINGTON - Building on President Obama's Climate Action Plan, which calls for steady, responsible steps to reduce carbon pollution, the Energy Department today broke ground on the nation's largest federally-owned wind project at the Pantex Plant in Amarillo, Texas. Once completed, this five-turbine 11.5 megawatt project will power more than 60 percent of the plant with clean, renewable wind energy and reduce carbon emissions by over 35,000 metric tons per year - equivalent to taking 7,200 cars off the road. The Pantex Plant is the primary site for the assembly, disassembly,


Largest Federally-Owned Wind Farm Breaks Ground at U.S. Weapons Facility |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Largest Federally-Owned Wind Farm Breaks Ground at U.S. Weapons Largest Federally-Owned Wind Farm Breaks Ground at U.S. Weapons Facility Largest Federally-Owned Wind Farm Breaks Ground at U.S. Weapons Facility August 13, 2013 - 10:54am Addthis News Media Contact (202) 586-4940 WASHINGTON - Building on President Obama's Climate Action Plan, which calls for steady, responsible steps to reduce carbon pollution, the Energy Department today broke ground on the nation's largest federally-owned wind project at the Pantex Plant in Amarillo, Texas. Once completed, this five-turbine 11.5 megawatt project will power more than 60 percent of the plant with clean, renewable wind energy and reduce carbon emissions by over 35,000 metric tons per year - equivalent to taking 7,200 cars off the road. The Pantex Plant is the primary site for the assembly, disassembly,



NLE Websites -- All DOE Office Websites (Extended Search)

GC GUIDANCE ON BARTER TRANSACTIONS INVOLVING DOE-OWNED URANIUM GC GUIDANCE ON BARTER TRANSACTIONS INVOLVING DOE-OWNED URANIUM GC GUIDANCE ON BARTER TRANSACTIONS INVOLVING DOE-OWNED URANIUM The Department of Energy has on a variety of occasions engaged in transactions under which it bartered uranium to which it has title for goods or services . This guidance memorializes the results of analyses previously directed to individual proposed transactions . For the reasons discussed below, we conclude that the Atomic Energy Act of 1954' , as amended, (AEA), authorizes such barter transactions. GC GUIDANCE ON BARTER TRANSACTIONS INVOLVING DOE-OWNED URANIUM More Documents & Publications Leasing of Department of Energy Property Before the Senate Energy and Natural Resources Subcommittee on Energy EIS-0468: Final Environmental Impact Statement


City of Fort Collins - Green Building Requirement for City-Owned Buildings  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Fort Collins - Green Building Requirement for City-Owned Fort Collins - Green Building Requirement for City-Owned Buildings City of Fort Collins - Green Building Requirement for City-Owned Buildings < Back Eligibility Local Government Savings Category Heating & Cooling Home Weatherization Construction Commercial Weatherization Commercial Heating & Cooling Design & Remodeling Bioenergy Solar Lighting Windows, Doors, & Skylights Heating Buying & Making Electricity Water Water Heating Wind Program Info State Colorado Program Type Energy Standards for Public Buildings Provider The City of Fort Collins The City Council of Fort Collins passed a resolution in September 2006, establishing green building goals for new city-owned buildings of 5,000 square feet or more. New buildings must be designed and constructed to


A new life for plazas : reimagining privately owned public spaces in New York City  

E-Print Network (OSTI)

Since 1961 the City of New York has allowed buildings to receive added floor area in exchange for privately owned public spaces. These spaces, typically in the form of small outdoor plazas, are spatially clustered in the ...

Suarez, Richard Anthony



Electricity privatization : should South Korea privatize its state-owned electric utility?  

E-Print Network (OSTI)

The state-owned electric utility, Korea Electricity Power Cooperation (KEPCO), privatization has been a key word in South Korea since 1997, when the government received $55 billion from the International Monetary Fund in ...

Lim, Sungmin



Who Owns Renewable Energy Certificates? An Exploration of Policy Options and Practice  

E-Print Network (OSTI)

Company of New Mexico’s (PNM) Solar Energy Program thatMexico..40 vii Who Owns Renewable EnergyNew Mexico’s Solar PV Program, 101 and We Energies’ Energy

Holt, Edward A.; Wiser, Ryan; Bolinger, Mark



miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



202-328-5000 www.rff.orgCO2 Allowance Allocation in the Regional Greenhouse Gas Initiative and the Effect on Electricity Investors  

E-Print Network (OSTI)

The Regional Greenhouse Gas Initiative (RGGI) is an effort by nine Northeast and Mid-Atlantic states to develop a regional, mandatory, market-based cap-and-trade program to reduce greenhouse gas (GHG) emissions from the electricity sector. The initiative is expected to lead to an increase in the price of electricity in the RGGI region and beyond. The implications of these changes for the value of electricity-generating assets and the market value of the firms that own them depends on the initial allocation of carbon dioxide allowances, the composition of generating assets owned by the firm, and the locations of those assets. Changes in asset values inside the RGGI region may be positive or negative, whereas changes outside of the RGGI region are almost always positive but nonetheless vary greatly. Viewing changes at the firm level aggregates and moderates both positive and negative effects on market value compared with what would be observed by looking at changes at individual facilities. Nonetheless, a particular firm’s portfolio of assets is unlikely to reflect the overall composition of assets in the industry as a whole, and some firms are likely to do substantially better or worse than the industry average. Key Words: emissions trading, allowance allocations, electricity, air pollution, auction, grandfathering, generation-performance standard, output-based allocation, costeffectiveness,

Dallas Burtraw; Danny Kahn; Karen Palmer; Dallas Burtraw; Danny Kahn; Karen Palmer



electric rates | OpenEI  

Open Energy Info (EERE)

electric rates electric rates Dataset Summary Description This dataset, compiled by NREL and Ventyx, provides average residential, commercial and industrial electricity rates by zip code for both investor owned utilities (IOU) and non-investor owned utilities. Note: the file includes average rates for each utility, but not the detailed rate structure data found in the database available via the zip-code look-up feature on the OpenEI Utilities page (http://en.openei.org/wiki/Gateway:Utilities). The data was released by NREL/Ventyx in February 2011. Source NREL and Ventyx Date Released February 24th, 2012 (2 years ago) Date Updated Unknown Keywords electric rates rates US utilities Data text/csv icon IOU rates by zipcode (csv, 1.7 MiB) text/csv icon Non-IOU rates by zipcode (csv, 2.1 MiB)


US utilities | OpenEI  

Open Energy Info (EERE)

6489 6489 Varnish cache server US utilities Dataset Summary Description This dataset, compiled by NREL and Ventyx, provides average residential, commercial and industrial electricity rates by zip code for both investor owned utilities (IOU) and non-investor owned utilities. Note: the file includes average rates for each utility, but not the detailed rate structure data found in the database available via the zip-code look-up feature on the OpenEI Utilities page (http://en.openei.org/wiki/Gateway:Utilities). The data was released by NREL/Ventyx in February 2011. Source NREL and Ventyx Date Released February 24th, 2012 (2 years ago) Date Updated Unknown Keywords electric rates rates US utilities Data text/csv icon IOU rates by zipcode (csv, 1.7 MiB) text/csv icon Non-IOU rates by zipcode (csv, 2.1 MiB)


rates | OpenEI  

Open Energy Info (EERE)

rates rates Dataset Summary Description This dataset, compiled by NREL and Ventyx, provides average residential, commercial and industrial electricity rates by zip code for both investor owned utilities (IOU) and non-investor owned utilities. Note: the file includes average rates for each utility, but not the detailed rate structure data found in the database available via the zip-code look-up feature on the OpenEI Utilities page (http://en.openei.org/wiki/Gateway:Utilities). The data was released by NREL/Ventyx in February 2011. Source NREL and Ventyx Date Released February 24th, 2012 (2 years ago) Date Updated Unknown Keywords electric rates rates US utilities Data text/csv icon IOU rates by zipcode (csv, 1.7 MiB) text/csv icon Non-IOU rates by zipcode (csv, 2.1 MiB)


City of Berkeley - Green Building Standards for City Owned and Operated  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Green Building Standards for City Owned and Green Building Standards for City Owned and Operated Projects City of Berkeley - Green Building Standards for City Owned and Operated Projects < Back Eligibility Local Government Savings Category Heating & Cooling Home Weatherization Construction Commercial Weatherization Commercial Heating & Cooling Design & Remodeling Solar Lighting Windows, Doors, & Skylights Heating Buying & Making Electricity Water Heating Wind Program Info State California Program Type Energy Standards for Public Buildings Provider City of Berkeley The Berkeley City Council adopted Resolution 62284 on November 18, 2003 requiring that all city-sponsored building projects receive LEED certification. Its incorporation occurred in two phases, first requiring city-sponsored projects entering design and construction after January 1,


Do You Have Your Own Tips for Saving Fuel? | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Have Your Own Tips for Saving Fuel? Have Your Own Tips for Saving Fuel? Do You Have Your Own Tips for Saving Fuel? May 11, 2012 - 1:37pm Addthis Earlier this week, Amanda shared a checklist on Fueleconomy.gov that helps you keep your car well maintained. Keeping your car well maintained is one way to make sure that it's not using more gas than it needs to. Do you have any other ideas for saving gas this summer? You have the chance to share your thoughts on a question about energy efficiency or renewable energy for consumers. E-mail your responses to the Energy Saver team at consumer.webmaster@nrel.gov. Addthis Related Articles How Does Your Fuel Economy Compare to the Test Ratings on Fueleconomy.gov? How Will You Save Fuel and Energy this 4th of July? How Did You Celebrate Valentine's Day Efficiently


Pantex receives Perkins Award in recognition of its work with women-owned  

National Nuclear Security Administration (NNSA)

Perkins Award in recognition of its work with women-owned Perkins Award in recognition of its work with women-owned small businesses | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Home > NNSA Blog > Pantex receives Perkins Award in recognition of ... Pantex receives Perkins Award in recognition of its work with women-owned small businesses


Beating Nature at her Own Game? | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Beating Nature at her Own Game? Beating Nature at her Own Game? Discovery & Innovation Stories of Discovery & Innovation Brief Science Highlights SBIR/STTR Highlights Contact Information Office of Science U.S. Department of Energy 1000 Independence Ave., SW Washington, DC 20585 P: (202) 586-5430 08.24.11 Beating Nature at her Own Game? New catalyst speeds conversion of electricity to hydrogen fuel. Print Text Size: A A A Subscribe FeedbackShare Page Click to enlarge photo. Enlarge Photo Systemic view of how catalyst might fit into a renewable energy production and storage system Image courtesy of Pacific Northwest National Laboratory Systemic view of how catalyst might fit into a renewable energy production and storage system. Major improvements in our ability to store electrical energy will be


Make Your Own National Science Bowl® Competition Buzzer | U.S. DOE Office  

Office of Science (SC) Website

Resources » Make Resources » Make Your Own National Science Bowl® Competition Buzzer National Science Bowl® (NSB) NSB Home About High School High School Students High School Coaches High School Regionals High School Rules, Forms, and Resources Make Your Own National Science Bowl® Competition Buzzer National Science Bowl® Competition Buzzer Materials List National Science Bowl® Competition Buzzer Schematic Sample Questions Middle School Attending National Event Volunteers 2013 Competition Results News Media WDTS Home Contact Information National Science Bowl® U.S. Department of Energy SC-27/ Forrestal Building 1000 Independence Ave., SW Washington, DC 20585 P: 202-586-6702 E: National.Science.Bowl@science.doe.gov High School Rules, Forms, and Resources Make Your Own National Science Bowl® Competition Buzzer


Purple Bacteria Develops Its Own Form of Sunscreen | U.S. DOE Office of  

Office of Science (SC) Website

Purple Bacteria Develops Its Own Form Purple Bacteria Develops Its Own Form of "Sunscreen" Energy Frontier Research Centers (EFRCs) EFRCs Home Centers Research Science Highlights Highlight Archives News & Events Publications Contact BES Home 05.03.12 Purple Bacteria Develops Its Own Form of "Sunscreen" Print Text Size: A A A RSS Feeds FeedbackShare Page Scientific Achievement Found that specific pigments in the light harvesting complex of a photosynthetic bacterium act primarily to protect the cell from damage by excess sunlight Significance and Impact May aid the design of both natural and artificial light harvesting systems to minimize deleterious effects of exposure to too much light energy Research Details In photosynthetic organisms, carotenoids typically act as supplementary


Make Your Own National Science Bowl® Competition Buzzer | U.S. DOE Office  

Office of Science (SC) Website

Make Your Own National Science Bowl® Competition Buzzer Make Your Own National Science Bowl® Competition Buzzer National Science Bowl® (NSB) NSB Home About High School Middle School Middle School Students Middle School Coaches Middle School Regionals Middle School Rules, Forms, and Resources Academic Question Resources Make Your Own National Science Bowl® Competition Buzzer National Science Bowl® Competition Buzzer Materials List National Science Bowl® Competition Buzzer Schematic Sample Questions Attending National Event Volunteers 2013 Competition Results News Media WDTS Home Contact Information National Science Bowl® U.S. Department of Energy SC-27/ Forrestal Building 1000 Independence Ave., SW Washington, DC 20585 P: 202-586-6702 E: National.Science.Bowl@science.doe.gov Middle School Rules, Forms, and Resources

Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Financial statistics of major U.S. publicly owned electric utilities 1997  

Science Conference Proceedings (OSTI)

The 1997 edition of the ``Financial Statistics of Major U.S. Publicly Owned Electric Utilities`` publication presents 5 years (1993 through 1997) of summary financial data and current year detailed financial data on the major publicly owned electric utilities. The objective of the publication is to provide Federal and State governments, industry, and the general public with current and historical data that can be used for policymaking and decisionmaking purposes related to publicly owned electric utility issues. Generator (Tables 3 through 11) and nongenerator (Tables 12 through 20) summaries are presented in this publication. Five years of summary financial data are provided (Tables 5 through 11 and 14 through 20). Summaries of generators for fiscal years ending June 30 and December 31, nongenerators for fiscal years ending June 30 and December 31, and summaries of all respondents are provided in Appendix C. The composite tables present aggregates of income statement and balance sheet data, as well as financial indicators. Composite tables also display electric operation and maintenance expenses, electric utility plant, number of consumers, sales of electricity, operating revenue, and electric energy account data. The primary source of publicly owned financial data is the Form EIA-412, ``Annual Report of Public Electric Utilities.`` Public electric utilities file this survey on a fiscal year basis, in conformance with their recordkeeping practices. The EIA undertook a review of the Form EIA-412 submissions to determine if alternative classifications of publicly owned electric utilities would permit the inclusion of all respondents. The review indicated that financial indicators differ most according to whether or not a publicly owned electric utility generates electricity. Therefore, the main body of the report provides summary information in generator/nongenerator classifications. 2 figs., 101 tabs.




LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy’s National Nuclear Security Administration. SAND # 2013-10084P


Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


May 8, 2013 Each of us facing similar challenges on our own  

E-Print Network (OSTI)

May 8, 2013 #12;2 Each of us facing similar challenges on our own #12;3 DIY SaaS -e-commerce Video: the DIY (do it yourself) user experience Sample e-Commerce use cases Catalogs, Pricing, Product, enrich, apply The economics of DIY semantic SaaS Automate, instant ROI, DIY personalize & maintain k

Shamir, Ron


Publish Your Own Magazine, Guidebk...: How to Start, Manage, and Profit from a Homebased Publishing Company  

Science Conference Proceedings (OSTI)

From the Publisher:A dynamic step-by-step guide to creating everything from tourism books and niche market magazines to specialty tabloids, using a home computer. Having built his own publishing business from scratch, Williams is uniquely qualified to ...

Thomas A. Williams



Making Google Maps A comprehensive user guide for creating and using your own online Google Maps  

E-Print Network (OSTI)

1 Making Google Maps A comprehensive user guide for creating and using your own online Google Maps By Devlin Hughes and Brett Jackson Trinity College May 2007 edition #12;2 Chapter 1: Introduction to Google, and are accessible to the public. You can also chose to display a mashup on your website. Mashups use Google Map

Wright, Dawn Jeannine


Audit of the transfer of government-owned property at the Mound and Pinellas Plants  

SciTech Connect

This report addresses the audit of the transfer of government-owned property at the Mound and Pinellas Plants. The end of the Cold War brought many changes to the Department of Energy (Department), including the reconfiguration of defense program activities and the closure of some operations. Public Law 103-160 allows the Department to transfer or lease, under specified conditions, Department-owned personal property to economic development initiatives. By encouraging economic development, the Department hopes to mitigate adverse impacts that plant closures would have on local economies. The objective of the audit was to determine whether the Department's interests were properly protected with regard to the transfer of equipment from weapons production use to economic development initiatives. The Mound Plant (Mound) and the Pinellas Plant (Pinellas) did not have property disposition plans that would properly protect Departmental interests. Specifically, Mound planned to make about $13.2 million of Government-owned property available to private businesses even through the property was needed by Defense Programs at other facilities and would cost less than $1 million to relocate. In addition, Mound and Pinellas planned to make available to economic development initiatives several hundred million dollars of Government-owned property without first determining whether it was needed by other Departmental elements. These conditions existed because neither Headquarters nor the Albuquerque Operations Office provided Mound and Pinellas adequate guidance, and Mound and Pinellas management believed that economic development initiatives could take precedence over some Departmental programs.

Not Available



The United States and Gun Violence Americans owned between 220 and 280 million guns in  

E-Print Network (OSTI)

rifles for sale, Dayton, Ohio. 11 #12;Inside Gun Shows for less than 5% of the worlds population but 351 Gun Shows in Context The United States and Gun Violence Americans owned between 220 and 280 million guns in 2004, including at least 86 million handguns.1 Millions of guns are added to that total

Leistikow, Bruce N.


Community-Owned wind power development: The challenge of applying the European model in the United States, and how states are addressing that challenge  

DOE Green Energy (OSTI)

Local farmers, towns, schools, and individual investors are, however, beginning to invest in wind power. With the help of state policy and clean energy fund support, new federal incentives, and creative local wind developers who have devised ownership structures that maximize the value of both state and federal support, community wind power is beginning to take a foothold in parts of the US, in particular the upper Midwest. The purpose of this report is to describe that foothold, as well as the state support that helped to create it. There are a number of reasons why states are becoming increasingly interested in community wind power. In rural Midwestern states such as Minnesota, Wisconsin, Iowa, and Illinois, community wind is seen as a way to help supplement and stabilize farmer income, and thereby contribute to the preservation of farming communities and the rural landscapes and values they create. In the Northeast, densely populated states such as Massachusetts are turning to community-scale wind development to increase not only the amount of wind power on the grid, but also the public's knowledge, perception, and acceptance of wind power. In still other areas--such as the Pacific Northwest, which is already home to several large wind farms--states are simply responding to strong interest from local constituents who see community wind power as a way to take responsibility for, and mitigate the environmental impact of, electricity generation. But what exactly is ''community wind power''? Definitions vary widely, ranging from behind-the-meter installations to the Danish wind ''cooperatives'' to wind projects owned by municipal utilities. Possible defining criteria include: project size (small vs. large projects); purpose (to offset end-use power consumption vs. to sell power to the grid); ownership (single local vs. multiple local vs. municipal utility vs. commercial owners); and interconnection (behind the meter vs. to the distribution grid vs. to the transmission grid). For the purposes of this report, ''community wind'' is defined as locally owned utility-scale wind development, on either the customer or utility side of the meter. This definition accommodates projects of various sizes (e.g., ranging from single utility-scale turbine installations at Iowa schools all the way up to the 100 MW Trimont project in Minnesota), single or multiple local owners, and perhaps even municipal utilities. In this report, however, municipal utility projects will only be mentioned if specifically funded by a state clean energy fund. Within the confines of this definition, this report first describes state support for, and the status of, community wind in the upper Midwest, including Minnesota, Wisconsin, Iowa, and Illinois. The focus then shifts to the Northeast, where Massachusetts and, to a lesser extent, New York have recently funded community wind initiatives. The report concludes in the western US by briefly describing community wind-related work just getting underway in Oregon and Washington, as well as a few isolated projects in California, Idaho, and on tribal lands.

Bolinger, Mark



How to Live Well Without Owning a Car: Save Money, Breathe Easier, and Get More Mileage Out of Life By Chris Balish  

E-Print Network (OSTI)

Without Owning a Car: Save Money, Breathe Easier, and GetWithout Owning a Car: Save Money, Breathe Easier, an Getyou can save a ton of money by not owning. One assumption he

Wong, Carleton



How to Live Well Without Owning a Car: Save Money, Breathe Easier, and Get More Mileage Out of Life By Chris Balish  

E-Print Network (OSTI)

Live Well Without Owning a Car: Save Money, Breathe Easier,Live Well Without Owning a Car: Save Money, Breathe Easier,mere thought of not owning a car in the United States today

Wong, Carleton



Power Technologies Energy Data Book: Fourth Edition, Chapter...  

NLE Websites -- All DOE Office Websites (Extended Search)

Table 10.3 - Composite Statements of Income for Major U.S. Publicly Owned Generator and Investor-Owned Electric Utilities, 2004 (Million 2004 Dollars) Investor-Owned Publicly...


Power Technologies Energy Data Book: Fourth Edition, Chapter...  

NLE Websites -- All DOE Office Websites (Extended Search)

Table 9.6 - Production, Operation, and Maintenance Expenses for Major U.S. Investor-Owned and Publicly Owned Utilities (Million of Nominal Dollars) Investor-Owned Utilities...


ESS 2012 Peer Review - Evaluating Utility Owned Electric ESS - Dhruv Bhatnagar, SNL  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Evaluating Utility Owned Evaluating Utility Owned Electric Energy Storage Systems: A Perspective for State Electric Utility Regulators DOE Energy Storage Program Peer Review 2012 September 28, 2012 Dhruv Bhatnagar & Verne Loose Sandia National Laboratories Motivation for this Work  Many state utility regulatory bodies are unfamiliar with electric energy storage systems  The technology  The functional uses  The value of these uses to the grid  This leads to a handicap in their proper evaluation for rate base  May prevent the best (economic) technologies from system integration 2 Source: GE What we are doing  Developing a guidebook:  Inform regulators about the system benefits of energy storage  Identify regulatory challenges to increased


Wind Generators and Market Power: Does it matter who owns them?  

E-Print Network (OSTI)

Electricity production from wind generators holds significant importance in European Union’s 20 % renewable energy target by 2020. In this paper, I show that ownership of wind generators affects market outcomes by using both a Cournot oligopoly model and a real options model. In the Cournot oligopoly model, ownership of the wind generators by owners of fossil-fueled (peakload) generators decreases total peakload production and increases the market price. These effects increase with total wind generation and aggregate wind generator ownership. In the real options model, start up and shut down price thresholds are significantly higher when the monopolist at the peakload level owns both types of generators. Furthermore, when producing electricity with the peakload generator, the monopolist can avoid facing prices below marginal cost by owning a certain share of the wind generators.

Nihat Misir



Unpacking the opportunities for change within a family owned manufacturing sme : a design led innovation case study.  

E-Print Network (OSTI)

??This thesis explored how an Australian, family owned, manufacturing firm responded to a design led innovation approach as conducted by the action researcher. Specifically, it… (more)

Pozzey, Erica C.



A comparative analysis of business structures suitable for farmer-owned wind power projects in the United States  

E-Print Network (OSTI)

own challenges. 9 The Internal Revenue Service will considerlimited For example, the Internal Revenue Code requires thatPower Price Revenue Shortfall After-Tax Internal Rate of

Bolinger, Mark; Wiser, Ryan



A Case Study on Remote Dispatch of Customer-Owned Resources:Consolidated Edison  

Science Conference Proceedings (OSTI)

This case study from the Consolidated Edison Smart Grid Demonstration Initiative addresses the implementa­tion of a key component of a “virtual power plant,” an automated demand response (AutoDR) application for the remote dispatch of distributed customer-owned resources.The Consolidated Edison demonstration is focused on develop­ing the technology necessary to integrate distributed resources into the utility’s distribution system and distribution control ...


Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Evaluation and Design of Utility Co-Owned Cogeneration Systems for Industrial Parks  

E-Print Network (OSTI)

The Electric Power Research Institute, EPRI, is currently evaluating the potential of utility co-owned cogeneration facilities in industrial parks. This paper describes part of the work performed by one of EPRI's contractors, Impell Corporation, chosen by EPRI to support the industrial parks study. Cogeneration benefits for park owners, tenants and the local utilities are presented. A method developed for selecting industrial park sites for cogeneration facilities and design and financing options are also discussed.

Hu, D. S.; Tamaro, R. F.; Schiller, S. R.



Financial statistics of major U.S. publicly owned electric utilities 1995  

SciTech Connect

The 1995 Edition of the Financial Statistics of Major U.S. Publicly Owned Electric Utilities publication presents 5 years (1991 through 1995) of summary financial data and current year detailed financial data on the major publicly owned electric utilities. The objective of the publication is to provide Federal and State governments, industry, and the general public with current and historical data that can be used for policymaking and decisionmaking purposes related to publicly owned electric utility issues. Generator (Tables 3 through 11) and nongenerator (Tables 12 through 20) summaries are presented in this publication. Five years of summary financial data are provided (Tables 5 through 11 and 14 through 20). Summaries of generators for fiscal years ending June 30 and December 31, nongenerators for fiscal years ending June 30 and December 31, and summaries of all respondents are provided in Appendix C. The composite tables present aggregates of income statement and balance sheet data, as well as financial indicators. Composite tables also display electric operation and maintenance expenses, electric utility plant, number of consumers, sales of electricity, and operating revenue, and electric energy account data. 9 figs., 87 tabs.





National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Implementation process of management control systems in the municipally owned hospitals: in the case of Nagasaki prefectural hospitals in Japan  

Science Conference Proceedings (OSTI)

The purpose of this paper is to describe and explore management reforms in the municipally owned hospitals in Nagasaki prefecture, Japan, based on 'levers of control' framework (Simons, 1995). The hospitals are changing their strategy ... Keywords: Japan, Local Public Enterprise Law, healthcare, levers of control, management control systems, management reform, municipally owned hospitals

Takahito Kondo; Hiromasa Okada



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab




Office of Legacy Management (LM)

A" 917 A" 917 RADIOLOGICAL SURVEY OF A PORTION OF PROPERTY OWNED BY MODERN LANDFILL, INC. - FORMER LOOW SITE Summary Report Work performed by the Health and Safety Research Division Oak Ridge National Laboratory Oak Ridge, Tennessee 37830 March 1981 OAK RIDGE NATIONAL LABORATORY operated by UNION. CARBIDE CORPORATION for the DEPARTMENT OF ENERGY as part of the Formerly Utilized Sites-- Remedial Action Program CONTENTS Page LIST OF FIGURES .. .. . .. . . . . . . . ......... iii LIST OF TABLES ......... .. iv INTRODUCTION .. ......... 1 OBJECTIVE .................... 1 SURVEY TECHNIQUES . . ............. ...... 1 RESULTS ..... 2 Gamma-Ray Exposure Rates . . . . . . 2 Beta-Gamma Dose Rate ............. 2 226Ra in Soil ............ 3 CONCLUSIONS .. . . . . . . . . . . . .. .. . .. .. 3 REFERENCES . . . . . . . . .


Own Your Power! A Consumer Guide to Solar Electricity for the Home (Brochure)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Consumer Guide to Solar Electricity for the Home Consumer Guide to Solar Electricity for the Home Own Your Power! Contents Benefits of Solar Electricity . . . . . . . . . . . . . . . . . . . 1 Solar Electricity Basics . . . . . . . . . . . . . . . . . . . . . . . 2 Types of Solar Panels . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 Types of Solar Electric Systems . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 Power Produced by a Solar Electric System . . . . . . . . . . . . . . . . . . . . . . 5 How To Choose a System . . . . . . . . . . . . . . . . . . . . . 6 Roof Requirements . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7 Installation and Maintenance . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 Costs and Financial Incentives . . . . . . . . . . . . . . . . . 10 Purchasing Considerations . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10 Financing . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 12 About this guide: The U .S . Department of Energy (DOE) receives numerous inquiries each year


Cost Containment Through Energy Efficiency in Texas State-Owned Buildings  

E-Print Network (OSTI)

"The Energy Cost Containment Through Energy Efficiency" in Texas State-owned buildings project was begun in the spring of 1984 as a part of a multipronged effort to reduce rising energy costs in State operations. Energy audits of 21 million square feet (22% of total conditioned space) were conducted by three energy engineering firms and Texas Engineering Extension Service personnel under contract to the Public Utility Commission of Texas. Retrofits totaling $15.6 million with annual savings of $9.2 million were identified (59% ROI). This paper will detail the objectives of the project, summarize audit results, and outline financing options for individual projects.

Ponder, W. M.; Verdict, M. E.



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Privately owned public space attached to office buildings in Manhattan : economic and urban perspectives of incentive zoning  

E-Print Network (OSTI)

This thesis examines the Incentive Zoning Policy of New York City from economic and urban perspectives. In the first part, it evaluates empirically the economic contribution of privately owned public space to the value of ...

Cai, Hongyu.



Own-price and income elasticities for household electricity demand : a survey of literature using meta-regression analysis.  

E-Print Network (OSTI)

??Maria Wist Langmoen Own-price and income elasticities for household electricity demand -A Literature survey using meta-regression analysis Economists have been modelling the electricity demand for… (more)

Langmoen, Maria Wist



Who Owns Renewable Energy Certificates? An Exploration of PolicyOptions and Practice  

SciTech Connect

Renewable energy certificates (RECs) represent the bundle of information that describes the characteristics of renewable electricity generation, and may be (and increasingly are) sold separately from the underlying electricity itself. RECs are a relatively new phenomenon, emerging as a tradable commodity in voluntary markets in the late 1990s, and gaining strength as a means of compliance with various state policy requirements affecting renewable generation in the early 2000s (Holt and Bird 2005). Twenty states and Washington, D.C. now have mandatory renewables portfolio standard (RPS) obligations, and most of these may be satisfied by owning and retiring RECs. Many states also have fuel source and emissions disclosure requirements, for which RECs are useful. Even where state policy does not allow unbundled and fully tradable RECs to meet these requirements, RECs may still be used as an accounting and verification tool (REC tracking systems are in place or under development in many regions of the U.S.). These applications, plus REC trading activity in support of voluntary green claims, give rise to potential ''double counting'' to the extent that the purchaser of the RECs and the purchaser of the underlying electricity both make claims to the renewable energy attributes of the facility in question (Hamrin and Wingate 2003). When renewable electricity is sold and purchased, an important question therefore arises: ''Who owns the RECs created by the generation of renewable energy?'' In voluntary transactions, most agree that the question of REC ownership can and should be negotiated between the buyer and the seller privately, and should be clearly established by contract. Claims about purchasing renewable energy should only be made if REC ownership can be documented. In many other cases, however, renewable energy transactions are either mandated or encouraged through state or federal policy. In these cases, the issue of REC ownership must often be answered by legislative or regulatory authorities. Some renewable energy contracts pre-date the existence of RECs, however, and in these cases the disposition of RECs is often unclear. Similarly, because of the recent appearance of RECs, legislation and regulation mandating the purchase of renewable energy has sometimes been silent on the disposition of the RECs associated with that generation. The resulting uncertainty in REC ownership has hindered the development of robust REC markets and has, in some cases, led to contention between buyers and sellers of renewable generation. The purpose of this report is to provide information and insight to state policy-makers, utility regulators, and others about different approaches to clarifying the ownership of RECs. We focus exclusively on three distinct areas in which REC ownership issues have arisen: (1) Qualifying Facilities (QFs) that sell their generation under the Public Utility Regulatory Policies Act (PURPA) of 1978; (2) Customer-owned generation that benefits from state net metering rules; and (3) Generation facilities that receive financial incentives from state or utility funds. This is a survey report. It reviews how both the federal government and states have addressed these issues to date, and highlights the arguments that have been raised for different REC ownership dispositions. Our aim is to describe the arguments on each side, and the context for the debates that are occurring. We do not, in this report, provide a list of policy recommendations for how policymakers should be addressing these issues.

Holt, Edward A.; Wiser, Ryan; Bolinger, Mark



Who Owns Renewable Energy Certificates? An Exploration of PolicyOptions and Practice  

SciTech Connect

Renewable energy certificates (RECs) represent the bundle of information that describes the characteristics of renewable electricity generation, and may be (and increasingly are) sold separately from the underlying electricity itself. RECs are a relatively new phenomenon, emerging as a tradable commodity in voluntary markets in the late 1990s, and gaining strength as a means of compliance with various state policy requirements affecting renewable generation in the early 2000s (Holt and Bird 2005). Twenty states and Washington, D.C. now have mandatory renewables portfolio standard (RPS) obligations, and most of these may be satisfied by owning and retiring RECs. Many states also have fuel source and emissions disclosure requirements, for which RECs are useful. Even where state policy does not allow unbundled and fully tradable RECs to meet these requirements, RECs may still be used as an accounting and verification tool (REC tracking systems are in place or under development in many regions of the U.S.). These applications, plus REC trading activity in support of voluntary green claims, give rise to potential ''double counting'' to the extent that the purchaser of the RECs and the purchaser of the underlying electricity both make claims to the renewable energy attributes of the facility in question (Hamrin and Wingate 2003). When renewable electricity is sold and purchased, an important question therefore arises: ''Who owns the RECs created by the generation of renewable energy?'' In voluntary transactions, most agree that the question of REC ownership can and should be negotiated between the buyer and the seller privately, and should be clearly established by contract. Claims about purchasing renewable energy should only be made if REC ownership can be documented. In many other cases, however, renewable energy transactions are either mandated or encouraged through state or federal policy. In these cases, the issue of REC ownership must often be answered by legislative or regulatory authorities. Some renewable energy contracts pre-date the existence of RECs, however, and in these cases the disposition of RECs is often unclear. Similarly, because of the recent appearance of RECs, legislation and regulation mandating the purchase of renewable energy has sometimes been silent on the disposition of the RECs associated with that generation. The resulting uncertainty in REC ownership has hindered the development of robust REC markets and has, in some cases, led to contention between buyers and sellers of renewable generation. The purpose of this report is to provide information and insight to state policy-makers, utility regulators, and others about different approaches to clarifying the ownership of RECs. We focus exclusively on three distinct areas in which REC ownership issues have arisen: (1) Qualifying Facilities (QFs) that sell their generation under the Public Utility Regulatory Policies Act (PURPA) of 1978; (2) Customer-owned generation that benefits from state net metering rules; and (3) Generation facilities that receive financial incentives from state or utility funds. This is a survey report. It reviews how both the federal government and states have addressed these issues to date, and highlights the arguments that have been raised for different REC ownership dispositions. Our aim is to describe the arguments on each side, and the context for the debates that are occurring. We do not, in this report, provide a list of policy recommendations for how policymakers should be addressing these issues.

Holt, Edward A.; Wiser, Ryan; Bolinger, Mark



U.S. Electric Utility Companies and Rates: Look-up by Zipcode (Feb 2011) |  

Open Energy Info (EERE)

Utility Companies and Rates: Look-up by Zipcode (Feb 2011) Utility Companies and Rates: Look-up by Zipcode (Feb 2011) Dataset Summary Description This dataset, compiled by NREL and Ventyx, provides average residential, commercial and industrial electricity rates by zip code for both investor owned utilities (IOU) and non-investor owned utilities. Note: the file includes average rates for each utility, but not the detailed rate structure data found in the database available via the zip-code look-up feature on the OpenEI Utilities page (http://en.openei.org/wiki/Gateway:Utilities). The data was released by NREL/Ventyx in February 2011. Source NREL and Ventyx Date Released February 24th, 2012 (2 years ago) Date Updated Unknown Keywords electric rates rates US utilities Data text/csv icon IOU rates by zipcode (csv, 1.7 MiB)


2009 Wind Technologies Market Report  

E-Print Network (OSTI)

twenty” investor-owned utility list at position number 14 (twenty” investor-owned utility list at position number 14;19 th in our combined list of all utility types); and (2)

Wiser, Ryan



Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Indiana" "1. Duke Energy Indiana Inc","Investor-Owned",28258839,9627037,8531725,10100077,"-" "2. Northern Indiana Pub Serv Co","Investor-Owned",16190907,3625579,4086569,8459042,197...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Co","Investor-Owned",38427458,14639909,15109890,8655643,22016 "2. Kansas City Power & Light Co","Investor-Owned",8877996,2735066,4548499,1594431,"-" "3. KCP&L Greater Missouri...


Revisiting the 'Buy versus Build' Decision for Publicly Owned Utilities in California Considering Wind and Geothermal Resources  

DOE Green Energy (OSTI)

The last two decades have seen a dramatic increase in the market share of independent, nonutility generators (NUGs) relative to traditional, utility-owned generation assets. Accordingly, the ''buy versus build'' decision facing utilities--i.e., whether a utility should sign a power purchase agreement (PPA) with a NUG, or develop and own the generation capacity itself--has gained prominence in the industry. Very little of this debate, however, has focused specifically on publicly owned electric utilities, and with few exceptions, renewable sources of supply have received similarly scant attention. Contrary to historical treatment, however, the buy versus build debate is quite relevant to publicly owned utilities and renewables because publicly owned utilities are able to take advantage of some renewable energy incentives only in a ''buy'' situation, while others accrue only in a ''build'' situation. In particular, possible economic advantages of public utility ownership include: (1) the tax-free status of publicly owned utilities and the availability of low-cost debt, and (2) the renewable energy production incentive (REPI) available only to publicly owned utilities. Possible economic advantages to entering into a PPA with a NUG include: (1) the availability of federal tax credits and accelerated depreciation schedules for certain forms of NUG-owned renewable energy, and (2) the California state production incentives available to NUGs but not utilities. This article looks at a publicly owned utility's decision to buy or build new renewable energy capacity--specifically wind and geothermal power--in California. To examine the economic aspects of this decision, we used a 20-year financial cash-flow model to assess the levelized cost of electricity under four supply options: (1) public utility ownership of new geothermal capacity, (2) public utility ownership of new wind capacity, (3) a PPA for new geothermal capacity, and (4) a PPA for new wind capacity. We focus on wind and geothermal because both resources are abundant and, in some cases, potentially economic in California. Our analysis is not intended to provide precise estimates of the levelized cost of electricity from wind projects and geothermal plants; nor is our intent to compare the levelized costs of wind and geothermal power to one another. Instead, our intent is simply to compare the costs of buying wind or geothermal power to the costs of building and operating wind or geothermal capacity under various scenarios. Of course, the ultimate decision to buy or build cannot and should not rest solely on a comparison of the levelized cost of electricity. Thus, in addition to quantitative analysis, we also include a qualitative discussion of several important features of the ''buy versus build'' decision not reflected in the economic analysis.

Bolinger, Mark; Wiser, Ryan; Golove, William


Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Revisiting the 'Buy versus Build' decision for publicly owned utilities in California considering wind and geothermal resources  

DOE Green Energy (OSTI)

The last two decades have seen a dramatic increase in the market share of independent, non-utility generators (NUGs) relative to traditional, utility-owned generation assets. Accordingly, the ''buy versus build'' decision facing utilities--i.e., whether a utility should sign a power purchase agreement (PPA) with a NUG, or develop and own the generation capacity itself--has gained prominence in the industry. Specific debates have revolved around the relative advantages of, the types of risk created by, and the regulatory incentives favoring each approach. Very little of this discussion has focused specifically on publicly owned electric utilities, however, perhaps due to the belief that public power's tax-free financing status leaves little space in which NUGs can compete. With few exceptions (Wiser and Kahn 1996), renewable sources of supply have received similarly scant attention in the buy versus build debate. In this report, we revive the ''buy versus build'' debate and apply it to the two sectors of the industry traditionally underrepresented in the discussion: publicly owned utilities and renewable energy. Contrary to historical treatment, this debate is quite relevant to public utilities and renewables because publicly owned utilities are able to take advantage of some renewable energy incentives only in a ''buy'' situation, while others accrue only in a ''build'' situation. In particular, possible economic advantages of public utility ownership include: (1) the tax-free status of publicly owned utilities and the availability of low-cost debt, and (2) the renewable energy production incentive (REPI) available only to publicly owned utilities. Possible economic advantages to entering into a PPA with a NUG include: (1) the availability of federal tax credits and accelerated depreciation schedules for certain forms of NUG-owned renewable energy, and (2) the California state production incentives available to NUGs but not utilities. This report looks at a publicly owned utility's decision to buy or build new renewable energy capacity--specifically wind or geothermal power--in California. To examine the economic aspects of this decision, we modified and updated a 20-year financial cash-flow model to assess the levelized cost of electricity under four supply options: (1) public utility ownership of new geothermal capacity, (2) public utility ownership of new wind capacity, (3) a PPA for new geothermal capacity, and (4) a PPA for new wind capacity.

Bolinger, Mark; Wiser, Ryan; Golove, William



White Paper: Multi-purpose canister (MPC) for DOE-owned spent nuclear fuel (SNF)  

Science Conference Proceedings (OSTI)

The paper examines the issue, What are the advantages, disadvantages, and other considerations for using the MPC concept as part of the strategy for interim storage and disposal of DOE-owned SNF? The paper is based in part on the results of an evaluation made for the DOE National Spent Fuel Program by the Waste Form Barrier/Canister Team, which is composed of knowledgeable DOE and DOE-contractor personnel. The paper reviews the MPC and DOE SNF status, provides criteria and other considerations applicable to the issue, and presents an evaluation, conclusions, and recommendations. The primary conclusion is that while most of DOE SNF is not currently sufficiently characterized to be sealed into an MPC, the advantages of standardized packages in handling, reduced radiation exposure, and improved human factors should be considered in DOE SNF program planning. While the design of MPCs for DOE SNF are likely premature at this time, the use of canisters should be considered which are consistent with interim storage options and the MPC design envelope.

Knecht, D.A.



Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Environmental Improvement and Energy Resources Authority (Missouri) Missouri Agricultural Commercial Construction Industrial Institutional Investor-Owned Utility MunicipalPublic...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Environmental Assessment (Saskatchewan, Canada) Saskatchewan Agricultural Commercial Construction Developer Fuel Distributor Industrial Institutional Investor-Owned Utility Local...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Virginia Offshore Wind Development Authority (Virginia) Virginia Commercial Construction Developer Industrial InstallerContractor Investor-Owned Utility Local Government...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Investor-Owned Utility Municipal Utility Rural Electric Cooperative Bioenergy Biofuels Alternative Fuel Vehicles Commercial Heating & Cooling Manufacturing Buying & Making...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Investor-Owned Utility Retail Supplier Rural Electric Cooperative Bioenergy Biofuels Alternative Fuel Vehicles Commercial Heating & Cooling Manufacturing Buying & Making...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Incentives (Massachusetts) Massachusetts Agricultural Commercial Construction Industrial InstallerContractor Institutional Investor-Owned Utility Nonprofit Retail Supplier Systems...


Market Data  

U.S. Energy Information Administration (EIA)

... including governments and investor owned utilities, ... There is no official database that maintains and archives time ... Entergy Transmission Service Rates ...


Michigan Business Development Program (Michigan) | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Business Development Program (Michigan) Michigan Business Development Program (Michigan) Eligibility Commercial Investor-Owned Utility Savings For Alternative Fuel Vehicles...


Water Resource Management (Indiana) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Resource Management (Indiana) Water Resource Management (Indiana) Eligibility Agricultural Commercial Construction Fuel Distributor Industrial InstallerContractor Investor-Owned...


Water Quality Standards Implementation (Oklahoma) | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Implementation (Oklahoma) Water Quality Standards Implementation (Oklahoma) Eligibility Agricultural Construction Fuel Distributor Industrial InstallerContractor Investor-Owned...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Midwest Nuclear Compact (Iowa) Iowa Industrial Institutional Investor-Owned Utility MunicipalPublic Utility Utility Midwest Nuclear Compact Commission...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Aquatic Habitat Protection Permit (Saskatchewan, Canada) Saskatchewan Agricultural Commercial Construction Developer Industrial InstallerContractor Institutional Investor-Owned...


Biomass Guidelines (Prince Edward Island, Canada) | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Biomass Guidelines (Prince Edward Island, Canada) Biomass Guidelines (Prince Edward Island, Canada) Eligibility Agricultural Construction Developer Industrial Investor-Owned...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Canada-Saskatchewan Western Economic Partnership Agreement (Saskatchewan, Canada) Saskatchewan Agricultural Construction Institutional Investor-Owned Utility Local Government...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Municipal Solid Waste Management, Resource Recovery, and Conservation Act (Texas) Texas Utility Commercial Agricultural Investor-Owned Utility Industrial Construction...


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos


Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Unique challenges for storage and disposal of DOE-owned SNF at the INEEL  

SciTech Connect

Non-commercial Spent Nuclear Fuel (SNF) owned by the Department of Energy presents some unique challenges for interim storage as well as ultimate disposal in a repository. There is an important link between Yucca Mountain Repository work and the future needs of the DOE SNF program. Close coordination and early definition of acceptance criteria are essential. Much of the Yucca Mountain Repository work has focused on commercial SNF which has very high structural integrity and a well documented set of characteristics and burn-up histories. In contrast, DOE non-commercial SNF at the Idaho National Environmental and Engineering Laboratory (INEEL) represents over two hundred fifty fuel types, much of which is degraded. Fuel designs by DOE were centered around various test objectives in experimental reactors. The result was a proliferation of fuel types. Interest in enhanced heat transfer led to use of sodium as a bond between the fuel and cladding. The desire for smaller more compact reactors with higher power densities led to a variety of enrichments from less than 20% to greater than 90%. INEEL has most of the US U-233 spent nuclear fuel, which came from breeder reactor concepts and consideration of a thorium fuel cycle. These various fuel types now must be placed in safe, stable interim dry storage. Emphasis is being placed on the use of commercially available dry storage designs and independent spent fuel storage installations licensed under NRC criteria. A lot of technological development is being done to characterize fuels that do not have the documented fabrication and operational histories of commercial LWR fuels. Program objectives are safe interim storage and least cost transition to geological repository storage.

Mathews, T.A.



How Well Do Investors Understand Loss Persistence?  

E-Print Network (OSTI)

I obtain quarterly financial statement data from theSPIQ) with zero. 12 All financial statement variables are

Li, Ke



Risk Neutral Investors Do Not Acquire Information¤  

E-Print Network (OSTI)

Kerry and Shmuel Baruch, “Information in Securities Markets:and Pietro Veronesi, “Information Acquisition in FinancialDo Not Acquire Information ? Marc-Andreas Muendler ¶

Muendler, Marc-Andreas




E-Print Network (OSTI)

model-based estimates of the value of oil in Alaska's Arctic National Wildlife Refuge (ANWR). The best estimate of economically recoverable oil in the federal portion of ANWR is 7.06 billion barrels of oil in ANWR would also bring about environmental costs. These costs would consist largely of lost nonuse

Lotko, William



energy systems (solar and wind),” said Dr. Edwards of the University of Idaho. ... prevailing weather conditions in the Company’s market areas, ...


The multiple market-exposure of waste management companies: A case study of two Swedish municipally owned companies  

SciTech Connect

Highlights: Black-Right-Pointing-Pointer Swedish municipally owned waste management companies are active on political, material, technical, and commercial markets. Black-Right-Pointing-Pointer These markets differ in kind and their demands follow different logics. Black-Right-Pointing-Pointer These markets affect the public service, processing, and marketing of Swedish waste management. Black-Right-Pointing-Pointer Articulating these markets is a strategic challenge for Swedish municipally owned waste management. - Abstract: This paper describes how the business model of two leading Swedish municipally owned solid waste management companies exposes them to four different but related markets: a political market in which their legitimacy as an organization is determined; a waste-as-material market that determines their access to waste as a process input; a technical market in which these companies choose what waste processing technique to use; and a commercial market in which they market their products. Each of these markets has a logic of its own. Managing these logics and articulating the interrelationships between these markets is a key strategic challenge for these companies.

Corvellec, Herve, E-mail: herve.corvellec@ism.lu.se [Department of Service Management, Lund University, Campus Helsingborg, PO Box 882, SE-251 08 Helsingborg (Sweden); Bramryd, Torleif [Department of Environmental Strategy, Lund University, Campus Helsingborg, PO Box 882, SE-251 08 Helsingborg (Sweden)



Characteristics of Social Networks and Employee Behavior and Performance A Chinese Case Study of a State-Owned Enterprise  

Science Conference Proceedings (OSTI)

Based on the social networks at a Chinese state-owned enterprise, the authors examine the factors that are correlated with employee performance. They delineate two types of performance: task and contextual. The factors in their study are the characteristics ... Keywords: China, Employee Performance, Information Technology Capability, Knowledge Sharing, Social Network Analysis SNA

Jianping Peng; Jing Quan



Electric Trade in the United States  

Reports and Publications (EIA)

Final Issue Presents information on bulk power transactions by investor-owned utilities, Federal and other publicly-owned utilities, and cooperative utilities.

Information Center



Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



A comparative analysis of business structures suitable forfarmer-owned wind power projects in the United States  

DOE Green Energy (OSTI)

For years, farmers in the United States have looked with envy on their European counterparts' ability to profitably farm the wind through ownership of distributed, utility-scale wind projects. Only within the past few years, however, has farmer- or community-owned wind power development become a reality in the United States. The primary hurdle to this type of development in the United States has been devising and implementing suitable business and legal structures that enable such projects to take advantage of tax-based federal incentives for wind power. This article discusses the limitations of such incentives in supporting farmer- or community-owned wind projects, describes four ownership structures that potentially overcome such limitations, and finally conducts comparative financial analysis on those four structures, using as an example a hypothetical 1.5 MW farmer-owned project located in the state of Oregon. We find that material differences in the competitiveness of each structure do exist, but that choosing the best structure for a given project will largely depend on the conditions at hand; e.g., the ability of the farmer(s) to utilize tax credits, preference for individual versus ''cooperative'' ownership, and the state and utility service territory in which the project will be located.

Bolinger, Mark; Wiser, Ryan



Table 3. Top Five Retailers of Electricity, with End Use Sectors, 2010  

U.S. Energy Information Administration (EIA) Indexed Site

Wisconsin" Wisconsin" "1. Wisconsin Electric Power Co","Investor-Owned",24533047,8260048,8827660,7445339,"-" "2. Wisconsin Public Service Corp","Investor-Owned",10517120,2780951,3863501,3872668,"-" "3. Wisconsin Power & Light Co","Investor-Owned",10130310,3541703,2336594,4252013,"-" "4. Northern States Power Co - Wisconsin","Investor-Owned",6177480,1907315,2699730,1570435,"-" "5. Madison Gas & Electric Co","Investor-Owned",3331795,826021,2243141,262633,"-" "Total Sales, Top Five Providers",,54689752,17316038,19970626,17403088,"-" "Percent of Total State Sales",,80,78,87,74


PoS(Nufact08)096 Copyright owned by the author(s) under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike Licence. http://pos.sissa.it  

E-Print Network (OSTI)

MI The two NuMI horns are designed for remote handling and exchange. A shielded and equipped work cell exists for remote handling and exchange. Special effort is put into the optimisation of dedicated tooling and in to ensure a high uptime of the neutrino beam line. Remote horn handling and remote horn exchange have

McDonald, Kirk


Entity State Ownership Residential Commercial Industrial Transportation  

U.S. Energy Information Administration (EIA) Indexed Site

Pacific Gas & Electric Co Pacific Gas & Electric Co CA Investor Owned 38,657 306,699 232,366 2,843 580,565 San Diego Gas & Electric Co CA Investor Owned 1,019 62,400 84,143 0 147,563 Southern California Edison Co CA Investor Owned 6,706 456,007 69,193 . 531,906 Connecticut Light & Power Co CT Investor Owned 362,262 514,043 100,262 6,681 983,248 United Illuminating Co CT Investor Owned 145,914 170,830 33,167 0 349,911 Potomac Electric Power Co DC Investor Owned 9,594 280,753 2,929 9,856 303,132 Delmarva Power DE Investor Owned 5,937 37,312 9,617 . 52,867 Ameren Illinois Company IL Investor Owned 97,751 188,211 50,163 . 336,125 Commonwealth Edison Co IL Investor Owned 293,240 468,785 345,822 6,443 1,114,290 MidAmerican Energy Co IL Investor Owned . 39 . . 39 Fitchburg Gas & Elec Light Co MA Investor Owned 3,595 5,856 10,690 0 20,141 Massachusetts Electric Co


Copyright 2005 Investor's Business Daily Inc. INVESTOR'S BUSINESS DAILY MONDAY, JUNE 6, 2005 A9  

E-Print Network (OSTI)

Zucker the flexibility to work whenever she wants, a plus that appeals to many home-based entrepreneurs's no of- ficerentorutilitybilltopay,soreve- nue can be used to keep expanding the business. A home-based- allyatadinerortheclient'soffice. Zbar pointed out another option for the home-based entrepreneur whosehousecan

Kuzmanovic, Aleksandar


Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Who Owns Copyrighted Work?  

Science Conference Proceedings (OSTI)

This does not always hold true, and under these facts the business owner's assumption is wrong. (Although this scenario focuses on computer software, any  ...


ZIP-Code-Level Distributions of Real-Estate-Owned (REO) Properties during the U.S. Mortgage Crisis  

E-Print Network (OSTI)

During the mortgage crisis, community developers, policymakers, and others have become increasingly concerned about the extent to which lender-owned homes, often called real-estate-owned or “REO” properties, have accumulated in their neighborhoods and communities. REO properties are usually vacant and, especially when geographically concentrated, can have destabilizing impacts on neighborhoods and communities. However, due to data challenges, little systematic research has been done on the intrametropolitan distributions of such properties, especially across different metropolitan regions. This paper describes the accumulation of REO within different parts of metropolitan areas as of November 2008. First, the urban-versus-suburban distribution of REO is found to vary significantly across metropolitan areas. In general, in traditionally weak-market metros—many of which had substantial REO levels before the advent of the national mortgage crisis—REO tend to be relatively concentrated in central cities. Conversely, in regions where REO accumulated more recently and in those with high central-city housing prices, REO tend to be somewhat more suburbanized. Second, while ZIP codes with high REO densities are disproportionately located in central cities, this pattern varies significantly across metropolitan areas. In particular, in the formerly “hot-market ” regions where home values have declined rapidly, a large majority of ZIP codes with “severe ” REO levels are suburban. Finally, among suburban ZIP codes, those with long commute times experienced larger increases in REO over the November 2006 to 2008 period than those with shorter commute times. The paper concludes with some broad implications for community development policy and planning. About the Author Dan Immergluck is a visiting scholar in community affairs at the Federal Reserve Bank of Atlanta and an

Foreclosed Homes; Dan Immergluck



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 – 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: © 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan


Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Iran cannot have claimed to be building a thermonuclear reactor -To build a thermonuclear reactor by its own efforts is a task absolutely beyond Iran's  

E-Print Network (OSTI)

Iran cannot have claimed to be building a thermonuclear reactor - expert To build a thermonuclear reactor by its own efforts is a task absolutely beyond Iran's strength, and reports that Iran has made such claims must be a misunderstanding, a nuclear specialist said._Georgy Yeliseyev, chief specialist


Participatory Pricing in Sport: An Examination of Name-Your-Own-Price and Pay-What-You-Want Pricing  

E-Print Network (OSTI)

The purpose of this study is to better understand the effects participatory pricing strategies have on consumer perceptions and behaviors in a sport event pricing scenario. Participatory pricing strategies are those that include the consumer in setting the final price of a good or service. These mechanisms include name-your-own-price (NYOP) and pay-what-you-want (PWYW). These pricing strategies are now being introduced into the sport industry. With the increased use of these strategies, and the lack of research in sport management pertaining to consumers’ perceptions of price, specifically consumer voice in price setting, there is a gap in the literature that needs to be filled. This study investigates the consumer’s perceptions of price fairness, perceived value, as well as consumer behavior (i.e. purchase intentions and willingness-to-pay), when encountering participatory pricing strategies. The following dissertation presents a quantitative experimental design, asking subjects to participate in a simulated ticket purchase experience. Difference between experimental groups was assessed based on price fairness, perceived value, willingness-to-pay, and purchase intentions. Results indicate there is a significant difference between participatory pricing groups and traditional fixed price groups when examining price fairness, perceived value, willingness-to-pay, and final average prices paid. Specifically, price fairness evaluations were significantly higher for the PWYW and fixed price groups, and lower for the NYOP group. In addition to the price fairness differences, the groups differed on their evaluations of perceived value (PWYW and fixed are the same, both higher than NYOP). Furthermore, the results reveal that consumers involved in the NYOP mechanism evoked higher levels of willingness-to-pay than PWYW and fixed. Furthermore, the study also found that the final average price paid following the experiment differed based on the mechanism. The PWYW and fixed price mechanisms paid similar amounts, while both of them were significantly higher than the NYOP mechanism. This suggests that while one of the biggest concerns for the PWYW treatment is a low final average price (even $0); this may not be an issue in a sport ticket pricing scenario. Study limitations and future research are included in the following dissertation.

Reese, Jason 1985-



A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



Revisiting the 'Buy versus Build' Decision for Publicly Owned Utilities in California Considering Wind and Geothermal Resources  

SciTech Connect

The last two decades have seen a dramatic increase in the market share of independent, nonutility generators (NUGs) relative to traditional, utility-owned generation assets. Accordingly, the ''buy versus build'' decision facing utilities--i.e., whether a utility should sign a power purchase agreement (PPA) with a NUG, or develop and own the generation capacity itself--has gained prominence in the industry. Very little of this debate, however, has focused specifically on publicly owned electric utilities, and with few exceptions, renewable sources of supply have received similarly scant attention. Contrary to historical treatment, however, the buy versus build debate is quite relevant to publicly owned utilities and renewables because publicly owned utilities are able to take advantage of some renewable energy incentives only in a ''buy'' situation, while others accrue only in a ''build'' situation. In particular, possible economic advantages of public utility ownership include: (1) the tax-free status of publicly owned utilities and the availability of low-cost debt, and (2) the renewable energy production incentive (REPI) available only to publicly owned utilities. Possible economic advantages to entering into a PPA with a NUG include: (1) the availability of federal tax credits and accelerated depreciation schedules for certain forms of NUG-owned renewable energy, and (2) the California state production incentives available to NUGs but not utilities. This article looks at a publicly owned utility's decision to buy or build new renewable energy capacity--specifically wind and geothermal power--in California. To examine the economic aspects of this decision, we used a 20-year financial cash-flow model to assess the levelized cost of electricity under four supply options: (1) public utility ownership of new geothermal capacity, (2) public utility ownership of new wind capacity, (3) a PPA for new geothermal capacity, and (4) a PPA for new wind capacity. We focus on wind and geothermal because both resources are abundant and, in some cases, potentially economic in California. Our analysis is not intended to provide precise estimates of the levelized cost of electricity from wind projects and geothermal plants; nor is our intent to compare the levelized costs of wind and geothermal power to one another. Instead, our intent is simply to compare the costs of buying wind or geothermal power to the costs of building and operating wind or geothermal capacity under various scenarios. Of course, the ultimate decision to buy or build cannot and should not rest solely on a comparison of the levelized cost of electricity. Thus, in addition to quantitative analysis, we also include a qualitative discussion of several important features of the ''buy versus build'' decision not reflected in the economic analysis.

Bolinger, Mark; Wiser, Ryan; Golove, William



Wind Energy Production Tax Credit (Iowa) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Production Tax Credit (Iowa) Wind Energy Production Tax Credit (Iowa) Eligibility Agricultural Industrial Investor-Owned Utility Local Government MunicipalPublic Utility Rural...


Land Reclamation Act (Missouri) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Reclamation Act (Missouri) Land Reclamation Act (Missouri) Eligibility Commercial Construction Industrial Institutional Investor-Owned Utility Local Government MunicipalPublic...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Institutional Investor-Owned Utility Local Government MunicipalPublic Utility Rural Electric Cooperative Schools StateProvincial Govt Tribal Government Utility Water...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Kansas Commercial Investor-Owned Utility Local Government MunicipalPublic Utility Rural Electric Cooperative Utility Water Buying & Making Electricity Health and Environment...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Commercial Construction Industrial Investor-Owned Utility MunicipalPublic Utility Rural Electric Cooperative Systems Integrator Utility Virginia Department of Mines,...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Industrial InstallerContractor Investor-Owned Utility MunicipalPublic Utility Rural Electric Cooperative Transportation Utility Kentucky Department for Environmental...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Institutional Investor-Owned Utility Local Government MunicipalPublic Utility Rural Electric Cooperative Tribal Government Utility Department of Environmental Protection...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Developer Industrial Investor-Owned Utility Local Government MunicipalPublic Utility Rural Electric Cooperative Systems Integrator Tribal Government Utility Virginia Department...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

InstallerContractor Investor-Owned Utility Local Government MunicipalPublic Utility Rural Electric Cooperative StateProvincial Govt Transportation Utility Water Buying &...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Industrial Investor-Owned Utility Local Government MunicipalPublic Utility Rural Electric Cooperative StateProvincial Govt Utility Water Buying & Making Electricity...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Incentives Montana Utility Commercial Investor-Owned Utility MunicipalPublic Utility Rural Electric Cooperative Retail Supplier Systems Integrator Fuel Distributor Alternative...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

InstallerContractor Investor-Owned Utility Local Government MunicipalPublic Utility Rural Electric Cooperative Systems Integrator Transportation Utility Alternative Fuel...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Construction Developer Industrial Investor-Owned Utility MunicipalPublic Utility Rural Electric Cooperative StateProvincial Govt Utility New Mexico Environment Department...

Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Maryland Commercial Investor-Owned Utility Local Government MunicipalPublic Utility Rural Electric Cooperative Utility Water Buying & Making Electricity Home Weatherization...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Institutional Investor-Owned Utility Local Government MunicipalPublic Utility Rural Electric Cooperative Utility Missouri Department of Natural Resources Missouri Air...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Agricultural Industrial Institutional Investor-Owned Utility MunicipalPublic Utility Rural Electric Cooperative Utility Buying & Making Electricity Water Home Weatherization...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Investor-Owned Utility Local Government MunicipalPublic Utility Nonprofit Rural Electric Cooperative Transportation Tribal Government Utility Water Buying & Making...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Commercial Construction Industrial Investor-Owned Utility MunicipalPublic Utility Rural Electric Cooperative Utility Water Buying & Making Electricity Home Weatherization...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Solid Waste Reduction, Recovery, and Recycling Wisconsin Investor-Owned Utility Rural Electric Cooperative Utility Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Massachusetts Agricultural Industrial Investor-Owned Utility MunicipalPublic Utility Rural Electric Cooperative StateProvincial Govt Tribal Government Utility Alternative Fuel...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Institutional Investor-Owned Utility MunicipalPublic Utility Retail Supplier Rural Electric Cooperative Systems Integrator Utility Maryland Department of the Environment...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Fuel Distributor Investor-Owned Utility MunicipalPublic Utility Retail Supplier Rural Electric Cooperative Systems Integrator Utility Department of Environmental Quality...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

InstallerContractor Investor-Owned Utility MunicipalPublic Utility Retail Supplier Rural Electric Cooperative Utility Kentucky Department for Environmental Protection Chapter...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

InstallerContractor Investor-Owned Utility Local Government MunicipalPublic Utility Rural Electric Cooperative Systems Integrator Tribal Government Utility Alternative Fuel...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Institutional Investor-Owned Utility MunicipalPublic Utility Nonprofit Retail Supplier Rural Electric Cooperative Systems Integrator Transportation Utility Department of...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Commercial Construction Industrial Investor-Owned Utility MunicipalPublic Utility Rural Electric Cooperative Utility Maryland Department of the Environment Coastal Facilities...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Environmental Approvals (Ontario, Canada) Ontario Agricultural Commercial Developer Fuel Distributor General PublicConsumer Industrial Investor-Owned Utility MunicipalPublic...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Efficiency and Conservation Requirements for Utilities Pennsylvania Investor-Owned Utility Other Solar Buying & Making Electricity Heating & Cooling Commercial Heating &...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Competitive Natural Gas Providers (Iowa) Iowa Commercial Fuel Distributor Industrial Investor-Owned Utility MunicipalPublic Utility Rural Electric Cooperative Tribal Government...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Underground Wells (Oklahoma) Oklahoma Agricultural Construction Fuel Distributor Industrial Investor-Owned Utility MunicipalPublic Utility Rural Electric Cooperative Utility...


2012 Revenue for Delivery Service Providers  

U.S. Energy Information Administration (EIA) Indexed Site

Revenue for Delivery Service Providers" Revenue for Delivery Service Providers" "(Data from form EIA-861 schedule 4C)" ,,,"Revenue (Thousands Dollars)" "Entity","State","Ownership","Residential","Commercial","Industrial","Transportation","Total" "Pacific Gas & Electric Co","CA","Investor Owned",38657,306699,232366,2843,580565 "San Diego Gas & Electric Co","CA","Investor Owned",1019.1,62400.1,84143.3,0,147562.5 "Southern California Edison Co","CA","Investor Owned",6706,456007,69193,".",531906 "Connecticut Light & Power Co","CT","Investor Owned",362262,514043,100262,6681,983248


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Offshore Natural Gas Royalty Regime (Newfoundland and Labrador, Canada) Newfoundland and Labrador Utility Investor-Owned Utility StateProvincial Govt Industrial MunicipalPublic...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Portfolio Standard District of Columbia Investor-Owned Utility Retail Supplier Bioenergy Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Solar...

Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Investor-Owned Utility Rural Electric Cooperative Heating & Cooling Commercial Heating & Cooling Heat Pumps Bioenergy Biofuels Alternative Fuel Vehicles Manufacturing Buying &...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Portfolio Standard Kansas Investor-Owned Utility Rural Electric Cooperative Bioenergy Alternative Fuel Vehicles Hydrogen & Fuel Cells Water Buying & Making Electricity Solar...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Pollution Control Regulations: No. 46 & 47 - CO2 Budget Trading Program & Allowance Distribution (Rhode Island) Rhode Island Commercial Industrial Investor-Owned Utility Municipal...


Retail Unbundling - Georgia - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Legislation was passed in 1997 which allowed the state's two investor-owned utilities ... PSC to cover expenses, implement ... the needs of the gas and electric ...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Innovation Ohio Loan Program (Ohio) Ohio Commercial Industrial Investor-Owned Utility MunicipalPublic Utility Rural Electric Cooperative Utility Alternative Fuel Vehicles Hydrogen...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Solid Waste and Infectious Waste Regulations (Ohio) Ohio Utility Agricultural Investor-Owned Utility Industrial MunicipalPublic Utility Local Government Rural Electric Cooperative...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Air Pollution Control Fees (Ohio) Ohio Utility Agricultural Investor-Owned Utility StateProvincial Govt Construction MunicipalPublic Utility Local Government Rural Electric...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Water Quality Trading Program (Ohio) Ohio Utility Commercial Agricultural Investor-Owned Utility Industrial Construction Rural Electric Cooperative Retail Supplier Fuel Distributor...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Minimum Gas Service Standards (Ohio) Ohio Fuel Distributor Industrial Investor-Owned Utility MunicipalPublic Utility Utility Public Utilities Commission of Ohio Ohio Biomass...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Portfolio Standard Ohio Investor-Owned Utility Retail Supplier Other Heating & Cooling Commercial Heating & Cooling Heating Manufacturing Buying & Making Electricity Energy Sources...


Hazardous Waste Management System-General (Ohio) | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

System-General (Ohio) Hazardous Waste Management System-General (Ohio) Eligibility Agricultural Industrial Investor-Owned Utility Local Government MunicipalPublic Utility Rural...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Ohio" "1. First Energy Solutions Corp.","Other Provider",29606124,8135208,12599886,8846018,25012 "2. Ohio Power Co","Investor-Owned",26197992,7581485,5816681,12799826,"-" "3....


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Industrial Solid Waste Landfill Facilities (Ohio) Ohio Agricultural Industrial Investor-Owned Utility MunicipalPublic Utility Rural Electric Cooperative StateProvincial Govt...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Water Quality Standards (Ohio) Ohio Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial Construction MunicipalPublic Utility...


Gas Safety Law (Florida) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Gas Safety Law (Florida) Gas Safety Law (Florida) Eligibility Commercial Construction Industrial Investor-Owned Utility MunicipalPublic Utility Retail Supplier Rural Electric...


Gas Pipeline Securities (Indiana) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Pipeline Securities (Indiana) Gas Pipeline Securities (Indiana) Eligibility Utility Investor-Owned Utility Industrial MunicipalPublic Utility Rural Electric Cooperative Fuel...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Oil, Gas, and Metallic Minerals (Iowa) Iowa Agricultural Commercial Fuel Distributor Industrial InstallerContractor Investor-Owned Utility MunicipalPublic Utility Tribal...


Coal Severance Tax (Montana) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Coal Severance Tax (Montana) Coal Severance Tax (Montana) Eligibility Utility Commercial Investor-Owned Utility Industrial MunicipalPublic Utility Rural Electric Cooperative...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Coal Mine Safety Act (Virginia) Virginia Commercial Construction Developer Industrial Investor-Owned Utility MunicipalPublic Utility Systems Integrator Utility Virginia Department...


Gas Production Tax (Texas) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Production Tax (Texas) Gas Production Tax (Texas) Eligibility Utility Commercial Agricultural Investor-Owned Utility Industrial Construction MunicipalPublic Utility Local...

Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Community-Based Energy Development (C-BED) Tariff Minnesota Investor-Owned Utility Municipal Utility Rural Electric Cooperative Utility Bioenergy Alternative Fuel Vehicles Hydrogen...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Efficiency Portfolio Standard Hawaii Investor-Owned Utility Rural Electric Cooperative Heating & Cooling Commercial Heating & Cooling Heat Pumps Manufacturing Buying &...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Efficiency Resource Standard California Investor-Owned Utility Other California Public Utilities Commission Feed-In Tariff California Agricultural Commercial Industrial...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

& Making Electricity Water Solar Home Weatherization Wind California Energy Commission Energy Efficiency Resource Standard California Investor-Owned Utility Other California...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Developer Industrial Investor-Owned Utility Transportation Utility Water Buying & Making Electricity Georgia Department of Natural Resources Renewable and Non-Renewable Resources...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Wastewater Construction and Operation Permits (Iowa) Iowa Agricultural Industrial Institutional Investor-Owned Utility Local Government MunicipalPublic Utility Rural Electric...


Montana Ground Water Assessment Act (Montana) | Department of...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ground Water Assessment Act (Montana) Montana Ground Water Assessment Act (Montana) Eligibility Utility Fed. Government Commercial Agricultural Investor-Owned Utility State...


Solar | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

commercial and industrial customers of the state's investor-owned utilities and energy suppliers (and certain competitive municipal utilities and electric cooperatives)....


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

commercial and industrial customers of the state's investor-owned utilities and energy suppliers (and certain competitive municipal... http:energy.govsavings...


Configuring load as a resource for competitive electricity markets--Review of demand response programs in the U.S. and around the world  

E-Print Network (OSTI)

emergencies (see Table 2). Xcel’s Electric Reduction Savingsinstead, operated so that Xcel could avoid exceeding MAPPElectricity Cooperative Xcel Energy Investor-Owned Utility

Heffner, Grayson C.



Partnering with Utilities Part 1: Successful Partnerships and...  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Program Administrator 24 | TAP Webinar eere.energy.gov * Utility Provider(s): Xcel Energy * Utility Type(s): Investor Owned * Relationship Length: 10+ years * Program...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Consumer Residential Wind Buying & Making Electricity Minnesota Department of Commerce Xcel Energy Wind and Biomass Generation Mandate Minnesota Investor-Owned Utility Bioenergy...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

"2. Sierra Pacific Power Co","Investor-Owned",7548312,2188375,2877253,2482684,"-" "3. Colorado River Comm of Nevada","Public",1669538,"-",991813,677725,"-" "4. Coral Power...


Edward Randolph  

NLE Websites -- All DOE Office Websites (Extended Search)

in its regulation of four types of Investor-Owned Utilities (IOUs): Electric, Natural Gas, Steam and Petroleum Pipeline Companies. Commission-approved tariffs (official...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Natural Gas Processing Plant- Sulfur (New Mexico) New Mexico Developer Industrial Investor-Owned Utility Utility New Mexico Environment Department Open Burning (New Mexico) New...



U.S. Energy Information Administration (EIA)

Alaska Electric Light&Power Co AK Investor Owned Chugach Electric Assn Inc Cooperative City & Borough of Sitka - (AK) Municipal City of ...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

School Land Board (Texas) Texas Utility Fed. Government Commercial Agricultural Investor-Owned Utility Industrial Construction MunicipalPublic Utility Local Government Rural...


Gas Pipelines (Texas) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Pipelines (Texas) Gas Pipelines (Texas) Eligibility Utility Fed. Government Commercial Investor-Owned Utility Industrial Construction MunicipalPublic Utility Local Government...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Groundwater Conservation Districts (Texas) Texas Utility Fed. Government Commercial Investor-Owned Utility Industrial Construction MunicipalPublic Utility Local Government Rural...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Solid Waste Disposal Act (Texas) Texas Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial Construction MunicipalPublic Utility...

Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Uranium Recovery Surface Activities (Texas) Texas Utility Investor-Owned Utility StateProvincial Govt Industrial Construction MunicipalPublic Utility Texas Commission on...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Geothermal Resources Act (Texas) Texas Utility Fed. Government Commercial Investor-Owned Utility Industrial Construction MunicipalPublic Utility Local Government Rural Electric...


Electric Power Annual 2011 - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Generation and thermal output; Electric power plants generating capacity; ... Average power plant operating expenses for major U.S. investor-owned electric utilities XLS:


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Climate Action Plan (Wisconsin) Wisconsin Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial Construction MunicipalPublic...


Power Technologies Energy Data Book: Fourth Edition, Chapter...  

NLE Websites -- All DOE Office Websites (Extended Search)

Small Hydro, Tidal Energy, Wave Energy, Ocean Thermal None Purchased by utility at spot- market energy rate Yes Investor- owned utilities only Delaware 25 kW Commercial,...


Clean Water Partnership Law (Minnesota) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Partnership Law (Minnesota) Clean Water Partnership Law (Minnesota) Eligibility Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Alternate Energy Production, Cogeneration, and Small Hydro Facilities (Indiana) Indiana Utility Investor-Owned Utility MunicipalPublic Utility Rural Electric Cooperative Buying &...


Interstate Oil and Gas Conservation Compact (Montana) | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Montana) Interstate Oil and Gas Conservation Compact (Montana) Eligibility Utility Commercial Investor-Owned Utility Industrial Construction MunicipalPublic Utility Rural Electric...


Oil and Gas Conservation (Montana) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Conservation (Montana) Oil and Gas Conservation (Montana) Eligibility Utility Commercial Investor-Owned Utility Industrial Construction MunicipalPublic Utility Installer...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

PEPCO Energy Services","Other Provider",4523378,2999,4520379,"-","-" "5. The Potomac Edison Co","Investor-Owned",4383248,3303277,796849,283122,"-" "Total Sales, Top Five...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Offshore Wind Development Authority (Virginia) Virginia Commercial Construction Developer Industrial InstallerContractor Investor-Owned Utility Local Government MunicipalPublic...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Design & Remodeling New York State Energy Research and Development Authority 12312015 Offshore Wind in NY State (New York) New York Commercial Investor-Owned Utility Municipal...


Optimal Execution Under Jump Models For Uncertain Price Impact  

E-Print Network (OSTI)

comes from price impacts of both the investor's own trades and other concurrent ... Indeed price impact of large trades have been considered as one of the main ...


Optimal Execution Under Jump Models For Uncertain Price Impact  

E-Print Network (OSTI)

Aug 13, 2012 ... A major source of the execution cost comes from price impacts of both the investor's own trades and other concurrent institutional trades.


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Water Pollution Control Facilities, Tax exemption (Michigan) Michigan Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial...


An Internship in Environmental Compliance and Water Management with Duke Energy Cincinnati, Ohio.  

E-Print Network (OSTI)

??The purpose of this report is to describe my internship experience with Duke Energy, an investor owned gas and electric utility company in Cincinnati, Ohio.… (more)

Huddleston, Brian J.



Electric Power Generation and Transmission (Iowa) | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Power Generation and Transmission (Iowa) Electric Power Generation and Transmission (Iowa) < Back Eligibility Agricultural Industrial Investor-Owned Utility MunicipalPublic...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Coal Bed Methane Protection Act (Montana) Montana Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial Construction Municipal...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Puget Sound Energy Inc","Investor-Owned",20904907,10609011,9138486,1153642,3768 "2. Seattle City of","Public",9384736,3094576,5084754,1204764,642 "3. Bonneville Power...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Resource Management Services, Part 609: Reclassification of Waters (New York) New York Commercial Investor-Owned Utility MunicipalPublic Utility Tribal Government Utility Water...

Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DC Hazardous Waste Management (District of Columbia) District of Columbia Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Montana Integrated Waste Management Act (Montana) Montana Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt MunicipalPublic Utility...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Solid Waste Management (South Dakota) South Dakota Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial Construction Municipal...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Waste Management Assistance Act (Iowa) Iowa Agricultural Commercial Construction Fuel Distributor Industrial Institutional Investor-Owned Utility MunicipalPublic Utility...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Lakeshore Management by Local Governments (Montana) Montana Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial Construction...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Institutional Investor-Owned Utility Local Government Low-Income Residential Multi-Family Residential MunicipalPublic Utility Nonprofit Residential Retail Supplier Rural Electric...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Commercial Fuel Distributor Industrial Institutional Investor-Owned Utility Multi-Family Residential MunicipalPublic Utility Rural Electric Cooperative Transportation Utility NY...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

InstallerContractor Institutional Investor-Owned Utility Local Government Low-Income Residential Multi-Family Residential MunicipalPublic Utility Nonprofit Residential Retail...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Streamside Management Zones (Montana) Montana Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial Construction MunicipalPublic...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Water Management Act (Massachusetts) Massachusetts Agricultural Industrial Institutional Investor-Owned Utility MunicipalPublic Utility Rural Electric Cooperative Utility Buying &...


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

which requires that the investor owned utility, Georgia Power Company, purchase... http:energy.govsavingsrenewable-and-non-renewable-resources-tariff-rnr-7-georgia Rebate Sales...


Water Wells and Drilled or Mined Shafts (Texas) | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Water Wells and Drilled or Mined Shafts (Texas) Water Wells and Drilled or Mined Shafts (Texas) Eligibility Utility Fed. Government Commercial Investor-Owned Utility Industrial...


Water Quality Act (Montana) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Water Quality Act (Montana) Water Quality Act (Montana) Eligibility Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial...


Water Pollution Control Act (West Virginia) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Water Pollution Control Act (West Virginia) Water Pollution Control Act (West Virginia) Eligibility Utility Fed. Government Commercial Agricultural Investor-Owned Utility State...


Water Quality Standards (Iowa) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Iowa) Water Quality Standards (Iowa) Eligibility Agricultural Commercial Construction Fuel Distributor Industrial InstallerContractor Institutional Investor-Owned Utility Local...


Water Quality Control (Texas) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Control (Texas) Water Quality Control (Texas) Eligibility Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial Construction...


Water Pollution Control and Abatement (Maryland) | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Pollution Control and Abatement (Maryland) Water Pollution Control and Abatement (Maryland) Eligibility Agricultural Commercial Construction Industrial Investor-Owned Utility Local...


Water Resources Act (Ontario, Canada) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Water Resources Act (Ontario, Canada) Water Resources Act (Ontario, Canada) Eligibility Agricultural Developer Industrial Investor-Owned Utility MunicipalPublic Utility Rural...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Water Usage Law, Major Water Users (Missouri) Missouri Agricultural Commercial Construction Fed. Government Industrial Institutional Investor-Owned Utility Local Government...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mining Compact Commission (multi-state) Alabama Commercial Construction Developer Industrial Investor-Owned Utility Local Government MunicipalPublic Utility Rural Electric...

Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Sabine River Compact (Multiple States) Texas Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial Construction MunicipalPublic...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Appalachian States Low-Level Radioactive Waste Compact (Maryland) Maryland Commercial Construction Industrial Institutional Investor-Owned Utility MunicipalPublic Utility Retail...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Northwest Interstate Compact on Low-Level Radioactive Waste Management (Multiple States) Alaska Utility Fed. Government Commercial Investor-Owned Utility StateProvincial Govt...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Atlantic Interstate Low-Level Radioactive Waste Management Compact (South Carolina) South Carolina Utility Commercial Agricultural Investor-Owned Utility Industrial Construction...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

of Environment and Conservation Appalachian States Low-Level Radioactive Waste Compact (Maryland) Maryland Commercial Construction Industrial Institutional Investor-Owned...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Southeast Interstate Low-Level Radioactive Waste Management Compact (multi-state) Alabama Commercial Construction Industrial InstallerContractor Institutional Investor-Owned...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Oil and Gas Conservation Compact (Multiple States) Alabama Commercial Developer Industrial Investor-Owned Utility MunicipalPublic Utility Utility Interstate Oil & Gas Compact...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Contractor Institutional Investor-Owned Utility Local Government Low-Income Residential Multi-Family Residential MunicipalPublic Utility Nonprofit Residential Retail Supplier...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Connecticut" "1. Connecticut Light & Power Co","Investor-Owned",9638612,7191790,2053659,273607,119556 "2. Constellation NewEnergy, Inc","Other Provider",3680529,"-",2516320,1164209...


Net Metering | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Program Type Net Metering Provider Georgia Public Service Commission The Georgia Cogeneration and Distributed Generation Act of 2001 requires all utilities -- investor-owned...


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

31 - 20140 of 28,905 results. Rebate Net Metering The Georgia Cogeneration and Distributed Generation Act of 2001 requires all utilities -- investor-owned utilities, municipal...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Alternative Energy Law (AEL) Iowa Investor-Owned Utility Bioenergy Water Buying & Making Electricity Solar Wind Iowa Utilities Board Alternative Energy Law (AEL) Iowa...


DSW Home Page  

NLE Websites -- All DOE Office Websites (Extended Search)

as towns, rural electric cooperatives, public utility and irrigation districts, Federal, state, and military agencies, Native American tribes, investor-owned utilities, power...


Georgia Nuclear Energy Financing Act (Georgia) | Department of...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Nuclear Energy Financing Act (Georgia) Georgia Nuclear Energy Financing Act (Georgia) Eligibility Investor-Owned Utility MunicipalPublic Utility Rural Electric Cooperative Utility...


Hazardous Waste Management (Michigan) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Michigan) Hazardous Waste Management (Michigan) Eligibility Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial Construction...


Hazardous Waste Management (Delaware) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Management (Delaware) Hazardous Waste Management (Delaware) Eligibility Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Capital Investment Tax Credit (Florida) Florida Commercial Construction Fuel Distributor InstallerContractor Investor-Owned Utility Systems Integrator Transportation Utility...


Direct Discharge Permit (Vermont) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Discharge Permit (Vermont) Direct Discharge Permit (Vermont) Eligibility Utility Agricultural Investor-Owned Utility Industrial MunicipalPublic Utility Rural Electric Cooperative...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Vermont Wetland Rules (Vermont) Vermont Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial Construction MunicipalPublic...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Air Pollution Control Permit to Construct and Permit to Operate (Vermont) Vermont Utility Agricultural Investor-Owned Utility Industrial MunicipalPublic Utility Department of...

Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Vermont Air Pollution Control Regulations, Ambient Air Quality...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ambient Air Quality Standards (Vermont) Vermont Air Pollution Control Regulations, Ambient Air Quality Standards (Vermont) Eligibility Utility Agricultural Investor-Owned Utility...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Vermont Air Pollution Control Regulations, Ambient Air Quality Standards (Vermont) Vermont Utility Agricultural Investor-Owned Utility Industrial Construction MunicipalPublic...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Vermont Employment Growth Incentive (Vermont) Vermont Utility Commercial Agricultural Investor-Owned Utility Industrial Construction InstallerContractor Retail Supplier Fuel...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Generation Project Permitting (Vermont) Vermont Construction Industrial InstallerContractor Investor-Owned Utility MunicipalPublic Utility Rural Electric Cooperative...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

The Payroll Tax Credit (Vermont) Vermont Utility Commercial Agricultural Investor-Owned Utility Industrial Construction InstallerContractor Fuel Distributor Alternative Fuel...


Conservation of Biomass Fuel, Firewood (Minnesota) | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Conservation of Biomass Fuel, Firewood (Minnesota) Conservation of Biomass Fuel, Firewood (Minnesota) Eligibility Utility Fed. Government Commercial Agricultural Investor-Owned...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Industrial Investor-Owned Utility Nonprofit Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making Electricity Water Home Weatherization Solar Wind Louisiana...


Electricity - U.S. Energy Information Administration (EIA ...  

U.S. Energy Information Administration (EIA)

Short-Term Energy Outlook ... Search EIA.gov. A-Z ... This statewide program requires Hawaii's three investor-owned utilities to enter into 20-year ...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Wind Solar Heating & Cooling Heating Water Heating Ohio Development Services Agency Industry Supply Chain Development (Ohio) Ohio Utility Commercial Agricultural Investor-Owned...


Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Solar › Energy in Brief ... Chinese investors—such as the state-owned enterprises Export Import Bank of China and China Development Bank ... Oil and gas industry ...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

& Making Electricity Home Weatherization Solar Wind Nova Scotia Department of Energy Industry Supply Chain Development (Ohio) Ohio Utility Commercial Agricultural Investor-Owned...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Georgia Underground Gas Storage Act of 1972 (Georgia) Georgia Commercial Construction Developer General PublicConsumer Industrial Investor-Owned Utility MunicipalPublic Utility...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Pipelines and Underground Gas Storage (Iowa) Iowa Commercial Fuel Distributor Industrial InstallerContractor Investor-Owned Utility MunicipalPublic Utility Transportation Tribal...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Interstate Natural Gas Pipelines (Iowa) Iowa Agricultural Commercial Developer Fed. Government Fuel Distributor Industrial Investor-Owned Utility Local Government MunicipalPublic...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Special Provisions Affecting Gas, Water, or Pipeline Companies (South Carolina) South Carolina Utility Commercial Investor-Owned Utility Industrial Construction MunicipalPublic...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Renewable Energy Standard Colorado Investor-Owned Utility Municipal Utility Rural Electric Cooperative Bioenergy Alternative Fuel Vehicles Hydrogen & Fuel Cells Buying & Making...


Public Service Commission Authorization to Utilize an Alternative...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Industrial InstallerContractor Investor-Owned Utility Rural Electric Cooperative Utility Savings For Alternative Fuel Vehicles Hydrogen & Fuel Cells Program Information...


Fuel Mix and Environmental Characteristics Disclosure  

Energy.gov (U.S. Department of Energy (DOE))

In July 2010, New Hampshire enacted legislation (SB 327) requiring investor-owned utilities and electric cooperatives to disclose the energy sources of their electricity and the environmental...


Browse wiki | Open Energy Information  

Open Energy Info (EERE)

, Investor-Owned Utility + , MunicipalPublic Utility + , Utility + IncentiveImplSector StateProvince + IncentiveName Biomass Guidelines (Prince Edward Island, Canada) +...


California Solar Initiative - Multi-Family Affordable Solar Housing...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

administrator for up to date information on the status of Track 1. ''''' The California Solar Initiative (CSI) provides financial incentives to customers in investor-owned...

Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Minnesota Investor-Owned Utility Municipal Utility Rural Electric Cooperative Utility Bioenergy Alternative Fuel Vehicles Hydrogen & Fuel Cells Solar Buying & Making Electricity...


Energy Efficiency Resource Standards (Delaware) | Open Energy...  

Open Energy Info (EERE)

DSIRE1 Summary In July 2009 the Delaware legislature enacted legislation creating energy savings targets for Delaware's investor-owned, municipal, and cooperative electric...


Energy Efficiency Resource Standard (California) | Open Energy...  

Open Energy Info (EERE)

reduction requirements for each of the three investor-owned electrical utilities and energy savings requirements for the state's three gas utilities. Electricity Savings...


Renewable Energy Portfolio Standard | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Portfolio Standard Renewable Energy Portfolio Standard Eligibility Investor-Owned Utility Municipal Utility Retail Supplier Rural Electric Cooperative Savings For Bioenergy...


Renewable Generation Requirement | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Generation Requirement Renewable Generation Requirement Eligibility Investor-Owned Utility Retail Supplier Savings For Bioenergy Buying & Making Electricity Water Solar Heating &...


Renewable Portfolio Standard (New Brunswick, Canada) | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Portfolio Standard (New Brunswick, Canada) Renewable Portfolio Standard (New Brunswick, Canada) Eligibility Investor-Owned Utility Local Government MunicipalPublic Utility Rural...


Net Metering (Ontario, Canada) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Net Metering (Ontario, Canada) Net Metering (Ontario, Canada) Eligibility Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Air Quality Approvals and Permits (New Brunswick, Canada) New Jersey Commercial Construction Developer Industrial InstallerContractor Investor-Owned Utility MunicipalPublic...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Capital Investment Incentive (Nova Scotia, Canada) Nova Scotia Commercial Developer Fuel Distributor Industrial InstallerContractor Institutional Investor-Owned Utility Municipal...


Air Quality (Nova Scotia, Canada) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Air Quality (Nova Scotia, Canada) Air Quality (Nova Scotia, Canada) Eligibility Agricultural Industrial Investor-Owned Utility Multi-Family Residential MunicipalPublic Utility...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Air Quality (Nova Scotia, Canada) Nova Scotia Agricultural Industrial Investor-Owned Utility Multi-Family Residential MunicipalPublic Utility Rural Electric Cooperative Utility...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

o","Investor-Owned",1641094,646566,870490,124038,"-" "4. Basin Electric Power Coop","Cooperative",998782,"-","-",998782,"-" "5. Cass County Electric Coop Inc","Cooperative",949129,...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

c","Investor-Owned",1439002,513084,720009,205909,"-" "4. Sioux Valley SW Elec Coop","Cooperative",543948,273406,37503,233039,"-" "5. Southeastern Electric Coop...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Power Co","Investor-Owned",2085395,566573,1020138,498684,"-" "4. Connexus Energy","Cooperative",1961569,1169218,714619,77732,"-" "5. Dakota Electric Association","Cooperative",18...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Co Inc","Investor-Owned",1109783,430942,443059,235782,"-" "4. Kauai Island Utility Cooperative","Cooperative",434533,159426,115447,159660,"-" "5. Gay & Robinson...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

Power","Investor-Owned",4450617,3054492,1065773,330352,"-" "2. Delaware Electric Cooperative","Cooperative",1262460,1033025,229435,"-","-" "3. Constellation NewEnergy,...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Construction Developer Industrial Investor-Owned Utility MunicipalPublic Utility Rural Electric Cooperative Systems Integrator Utility Virginia Department of Mines, Minerals and...


Rio Grande Compact (Texas) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Rio Grande Compact (Texas) Rio Grande Compact (Texas) Eligibility Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Verification, Monitoring, and Certification of Clean Energy Project (Texas) Texas Utility Commercial Investor-Owned Utility Industrial Construction MunicipalPublic Utility Rural...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ownership of Carbon Dioxide Captured by Clean Coal Project (Texas) Texas Utility Commercial Investor-Owned Utility Industrial Construction MunicipalPublic Utility Rural Electric...

Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Canadian River Compact (Texas) Texas Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial Construction MunicipalPublic Utility...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Rio Grande Compact (Texas) Texas Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial Construction MunicipalPublic Utility Local...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Municipal Utility Districts (Texas) Texas Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial Construction MunicipalPublic...


Regional Districts (Texas) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Districts (Texas) Regional Districts (Texas) Eligibility Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial Construction...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Texas Radiation Control Act (Texas) Texas Utility Commercial Agricultural Investor-Owned Utility Industrial Construction MunicipalPublic Utility Local Government Rural Electric...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Water Wells and Drilled or Mined Shafts (Texas) Texas Utility Fed. Government Commercial Investor-Owned Utility Industrial Construction MunicipalPublic Utility Local Government...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Pecos River Compact (Texas) Texas Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial Construction MunicipalPublic Utility...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Conservation of Oil and Gas (Texas) Texas Utility Fed. Government Commercial Investor-Owned Utility Industrial Construction MunicipalPublic Utility Local Government Rural Electric...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Texas Clean Air Act (Texas) Texas Utility Commercial Agricultural Investor-Owned Utility Industrial Construction MunicipalPublic Utility Local Government Rural Electric...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Coastal Public Lands Management Act (Texas) Texas Utility Fed. Government Commercial Agricultural Investor-Owned Utility Industrial Construction MunicipalPublic Utility Local...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Oil and Gas on Public Lands (Texas) Texas Utility Fed. Government Commercial Investor-Owned Utility Industrial Construction MunicipalPublic Utility Local Government Rural Electric...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Cavern Protection (Texas) Texas Utility Fed. Government Commercial Investor-Owned Utility Industrial Construction MunicipalPublic Utility Local Government Rural Electric...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Red River Compact (Texas) Texas Utility Fed. Government Commercial Agricultural Investor-Owned Utility StateProvincial Govt Industrial Construction MunicipalPublic Utility Local...


Tax Credits, Rebates & Savings | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Maritime Electric - Net Metering (Prince Edward Island, Canada) Prince Edward Island Agricultural Commercial General PublicConsumer Industrial Investor-Owned Utility Low-Income...


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


GAO-11-520T Federal Real Property: Progress Made on Planning and Data, but Unneeded Owned and Leased Facilities Remain  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Economic Economic Development, Public Buildings and Emergency Management, Committee on Transportation and Infrastructure, House of Representatives FEDERAL REAL PROPERTY Progress Made on Planning and Data, but Unneeded Owned and Leased Facilities Remain Statement of David J. Wise, Director Physical Infrastructure Issues Brian J. Lepore, Director Defense Capabilities and Management Issues For Release on Delivery Expected at 10:00 a.m. EDT Wednesday, April 6, 2011 GAO-11-520T Accountability * Integrity * Reliability Highlights of GAO-11-520T, a testimony before the Subcommittee on Economic Development, Public Buildings, and Emergency Management, Committee on Transportation and Infrastructure, House of Representatives. April 6, 2011 FEDERAL REAL PROPERTY


Energy Efficiency and Value: Opportunities for Investors | ENERGY...  

NLE Websites -- All DOE Office Websites (Extended Search)

providers Verify applications for ENERGY STAR certification Design commercial buildings Energy efficiency program administrators Commercial and industrial program sponsors...


Green Pricing: Renewables and Hydro Business Unit Investors' Report  

Science Conference Proceedings (OSTI)

Green pricing is a new concept that gives customers the choice of renewable energy sources for their electricity. It can give utilities brand recognition and promote customer loyalty in a competitive marketplace. Utilities can gain much from closely watching the efforts of others in this new area.



Law, Politics and Markets of Corporate Governance: Institutional Investors' Influence  

E-Print Network (OSTI)

to understand what the financial statements and otherthe frequency of financial statement errors and fraud to theaudits is not in the financial statement errors discovered

Carniglia, Stephen Davis


Note: This page contains sample records for the topic "mi investor owned" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The influence of institutional investors on firm value  

E-Print Network (OSTI)

The impact of corporate governance on firm value has been extensively debated by academics and business practitioners. Some studies show that companies that allow minority shareholders to have more control are likely to ...

Lee, Yong Seung



Six ARPA-E Projects Illustrate Private Investors Excited About...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

between 750,000 and 8 million each, focus on improving solar and wind energy technologies and advanced battery storage. "This amount of private capital support indicates...


Appendices of an appraisal for the use of geothermal energy in state-owned buildings in Colorado. Section E. Glenwood Springs  

DOE Green Energy (OSTI)

The State Highway Department Buildings in Glenwood Springs have been evaluated in this appraisal for the use of geothermal energy in state-owned buildings. Glenwood Springs is the location of surface hot springs and has been assessed by various parties for several geothermal applications. The Glenwood Highway Department Buildings consist of an office building and a maintenance garage. These two building140 gpm. currently use an array of natural gas forced air furnaces and electric heaters for space/heating purpose; a propane unit is used for one water heater. Retrofit engineering for geothermal heating is based upon a central plate-in-frame heat exchanger coupled to several fan coil heaters and unit heaters. Design heating can be accomplished with 150/sup 0/F geothermal water at 140 gpm. The geothermal energy economics are evaluated for a single deep well, with and without a proration of the total production well cost for the required 140 gpm out of the 1000 gpm production capacity. Only the prorated well cost option provides an economically feasible geothermal system. The feasibility, therefore, depends on the use of the excess geothermal water by private or municipal facilities. The principal institutional/environmental issue for a geothermal heating sytem for the Highway Department Buildings is the question of whether or not the states owns the geothermal rights on the state property.

Meyer, R.T.; Coe, B.A.; Dick, J.D.



National spent fuel program preliminary report RCRA characteristics of DOE-owned spent nuclear fuel DOE-SNF-REP-002. Revision 3  

Science Conference Proceedings (OSTI)

This report presents information on the preliminary process knowledge to be used in characterizing all Department of Energy (DOE)-owned Spent Nuclear Fuel (SNF) types that potentially exhibit a Resource Conservation and Recovery Act (RCRA) characteristic. This report also includes the process knowledge, analyses, and rationale used to preliminarily exclude certain SNF types from RCRA regulation under 40 CFR {section}261.4(a)(4), ``Identification and Listing of Hazardous Waste,`` as special nuclear and byproduct material. The evaluations and analyses detailed herein have been undertaken as a proactive approach. In the event that DOE-owned SNF is determined to be a RCRA solid waste, this report provides general direction for each site regarding further characterization efforts. The intent of this report is also to define the path forward to be taken for further evaluation of specific SNF types and a recommended position to be negotiated and established with regional and state regulators throughout the DOE Complex regarding the RCRA-related policy issues.




Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Alternative Energy Law (AEL)  

Energy.gov (U.S. Department of Energy (DOE))

Iowa requires its two investor-owned utilities (MidAmerican Energy and Alliant Energy Interstate Power and Light) to own or to contract for a combined total of 105 megawatts (MW) of renewable...


Table 3. Top Five Retailers of Electricity, with End Use Sectors...  

U.S. Energy Information Administration (EIA) Indexed Site

or-Owned",4170296,1193627,1383319,1593350,"-" "3. Mississippi County Electric Coop","Cooperative",3089262,65996,19109,3004157,"-" "4. Oklahoma Gas & Electric Co","Investor-Owned",2...


Peace and Conflict Studies (PACS) Essay Contest --$500 Scholarship to the Winner! Inspired by her own survival of the dropping of an atomic bomb on Hiroshima, BGSU alumnus Ms.  

E-Print Network (OSTI)

own survival of the dropping of an atomic bomb on Hiroshima, BGSU alumnus Ms. Hiroko Nakamoto has threat of nuclear weapons in our world in a lecture entitled: "Nuclear Alarmism from Hiroshima to Al

Moore, Paul A.


Who Owns Renewable Energy Certificates?  

E-Print Network (OSTI)

on the ownership question. FERC Decides…Or Does It? In 2003,utilities led to a petition to FERC to issue a declaratoryto Section 210 of PURPA. FERC declared that avoided cost

Holt, Edward; Wiser, Ryan; Bolinger, Mark



A Wholly Owned Subsidiary of  

E-Print Network (OSTI)

This Environmental Report (ER) constitutes one portion of an application being submitted by International Isotopes Fluorine Products (IIFP) to construct and operate a facility that will utilize depleted DUF6 to produce high purity inorganic fluorides, uranium oxides, and anhydrous hydrofluoric acid. The proposed IIFP facility will be located near Hobbs, New Mexico. IIFP has prepared the ER to meet the requirements specified in 10 CFR 51, Subpart A, particularly those requirements set forth in 10 CFR 51.45(b)-(e). The organization of this ER is generally consistent with NUREG-1748, “Environmental Review Guidance for Licensing Actions Associated with NMSS Programs, Final Report.” The Environmental Report for this proposed facility provides information that is specifically required by the NRC to assist it in meeting its obligations under the National Environmental Policy Act (NEPA) of 1969 and the agency’s NEPA-implementing regulations. This ER demonstrates that the environmental protection measures proposed by IIFP are adequate to protect both the environment and the health and safety of the public. This Environmental Report evaluates the potential environmental impacts of the Proposed Action and its reasonable alternatives. This ER also describes the environment potentially affected by IIEF’s proposal,

Revision A



Who Owns Renewable Energy Certificates?  

E-Print Network (OSTI)

energy and capacity. Utilities also argue that they and their ratepayers are already paying above-market pricesenergy. QFs answer that although many QF contracts have turned out to be expensive relative to market prices,

Holt, Edward; Wiser, Ryan; Bolinger, Mark



Who Owns Renewable Energy Certificates?  

E-Print Network (OSTI)

from fossil-fuel fired cogeneration is priced the same asFERC noted that “…cogeneration facilities, to receive QFis a pre-requisite to a cogeneration facility’s achieving QF

Holt, Edward; Wiser, Ryan; Bolinger, Mark



Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


Renewable Energy Standard | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Renewable Energy Standard Renewable Energy Standard Renewable Energy Standard < Back Eligibility Investor-Owned Utility Municipal Utility Retail Supplier Rural Electric Cooperative Savings Category Bioenergy Commercial Heating & Cooling Manufacturing Buying & Making Electricity Water Solar Wind Program Info State Michigan Program Type Renewables Portfolio Standard Provider Michigan Public Service Commission '''''Note: The Michigan Public Service Commission (MPSC) created a temporary order ([http://www.dleg.state.mi.us/mpsc/orders/electric/2008/u-15800_12-04-2008... U-15800]) in December of 2008 to address implementation issues for renewable energy and energy optimization plans arising from the passage of PA 295. In March of 2010 the MPSC was granted informal approval of its RPS governing rules by the Michigan State Office of Administrative Hearings and


Update to Assessment of Direct Disposal in Unsaturated Tuff of Spent Nuclear Fuel and High-Level Waste Owned by U.S. Department of Energy  

SciTech Connect

The overall purpose of this study is to provide information and guidance to the Office of Environmental Management of the U.S. Department of Energy (DOE) about the level of characterization necessary to dispose of DOE-owned spent nuclear fuel (SNF). The disposal option modeled was codisposal of DOE SNF with defense high-level waste (DHLW). A specific goal was to demonstrate the influence of DOE SNF, expected to be minor, in a predominately commercial repository using modeling conditions similar to those currently assumed by the Yucca Mountain Project (YMP). A performance assessment (PA) was chosen as the method of analysis. The performance metric for this analysis (referred to as the 1997 PA) was dose to an individual; the time period of interest was 100,000 yr. Results indicated that cumulative releases of 99Tc and 237Np (primary contributors to human dose) from commercial SNF exceed those of DOE SNF both on a per MTHM and per package basis. Thus, if commercial SNF can meet regulatory performance criteria for dose to an individual, then the DOE SNF can also meet the criteria. This result is due in large part to lower burnup of the DOE SNF (less time for irradiation) and to the DOE SNF's small percentage of the total activity (1.5%) and mass (3.8%) of waste in the potential repository. Consistent with the analyses performed for the YMP, the 1997 PA assumed all cladding as failed, which also contributed to the relatively poor performance of commercial SNF compared to DOE SNF.

P. D. Wheatley (INEEL POC); R. P. Rechard (SNL)



Dose Modeling Evaluations and Technical Support Document For the Authorized Limits Request for the DOE-Owned Property Outside the Limited Area, Paducah Gaseous Diffusion Plant Paducah, Kentucky  

SciTech Connect

Environmental assessments and remediation activities are being conducted by the U.S. Department of Energy (DOE) at the Paducah Gaseous Diffusion Plant (PGDP), Paducah, Kentucky. The Oak Ridge Institute for Science and Education (ORISE), a DOE prime contractor, was contracted by the DOE Portsmouth/Paducah Project Office (DOE-PPPO) to conduct radiation dose modeling analyses and derive single radionuclide soil guidelines (soil guidelines) in support of the derivation of Authorized Limits (ALs) for 'DOE-Owned Property Outside the Limited Area' ('Property') at the PGDP. The ORISE evaluation specifically included the area identified by DOE restricted area postings (public use access restrictions) and areas licensed by DOE to the West Kentucky Wildlife Management Area (WKWMA). The licensed areas are available without restriction to the general public for a variety of (primarily) recreational uses. Relevant receptors impacting current and reasonably anticipated future use activities were evaluated. In support of soil guideline derivation, a Conceptual Site Model (CSM) was developed. The CSM listed radiation and contamination sources, release mechanisms, transport media, representative exposure pathways from residual radioactivity, and a total of three receptors (under present and future use scenarios). Plausible receptors included a Resident Farmer, Recreational User, and Wildlife Worker. single radionuclide soil guidelines (outputs specified by the software modeling code) were generated for three receptors and thirteen targeted radionuclides. These soil guidelines were based on satisfying the project dose constraints. For comparison, soil guidelines applicable to the basic radiation public dose limit of 100 mrem/yr were generated. Single radionuclide soil guidelines from the most limiting (restrictive) receptor based on a target dose constraint of 25 mrem/yr were then rounded and identified as the derived soil guidelines. An additional evaluation using the derived soil guidelines as inputs into the code was also performed to determine the maximum (peak) dose for all receptors. This report contains the technical basis in support of the DOE?s derivation of ALs for the 'Property.' A complete description of the methodology, including an assessment of the input parameters, model inputs, and results is provided in this report. This report also provides initial recommendations on applying the derived soil guidelines.

Boerner, A. J. [Oak Ridge Institute for Science and Education (ORISE), Oak Ridge, TN (United States). Independent Environmental Assessment and Verification Program; Maldonado, D. G. [Oak Ridge Institute for Science and Education (ORISE), Oak Ridge, TN (United States). Independent Environmental Assessment and Verification Program; Hansen, Tom [Ameriphysics, LLC (United States)



A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Other Policy | Open Energy Information  

Open Energy Info (EERE)

Other Policy Other Policy Jump to: navigation, search Incentive that does not fit under any of the other policy types. Other Policy Incentives CSV (rows 1 - 3) Incentive Incentive Type Place Applicable Sector Eligible Technologies Active Alternative Energy Portfolio Standard (Massachusetts) Other Policy Massachusetts Investor-Owned Utility Retail Supplier CHP/Cogeneration Yes Community-Based Energy Development (C-BED) Tariff (Minnesota) Other Policy Minnesota Investor-Owned Utility Municipal Utility Rural Electric Cooperative Utility Biomass Hydrogen Landfill Gas Municipal Solid Waste Photovoltaics Small Hydroelectric Solar Thermal Electric Wind energy Yes Renewable Energy Pilot Program (Louisiana) Other Policy Louisiana Investor-Owned Utility Rural Electric Cooperative Biomass



U.S. Energy Information Administration (EIA)

SEPT03NV 1. Nevada Power Co Investor-Owned 2. Sierra Pacific Power Co 3. Colorado River Comm of Nevada Public 4. Coral Power LLC Other Provider 5. Wells Rural Electric Co


Review of California and National Methods for Energy Performance Benchmarking of Commercial Buildings  

E-Print Network (OSTI)

the CEUS surveyor lists the utility meters found – notingnot found, etc. The utility meter list is then used tos investor-owned utilities. Table 2-2 lists the number of

Matson, Nance E.; Piette, Mary Ann
