Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

While Drilling Operations The downhole logging while drilling (LWD) operations in the Gulf of Mexico Gas Hydrate JIP Drilling Program (GOM-JIP) was designed in part to obtain...


Performance Evaluation of HYCOM-GOM for Hydrokinetic Resource Assessment in the Florida Strait  

SciTech Connect

The U.S. Department of Energy (DoE) is assessing and mapping the potential off-shore ocean current hydrokinetic energy resources along the U.S. coastline, excluding tidal currents, to facilitate market penetration of water power technologies. This resource assessment includes information on the temporal and three-dimensional spatial distribution of the daily averaged power density, and the overall theoretical hydrokinetic energy production, based on modeled historical simulations spanning a 7-year period of record using HYCOM-GOM, an ocean current observation assimilation model that generates a spatially distributed three-dimensional representation of daily averaged horizontal current magnitude and direction time series from which power density time series and their statistics can be derived. This study ascertains the deviation of HYCOM-GOM outputs, including transport (flow) and power density, from outputs based on three independent observation sources to evaluate HYCOM-GOM performance. The three independent data sources include NOAA s submarine cable data of transport, ADCP data at a high power density location, and HF radar data in the high power density region of the Florida Strait. Comparisons with these three independent observation sets indicate discrepancies with HYCOM model outputs, but overall indicate that the HYCOM-GOM model can provide an adequate assessment of the ocean current hydrokinetic resource in high power density regions like the Florida Strait. Additional independent observational data, in particular stationary ADCP measurements, would be useful for expanding this model performance evaluation study. ADCP measurements are rare in ocean environments not influenced by tides, and limited to one location in the Florida Strait. HF radar data, although providing great spatial coverage, is limited to surface currents only.

Neary, Vincent S [ORNL; Gunawan, Budi [ORNL; Ryou, Albert S [ORNL



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Wireline Logging Wireline Logging From: Timothy Collett, USGS Conventional Wireline Logging Operations in the Gulf of Mexico Gas Hydrate JIP Drilling Program Conventional wireline (CWL) logging operations in the Gulf of Mexico Gas Hydrate JIP Drilling Program (GOM-JIP) was scheduled to include the deployment of a signal logging string (Figure 1) and a vertical seismic profiling (VSP) tool (Figure 2) in several of the Atwater Valley and Keathley Canyon drill sites. The only wireline logging tool scheduled to be deployed was the FMS-sonic tool string, which consisted of the Formation MicroScanner (FMS), a general purpose inclinometer tool (GPIT), and scintillation gamma ray tool (SGT), and the dipole shear sonic imager tool (DSI). The vertical seismic imager tool (VSI) will also be deployed during the GOM-JIP drilling program. The wireline logging tools were provided by Schlumberger wireline services.


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.




E-Print Network (OSTI)

As the U.S. offshore Gulf of Mexico (GOM) oil and gas province has matured, the exploration and production industry has pushed into deeper waters supported by technology advances and the growing awareness that the GOM represents one of the most important supply areas for hydrocarbons. This case presents an analysis of GOM deepwater development from the perspective of our virtual company, Energy Inc., a company that was faced with developing an entry strategy for the GOM deepwater in 1998. It includes an overview of GOM trends and incorporates specific U.S. energy policy questions, as outlined below. Should the U.S., through its federal Minerals Management Service (MMS), an agency of the Department of Interior, provide incentives for risk taking in GOM deepwater blocks through royalty relief? How should expensive transportation infrastructure investments be made to deliver GOM production to shore and under what policy and regulatory framework?

unknown authors



File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2013-10084P


NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

Expedition - The LWD Program Expedition - The LWD Program GoM JIP Leg II will feature a state-of-the-art LWD tool combination that will provide unprecedented information on the nature of the sediments and their pore fill constituents. The program will feature full research-level LWD data on formation lithology and porosity, and will include Schlumberger’s MP3 (quadrapole sonic tool) and PeriScope (3-D high-resolution resistivity) tools. These tools will provide full 3-D information on the both acoustic (both compressional and shear wave) and electrical properties of the sediment enabling the improved evaluation of gas hydrate in both pore filling and fracture-filling modes. This full suite of LWD tools includes the 4.75" MP3 multipole acoustic tool immediately behind the 6.75" bit, followed by an 8.5" reamer which opens up the hole for the 6.75" LWD tools that follow. These include the geoVISION resistivity imaging tool, the EcoScope integrated propagation resistivity, density and neutron tool, the TeleScope MWD tool, the PeriScope directional propagation resistivity tool, and the sonicVISION monopole acoustic tool whose sensors are ~160 ft above the bit.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


Office of Fossil Energy DOE Award No.: DE-NT0005668 Quarterly...  

NLE Websites -- All DOE Office Websites (Extended Search)

Fossil Energy DOE Award No.: DE-NT0005668 Quarterly Report October 2009 to April 2011 Gas Hydrate Characterization in the GoM using Marine EM Methods Submitted by: Scripps...

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

The National Methane Hydrates R&D Program The National Methane Hydrates R&D Program 2009 Gulf of Mexico JIP - Leg II DOE-Sponsored Expedition Confirms Resource-Quality Gas Hydrate in the Gulf of Mexico Leg II Initial Scientific Reports Now Available Photo of semi-submersible Helix Project Background Participants Pre-Drilling Expedition Overview Drilling/Logging Sites The LWD Program Site Summaries Walker Ridge-Block 313 Green Canyon-Block 955 Alaminos Canyon block 21 and East Breaks block 992 JIP Website [external site] FITI article - Summer 2009 Leg II Initial Scientific Reports On May 6, 2009, the U.S. Department of Energy (DOE) National Energy Technology Laboratory (NETL)in collaboration with the U.S. Geological Survey (USGS), the U.S. Minerals Management Service, an industry research consortium led by Chevron, and others completed a landmark gas hydrate


Gas Hydrate Characterization in the GoM using Marine EM Methods  

SciTech Connect

In spite of the importance of gas hydrate as a low-carbon fuel, a possible contributor to rapid climate change, and a significant natural hazard, our current understanding about the amount and distribution of submarine gas hydrate is somewhat poor; estimates of total volume vary by at least an order of magnitude, and commercially useful concentrations of hydrate have remained an elusive target. This is largely because conventional geophysical tools have intrinsic limitations in their ability to quantitatively image hydrate. It has long been known from well logs that gas hydrate is resistive compared to the host sediments, and electrical and electromagnetic methods have been proposed and occasionally used to image hydrates. This project seeks to expand our capabilities to use electromagnetic methods to explore for gas hydrate in the marine environment. An important basic science aspect of our work was to quantify the resistivity of pure gas hydrate as a function of temperature at seafloor pressures. We designed, constructed, and tested a highpressure cell in which hydrate could be synthesized and then subjected to electrical conductivity measurements. Impedance spectroscopy at frequencies between 20 Hz and 2 MHz was used to separate the effect of the blocking electrodes from the intrinsic conductivity of the hydrate. We obtained very reproducible results that showed that pure methane hydrate was several times more resistive than the water ice that seeded the synthesis, 20,000 {Ohm}m at 0{degrees}#14;C, and that the activation energy is 30.6 kJ/mol over the temperature range of -15 to 15{degrees}#14;C. Adding silica sand to the hydrate, however, showed that the addition of the extra phase caused the conductivity of the assemblage to increase in a counterintuitive way. The fact that the increased conductivity collapsed after a percolation threshold was reached, and that the addition of glass beads does not produce a similar increase in conductivity, together suggest that while the surface of the gas hydrate grains are not intrinsically conductive, the presence of sand does increase their conductivity. In the field component of this project, we carried out an 18day cruise on the R.V. Roger Revelle in the Gulf of Mexico from 7th-??26th October 2008 to collect controlled-source electromagnetic (CSEM) data over four hydrate prospects; blocks AC 818, WR 313, GC 955, and MC 118. During these surveys we deployed 30 ocean bottom electromagnetic (OBEM) recorders a total of 94 times at four survey areas and towed the Scripps Undersea Electromagnetic Source Instrument (SUESI) a total of 103 hours. SUESI transmission was 200 A on a 50 m dipole antenna at heights of 70-100 m above the seafloor. We also towed a neutrally buoyant 3-axis electric field recorder behind the SUESI antenna at a constant offset of 300 m. The use of a towed receiver that is "flown" above the seafloor allowed us to operate in areas where seafloor infrastructure such as wellheads, pipelines, and installed scientific equipment existed. We reduced the data to apparent resistivity psuedosections. The most compelling results come from the hydrate observatory at MC 118, where a localized resistivity anomaly is clearly identified under the southeast crater in an otherwise uniform 1 {Ohm}m background. The data from MC 118 also show that authigenic carbonate does not necessarily express itself as a confounding resistor, as was feared at the start of this project. While the results from the other prospects are much more complicated, the data are well correlated with known geology, and line to line agreement is good. Although these data are not amenable to 1D inversion as was initially hoped, we expect to use a newly developed 2D CSEM inversion code to continue to get useful information from this rich data set.

Steven Constable



The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Office of Fossil Energy DOE Award No.: DE-NT0005668 Quarterly Report  

NLE Websites -- All DOE Office Websites (Extended Search)

1 to September 2011 1 to September 2011 Gas Hydrate Characterization in the GoM using Marine EM Methods Submitted by: Scripps Institution of Oceanography University of California San Diego La Jolla, CA 92093-0225 Principal Investigator: Steven Constable Prepared for: United States Department of Energy National Energy Technology Laboratory October 27, 2011 Oil & Natural Gas Technology TABLE OF CONTENTS Executive Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Progress, Results, and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4 Milestone Status . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .


Office of Fossil Energy DOE Award No.: DE-NT0005668 Quarterly Report  

NLE Websites -- All DOE Office Websites (Extended Search)

1 to June 2011 1 to June 2011 Gas Hydrate Characterization in the GoM using Marine EM Methods Submitted by: Scripps Institution of Oceanography University of California San Diego La Jolla, CA 92093-0225 Principal Investigator: Steven Constable Prepared for: United States Department of Energy National Energy Technology Laboratory August 4 2011 Oil & Natural Gas Technology TABLE OF CONTENTS Executive Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Progress, Results, and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 Milestone Status . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .


Office of Fossil Energy DOE Award No.: DE-NT0005668 Quarterly Report  

NLE Websites -- All DOE Office Websites (Extended Search)

09 to March 2009 09 to March 2009 Gas Hydrate Characterization in the GoM using Marine EM Methods Submitted by: Scripps Institution of Oceanography University of California San Diego La Jolla, CA 92093-0225 Principal Investigator: Steven Constable Prepared for: United States Department of Energy National Energy Technology Laboratory April 30, 2009 Oil & Natural Gas Technology TABLE OF CONTENTS Executive Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Progress, Results, and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Conclusions . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 6 Cost Status . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .


Office of Fossil Energy DOE Award No.: DE-NT0005668 Quarterly Report  

NLE Websites -- All DOE Office Websites (Extended Search)

10 to June 2010 10 to June 2010 Gas Hydrate Characterization in the GoM using Marine EM Methods Submitted by: Scripps Institution of Oceanography University of California San Diego La Jolla, CA 92093-0225 Principal Investigator: Steven Constable Prepared for: United States Department of Energy National Energy Technology Laboratory August 2, 2010 Oil & Natural Gas Technology TABLE OF CONTENTS Executive Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Progress, Results, and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 5 Cost Status . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .


Office of Fossil Energy DOE Award No.: DE-NT0005668 Quarterly Report  

NLE Websites -- All DOE Office Websites (Extended Search)

0 to March 2010 0 to March 2010 Gas Hydrate Characterization in the GoM using Marine EM Methods Submitted by: Scripps Institution of Oceanography University of California San Diego La Jolla, CA 92093-0225 Principal Investigator: Steven Constable Prepared for: United States Department of Energy National Energy Technology Laboratory April 12, 2010 Oil & Natural Gas Technology TABLE OF CONTENTS Executive Summary . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Progress, Results, and Discussion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 Conclusion . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 7 Cost Status . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.



NLE Websites -- All DOE Office Websites (Extended Search)

Sciences STATE: MI PROJECT TITLE : Manufacturing Industrial Development for the Alternative Energy Systems Funding Opportunity Announcement Number Procurement Instrument...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


Energy Efficiency and Conservation Block Grant Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U.S. Department of Energy Categorical Exclusion Determination Form Program or Field Office: Energy Efficiency and Conservation Block Grant Program Project Title MI-County-St. Clair Location: County St. Clair MI American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Develop County's Long Term Energy Efficiency and Conservation Strategy, 2) technical consultant


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

61 - 13870 of 26,764 results. 61 - 13870 of 26,764 results. Download CX-007493: Categorical Exclusion Determination GoM Miocene Carbon Dioxide Site Characterization Mega Transect: High-Resolution 3-dimensional Seismic Acquisition Survey CX(s) Applied: B3.1 Date: 12/06/2011 Location(s): Texas Offices(s): National Energy Technology Laboratory http://energy.gov/nepa/downloads/cx-007493-categorical-exclusion-determination Download CX-007498: Categorical Exclusion Determination Subtask 6.1 - Strategic Studies CX(s) Applied: A9 Date: 12/06/2011 Location(s): North Dakota Offices(s): National Energy Technology Laboratory http://energy.gov/nepa/downloads/cx-007498-categorical-exclusion-determination Download CX-007499: Categorical Exclusion Determination City of Las Vegas Electric Vehicle Program

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Michigan | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Efficiency and Renewable Energy, Golden Field Office August 18, 2010 Peterbilt Model 320 Hybrid HLAs are being put to use in Ann Arbor, MI, where they will serve as recycling...


Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



EnergyCS Prius Altairnano 2009 Report.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

period: All trips combined Overall gasoline fuel economy (mpg) Overall DC electrical energy consumption (DC Whmi) 2 Total number of trips Total distance traveled (mi) Trips...


EnergyCS Prius Valence 2009 Report.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

period: All trips combined Overall gasoline fuel economy (mpg) Overall DC electrical energy consumption (DC Whmi) 2 Total number of trips Total distance traveled (mi) Trips...


Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Office of Fossil Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

and Rice to be appropriate. The initial ocean locations are Blake Ridge, Hydrate Ridge, Peru Margin and GOM. The permafrost location is Mallik. Although the ultimate goal of the...


Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


NETL: News Release - Energy Department Announces Nearly $4.3...  

NLE Websites -- All DOE Office Websites (Extended Search)

in Grants to Michigan FERNDALE, MI - Acting Under Secretary of Energy David K. Garman today announced nearly 4.3 million in Department of Energy (DOE) grants to Michigan...


Category:SecondarySchool | Open Energy Information  

Open Energy Info (EERE)

IA MidAmerican Energy Co (Iowa).png SVSecondarySchool Des ... 68 KB SVSecondarySchool Detroit MI Detroit Edison Co.png SVSecondarySchool Detr... 66 KB SVSecondarySchool El Paso TX...


Energy Efficiency and Conservation Block Grant Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U.S. Department of Energy Categorical Exclusion Determination Form Program or Field Office: TRIBAL ENERGY PROGRAM MI Project Title MI-TEP-KEWEENAW BAY INDIAN COMMUNITY Location: Tribal KEWEENAW BAY INDIAN COMMUNITY Proposed Action or Project Description: American Recovery and Reinvestment Act: The Keweenaw Bay Indian Community (KBIC) proposes to study the feasibility of wind power at two locations for the purpose of reducing the Tribe's reliance upon fossil fuels, and this proposed project would



Gasoline and Diesel Fuel Update (EIA)

Department of Energy EIA Energy Information Administration, U.S. Department of Energy FERC Federal Energy Regulatory Commission GOM Gulf of Mexico LNG Liquefied natural gas Mcf...

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION


NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Core Handling Core Handling From: Cruise Prospectus [PDF-827KB] Visit the Photo Gallery for more pictures showing core handling Non-pressurized and Pressure Core Handling Non-pressurized Core Handling (Fugro Hydraulic Piston Corer and Fugro Corer) Photo of Core packed in ice bath Core packed in ice bath Cores that might contain gas hydrates should be recovered as quickly as possible. An ice bath may be used in some cases to slow the dissociation process. A core reception/preparation van will be on the deck of the Uncle John where individual cores (perhaps up to 9 m long) can be laid on ‘core hooks' and quickly drilled, labeled and sectioned. Infrared (IR) camera imaging will be done as soon as practical after core recovery. Both track-mounted and hand held IR cameras will be used to identify the


NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Cruise Cruise Special Report - Bottom-Simulating Reflections(BSR). Seismic lines from deep continental shelves all around the world contain anomalous reflections known as bottom-simulating reflections(BSR). The reflections mimic the sea-floor topography at a near constant depth below the surface, and commonly cut across geological layers. The nature of the reflection indicates a horizon across which seismic velocity dramatically decreases. At one time, scientists thought the reflection must be due to some mineralogical alteration in the sediment due to heat and pressure. Once the existence of natural methane hydrate was established, BSRs were thought to record the decrease in velocity when passing from hydrate-bearing sediments to those containing only water. Therefore, BSRs were thought to be a direct indicator of hydrate: no BSR meant no hydrate. However, the velocity contrast between hydrate and no-hydrate was determined to be insufficient to cause BSRs. Today, scientists have established that BSRs are an indication of concentrations of free methane gas that is blocked from further upward migration by the presence of methane hydrate in the overlying layers. Consequently, the distribution of BSRs may mark only a subset of the areas containing hydrate.


NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Core Processing Core Processing Photos and other pertinent images from the cruise will be posted in the "Photo Gallery" as they become available. Core Processing Photos taken by NETL scientist aboard the Uncle John. These photos show the various tools used to analyze pressurized and non-pressurized core taken from the first drilling location at Atwater Valley. A_Transferring core to lab B_Pressure Core Transfer Chamber BC_Pressure core lab BCC_Core Processing Lab Transferring core to lab Pressure core transfer chamber Pressure core lab Core Processing lab BD_Pressure core analysis tools2 C_Pressure core analysis tools Ga Tech Mechanical Measurements Tool GeoTek Core logger Pressure core analysis tools Pressure core analysis tools Georgia Tech Mechanical measurements tool GeoTek core logger


NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

The DOE/JIP Gulf of Mexico Hydrate Research Cruise The DOE/JIP Gulf of Mexico Hydrate Research Cruise Status Reports During this expedition we will maintain an intermittent log of information relayed from the chief scientist on the expedition. To view a report for a particular day click on the "Day x" link in any highlighted box. The planned cruise timeline [PDF-13KB] is April 17 - May 21, 2005. This is the "planned" timeline. The schedule may change without prior notification due weather conditions or other unplanned occurrences. April 17 Day 1 April 18 Day 2 April 19 Day 3 April 20 Day 4 April 21 Day 5 April 22 Day 6 April 23 Day 7 April 24 Day 8 April 25 Day 9 April 26 Day 10 April 27 Day 11 April 28 Day 12 April 29 Day 13 April 30 Day 14 May 1 Day 15 May 2 Day 16 May 3 Day 17 May 4 Day 18 May 5


NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Pressurized Coring Equipment Pressurized Coring Equipment Pressure Core Equipment used by the Gulf of Mexico Gas Hydrate JIP Drilling Program Pressure Core Equipment - Photo Gallery One of the key objectives of the ChevronTexaco Gulf of Mexico hydrates Joint Industry Project is the collection and analyses of deepwater sediment samples. Because these samples may contain hydrate which is only stable at specific temperature and pressure conditions it is necessary to use specialized sampling equipment. Otherwise, the combination of reduced pressure and increased temperatures as the sample is retrieved through 4,000 feet of gulf seawater will fully dissociate the hydrate, leaving only gas and water. Although techniques exist to infer hydrates presence from distinctive geochemical markers, we have lost the ability to image the nature of hydrate distribution, or to conduct measurements of the various physical and chemical properties of hydrates in the host sediments.


NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

available. Day 10 - 26 April 2005 Day 10 photos showing core taken using the Fugro Hydraulic Piston Corer (FHPC) and the seabed frame which houses the FHPC. Core1 core2...


NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Non-pressurized and Pressure Core Handling Non-pressurized Core Handling (Fugro Hydraulic Piston Corer and Fugro Corer) Photo of Core packed in ice bath Core packed in ice...


NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

the omni-directional source generates compressional, shear, and Stoneley waves into hard formations. The configuration of the DSI also allows recording of both in-line and...


NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Analysis - Fugro Operations and Geotechnical Investigations PDF-7.13MB National Methane Hydrate R&D Program website. Photos: Photo Gallery - miscellaneous - Photos from...


NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

- Contacts Contact information for technical or media related information is listed below. Media Related Inquiries: Otis Mills Office of Public Affairs Coordination, NETL...


NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Geochemistry Program On-Board Uncle John From: Miriam Kastner, University of California at San Diego On-Board Geochemistry Analyses The objectives of the geochemistry program are...


NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

The DOEJIP Gulf of Mexico Hydrate Research Cruise Status Reports During this expedition we will maintain an intermittent log of information relayed from the chief scientist on the...


NETL: Methane Hydrates - DOE/JIP GOM Hydrate Research Cruise  

NLE Websites -- All DOE Office Websites (Extended Search)

Pressurized Coring Equipment Pressure Core Equipment used by the Gulf of Mexico Gas Hydrate JIP Drilling Program Pressure Core Equipment - Photo Gallery One of the key objectives...


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....


U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Shelby, Charter Township of MI-City-Shelby, Charter Township of Location: City Shelby, Charter MI Township of American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Acquisition of technical services for development of an energy efficiency and conservation strategy and to conduct energy audits on all Township buildings (completed), 2) conduct energy efficiency building retrofits on the Shelby Township Municipal Building envelope (window replacement project), 3) conduct energy efficiency building retrofits to the Township Municipal Building (heating, ventilating, and air conditioning upgrades), 4) conduct energy efficiency building retrofits on township municipal buildings (lighting upgrades-Municipal Building, Detective Building, Parks & Recreation Gas Pump, Nature Center


Annual Energy Outlook 2013 Early Release Reference Case  

U.S. Energy Information Administration (EIA) Indexed Site

Vehicle Choice Modeling and Vehicle Choice Modeling and Projections for the Annual Energy Outlook John Maples Office of Energy Analysis, Energy Efficiency and End Use January 25, 2013 | Detroit, MI Outline John Maples, Vehicle Choice Models and Markets Detroit, MI, January 25, 2013 2 * Overview of model structure and inputs * Battery electric vehicles and current state of the market * Projections of battery electric vehicles in the Annual Energy Outlook 2013 * High Battery Technology case in the Annual Energy Outlook 2012 Overview of model structure and inputs 3 John Maples, Vehicle Choice Models and Markets Detroit, MI, January 25, 2013 Light duty vehicle technology market penetration John Maples, Vehicle Choice Models and Markets Detroit, MI, January 25, 2013 4 * Technologies affecting light-duty vehicle fuel economy are


Energy Efficiency and Conservation Block Grant Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Sterling Heights MI-City-Sterling Heights Location: City Sterling Heights MI American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Energy Efficiency and Conservation Strategy administrative costs; 2) completion of an energy audit of city-owned Nature Center to identify energy-consuming items; 3) energy efficiency retrofits to replace lighting in the Department of Public Works (DPW) Office Building (1971); 4) energy efficiency retrofits to replace windows at Fire Station #5 (1991); 5) energy efficiency retrofits to include replacing boilers, chillers, electric furnaces, and/or hot water tank at the Parks & Recreation Building (1974), Police Department (1977), Library (1978), City Hall (1968), DPW (1971), Nature Center (1980); integrated control systems,


Carbon Capture and Storage: Sustainability in the UK energy mix yryfasyfrtsayfsaytrsyfysa 1 UK Energy Research Centre  

E-Print Network (OSTI)

whole-systems aspects of energy supply and use, while developing and maintaining the means to enableCarbon Capture and Storage: Sustainability in the UK energy mix yryfasyfrtsayfsaytrsyfysa 1 UK Energy Research Centre CARBON CAPTURE AND STORAGE: SUSTAI NABI LI TY I N THE UK ENERGY MI X Workshop

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



U.S. Department of Energy's Office of Energy Efficiency and Renewable Energy National Environmental Policy Act  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Southfield MI-City-Southfield Location: City Southfield MI American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Establish an Energy Office, 2) establish a program of behavioral changes for reducing energy use at the Civic Center Complex (EXCLUDES Activity 2), 3) establish an energy auditing program for municipal and commercial facilities, 4) energy efficiency and retrofits at the Administration and Pavilion buildings and installation of sub-meters (EXCLUDES Activity 4), 5) lighting upgrades at municipal buildings and the covered parking deck (EXCLUDES Activity 5), 6) HVAC upgrades and new ceiling for the ice rink (EXCLUDES Activity 6), 7) community outreach to residences and businesses to improve energy efficiency, 8) develop a non-motorized transportation plan


A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



U.S. Department of Energy Office of Energy Efficiency and Renewable Energy NEPA Categorical Exclusion Determination  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-SAULT STE. MARIE TRIBE OF CHIPPEWA INDIANS OF MI-TRIBE-SAULT STE. MARIE TRIBE OF CHIPPEWA INDIANS OF MICHIGAN Location: Tribe MI-TRIBE-SAULT STE. MARIE TRIBE OF CHIPPEWA INDIANS OF MICHIGAN MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Sault Ste. Marie Tribe of Chippewa Indians proposes to perform energy efficiency lighting retrofits at several Tribal-owned facilities. Retrofit activities include installing ballasts, light sockets, lamps, and motion sensors. Conditions: Historic preservation clause applies to this application (Tribal Administration Building I located @ 523 Ashmun St [1949], Chippewa Service Building [1955], and Northern Hospitality Building [1955]) Categorical Exclusion(s) Applied: B2.5, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21


Natural Gas - U.S. Energy Information Administration (EIA) -...  

Annual Energy Outlook 2012 (EIA)

Archive) JUMP TO: In The News | Overview | PricesDemandSupply | Storage In the News: Natural gas drilling activity in the U.S. Gulf of Mexico (GOM) generally increased over the...


Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...


Guardian Industries | Open Energy Information  

Open Energy Info (EERE)

Industries Industries Jump to: navigation, search Name Guardian Industries Place Auburn Hills, MI Website http://www.guardian.com/ References Results of NREL Testing (Glass Magazine)[1] Guardian News Archive[2] Information About Partnership with NREL Partnership with NREL Yes Partnership Type Other Relationship Partnering Center within NREL Transportation Technologies and Systems Partnership Year 2002 LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! Guardian Industries is a company located in Auburn Hills, MI. References ↑ "Results of NREL Testing (Glass Magazine)" ↑ "Guardian News Archive" Retrieved from "http://en.openei.org/w/index.php?title=Guardian_Industries&oldid=381719" Categories: Clean Energy Organizations


Transportation Energy Futures | OpenEI  

Open Energy Info (EERE)

Energy Futures Energy Futures Dataset Summary Description The 2009 National Household Travel Survey (NHTS) provides information to assist transportation planners and policy makers who need comprehensive data on travel and transportation patterns in the United States. The 2009 NHTS updates information gathered in the 2001 NHTS and in prior Nationwide Personal Transportation Surveys (NPTS) conducted in 1969, 1977, 1983, 1990, and 1995. Source U.S. Department of Transportation, Federal Highway Administration Date Released February 28th, 2011 (3 years ago) Date Updated Unknown Keywords NHTS TEF transportation Transportation Energy Futures travel trip Data application/zip icon Travel Day Trip File (zip, 42.6 MiB) application/zip icon Household File (zip, 5 MiB) application/zip icon Person File (zip, 17.4 MiB)


U.S. Department of Energy National Environmental Policy Act categorical exclusion determination  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Farmington Hills MI-City-Farmington Hills Location: City Farmington Hills MI American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Establish regional energy office; 2) provide grants to conduct comprehensive energy audits for commercial and residential buildings; 3) financial incentive program; 4) building retrofits to include: 4a) lighting retrofits, occupancy sensors, building management controls, and ice controls in two buildings and installation of solar hot water heater, 4b) green roof, solar hot water heater, and sky lights and solar tubes at City Hall, and 4c) Mayor's Youth Council Program to purchase a foreclosed home and renovate to


U.S. Department of Energy National Environmental Policy Act Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Warren MI-City-Warren Location: City Warren MI American Recovery and Reinvestment Act: Proposed Action or Project Description: 1) Conduct energy audits of several municipal buildings; 2) install green roof on Police Headquarters, 3) install green roof on Sanitation Building, 4) conduct a biomass feasibility study; and 5) conduct building retrofits based on audit recommendations in municipal buildings (Police Headquarters, Judicial Building, Water Garage, Sanitation Building, six identified Fire Stations, DPW Garage, Stilwell Manor, Ice Rink, Owen Jax, and Community Center): replacement of boilers; replacement of HVAC units; and installation of energy efficiency lighting, exit lights, and parking lot lights; and replace exit lights and install occupancy


Reducing the Environmental Footprint and Economic Costs of Automotive Manufacturing through an Alternative Energy Supply  

E-Print Network (OSTI)

in urban areas like the Detroit region. In such a situation,energy supply based on in Detroit, MI, region in the Unitedsupply figures for the Detroit region where much of the U.S.

Yuan, Chris; Dornfeld, David



Microsoft Word - figure_03.doc  

Gasoline and Diesel Fuel Update (EIA)

Gas in the United States and the Gulf of Mexico, 2005 (Million Cubic Feet) GOM Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity...


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use



Site Map; Printable Version; Share this resource. Send a link to Full Size Image - Energy Innovation Portalto someone by E-mail; Share Full Size Image - Energy ...


EIA Report 12/6/05 - Hurricane Impacts on U.S. Oil & Natural Gas Energy  

U.S. Energy Information Administration (EIA) Indexed Site

Beginning today this report will be updated every Tuesday. Beginning today this report will be updated every Tuesday. As of Tuesday, December 6, 5:00 pm Shut-in Status Date Shut-in Oil (bbl/d) % of Total Federal GOM Shut-in Gas (mmcf/d) % of Total Federal GOM 12/6/2005 503,187 31.9% 2,650 26.2% 12/5/2005 509,270 32.3% 2,716 26.9% 12/2/2005 539,074 34.2% 2,943 29.1% 12/1/2005 547,074 34.7% 2,964 29.3% 11/30/2005 547,223 34.7% 2,965 29.4% 11/29/2005 564,229 35.8% 2,994 29.6% 11/28/2005 594,421 37.7% 3,060 30.3% 11/23/2005 615,623 39.1% 3,196 31.6% 11/22/2005 621,233 39.4% 3,219 31.9% 11/21/2005 633,064 40.2% 3,269 32.4% 11/18/2005 717,807 45.5% 3,648 36.1% source: Minerals Management Service; Energy Information Administration note: Represents Federal offshore oil and natural gas production shut-ins. Prices NYMEX Futures Prices 12/6/2005 12/5/2005 change Week Ago 11/29/2005 Year Ago


EIA Report 12/13/05 - Hurricane Impacts on U.S. Oil & Natural Gas Energy  

U.S. Energy Information Administration (EIA) Indexed Site

13, 6:00 pm 13, 6:00 pm Shut-in Status Date Shut-in Oil (bbl/d) % of Total Federal GOM Shut-in Gas (mmcf/d) % of Total Federal GOM 12/12/2005 441,394 28.0% 2,312 22.9% 12/9/2005 447,425 28.4% 2,347 23.2% 12/8/2005 464,858 29.5% 2,442 24.2% 12/7/2005 476,035 30.2% 2,475 24.5% 12/6/2005 503,187 31.9% 2,650 26.2% 12/5/2005 509,270 32.3% 2,716 26.9% 12/2/2005 539,074 34.2% 2,943 29.1% 12/1/2005 547,074 34.7% 2,964 29.3% 11/30/2005 547,223 34.7% 2,965 29.4% 11/29/2005 564,229 35.8% 2,994 29.6% 11/28/2005 594,421 37.7% 3,060 30.3% source: Minerals Management Service; Energy Information Administration note: Represents Federal offshore oil and natural gas production shut-ins. graph of shut-in oil & natural gas production comparison of hurricanes Katrina & Ivan figure data Prices graph of oil and gas prices figure data graph of nymex futures for gasoline & deisel


EIA Report 12/27/05 - Hurricane Impacts on U.S. Oil & Natural Gas Energy  

U.S. Energy Information Administration (EIA) Indexed Site

This will be the last of our reports summarizing Hurricane impacts. The statistics used in the report can still be found on our site in these specific locations. This will be the last of our reports summarizing Hurricane impacts. The statistics used in the report can still be found on our site in these specific locations. As of Tuesday, December 27, 5:00 pm Shut-in Status Date Shut-in Oil (bbl/d) % of Total Federal GOM Shut-in Gas (mmcf/d) % of Total Federal GOM 12/22/2005 412,687 26.2% 1,962 19.4% 12/19/2005 414,495 26.3% 2,014 19.9% 12/16/2005 426,282 27.0% 2,228 22.1% 12/15/2005 426,282 27.0% 3,228 22.1% 12/12/2005 441,394 28.0% 2,312 22.9% 12/9/2005 447,425 28.4% 2,347 23.2% 12/8/2005 464,858 29.5% 2,442 24.2% 12/7/2005 476,035 30.2% 2,475 24.5% 12/6/2005 503,187 31.9% 2,650 26.2% 12/5/2005 509,270 32.3% 2,716 26.9% 12/2/2005 539,074 34.2% 2,943 29.1% source: Minerals Management Service; Energy Information Administration note: Represents Federal offshore oil and natural gas production shut-ins.

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


2011-2012 Wind Energy Minor Form STUDENT INFORMATION  

E-Print Network (OSTI)

2011-2012 Wind Energy Minor Form STUDENT INFORMATION R Number (Current TTU Students Only Name First Name MI Choose 18 hours from the following list of courses in Wind Energy. All courses must be approved by a wind energy advisor and a grade of C or better achieved in each course. UNDERGRADUATE MINOR

Rock, Chris


Beryllium Vender Screening Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Speedring Systems, Inc. (Detroit, MI); Wolverine Tube Division...


Energy Efficiency and Conservation Block Grant Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Warren MI-City-Warren Location: City Warren MI American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Feasibility study for a geothermal heating, ventilating, and air conditioning system for the Community Center; 2) streetlight LED feasibility study; 3) audits of 26 municipal buildings; 4) Police Headquarters green roof, 5) Sanitation Building green roof, 6) energy efficiency retrofits to the Peacock Building which will include energy efficiency lighting; heating, ventilating, and air conditioning system installation, window replacement, and insulation; 7) biomass feasibility study; and 8) establish a revolving loan fund which included unidentified building retrofits (Approval excludes Activity 8) Conditions: Excludes approval for Activity 8; Historic preservation clause applies to this application


Energy Efficiency and Conservation Block Grant Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Grand Rapids MI-City-Grand Rapids Location: City Grand Rapids MI American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Develop energy efficiency conservation strategy, 2) exterior glass replacement at City Hall, 3) lighting control retrofits, 4) light fixture replacement in ten buildings, 5) implement facility based energy tracking system, and 6) install (approximately 5-10 ton) closed-loop, geothermal ground source heating and cooling systems at fire stations. Conditions: Historic preservation clause applies to this application (Fire Stations--1734 S Division [84 yrs old], 1002 Chester St [108 yrs old], 38 LaGrave Ave [99 yrs old], and 2251 Plainfield Ave [59 yrs old] and MLK Park Lodge [91 yrs old], Refuse Center, Woodlawn Cemetery Service


Revitalizing American Manufacturing | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Revitalizing American Manufacturing Revitalizing American Manufacturing Revitalizing American Manufacturing September 13, 2010 - 5:30pm Addthis A123 Systems' President David Vieau speaks with Energy Secretary Steven Chu and Michigan Governor Jennifer Granholm at the opening of their Livonia, MI plant. The plant will develop and manufacture advanced batteries systems for electric vehicles. | Department of Energy Photo | A123 Systems' President David Vieau speaks with Energy Secretary Steven Chu and Michigan Governor Jennifer Granholm at the opening of their Livonia, MI plant. The plant will develop and manufacture advanced batteries systems for electric vehicles. | Department of Energy Photo | Secretary Chu Secretary Chu Former Secretary of Energy "The Department of Energy has long been charged with accelerating energy



Science Conference Proceedings (OSTI)

Energy. Summary: Key metrologies/systems: Scanning tunneling microscopy and one- and two-photon photoemission/Model ...




Home. Site Map; Printable Version; Share this resource. About; Search; Categories (15) Advanced Materials; Biomass and Biofuels; Building Energy Efficiency ...


U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-County-Livingston MI-County-Livingston Location: County Livingston MI American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Development of an energy efficiency and conservation strategy (CX-8/14/09); 2) retrofit of boiler systems for the Administration Building, Courthouse, and County Jail; 3) retrofit of heating, ventilating, and air conditioning (HVAC) control systems for the Administration Building, Courthouse, Animal Shelter, Law Center, Judicial Center, and County Jail; 4) provision of project management services for EECBG-funded projects, 5) retrofit of the HVAC systems for the Jail and Animal Shelter, 6) installation of lighting controls


U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Novi MI-City-Novi Location: City Novi MI American Recovery and Reinvestment Act: Proposed Action or Project Description: 1) Technical consultant to prepare Energy Efficiency and Conservation Strategy, 2) establish an Energy Office, 3) energy efficiency retrofits at the Civic Center 4) energy efficiency retrofits at the Ice Arena, 5) energy efficiency retrofits at Fire Stations 1 and 4, 6) energy efficiency retrofits at Meadowbrook Senior Center, 7) energy efficient retrofits at the Public Service Building, and 8) engineering analysis of Civic Center duct work, and expanding the existing city non-motorized plan Conditions: None Categorical Exclusion(s) Applied: A1, A9, A11, B1.32, B2.5, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21


Amur Energy Division | Open Energy Information  

Open Energy Info (EERE)

Amur Energy Division Amur Energy Division Jump to: navigation, search Name Amur Energy Division Place 46001 Valencia, Spain Sector Solar Product Engineering and construction group specialising in large solar power plants. References AMUR[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! TODO: Determine if this company is valid. This article is a stub. You can help OpenEI by expanding it. Amur Energy Division is a company located in Spain. Related Links http://findarticles.com/p/articles/mi_m5CNK/is_2007_Jan_4/ai_n24998390/ http://www.businesswirenet.org/pr/index.php/id/jesus-linares-gil-chairman-and-ceo-of-ae http://solarstocks.blogspot.com/2007_01_01_archive.html References ↑ "Amur Energy Division" Retrieved from "http://en.openei.org/w/index.php?title=Amur_Energy_Division&oldid=391205"


Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Michigan | Building Energy Codes Program  

NLE Websites -- All DOE Office Websites (Extended Search)

Michigan Michigan Last updated on 2013-06-03 Commercial Residential Code Change Current Code ASHRAE Standard 90.1-2007 with Amendments Amendments / Additional State Code Information 2009 Commercial MI Uniform Energy Code Rules Approved Compliance Tools Can use COMcheck State Specific Research Impacts of ASHRAE 90.1-2007 for Commercial Buildings in the State of Michigan (BECP Report, Sept. 2009) Approximate Energy Efficiency Equivalent to ASHRAE 90.1-2007 Effective Date 03/09/2011 Adoption Date 11/08/2010 Code Enforcement Mandatory DOE Determination ASHRAE 90.1-2007: No ASHRAE 90.1-2010: No Michigan DOE Determination Letter, May 31, 2013 Current Code 2009 IECC with Amendments Amendments / Additional State Code Information 2009 Residential MI Uniform Energy Code Rules Approved Compliance Tools Can use REScheck



Science Conference Proceedings (OSTI)

There has been a significant progress in converting solar energy using silicon technology to replace fossil fuels. However, its high cost of production has led...



Efficient, Low-cost Microchannel Heat Exchanger. Return to Marketing Summary. Skip footer navigation to end of page. ... Energy Innovation Portal on Facebook;



NLE Websites -- All DOE Office Websites (Extended Search)

Energy Energy Energy Express Licensing Accelerator-Driven Transmutation Of Spent Fuel Elements Express Licensing Acid-catalyzed dehydrogenation of amine-boranes Express Licensing Air Breathing Direct Methanol Fuel Cell Express Licensing Aligned Crystalline Semiconducting Film On A Glass Substrate And Method Of Making Express Licensing Anion-Conducting Polymer, Composition, And Membrane Express Licensing Apparatus for Producing Voltage and Current Pulses Express Licensing Biaxially oriented film on flexible polymeric substrate Express Licensing Corrosion Test Cell For Bipolar Plates Express Licensing Device for hydrogen separation and method Negotiable Licensing Durable Fuel Cell Membrane Electrode Assembly (MEA) Express Licensing Energy Efficient Synthesis Of Boranes Express Licensing



NLE Websites -- All DOE Office Websites (Extended Search)

energy, including Fundamental advances in nuclear fuels Nonproliferation safeguards Reactor concepts Reactor waste disposition Animation of new reactor concept for deep space...


Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012


Energy Efficiency and Conservation Block Grant Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Clinton, Charter Township of MI-City-Clinton, Charter Township of Location: City Clinton, Charter MI Township of American Recovery and Reinvestment Act: Proposed Action or Project Description: 1) Energy efficiency retrofits (install vinyl siding) at the Heritage Estates Senior Center, and 2) upgrade of existing street lights. Conditions: None Categorical Exclusion(s) Applied: B2.5, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21 This action would not: threaten a violation of applicable statutory, regulatory, or permit requirements for environment, safety, and health, including DOE and/or Executive Orders; require siting, construction, or major expansion of waste storage, disposal, recovery, or


Energy Efficiency and Conservation Block Grant Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Taylor MI-City-Taylor Location: City Taylor MI American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Replace boilers with energy efficient boilers in apartment communities owned by the city of Taylor; 2) replace lighting fixtures and roof at the Department of Public Works Building; 3) replace parking lot lights around the city of Taylor; and 4) lighting retrofits at the Taylor Sportsplex recreational facility. Conditions: None Categorical Exclusion(s) Applied: B1.32, B2.5, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21 This action would not: threaten a violation of applicable statutory, regulatory, or permit requirements for environment, safety, and health,


Present and future high-energy accelerators for neutrino experiments  

SciTech Connect

There is an active neutrino program making use of the high-energy (larger than 50 GeV) accelerators both in USA at Fermilab with NuMI and at CERN in Europe with CNGS. In this paper we will review the prospects for high intensity high energy beams in those two locations during the next decade.

Kourbanis, I.; /Fermilab


Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


energy intensity | OpenEI  

Open Energy Info (EERE)

intensity intensity Dataset Summary Description Energy intensity data and documentation published by the U.S. DOE's office of Energy Efficiency and Renewable Energy (EERE). Energy intensity is defined as: amount of energy used in producing a given level of output or activity; expressed as energy per unit of output. This is the energy intensity of the the electricity sector, which is an energy consuming sector that generates electricity. Data are organized to separate electricity-only generators from combined heat and power (CHP) generators. Data is available for the period 1949 - 2004. Source EERE Date Released May 31st, 2006 (8 years ago) Date Updated Unknown Keywords Electricity Energy Consumption energy intensity fossil fuels renewable energy Data application/vnd.ms-excel icon electricity_indicators.xls (xls, 2.1 MiB)


Renewable Energy Standard | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Renewable Energy Standard Renewable Energy Standard Renewable Energy Standard < Back Eligibility Investor-Owned Utility Municipal Utility Retail Supplier Rural Electric Cooperative Savings Category Bioenergy Commercial Heating & Cooling Manufacturing Buying & Making Electricity Water Solar Wind Program Info State Michigan Program Type Renewables Portfolio Standard Provider Michigan Public Service Commission '''''Note: The Michigan Public Service Commission (MPSC) created a temporary order ([http://www.dleg.state.mi.us/mpsc/orders/electric/2008/u-15800_12-04-2008... U-15800]) in December of 2008 to address implementation issues for renewable energy and energy optimization plans arising from the passage of PA 295. In March of 2010 the MPSC was granted informal approval of its RPS governing rules by the Michigan State Office of Administrative Hearings and


Energy Expenditures | OpenEI  

Open Energy Info (EERE)

Expenditures Expenditures Dataset Summary Description The State Energy Data System (SEDS) is compiled by the U.S. Energy Information Administration's (EIA); it is a comprehensive database of energy statistics by state (and includes totals for the entire US). SEDS includes estimates of energy production, consumption, prices, and expenditures broken down by energy source and sector. Annual estimates are available from 1960 - 2009 for production and consumption estimates and from 1970 - 2009 for price and expenditure estimates. Source EIA Date Released June 30th, 2011 (3 years ago) Date Updated Unknown Keywords EIA Energy Consumption Energy Expenditures energy prices energy production SEDS State energy data States US Data text/csv icon Complete SEDS dataset as csv (may be too big for Excel) (csv, 40.6 MiB)


energy prices | OpenEI  

Open Energy Info (EERE)

prices prices Dataset Summary Description The State Energy Data System (SEDS) is compiled by the U.S. Energy Information Administration's (EIA); it is a comprehensive database of energy statistics by state (and includes totals for the entire US). SEDS includes estimates of energy production, consumption, prices, and expenditures broken down by energy source and sector. Annual estimates are available from 1960 - 2009 for production and consumption estimates and from 1970 - 2009 for price and expenditure estimates. Source EIA Date Released June 30th, 2011 (3 years ago) Date Updated Unknown Keywords EIA Energy Consumption Energy Expenditures energy prices energy production SEDS State energy data States US Data text/csv icon Complete SEDS dataset as csv (may be too big for Excel) (csv, 40.6 MiB)


U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Flint MI-City-Flint Location: City Flint MI American Recovery and Reinvestment Act: Proposed Action or Project Description: 1) Technical assistance for developing five energy efficiency programs, 2) technical expertise to review data, conduct studies and deliver recommendation about materials recovery and waste management program, 3) residential energy audits, 4) revolving loan fund for residential energy audits and energy efficiency and conservation retrofits to residential homes, 5) recycling loan fund for local manufacturers of recycled products, 6) develop request for proposal for software to track greenhouse gas emissions, 7) install, monitor, and report on energy saving building automation system Conditions: None Categorical Exclusion(s) Applied: A1, A9, A11, B5.1



Office of Legacy Management (LM)

..) ".. ..) ".. _,; ,' . ' , ,; Depar?.me.nt ,of.' Energy Washington; DC 20585 : . ' , - $$ o"\ ' ~' ,' DEC ?;$ ;y4,,, ~ ' .~ The Honorable John Kalwitz , 200 E. Wells Street Milwaukee, W~isconsin 53202, . . i :. Dear,Mayor 'Kalwitz: " . " Secretary of Energy Hazel' O'Leary has announceha new,approach 'to,openness in " the Department of Ene~rgy (DOE) and its communications with'the public. In -. support of~this initiative, we areipleased to forward the enclosed information related to the Milwaukee Ai.rport site in your jurisdiction that performed work, for DOE orits predecessor agencies. information; use, and retention. ., This information .is provided for your '/ ,' DOE's Formerly Utilized Sites Remedial:'Action~'Prog&is responsible for ,"'


PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012 Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 25. Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Company Name Plant Location Top Ten Manufacturers American Crystal Sugar Co MN, ND Archer Daniels Midland IA, IL, MN, ND, NE Carmeuse Lime Stone Inc AL, IL, IN, KY, MI, OH, PA, TN, VA, WI Cemex Inc AL, CA, CO, FL, GA, KY, OH, TN, TX Dakota Gasification Company ND Eastman Chemical Company TN Georgia-Pacific LLC AL, GA, OK, VA, WI Holcim (US) Inc AL, CO, MD, MO, MT, OK, SC, TX, UT NewPage Corporation MD, MI, WI U S Steel Corporation AL, IN, MI, MN Other Major Manufacturers Ash Grove Cement Co


Low energy proton storage ring with longitudinal magnetic  

E-Print Network (OSTI)

Proton energy 1,75 MeV Energy spread ±3,2 % = ±56 keV (2) Current (DC) 100 mkA Transverse size ±10 mm (2Low energy proton storage ring with longitudinal magnetic field and electron cooling M.I. Bryzgunov energy protons. In this particular case it is reaction for production of resonant gamma-quant (9.17 Me


U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-NOTTAWASEPPI HURON BAND OF THE POTAWATOMI MI-TRIBE-NOTTAWASEPPI HURON BAND OF THE POTAWATOMI Location: Tribe MI-TRIBE- NOTTAWASEPPI HURON BAND OF THE POTAWATOMI MI American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Funds for incremental costs associated with building three LEED certified homes on the Pine Creek Reservation and acquiring technical services for project management services for their construction (incremental costs are for purchasing materials for foundation walls, lumber [sealants and energy heel truss], additional framing required, geothermal heat pump, plumbing, insulation, landscaping, LEED supervision and general conditions) Conditions: None Categorical Exclusion(s) Applied: A9, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21


The Secretary of Energy  

Office of Legacy Management (LM)

The Secretary of Energy The Secretary of Energy 0, .: ., Washington, bC-20585 . . October 10, 19g7 ' , .-. , The Honorable W illiam S. Cohen Secretary ofDefense Washington, D.C. 203Oi .. . . &arMi.Se&etaQ: ~ , . ' . The Congress recently sent to the President for signature the Energy and Water . Development Appropriations Act,' 1998. Among other provisions, this bill would immediately transfer responsibility for' the Formerly~Utilized Sites Remedial Action Program (FUSRAP) from the Department of Energy to the United States Army Corps of Engineers. Assuming that this transfer becomes law, but without prejudging the President' s decision, the Department of Energy will work with the Corps to ensure a prompt and smooth transition, consistent with the wishes of the


U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Westland City MI-City-Westland City Location: City Westland City MI American Recovery and Reinvestment Act: Proposed Action or Project Description: 1) Development of an energy efficiency and conservation strategy (ongoing), 2) technical consultant services, 3) retrofit the HVAC and refrigeration systems at the Mike Modano Ice Arena with more energy efficient systems, 4) retrofit the HVAC system at the Bailey Recreation Center with more energy efficient motors, dampers, and frequency drives, 5) replacement of the boiler at the Police Station with a more energy efficient boiler, and 6) implementation of an incandescent light-bulb trade-in program for low- income households Conditions: None Categorical Exclusion(s) Applied: A9, A11, B2.5, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21


U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Rochester Hills MI-City-Rochester Hills Location: City Rochester Hills MI American Recovery and Reinvestment Act: Proposed Action or Project Description: 1) Purchase software and provide staff training to conduct energy audits; 2) energy efficiency retrofits including lighting upgrades, HVAC energy management systems, occupancy sensors, and other controls, roof insulation, and glass replacement; 3) promote residential energy efficiency through outreach and education--provide CFL; and 4) upgrade municipal buildings by installing storm windows, replacing boilers and HVAC units, and replacing/converting outside lighting to light emitting diodes. Conditions: Applicant must comply with Programmatic Agreement stipulations for buildings >50 years of age Categorical Exclusion(s) Applied: A9, B2.5, B5.1


Solar Energy | OpenEI  

Open Energy Info (EERE)

Energy Energy Dataset Summary Description Reduction of global greenhouse gas emission to arrest global warming requires minimizing the use of fossil fuels. To achieve this a large scale use of renewable energies must be made over the globe for production of electrical and thermal energy. Success of wind and solar energy projects require detailed and precise information on the resources. For most developing countries adequate information on the resources are not available. Source Renewable Energy Research Centre, University of Dhaka Date Released February 19th, 2007 (7 years ago) Date Updated Unknown Keywords Feasibility Study resource assessment Solar Energy SWERA Bangladesh Wind Energy Data application/pdf icon swera_bangladesh_fullreport.pdf (pdf, 2.7 MiB)


Wind Energy | OpenEI  

Open Energy Info (EERE)

Energy Energy Dataset Summary Description Reduction of global greenhouse gas emission to arrest global warming requires minimizing the use of fossil fuels. To achieve this a large scale use of renewable energies must be made over the globe for production of electrical and thermal energy. Success of wind and solar energy projects require detailed and precise information on the resources. For most developing countries adequate information on the resources are not available. Source Renewable Energy Research Centre, University of Dhaka Date Released February 19th, 2007 (7 years ago) Date Updated Unknown Keywords Feasibility Study resource assessment Solar Energy SWERA Bangladesh Wind Energy Data application/pdf icon swera_bangladesh_fullreport.pdf (pdf, 2.7 MiB)


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office


The Secretary of Energy  

Office of Legacy Management (LM)

The Secretary of Energy 0 ' -. . . _ Washington, bC 20585 . October 10, 1997 ' , :-. The FIonorable% William S. Cohen : Secretary ofijefense Washington, D.C. 203Oi -' 8 1 .' *- . A .' JharMiSecietary: , ' The Congress recently sent to the Fresident for signature the Energy and Water ' Development Appropriations Act, 1998. Among other provisions, this bill would immediately transfer responsibility for the Formerly Utilized Sites Remedial Action Program (FUSRAP) from the Department -of Energy to the United States Army Corps of Engineers.. Assuming that this transfer becomes law, but without prejudging the President' s decision, the Department of Energy will work with the Corps to ensure a prompt and smooth transition, consistent with the wishes of the


Office of Fossil Energy Hydrogen Turbine Program 2012 Portfolio  

NLE Websites -- All DOE Office Websites (Extended Search)

b a r r i e r c o a t i n g mi c r o s t r u c t u r e P a g e 2 3 1 Office of Fossil Energy Hydrogen Turbine Program 2012 Portfolio Turbines for Coal Based Systems that Capture...



co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-County-Macomb MI-County-Macomb Location: County Macomb MI American Recovery and Reinvestment Act: Proposed Action or Project Description: 1) Develop plan for retrofitting county buildings, provide reports/website to inform public about activities and energy savings, and conduct energy audits and 2) retrofit County Court Building and Robert A. Ver Kuilen Building with energy efficiency upgrades: conduct interior lighting retrofits (lights and sensors), installation of air-cooled air conditioning units, and installation of new reflective ceiling tiles. Conditions: None - applicant must comply with Programmatic Agreement Categorical Exclusion(s) Applied: A9, A11, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21


State energy data | OpenEI  

Open Energy Info (EERE)

0 0 Varnish cache server State energy data Dataset Summary Description The State Energy Data System (SEDS) is compiled by the U.S. Energy Information Administration's (EIA); it is a comprehensive database of energy statistics by state (and includes totals for the entire US). SEDS includes estimates of energy production, consumption, prices, and expenditures broken down by energy source and sector. Annual estimates are available from 1960 - 2009 for production and consumption estimates and from 1970 - 2009 for price and expenditure estimates. Source EIA Date Released June 30th, 2011 (3 years ago) Date Updated Unknown Keywords EIA Energy Consumption Energy Expenditures energy prices energy production SEDS State energy data States US Data text/csv icon Complete SEDS dataset as csv (may be too big for Excel) (csv, 40.6 MiB)


Taylor, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Taylor, Michigan: Energy Resources Taylor, Michigan: Energy Resources (Redirected from Taylor, MI) Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.240872°, -83.2696509° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.240872,"lon":-83.2696509,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Dearborn, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Dearborn, Michigan: Energy Resources Dearborn, Michigan: Energy Resources (Redirected from Dearborn, MI) Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.3222599°, -83.1763145° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.3222599,"lon":-83.1763145,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Detroit, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Michigan: Energy Resources Michigan: Energy Resources (Redirected from Detroit, MI) Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.331427°, -83.0457538° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.331427,"lon":-83.0457538,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Women @ Energy: Deborah Harris | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Harris Harris Women @ Energy: Deborah Harris March 11, 2013 - 5:33pm Addthis Women @ Energy: Deborah Harris Dr. Deborah Harris's current research interest is in the field of neutrino interactions and oscillations. Her work at Fermilab began with NuMI, the beamline that provides neutrinos to the MINERvA experiment, focusing on the beamline monitoring system. After working on both NOvA and MINOS oscillation experiments she realized that both of these experiments would need a better understanding of neutrino interactions in order to fully exploit the planned statistics of the expected data sets. Deborah is currently the co-spokesperson of MINERvA, an experiment whose goal is to measure neutrino interactions on a variety of different nuclei with unprecedented accuracy. Deborah received her A.B. in Physics from


Midland, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Midland, Michigan: Energy Resources Midland, Michigan: Energy Resources (Redirected from Midland, MI) Jump to: navigation, search Equivalent URI DBpedia Coordinates 43.6155825°, -84.2472116° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.6155825,"lon":-84.2472116,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Lansing, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Michigan: Energy Resources Michigan: Energy Resources (Redirected from Lansing, MI) Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.732535°, -84.5555347° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.732535,"lon":-84.5555347,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Energy Deputy Secretary Poneman Tours Minority-Owned Small Business in  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Deputy Secretary Poneman Tours Minority-Owned Small Business Energy Deputy Secretary Poneman Tours Minority-Owned Small Business in Detroit Energy Deputy Secretary Poneman Tours Minority-Owned Small Business in Detroit May 22, 2012 - 10:37am Addthis Deputy Secretary of Energy Daniel Poneman meets with owners and workers at Diversified Chemical Technologies, a small business in Detroit, MI. | Energy Department photo Deputy Secretary of Energy Daniel Poneman meets with owners and workers at Diversified Chemical Technologies, a small business in Detroit, MI. | Energy Department photo Bill Gibbons Deputy Press Secretary, Office of Public Affairs What does this mean for me? During National Small Business Week, Energy Department leaders are visiting small businesses across the country as a renewed promise to help their businesses grow, hire and succeed.



E-Print Network (OSTI)

be the first oil services company to use polyester mooring ropes for station keeping on a production platform severe in the GOM than elsewhere in the world, and the Minerals Management Service is requiring of the rope and stretch in response to loads. Test data indicates that the strain in the rope at failure


U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-West Bloomfield, Charter Township of MI-City-West Bloomfield, Charter Township of Location: City West Bloomfield, MI Charter Township of American Recovery and Reinvestment Act: Proposed Action or Project Description: 1) Perform energy audits on city buildings, and 2) energy efficiency retrofits on seven city buildings Conditions: None Categorical Exclusion(s) Applied: A9, B2.5, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21 This action would not: threaten a violation of applicable statutory, regulatory, or permit requirements for environment, safety, and health, including DOE and/or Executive Orders; require siting, construction, or major expansion of waste storage, disposal, recovery, or


NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

Green Canyon Block 955 Green Canyon Block 955 The gas hydrates JIP site selection team identified numerous potential targets in Green Canyon block 955. Three of these sites were drilled in Leg II. The wells are located in over 6,500 ft of water near the foot of the Sigsbee Escarpment. The locations are near a major embayment into the Escarpment (“Green Canyon”) which has served as a persistent focal point for sediment delivery into the deep Gulf of Mexico. Topographic map of the seafloor in the Green Canyon area. Topographic map of the seafloor in the Green Canyon area. Block 955 lies just seaward of the Sigsbee Escarpment in ~6,500 feet of water Green Canyon block 995 includes a prominent channel/levee complex that has transported and deposited large volumes of sandy sediment from the canyon to the deep Gulf of Mexico abyssal plain. The southwest corner of the block includes a recently developed structural high caused by deeper mobilization of salt. The crest of the structural high is cut by complex network of faults that can provide pathways for migrating fluids and gases. Geophysical data reviewed during assessment of the site revealed a complex array of geophysical responses near the inferred base of gas hydrate stability. Some of these responses are suggestive of free gas and some indicative of gas hydrate, but all are limited to depths that are near or below the inferred base of gas hydrate stability.


NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

A small isolated sand body within the target interval was penetrated by the 1995 ExxonMobil Rockefeller well (EB992 001). Log data from that well indicated a sand 130 ft...


NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

and geophysical evaluations of numerous potential sites, seeking evidence for active petroleum systems (gas sources and migration pathways) co-located with sand-prone...


NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

- Site Summaries - Site Summaries Site Summary – Walker Ridge Block 313 The drill sites at Walker Ridge 313 lies in ~6,500 ft of water within the western part of the “Terrebonne” mini-basin in the northern Gulf of Mexico. The primary target of drilling were a series of strong seismic anomaly that lay approximately 3,000 fbsf (feet below the seafloor). These anomalies exhibit strong “positive” amplitude response, indicating a horizon in the subsurface across which the speed of sound waves significantly increases. In addition, these same horizons, when traced deeper to the west, are observed to switch “polarity” to a strong negative response. Pre-drill interpretations determined that this collection of seismic responses was indicative of free gas accumulations (the negative anomalies) being trapped within porous and permeable sand horizons by significant accumulations of overlying gas hydrate within the sediment pore space. The primary goal of JIP drilling at this site was to test the validity of this interpretation through drilling and logging of wells at this site.


NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

high is cut by complex network of faults that can provide pathways for migrating fluids and gases. Geophysical data reviewed during assessment of the site revealed a...


NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

of fracture-filling gas hydrate. As drilling proceeding, the lack of use of heavy drilling fluids and slow penetration rates (both designed intentionally to maximize the...


NETL: National Methane Hydrates R&D Program- 2009 GOM JIP Expedition  

NLE Websites -- All DOE Office Websites (Extended Search)

soon as possible. Please note as you access these reports that the data and preliminary results represent work very much still in progress. Studies to calibrate pre-drill...


,"GOM Gross EST",,,"Louisiana Gross EST",,,"New Mexico Gross...  

U.S. Energy Information Administration (EIA) Indexed Site

Gross EST",,,"Wyoming Gross EST",,,"Other States Gross EST",,,"Lower 48 Gross EST",,,"Alaska Gross State Data",,,"U. S. Gross EST" ,"Initial Est","Revised Est",,"Initial...

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Montana's At-large congressional district: Energy Resources | Open Energy  

Open Energy Info (EERE)

Montana's At-large congressional district: Energy Resources Montana's At-large congressional district: Energy Resources Jump to: navigation, search Equivalent URI DBpedia This article is a stub. You can help OpenEI by expanding it. This page represents a congressional district in Montana. Registered Research Institutions in Montana's At-large congressional district Big Sky Carbon Sequestration Partnership Registered Policy Organizations in Montana's At-large congressional district National Center for Appropriate Technology Registered Energy Companies in Montana's At-large congressional district Bioroot Energy Business Excellence Consulting Confluence Communications Grasslands Renewable Energy LLC Montana Sustainable Building Systems REC Silicon formerly ASiMI Rivertop Renewables Saddlehorn Sage Resources Semitool Inc SolarMission Technologies Inc


Recovery Act | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

May 14, 2010 May 14, 2010 Club's Chairman Leading by Example Why the Sierra Club Oregon Chairman is helping his organization live up to its legacy. May 14, 2010 Cincinnati Non-profits Getting Help Saving Energy How one church is saving money and saving energy. May 14, 2010 Charlevoix, MI is using Recovery Act funds for energy upgrades | Photo courtesy Charlevoix, Michigan, City Manager | Michigan Town Committed to Sustainable Future Charlevoix, Mich. residents are taking steps to become a more environmentally-conscious community, and a $50,000 Energy Efficiency and Conservation Block Grant will help that cause. The funding will be used to launch projects aimed at energy efficiency and sustainability, such as retrofitting the city's fire and emergency vehicles with new,


Heritage Garden | Open Energy Information  

Open Energy Info (EERE)

Garden Garden Jump to: navigation, search Name Heritage Garden Facility Heritage Garden Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Heritage Sustainable Energy Developer Heritage Sustainable Energy Energy Purchaser Consumers Energy / Detroit Edison Location Garden MI Coordinates 45.776334°, -86.5527241° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.776334,"lon":-86.5527241,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Lake Winds | Open Energy Information  

Open Energy Info (EERE)

Winds Winds Jump to: navigation, search Name Lake Winds Facility Lake Winds Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Consumers Energy Developer Consumers Energy Energy Purchaser Consumers Energy Location Ludington MI Coordinates 43.83972728°, -86.38154984° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.83972728,"lon":-86.38154984,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


1996 Department of Energy pre-freshman enrichment program at GMI Engineering and Management Institute, Flint, MI  

SciTech Connect

This document reports on a summer program to encourage students to pursue scientific or engineering professions. The topics of the report include a description of the recruitment program, selection criteria for participants, workshops, nine follow up activities, research projects and student`s presentation, and field trips. Course descriptions and schedule are included as appendices.



Gratiot | Open Energy Information  

Open Energy Info (EERE)

Gratiot Gratiot Jump to: navigation, search Name Gratiot Facility Gratiot Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Detroit Edison Developer Invenergy Energy Purchaser Detroit Edison Location Breckenridge MI Coordinates 43.39354149°, -84.50833797° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.39354149,"lon":-84.50833797,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Michigan Town Committed to Sustainable Future | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Michigan Town Committed to Sustainable Future Michigan Town Committed to Sustainable Future Michigan Town Committed to Sustainable Future May 14, 2010 - 10:04am Addthis Charlevoix, MI is using Recovery Act funds for energy upgrades | Photo courtesy Charlevoix, Michigan, City Manager | Charlevoix, MI is using Recovery Act funds for energy upgrades | Photo courtesy Charlevoix, Michigan, City Manager | Stephen Graff Former Writer & editor for Energy Empowers, EERE Charlevoix, Mich., sits on a stretch of land between Lake Michigan and Lake Charlevoix along the Pine River. It's a scenic atmosphere that both summer vacationers and local residents have worked to protect, city manager Rob Straebel says. "The community here has been proactive in creating a sustainable future," he says. Citizens are taking steps to become a more environmentally-conscious


Michigan Town Committed to Sustainable Future | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Michigan Town Committed to Sustainable Future Michigan Town Committed to Sustainable Future Michigan Town Committed to Sustainable Future May 14, 2010 - 10:04am Addthis Charlevoix, MI is using Recovery Act funds for energy upgrades | Photo courtesy Charlevoix, Michigan, City Manager | Charlevoix, MI is using Recovery Act funds for energy upgrades | Photo courtesy Charlevoix, Michigan, City Manager | Stephen Graff Former Writer & editor for Energy Empowers, EERE Charlevoix, Mich., sits on a stretch of land between Lake Michigan and Lake Charlevoix along the Pine River. It's a scenic atmosphere that both summer vacationers and local residents have worked to protect, city manager Rob Straebel says. "The community here has been proactive in creating a sustainable future," he says. Citizens are taking steps to become a more environmentally-conscious



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

I'IENT OF ENERGY I'IENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERl'vIINATION RECIPIENT:MI Department of Energy, labor & Economic Growth PROJECT TITLE: Green Chemistry - CEAM Phase 3 - Working Bug LLC Page 1 of2 STATE: MI Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-OOOOO52 DE-EEOOOO166 GFO..oooo166-033 GOO Based on my review oftbe informalion concerning tbe proposed action, ali NEPA Compliance Officer (authorized under DOE Order 4S1.IA).1 bave made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy. demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

eUJI eUJI us. DEP.-\RThIENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DITFRMINAnON RECiPIENT:MI Department of Energy, Labor & Economic Growth PROJECT TITLE: SEP ARRA - Michigan Slate University. BioEnergy Page 1 of2 STATE: MI Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-OOOOO52 DE-EE0000166 GF0-0000166-039 GOO Based on my review of the information concerning the proposed action, 85 NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: B5.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency thai do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U) , U) , u.s. DEPARTUENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIPIENT:MI Department of Energy, Labor & Economic Growth PROJECT TITLE: Clean Energy Advanced Manufacturing Phase 2 * URV USA Page 1 of2 STATE: MI Funding Opportunity Announcement Nurnbt'r Proc:urtmtnt Instrument Number NEPA Control NumMT CID Number DE-FOA-0000052 DE·EEOOOO166 GFO-09-148-019 GOO Ba~d on my ~yicw of the information concuning tbe proposed action, as NEPA Compliance Omcer (authorized under DOE Order 451.IA), I have made tbe (ollowing determination: ex, EA, [IS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical


Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



User:NCSCJustin | Open Energy Information  

Open Energy Info (EERE)

NCSCJustin NCSCJustin Jump to: navigation, search Name Justin Barnes Edits 923 Justin Barnes is a Policy Analyst at the North Carolina Solar Center (NCSC), where he works on the Database of State Incentives for Renewables and Efficiency (DSIRE) and leads the NCSC's efforts under the Solar America Communities Outreach Partnership. Justin has a B.S. in Geography from the University of Oklahoma and an M.S. in Environmental Policy from Michigan Technological University in Houghton, MI. Justin's past research has focused on local opposition to wind energy facilities and barriers to the commercialization of lignocellulosic ethanol. Upon completing his graduate education, he worked briefly for Environment Michigan and Clean Water Action in Ann Arbor, MI. He joined the NCSC in September 2007.


ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George


Automakers' Short-Run Responses to Changing Gasoline Prices and the Implications for Energy Policy  

E-Print Network (OSTI)

Automakers' Short-Run Responses to Changing Gasoline Prices and the Implications for Energy Policy Policy, 735 S. State St. #5224, Ann Arbor, MI 48109. Miller: Economic Analysis Group, U.S. Department of intervention, the market is likely to produce efficient outcomes.1 We examine the empirical relationship

Edwards, Paul N.


Natural Gas - U.S. Energy Information Administration (EIA) - U.S. Energy  

Gasoline and Diesel Fuel Update (EIA)

5, 2012 | Release Date: September 6, 5, 2012 | Release Date: September 6, 2012 | Next Release: September 13, 2012 Previous Issues Week: 12/22/2013 (View Archive) JUMP TO: In The News | Overview | Prices/Demand/Supply | Storage In the News: Shut-In Natural Gas Production from Isaac Represents Decreasing Share of Historical U.S. Production Peak shut-in natural gas production in the Federal Offshore Gulf of Mexico (GOM) during Hurricane Isaac was about 3.2 billion cubic feet (Bcf) per day. Isaac was sufficiently powerful to force evacuation of 85% of production platforms and shut-in 73% of GOM natural gas production (at peak). However, Isaac's impact on overall U.S. natural gas production was relatively modest, representing only 4.7% of average daily natural gas production in 2012. While the shut-ins associated with Isaac represented a significant portion


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

81 - 11890 of 26,764 results. 81 - 11890 of 26,764 results. Article Energy Department Advances Research on Methane Hydrates - the World's Largest Untapped Fossil Energy Resource Projects to research the nature and occurrence of deepwater and arctic gas hydrates and its potential for dramatically expanding U.S. energy supplies http://energy.gov/node/387289 Rebate Renewable Energy Standard '''''Note: The Michigan Public Service Commission (MPSC) created a temporary order ([http://www.dleg.state.mi.us/mpsc/orders/electric/2008/u-15800_12-04-2008... U-15800]) in December of 2008 to... http://energy.gov/savings/renewable-energy-standard-1 Download FIA-13-0040- In the Matter of DeShonne E. Massey Sr. On July 17, 2013, OHA issued a decision denying an appeal (Appeal) from a FOIA determination issued by the Office of Information Resources (OIR).


Category:Mason, IA | Open Energy Information  

Open Energy Info (EERE)

IA IA Jump to: navigation, search Go Back to PV Economics By Location Media in category "Mason, IA" The following 16 files are in this category, out of 16 total. SVQuickServiceRestaurant Mason IA MidAmerican Energy Co (Iowa).png SVQuickServiceRestaura... 64 KB SVFullServiceRestaurant Mason IA MidAmerican Energy Co (Iowa).png SVFullServiceRestauran... 64 KB SVHospital Mason IA MidAmerican Energy Co (Iowa).png SVHospital Mason IA Mi... 73 KB SVLargeHotel Mason IA MidAmerican Energy Co (Iowa).png SVLargeHotel Mason IA ... 72 KB SVLargeOffice Mason IA MidAmerican Energy Co (Iowa).png SVLargeOffice Mason IA... 73 KB SVMediumOffice Mason IA MidAmerican Energy Co (Iowa).png SVMediumOffice Mason I... 69 KB SVMidriseApartment Mason IA MidAmerican Energy Co (Iowa).png


U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Canton, Charter Township of MI-City-Canton, Charter Township of Location: City Canton, Charter MI Township of American Recovery and Reinvestment Act: Proposed Action or Project Description: 1) Fund a recycling education and awareness program to promote new single stream recycling option and increase participation, 2) streetlight retrofit/replacement to LED, 3) athletic field energy efficiency lighting, and 4) replace area/roadway lighting with LED fixtures and poles. Conditions: None Categorical Exclusion(s) Applied: A9, B1.32, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21 This action would not: threaten a violation of applicable statutory, regulatory, or permit requirements for environment, safety, and health,


U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-County-Jackson MI-County-Jackson Location: County Jackson MI American Recovery and Reinvestment Act: Proposed Action or Project Description: 1) Retrofit windows at identified facility (Jackson County Tower Building), 2) lighting controls at identified facility, 3) steam trap replacement at county facilities, and 4) conduct energy analysis study on county building. Conditions: None - SHPO concurrence received 5/12/2010 Categorical Exclusion(s) Applied: A9, A11, B2.5, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21 This action would not: threaten a violation of applicable statutory, regulatory, or permit requirements for environment, safety, and health, including DOE and/or Executive Orders; require siting, construction, or major expansion of waste storage, disposal, recovery, or

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U.S. Department of Energy U.S. Department of Energy Categorical Exclusion Determination Form Program or Field Office: Energy Efficiency and Conservation Block Grant Program Project Title MI-City-Macomb, Township of Location: City Macomb, Township MI of American Recovery and Reinvestment Act: Proposed Action or Project Description: 1) Develop energy efficiency and conservation plan, 2) hire consultant as energy manager, 3) upgrade/retrofit lighting in ten municipal buildings, and 4) heating, ventilating, and air conditioning retrofits in three municipal buildings. Conditions: In accordance with Programmatic Agreement (Fire Station #1 >50 yrs of age) Categorical Exclusion(s) Applied: A1, A9, A11, B2.5, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DETERM DETERM INATION RECIPIENT:MI Department of Energy, Labor & Economic Growth PRQJECf TITLE: SEP ARRA - The Power Alternative - BioEnergy Page 1 of2 STATE: MI Funding Opportunity Announ~ement Number Procurement Instr ument Number NEPA Control Number em Number DE-FOA-OOOOO52 DE-EEOOOO166 GFQ-OOOO166-038 GOO Based on my Rview of the information ~onterning the proposed action, as NEPA Compliance Offh:er (authorized under DOE Order 451.1A), I have made the (ollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Adions to ronserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor ooncentrations of potentially harmful substances. These actions may involve financial and technical


Microsoft Word - figure_03.doc  

Gasoline and Diesel Fuel Update (EIA)

Cubic Feet) None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over GOM Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895...


Microsoft Word - figure_03.doc  

Gasoline and Diesel Fuel Update (EIA)

Cubic Feet) None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over GOM Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895A...


Microsoft Word - figure_03.doc  

Gasoline and Diesel Fuel Update (EIA)

1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over GOM Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Annual Quantity...


Microsoft Word - figure_03.doc  

Annual Energy Outlook 2012 (EIA)

1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over GOM Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895A, "Annual Quantity...


Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Harvest II | Open Energy Information  

Open Energy Info (EERE)

Harvest II Harvest II Facility Harvest II Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Exelon Wind Developer Exelon Wind Energy Purchaser Consumers Energy Location Pigeon MI Coordinates 43.83861292°, -83.2171011° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.83861292,"lon":-83.2171011,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5001 - 25010 of 28,905 results. 5001 - 25010 of 28,905 results. Article U.S. Department of Energy Selects Michigan State University To Design and Establish Facility for Rare Isotope Beams WASHINGTON, DC - The U.S. Department of Energy (DOE) announced today that Michigan State University (MSU) in East Lansing, MI has been selected to design and establish the Facility for Rare Isotope... http://energy.gov/articles/us-department-energy-selects-michigan-state-university-design-and-establish-facility-rare Article U.S. And Russia Complete Nuclear Security Upgrades Under Bratislava Initiative WASHINGTON, DC -The U.S. Department of Energy today delivered the Bratislava Nuclear Security report to the White House, which detailed the status of work agreed to by Presidents Bush and Putin in... http://energy.gov/articles/us-and-russia-complete-nuclear-security-upgrades-under-bratislava-initiative


Related Links | Building Energy Codes Program  

NLE Websites -- All DOE Office Websites (Extended Search)

Related Links Related Links Regional Energy Efficiency Organizations MEEA NEEP NEEA SEEA SWEEP SPEER Midwest Energy Efficiency Alliance (MEEA) IL, IN, IA, KS, KY, ND, NE, MI, MN, MO, OH, SD, WI The Midwest Energy Efficiency Alliance (MEEA) is a collaborative network advancing energy efficiency in the Midwest to support sustainable economic development and environmental preservation. MEEA raises awareness, facilitates energy efficiency programs and strengthens policy across the nine-state region. MEEA brings together a respected network of members, partners, board and staff, and inspires others to create new technologies, new products and new ways of thinking when it comes to energy efficiency. Codes Contact Isaac Elnecave Senior Policy Manager ielnecave@mwalliance.org phone: (312)784-7253


DTE | Open Energy Information  

Open Energy Info (EERE)

DTE DTE Jump to: navigation, search Name DTE Energy Place Detroit, MI Zip 48226 Website http://www.dte.com Coordinates 42.328245°, -83.0495622° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.328245,"lon":-83.0495622,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


EA-1708: Finding of No Significant Impact | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8: Finding of No Significant Impact 8: Finding of No Significant Impact EA-1708: Finding of No Significant Impact Dow Kokam Mi, LLC, Manufacture Advanced Lithium POlymer Batteries for Hybrid and Electric Vehicles At Midland, Michigan U.S. Department of Energy (DOE) prepared this Environmental Assessment (EA) to evaluate the potential environmental impacts of providing two types of financial assistance to Dow Kokam MI, LLC to construct and operate the Midland Battery Park for manufacturing of advanced lithium polymer batteries for hybrid and electric vehicles: (1) a grant under Funding Opportunity Announcement DE-FOA 0000026, Recovery Act - Electric Drive Vehicle Battery and Component Manufacturing Initiative and (2) a loan pursuant to Section 136 of the Energy Independence and Security Act of 2007


U.S. Department of Energy Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

-1594) Eaton Corporation - -1594) Eaton Corporation - Predictive Battery Management for Commercial Hybrid Vehicles Program or Field Office: Advanced Research Projects Agency - Energy LocationCs) (City/County/State): Southfield, MI; Eden Prairie, MN; Golden, CO Proposed A~tion Description: Funding will support efforts to develop a predictive battery management system for use in commercial hybrid vehicles. Proposed work will consist of: (1) development and validation of algorithms and software and (2) design, fabrication, and testing of two power management system prototypes. Analytical work will take place at all three project facilities, including Eaton Corporation's (Eaton) office and laboratory facilities in Southfield, MI and Ede'n Prairie, MN and the National Renewable Energy Laboratory's (NREL) facilities in Golden, CO. Design and fabrication of the two power


EA-1708: Final Environmental Assessment | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

708: Final Environmental Assessment 708: Final Environmental Assessment EA-1708: Final Environmental Assessment Financial Assistance to Dow Kokam Mi, LLC To Manufacture Advanced Lithium Polymer Batteries for Hybrid and Electric Vehicles At Midland, Michigan U.S. Department of Energy (DOE) prepared this Environmental Assessment (EA) to evaluate the potential environmental impacts of providing two types of financial assistance to Dow Kokam MI, LLC to construct and operate the Midland Battery Park for manufacturing of advanced lithium polymer batteries for hybrid and electric vehicles: (1) a grant under Funding Opportunity Announcement DE-FOA 0000026, Recovery Act - Electric Drive Vehicle Battery and Component Manufacturing Initiative and (2) a loan pursuant to Section 136 of the Energy Independence and Security Act of 2007


Energy Information Administration/Oil and Gas Field Code ...  

U.S. Energy Information Administration (EIA)

mississippi union 01-26n-9w grand traverse mi 055 003557 n 1969 union 02-26n-9w grand traverse mi 055 006252 n 1973 union 03-26n-9w grand traverse mi ...


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013


Energy Basics: Tidal Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Energy Basics Renewable Energy Printable Version Share this resource Biomass Geothermal Hydrogen Hydropower Ocean Ocean Thermal Energy Conversion Tidal Energy Wave Energy...

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Energy Basics: Wave Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Energy Basics Renewable Energy Printable Version Share this resource Biomass Geothermal Hydrogen Hydropower Ocean Ocean Thermal Energy Conversion Tidal Energy Wave Energy...


Energy guides | ENERGY STAR  

NLE Websites -- All DOE Office Websites (Extended Search)

track, and benchmark Improve energy performance ENERGY STAR industrial partnership Energy guides Energy efficiency and air regulation Plant energy auditing Industrial...


fcmlbig - Energy Information Administration  

U.S. Energy Information Administration (EIA)

256821 TX Freeman-Martin 256852 MI Freeman-Redding 256914 WV Freemansburg 256945 IL Freemanspur 256976 KS Freemeyer 257007 CA Fremont Landing 257038 OK Freeny


Michigan | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Assistance to Dow Kokam Mi, LLC To Manufacture Advanced Lithium Polymer Batteries for Hybrid and Electric Vehicles At Midland, Michigan March 1, 2010 EA-1721: Final...


Pulte | Open Energy Information  

Open Energy Info (EERE)

MI Information About Partnership with NREL Partnership with NREL Yes Partnership Type Test & Evaluation Partner Partnering Center within NREL Electricity Resources & Building...


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

01 - 18710 of 28,905 results. 01 - 18710 of 28,905 results. Rebate Energy Optimization Savings Standard Note: The Michigan Public Service Commission (MPSC) created a temporary order ([http://www.dleg.state.mi.us/mpsc/orders/electric/2008/u-15800_12-04-2008... U-15800]) in December of 2008 to address... http://energy.gov/savings/energy-optimization-savings-standard Download Peer Review 2009 Subject: Department of Energy, Peer Review for the Fiscal Year Ending September 30, 2009 Reviewer: Social Security Administration, Office of the Inspector General http://energy.gov/ig/downloads/peer-review-2009 Page State Government Websites With Indian Tribe Information This list was compiled by the federal government's Interagency Working Group on Indian Affairs (IWGIA) as an aid to federal agency consultation


Stoney Corners III | Open Energy Information  

Open Energy Info (EERE)

Stoney Corners III Stoney Corners III Facility Stoney Corners III Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Heritage Sustainable Energy Developer Heritage Sustainable Energy Energy Purchaser Consumers Energy Location McBain MI Coordinates 44.209°, -85.275° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.209,"lon":-85.275,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Stoney Corners Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Wind Farm Wind Farm Jump to: navigation, search Name Stoney Corners Wind Farm Facility Stoney Corners Wind Farm Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Heritage Sustainable Energy Developer Heritage Sustainable Energy Energy Purchaser DTE Energy Location Missaukee County MI Coordinates 44.208269°, -85.273706° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.208269,"lon":-85.273706,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Auburn Hills, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Auburn Hills, Michigan: Energy Resources Auburn Hills, Michigan: Energy Resources (Redirected from Auburn Hills, MI) Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.6875323°, -83.2341028° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.6875323,"lon":-83.2341028,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Rochester Hills, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Hills, Michigan: Energy Resources Hills, Michigan: Energy Resources (Redirected from Rochester Hills, MI) Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.6583661°, -83.1499322° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.6583661,"lon":-83.1499322,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Mozambique-Accrediation of NIE | Open Energy Information  

Open Energy Info (EERE)

Mozambique-Accrediation of NIE Mozambique-Accrediation of NIE Jump to: navigation, search Name Mozambique accreditation of NIE Agency/Company /Organization Climate and Development Knowledge Network (CDKN), United Kingdom Department for International Development Partner FUNAB - Environment Fund under Environment Department Sector Climate Focus Area Greenhouse Gas Topics Adaptation, Finance, Low emission development planning Country Mozambique Eastern Africa References Climate and Development Knowledge Network[1] CDKN is providing support to the Government of Mozambique (GoM) to work towards the accreditation of the Fundo do Ambiente (FUNAB) as an NIE. If successful this will enable the GoM to access additional international climate finance such as the Adaptation Fund (AF) and the emerging Green


Mozambique-Accrediation of NIE | Open Energy Information  

Open Energy Info (EERE)

Mozambique-Accrediation of NIE Mozambique-Accrediation of NIE (Redirected from Mozambique accrediation of NIE) Jump to: navigation, search Name Mozambique accreditation of NIE Agency/Company /Organization Climate and Development Knowledge Network (CDKN), United Kingdom Department for International Development Partner FUNAB - Environment Fund under Environment Department Sector Climate Focus Area Greenhouse Gas Topics Adaptation, Finance, Low emission development planning Country Mozambique Eastern Africa References Climate and Development Knowledge Network[1] CDKN is providing support to the Government of Mozambique (GoM) to work towards the accreditation of the Fundo do Ambiente (FUNAB) as an NIE. If successful this will enable the GoM to access additional international climate finance such as the Adaptation Fund (AF) and the emerging Green


Gratiot County | Open Energy Information  

Open Energy Info (EERE)

Gratiot County Gratiot County Jump to: navigation, search Name Gratiot County Facility Gratiot County Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Ivenergy Developer Ivenergy Energy Purchaser Detroit Edison Location Breckenridge MI Coordinates 43.38009947°, -84.4896698° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.38009947,"lon":-84.4896698,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:


EcoCAR2 Teams Start their Virtual Engines | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EcoCAR2 Teams Start their Virtual Engines EcoCAR2 Teams Start their Virtual Engines EcoCAR2 Teams Start their Virtual Engines May 17, 2012 - 4:11pm Addthis A North Carolina State University student works on an EcoCAR vehicle at the Year 3 finals last year in Milford, MI. | Energy Department photo. A North Carolina State University student works on an EcoCAR vehicle at the Year 3 finals last year in Milford, MI. | Energy Department photo. Shannon Brescher Shea Communications Manager, Clean Cities Program What are the key facts? First-year finals of the EcoCar2 competition begin Friday, May 18 in Los Angeles, CA. As the auto industry introduces more alternative fuel and energy efficient vehicles to dealerships across the U.S., teams of university students are also making sure consumers have more choices on the showroom floor.


REN Electron srl formerly FIMI Group srl | Open Energy Information  

Open Energy Info (EERE)

Electron srl formerly FIMI Group srl Electron srl formerly FIMI Group srl Jump to: navigation, search Name REN Electron srl (formerly FIMI Group srl) Place Carugate (MI), Italy Zip 20061 Sector Solar Product Italian solar installers. References REN Electron srl (formerly FIMI Group srl)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. REN Electron srl (formerly FIMI Group srl) is a company located in Carugate (MI), Italy . References ↑ "[ REN Electron srl (formerly FIMI Group srl)]" Retrieved from "http://en.openei.org/w/index.php?title=REN_Electron_srl_formerly_FIMI_Group_srl&oldid=350281" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes


EIS-0389: Final Environmental Impact Statement | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Final Environmental Impact Statement Final Environmental Impact Statement EIS-0389: Final Environmental Impact Statement Trinity Public Utilities District Direct Interconnection Project The Western Area Power Administration (Western), part of the U.S. Department of Energy (DOE), prepared an environmental impact statement (EIS) on the construction and operation of proposed power transmission facilities in Trinity County, California. The U.S. Forest Service (USFS), the Bureau of Land Management (BLM), and the Bureau of Reclamation (Reclamation) participated in the preparation of the EIS, which addresses the proposed removal of about 5.3 mi of 12-kilovolt (kV) distribution line and the construction and operation of about 16 mi of new 60-kV transmission line, a tap structure and associated equipment, and a new switchyard. The


Harvest Wind Farm II | Open Energy Information  

Open Energy Info (EERE)

II II Facility Harvest Wind Farm Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner John Deere Wind Energy Developer John Deere Wind Energy Energy Purchaser Wolverine Power Cooperative Location Oliver and Chandler Townships MI Coordinates 43.829789°, -83.222872° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.829789,"lon":-83.222872,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Tuscola Bay Wind | Open Energy Information  

Open Energy Info (EERE)

Tuscola Bay Wind Tuscola Bay Wind Jump to: navigation, search Name Tuscola Bay Wind Facility Tuscola Bay Wind Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner NextEra Energy Resources Developer NextEra Energy Resources Energy Purchaser Detroit Edison Location Fairgrove MI Coordinates 43.52596°, -83.653106° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.52596,"lon":-83.653106,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Stoney Corners II (REpower) | Open Energy Information  

Open Energy Info (EERE)

REpower) REpower) Jump to: navigation, search Name Stoney Corners II (REpower) Facility Stoney Corners II (REpower) Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Heritage Sustainable Energy Developer Heritage Sustainable Energy Energy Purchaser Traverse City Light & Power/Detroit Edison Location McBain MI Coordinates 44.209°, -85.275° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.209,"lon":-85.275,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

11 - 17820 of 28,560 results. 11 - 17820 of 28,560 results. Rebate Interconnection Standards In December 2005, the Colorado Public Utilities Commission (PUC) adopted standards for net metering and interconnection, as required by Amendment 37, a renewable-energy ballot initiative approved... http://energy.gov/savings/interconnection-standards-0 Download COMPILATION OF MEMORANDA OF EXECUTIVE SECRETARIAT COMMITMENTS SYSTEM (ESECS) http://energy.gov/management/downloads/compilation-memoranda-executive-secretariat-commitments-system-esecs Rebate Nonrefundable Business Activity Tax Credit '''''Note: [http://www.legislature.mi.gov/documents/2011-2012/publicact/pdf/2011-PA-... Public Act 38] of 2011 repealed the Michigan Business Tax (MBT) and implemented the Corporate Income Tax (CIT... http://energy.gov/savings/nonrefundable-business-activity-tax-credit



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CENT~R CENT~R NEPA DETERlV.IINATION RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT SEP Passive Solar Hoophouse Implementation TITLE: Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE-0000166 GFO-0000166-036 GOO Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical


Nepal: Applications of Renewable Energy Technologies | OpenEI  

Open Energy Info (EERE)

Nepal: Applications of Renewable Energy Technologies Nepal: Applications of Renewable Energy Technologies Dataset Summary Description (Abstract): Wind, biomass, bio-gas, photovoltaic and small hydro renewable energy technologies in Nepal (Purpose): SWERA Documentation Source Alternate Energy Promotion Centre Date Released December 02nd, 2003 (10 years ago) Date Updated October 20th, 2007 (7 years ago) Keywords biomass documentation GEF Nepal renewable energy small hydro solar SWERA UNEP wind Data application/pdf icon Download Document (pdf, 1.6 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period 2002 License License Other or unspecified, see optional comment below Comment Please cite publication as follows: AEPC,2003. Nepal: Applications of Renewable Energy Technologies, Alternate Energy Promotion Centre, Nepal. GEF UNEP SWERA. Available from http://swera.unep.net on 2 December 2003.


DOE Recognizes Midwest Industrial Efficiency Leaders | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Midwest Industrial Efficiency Leaders Midwest Industrial Efficiency Leaders DOE Recognizes Midwest Industrial Efficiency Leaders September 10, 2009 - 12:00am Addthis DETROIT, MI - The U.S. Department of Energy and Michigan Governor Jennifer M. Granholm joined with over 300 industry, state, and federal leaders to recognize industrial efficiency leaders and plot a course to accelerate industrial energy efficiency in the Midwest. As part of the Midwest Industrial Energy Efficiency Exchange that began last night and continued today, Governor Granholm and DOE announced 11 Save Energy Now awards recognizing industry leaders for their exemplary energy saving accomplishments. Attendees at the Energy Efficiency Exchange also had an opportunity to learn about new energy saving technologies and ways to



Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:


The role of geothermal energy in the world  

SciTech Connect

Geothermal energy, in the broadest sense, is the natural heat of the earth. Immense amounts of thermal energy are generated and stored in the earth`s core, mantle, and crust. The heat is transferred from the interior towards the surface mostly by conduction, and this conductive heat flow makes temperatures rise with increasing depth in the crust on average 25-30{degrees}C/km. This is called the geothermal gradient. The recoverable thermal energy theoretically suitable for direct applications has been estimated at 2.9 {times} 10{sup 24} Joules, which is about 10,000 times the present annual world consumption of primary energy without regard to grade (Armstead, 1983). Most of the earth`s heat is, however, far too deeply buried to be tapped by man, even under the most optimistic assumptions of technological development. Geothermal energy has at present a considerable economic potential only in areas where thermal water or steam is concentrated at depths less than 3 km(1.9 mi) in restricted volumes analogous to oil in commercial oil reservoirs. The drilling technology is similar for geothermal fluid as for oil. But as the energy content of a barrel of oil is much greater than an equivalent amount of hot water, the economic requirements for permeability of the formations and the productivity of the geothermal wells are much higher than for oil wells. Geothermal production wells are commonly 2 km (1.2 mi) deep, but rarely much over 3 km (1.9 mi) at present.

Fridleifsson, I.B. [United Nations Univ. Geothermal Training Programme, Reykjavik (Iceland)



energy imports | OpenEI  

Open Energy Info (EERE)

imports imports Dataset Summary Description No description given. Source World Bank Date Released Unknown Date Updated Unknown Keywords coal energy imports energy production energy use fossil fuels Fuel global Hydroelectric international nuclear oil renewables statistical statistics world bank Data application/zip icon Data in XML Format (zip, 1 MiB) application/zip icon Data in Excel Format (zip, 1.3 MiB) Quality Metrics Level of Review Peer Reviewed Comment Temporal and Spatial Coverage Frequency Time Period 1970 - 2007 License License Other or unspecified, see optional comment below Comment Summary of Usage Terms ---------------------- You are free to copy, distribute, adapt, display or include the data in other products for commercial and noncommercial purposes at no cost subject to certain limitations summarized below. You must include attribution for the data you use in the manner indicated in the metadata included with the data. You must not claim or imply that The World Bank endorses your use of the data by or use The World Bank's logo(s) or trademark(s) in conjunction with such use. Other parties may have ownership interests in some of the materials contained on The World Bank Web site. For example, we maintain a list of some specific data within the Datasets that you may not redistribute or reuse without first contacting the original content provider, as well as information regarding how to contact the original content provider. Before incorporating any data in other products, please check the list: Terms of use: Restricted Data. The World Bank makes no warranties with respect to the data and you agree The World Bank shall not be liable to you in connection with your use of the data. Links ----- Summary of Terms: http://data.worldbank.org/summary-terms-of-use Detailed Usage Terms: http://www.worldbank.org/terms-datasets


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan



Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

01 - 12710 of 26,764 results. 01 - 12710 of 26,764 results. Download EA 1714: Final Environmental Assessment Toda America, Incorporated Electric Drive Vehicle Battery and Component Manufacturing Initiative Project Battle Creek, MI http://energy.gov/nepa/downloads/ea-1714-final-environmental-assessment Download DOE-STD-1195-2011 Design of Safety Significant Safety Instrumented Systems Used at DOE Non-Reactor Nuclear Facilities This standard provides requirements and guidance for the design, procurement, installation, testing, maintenance, operation, and quality assurance of safety instrumented systems (SIS) that may be used at Department of Energy (DOE) nonreactor nuclear facilities for safety significant (SS) functions. http://energy.gov/hss/downloads/doe-std-1195-2011 Download DOE-STD-1193-2010


Beebe Community Wind | Open Energy Information  

Open Energy Info (EERE)

Beebe Community Wind Beebe Community Wind Jump to: navigation, search Name Beebe Community Wind Facility Beebe Community Wind Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Exelon Wind Developer Nordex Energy Purchaser Consumers Energy Location Ithaca MI Coordinates 43.3061272°, -84.5722881° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.3061272,"lon":-84.5722881,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Mackinaw City Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Mackinaw City Wind Farm Mackinaw City Wind Farm Jump to: navigation, search Name Mackinaw City Wind Farm Facility Mackinaw City Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Mackinaw Power Developer Mackinaw Power Energy Purchaser Consumers Energy Location Mackinaw City MI Coordinates 45.738212°, -84.738024° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":45.738212,"lon":-84.738024,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


National Renewable Energy Report for SWERA: Ghana | OpenEI  

Open Energy Info (EERE)

Report for SWERA: Ghana Report for SWERA: Ghana Dataset Summary Description (Abstract): The National Renewable Energy Report describes the energy situation in Ghana and identifies solar and wind energy opportunities. (Purpose): To promote solar and wind energy investments. Source Ghana Energy Commission Date Released September 02nd, 2005 (9 years ago) Date Updated November 07th, 2007 (7 years ago) Keywords documentation Ghana renewable energy solar SWERA UNEP wind Data application/msword icon Download Document (doc, 1.2 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period 2005 License License Open Data Commons Public Domain Dedication and Licence (PDDL) Comment Rate this dataset Usefulness of the metadata Average vote Your vote Usefulness of the dataset


Obama Administration Announces More Than $32 Million for Energy Projects in  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

32 Million for Energy 32 Million for Energy Projects in Michigan Obama Administration Announces More Than $32 Million for Energy Projects in Michigan June 22, 2009 - 12:00am Addthis Battle Creek, MI - U.S. Department of Energy Secretary Steven Chu today announced more than $32 million in Recovery Act funding to support energy efficiency and renewable energy projects in Michigan. Under DOE's State Energy Program, states have proposed statewide plans that prioritize energy savings, create or retain jobs, increase the use of renewable energy, and reduce greenhouse gas emissions. This initiative is part of the Obama Administration's national strategy to support job growth, while making a historic down payment on clean energy. "This funding will provide an important boost for state economies, help put


Dermond Inc | Open Energy Information  

Open Energy Info (EERE)

Dermond Inc Dermond Inc Jump to: navigation, search Name Dermond Inc Place Brightom, Michigan Zip MI 48114 Sector Wind energy Product The company is working to develop a new wind turbine for the production of electrical power, targeting off-grid electricity generation locations. Coordinates 50.865669°, 4.62993° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":50.865669,"lon":4.62993,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Net Metering | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

You are here You are here Home » Net Metering Net Metering < Back Eligibility Agricultural Commercial Fed. Government Industrial Local Government Nonprofit Residential Schools State Government Savings Category Bioenergy Water Buying & Making Electricity Solar Home Weatherization Wind Program Info State Michigan Program Type Net Metering Provider Michigan Public Service Commission '''''The MPSC is reviewing state interconnection and net metering policies in [http://efile.mpsc.state.mi.us/efile/viewcase.php?casenum=15919&submit.x=... Case U-15919].''''' In October 2008, Michigan enacted legislation (P.A. 295) requiring the Michigan Public Service Commission (PSC) to establish a statewide net metering program for renewable-energy systems within 180 days. On May 26, 2009 the Michigan Public Service Commission (PSC) issued an order formally


Aegir II | Open Energy Information  

Open Energy Info (EERE)

II II Jump to: navigation, search Name Aegir II Facility Aegir II Sector Wind energy Facility Type Offshore Wind Facility Status Proposed Location Lake Michigan MI Coordinates 43.098°, -86.597° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.098,"lon":-86.597,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Geothermal Energy Geopressure Subprogram, GCO-DOE, Pleasant Bayou No. 1  

DOE Green Energy (OSTI)

This Environmental Assessment (EA) has been prepared to assess the environmental implications of the Department of Energy's proposal to drill, complete, and test one geopressure well located in Brazoria County on a 2 hectares (five acre) test site 64 km (40 mi) south of Houston, Abstract 107, Perry and Austin Survey, Brazoria County, TX. The test well is herein referred to as GCO-DOE Pleasant Bayou No. 1. A maximum of four disposal wells will be located within .8 km (1/2 mi) of the proposed well. The DOE and the University of Texas Center for Energy Studies propose to operate the test facility for three years to evaluate the geopressure potential of the subsurface. Tests to be conducted include flow rates, fluid composition, temperature, gas content, geologic characteristics, and the land subsidence potential for subsequent production.




Comment submitted by Whirlpool Corporation regarding the Energy Star Verification Testing Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ADMINISTRATIVE CENTER * 2000 N. M63 - MD 3005 * BENTON HARBOR, MI 49022 * 269.923.4646 ADMINISTRATIVE CENTER * 2000 N. M63 - MD 3005 * BENTON HARBOR, MI 49022 * 269.923.4646 May 9, 2011 Via email Ashley Armstrong U.S. Department of Energy Building Technologies Program 1000 Independence Avenue, SW Washington, DC 20585-0121 ESTARVerificationTesting@ee.doe.gov Re: DOE ENERGY STAR Verification Testing Program Dear Ms. Armstrong: We appreciate the opportunity to comment on the DOE Verification Testing Program that was put forth on April 22, 2011 (DOE Testing Document). As a very active member of the Association of Home Appliance Manufacturers (AHAM), we have worked closely with them in the development of the comments they have submitted (under separate cover)



E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


FirstEnergy Uses EPRI Interregional Reactive Power Management Framework to Help Improve Transmission Voltage Stability  

Science Conference Proceedings (OSTI)

FirstEnergy teamed with EPRI and Powertech Labs to develop a practical, automated method for identifying areas prone to voltage instability due to a lack of reactive power reserves. Power system designers and operational planning engineers can use the new method to evaluate the performance of various power system designs or configurations with regard to susceptibility to voltage instability, determine weak areas requiring special remediation, and maximize the efficient use of assets by determining the mi...



Energy implications of glass-container recycling  

SciTech Connect

This report addresses the question of whether glass-container recycling actually saves energy. Glass-container production in 1991 was 10{sup 7} tons, with cullet making up about 30% of the input to manufacture. Two-thirds of the cullet is postconsumer waste; the remainder is in-house scrap (rejects). Most of the glass recycled is made into new containers. Total primary energy consumption includes direct process-energy use by the industry (adjusted to account for the efficiency of fuel production) plus fuel and raw-material transportation and production energies; the grand total for 1991 is estimated to be about 168 {times} 10{sup 12} Btu. The total primary energy use decreases as the percent of glass recycled rises, but the maximum energy saved is only about 13%. If distance to the landfill is kept fixed and that to the recovery facility multiplied by about eight, to 100 mi, a break-even point is reached, and recycling saves no energy. Previous work has shown that to save energy when using glass bottles, reuse is the clear choice. Recycling of glass does not save much energy or valuable raw material and does not reduce air or water pollution significantly. The most important impacts are the small reduction of waste sent to the landfill and increased production rates at glass plants.

Gaines, L.L.; Mintz, M.M. [Argonne National Lab., IL (United States)



Energy Policy | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Public Services Energy Economy Energy Policy Energy Policy Energy Secretary Steven Chu speaks with President Barack Obama. | Energy Department Photo Energy Secretary Steven...


Renewable Energy | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Renewable Energy October 7, 2013 - 9:16am Addthis Renewable energy increases energy security, creates jobs, and powers our clean energy economy. Renewable energy increases...


Energy Optimization Savings Standard  

Energy.gov (U.S. Department of Energy (DOE))

Note: The Michigan Public Service Commission (MPSC) created a temporary order ([http://www.dleg.state.mi.us/mpsc/orders/electric/2008/u-15800_12-04-2008... U-15800]) in December of 2008 to address...


Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

81 - 12190 of 31,917 results. 81 - 12190 of 31,917 results. Download Microsoft Word- Political Activity and the Federal Employee.doc http://energy.gov/cio/downloads/microsoft-word-political-activity-and-federal-employeedoc Download FAQS Reference Guide - Safeguards and Security General Technical Base This reference guide addresses the competency statements in the July 2009 edition of DOE-STD-1123-2009, Safeguards and Security General Technical Base Qualification Standard. http://energy.gov/hss/downloads/faqs-reference-guide-safeguards-and-security-general-technical-base Rebate Refundable Payroll Tax Credit '''''Note: [http://www.legislature.mi.gov/documents/2011-2012/publicact/pdf/2011-PA-... Public Act 38 of 2011] repealed the Michigan Business Tax (MBT) and implemented the Corporate Income Tax (CIT...


Minden Wind Park | Open Energy Information  

Open Energy Info (EERE)

Minden Wind Park Minden Wind Park Facility Minden Wind Park Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Detroit Edison Developer Detroit Edison Energy Purchaser Detroit Edison Location Minden City MI Coordinates 43.637272°, -82.78022° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.637272,"lon":-82.78022,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Sigel Wind Park | Open Energy Information  

Open Energy Info (EERE)

Sigel Wind Park Sigel Wind Park Jump to: navigation, search Name Sigel Wind Park Facility Sigel Wind Park Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Detroit Edison Developer Detroit Edison Energy Purchaser Detroit Edison Location Harbor Beach MI Coordinates 43.8549985°, -82.7925216° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.8549985,"lon":-82.7925216,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Matter & Energy Solar Energy  

E-Print Network (OSTI)

See Also: Matter & Energy Solar Energy· Electronics· Materials Science· Earth & Climate Energy at the University of Illinois, the future of solar energy just got brighter. Although silicon is the industry Electronics Over 1.2 Million Electronics Parts, Components and Equipment. www.AlliedElec.com solar energy

Rogers, John A.


Energy Efficiency & Renewable Energy  

E-Print Network (OSTI)

Energy Efficiency & Renewable Energy 2009 WIND TECHNOLOGIES MARKET REPORT AUGUST 2010 #12;2009 Wind Associates) Suzanne Tegen (National Renewable Energy Laboratory) Table of Contents Acknowledgments' Association); Ed DeMeo (Renewable Energy Consulting Services, Inc.); Mike O'Sullivan (NextEra Energy Resources


Energy Information Administration  

Gasoline and Diesel Fuel Update (EIA)

Washington, 0 C Washington, 0 C Housing Characteristics 1984 i if I ^^^PVrjuV 9861 wo suoiidu.)sqns ot ,< iou Xq sn oj it ujnpj jsnui no^ - via ^Mi uo 3-ic no^ JI ')si -uoo si (VI3) uoiiBJisiuiuipv uoiieuuojui 3DI1ON meuoduii UB noX Suipuas sir jo -986! ' J '9861 uoos [((.w a Xq pwmbw sy (202) jo 0098-2SZ (202) S8S02 0 0 'uoi8u!M«eM 6uip|ing J0| soi aq XSLU si jepjo uy «0|eq jesdde sjaqainu auot|de|a] ptie sessaippv 'QI3N ^Ml oi uo suoqsano '(OI3N) J9iueo uoijeiujojui ASjeug IBUOIIBN S.VI3 aiJi JO Od9 (VI3) uoiiejisiunupy uot;6tux>|ui Xfijaug jat»o pue snji jo aseqajnd pue uorieauofui lueuiuWAOQ 5 Tl 'sjuauunooQ jo luepueiuiJ&dng &LJJ 0104 8iqet!*AB si uoiieoitqnd DOE/EiA-0314(84) Distribution Category UC-98 Residential Energy Consumption v^-^s--. Survey: Housing Characteristics 1984


Save energy | ENERGY STAR  

NLE Websites -- All DOE Office Websites (Extended Search)

energy Stamp out energy waste Find cost-effective investments Engage occupants Purchase energy-saving products Put computers to sleep Get help from an expert Take a comprehensive...


Energy Basics: Ocean Energy Technologies  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Energy Basics Renewable Energy Printable Version Share this resource Biomass Geothermal Hydrogen Hydropower Ocean Ocean Thermal Energy Conversion Tidal Energy Wave Energy...


Plant energy auditing | ENERGY STAR  

NLE Websites -- All DOE Office Websites (Extended Search)

track, and benchmark Improve energy performance ENERGY STAR industrial partnership Energy guides Energy efficiency and air regulation Plant energy auditing Industrial...


Improve energy performance | ENERGY STAR  

NLE Websites -- All DOE Office Websites (Extended Search)

track, and benchmark Improve energy performance ENERGY STAR industrial partnership Energy guides Energy efficiency and air regulation Plant energy auditing Industrial...


NETL: News Release - We Energies Begins Operational Phase of Mercury  

NLE Websites -- All DOE Office Websites (Extended Search)

7, 2006 7, 2006 We Energies Begins Operational Phase of Mercury Control Test in Michigan Coal-Fired Power Plant TOXECON(tm) Process Could Achieve 90 Percent Mercury Removal Washington, DC - The nation's first full-scale test of the patented TOXECON(tm) pollution control process began operations at the We Energies Presque Isle Power Plant located in Marquette, MI. The $52.9 million TOXECON(tm) project was selected by the U.S. Department of Energy in 2003 as part of the President's Clean Coal Power Initiative. Under their agreement with DOE, We Energies is designing, installing, operating and evaluating the TOXECON(tm) process as an integrated system to control emissions of mercury, particulate matter, sulfur dioxide and nitrogen oxides during the operations of its Presque Isle plant.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1.2 1.2 OMB Control No. 1910-1400 (Formerly DOE F 1430.22) Burden Disclosure (05-98) Statement on Back All other editions are obsolete. U.S. DEPARTMENT OF ENERGY NOTICE OF ENERGY RD&D PROJECT 1. DOE CONTRACT OR GRANT NUMBER ' New Contract ' Continuation/Revision 2. BUDGET AND REPORTING (B&R) CODE 3. PRINCIPAL INVESTIGATOR A. Last First MI B. Affiliation C. Address Zip D. Phone: Commercial FAX E. E-Mail Address 4. DOE SPONSORING OFFICE (e.g., ER-34) 5. PROJECT TITLE 6. PROJECT DESCRIPTION 7. ASSOCIATED REFERENCE NUMBER 8. OUT YEAR COST ESTIMATE (in whole dollars) 9. NON-DOE CONTRIBUTION (percentage whole number) 10. PUBLICATION 11. DATE INSTRUCTIONS NOTICE OF ENERGY RD&D PROJECT Notice Complete all data elements on this form and send to the U.S. Department of Energy, Office of Scientific and


Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


Energy Efficiency & Renewable Energy  

E-Print Network (OSTI)

of energy; · increase efficiency and productivity of the existing energy infrastructure; · bring clean lives of Americans by productively enhancing their energy choices and quality of life. Energy Efficiency Performance and Sustainable Buildings by 2015 Design all new Federal buildings which begin the planning


Energy Conservation Renewable Energy  

E-Print Network (OSTI)

Energy Conservation Renewable Energy The Future at Rutgers University Facilities & Capital Planning Operations & Services Utilities Operations 6 Berrue Circle Piscataway, NJ 08854 #12;Energy Conservation Wh C ti ? R bl EWhy Conservation? Renewable Energy · Climate control reduces green house gases · Reduces

Delgado, Mauricio

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


U.S. Department of Energy National Environmental Policy Act Categorical Exclusion Determination  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

St. Clair Shores St. Clair Shores Location: City St. Clair Shores MI American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Conduct energy audits for six municipal buildings; 2) energy efficiency retrofits for six municipal buildings-retrofits are limited to the following activities: retrofit of lighting systems, replacement of HVAC systems, replacement of windows, caulking windows, removal and replacement of insulation, installation of additional insulation, replacement of water heaters, and replacement of toilets; 3) installation of a vertical wind turbine demonstration project involving four small 2,000 kWh/year capacity units at the City Hall


Energy Education  

Science Conference Proceedings (OSTI)

Mar 6, 2013 ... Energy Technologies and Carbon Dioxide Management: Energy Education .... A Suggestion for Establishing Energy Management Policy in...


Energy Portal  

Science Conference Proceedings (OSTI)

NIST Home > Energy Portal. Energy Portal - Overview. ... see all Energy programs and projects ... Instruments. Nonlinear Optical Spectroscopy ...



Energy Information Administration - Energy Efficiency, energy ...  

U.S. Energy Information Administration (EIA)

The Energy Efficiency Page reflects EIA's information on energy efficiency and related information. This site provides an in depth discussion of the concept of energy ...


EIS-0365: Final Environmental Impact Statement | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Final Environmental Impact Statement Final Environmental Impact Statement EIS-0365: Final Environmental Impact Statement Imperial-Mexicali 230-kV Transmission Lines A U.S. Department of Energy (DOE) Presidential permit is required to construct, operate, maintain, and connect an electric transmission line across the U.S.-Mexico border. On February 27, 2001, Baja California Power, Inc., InterGen Aztec Energy, V.B.V. (hereafter referred to as Intergen), filed an application with DOE, Office of Fossil Energy, for a Presidential permit for a double-circuit, 230-kV transmission line extending from the Imperial Valley Substation in California for a distance of about 6 mi (10 km) to a point west of Calexico at the U.S.-Mexico border. EIS-0365-FEIS-01-2004.pdf EIS-0365-FEIS-02-2004.pdf EIS-0365-FEIS-FiguresTables-2004.pdf


Stoney Corners (Northern Power Systems) | Open Energy Information  

Open Energy Info (EERE)

Power Systems) Power Systems) Jump to: navigation, search Name Stoney Corners (Northern Power Systems) Facility Stoney Corners (Northern Power Systems) Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Heritage Sustainable Energy Developer Heritage Sustainable Energy Location McBain MI Coordinates 44.208°, -85.274° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.208,"lon":-85.274,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central


Stoney Corners - REpower Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Wind Farm Wind Farm Jump to: navigation, search Name Stoney Corners - REpower Wind Farm Facility Stoney Corners - REpower Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Heritage Sustainable Energy Developer Heritage Sustainable Energy Location McBain MI Coordinates 44.20823°, -85.27371° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":44.20823,"lon":-85.27371,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Michigan Wind II Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Wind II Wind Farm Wind II Wind Farm Jump to: navigation, search Name Michigan Wind II Wind Farm Facility Michigan Wind II Wind Farm Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Exelon Wind Developer Exelon Wind Energy Purchaser Consumers Energy Location Minden City MI Coordinates 43.6572421°, -82.7681278° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.6572421,"lon":-82.7681278,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Michigan Wind I Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Wind I Wind Farm Wind I Wind Farm Jump to: navigation, search Name Michigan Wind I Wind Farm Facility Michigan Wind I Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner John Deere Wind Developer Noble Environmental Power Energy Purchaser Consumers Energy Location Huron County MI Coordinates 43.7099°, -82.9388° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.7099,"lon":-82.9388,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Energy Generation by State, by Technology (2009) | OpenEI  

Open Energy Info (EERE)

Generation by State, by Technology (2009) Generation by State, by Technology (2009) Dataset Summary Description Provides annual energy generation for all states by fuel source (e.g. coal, gas, solar, wind) in 2009, reported in MWh. Also includes facility-level data (directly from EIA Form 923). Source NREL Date Released August 01st, 2010 (4 years ago) Date Updated Unknown Keywords coal EIA Energy Generation gas geothermal oil solar States wind Data application/vnd.ms-excel icon Energy Generation by Fuel Source and State, 2009 (xls, 5.9 MiB) application/msword icon Data dictionary for EIA 923 database (used to develop the NREL summary dataset) (doc, 239.6 KiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period 2009 License License Other or unspecified, see optional comment below


Michigan Offshore Wind Pilot Project | Open Energy Information  

Open Energy Info (EERE)

Offshore Wind Pilot Project Offshore Wind Pilot Project Jump to: navigation, search Name Michigan Offshore Wind Pilot Project Facility Michigan Offshore Wind Pilot Project Sector Wind energy Facility Type Offshore Wind Facility Status Proposed Owner Mighigan Alternative and Renewable Energy Center Developer Mighigan Alternative and Renewable Energy Center Location Muskegon Lake MI Coordinates 43.231°, -86.307° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.231,"lon":-86.307,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Department of Energy - Energy Efficiency  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1 en Energy Efficiency: Helping Home Owners and Businesses Understand Energy Usage http:energy.govarticlesenergy-efficiency-helping-home-owners-and-businesses-understand-energy...


Energy Basics: Renewable Energy Technologies  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Energy Basics Renewable Energy Printable Version Share this resource Biomass Geothermal Hydrogen Hydropower Ocean Solar Wind Renewable Energy Technologies Renewable energy...


Energy Policy | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Policy Energy Policy Energy Secretary Steven Chu speaks with President Barack Obama. | Energy Department Photo Energy Secretary Steven Chu speaks with President Barack Obama. |...


Energy Sources | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Sources Energy Sources Renewable Energy Learn more about Solar, Water, Biomass, Geothermal and Wind Energy. Read more Nuclear Learn more about how we use Nuclear Energy. Read more...


Energy Sources | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Science & Innovation Energy Sources Energy Sources Renewable Energy Learn more about Solar, Water, Biomass, Geothermal and Wind Energy. Read more Nuclear Learn more about how we...


Leonardo Energy | Open Energy Information  

Open Energy Info (EERE)

Area: Energy Efficiency, Renewable Energy, Transportation Resource Type: Webinar, Training materials Website: www.leonardo-energy.org References: Leonardo Energy 1 "Leonardo...


American Electric Technologies Inc | Open Energy Information  

Open Energy Info (EERE)

Electric Technologies Inc Electric Technologies Inc Jump to: navigation, search Name American Electric Technologies Inc Place Houston, Texas Zip TX 77087 Sector Services Product American Electric Technologies (formerly M&I Electric Industries) is a global supplier of power delivery products and services to the traditional and alternative energy industries. References American Electric Technologies Inc[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. American Electric Technologies Inc is a company located in Houston, Texas . References ↑ "American Electric Technologies Inc" Retrieved from "http://en.openei.org/w/index.php?title=American_Electric_Technologies_Inc&oldid=342113"


All Other Editions Are Obsolete U.S. Department of Energy Subsidy for Energy Employees' Transit Application  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

80.2 80.2 (02-93) All Other Editions Are Obsolete U.S. Department of Energy Subsidy for Energy Employees' Transit Application Name: (Last) (First) (MI) (Social Security No. Home Address: (Number/Street) (City) (State) (Zip Code) Building (FOR, GTN, etc.): Certification: I hereby certify that I am employed by U.S. Department of Energy (DOE) and am not a member of a commuter vanpool or carpool and not listed on a worksite parking permit with any Federal agency. I certify that I am eligible for a public transportation fare benefit, am obtaining it for my personal, commuting use to and/or from work, and will not transfer it to anyone else. I further certify that the monthly transit benefit I am receiving does not exceed my

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Energy Programs | Solar Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

Solar Energy Solar Energy Harnessing the Sun's Power for Fuel and Electricity Page 1 of 2 Solar Panels Featured Publication: Artificial Photosynthesis The average power need of the world's energy economy is 13 terawatts - a thousand trillion watts of power - and by 2050, that amount is expected to double. Fossil fuels and other nonrenewable sources are not the answer to the world's ever-expanding need for energy. Also, burning oil, coal or natural gas pollutes the atmosphere and contributes to global warming, which threatens the long-term viability of the earth and its inhabitants. Efficient utilization of energy from the sun may provide a solution to this important problem. The amount of clean, renewable energy derived from the sun in just one hour would meet the world's energy needs for a year. If


Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available



--No Title--  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Michigan Total Sum City, County, and SEO Allocations All 76,601,500 MI Michigan State Energy Office 19,599,600 MI Ann Arbor City 1,243,400 MI Battle Creek City 545,100...


Ford Electric Battery Group | Open Energy Information  

Open Energy Info (EERE)

Ford Electric Battery Group Jump to: navigation, search Name Ford Electric Battery Group Place Dearborn, MI Information About Partnership with NREL Partnership with NREL Yes...


Adaptive Materials Inc | Open Energy Information  

Open Energy Info (EERE)

Zip MI 48108 Product Adaptive Materials Inc (AMI) is a developer of portable fuel cell technology. References Adaptive Materials Inc1 LinkedIn Connections CrunchBase...


Pulte/Del Webb | Open Energy Information  

Open Energy Info (EERE)

MI Information About Partnership with NREL Partnership with NREL Yes Partnership Type Test & Evaluation Partner Partnering Center within NREL Electricity Resources & Building...


Solar and Wind Energy Resource Assessment - Kenya Country Report | OpenEI  

Open Energy Info (EERE)

- Kenya Country Report - Kenya Country Report Dataset Summary Description (Abstract): The Kenya Country Report describes the energy situation in Kenys and identifies solar and wind energy opportunities. (Purpose): To influence investment decisions by promoting and supporting renewable energy by overcoming informational barriers in solar and wind energy financing. Source Daniel Theuri - SWERA National Team Date Released November 23rd, 2008 (6 years ago) Date Updated Unknown Keywords documentation Kenya renewable energy solar SWERA UNEP wind Data application/pdf icon Download Report (pdf, 9.3 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period 2008 License License Open Data Commons Public Domain Dedication and Licence (PDDL) Comment


Service Report Enwgy Information Administration Office of Energy Markets and End Use  

U.S. Energy Information Administration (EIA) Indexed Site

Enwgy Information Administration Enwgy Information Administration Office of Energy Markets and End Use U;S. Department of Energy Washington, O.C. 20585 ^ ± SR-EEUD--84-I leather izat ion Program Evaluation §]*: b? .. Gerald E. Pealjody of Energy Markets and End Use Energy End Use Division August 20, 1984 This raport has not received a complete technical review by the Energy In formation Administration (E1A) and, therefore, should not be represented as an official EIA product. |||lsS|; program in 198 l^^lRia; study is based -on a scatii;f|^ipiiii|', national samp 1* Of : - households chac aarcicipscac in the pr; 3 §S||tMi-lfc|Sis2?ia covers ;he ^tiecrr^n: of conditions under vhich the p This ,s«;;5^H:«lil-lSi|iuGcaG ac che requesic of :rva


Energy Literacy  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Literacy Essential Principles and Fundamental Concepts for Energy Education A Framework for Energy Education for Learners of All Ages Intended use of this document as a...


Energy Efficiency & Renewable Energy  

E-Print Network (OSTI)

and the installed capacity of small wind turbines, which are defined as having rated capacities of 100 kilowatts (k are electric generators that utilize wind energy to produce clean, emissions-free power for individual homes to the American Wind Energy Association (AWEA), the United States leads the world in both the manufacture


Energy Efficiency & Renewable Energy  

E-Print Network (OSTI)

's buildings and will provide hot water. Table 7: Summary of UTC Power 2009 Projects Source: Fuel Cells 2000Energy Efficiency & Renewable Energy 2009 FUEL CELL MARKET REPORT NOVEMBER 2010 #12;Authors was the result of hard work and valuable contributions from government staff and the fuel cell industry


Energy Efficiency & Renewable Energy  

E-Print Network (OSTI)

.S currently imports from the Middle East and Venezuela combined within 10 years · Enhance Nuclear Security security, and environmental challenges concurrently. Energy Security Economic · Deploy the cheapest.S. DOE #12;President's National Objectives for DOE-- Energy to Secure America's Future · Quickly


Property:Incentive/Auth3Link | Open Energy Information  

Open Energy Info (EERE)

Auth3Link Auth3Link Jump to: navigation, search Property Name Incentive/Auth3Link Property Type URL Pages using the property "Incentive/Auth3Link" Showing 25 pages using this property. (previous 25) (next 25) 3 30% Business Tax Credit for Solar (Vermont) + http://publicservice.vermont.gov/energy/ee_files/cedf/SolarTaxCredit_Round2_Announcement.pdf + A Advanced Energy Tax Credit (Corporate) (New Mexico) + http://www.nmonesource.com/nmnxtadmin/NMPublic.aspx + Air Pollution Control (Michigan) + http://www7.dleg.state.mi.us/orr/AdminCode.aspx?AdminCode=Department&Dpt=EQ&Level_1=Air%2BQuality%2BDivision + Air Pollution Control Program (Alabama) + http://alisondb.legislature.state.al.us/acas/CodeOfAlabama/1975/22-22A-6.htm + Air Pollution Emissions and Abatement (Minnesota) + https://www.revisor.mn.gov/rules/?id=7011 +


Laker Elementary School Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Laker Elementary School Wind Farm Laker Elementary School Wind Farm Jump to: navigation, search Name Laker Elementary School Wind Farm Facility Laker Elementary School Sector Wind energy Facility Type Community Wind Facility Status In Service Owner Laker Elementary Energy Purchaser Laker Elementary Location Pigeon MI Coordinates 43.817384°, -83.228218° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.817384,"lon":-83.228218,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NEPADETEmITNATION NEPADETEmITNATION Page 1 of2 RECIPIENT:MiSSQuri Department of Natural Resources ~ Division of Energy STATE: MO PROJECf TITLE: ARRA Energized Missouri Water Loan project al City of Maryville I<'unding Opportunity Announcement Number DE-FOA-OOOO52 Procurement Instrument Number NEPA Control Number CID Number EE0000131 GFO-OOO131-043 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4SI.lA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.2 Modifications to pumps and piping 65.1 Actions to conserve energy or water Modifications to existing pump and piping configurations (including, but not limited to, manifolds, metering systems, and other instrumentation on such configurations conveying materials such as air, brine, carbon


McKinley Wind Park | Open Energy Information  

Open Energy Info (EERE)

McKinley Wind Park McKinley Wind Park Facility McKinley Wind Park Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Detroit Edison Developer Detroit Edison Energy Purchaser Detroit Edison Location Pigeon MI Coordinates 43.87277698°, -83.26126099° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.87277698,"lon":-83.26126099,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


EA-1759: Final Environmental Assessment | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EA-1759: Final Environmental Assessment EA-1759: Final Environmental Assessment EA-1759: Final Environmental Assessment Southwest Alaska Regional Geothermal Energy Project Naknek, Alaska The U.S. Department of Energy (DOE) is proposing an action (the Proposed Action) to fund the construction, operation, drilling, well logging, completion, installation of a seismic monitoring network, and testing of two of the exploratory geothermal wells (G2 and G3) and stimulation of one well (G1, G2, or G3), if feasible, on a 49-hectare (120-acre) parcel of land in southwest Alaska. The Naknek Electric Association (NEA) owned land is approximately 8 kilometers (km) (5 miles [mi]) northeast of King Salmon (Figure 1.0-1). Existing infrastructure includes a gravel road to the project area, two gravel pads connected by a gravel road, and a single


Energy Efficiency | Open Energy Information  

Open Energy Info (EERE)

Efficiency Jump to: navigation, search Energy Efficiency refers to products or systems using less energy to do the same or better job than conventional products or systems. Energy...


Todd Energy | Open Energy Information  

Open Energy Info (EERE)

New Zealand Sector Renewable Energy Product New Zealand energy company with operations in exploration, production and generation. It is also active in developing renewable energy...


Tigo Energy | Open Energy Information  

Open Energy Info (EERE)

Tigo Energy Jump to: navigation, search Name Tigo Energy Place Los Gatos, California Zip 95032 Sector Solar Product Tigo Energy builds hardware and software intelligence into solar...

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Clairvoyant Energy | Open Energy Information  

Open Energy Info (EERE)

Energy Jump to: navigation, search Name Clairvoyant Energy Place Santa Barbara, California Sector Services, Solar Product Clairvoyant Energy builds, owns and operates...


Energy Basics: Wind Energy Resources  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Energy Basics Renewable Energy Printable Version Share this resource Biomass Geothermal Hydrogen Hydropower Ocean Solar Wind Wind Turbines Wind Resources Wind Energy...


Energy Basics: Wind Energy Technologies  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Energy Basics Renewable Energy Printable Version Share this resource Biomass Geothermal Hydrogen Hydropower Ocean Solar Wind Wind Turbines Wind Resources Wind Energy...


Energy Basics | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

INDUSTRIAL TECHNOLOGIES Industrial Energy Efficiency Basics More Additional Links Glossary of Energy-Related Terms Here you'll find a glossary of energy-related terms. Related...


Energy News | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Avoid Over 710,000 Tons of Carbon Dioxide Annually April 14, 2011 Department of Energy, Duke Energy and EPRI Partner to Test Advanced Energy Technologies for Utilities...


Energy Efficiency | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

take advantage of Xcel Energy's rebate programs that cut the cost of whole-house energy efficiency upgrades. February 22, 2010 Service Members Aim High -- for Energy Savings...


Energy Blog | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

October 15, 2008 Improving the Energy Efficiency of Existing Windows Make your windows more efficient and save energy and money. October 13, 2008 Purchasing Energy-Efficient...


Energy Basics: Solar Energy Technologies  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Technologies Solar energy technologies produce electricity from the energy of the sun. Small solar energy systems can provide electricity for homes, businesses, and remote power...


ENERGY STAR Petroleum Energy Guide  

NLE Websites -- All DOE Office Websites (Extended Search)

183 ERNEST ORLANDO LAWRENCE BERKELEY NATIONAL LABORATORY Energy Efficiency Improvement and Cost Saving Opportunities For Petroleum Refineries An ENERGY STAR Guide for Energy and...


Energy Programs | The Energy Challenge  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Challenge Page 1 of 3 Our nation faces a grand challenge: finding alternatives to fossil fuels and improving energy efficiency to meet our exponentially growing energy...


Energy News | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

November 10, 2009 Secretary Chu to Travel to India and China to Promote Clean Energy Partnerships Washington, DC - The Department of Energy announced today that Energy Secretary...


Dezentrale Energie | Open Energy Information  

Open Energy Info (EERE)

Dezentrale Energie Place Neustadt a. Rbge., Germany Zip D-31535 Sector Wind energy Product Wind power developer. References Dezentrale Energie1 LinkedIn Connections CrunchBase...


Renewable Energy | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Science & Innovation Energy Sources Renewable Energy Renewable Energy Watch as these fourth grade students go from learning about electricity to making their own electricity...


Sterling Energy | Open Energy Information  

Open Energy Info (EERE)

California . References "Sterling Energy" Retrieved from "http:en.openei.orgwindex.php?titleSterlingEnergy&oldid351704" Categories: Clean Energy Organizations...


Solarium Energy | Open Energy Information  

Open Energy Info (EERE)

Solarium Energy is a company located in San Diego, California . References "Solarium Energy" Retrieved from "http:en.openei.orgwindex.php?titleSolariumEnergy&oldid35139...


Balance Energy | Open Energy Information  

Open Energy Info (EERE)

Balance Energy is a company located in San Diego, California . References "Balance Energy" Retrieved from "http:en.openei.orgwindex.php?titleBalanceEnergy&oldid342509...


Aleltho Energy | Open Energy Information  

Open Energy Info (EERE)

it. Aleltho Energy is a company located in United Kingdom . References "Aleltho Energy" Retrieved from "http:en.openei.orgwindex.php?titleAlelthoEnergy&oldid341988...


Vortex Energy | Open Energy Information  

Open Energy Info (EERE)

by expanding it. Vortex Energy is a company located in Germany . References "Vortex Energy" Retrieved from "http:en.openei.orgwindex.php?titleVortexEnergy&oldid352892...


Bryte Energy | Open Energy Information  

Open Energy Info (EERE)

search Name Bryte Energy Place Leicestershire, United Kingdom Zip LE3 0QP Sector Hydro, Hydrogen, Renewable Energy, Services Product Bryte Energy Ltd provides consultancy...


Symmetry Energy  

E-Print Network (OSTI)

Examination of symmetry energy is carried out on the basis of an elementary binding-energy formula. Constraints are obtained on the energy value at the normal nuclear density and on the density dependence of the energy at subnormal densities.

P. Danielewicz


Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Renewable Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

Renewable Energy Renewable Energy1354608000000Renewable EnergySome of these resources are LANL-only and will require Remote Access.No Renewable Energy Some of these resources are...


Energy Conservation  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Goal 1: Energy Conservation LANL strives to reduce greenhouse gas emissions to meet and surpass Department of Energy goals. The Lab's goal is to reduce emissions from energy...


Renewable Energy  

U.S. Energy Information Administration (EIA)

Renewable energy sources including biomass, hydropower, geothermal, wind, and solar provide 8% of the energy used in the United States.



NLE Websites -- All DOE Office Websites (Extended Search)

Small business Service providers Service and product providers Verify applications for ENERGY STAR certification Design commercial buildings Energy efficiency program...


Energy Crossroads: Energy Education | Environmental Energy Technologie...  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Education < Previous Topic Energy Crossroads Index Next Topic > Suggest a Listing Continuing and Higher Education AEE Seminars for Professionals From the Association of...


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Energy Basics: Wave Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

niche markets. Once built, they have low operation and maintenance costs because their fuel-seawater-is free. Contacts | Web Site Policies | U.S. Department of Energy | USA.gov...


Energy Basics: Tidal Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

the cost per kilowatt-hour of tidal power is not competitive with conventional fossil fuel power. Contacts | Web Site Policies | U.S. Department of Energy | USA.gov Content Last...


The Resource Potential of Natural Gas Hydrates  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Complementary Program Research Complementary Program Research Office of Research and Development National Energy Technology Laboratory September 26 th , 2012 EPAct Complementary Program- Extreme Offshore 2 The NETL Complementary Program - Targeting top offshore/UDW spill risks Schematic representation of offshore spill risk profile % of recorded spills & drilling phase in the GOM & North Sea -Source: SINTEF Database * Cementing Failures * Equipment & Casing Failures * Higher risk targets, "exploratory" systems -Izon et al. 2007 IAM Tools for GOM Barriers & Controls - Cements Barriers & Controls - Metals Multiphase flow HPHT Fluids/EOS Risk & Impacts 3 Initial risk assessment requires a firm basis of materials behavior in extreme environments.


The Resource Potential of Natural Gas Hydrates  

NLE Websites -- All DOE Office Websites (Extended Search)

Complementary Program Research Complementary Program Research Office of Research and Development National Energy Technology Laboratory EPAct Complementary Program- Extreme Offshore 2 The NETL Complementary Program - Targeting top offshore/UDW spill risks Schematic representation of offshore spill risk profile % of recorded spills & drilling phase in the GOM & North Sea -Source: SINTEF Database * Cementing Failures * Equipment & Casing Failures * Higher risk targets, "exploratory" systems -Izon et al. 2007 IAM Tools for GOM Barriers & Controls - Cements Barriers & Controls - Metals Multiphase flow HPHT Fluids/EOS Risk & Impacts 3 Initial risk assessment requires a firm basis of materials behavior in extreme environments.


Energy Saver | Department of Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

saving energy -- whether on the road or in your home. My Trip Home Energy Saver Water Heater Savings Tips & Advice Energy Saver Energy Savers Guide: Tips on Saving Money and...


Renewable Energy and Energy Efficiency Toolkit Website | Open Energy  

Open Energy Info (EERE)

Renewable Energy and Energy Efficiency Toolkit Website Renewable Energy and Energy Efficiency Toolkit Website Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Renewable Energy and Energy Efficiency Toolkit Website Focus Area: Renewable Energy Topics: Policy Impacts Website: toolkits.reeep.org/ Equivalent URI: cleanenergysolutions.org/content/renewable-energy-and-energy-efficienc Language: "English,Chinese,French,Portuguese,Spanish" is not in the list of possible values (Abkhazian, Achinese, Acoli, Adangme, Adyghe; Adygei, Afar, Afrihili, Afrikaans, Afro-Asiatic languages, Ainu, Akan, Akkadian, Albanian, Aleut, Algonquian languages, Altaic languages, Amharic, Angika, Apache languages, Arabic, Aragonese, Arapaho, Arawak, Armenian, Aromanian; Arumanian; Macedo-Romanian, Artificial languages, Assamese, Asturian; Bable; Leonese; Asturleonese, Athapascan languages, Australian languages, Austronesian languages, Avaric, Avestan, Awadhi, Aymara, Azerbaijani, Balinese, Baltic languages, Baluchi, Bambara, Bamileke languages, Banda languages, Bantu (Other), Basa, Bashkir, Basque, Batak languages, Beja; Bedawiyet, Belarusian, Bemba, Bengali, Berber languages, Bhojpuri, Bihari languages, Bikol, Bini; Edo, Bislama, Blin; Bilin, Blissymbols; Blissymbolics; Bliss, Bosnian, Braj, Breton, Buginese, Bulgarian, Buriat, Burmese, Caddo, Catalan; Valencian, Caucasian languages, Cebuano, Celtic languages, Central American Indian languages, Central Khmer, Chagatai, Chamic languages, Chamorro, Chechen, Cherokee, Cheyenne, Chibcha, Chichewa; Chewa; Nyanja, Chinese, Chinook jargon, Chipewyan; Dene Suline, Choctaw, Chuukese, Chuvash, Classical Newari; Old Newari; Classical Nepal Bhasa, Classical Syriac, Coptic, Cornish, Corsican, Cree, Creek, Creoles and pidgins , Crimean Tatar; Crimean Turkish, Croatian, Cushitic languages, Czech, Dakota, Danish, Dargwa, Delaware, Dinka, Divehi; Dhivehi; Maldivian, Dogri, Dogrib, Dravidian languages, Duala, Dutch; Flemish, Dyula, Dzongkha, Eastern Frisian, Efik, Egyptian (Ancient), Ekajuk, Elamite, English, Erzya, Esperanto, Estonian, Ewe, Ewondo, Fang, Fanti, Faroese, Fijian, Filipino; Pilipino, Finnish, Finno-Ugrian languages, Fon, French, Friulian, Fulah, Ga, Gaelic; Scottish Gaelic, Galibi Carib, Galician, Ganda, Gayo, Gbaya, Geez, Georgian, German, Germanic languages, Gilbertese, Gondi, Gorontalo, Gothic, Grebo, Greek, Modern, Guarani, Gujarati, Gwich'in, Haida, Haitian; Haitian Creole, Hausa, Hawaiian, Hebrew, Herero, Hiligaynon, Himachali languages; Western Pahari languages, Hindi, Hiri Motu, Hittite, Hmong; Mong, Hungarian, Hupa, Iban, Icelandic, Ido, Igbo, Ijo languages, Iloko, Inari Sami, Indic languages, Indo-European languages, Indonesian, Ingush, Interlingue; Occidental, Inuktitut, Inupiaq, Iranian languages, Irish, Iroquoian languages, Italian, Japanese, Javanese, Judeo-Arabic, Judeo-Persian, Kabardian, Kabyle, Kachin; Jingpho, Kalaallisut; Greenlandic, Kalmyk; Oirat, Kamba, Kannada, Kanuri, Kara-Kalpak, Karachay-Balkar, Karelian, Karen languages, Kashmiri, Kashubian, Kawi, Kazakh, Khasi, Khoisan languages, Khotanese; Sakan, Kikuyu; Gikuyu, Kimbundu, Kinyarwanda, Kirghiz; Kyrgyz, Klingon; tlhIngan-Hol, Komi, Kongo, Konkani, Korean, Kosraean, Kpelle, Kru languages, Kuanyama; Kwanyama, Kumyk, Kurdish, Kurukh, Kutenai, Ladino, Lahnda, Lamba, Land Dayak languages, Lao, Latin, Latvian, Lezghian, Limburgan; Limburger; Limburgish, Lingala, Lithuanian, Lojban, Lower Sorbian, Lozi, Luba-Katanga, Luba-Lulua, Luiseno, Lule Sami, Lunda, Luo (Kenya and Tanzania), Lushai, Luxembourgish; Letzeburgesch, Macedonian, Madurese, Magahi, Maithili, Makasar, Malagasy, Malay, Malayalam, Maltese, Manchu, Mandar, Mandingo, Manipuri, Manobo languages, Manx, Maori, Mapudungun; Mapuche, Marathi, Mari, Marshallese, Marwari, Masai, Mayan languages, Mende, Mi'kmaq; Micmac, Minangkabau, Mirandese, Mohawk, Moksha, Mon-Khmer languages, Mongo, Mongolian, Mossi, Multiple languages, Munda languages, N'Ko, Nahuatl languages, Nauru, Navajo; Navaho, Ndebele, North; North Ndebele, Ndebele, South; South Ndebele, Ndonga, Neapolitan, Nepal Bhasa; Newari, Nepali, Nias, Niger-Kordofanian languages, Nilo-Saharan languages, Niuean, North American Indian languages, Northern Frisian, Northern Sami, Norwegian, Nubian languages, Nyamwezi, Nyankole, Nyoro, Nzima, Occitan (post 1500); Provençal, Ojibwa, Oriya, Oromo, Osage, Ossetian; Ossetic, Otomian languages, Pahlavi, Palauan, Pali, Pampanga; Kapampangan, Pangasinan, Panjabi; Punjabi, Papiamento, Papuan languages, Pedi; Sepedi; Northern Sotho, Persian, Philippine languages, Phoenician, Pohnpeian, Polish, Portuguese, Prakrit languages, Pushto; Pashto, Quechua, Rajasthani, Rapanui, Rarotongan; Cook Islands Maori, Romance languages, Romanian; Moldavian; Moldovan, Romansh, Romany, Rundi, Russian, Salishan languages, Samaritan Aramaic, Sami languages, Samoan, Sandawe, Sango, Sanskrit, Santali, Sardinian, Sasak, Scots, Selkup, Semitic languages, Serbian, Serer, Shan, Shona, Sichuan Yi; Nuosu, Sicilian, Sidamo, Sign Languages, Siksika, Sindhi, Sinhala; Sinhalese, Sino-Tibetan languages, Siouan languages, Skolt Sami, Slave (Athapascan), Slavic languages, Slovak, Slovenian, Sogdian, Somali, Songhai languages, Soninke, Sorbian languages, Sotho, Southern, South American Indian (Other), Southern Altai, Southern Sami, Spanish; Castilian, Sranan Tongo, Sukuma, Sumerian, Sundanese, Susu, Swahili, Swati, Swedish, Swiss German; Alemannic; Alsatian, Syriac, Tagalog, Tahitian, Tai languages, Tajik, Tamashek, Tamil, Tatar, Telugu, Tereno, Tetum, Thai, Tibetan, Tigre, Tigrinya, Timne, Tiv, Tlingit, Tok Pisin, Tokelau, Tonga (Nyasa), Tonga (Tonga Islands), Tsimshian, Tsonga, Tswana, Tumbuka, Tupi languages, Turkish, Turkmen, Tuvalu, Tuvinian, Twi, Udmurt, Ugaritic, Uighur; Uyghur, Ukrainian, Umbundu, Uncoded languages, Undetermined, Upper Sorbian, Urdu, Uzbek, Vai, Venda, Vietnamese, Volapük, Votic, Wakashan languages, Walamo, Walloon, Waray, Washo, Welsh, Western Frisian, Wolof, Xhosa, Yakut, Yao, Yapese, Yiddish, Yoruba, Yupik languages, Zande languages, Zapotec, Zaza; Dimili; Dimli; Kirdki; Kirmanjki; Zazaki, Zenaga, Zhuang; Chuang, Zulu, Zuni) for this property.



NLE Websites -- All DOE Office Websites (Extended Search)

Small business Service providers Service and product providers Verify applications for ENERGY STAR certification Design commercial buildings Energy efficiency program...


Energy Basics: Solar Energy Technologies  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Energy Basics Renewable Energy Printable Version Share this resource Biomass Geothermal Hydrogen Hydropower Ocean Solar Photovoltaics Concentrating Solar Power Solar...


Energy Basics: Solar Energy Resources  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Energy Basics Renewable Energy Printable Version Share this resource Biomass Geothermal Hydrogen Hydropower Ocean Solar Photovoltaics Concentrating Solar Power Solar...


Geothermal energy | Open Energy Information  

Open Energy Info (EERE)

Buildings Clean Energy Economy Coordinated Low Emissions Assistance Network Geothermal Incentives and Policies International Clean Energy Analysis Low Emission Development...


EIA Energy Kids - Energy Timelines  

U.S. Energy Information Administration (EIA)

Recycling; History of Energy. Energy Timelines; Famous People; Calculators & Tools Games & Activities. Riddles; Slang; Puzzles; Science Fair Experiments; Field Trips ...


Renewable Energy | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Renewable Energy Renewable Energy Calibration Facilities Ecosystem Management Team Environmental Justice Environmental Management System NEPA Long-Term Surveillance - Operations...


U.S. Department of Energy Selects Michigan State University To Design and  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U.S. Department of Energy Selects Michigan State University To U.S. Department of Energy Selects Michigan State University To Design and Establish Facility for Rare Isotope Beams U.S. Department of Energy Selects Michigan State University To Design and Establish Facility for Rare Isotope Beams December 11, 2008 - 8:51am Addthis WASHINGTON, DC - The U.S. Department of Energy (DOE) announced today that Michigan State University (MSU) in East Lansing, MI has been selected to design and establish the Facility for Rare Isotope Beams (FRIB), a cutting-edge research facility to advance understanding of rare nuclear isotopes and the evolution of the cosmos. The new facility-expected to take about a decade to design and build and to cost an estimated $550 million-will provide research opportunities for an international community



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

!/www.eere-pmc.energy.govfNEPA/Nepa_ef2a.aspx?key=10036 !/www.eere-pmc.energy.govfNEPA/Nepa_ef2a.aspx?key=10036 u.s. DEPARTlIfENT OF ENERGY EERE PROJECT MANAGEMENT CE:-.JTER NEPA DETERMINATION RECIPIENT:Oaktand University PROJECT TITLE . . : . Oakland University HH8 Ground Source HP (Phase 2) STATE : MI Funding Opportunity Announcement Number DE-FOA-0000116 Procurement Instrument Number DE-EEOOO2970 NEPA Control Number cm Number GFO-10-193 0 Based on my review oUhe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Oroer 4S1.1A), I have made the following determmation: CX, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories. audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Energy Blog | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy.gov » Energy Blog Energy.gov » Energy Blog Energy Blog RSS September 30, 2008 Energy-Efficient Cooking for Winter Cold-weather cooking means a seasonal shift in the kitchen. September 25, 2008 Question of the Week: Do Energy-Related Financial Incentives Prompt You to Be More Energy Efficient? Do energy-related financial incentives or assistance programs prompt you to be more energy efficient or to purchase products that can help you save energy? September 23, 2008 Six Places to Find Help with Your Energy Costs Read about six resources that can help you save energy and money in your home. September 18, 2008 Question of the Week: What are Your Strategies for Saving Money and Energy in the Winter? What are your strategies for saving money and energy in the winter? September 16, 2008


Energy Information Administration - Energy Efficiency, energy consumption  

U.S. Energy Information Administration (EIA) Indexed Site

Efficiency Efficiency Energy Efficiency energy consumption savings households, buildings, industry & vehicles The Energy Efficiency Page reflects EIA's information on energy efficiency and related information. This site provides an in depth discussion of the concept of energy efficiency and how it is measured, measurement, summaries of formal user meetings on energy efficiency data and measurement, as well as analysis of greenhouse gas emissions as related to energy use and energy efficiency. At the site you will find links to other sources of information, and via a listserv all interested analysts can share ideas, data, and ask for assistance on methodological problems associated with energy use, energy efficiency, and greenhouse gas issues. Contact: Behjat.Hojjati@eia.doe.gov


Energy Perspectives, Total Energy - Energy Information Administration  

Gasoline and Diesel Fuel Update (EIA)

Total Energy Total Energy Glossary › FAQS › Overview Data Monthly Annual Analysis & Projections this will be filled with a highchart PREVIOUSNEXT Energy Perspectives 1949-2011 September 2012 PDF | previous editions Release Date: September 27, 2012 Introduction Energy Perspectives is a graphical overview of energy history in the United States. The 42 graphs shown here reveal sweeping trends related to the Nation's production, consumption, and trade of energy from 1949 through 2011. Energy Flow, 2011 (Quadrillion Btu) Total Energy Flow diagram image For footnotes see here. Energy can be grouped into three broad categories. First, and by far the largest, is the fossil fuels-coal, petroleum, and natural gas. Fossil fuels have stored the sun's energy over millennia past, and it is primarily


AND FINANCIAL 2011 Edition | EConoMiC And FinAnCiAL PRoFiLE oF QUBEC  

E-Print Network (OSTI)

ENERGY AGENCY. SOURCE: HYDRO-QU?BEC, COMPARISON OF ELECTRICITY PRICES IN MAJOR NORTH AMERICAN CITIES renewable energy, hydro-electricity in particular. It supports the development of wind power through its Energy Strategy 2006-2015, Hydro-Québec is actively pursuing development of Québec's hydroelectric

Rosei, Federico


Energy Education & Workforce Development: Energy 101 Undergraduate...  

NLE Websites -- All DOE Office Websites (Extended Search)

101 Undergraduate Course Framework: Teaching the Fundamentals of Energy Energy 101 Outline. Energy 101 Science Technology Society. Introduction to Energy. Energy Basics. Energy...


Federal Energy Management Program: Energy Savings Performance...  

NLE Websites -- All DOE Office Websites (Extended Search)

of Energy - Energy Efficiency and Renewable Energy Federal Energy Management Program Energy Savings Performance Contracts Laws and Regulations Legislation authorizing energy...


Distributed Energy | Department of Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

Distributed Distributed Energy Distributed Energy Distributed energy consists of a range of smaller-scale and modular devices designed to provide electricity, and sometimes also thermal energy, in locations close to consumers. They include fossil and renewable energy technologies (e.g., photovoltaic arrays, wind turbines, microturbines, reciprocating engines, fuel cells, combustion turbines, and steam turbines); energy storage devices (e.g., batteries and flywheels); and combined heat and power systems. Distributed energy offers solutions to many of the nation's most pressing energy and electric power problems, including blackouts and brownouts, energy security concerns, power quality issues, tighter emissions standards, transmission bottlenecks, and the desire for greater control over energy costs.


Gravitational energy  

E-Print Network (OSTI)

Observers at rest in a stationary spacetime flat at infinity can measure small amounts of rest-mass+internal energies+kinetic energies+pressure energy in a small volume of fluid attached to a local inertial frame. The sum of these small amounts is the total "matter energy" for those observers. The total mass-energy minus the matter energy is the binding gravitational energy. Misner, Thorne and Wheeler evaluated the gravitational energy of a spherically symmetric static spacetime. Here we show how to calculate gravitational energy in any static and stationary spacetime for isolated sources with a set of observers at rest. The result of MTW is recovered and we find that electromagnetic and gravitational 3-covariant energy densities in conformastatic spacetimes are of opposite signs. Various examples suggest that gravitational energy is negative in spacetimes with special symmetries or when the energy-momentum tensor satisfies usual energy conditions.

Joseph Katz



Energy Efficiency | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Resources » Energy Resource Library » Energy Efficiency Resources » Energy Resource Library » Energy Efficiency Energy Efficiency Below are resources for Tribes on energy efficiency. Energy Efficiency Opportunities at USDA Provides an overview of the various programs at the U.S. Department of Agriculture (USDA) that address energy use in rural America. The paper examines changes to existing energy efficiency programs proposed in both the House and Senate versions of the Farm Bill, and offers a set of recommendations to make energy efficiency resources at USDA more accessible. Source: American Council for an Energy-Efficient Economy. Energy Planning: A Guide for Northwest Indian Tribes Information and resources to help Tribes select, implement, and finance projects that conserve energy, generate renewable energy, construct and


Energy News | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

27,777,600 for Local Energy 27,777,600 for Local Energy Efficiency Improvements in Utah Block Grants to Support Jobs, Cut Energy Bills, and Increase Energy Independenc March 26, 2009 Obama Administration Announces Additional $27,172,500 for Local Energy Efficiency Improvements in Oklahoma Block Grants to Support Jobs, Cut Energy Bills, and Increase Energy Independence March 26, 2009 Obama Administration Announces Additional $12,522,900 for Local Energy Efficiency Improvements in New Hampshire Block Grants to Support Jobs, Cut Energy Bills, and Increase Energy Independence March 26, 2009 Obama Administration Announces Additional $12,019,800 for Local Energy Efficiency Improvements in Wyoming Block Grants to Support Jobs, Cut Energy Bills, and Increase Energy Independence March 26, 2009 Obama Administration Announces Additional $208,759,900 for Local Energy


Events - Energy Innovation Portal  

Energy Innovation Portal Technologies. ... Building Energy Efficiency; Electricity Transmission; Energy Analysis; Energy Storage; Geothermal; Hydrogen ...


Tidal Energy  

Office of Scientific and Technical Information (OSTI)

into Wave and Tidal Ocean Power: 15% Water Power by 2030, Energy.gov News Assessment of Energy Production Potential from Tidal Streams in the United States, Energy Citations...


Energy Basics  

Energy.gov (U.S. Department of Energy (DOE))

The EERE Energy Basics website contains basics about renewable energy and energy efficiency technologies. Learn how they work, what they're used for, and how they can improve our lives, homes,...


Energy Literacy  

NLE Websites -- All DOE Office Websites (Extended Search)

for Energy Education A Framework for Energy Education for Learners of All Ages Intended use of this document as a guide includes, but is not limited to, formal and informal energy...


Energy Audits | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Audits Energy Audits Energy Audits September 9, 2008 - 11:30am Addthis John Lippert What does this mean for me? Energy audits can help you determine whether your home wastes energy, and pinpoint where energy is lost -- so you can evaluate what measures you can take to make your home more energy efficient. Autumn officially begins soon, and with it comes cooler weather and fewer hours of daylight. Fall is a great time to start thinking of a home energy audit so that you can prepare your home for winter, saving energy and money in the process. The main purpose of an energy audit is to determine whether your home wastes energy, and to pinpoint where energy is being lost so you can evaluate what measures you can take to make your home more energy efficient. Audits also determine the efficiency of your home's heating


Energy News | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

31,577,900 for Local Energy 31,577,900 for Local Energy Efficiency Improvements in Alabama Block Grants to Support Jobs, Cut Energy Bills, and Increase Energy Independence March 26, 2009 Obama Administration Announces Additional $12,810,300 for Local Energy Efficiency Improvements in North Dakota Block Grants to Support Jobs, Cut Energy Bills, and Increase Energy Independence March 26, 2009 Obama Administration Announces Additional $24,522,900 for Local Energy Efficiency Improvements in Connecticut Block Grants to Support Jobs, Cut Energy Bills, and Increase Energy Independence March 26, 2009 Obama Administration Announces Additional $42,380,100 for Local Energy Efficiency Improvements in Indiana Block Grants to Support Jobs, Cut Energy Bills, and Increase Energy Independence March 26, 2009


Energy News | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

26, 2012 26, 2012 U.S. Department of Energy and the MIT Energy Initiative Announce a Women in Clean Energy Program for United States At the Third Clean Energy Ministerial in London today, the U.S. Department of Energy announced a three-part plan to help implement the Clean Energy Education and Empowerment initiative or "C3E" - a Ministerial program aimed at attracting more women to clean energy careers and supporting their advancement into leadership positions. April 26, 2012 Coalition of World Energy Ministers Commit to Improvements in Energy Efficiency, Renewable Energy, Energy Access Leaders from the 23-government Clean Energy Ministerial (CEM) and the UN Secretary-General's Sustainable Energy for All initiative (SE4All) outlined specific commitments by participating countries and private sector


Energy News | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

102,508,400 for Local Energy 102,508,400 for Local Energy Efficiency Improvements in Pennsylvania Block Grants to Support Jobs, Cut Energy Bills, and Increase Energy Independence March 26, 2009 Obama Administration Announces Additional $56,099,900 for Local Energy Efficiency Improvements in Washington Block Grants to Support Jobs, Cut Energy Bills, and Increase Energy Independenc March 26, 2009 Obama Administration Announces Additional $20,608,300 for Local Energy Efficiency Improvements in New Mexico Block Grants to Support Jobs, Cut Energy Bills, and Increase Energy Independence March 26, 2009 Obama Administration Announces Additional $67,187,600 for Local Energy Efficiency Improvements in Georgia Block Grants to Support Jobs, Cut Energy Bills, and Increase Energy Independence March 26, 2009


Energy Audits | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Audits Energy Audits Energy Audits September 9, 2008 - 11:30am Addthis John Lippert What does this mean for me? Energy audits can help you determine whether your home wastes energy, and pinpoint where energy is lost -- so you can evaluate what measures you can take to make your home more energy efficient. Autumn officially begins soon, and with it comes cooler weather and fewer hours of daylight. Fall is a great time to start thinking of a home energy audit so that you can prepare your home for winter, saving energy and money in the process. The main purpose of an energy audit is to determine whether your home wastes energy, and to pinpoint where energy is being lost so you can evaluate what measures you can take to make your home more energy efficient. Audits also determine the efficiency of your home's heating


HLT Energies 2006 Inc formerly HLT Energies Inc Heliotech Energies...  

Open Energy Info (EERE)

HLT Energies 2006 Inc formerly HLT Energies Inc Heliotech Energies Inc Canada Inc Jump to: navigation, search Name HLT Energies 2006 Inc (formerly HLT Energies Inc, Heliotech...

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Nuclear Energy Enabling Technologies | Department of Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Enabling Technologies Nuclear Energy Enabling Technologies Nuclear Energy Enabling Technologies The Nuclear Energy Enabling Technologies (NEET) Program will develop...


Barron Electric Cooperative - Energy Star Appliance & Energy...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Barron Electric Cooperative - Energy Star Appliance & Energy Efficient Lighting Rebate Program Barron Electric Cooperative - Energy Star Appliance & Energy Efficient Lighting...


Energy Policy  

NLE Websites -- All DOE Office Websites (Extended Search)

Wind turbines Energy Policy Energy policy research at the Lawrence Berkeley National Laboratory covers a wide range of topics from the development of policy strategies to encourage...


Renewable Energy  

Energy.gov (U.S. Department of Energy (DOE))

Learn how the Energy Department's investments in clean, renewable energy technologies -- including wind, solar and geothermal sources -- are helping strengthen the American economy.


Energy Analysis  

Energy.gov (U.S. Department of Energy (DOE))

Energy analysis informs EERE decision-making by delivering analytical products in four main areas: Data Resources, Market Intelligence, Energy Systems Analysis, and Portfolio Impacts Analysis.


Energy Outlook  

U.S. Energy Information Administration (EIA) Indexed Site

Energy Outlook For NY Energy Forum October 29, 2013 | New York, NY By Adam Sieminski, Administrator Agenda * Winter Fuels Outlook * Drilling Productivity Report * Geopolitical...


Energy Technologies  

NLE Websites -- All DOE Office Websites (Extended Search)

Advanced sensors through laser ablation and ultrasonics; advanced materials and nanotechnology for clean energy. Batteries and Fuel Cells Buildings Energy Efficiency Electricity...


Solar Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy-linked challenges: * Energy price volatility * Dependence on and cost of imported fossil fuels * Potential fossil fuel supply constraints * Health & environmental impacts *...


International Energy Statistics - Energy Information Administration  

U.S. Energy Information Administration (EIA)

> Countries > International Energy Statistics: International Energy Statistics; Petroleum. ... Total Primary Energy Consumption (Quadrillion Btu) Loading ...


Energy Economy | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Economy Energy Economy Energy Economy January 6, 2014 The Clean Energy Economy in Three Charts Over the last five years, American inventors and investors have made significant progress in developing and deploying key clean energy technologies -- supported by Energy Department policies. December 3, 2013 Additional Funding & Financing Resources Want to know more about funding and financing for energy projects and businesses? Check out general resources at the Energy Department and other parts of the federal government. December 3, 2013 Funding & Financing for Energy Businesses Do you own or represent an energy business? Learn about funding and financing resources from the Energy Department and other U.S. government agencies. November 15, 2013 Energy Department Authorizes Additional Volume at Proposed Freeport LNG


Energy News | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

6, 2009 6, 2009 Obama Administration Announces Additional $75,468,200 for Local Energy Efficiency Improvements in New Jersey Block Grants to Support Jobs, Cut Energy Bills, and Increase Energy Independence March 26, 2009 Obama Administration Announces Additional $15,068,200 for Local Energy Efficiency Improvements in Hawaii Block Grants to Support Jobs, Cut Energy Bills, and Increase Energy Independence March 26, 2009 Obama Administration Announces Additional $24,624,200 for Local Energy Efficiency Improvements in Louisiana Block Grants to Support Jobs, Cut Energy Bills, and Increase Energy Independence March 26, 2009 Obama Administration Announces Additional $10,323,300 for Local Energy Efficiency Improvements in Vermont Block Grants to Support Jobs, Cut Energy Bills, and Increase Energy


Energy Efficiency | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8, 2010 Saving Energy and Money Starts at Home Video: Why a home energy assessment is so crucial to saving serious serious money. July 27, 2010 Tribe's Headquarters Gets Energy...


Energy Economy | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

August 28, 2013 August 28, 2013 Photo from the Energy Department archive. Energy Department Releases New Clean Energy Finance Guide A new resource can help state, local and tribal governments -- and their partners in the private sector -- find financing for energy efficiency and renewable energy projects. August 28, 2013 Federal Finance Facilities Available for Energy Efficiency Upgrades and Clean Energy Deployment "Federal Finance Facilities Available for Energy Efficiency Upgrades and Clean Energy Deployment" is a resource guide that lists the various federal financing programs for which energy efficiency and clean energy qualify - meant to make it easier for state, local and tribal leaders, along with their partners in the private sector, to find capital for energy


Energy Blog | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy.gov » Energy Blog Energy.gov » Energy Blog Energy Blog RSS October 24, 2008 2009 Fuel Economy Guide and FuelEconomy.gov Learn about the 2009 Fuel Economy Guide here. October 21, 2008 Purchasing a New Energy-Efficient Central Heating System Think you know heating systems? Check this out before purchasing a new one. October 16, 2008 Question of the Week: What Have You Done to Improve Your Windows? Share your thoughts on window efficiency upgrades with us! October 15, 2008 Improving the Energy Efficiency of Existing Windows Make your windows more efficient and save energy and money. October 13, 2008 Purchasing Energy-Efficient Windows Need help shopping for energy efficient windows? Look here. October 9, 2008 Question of the Week: Besides Cost, What Motivates You to Save Energy? Share your thoughts on saving energy.


Energy Speeches | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy.gov » Energy Speeches Energy.gov » Energy Speeches Energy Speeches RSS June 18, 2013 Testimony Before the House Committee on Science, Space, and Technology Secretary Moniz's full written testimony prepared for the House Committee on Science, Space, and Technology. June 13, 2013 Testimony Before the House Committee on Energy and Commerce Subcommittee on Energy and Power Secretary Moniz's full written testimony prepared for the House Committee on Energy and Commerce, Subcommittee on Energy and Power. November 30, 2012 Hurricane Sandy and Our Energy Infrastructure Acting Under Secretary of Energy David Sandalow's remarks, as delivered, at the Columbia University Energy Symposium on November 30, 2012. September 18, 2012 Secretary Chu's Remarks at the 2012 IAEA General Conference -- As Prepared


ENERGY STAR | Open Energy Information  

Open Energy Info (EERE)

ENERGY STAR ENERGY STAR Jump to: navigation, search Logo: ENERGY STAR Name ENERGY STAR Year founded 1992 Notes Partnered with more than 20,000 public sector organizations. Website https://www.energystar.gov/ind References About ENERGY STAR[1] LinkedIn Connections Contents 1 About ENERGY STAR 1.1 For the Home 1.2 For Business 1.3 References About ENERGY STAR ENERGY STAR is a joint program of the U.S. Environmental Protection Agency and the U.S. Department of Energy helping us all save money and protect the environment through energy efficient products and practices. Results are already adding up. Americans, with the help of ENERGY STAR, saved enough energy in 2010 alone to avoid greenhouse gas emissions equivalent to those from 33 million cars - all while saving nearly $18 billion on their


Refex Energy | Open Energy Information  

Open Energy Info (EERE)

Refex Energy Jump to: navigation, search Name Refex Energy Place Tamil Nadu, India Zip 600017 Sector Wind energy Product Part of the refrigeration major Refex Group, plans to set...


Energy News | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

in Half September 8, 2011 Department of Energy Awards 43 Million to Spur Offshore Wind Energy Washington, D.C. - U.S. Energy Secretary Steven Chu today announced 43 million...


Fossil Energy | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Fossil Energy Fossil Energy Below are resources for Tribes on fossil energy. Sales of Fossil Fuels Produced from Federal and Indian Lands, FY 2003 through FY 2011 This paper...


Dei Energy | Open Energy Information  

Open Energy Info (EERE)

OpenEI by expanding it. Dei Energy is a company located in Bulgaria . References "Dei Energy" Retrieved from "http:en.openei.orgwindex.php?titleDeiEnergy&oldid344129"...

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Second Line of Defense, Megaports Initiative, Operational Testing and Evaluation Plan, Port of Lazaro Cardenas, Mexico  

Science Conference Proceedings (OSTI)

The purpose of the Operational Testing and Evaluation (OT&E) phases of the project is to prepare for turnover of the Megaports System supplied by U.S. Department of Energy/National Nuclear Security Administration (DOE/NNSA)located at the Export Lanes of the Port of Lazaro Cardenas, Mexicoto the Government of Mexico (GOM).

Hughes, Jamie D.



Department of Energy - Energy Economy  


Energy Efficiency | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

July 11, 2011 Help Consumers Save Money by Saving Energy Setting the record straight on the 2007 lighting energy efficiency standards. July 11, 2011 Today's refrigerators have been...


Energy Basics: Renewable Energy Technologies  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

quality, and contribute to a strong energy economy. Learn more about: Biomass Geothermal Hydrogen Hydropower Ocean Solar Energy Wind Contacts | Web Site Policies | U.S....


Aerowatt Energies | Open Energy Information  

Open Energy Info (EERE)

Name Aerowatt Energies Place France Sector Solar, Wind energy Product France-based joint venture established to develop wind and solar projects in French territories....


Energy Systems | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Systems Energy Systems webinarsteamtrap20100605.pdf webcast2009-0827hvacefficiency.pdf webcast2009-0820whmanagephsystems.pdf More Documents & Publications New and...


Energy Information Administration - Transportation Energy ...  

U.S. Energy Information Administration (EIA)

Survey forms used by the U.S. Department of Energy (DOE) to collect energy information (e.g., gasoline prices, oil and gas reserves, coal production, etc.).


Cavallo Energy | Open Energy Information  

Open Energy Info (EERE)

Energy Place Houston, Texas Zip 77027 Sector Services, Solar Product Houston-based energy management, finance procurement and engineering company. The firm offers...


ENRO Energie | Open Energy Information  

Open Energy Info (EERE)

ENRO Energie Place Essen, Germany Zip 45128 Sector Geothermal energy Product Germany-based company engaged in the design and construction of geothermal power plants. References...


African Energy | Open Energy Information  

Open Energy Info (EERE)

African Energy Place Scottsdale, Arizona Zip 85267 Sector Solar Product African Energy is a wholesale distributor of back-up and solar power equipment, exclusively for Africa....


Energy Efficiency | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

of Energy, the American Lighting Association (ALA), and the Consortium for Energy Efficiency (CEE), announced this week the winners of the eighth-annual Lighting for Tomorrow...


Energy Efficiency | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

of Texas Industries of the FutureDave Bray Manufacturing Plants Incorporate Energy Efficiency into Business Model Four Texas-based manufacturing plants are adopting robust energy...


Energy Efficiency | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

draws from technologies and strategies in residential efficiency and renewable energy developed through the Energy Department's Building America program. His class' first...


Energy Efficiency | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Wisconsin nature center will be at the forefront in demonstrating the latest energy efficiency and renewable energy technologies to thousands of visitors every year. January 19,...


Energy Efficiency | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Houck Low E Brings High Savings in Newark, Delaware Newark, Delaware used an Energy Efficiency and Conservation Block Grant to install energy efficient windows and lights. July...


Energy Basics: Wind Energy Technologies  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Photo of a hilly field, with six visible wind turbines spinning in the wind. Wind energy technologies use the energy in wind for practical purposes such as generating...


Insource Energy | Open Energy Information  

Open Energy Info (EERE)

search Name Insource Energy Place England, United Kingdom Sector Biomass Product The energy and waste management business provides biomass boilers and anaerobic digestion...


Cleanstar Energy | Open Energy Information  

Open Energy Info (EERE)

Cleanstar Energy Jump to: navigation, search Name Cleanstar Energy Place India Sector Biofuels Product CleanStar is biofuels research and producer in land that is not appropriate...


Altostrata Energy | Open Energy Information  

Open Energy Info (EERE)

Name Altostrata Energy Place England, United Kingdom Product London-based cleantech investment and advisory firm. References Altostrata Energy1 LinkedIn Connections CrunchBase...


Land Energy | Open Energy Information  

Open Energy Info (EERE)

Product A renewable-energy company focussed on harnessing biomass. Activities include wood-pellet production, biomass-combined heat and power and forestry and energy-crop...

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Energy Efficiency | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Competition Philips Product Delivers on Department's Challenge to Replace Common Light Bulb with Energy-Saving Lighting Alternative August 1, 2011 Department of Energy...


Winch Energy | Open Energy Information  

Open Energy Info (EERE)

Page Edit with form History Facebook icon Twitter icon Winch Energy Jump to: navigation, search Name Winch Energy Place Cavalaire Sur Mer, France Zip 83240 Sector Solar Product...


Wave Energy | Open Energy Information  

Open Energy Info (EERE)

TODO: Add description List of Wave Energy Incentives Retrieved from "http:en.openei.orgwindex.php?titleWaveEnergy&oldid267203" Category: Articles with outstanding TODO tasks...


Tidal Energy | Open Energy Information  

Open Energy Info (EERE)

Add description List of Tidal Energy Incentives Retrieved from "http:en.openei.orgwindex.php?titleTidalEnergy&oldid267201" Category: Articles with outstanding TODO tasks...


BRI Energy | Open Energy Information  

Open Energy Info (EERE)

Energy Place Studio City, California Zip 91604-4207 Sector Biomass Product Developer of a biomass to electricity and ethanol technology References BRI Energy1 LinkedIn...


Energy Saver | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Skip to main content Energy.gov Search form Search Energy.gov Public Services Tax Credits, Rebates & Savings Homes Vehicles Building Design Manufacturing National Security & Safety...


SWERA: In the Case of Renewable Energy, Knowledge IS Power | OpenEI  

Open Energy Info (EERE)

SWERA: In the Case of Renewable Energy, Knowledge IS Power SWERA: In the Case of Renewable Energy, Knowledge IS Power Dataset Summary Description (Abstract): Information document including preliminary impact in countries so far assessed. (Purpose): SWERA Information Source UNEP Date Released May 01st, 2005 (9 years ago) Date Updated November 07th, 2007 (7 years ago) Keywords documentation renewable energy solar SWERA UNEP wind Data application/pdf icon Download Document (pdf, 4.1 MiB) Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Time Period 2002 License License Open Data Commons Attribution License Comment Please cite publication as follows: UNEP Rate this dataset Usefulness of the metadata Average vote Your vote Usefulness of the dataset Average vote Your vote Ease of access


EA 1714: Final Environmental Assessment | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EA 1714: Final Environmental Assessment EA 1714: Final Environmental Assessment EA 1714: Final Environmental Assessment Toda America, Incorporated Electric Drive Vehicle Battery and Component Manufacturing Initiative Project Battle Creek, MI The U.S. Department of Energy (DOE) proposes, through a cooperative agreement with Toda America, Incorporated (Toda) to partially fund the construction of a manufacturing plant to produce oxide materials for cathodes for lithium-ion batteries. The plant would be constructed within an existing industrial park in Battle Creek, Michigan. This plant would support the anticipated growth in the lithium-ion battery industry and, more specifically, the electric drive vehicle (EDV) industry and hybrid-electric vehicle (HEV) industry. If approved, DOE would provide



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

"",. "",. u.s. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NFPA DETERMINATION RECIPI[NT: Michigan Biotechnology Institute d/b/a MBt Intemational STATE: MI PROJECT TITLE: Process Improvements to Biomass Pretreatment for Fuels and Chemicals Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-EEOOOO5071 DE-EEOOO5071 GF().{)()()5071.()()1 0 Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4SI.IA), I have made the follo,,"ing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 83.6 Siting, construction (or modification). operation, and decommissioning of facilities for indoor bench-scale research


Wave Energy  

Energy.gov (U.S. Department of Energy (DOE))

Wave energy technologies extract energy directly from surface waves or from pressure fluctuations below the surface. Renewable energy analysts believe there is enough energy in ocean waves to provide up to 2 terawatts of electricity. (A terawatt is equal to a trillion watts.)


Energy Economy  

Energy.gov (U.S. Department of Energy (DOE))

Energy is beneficial to America's economy, creating jobs and reducing our dependence on foreign oil.


Federal Energy Management Program: Office Energy Checklist  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Checklist to someone by E-mail Share Federal Energy Management Program: Office Energy Checklist on Facebook Tweet about Federal Energy Management Program: Office Energy...


Energy Basics: Ocean Thermal Energy Conversion  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Energy Basics Renewable Energy Printable Version Share this resource Biomass Geothermal Hydrogen Hydropower Ocean Ocean Thermal Energy Conversion Tidal Energy Wave Energy...


Federal Energy Management Program: Energy Action Month  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Action Month to someone by E-mail Share Federal Energy Management Program: Energy Action Month on Facebook Tweet about Federal Energy Management Program: Energy Action Month...


Solar Energy Technologies | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Solar Energy Technologies Solar Energy Technologies August 16, 2013 - 4:37pm Addthis Solar energy technologies produce electricity from the energy of the sun. Small solar energy...


Solar Energy Potential | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Potential Solar Energy Potential Solar Energy Potential Addthis Browse By Topic TOPICS Energy Efficiency ---Home Energy Audits --Design & Remodeling -Vehicles --Alternative...


Department of Energy Facilities | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Person Solar Energy Potential Solar Energy Potential Renewable Energy Production By State Renewable Energy Production By State 2009 Total Energy Production by State 2009 Total...


Energy Refits in Philadelphia | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Person Solar Energy Potential Solar Energy Potential Renewable Energy Production By State Renewable Energy Production By State 2009 Total Energy Production by State 2009 Total...


Federal Energy Management Program: Home Energy Checklist  

NLE Websites -- All DOE Office Websites (Extended Search)

Home Energy Checklist to someone by E-mail Share Federal Energy Management Program: Home Energy Checklist on Facebook Tweet about Federal Energy Management Program: Home Energy...


Federal Energy Management Program: Energy Savings Performance...  

NLE Websites -- All DOE Office Websites (Extended Search)

of Energy - Energy Efficiency and Renewable Energy Federal Energy Management Program Energy Savings Performance Contract Federal Financing Specialists FEMP's Federal financing...

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tribal Renewable Energy Foundational Course: Strategic Energy...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Renewable Energy Foundational Course: Strategic Energy Planning Tribal Renewable Energy Foundational Course: Strategic Energy Planning Watch the U.S. Department of Energy Office of...


Advanced Renewable Energy | Open Energy Information  

Open Energy Info (EERE)

Renewable Energy Jump to: navigation, search Name Advanced Renewable Energy Place Italy Sector Biomass, Renewable Energy, Wind energy Product Advanced Renewable Energy Ltd combines...


Tierra Energy | Open Energy Information  

Open Energy Info (EERE)

Tierra Energy Tierra Energy Jump to: navigation, search Name Tierra Energy Place Austin, Texas Zip 78731 Sector Wind energy Product Tierra Energy is an energy company based in Austin, Texas, that is building a portfolio of windpower and natural gas-fired power generation projects. References Tierra Energy[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Tierra Energy is a company located in Austin, Texas . References ↑ "Tierra Energy" Retrieved from "http://en.openei.org/w/index.php?title=Tierra_Energy&oldid=352280" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link


Energy Saver | Department of Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

Save Energy, Save Money Save Energy, Save Money Home Heating Infographic Everything you need to know about home heating, including how heating systems work, the different types on the market and proper maintenance. Read more Fall and Winter Energy-Saving Tips Simple and inexpensive actions can help you save energy and money when the weather is cool. Check out tips for saving energy and money this fall and winter. Read more New PSAs Share Tips for Saving Energy The Energy Department partnered with the Ad Council to create PSAs that offer practical, no-cost actions that both homeowners and renters can take to save money on their energy bills. Read more Energy Efficiency Tax Credits to Consider for 2013 Did you miss the energy efficiency and renewable energy tax credits for 2012? Learn how you can take advantage of them this year.


Energy Basics | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Services » Energy Basics Services » Energy Basics Energy Basics The basics about renewable energy and energy efficiency technologies: learn how they work, what they're used for, and how they can improve our lives, homes, businesses, and industries. The basics about renewable energy and energy efficiency technologies: learn how they work, what they're used for, and how they can improve our lives, homes, businesses, and industries. RENEWABLE ENERGY TECHNOLOGIES Biomass Technology Basics Geothermal Technology Basics Hydrogen and Fuel Cell Technology Basics Hydropower Technology Basics Ocean Energy Technology Basics Solar Energy Technology Basics Wind Energy Technology Basics More HOME & BUILDING TECHNOLOGIES Lighting and Daylighting Basics Passive Solar Building Design Basics Space Heating and Cooling Basics


Energy Saver | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Save Energy, Save Money Save Energy, Save Money Home Heating Infographic Everything you need to know about home heating, including how heating systems work, the different types on the market and proper maintenance. Read more Fall and Winter Energy-Saving Tips Simple and inexpensive actions can help you save energy and money when the weather is cool. Check out tips for saving energy and money this fall and winter. Read more New PSAs Share Tips for Saving Energy The Energy Department partnered with the Ad Council to create PSAs that offer practical, no-cost actions that both homeowners and renters can take to save money on their energy bills. Read more Energy Efficiency Tax Credits to Consider for 2013 Did you miss the energy efficiency and renewable energy tax credits for 2012? Learn how you can take advantage of them this year.



Gasoline and Diesel Fuel Update (EIA)

(93) (93) ANNUAL ENERGY OUTLOOK 1993 With Projections to 2010 EIk Energy Information Administration January 1993 For Further Information ... The Annual Energy Outlook (AEO) is prepared by the Energy Information Administration (EIA), Office of Integrated Analysis and Forecasting, under the direction of Mary J. Hutzler (202/586-2222). General questions concerning energy demand or energy markets may be addressed to Mark E. Rodekohr (202/586-1130), Director of the Energy Demand and Integration Division. General questions regarding energy supply and conversion activities may be addressed to Mary J. Hutzler (202/586-2222), Acting Director of the Energy Supply and Conversion Division. Detailed questions may be addressed to the following EIA analysts: Framing the 1993 Energy Outlook ............. Susan H. Shaw (202/586-4838)



E-Print Network (OSTI)

CALIFORNIA ENERGY COMMISSION CALIFORNIA'S STATE ENERGY EFFICIENT APPLIANCE REBATE PROGRAM INITIAL November 2009 CEC-400-2009-026-CMD Arnold Schwarzenegger, Governor #12;#12;CALIFORNIA ENERGY COMMISSION Program Manager Paula David Supervisor Appliance and Process Energy Office Valerie T. Hall Deputy Director


Energy Blog | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

23, 2012 23, 2012 Breaking down the latest Clean Energy Roundup from the Environmental Entrepreneurs. More details here. | Infographic by Sarah Gerrity. INFOGRAPHIC | Made in America: Clean Energy Jobs As the clean energy economy grows -- thousands of clean energy job opportunities are being created all across the country. August 23, 2012 New Report Highlights Growth of America's Clean Energy Job Sector Taking a moment to break-down key findings from the latest Clean Energy Jobs Roundup. August 21, 2012 Solar Energy for All: How-To Guides Encourage Growth of Solar Communities How to join forces with your neighbors to start a community shared solar project. August 20, 2012


Energy Blog | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

December 2, 2008 December 2, 2008 Tips to Save Energy During the Holidays Tips to help you save energy and money, even as you celebrate the holidays. November 25, 2008 Saving Energy Is a Lifestyle, Not a Diet Why saving energy should be important to you. November 20, 2008 Question of the Week: What Kind of Heating System Do You Have in Your Home? What kind of heating system do you have in your home? November 18, 2008 Energy Resources for Students and Teachers The Office of Energy Efficiency and Renewable Energy has resources to help students research that report or teachers set up lesson plans. November 13, 2008 Question of the Week: What Do You Do to Save Energy? Since we started this blog, much of our focus has been on winter energy savings and the steps you can take specifically to save energy in the


Energy Insight | Open Energy Information  

Open Energy Info (EERE)

Energy Insight Energy Insight Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Energy Insight Agency/Company /Organization: Tendril Connect Sector: Energy Focus Area: Energy Efficiency Resource Type: Software/modeling tools User Interface: Website Website: greenbuttonconnect.com/home Web Application Link: greenbuttonconnect.com/apps/energyinsight/? OpenEI Keyword(s): Green Button Apps Language: English Energy Insight Screenshot References: Tendril[1] Green Button Connect[2] Logo: Energy Insight An application that analyzes and presents your energy data in easy-to-understand charts. Energy Insight enables you to dynamically sort the chart data using a variety of time periods: hourly, daily, monthly. In addition to the charts, the Energy Insight application can display your


Home Energy Yardstick : ENERGY STAR  

NLE Websites -- All DOE Office Websites (Extended Search)

Home > Home Improvement > Home Energy Yardstick Home > Home Improvement > Home Energy Yardstick Home Energy Yardstick Assess the energy efficiency of your home and see how it measures up: EPA's Home Energy Yardstick provides a simple assessment of your home's annual energy use compared to similar homes. By answering a few basic questions about your home, you can get: Your home's Home Energy Yardstick score (on a scale of 1 to 10); Insights into how much of your home's energy use is related to heating and cooling versus other everyday uses like appliances, lighting, and hot water; Links to guidance from ENERGY STAR on how to increase your home's score, improve comfort, and lower utility bills; and An estimate of your home's annual carbon emissions. Learn more about how the Home Energy Yardstick works.


Energy News | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

September 25, 2013 September 25, 2013 New Energy Dept., Berkeley Lab Report on Energy Service Company Industry Growth Report Details Market Size and Industry Trends in Energy Savings Performance-Based Contracting September 25, 2013 U.S. Manufacturers Save $1 Billion, 11 Million Tons of CO2 through Energy Efficiency Investments Energy Department Releases Progress Update on Better Buildings, Better Plants Program September 20, 2013 Energy Department Invests $60 Million to Train Next Generation Nuclear Energy Leaders, Pioneer Advanced Nuclear Technology Building on President Obama's Climate Action Plan to continue America's leadership in clean energy innovation, the Energy Department announced more than $60 million in nuclear energy research awards and improvements to university research reactors and infrastructure.


ENERGY STAR® | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Appliance & Equipment Standards » ENERGY STAR® Appliance & Equipment Standards » ENERGY STAR® ENERGY STAR® ENERGY STAR® is a joint program of the Environmental Protection Agency (EPA) and the Department of Energy (DOE). Its goal is to help consumers, businesses, and industry save money and protect the environment through the adoption of energy efficient products and practices. The ENERGY STAR label identifies top performing, cost-effective products, homes, and buildings. Since inception, ENERGY STAR has shown impressive results: in 2010 Americans saved enough energy to avoid greenhouse gas emissions equivalent to those from 33 million cars, while saving nearly $18 billion on utility bills. A Memorandum of Understanding between EPA and DOE on improving the energy efficiency of products and buildings establishes working arrangements to


Zero Energy Windows  

E-Print Network (OSTI)

DOE Office of Energy Efficiency and Renewable Energy (2005).Office of Energy Efficiency and Renewable Energy. : http://for Energy Efficiency and Renewable Energy, Building

Arasteh, Dariush; Selkowitz, Steve; Apte, Josh; LaFrance, Marc



Energy News  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

news-archive 1000 Independence Ave. SW Washington DC news-archive 1000 Independence Ave. SW Washington DC 20585 202-586-5000 en Energy Department Launches Competition to Encourage the Creation of Innovative Energy Apps Built with Open Data http://energy.gov/articles/energy-department-launches-competition-encourage-creation-innovative-energy-apps-built-open energy-department-launches-competition-encourage-creation-innovative-energy-apps-built-open" class="title-link">Energy Department Launches Competition to Encourage the Creation of Innovative Energy Apps Built with Open Data



NLE Websites -- All DOE Office Websites (Extended Search)

New Energy Technology 2754 Compass Drive, Grand Junction, CO 81506 Business: Energy Management Services/Consulting Sarah Faverman Phone: 970-243-0255 / Fax: 970-245-4268 Email: sarah@newenergytech.net Customer JCPenney Company, Inc. 6501 Legacy Drive, Plano, TX 75024 Business: Retail Rob Keller, P.E., Energy Management & Engineering Services Director Phone: 972-431-1788 / Fax: 972-531-1788 Email: rkeller@jcpenney.com New Energy Technology helped JCPenney earn the first ENERGY STAR labels for retail buildings and Partner of the Year Award. Project Scope New Energy Technology (NET) supports JCPenney's (JCP) energy conservation culture through three programs focused on high-quality energy data and energy management. Through its automated benchmarking


Energy Conservation vs. Energy Efficiency  

Science Conference Proceedings (OSTI)

Energy conservation is considered by some as synonymous with energy efficiency, but to others, it has a meaning of getting fewer or lower quality energy services. The degree of confusion between these meanings varies widely by individual, culture, historic period and language spoken. In the context of this document, energy conservation means to keep from being lost or wasted; saved, and energy efficiency means the ability to produce a desired effect or product with a minimum of effort, expense or waste.

Somasundaram, Sriram



Shallow water flow is a serious drilling hazard encoun-tered across several areas of the Gulf of Mexico (GoM).  

E-Print Network (OSTI)

question: "How does fresh- water come to be near the seafloor in deepwater areas of the Gulf of Mexico extending from onshore to offshore. This option is not generally accepted by experienced Gulf of MexicoShallow water flow is a serious drilling hazard encoun- tered across several areas of the Gulf

Texas at Austin, University of


Energy Crossroads: Water & Energy | Environmental Energy Technologies...  

NLE Websites -- All DOE Office Websites (Extended Search)

as 40%. A simple, effortless and inexpensive solution for residential renovation, sustainable construction and for obtaining LEED credits as well as ENERGY STAR for New Homes...

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Energy Sources | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

9, 2013 9, 2013 Students from the University of Maryland's Designing a Sustainable World course, a class based on the Energy Department's Energy 101 Course Framework, present their end-of-year design projects. | Photo courtesy of the University of Maryland. Class Is Now in Session: Energy 101 This week, energy.gov is going back to school. Our first stop: a look at how the Energy Department's Energy 101 Course Framework is helping colleges and universities offer energy-related classes. July 11, 2013 Department of Energy Releases New Report on Energy Sector Vulnerablities Report Details Effects of Climate Change and Extreme Weather on Nation's Critical Energy Infrastructure and Supply June 21, 2013 Did you know: Incandescent light bulbs only convert about 10 percent of the energy they consume into light and the rest is released as heat. The Energy Department's Energy Bike demonstrates the physical effort it takes to power incandescent, compact fluorescent and LED light bulbs. Students from Churchill Road Elementary School in Virginia recently pedaled for power at their Earth Day assembly, learning firsthand about energy efficiency. | Photo courtesy of the Energy Department.


EIA Energy Kids - Energy Kids: Energy Information Administration  

U.S. Energy Information Administration (EIA)

Saving Energy; Recycling; History of Energy. Energy Timelines; Famous People; Calculators & Tools Games & Activities. Riddles; Slang; Puzzles; Science Fair ...


DOE-Energy 101: Energy Management Monthly Training | Open Energy...  

Open Energy Info (EERE)

DOE-Energy 101: Energy Management Monthly Training (Redirected from Energy 101 Training) Jump to: navigation, search Name Energy 101 Training AgencyCompany Organization United...


Energy 101: Energy Efficient Data Centers | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Sites Power Marketing Administration Other Agencies You are here Home Energy 101: Energy Efficient Data Centers Energy 101: Energy Efficient Data Centers Addthis...


Energy News | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

December 12, 2013 December 12, 2013 Department of Energy Releases $8 Billion Solicitation for Advanced Fossil Energy Projects The Energy Department published a solicitation today, making up to $8 billion in loan guarantee authority available to support innovative advanced fossil energy projects that avoid, reduce, or sequester greenhouse gases December 12, 2013 Energy Department Releases Grid Energy Storage Report Detailed Discussion of Benefits, Challenges, and Next Steps for Wider Adoption onto the Nation's Electric Grid December 12, 2013 Energy Department Announces $150 Million in Tax Credits to Invest in U.S. Clean Energy Manufacturing Domestic Manufacturing Projects to Support Renewable Energy Generation as well as Boost Building and Vehicle Efficiency December 11, 2013


Energy Sources | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City of Bloomington - Sustainable Development Incentives City of Bloomington - Sustainable Development Incentives The City of Bloomington offers fee waivers and other design incentives for developers that incorporate the city's sustainability goals. The city's four goals include: October 16, 2013 Boulder County - EnergySmart Commercial Energy Efficiency Rebate Program (Colorado) EnergySmart offers a full suite of energy efficiency services. EnergySmart helps businesses (and homes) identify and implement energy improvements. The "One Stop Shop" aims to reduce the hassles and hurdles associated with improving the energy efficiency and comfort of a home or business by providing an expert Energy Advisor to each participant. The Advisor assists with scheduling an energy assessment, reviewing contractor bids, and


Energy News | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

02.8 Million in 02.8 Million in Weatherization Funding and Energy Efficiency Grants for Connecticut Part of nearly $8 billion in Recovery Act funding for energy efficiency efforts nationwide that will create 100,000 jobs and cut energy bills for families March 12, 2009 Obama-Biden Administration Announces Nearly $86 Million in Weatherization Funding and Energy Efficiency Grants for Puerto Rico Part of nearly $8 billion in Recovery Act funding for energy efficiency efforts nationwide that will create 100,000 jobs and cut energy bills for families March 12, 2009 Obama-Biden Administration Announces Nearly $177 Million in Weatherization Funding and Energy Efficiency Grants for Massachusetts Part of nearly $8 billion in Recovery Act funding for energy efficiency efforts nationwide that will create 100,000 jobs and cut energy bills for


Energy Blog | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy.gov » Energy Blog Energy.gov » Energy Blog Energy Blog RSS September 27, 2010 Recovery Act is "Lighting Up" the Streets of Philadelphia The city is converting 58,000 traffic signals, which is just one of the city's energy efficiency targets. September 27, 2010 Are You Ready to Make a Difference? In the video below Secretary Chu reflects on how his high school physics teacher, Mr. Miner, aided his intellectual development and pushed him to embrace the learning process - lessons he's kept with him ever since. September 27, 2010 A worker synchronizes a traffic light on State Road A1A in St. Augustine, FL. | Energy Department Photo | Florida County Seeks to Reduce Emissions and Improve Traffic St. Johns County, Florida is tackling its traffic-timing problem with a little help from an Energy Department Energy Efficiency and Conservation


Greenpark Energy | Open Energy Information  

Open Energy Info (EERE)

Greenpark Energy Greenpark Energy Jump to: navigation, search Name Greenpark Energy Place Corbriggs, Chesterfield, England, United Kingdom Zip S41 OJW Sector Biomass Product Uk based, Green Park Energy, project developer of a planned 50MW coal bed methane/biomass power plant. References Greenpark Energy[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Greenpark Energy is a company located in Corbriggs, Chesterfield, England, United Kingdom . References ↑ "[ Greenpark Energy]" Retrieved from "http://en.openei.org/w/index.php?title=Greenpark_Energy&oldid=346104" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes


Energy Blog | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

31, 2010 31, 2010 Empowering Actions to Save Energy Across the Country Some of my favorite reminders of the rapid strides we are taking toward a clean energy future are the daily stories we feature on our Energy Empowers clean energy blog, and yesterday, we launched our brand new redesigned Energy Empowers Web site. August 30, 2010 Response to Weatherization Questions We respond to the questions about weatherization you asked on Twitter. August 30, 2010 Energy 101 Videos: Learn More About the Basics! A brand new Web site on EERE talks about the basics of how energy efficiency and renewable energy technologies work. But I wanted to point out something in particular: the Energy 101 series of videos! August 30, 2010 Allison's bus hybrid drive unit for transit buses can be found in 164 cities around the world. The company will use similar technology in the commercial truck hybrid system. | Photo courtesy of Allison Transmission


Gander Energy | Open Energy Information  

Open Energy Info (EERE)

Gander Energy Gander Energy Jump to: navigation, search Name Gander Energy Place Ontario, Canada Zip M1R 2T6 Sector Solar Product Ontario based solar power project developer. References Gander Energy[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Gander Energy is a company located in Ontario, Canada . References ↑ "Gander Energy" Retrieved from "http://en.openei.org/w/index.php?title=Gander_Energy&oldid=345654" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties About us Disclaimers Energy blogs Linked Data Developer services OpenEI partners with a broad range of international organizations to grow


Energy News | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

July 25, 2012 July 25, 2012 Agriculture and Energy Departments Announce New Investments to Drive Innovations in Biofuels and Biobased Products U.S. Departments of Agriculture and Energy announced a $41 million investment that will drive more efficient biofuels production and feedstock improvements. July 24, 2012 Obama Administration Releases Roadmap for Solar Energy Development on Public Lands As part of President Obama's all-of-the-above energy strategy, the Department of the Interior, in partnership with the Department of Energy, will publish the Final Programmatic Environmental Impact Statement (PEIS) for solar energy development in six southwestern states. July 24, 2012 Maine Deploys First U.S. Commercial, Grid-Connected Tidal Energy Project Energy Department-Supported Project Diversifies Energy Mix, Tests Promising


Definition: Energy | Open Energy Information  

Open Energy Info (EERE)

Energy Energy Broadly defined as the capacity to do work. There are many forms of energy, including: chemical, electrical, gravitational, mechanical, nuclear, radiant, and thermal energy. The official SI unit for energy is the joule (J); energy can also be measured in calories or British thermal units (Btu).[1][2][3] View on Wikipedia Wikipedia Definition In physics, energy is a conserved extensive property of a physical system, which cannot be observed directly but can be calculated from its state. Energy is of central importance in physics. It is impossible to give a comprehensive definition of energy because of the many forms it may take, but the most common definition is that it is the capacity of a system to perform work. The definition of work in physics is the movement of a force


Renewable Energy | Open Energy Information  

Open Energy Info (EERE)

Renewable Energy Renewable Energy Jump to: navigation, search This article is a stub. You can help OpenEI by expanding it. Renewable Energy is energy obtained from sources which are practically inexhaustible.[1] Prominent examples include solar energy, wind energy, and geothermal energy. The table below lists some of the conversion technologies that are used to harness the energy from these resources[2] . Renewable Resource Energy Conversion Technology Biomass, solid fuels Combustion (direct-fired, cofiring with coal); Gasification/Pyrolysis Biomass, gas and liquid fuels Fuel Cells Geothermal Dry steam electric; Flash electric; Binary cycle electric; Direct use; Geothermal heat pumps Solar Photovoltaics (PV); Concentrating solar thermal electric (parabolic trough, parabolic trough, power tower); Thermal water heating; Absorption chilling


Tuusso Energy | Open Energy Information  

Open Energy Info (EERE)

Tuusso Energy Tuusso Energy Jump to: navigation, search Name Tuusso Energy Place Seattle, Washington Zip 98122 Sector Solar Product Washington-based developer and operator of utility scale solar plants. References Tuusso Energy[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Tuusso Energy is a company located in Seattle, Washington . References ↑ "Tuusso Energy" Retrieved from "http://en.openei.org/w/index.php?title=Tuusso_Energy&oldid=380787" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties About us Disclaimers Energy blogs Linked Data Developer services


Minnesota Energy | Open Energy Information  

Open Energy Info (EERE)

Energy Energy Jump to: navigation, search Name Minnesota Energy Place Buffalo Lake, Minnesota Zip 55314 Product 21mmgy (79.5m litres/y) farmer-owned ethanol production cooperative. References Minnesota Energy[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Minnesota Energy is a company located in Buffalo Lake, Minnesota . References ↑ "Minnesota Energy" Retrieved from "http://en.openei.org/w/index.php?title=Minnesota_Energy&oldid=348849" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version Permanent link Browse properties About us Disclaimers Energy blogs Linked Data Developer services


Energy Enterprises | Open Energy Information  

Open Energy Info (EERE)

Energy Enterprises Energy Enterprises Place Mays Landing, New Jersey Zip 8330 Sector Solar Product Energy Enterprises is a licensed dealer, installer, and servicer of solar energy systems, serving residential and commercial customers primarily in southern New Jersey. References Energy Enterprises[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Energy Enterprises is a company located in Mays Landing, New Jersey . References ↑ "Energy Enterprises" Retrieved from "http://en.openei.org/w/index.php?title=Energy_Enterprises&oldid=344850" Categories: Clean Energy Organizations Companies Organizations Stubs What links here Related changes Special pages Printable version


Energy Sources | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Sources Energy Sources Energy Sources December 12, 2013 AEMC Summit Slideshow: Innovation in the Manufacturing Sector Learn how advanced technologies are helping manufacturers reduce waste, increase productivity and become leaders in the clean energy economy. October 16, 2013 West Penn Power SEF Commercial Loan Program The West Penn Power Sustainable Energy Fund (WPPSEF) promotes the use of renewable energy and clean energy among commercial, industrial, institutional and residential customers in the West Penn market region. Eligible technologies include solar, wind, low-impact hydro, and sustainable biomass such as closed-loop biomass and biomass gasification, as well as energy efficiency. October 16, 2013 UES - Renewable Energy Credit Purchase Program '''''Note: The Arizona Corporation Commission (ACC) is in the process of


Energy Blog | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1, 2013 1, 2013 This Halloween, keep ghosts and goblins at bay -- while saving energy and money -- with these home energy efficiency tricks. | Infographic by Sarah Gerrity, Energy Department. Energy Efficiency Tricks to Stop Your Energy Bill from Haunting You This Halloween don't let your energy bill give you a scare. Check out tips on ways to save energy and money at home. October 21, 2013 Learn how combined heat and power could strengthen U.S. manufacturing competitiveness, lower energy consumption and reduce harmful emissions. | Infographic by Sarah Gerrity, Energy Department. Top 10 Things You Didn't Know About Combined Heat and Power Combined heat and power could help U.S. manufacturers save money, lower


Energy Blog | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy.gov » Energy Blog Energy.gov » Energy Blog Energy Blog RSS June 29, 2011 Hybrid vehicles circle the track at Indianapolis Motor Speedway as part of the inaugural Clean Cities Stakeholder Summit The Clean Energy Race Assistant Secretary David Sandalow documents his experiences at the inaugural Clean Cities Stakeholder Summit at the Indianapolis Motor Speedway. June 29, 2011 Finding & Sharing Information about Energy Efficiency Know someone looking for efficiency tips? Now you can send them to our Stay Cool, Save Money campaign. June 29, 2011 Our Energy Independence - A Live Chat With Dr. Arun Majumdar Join Dr. Arun Majumdar at 2 PM ET for a live, two-way conversation about the investments we're making to build the clean energy infrastructure of the future. June 29, 2011 Los Alamos National Laboratory: Las Conchas Fire Update

Note: This page contains sample records for the topic "mi gom energy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Energy Blog | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

14, 2013 14, 2013 Secretary Moniz, Ambassadors of the Minorities in Energy Initiative, and panelists attend the White House Forum on Minorities in Energy. View additional photos from the event by checking out our latest slideshow. | Photo by Matty Greene, Energy Department. At the White House, Engaging in a Dialogue on Diversity and Energy Announcing the Ambassadors of the Minorities in Energy Initiative -- a group of thought leaders committed to promoting diversity and inclusion in the energy field. November 14, 2013 At the Energy Department's Pacific Northwest National Laboratory (PNNL), researchers are using two modular homes to test energy-efficient products and calculate their energy savings. Researchers test new technologies in the Experimental home (pictured above), while the Baseline home (not pictured) serves as a control and doesn't get changed during any of the experiments. | Photo courtesy of PNNL.


Energy Sources | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

July 20, 2011 July 20, 2011 Today's Forecast: Improved Wind Predictions Accurate weather forecasts are critical for making energy sources -- including wind and solar -- dependable and predictable. July 8, 2011 Energy Matters Mailbag This edition of the mailbag tackles follow-up questions from our Energy Matters discussion on breaking our reliance on foreign oil. June 30, 2011 Energy Matters: Our Energy Independence June 22, 2011 Distributed Energy Distributed energy consists of a range of smaller-scale and modular devices designed to provide electricity, and sometimes also thermal energy, in locations close to consumers. They include fossil and renewable energy technologies (e.g., photovoltaic arrays, wind turbines, microturbines, reciprocating engines, fuel cells, combustion turbines, and steam


Energy Blog | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy.gov » Energy Blog Energy.gov » Energy Blog Energy Blog RSS August 31, 2010 Empowering Actions to Save Energy Across the Country Some of my favorite reminders of the rapid strides we are taking toward a clean energy future are the daily stories we feature on our Energy Empowers clean energy blog, and yesterday, we launched our brand new redesigned Energy Empowers Web site. August 30, 2010 Response to Weatherization Questions We respond to the questions about weatherization you asked on Twitter. August 30, 2010 Energy 101 Videos: Learn More About the Basics! A brand new Web site on EERE talks about the basics of how energy efficiency and renewable energy technologies work. But I wanted to point out something in particular: the Energy 101 series of videos! August 30, 2010 Allison's bus hybrid drive unit for transit buses can be found in 164 cities around the world. The company will use similar technology in the commercial truck hybrid system. | Photo courtesy of Allison Transmission


(Energy Efficiency)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Joint Statement by G8 Energy Ministers Joint Statement by G8 Energy Ministers Aomori, Japan on 8 June 2008 Energy Ministers of the G8 met in Aomori, Japan on 8 June 2008, in conjunction with the Energy Ministers' Meeting of G8, the People's Republic of China, India and the Republic of Korea. We welcome its joint statement. The G8 Energy Ministers extend the following additional messages to contribute to fruitful discussion in the G8 Hokkaido Toyako Summit. St. Petersburg Energy Security Principles 1. The G8 countries have discussed their progress in adhering to the 2006 St. Petersburg Energy Security Principles and welcome the International Energy Agency's (IEA) general comments on the national reports. The final national reports as well as the final IEA Assessment Report will be submitted to the G8 Hokkaido


Energy Science  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Science Energy Science Energy Science Print Our current fossil-fuel-based system is causing potentially catastrophic changes to our planet. The quest for renewable, nonpolluting sources of energy requires us to understand, predict, and ultimately control matter and energy at the electronic, atomic, and molecular levels. Light-source facilities-the synchrotrons of today and the next-generation light sources of tomorrow-are the scientific tools of choice for exploring the electronic and atomic structure of matter. As such these photon-science facilities are uniquely positioned to jump-start a global revolution in renewable and carbon-neutral energy technologies. To establish the scientific foundations for the kind of transformative breakthroughs needed to build a 21st-century energy economy, we must address fundamental questions involving matter and energy. Below is a sampling of such questions that can be addressed by light-source facilities:


Geothermal Energy  

DOE Green Energy (OSTI)

Geothermal Energy Technology (GET) announces on a bimonthly basis the current worldwide information available on the technologies required for economic recovery of geothermal energy and its use as direct heat or for electric power production.

Steele, B.C.; Harman, G.; Pitsenbarger, J. [eds.



Hubble Energy  

E-Print Network (OSTI)

Light received from a cosmological source is redshifted with an apparent loss of energy, a problem first pointed out by Edwin Hubble in 1936. A new type of energy called Hubble Energy is introduced to restore the principle of energy conservation. The energy has no inertial or gravitational effect but retards radial motion in a manner consistent with the anomalous acceleration experienced by the Pioneer probes leaving the solar system. The energy is predicted to have important effects on the scale of galaxies, and some of these effects are qualitatively examined: for example, with Hubble Energy, flat rotation curves are found to be an inevitable consequence of spiral galaxy formation. The Hubble Energy is incorporated into the Friedmann Equation and shown to add a term similar to the cosmological term, with a magnitude of order 10^-35 s^-2.

Alasdair Macleod



Renewable Energy  

Energy.gov (U.S. Department of Energy (DOE))

Renewable energy leveraged from natural, renewable resources delivers electricity, heating, cooling, and other applications to Federal facilities and fleets. By using renewable energy, Federal agencies increase national security, conserve natural resources, and meet regulatory requirements and goals.


Natural Energy  

NLE Websites -- All DOE Office Websites (Extended Search)

originate? I need to give the intitial natural source of this energy. Replies: The energy source for most known organisms is the sun. Some organisms, such as deep-sea vent fauna...


Energy Basics  

Energy.gov (U.S. Department of Energy (DOE))

The basics about renewable energy and energy efficiency technologies: learn how they work, what they're used for, and how they can improve our lives, homes, businesses, vehicles, and industries.


Dark Energy  

E-Print Network (OSTI)

We review the problem of dark energy, including a survey of phenomenological models and some aspects of data fitting.

Li, Miao; Wang, Shuang; Wang, Yi



Dark Energy  

E-Print Network (OSTI)

After some remarks about the history and the mystery of the vacuum energy I shall review the current evidence for a cosmologically significant nearly homogeneous exotic energy density with negative pressure (`Dark Energy'). Special emphasis will be put on the recent polarization measurements by WMAP and their implications. I shall conclude by addressing the question: Do the current observations really imply the existence of a dominant dark energy component?

Norbert Straumann



Energy News | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

August 6, 2013 August 6, 2013 Energy Dept. Reports: U.S. Wind Energy Production and Manufacturing Reaches Record Highs The Energy Department released two new reports showcasing record growth across the U.S. wind market -- increasing America's share of clean, renewable energy and supporting tens of thousands of jobs nationwide. August 1, 2013 Secretary Moniz Announces New Biofuels Projects to Drive Cost Reductions, Technological Breakthroughs During remarks at the Energy Department's Biomass 2013 annual conference, Secretary Moniz highlighted the important role biofuels play in the Administration's Climate Action Plan. July 31, 2013 Florida Project Produces Nation's First Cellulosic Ethanol at Commercial-Scale Groundbreaking Project Deploys Technology Developed Through Early Energy


Energy News | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

19, 2012 19, 2012 Energy and Commerce Departments Announce New Centers for Building Operations Excellence Part of Administration's Better Buildings Initiative, Centers Will Focus on Energy Efficiency Workforce Development for Building Operations Professionals June 18, 2012 United States Regains Lead with World's Fastest Supercomputer Five Supercomputers at Energy Department National Laboratories Rank in Top 20 of the World's Fastest Supercomputers June 14, 2012 Northwestern University Team Wins Energy Department's National Clean Energy Business Plan Competition As part of the Obama Administration's Startup America Initiative that works to encourage and accelerate high-growth entrepreneurship throughout the nation, the Energy Department today announced that NuMat Technologies


Wave Energy  

E-Print Network (OSTI)

Promoting the sustainable supply and use of energy for the greatest benefit of all. Publication details The compilation of the Survey of Energy Resources 2001 is the work of the editors and, while all reasonable endeavours have been used to ensure the accuracy of the data, neither the editors nor the World Energy Council can accept responsibility for any errors.

The World; Energy Council; Wb Lt; K. Yokobori (japan; A. W. Clarke (united Kingdom; J. A. Trinnaman (united Kingdom; Nuclear Energy; N. Alazard-toux; B. Bensad; W. Youngquist



Geothermal Energy  

DOE Green Energy (OSTI)

Geothermal Energy (GET) announces on a bimonthly basis the current worldwide information available on the technologies required for economic recovery of geothermal energy and its use as direct heat or for electric power production. This publication contains the abstracts of DOE reports, journal articles, conference papers, patents, theses, and monographs added to the Energy Science and Technology Database during the past two months.

Steele, B.C.; Pichiarella, L.S. [eds.; Kane, L.S.; Henline, D.M.



Materializing energy  

Science Conference Proceedings (OSTI)

Motivated and informed by perspectives on sustainability and design, this paper draws on a diverse body of scholarly works related to energy and materiality to articulate a perspective on energy-as-materiality and propose a design approach of ... Keywords: design, design theory, energy, materiality, sustainability

James Pierce; Eric Paulos



Energy engineering  

SciTech Connect

Evaluates the technical aspects of energy usage with a view toward more effective utilization. Focus is on uses which are significant in the overall picture, and determination of technical measurers which reduce usage and are economical. Chapter problems. Contents are as follows: Residential and commercial building heating requirements; heating and cooling of commercial buildings; heat pumps; energy use in industry; and renewable energy sources.

Mitchell, J.W.



EIA Energy Efficiency-  

U.S. Energy Information Administration (EIA)

Energy Savings (Key West City Electric System) Georgia. ... (El Paso Solar Energy Association) Energy Savings Center (Reliant Energy) Wisconsin. Savings ...


Energy 101: Lumens | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

or Search Energy.gov Search Clear Filters All Videos Energy 101: Biofuels Energy 101: Algae-to-Fuel Energy 101: Lighting Choices Energy 101: Hydroelectric Power Energy 101:...