Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Wind Shear and Turbulence Profiles at Elevated Heights: Great Lakes and Midwest Sites (Poster)  

DOE Green Energy (OSTI)

Analyzed wind resource characteristics at elevated heights (50 m-200+m) incuding shear and turbulence profiles for some areas of the Great Lakes and M idwest sites.

Elliott, D.; Schwartz, M.; Scott, G.

2009-05-01T23:59:59.000Z

2

Elevated Cloud and Aerosol Layer Retrievals from Micropulse Lidar Signal Profiles  

Science Conference Proceedings (OSTI)

A threshold-based detection algorithm for cloud and aerosol layer heights in elevated micropulse lidar data (0.523 ?m) is described. Thresholds for differentiating cloud and aerosol signals from that of the molecular atmosphere are based on the ...

James R. Campbell; Kenneth Sassen; Ellsworth J. Welton

2008-05-01T23:59:59.000Z

3

Functional profiling of microRNAs in stallions  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short non-coding RNAs that act as post-transcriptional regulators of gene expression in eukaryotic genomes and are thought to be critically involved in many biological processes. While the functions of sperm miRNAs in equine biology are yet to be determined, studies in mouse and humans suggest that sperm miRNAs regulate gene expression in the zygote and can indicate the status of male fertility. The aim of this study was to characterize the expression profiles of selected sperm miRNA in equine tissues and compare their expression levels in the sperm and testes of fertile/sexually mature and subfertile/sexually immature stallions. From sperm RNA-seq data, we selected 6 highly expressed miRNAs: miR-34b, -34c, -191, -223, -1248 and -1905c. Total RNA enriched with miRNAs was extracted from 10 adult tissues, sperm of 3 fertile and 3 subfertile stallions, and testes of five 1-year old and five 3-year old stallions. The RNA was polyadenylated, reverse transcribed into srcDNA, and examined through RT-PCR and qRT-PCR. Reverse transcriptase PCR on a panel of adult male tissues revealed ubiquitous expression of the 6 miRNAs, whereas transcription of miR-34c, -223, and -1905c was elevated in testes and sperm. Additionally, we showed that stallion sperm and testes contain transcripts of mature sperm-enriched tRNA-derived 2 small RNAs (mse-tsRNAs), which is a novel finding for the horse. A pilot study was conducted to quantify the expression of miR-34c and miR-1905c in the sperm of fertile and subfertile stallions. While the expression levels varied between individuals and the two fertility phenotypes, a significantly (p=0.04) elevated expression of miR-34c was observed in the subfertile group. Finally, due to the overall high expression of miR-1905c in sperm, its expression was qualified and quantified in the testes of 1-year old and 3-year old stallions. miR-1905c was expressed in all testes samples and no significant differences in expression level were observed between immature and maturing testes. Because the number of stallions was limited, the current results remain preliminary and further experimentation will be required. Nevertheless, the discovery of miRNAs in stallion sperm might lead to a new direction in the search of biomarkers for stallion fertility.

Wang, Aaron Stephen

2013-05-01T23:59:59.000Z

4

Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...

5

US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

6

US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

7

RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.

8

MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units

9

DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility

10

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed

11

MI  

NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)

12

DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4

13

DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

14

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...

15

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...

16

DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.

17

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either

18

DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical

19

DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated

20

Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Temperature-profile detector  

DOE Patents (OSTI)

Temperature profiles at elevated temperature conditions are monitored by use of an elongated device having two conductors spaced by the minimum distance required to normally maintain an open circuit between them. The melting point of one conductor is selected at the elevated temperature being detected, while the melting point of the other is higher. As the preselected temperature is reached, liquid metal will flow between the conductors creating short circuits which are detectable as to location.

Not Available

1981-01-29T23:59:59.000Z

22

Temperature profile detector  

DOE Patents (OSTI)

Temperature profiles at elevated temperature conditions are monitored by use of an elongated device having two conductors spaced by the minimum distance required to normally maintain an open circuit between them. The melting point of one conductor is selected at the elevated temperature being detected, while the melting point of the other is higher. As the preselected temperature is reached, liquid metal will flow between the conductors, creating short circuits which are detectable as to location.

Tokarz, Richard D. (West Richland, WA)

1983-01-01T23:59:59.000Z

23

MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab

2008-10-01T23:59:59.000Z

24

PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos

2008-06-27T23:59:59.000Z

25

Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)

2012-01-01T23:59:59.000Z

26

DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

27

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

28

Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio

2010-02-01T23:59:59.000Z

29

Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png

30

Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls

31

Elevated Transportation Company  

E-Print Network (OSTI)

Being stuck in traffic doesnt have to be a way of life. By approving citizens Initiative 53, Seattle voters asked for an alternative to traffic congestion through a new, expanded monorail system that would speed travelers up and over the cars below. The Elevated Transportation Company was asked to plan the new monorail and develop a proposal to build it. This document, the ETC Seattle Popular Monorail Plan, is our response. In it, we call for the creation of a 5-line, 58-mile citywide monorail system, and present a detailed proposal for the first line to be built, the 14-mile Green Line from Ballard and West Seattle to Downtown. The Plan includes a proposed route for the Green Line as well as cost, revenue, and ridership estimates, together with a proposal to fund Green Line construction and start-up. As we present this Plan today, we do so with great enthusiasm for the promise of monorail transportation in 21st century Seattle. A monorail system will give us a fast, elevated alternative to traffic congestion, and seamless mobility between Downtown and the neighborhoods. It will be safe, separated from cars and pedestrians. And it will be good for the environment, with its nonpolluting electric cars running quietly along the guideway beams. Our work has undergone extensive public review and comment as well as rigorous technical analysis from independent experts. The Plan has been refined and strengthened over the months and we are confident that it not only proposes a viable and efficient

Kristina Hill; Board Vice-chair; Donald King; Jeanne Kohl-welles

2002-01-01T23:59:59.000Z

32

,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

33

,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

34

Use of Elevators During Fires  

Science Conference Proceedings (OSTI)

... Smoke Control for Elevators. Klote, JH ASHRAE Journal, Vol. 26, No. 4, 23-33, April 1984. NBSIR 83-2715; 60 p. June 1983. ...

2013-11-26T23:59:59.000Z

35

Reconstructing Synthetic Profiles from Surface Data  

Science Conference Proceedings (OSTI)

A method for the extrapolation of vertical profiles of temperature (and/or steric heights) from measurements of sea surface elevation and sea surface temperature has been developed and is described here. The technique, called coupled pattern ...

Bruno Buongiorno Nardelli; Rosalia Santoleri

2004-04-01T23:59:59.000Z

36

Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.

37

Three-Dimensional Response of a Shear Flow to Elevated Heating  

Science Conference Proceedings (OSTI)

The three-dimensional response of a shear flow to elevated heating is investigated using linear theory. The basic wind profile is allowed to reverse directions at a certain height. Effects of shear, evaporative cooling, and the stratosphere are ...

Yuh-Lang Lin; Shiaolin Li

1988-10-01T23:59:59.000Z

38

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:

39

The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.

2005-05-01T23:59:59.000Z

40

DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP

42

DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co

43

Marathon pacing and elevation change  

E-Print Network (OSTI)

An analysis of marathon pacing and elevation change is presented. It is based on an empirical observation of how the pace of elite and non-elite marathon runners change over the course of the marathon and a simple approximation of the energy cost of ascent and decent. It was observed that the pace of the runners slowed in a regular manner that could be broken up into four regions. That observation can be used to project target paces for a desired marathon finish time. However, that estimate fails to take in to account the energetic costs of elevation changes (hills) along the marathon course. Several approximations are made to give a coarse estimate of target paces for marathon run on courses with significant elevation changes, i.e. a hilly course. The 2012 Oakland Marathon course is used as and example of a hilly course and the times of 23 finishers are examined.

Elliott, J B

2012-01-01T23:59:59.000Z

44

Special Issue: High Elevation Forests  

E-Print Network (OSTI)

Resources, Colorado State University William Ciesla, Aerial Survey Coordinator, U.S. Forest Service (retired material for homes. They also capture, purify, and release water for our use. Recent aerial surveys confirmSpecial Issue: High Elevation Forests 2008 The Health of Colorado's Forests Report #12;David A

45

DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on

46

DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:

47

REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

48

Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper

2012-02-20T23:59:59.000Z

49

Elevation leads to altruistic behavior  

E-Print Network (OSTI)

of an emotion are key to understand- ing its origins, functions, or social consequences (e.g., Frijda, 1987; Lazarus, 1991; Nesse, 1990; Russell, 1991; Tooby & Cosmides, 2008). However, to date, there is only limited evi- dence that elevation affects prosocial... Received 5/3/09; Revision accepted 6/29/09 Research Report 316 Schnall et al. Negro College Fund (UNCF). In a second experiment, partici- pants read about acts of compassion and then were asked to donate some or all of their $5 participation payment...

Schnall, Simone; Roper, Jean; Fessler, Daniel M. T.

2010-01-01T23:59:59.000Z

50

Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-10-01T23:59:59.000Z

51

Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel

2010-01-01T23:59:59.000Z

52

MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-12-01T23:59:59.000Z

53

Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)

2011-12-01T23:59:59.000Z

54

Mentee Profile  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mentee Profile Mentee Profile The information you provide on this form will assist us in providing you with a list of prospective mentor from which to choose the most appropriate match. Once you've completed the form, please email it to doementoringprogram@hq.doe.gov . Thank you for your interest in the DOE Mentoring Program. Name (last/first): Phone Number: Job Title/Series/Grade: Organization (indicate HQ or field - complete address): Email Address: Are you a Veteran? If yes, do want a veteran mentee? If yes, which branch of the service? Are you student or intern? Do you have a preference on mentor? For example, male, female, particular career field, specific person or other? If so, what or who? Do you want a mentor in your career field? What are your career goals?

55

Mentor Profile  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mentor Profile Mentor Profile The information you provide on this form will assist us in providing you with a list of prospective mentee from which to choose the most appropriate match. Once you've completed the form, please email it to doementoringprogram@hq.doe.gov . Thank you for your interest in the DOE Mentoring Program. Name (last/first): Phone Number: Job Title/Series/Grade: Organization (indicate HQ or field - complete address): Email Address: Are you a Veteran? If yes, do want a veteran mentee? If yes, which branch of the service? Do you want a student or intern mentee? Do you have a preference on mentee? For example, male, female, particular career field or other? If so, what or state name of pre selected mentee? Do you want a mentee in your career field? What are your hobbies?

56

A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)

2012-07-15T23:59:59.000Z

57

TABLE OF CONTENTS Structural Aluminides for Elevated ...  

Science Conference Proceedings (OSTI)

Structural Aluminides for Elevated ..... Influence of Oxidation Protective Coatings on the Ductility of ... Protection of TiAl-Alloys for Automotive and Aero-Engine.

58

Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.

1997-10-01T23:59:59.000Z

59

TecDEM: A MATLAB based toolbox for tectonic geomorphology, Part 1: Drainage network preprocessing and stream profile analysis  

Science Conference Proceedings (OSTI)

We present TecDEM, a software shell implemented in MATLAB that applies tectonic geomorphologic tasks to digital elevation models (DEMs). The first part of this paper series describes drainage partitioning schemes and stream profile analysis. The graphical ... Keywords: Digital elevation models, Hack index, MATLAB, Stream profile analysis, Tectonics

Faisal Shahzad; Richard Gloaguen

2011-02-01T23:59:59.000Z

60

Safety Share Elevators, Escalators and Moving Walkways  

NLE Websites -- All DOE Office Websites (Extended Search)

3, 2010 3, 2010 Safety Share Elevators, Escalators and Moving Walkways Dick Donovan, of HS-70, informed the HSS VPP Committee about a recent safety incident he experienced while at an airport in Las Vegas. Dick tripped as he was getting off of the escalator. The incident made him consider the day-to-day hazards we take for granted. With this in mind, Dick made an effort to look around to find safety information about using elevators, escalators and moving walkways. Dick came across some useful safety information provided by the Otis Elevator Company. The web site below provides links to two good one-page reminders for safety on elevators, escalators, and moving walkways. http://www.otis.com/site/us/Pages/SafetyforAll.aspx Dick also found more interactive presentations on the same material, see website below. These

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Broadband phase-preserved optical elevator  

E-Print Network (OSTI)

Phase-preserved optical elevator is an optical device to lift up an entire plane virtually without distortion in light path or phase. Using transformation optics, we have predicted and observed the realization of such a broadband phase-preserved optical elevator, made of a natural homogeneous birefringent crystal without resorting to absorptive and narrowband metamaterials involving time-consuming nano-fabrication. In our demonstration, the optical elevator is designed to lift a sheet upwards, and the phase is verified to be preserved always. The camouflage capability is also demonstrated in the presence of adjacent objects of the same scale at will. The elevating device functions in different surrounding media over the wavelength range of 400-700 nm. Our work opens up prospects for studies of light trapping, solar energy, illusion optics, communication, and imaging.

Yuan Luo; Tiancheng Han; Baile Zhang; Cheng-Wei Qiu; George Barbastathis

2011-09-30T23:59:59.000Z

62

OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown

2013-10-01T23:59:59.000Z

63

In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma

2013-06-01T23:59:59.000Z

64

NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk

65

Retrieval of Vertical Profiles of Liquid Water and Ice Content in Mixed Clouds from Doppler Radar and Microwave Radiometer Measurements  

Science Conference Proceedings (OSTI)

A new method to retrieve vertical profiles of liquid water content Mw(z), ice water content Mi(z), and ice particle size distribution Ni(D, z), (where D is the ice particle size and z the vertical coordinate) in mixed nonprecipitating clouds ...

Henri Sauvageot

1996-01-01T23:59:59.000Z

66

Electrostatic Climber for Space Elevator and Launcher  

E-Print Network (OSTI)

Author details research on the new, very prospective, electrostatic Space Elevator climber based on a new electrostatic linear engine previously offered at the 42nd Joint Propulsion Conference (AIAA-2006-5229) and published in AEAT, Vol.78, No.6, 2006, pp. 502-508. The electrostatic climber discussed can have any speed (and braking), the energy for climber movement is delivered by a lightweight high-voltage line into a Space Elevator-holding cable from Earth electric generator. This electric line also can be used for delivery electric energy to a Geosynchronous Space Station. At present, the best solution of the climber problem (announced by NASA as one important awarding problem of Space Elevator) is problematic. Author also shows the linear electrostatic engine may be used as realistic power space launcher at the present time. Two projects illustrate these new devices. Key words: Space elevator, Electrostatic climber for space elevator, Electrostatic space launcher, Electrostatic accelerator. This work is presented as paper AIAA-2007-5838 for 43 Joint Propulsion Conference, Cincinnati, Ohio, USA, 9-11 July, 2007,

A. Bolonkin

2007-05-14T23:59:59.000Z

67

Elevance Renewable Sciences Inc | Open Energy Information  

Open Energy Info (EERE)

Elevance Renewable Sciences Inc Elevance Renewable Sciences Inc Jump to: navigation, search Name Elevance Renewable Sciences Inc Place Bolingbrook, Illinois Zip 60440 Sector Biofuels, Renewable Energy Product Illinois-based developer of biofuels and renewable chemicals from plant-based oils and animal fats. Coordinates 41.698175°, -88.081199° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.698175,"lon":-88.081199,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

68

User_TalentProfile  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Accessing and Modifying Talent Profile Accessing and Modifying Talent Profile © 2011 SuccessFactors, Inc. - 1 - SuccessFactors Learning Confidential. All rights reserved. Job Aid: Accessing and Modifying Talent Profile Purpose The purpose of this job aid is to guide users through the step-by-step process of accessing their talent profiles, adding information to their profiles, and editing existing talent profile information. Task A. Access Talent Profile Enter the web address (URL) of the user application into your browser Address field and press the Enter key. Enter your user ID in the User ID textbox. Enter your password in the Password textbox. Click Sign In. Access Talent Profile 4 Steps Task A Add Information to Talent Profile Sections 5 Steps Task B Edit Talent Profile Sections

69

U-030: Apache Tomcat Lets Untrusted Web Applications Gain Elevated...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0: Apache Tomcat Lets Untrusted Web Applications Gain Elevated Privileges U-030: Apache Tomcat Lets Untrusted Web Applications Gain Elevated Privileges November 9, 2011 - 8:30am...

70

Forest succession at elevated CO2  

DOE Green Energy (OSTI)

We tested hypotheses concerning the response of forest succession to elevated CO2 in the FACTS-1 site at the Duke Forest. We quantified growth and survival of naturally recruited seedlings, tree saplings, vines, and shrubs under ambient and elevated CO2. We planted seeds and seedlings to augment sample sites. We augmented CO2 treatments with estimates of shade tolerance and nutrient limitation while controlling for soil and light effects to place CO2 treatments within the context of natural variability at the site. Results are now being analyzed and used to parameterize forest models of CO2 response.

Clark, James S.; Schlesinger, William H.

2002-02-01T23:59:59.000Z

71

Sensitivity of the South Asian monsoon to elevated and non-elevated heating  

E-Print Network (OSTI)

Sensitivity of the South Asian monsoon to elevated and non-elevated heating William R. Boos1 the South Asian summer monsoon, but recent work showed this monsoon was largely unaffected by removal. There is debate about whether those mountain ranges generate a strong monsoon by insulating the thermal maximum

72

miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay

73

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....

74

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA

75

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Vermont Electricity Profile 2010 Vermont profile Table 1. 2010 Summary Statistics (Vermont) Item Value U.S. Rank NERC Region(s) NPCC Primary Energy Source Nuclear Net Summer...

76

Accelerator beam profile analyzer  

DOE Patents (OSTI)

A beam profile analyzer employing sector or quadrant plates each servo controlled to outline the edge of a beam.

Godel, Julius B. (Bayport, NY); Guillaume, Marcel (Grivegnee, BE); Lambrecht, Richard M. (East Quogue, NY); Withnell, Ronald (East Setauket, NY)

1976-01-01T23:59:59.000Z

77

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA)

Trade and Reliability; All Reports See all Electricity Reports State Electricity Profiles. ... Electric Power Industry Emissions Estimates, 1990 Through 2010:

78

Elevated Convection and Castellanus: Ambiguities, Significance, and Questions  

Science Conference Proceedings (OSTI)

The term elevated convection is used to describe convection where the constituent air parcels originate from a layer above the planetary boundary layer. Because elevated convection can produce severe hail, damaging surface wind, and excessive ...

Stephen F. Corfidi; Sarah J. Corfidi; David M. Schultz

2008-12-01T23:59:59.000Z

79

Clean Cities: National Clean Fleets Partner: ThyssenKrupp Elevator  

NLE Websites -- All DOE Office Websites (Extended Search)

Clean Fleets Partner: ThyssenKrupp Elevator Photo of a ThyssenKrupp van parked at a propane fueling station. Between 2009 and 2011, ThyssenKrupp Elevator reduced the petroleum...

80

miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li

2009-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

The Extrapolation of Vertical Profiles of Wind Speed within the Marine Atmospheric Surface layer Using the p Formula  

Science Conference Proceedings (OSTI)

Values of p for the exponent-type wind profile formulation, used in vertical extrapolations of wind speed, were derived for the marine atmospheric surface layer. Nomograms were constructed providing p values as dependent on a single elevation ...

M. Segal; R. A. Pielke

1988-02-01T23:59:59.000Z

82

Texas Crop Profile: Onions  

E-Print Network (OSTI)

This profile of onion production in Texas gives an overview of basic commodity information; discusses insect, disease and weed pests; and covers cultural and chemical control methods.

Hall, Kent D.; Holloway, Rodney L.; Smith, Dudley

2000-04-12T23:59:59.000Z

83

A Moored Profiling Instrument*  

Science Conference Proceedings (OSTI)

The specifications and performance of a moored vertical profiling instrument, designed to acquire near-full-ocean-depth profile time series data at high vertical resolution, are described. The 0.8-m-diameter by 0.4-m-wide device utilizes a ...

K. W. Doherty; D. E. Frye; S. P. Liberatore; J. M. Toole

1999-11-01T23:59:59.000Z

84

Boulder County - Elevations Energy Loans Program (Colorado) | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Boulder County - Elevations Energy Loans Program (Colorado) Boulder County - Elevations Energy Loans Program (Colorado) Boulder County - Elevations Energy Loans Program (Colorado) < Back Eligibility Commercial Residential Savings Category Home Weatherization Commercial Weatherization Heating & Cooling Commercial Heating & Cooling Cooling Appliances & Electronics Sealing Your Home Ventilation Heating Heat Pumps Commercial Lighting Lighting Manufacturing Water Heating Windows, Doors, & Skylights Solar Buying & Making Electricity Program Info State Colorado Program Type Local Loan Program Rebate Amount Residential: $500 - $25,000 Commercial: $1,000 - $150,000 Provider Elevations Credit Union The Elevations Energy Loan can be used to finance a wide variety of efficiency and renewable energy projects in homes and businesses. Homes and

85

Importance of Elevation and Temperature Inversions for the Interpretation  

Open Energy Info (EERE)

Importance of Elevation and Temperature Inversions for the Interpretation Importance of Elevation and Temperature Inversions for the Interpretation of Thermal Infrared Satellite Images Used in Geothermal Exploration Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Conference Proceedings: Importance of Elevation and Temperature Inversions for the Interpretation of Thermal Infrared Satellite Images Used in Geothermal Exploration Details Activities (1) Areas (1) Regions (0) Abstract: Examples of nighttime temperature inversions are shown in thermal infrared satellite images collected over the Coso geothermal field in eastern California. Temperature-elevation plots show the normal trend of temperature decrease with elevation, on which temperature inversions appear superimposed as opposite trends. Such inversions are common and they should

86

Traction sheave elevator, hoisting unit and machine space  

DOE Patents (OSTI)

Traction sheave elevator consisting of an elevator car moving along elevator guide rails, a counterweight moving along counterweight guide rails, a set of hoisting ropes (3) on which the elevator car and counterweight are suspended, and a drive machine unit (6) driving a traction sheave (7) acting on the hoisting ropes (3) and placed in the elevator shaft. The drive machine unit (6) is of a flat construction. A wall of the elevator shaft is provided with a machine space with its open side facing towards the shaft, the essential parts of the drive machine unit (6) being placed in the space. The hoisting unit (9) of the traction sheave elevator consists of a substantially discoidal drive machine unit (6) and an instrument panel (8) mounted on the frame (20) of the hoisting unit.

Hakala, Harri (Hyvinkaa, FI); Mustalahti, Jorma (Hyvinkaa, FI); Aulanko, Esko (Kerava, FI)

2000-01-01T23:59:59.000Z

87

Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)

2010-01-01T23:59:59.000Z

88

Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)

2012-07-01T23:59:59.000Z

89

DEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE  

E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.

90

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Wyoming Electricity Profile 2010 Wyoming profile Wyoming Electricity Profile 2010 Wyoming profile Table 1. 2010 Summary Statistics (Wyoming) Item Value U.S. Rank NERC Region(s) WECC Primary Energy Source Coal Net Summer Capacity (megawatts) 7,986 37 Electric Utilities 6,931 31 Independent Power Producers & Combined Heat and Power 1,056 41 Net Generation (megawatthours) 48,119,254 31 Electric Utilities 44,738,543 25 Independent Power Producers & Combined Heat and Power 3,380,711 42 Emissions (thousand metric tons) Sulfur Dioxide 67 23 Nitrogen Oxide 61 15 Carbon Dioxide 45,703 21 Sulfur Dioxide (lbs/MWh) 3.1 19 Nitrogen Oxide (lbs/MWh) 2.8 7 Carbon Dioxide (lbs/MWh) 2,094 2 Total Retail Sales (megawatthours) 17,113,458 40 Full Service Provider Sales (megawatthours) 17,113,458 39

91

profiles | OpenEI  

Open Energy Info (EERE)

profiles profiles Dataset Summary Description This dataset contains hourly load profile data for 16 commercial building types (based off the DOE commercial reference building models) and residential buildings (based off the Building America House Simulation Protocols). This dataset also includes the Residential Energy Consumption Survey (RECS) for statistical references of building types by location. Source Commercial and Residential Reference Building Models Date Released April 18th, 2013 (9 months ago) Date Updated July 02nd, 2013 (7 months ago) Keywords building building demand building load Commercial data demand Energy Consumption energy data hourly kWh load profiles Residential Data Quality Metrics Level of Review Some Review Comment Temporal and Spatial Coverage Frequency Annually

92

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Idaho Electricity Profile 2010 Idaho profile Idaho Electricity Profile 2010 Idaho profile Table 1. 2010 Summary Statistics (Idaho) Item Value U.S. Rank NERC Region(s) WECC Primary Energy Source Hydroelectric Net Summer Capacity (megawatts) 3,990 44 Electric Utilities 3,035 36 Independent Power Producers & Combined Heat and Power 955 42 Net Generation (megawatthours) 12,024,564 44 Electric Utilities 8,589,208 37 Independent Power Producers & Combined Heat and Power 3,435,356 40 Emissions (thousand metric tons) Sulfur Dioxide 7 45 Nitrogen Oxide 4 48 Carbon Dioxide 1,213 49 Sulfur Dioxide (lbs/MWh) 1.2 39 Nitrogen Oxide (lbs/MWh) 0.8 43 Carbon Dioxide (lbs/MWh) 222 50 Total Retail Sales (megawatthours) 22,797,668 38 Full Service Provider Sales (megawatthours) 22,797,668 37

93

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

California Electricity Profile 2010 California profile California Electricity Profile 2010 California profile Table 1. 2010 Summary Statistics (California) Item Value U.S. Rank NERC Region(s) SPP/WECC Primary Energy Source Gas Net Summer Capacity (megawatts) 67,328 2 Electric Utilities 28,689 2 Independent Power Producers & Combined Heat and Power 38,639 4 Net Generation (megawatthours) 204,125,596 4 Electric Utilities 96,939,535 8 Independent Power Producers & Combined Heat and Power 107,186,061 4 Emissions (thousand metric tons) Sulfur Dioxide 3 47 Nitrogen Oxide 80 9 Carbon Dioxide 55,406 16 Sulfur Dioxide (lbs/MWh) * 49 Nitrogen Oxide (lbs/MWh) 0.9 41 Carbon Dioxide (lbs/MWh) 598 46 Total Retail Sales (megawatthours) 258,525,414 2 Full Service Provider Sales (megawatthours) 240,948,673 2

94

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Carolina Electricity Profile 2010 South Carolina profile Carolina Electricity Profile 2010 South Carolina profile Table 1. 2010 Summary Statistics (South Carolina) Item Value U.S. Rank NERC Region(s) SERC Primary Energy Source Nuclear Net Summer Capacity (megawatts) 23,982 17 Electric Utilities 22,172 9 Independent Power Producers & Combined Heat and Power 1,810 35 Net Generation (megawatthours) 104,153,133 14 Electric Utilities 100,610,887 6 Independent Power Producers & Combined Heat and Power 3,542,246 39 Emissions (thousand metric tons) Sulfur Dioxide 106 19 Nitrogen Oxide 30 33 Carbon Dioxide 41,364 23 Sulfur Dioxide (lbs/MWh) 2.2 30 Nitrogen Oxide (lbs/MWh) 0.6 45 Carbon Dioxide (lbs/MWh) 876 40 Total Retail Sales (megawatthours) 82,479,293 19 Full Service Provider Sales (megawatthours) 82,479,293 17

95

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

District of Columbia Electricity Profile 2010 District of Columbia profile District of Columbia Electricity Profile 2010 District of Columbia profile Table 1. 2010 Summary Statistics (District of Columbia) Item Value U.S. Rank NERC Region(s) RFC Primary Energy Source Petroleum Net Summer Capacity (megawatts) 790 51 Independent Power Producers & Combined Heat and Power 790 46 Net Generation (megawatthours) 199,858 51 Independent Power Producers & Combined Heat and Power 199,858 51 Emissions (thousand metric tons) Sulfur Dioxide 1 49 Nitrogen Oxide * 51 Carbon Dioxide 191 50 Sulfur Dioxide (lbs/MWh) 8.8 2 Nitrogen Oxide (lbs/MWh) 4.0 3 Carbon Dioxide (lbs/MWh) 2,104 1 Total Retail Sales (megawatthours) 11,876,995 43 Full Service Provider Sales (megawatthours) 3,388,490 50 Energy-Only Provider Sales (megawatthours) 8,488,505 12

96

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Virginia Electricity Profile 2010 Virginia profile Virginia Electricity Profile 2010 Virginia profile Table 1. 2010 Summary Statistics (Virginia) Item Value U.S. Rank NERC Region(s) RFC/SERC Primary Energy Source Nuclear Net Summer Capacity (megawatts) 24,109 16 Electric Utilities 19,434 15 Independent Power Producers & Combined Heat and Power 4,676 21 Net Generation (megawatthours) 72,966,456 21 Electric Utilities 58,902,054 16 Independent Power Producers & Combined Heat and Power 14,064,402 25 Emissions (thousand metric tons) Sulfur Dioxide 120 16 Nitrogen Oxide 49 24 Carbon Dioxide 39,719 25 Sulfur Dioxide (lbs/MWh) 3.6 15 Nitrogen Oxide (lbs/MWh) 1.5 23 Carbon Dioxide (lbs/MWh) 1,200 30 Total Retail Sales (megawatthours) 113,806,135 10 Full Service Provider Sales (megawatthours) 113,806,135 7

97

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Delaware Electricity Profile 2010 Delaware profile Delaware Electricity Profile 2010 Delaware profile Table 1. 2010 Summary Statistics (Delaware) Item Value U.S. Rank NERC Region(s) RFC Primary Energy Source Gas Net Summer Capacity (megawatts) 3,389 46 Electric Utilities 55 48 Independent Power Producers & Combined Heat and Power 3,334 29 Net Generation (megawatthours) 5,627,645 50 Electric Utilities 30,059 46 Independent Power Producers & Combined Heat and Power 5,597,586 36 Emissions (thousand metric tons) Sulfur Dioxide 13 41 Nitrogen Oxide 5 47 Carbon Dioxide 4,187 45 Sulfur Dioxide (lbs/MWh) 5.2 7 Nitrogen Oxide (lbs/MWh) 1.9 16 Carbon Dioxide (lbs/MWh) 1,640 15 Total Retail Sales (megawatthours) 11,605,932 44 Full Service Provider Sales (megawatthours) 7,582,539 46

98

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Colorado Electricity Profile 2010 Colorado profile Colorado Electricity Profile 2010 Colorado profile Table 1. 2010 Summary Statistics (Colorado) Item Value U.S. Rank NERC Region(s) RFC/WECC Primary Energy Source Coal Net Summer Capacity (megawatts) 13,777 30 Electric Utilities 9,114 28 Independent Power Producers & Combined Heat and Power 4,662 22 Net Generation (megawatthours) 50,720,792 30 Electric Utilities 39,584,166 28 Independent Power Producers & Combined Heat and Power 11,136,626 31 Emissions (thousand metric tons) Sulfur Dioxide 45 29 Nitrogen Oxide 55 20 Carbon Dioxide 40,499 24 Sulfur Dioxide (lbs/MWh) 2.0 32 Nitrogen Oxide (lbs/MWh) 2.4 10 Carbon Dioxide (lbs/MWh) 1,760 12 Total Retail Sales (megawatthours) 52,917,786 27 Full Service Provider Sales (megawatthours) 52,917,786 24

99

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Kansas Electricity Profile 2010 Kansas profile Kansas Electricity Profile 2010 Kansas profile Table 1. 2010 Summary Statistics (Kansas) Item Value U.S. Rank NERC Region(s) MRO/SPP Primary Energy Source Coal Net Summer Capacity (megawatts) 12,543 32 Electric Utilities 11,732 20 Independent Power Producers & Combined Heat and Power 812 45 Net Generation (megawatthours) 47,923,762 32 Electric Utilities 45,270,047 24 Independent Power Producers & Combined Heat and Power 2,653,716 44 Emissions (thousand metric tons) Sulfur Dioxide 41 30 Nitrogen Oxide 46 26 Carbon Dioxide 36,321 26 Sulfur Dioxide (lbs/MWh) 1.9 33 Nitrogen Oxide (lbs/MWh) 2.1 13 Carbon Dioxide (lbs/MWh) 1,671 14 Total Retail Sales (megawatthours) 40,420,675 32 Full Service Provider Sales (megawatthours) 40,420,675 30

100

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Pennsylvania Electricity Profile 2010 Pennsylvania profile Pennsylvania Electricity Profile 2010 Pennsylvania profile Table 1. 2010 Summary Statistics (Pennsylvania) Item Value U.S. Rank NERC Region(s) RFC Primary Energy Source Coal Net Summer Capacity (megawatts) 45,575 4 Electric Utilities 455 44 Independent Power Producers & Combined Heat and Power 45,120 2 Net Generation (megawatthours) 229,752,306 2 Electric Utilities 1,086,500 42 Independent Power Producers & Combined Heat and Power 228,665,806 2 Emissions (thousand metric tons) Sulfur Dioxide 387 3 Nitrogen Oxide 136 2 Carbon Dioxide 122,830 3 Sulfur Dioxide (lbs/MWh) 3.7 13 Nitrogen Oxide (lbs/MWh) 1.3 27 Carbon Dioxide (lbs/MWh) 1,179 32 Total Retail Sales (megawatthours) 148,963,968 5 Full Service Provider Sales (megawatthours) 114,787,417 6

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Pennsylvania Electricity Profile 2010 Pennsylvania profile Pennsylvania Electricity Profile 2010 Pennsylvania profile Table 1. 2010 Summary Statistics (Pennsylvania) Item Value U.S. Rank NERC Region(s) RFC Primary Energy Source Coal Net Summer Capacity (megawatts) 45,575 4 Electric Utilities 455 44 Independent Power Producers & Combined Heat and Power 45,120 2 Net Generation (megawatthours) 229,752,306 2 Electric Utilities 1,086,500 42 Independent Power Producers & Combined Heat and Power 228,665,806 2 Emissions (thousand metric tons) Sulfur Dioxide 387 3 Nitrogen Oxide 136 2 Carbon Dioxide 122,830 3 Sulfur Dioxide (lbs/MWh) 3.7 13 Nitrogen Oxide (lbs/MWh) 1.3 27 Carbon Dioxide (lbs/MWh) 1,179 32 Total Retail Sales (megawatthours) 148,963,968 5 Full Service Provider Sales (megawatthours) 114,787,417 6

102

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Wyoming Electricity Profile 2010 Wyoming profile Wyoming Electricity Profile 2010 Wyoming profile Table 1. 2010 Summary Statistics (Wyoming) Item Value U.S. Rank NERC Region(s) WECC Primary Energy Source Coal Net Summer Capacity (megawatts) 7,986 37 Electric Utilities 6,931 31 Independent Power Producers & Combined Heat and Power 1,056 41 Net Generation (megawatthours) 48,119,254 31 Electric Utilities 44,738,543 25 Independent Power Producers & Combined Heat and Power 3,380,711 42 Emissions (thousand metric tons) Sulfur Dioxide 67 23 Nitrogen Oxide 61 15 Carbon Dioxide 45,703 21 Sulfur Dioxide (lbs/MWh) 3.1 19 Nitrogen Oxide (lbs/MWh) 2.8 7 Carbon Dioxide (lbs/MWh) 2,094 2 Total Retail Sales (megawatthours) 17,113,458 40 Full Service Provider Sales (megawatthours) 17,113,458 39

103

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Kentucky Electricity Profile 2010 Kentucky profile Kentucky Electricity Profile 2010 Kentucky profile Table 1. 2010 Summary Statistics (Kentucky) Item Value U.S. Rank NERC Region(s) RFC/SERC Primary Energy Source Coal Net Summer Capacity (megawatts) 20,453 21 Electric Utilities 18,945 16 Independent Power Producers & Combined Heat and Power 1,507 38 Net Generation (megawatthours) 98,217,658 17 Electric Utilities 97,472,144 7 Independent Power Producers & Combined Heat and Power 745,514 48 Emissions (thousand metric tons) Sulfur Dioxide 249 7 Nitrogen Oxide 85 7 Carbon Dioxide 93,160 7 Sulfur Dioxide (lbs/MWh) 5.6 5 Nitrogen Oxide (lbs/MWh) 1.9 15 Carbon Dioxide (lbs/MWh) 2,091 3 Total Retail Sales (megawatthours) 93,569,426 14 Full Service Provider Sales (megawatthours) 93,569,426 12

104

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Michigan Electricity Profile 2010 Michigan profile Michigan Electricity Profile 2010 Michigan profile Table 1. 2010 Summary Statistics (Michigan) Item Value U.S. Rank NERC Region(s) MRO/RFC Primary Energy Source Coal Net Summer Capacity (megawatts) 29,831 11 Electric Utilities 21,639 10 Independent Power Producers & Combined Heat and Power 8,192 14 Net Generation (megawatthours) 111,551,371 13 Electric Utilities 89,666,874 13 Independent Power Producers & Combined Heat and Power 21,884,497 16 Emissions (thousand metric tons) Sulfur Dioxide 254 6 Nitrogen Oxide 89 6 Carbon Dioxide 74,480 11 Sulfur Dioxide (lbs/MWh) 5.0 8 Nitrogen Oxide (lbs/MWh) 1.8 19 Carbon Dioxide (lbs/MWh) 1,472 20 Total Retail Sales (megawatthours) 103,649,219 12 Full Service Provider Sales (megawatthours) 94,565,247 11

105

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Alabama Electricity Profile 2010 Alabama profile Alabama Electricity Profile 2010 Alabama profile Table 1. 2010 Summary Statistics (Alabama) Item Value U.S. Rank NERC Region(s) SERC Primary Energy Source Coal Net Summer Capacity (megawatts) 32,417 9 Electric Utilities 23,642 7 Independent Power Producers & Combined Heat and Power 8,775 12 Net Generation (megawatthours) 152,150,512 6 Electric Utilities 122,766,490 2 Independent Power Producers & Combined Heat and Power 29,384,022 12 Emissions (thousand metric tons) Sulfur Dioxide 218 10 Nitrogen Oxide 66 14 Carbon Dioxide 79,375 9 Sulfur Dioxide (lbs/MWh) 3.2 18 Nitrogen Oxide (lbs/MWh) 1.0 36 Carbon Dioxide (lbs/MWh) 1,150 33 Total Retail Sales (megawatthours) 90,862,645 15 Full Service Provider Sales (megawatthours) 90,862,645 13

106

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Michigan Electricity Profile 2010 Michigan profile Michigan Electricity Profile 2010 Michigan profile Table 1. 2010 Summary Statistics (Michigan) Item Value U.S. Rank NERC Region(s) MRO/RFC Primary Energy Source Coal Net Summer Capacity (megawatts) 29,831 11 Electric Utilities 21,639 10 Independent Power Producers & Combined Heat and Power 8,192 14 Net Generation (megawatthours) 111,551,371 13 Electric Utilities 89,666,874 13 Independent Power Producers & Combined Heat and Power 21,884,497 16 Emissions (thousand metric tons) Sulfur Dioxide 254 6 Nitrogen Oxide 89 6 Carbon Dioxide 74,480 11 Sulfur Dioxide (lbs/MWh) 5.0 8 Nitrogen Oxide (lbs/MWh) 1.8 19 Carbon Dioxide (lbs/MWh) 1,472 20 Total Retail Sales (megawatthours) 103,649,219 12 Full Service Provider Sales (megawatthours) 94,565,247 11

107

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Ohio Electricity Profile 2010 Ohio profile Ohio Electricity Profile 2010 Ohio profile Table 1. 2010 Summary Statistics (Ohio) Item Value U.S. Rank NERC Region(s) RFC Primary Energy Source Coal Net Summer Capacity (megawatts) 33,071 8 Electric Utilities 20,179 13 Independent Power Producers & Combined Heat and Power 12,892 7 Net Generation (megawatthours) 143,598,337 7 Electric Utilities 92,198,096 10 Independent Power Producers & Combined Heat and Power 51,400,241 7 Emissions (thousand metric tons) Sulfur Dioxide 610 1 Nitrogen Oxide 122 3 Carbon Dioxide 121,964 4 Sulfur Dioxide (lbs/MWh) 9.4 1 Nitrogen Oxide (lbs/MWh) 1.9 17 Carbon Dioxide (lbs/MWh) 1,872 8 Total Retail Sales (megawatthours) 154,145,418 4 Full Service Provider Sales (megawatthours) 105,329,797 9

108

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Wisconsin Electricity Profile 2010 Wisconsin profile Wisconsin Electricity Profile 2010 Wisconsin profile Table 1. 2010 Summary Statistics (Wisconsin) Item Value U.S. Rank NERC Region(s) MRO/RFC Primary Energy Source Coal Net Summer Capacity (megawatts) 17,836 23 Electric Utilities 13,098 19 Independent Power Producers & Combined Heat and Power 4,738 20 Net Generation (megawatthours) 64,314,067 24 Electric Utilities 45,579,970 22 Independent Power Producers & Combined Heat and Power 18,734,097 18 Emissions (thousand metric tons) Sulfur Dioxide 145 12 Nitrogen Oxide 49 25 Carbon Dioxide 47,238 19 Sulfur Dioxide (lbs/MWh) 5.0 9 Nitrogen Oxide (lbs/MWh) 1.7 20 Carbon Dioxide (lbs/MWh) 1,619 16 Total Retail Sales (megawatthours) 68,752,417 22 Full Service Provider Sales (megawatthours) 68,752,417 21

109

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Florida Electricity Profile 2010 Florida profile Florida Electricity Profile 2010 Florida profile Table 1. 2010 Summary Statistics (Florida) Item Value U.S. Rank NERC Region(s) FRCC/SERC Primary Energy Source Gas Net Summer Capacity (megawatts) 59,147 3 Electric Utilities 50,853 1 Independent Power Producers & Combined Heat and Power 8,294 13 Net Generation (megawatthours) 229,095,935 3 Electric Utilities 206,062,185 1 Independent Power Producers & Combined Heat and Power 23,033,750 15 Emissions (thousand metric tons) Sulfur Dioxide 160 11 Nitrogen Oxide 101 5 Carbon Dioxide 123,811 2 Sulfur Dioxide (lbs/MWh) 1.5 37 Nitrogen Oxide (lbs/MWh) 1.0 35 Carbon Dioxide (lbs/MWh) 1,191 31 Total Retail Sales (megawatthours) 231,209,614 3 Full Service Provider Sales (megawatthours) 231,209,614 3

110

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Arizona Electricity Profile 2010 Arizona profile Arizona Electricity Profile 2010 Arizona profile Table 1. 2010 Summary Statistics (Arizona) Item Value U.S. Rank NERC Region(s) WECC Primary Energy Source Coal Net Summer Capacity (megawatts) 26,392 15 Electric Utilities 20,115 14 Independent Power Producers & Combined Heat and Power 6,277 16 Net Generation (megawatthours) 111,750,957 12 Electric Utilities 91,232,664 11 Independent Power Producers & Combined Heat and Power 20,518,293 17 Emissions (thousand metric tons) Sulfur Dioxide 33 33 Nitrogen Oxide 57 17 Carbon Dioxide 55,683 15 Sulfur Dioxide (lbs/MWh) 0.7 43 Nitrogen Oxide (lbs/MWh) 1.1 31 Carbon Dioxide (lbs/MWh) 1,099 35 Total Retail Sales (megawatthours) 72,831,737 21 Full Service Provider Sales (megawatthours) 72,831,737 20

111

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Kentucky Electricity Profile 2010 Kentucky profile Kentucky Electricity Profile 2010 Kentucky profile Table 1. 2010 Summary Statistics (Kentucky) Item Value U.S. Rank NERC Region(s) RFC/SERC Primary Energy Source Coal Net Summer Capacity (megawatts) 20,453 21 Electric Utilities 18,945 16 Independent Power Producers & Combined Heat and Power 1,507 38 Net Generation (megawatthours) 98,217,658 17 Electric Utilities 97,472,144 7 Independent Power Producers & Combined Heat and Power 745,514 48 Emissions (thousand metric tons) Sulfur Dioxide 249 7 Nitrogen Oxide 85 7 Carbon Dioxide 93,160 7 Sulfur Dioxide (lbs/MWh) 5.6 5 Nitrogen Oxide (lbs/MWh) 1.9 15 Carbon Dioxide (lbs/MWh) 2,091 3 Total Retail Sales (megawatthours) 93,569,426 14 Full Service Provider Sales (megawatthours) 93,569,426 12

112

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Alabama Electricity Profile 2010 Alabama profile Alabama Electricity Profile 2010 Alabama profile Table 1. 2010 Summary Statistics (Alabama) Item Value U.S. Rank NERC Region(s) SERC Primary Energy Source Coal Net Summer Capacity (megawatts) 32,417 9 Electric Utilities 23,642 7 Independent Power Producers & Combined Heat and Power 8,775 12 Net Generation (megawatthours) 152,150,512 6 Electric Utilities 122,766,490 2 Independent Power Producers & Combined Heat and Power 29,384,022 12 Emissions (thousand metric tons) Sulfur Dioxide 218 10 Nitrogen Oxide 66 14 Carbon Dioxide 79,375 9 Sulfur Dioxide (lbs/MWh) 3.2 18 Nitrogen Oxide (lbs/MWh) 1.0 36 Carbon Dioxide (lbs/MWh) 1,150 33 Total Retail Sales (megawatthours) 90,862,645 15 Full Service Provider Sales (megawatthours) 90,862,645 13

113

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Arkansas Electricity Profile 2010 Arkansas profile Arkansas Electricity Profile 2010 Arkansas profile Table 1. 2010 Summary Statistics (Arkansas) Item Value U.S. Rank NERC Region(s) SERC/SPP Primary Energy Source Coal Net Summer Capacity (megawatts) 15,981 25 Electric Utilities 11,488 23 Independent Power Producers & Combined Heat and Power 4,493 24 Net Generation (megawatthours) 61,000,185 25 Electric Utilities 47,108,063 20 Independent Power Producers & Combined Heat and Power 13,892,122 27 Emissions (thousand metric tons) Sulfur Dioxide 74 22 Nitrogen Oxide 40 29 Carbon Dioxide 34,018 28 Sulfur Dioxide (lbs/MWh) 2.7 22 Nitrogen Oxide (lbs/MWh) 1.5 24 Carbon Dioxide (lbs/MWh) 1,229 29 Total Retail Sales (megawatthours) 48,194,285 29 Full Service Provider Sales (megawatthours) 48,194,285 27

114

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Maryland Electricity Profile 2010 Maryland profile Maryland Electricity Profile 2010 Maryland profile Table 1. 2010 Summary Statistics (Maryland) Item Value U.S. Rank NERC Region(s) RFC Primary Energy Source Coal Net Summer Capacity (megawatts) 12,516 33 Electric Utilities 80 47 Independent Power Producers & Combined Heat and Power 12,436 9 Net Generation (megawatthours) 43,607,264 33 Electric Utilities 2,996 48 Independent Power Producers & Combined Heat and Power 43,604,268 9 Emissions (thousand metric tons) Sulfur Dioxide 45 28 Nitrogen Oxide 25 34 Carbon Dioxide 26,369 33 Sulfur Dioxide (lbs/MWh) 2.3 29 Nitrogen Oxide (lbs/MWh) 1.3 29 Carbon Dioxide (lbs/MWh) 1,333 24 Total Retail Sales (megawatthours) 65,335,498 24 Full Service Provider Sales (megawatthours) 36,082,473 31

115

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Hawaii Electricity Profile 2010 Hawaii profile Hawaii Electricity Profile 2010 Hawaii profile Table 1. 2010 Summary Statistics (Hawaii) Item Value U.S. Rank NERC Region(s) -- Primary Energy Source Petroleum Net Summer Capacity (megawatts) 2,536 47 Electric Utilities 1,828 40 Independent Power Producers & Combined Heat and Power 708 47 Net Generation (megawatthours) 10,836,036 45 Electric Utilities 6,416,068 38 Independent Power Producers & Combined Heat and Power 4,419,968 38 Emissions (thousand metric tons) Sulfur Dioxide 17 36 Nitrogen Oxide 21 36 Carbon Dioxide 8,287 42 Sulfur Dioxide (lbs/MWh) 3.4 16 Nitrogen Oxide (lbs/MWh) 4.3 2 Carbon Dioxide (lbs/MWh) 1,686 13 Total Retail Sales (megawatthours) 10,016,509 48 Full Service Provider Sales (megawatthours) 10,016,509 44

116

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Mexico Electricity Profile 2010 New Mexico profile Mexico Electricity Profile 2010 New Mexico profile Table 1. 2010 Summary Statistics (New Mexico) Item Value U.S. Rank NERC Region(s) SPP/WECC Primary Energy Source Coal Net Summer Capacity (megawatts) 8,130 36 Electric Utilities 6,345 33 Independent Power Producers & Combined Heat and Power 1,785 36 Net Generation (megawatthours) 36,251,542 37 Electric Utilities 30,848,406 33 Independent Power Producers & Combined Heat and Power 5,403,136 37 Emissions (thousand metric tons) Sulfur Dioxide 15 38 Nitrogen Oxide 56 19 Carbon Dioxide 29,379 31 Sulfur Dioxide (lbs/MWh) 0.9 42 Nitrogen Oxide (lbs/MWh) 3.4 5 Carbon Dioxide (lbs/MWh) 1,787 11 Total Retail Sales (megawatthours) 22,428,344 39 Full Service Provider Sales (megawatthours) 22,428,344 38

117

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Hampshire Electricity Profile 2010 New Hampshire profile Hampshire Electricity Profile 2010 New Hampshire profile Table 1. 2010 Summary Statistics (New Hampshire) Item Value U.S. Rank NERC Region(s) NPCC Primary Energy Source Nuclear Net Summer Capacity (megawatts) 4,180 43 Electric Utilities 1,132 41 Independent Power Producers & Combined Heat and Power 3,048 32 Net Generation (megawatthours) 22,195,912 42 Electric Utilities 3,979,333 41 Independent Power Producers & Combined Heat and Power 18,216,579 19 Emissions (thousand metric tons) Sulfur Dioxide 34 32 Nitrogen Oxide 6 46 Carbon Dioxide 5,551 43 Sulfur Dioxide (lbs/MWh) 3.4 17 Nitrogen Oxide (lbs/MWh) 0.6 46 Carbon Dioxide (lbs/MWh) 551 47 Total Retail Sales (megawatthours) 10,890,074 47 Full Service Provider Sales (megawatthours) 7,712,938 45

118

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Oregon Electricity Profile 2010 Oregon profile Oregon Electricity Profile 2010 Oregon profile Table 1. 2010 Summary Statistics (Oregon) Item Value U.S. Rank NERC Region(s) WECC Primary Energy Source Hydroelectric Net Summer Capacity (megawatts) 14,261 29 Electric Utilities 10,846 27 Independent Power Producers & Combined Heat and Power 3,415 28 Net Generation (megawatthours) 55,126,999 27 Electric Utilities 41,142,684 26 Independent Power Producers & Combined Heat and Power 13,984,316 26 Emissions (thousand metric tons) Sulfur Dioxide 16 37 Nitrogen Oxide 15 42 Carbon Dioxide 10,094 40 Sulfur Dioxide (lbs/MWh) 0.6 44 Nitrogen Oxide (lbs/MWh) 0.6 47 Carbon Dioxide (lbs/MWh) 404 48 Total Retail Sales (megawatthours) 46,025,945 30 Full Service Provider Sales (megawatthours) 44,525,865 29

119

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Maine Electricity Profile 2010 Maine profile Maine Electricity Profile 2010 Maine profile Table 1. 2010 Summary Statistics (Maine) Item Value U.S. Rank NERC Region(s) NPCC Primary Energy Source Gas Net Summer Capacity (megawatts) 4,430 42 Electric Utilities 19 49 Independent Power Producers & Combined Heat and Power 4,410 25 Net Generation (megawatthours) 17,018,660 43 Electric Utilities 1,759 49 Independent Power Producers & Combined Heat and Power 17,016,901 22 Emissions (thousand metric tons) Sulfur Dioxide 12 42 Nitrogen Oxide 8 44 Carbon Dioxide 4,948 44 Sulfur Dioxide (lbs/MWh) 1.6 36 Nitrogen Oxide (lbs/MWh) 1.1 33 Carbon Dioxide (lbs/MWh) 641 44 Total Retail Sales (megawatthours) 11,531,568 45 Full Service Provider Sales (megawatthours) 151,588 51 Energy-Only Provider Sales (megawatthours) 11,379,980 10

120

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Mississippi Electricity Profile 2010 Mississippi profile Mississippi Electricity Profile 2010 Mississippi profile Table 1. 2010 Summary Statistics (Mississippi) Item Value U.S. Rank NERC Region(s) SERC Primary Energy Source Gas Net Summer Capacity (megawatts) 15,691 26 Electric Utilities 10,858 26 Independent Power Producers & Combined Heat and Power 4,833 18 Net Generation (megawatthours) 54,487,260 28 Electric Utilities 40,841,436 27 Independent Power Producers & Combined Heat and Power 13,645,824 28 Emissions (thousand metric tons) Sulfur Dioxide 59 26 Nitrogen Oxide 31 32 Carbon Dioxide 26,845 32 Sulfur Dioxide (lbs/MWh) 2.4 26 Nitrogen Oxide (lbs/MWh) 1.2 30 Carbon Dioxide (lbs/MWh) 1,086 36 Total Retail Sales (megawatthours) 49,687,166 28 Full Service Provider Sales (megawatthours) 49,687,166 26

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Washington Electricity Profile 2010 Washington profile Washington Electricity Profile 2010 Washington profile Table 1. 2010 Summary Statistics (Washington) Item Value U.S. Rank NERC Region(s) WECC Primary Energy Source Hydroelectric Net Summer Capacity (megawatts) 30,478 10 Electric Utilities 26,498 5 Independent Power Producers & Combined Heat and Power 3,979 26 Net Generation (megawatthours) 103,472,729 15 Electric Utilities 88,057,219 14 Independent Power Producers & Combined Heat and Power 15,415,510 23 Emissions (thousand metric tons) Sulfur Dioxide 14 39 Nitrogen Oxide 21 37 Carbon Dioxide 13,984 39 Sulfur Dioxide (lbs/MWh) 0.3 47 Nitrogen Oxide (lbs/MWh) 0.4 50 Carbon Dioxide (lbs/MWh) 298 49 Total Retail Sales (megawatthours) 90,379,970 16 Full Service Provider Sales (megawatthours) 88,116,958 14

122

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Mexico Electricity Profile 2010 New Mexico profile Mexico Electricity Profile 2010 New Mexico profile Table 1. 2010 Summary Statistics (New Mexico) Item Value U.S. Rank NERC Region(s) SPP/WECC Primary Energy Source Coal Net Summer Capacity (megawatts) 8,130 36 Electric Utilities 6,345 33 Independent Power Producers & Combined Heat and Power 1,785 36 Net Generation (megawatthours) 36,251,542 37 Electric Utilities 30,848,406 33 Independent Power Producers & Combined Heat and Power 5,403,136 37 Emissions (thousand metric tons) Sulfur Dioxide 15 38 Nitrogen Oxide 56 19 Carbon Dioxide 29,379 31 Sulfur Dioxide (lbs/MWh) 0.9 42 Nitrogen Oxide (lbs/MWh) 3.4 5 Carbon Dioxide (lbs/MWh) 1,787 11 Total Retail Sales (megawatthours) 22,428,344 39 Full Service Provider Sales (megawatthours) 22,428,344 38

123

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Delaware Electricity Profile 2010 Delaware profile Delaware Electricity Profile 2010 Delaware profile Table 1. 2010 Summary Statistics (Delaware) Item Value U.S. Rank NERC Region(s) RFC Primary Energy Source Gas Net Summer Capacity (megawatts) 3,389 46 Electric Utilities 55 48 Independent Power Producers & Combined Heat and Power 3,334 29 Net Generation (megawatthours) 5,627,645 50 Electric Utilities 30,059 46 Independent Power Producers & Combined Heat and Power 5,597,586 36 Emissions (thousand metric tons) Sulfur Dioxide 13 41 Nitrogen Oxide 5 47 Carbon Dioxide 4,187 45 Sulfur Dioxide (lbs/MWh) 5.2 7 Nitrogen Oxide (lbs/MWh) 1.9 16 Carbon Dioxide (lbs/MWh) 1,640 15 Total Retail Sales (megawatthours) 11,605,932 44 Full Service Provider Sales (megawatthours) 7,582,539 46

124

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Ohio Electricity Profile 2010 Ohio profile Ohio Electricity Profile 2010 Ohio profile Table 1. 2010 Summary Statistics (Ohio) Item Value U.S. Rank NERC Region(s) RFC Primary Energy Source Coal Net Summer Capacity (megawatts) 33,071 8 Electric Utilities 20,179 13 Independent Power Producers & Combined Heat and Power 12,892 7 Net Generation (megawatthours) 143,598,337 7 Electric Utilities 92,198,096 10 Independent Power Producers & Combined Heat and Power 51,400,241 7 Emissions (thousand metric tons) Sulfur Dioxide 610 1 Nitrogen Oxide 122 3 Carbon Dioxide 121,964 4 Sulfur Dioxide (lbs/MWh) 9.4 1 Nitrogen Oxide (lbs/MWh) 1.9 17 Carbon Dioxide (lbs/MWh) 1,872 8 Total Retail Sales (megawatthours) 154,145,418 4 Full Service Provider Sales (megawatthours) 105,329,797 9

125

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Arkansas Electricity Profile 2010 Arkansas profile Arkansas Electricity Profile 2010 Arkansas profile Table 1. 2010 Summary Statistics (Arkansas) Item Value U.S. Rank NERC Region(s) SERC/SPP Primary Energy Source Coal Net Summer Capacity (megawatts) 15,981 25 Electric Utilities 11,488 23 Independent Power Producers & Combined Heat and Power 4,493 24 Net Generation (megawatthours) 61,000,185 25 Electric Utilities 47,108,063 20 Independent Power Producers & Combined Heat and Power 13,892,122 27 Emissions (thousand metric tons) Sulfur Dioxide 74 22 Nitrogen Oxide 40 29 Carbon Dioxide 34,018 28 Sulfur Dioxide (lbs/MWh) 2.7 22 Nitrogen Oxide (lbs/MWh) 1.5 24 Carbon Dioxide (lbs/MWh) 1,229 29 Total Retail Sales (megawatthours) 48,194,285 29 Full Service Provider Sales (megawatthours) 48,194,285 27

126

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Oklahoma Electricity Profile 2010 Oklahoma profile Oklahoma Electricity Profile 2010 Oklahoma profile Table 1. 2010 Summary Statistics (Oklahoma) Item Value U.S. Rank NERC Region(s) SPP Primary Energy Source Gas Net Summer Capacity (megawatts) 21,022 20 Electric Utilities 16,015 18 Independent Power Producers & Combined Heat and Power 5,006 17 Net Generation (megawatthours) 72,250,733 22 Electric Utilities 57,421,195 17 Independent Power Producers & Combined Heat and Power 14,829,538 24 Emissions (thousand metric tons) Sulfur Dioxide 85 21 Nitrogen Oxide 71 12 Carbon Dioxide 49,536 17 Sulfur Dioxide (lbs/MWh) 2.6 24 Nitrogen Oxide (lbs/MWh) 2.2 11 Carbon Dioxide (lbs/MWh) 1,512 17 Total Retail Sales (megawatthours) 57,845,980 25 Full Service Provider Sales (megawatthours) 57,845,980 23

127

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Iowa Electricity Profile 2010 Iowa profile Iowa Electricity Profile 2010 Iowa profile Table 1. 2010 Summary Statistics (Iowa) Item Value U.S. Rank NERC Region(s) MRO/SERC Primary Energy Source Coal Net Summer Capacity (megawatts) 14,592 28 Electric Utilities 11,282 24 Independent Power Producers & Combined Heat and Power 3,310 30 Net Generation (megawatthours) 57,508,721 26 Electric Utilities 46,188,988 21 Independent Power Producers & Combined Heat and Power 11,319,733 30 Emissions (thousand metric tons) Sulfur Dioxide 108 18 Nitrogen Oxide 50 22 Carbon Dioxide 47,211 20 Sulfur Dioxide (lbs/MWh) 4.1 11 Nitrogen Oxide (lbs/MWh) 1.9 14 Carbon Dioxide (lbs/MWh) 1,810 10 Total Retail Sales (megawatthours) 45,445,269 31 Full Service Provider Sales (megawatthours) 45,445,269 28

128

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

West Virginia Electricity Profile 2010 West Virginia profile West Virginia Electricity Profile 2010 West Virginia profile Table 1. 2010 Summary Statistics (West Virginia) Item Value U.S. Rank NERC Region(s) RFC Primary Energy Source Coal Net Summer Capacity (megawatts) 16,495 24 Electric Utilities 11,719 21 Independent Power Producers & Combined Heat and Power 4,775 19 Net Generation (megawatthours) 80,788,947 20 Electric Utilities 56,719,755 18 Independent Power Producers & Combined Heat and Power 24,069,192 13 Emissions (thousand metric tons) Sulfur Dioxide 105 20 Nitrogen Oxide 49 23 Carbon Dioxide 74,283 12 Sulfur Dioxide (lbs/MWh) 2.9 20 Nitrogen Oxide (lbs/MWh) 1.3 25 Carbon Dioxide (lbs/MWh) 2,027 5 Total Retail Sales (megawatthours) 32,031,803 34 Full Service Provider Sales (megawatthours) 32,031,803 33

129

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Vermont Electricity Profile 2010 Vermont profile Vermont Electricity Profile 2010 Vermont profile Table 1. 2010 Summary Statistics (Vermont) Item Value U.S. Rank NERC Region(s) NPCC Primary Energy Source Nuclear Net Summer Capacity (megawatts) 1,128 50 Electric Utilities 260 45 Independent Power Producers & Combined Heat and Power 868 43 Net Generation (megawatthours) 6,619,990 49 Electric Utilities 720,853 44 Independent Power Producers & Combined Heat and Power 5,899,137 35 Emissions (thousand metric tons) Sulfur Dioxide * 51 Nitrogen Oxide 1 50 Carbon Dioxide 8 51 Sulfur Dioxide (lbs/MWh) * 51 Nitrogen Oxide (lbs/MWh) 0.2 51 Carbon Dioxide (lbs/MWh) 3 51 Total Retail Sales (megawatthours) 5,594,833 51 Full Service Provider Sales (megawatthours) 5,594,833 48 Direct Use (megawatthours) 19,806 47

130

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Mississippi Electricity Profile 2010 Mississippi profile Mississippi Electricity Profile 2010 Mississippi profile Table 1. 2010 Summary Statistics (Mississippi) Item Value U.S. Rank NERC Region(s) SERC Primary Energy Source Gas Net Summer Capacity (megawatts) 15,691 26 Electric Utilities 10,858 26 Independent Power Producers & Combined Heat and Power 4,833 18 Net Generation (megawatthours) 54,487,260 28 Electric Utilities 40,841,436 27 Independent Power Producers & Combined Heat and Power 13,645,824 28 Emissions (thousand metric tons) Sulfur Dioxide 59 26 Nitrogen Oxide 31 32 Carbon Dioxide 26,845 32 Sulfur Dioxide (lbs/MWh) 2.4 26 Nitrogen Oxide (lbs/MWh) 1.2 30 Carbon Dioxide (lbs/MWh) 1,086 36 Total Retail Sales (megawatthours) 49,687,166 28 Full Service Provider Sales (megawatthours) 49,687,166 26

131

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Wisconsin Electricity Profile 2010 Wisconsin profile Wisconsin Electricity Profile 2010 Wisconsin profile Table 1. 2010 Summary Statistics (Wisconsin) Item Value U.S. Rank NERC Region(s) MRO/RFC Primary Energy Source Coal Net Summer Capacity (megawatts) 17,836 23 Electric Utilities 13,098 19 Independent Power Producers & Combined Heat and Power 4,738 20 Net Generation (megawatthours) 64,314,067 24 Electric Utilities 45,579,970 22 Independent Power Producers & Combined Heat and Power 18,734,097 18 Emissions (thousand metric tons) Sulfur Dioxide 145 12 Nitrogen Oxide 49 25 Carbon Dioxide 47,238 19 Sulfur Dioxide (lbs/MWh) 5.0 9 Nitrogen Oxide (lbs/MWh) 1.7 20 Carbon Dioxide (lbs/MWh) 1,619 16 Total Retail Sales (megawatthours) 68,752,417 22 Full Service Provider Sales (megawatthours) 68,752,417 21

132

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Colorado Electricity Profile 2010 Colorado profile Colorado Electricity Profile 2010 Colorado profile Table 1. 2010 Summary Statistics (Colorado) Item Value U.S. Rank NERC Region(s) RFC/WECC Primary Energy Source Coal Net Summer Capacity (megawatts) 13,777 30 Electric Utilities 9,114 28 Independent Power Producers & Combined Heat and Power 4,662 22 Net Generation (megawatthours) 50,720,792 30 Electric Utilities 39,584,166 28 Independent Power Producers & Combined Heat and Power 11,136,626 31 Emissions (thousand metric tons) Sulfur Dioxide 45 29 Nitrogen Oxide 55 20 Carbon Dioxide 40,499 24 Sulfur Dioxide (lbs/MWh) 2.0 32 Nitrogen Oxide (lbs/MWh) 2.4 10 Carbon Dioxide (lbs/MWh) 1,760 12 Total Retail Sales (megawatthours) 52,917,786 27 Full Service Provider Sales (megawatthours) 52,917,786 24

133

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Hampshire Electricity Profile 2010 New Hampshire profile Hampshire Electricity Profile 2010 New Hampshire profile Table 1. 2010 Summary Statistics (New Hampshire) Item Value U.S. Rank NERC Region(s) NPCC Primary Energy Source Nuclear Net Summer Capacity (megawatts) 4,180 43 Electric Utilities 1,132 41 Independent Power Producers & Combined Heat and Power 3,048 32 Net Generation (megawatthours) 22,195,912 42 Electric Utilities 3,979,333 41 Independent Power Producers & Combined Heat and Power 18,216,579 19 Emissions (thousand metric tons) Sulfur Dioxide 34 32 Nitrogen Oxide 6 46 Carbon Dioxide 5,551 43 Sulfur Dioxide (lbs/MWh) 3.4 17 Nitrogen Oxide (lbs/MWh) 0.6 46 Carbon Dioxide (lbs/MWh) 551 47 Total Retail Sales (megawatthours) 10,890,074 47 Full Service Provider Sales (megawatthours) 7,712,938 45

134

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Carolina Electricity Profile 2010 North Carolina profile Carolina Electricity Profile 2010 North Carolina profile Table 1. 2010 Summary Statistics (North Carolina) Item Value U.S. Rank NERC Region(s) SERC Primary Energy Source Coal Net Summer Capacity (megawatts) 27,674 12 Electric Utilities 25,553 6 Independent Power Producers & Combined Heat and Power 2,121 34 Net Generation (megawatthours) 128,678,483 10 Electric Utilities 121,251,138 3 Independent Power Producers & Combined Heat and Power 7,427,345 34 Emissions (thousand metric tons) Sulfur Dioxide 131 14 Nitrogen Oxide 57 16 Carbon Dioxide 73,241 13 Sulfur Dioxide (lbs/MWh) 2.2 31 Nitrogen Oxide (lbs/MWh) 1.0 34 Carbon Dioxide (lbs/MWh) 1,255 28 Total Retail Sales (megawatthours) 136,414,947 9 Full Service Provider Sales (megawatthours) 136,414,947 5

135

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Nevada Electricity Profile 2010 Nevada profile Nevada Electricity Profile 2010 Nevada profile Table 1. 2010 Summary Statistics (Nevada) Item Value U.S. Rank NERC Region(s) WECC Primary Energy Source Gas Net Summer Capacity (megawatts) 11,421 34 Electric Utilities 8,713 29 Independent Power Producers & Combined Heat and Power 2,708 33 Net Generation (megawatthours) 35,146,248 38 Electric Utilities 23,710,917 34 Independent Power Producers & Combined Heat and Power 11,435,331 29 Emissions (thousand metric tons) Sulfur Dioxide 7 44 Nitrogen Oxide 15 40 Carbon Dioxide 17,020 38 Sulfur Dioxide (lbs/MWh) 0.4 46 Nitrogen Oxide (lbs/MWh) 1.0 37 Carbon Dioxide (lbs/MWh) 1,068 37 Total Retail Sales (megawatthours) 33,772,595 33 Full Service Provider Sales (megawatthours) 32,348,879 32

136

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Kansas Electricity Profile 2010 Kansas profile Kansas Electricity Profile 2010 Kansas profile Table 1. 2010 Summary Statistics (Kansas) Item Value U.S. Rank NERC Region(s) MRO/SPP Primary Energy Source Coal Net Summer Capacity (megawatts) 12,543 32 Electric Utilities 11,732 20 Independent Power Producers & Combined Heat and Power 812 45 Net Generation (megawatthours) 47,923,762 32 Electric Utilities 45,270,047 24 Independent Power Producers & Combined Heat and Power 2,653,716 44 Emissions (thousand metric tons) Sulfur Dioxide 41 30 Nitrogen Oxide 46 26 Carbon Dioxide 36,321 26 Sulfur Dioxide (lbs/MWh) 1.9 33 Nitrogen Oxide (lbs/MWh) 2.1 13 Carbon Dioxide (lbs/MWh) 1,671 14 Total Retail Sales (megawatthours) 40,420,675 32 Full Service Provider Sales (megawatthours) 40,420,675 30

137

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Nebraska Electricity Profile 2010 Nebraska profile Nebraska Electricity Profile 2010 Nebraska profile Table 1. 2010 Summary Statistics (Nebraska) Item Value U.S. Rank NERC Region(s) MRO/SPP Primary Energy Source Coal Net Summer Capacity (megawatts) 7,857 38 Electric Utilities 7,647 30 Independent Power Producers & Combined Heat and Power 210 50 Net Generation (megawatthours) 36,630,006 36 Electric Utilities 36,242,921 30 Independent Power Producers & Combined Heat and Power 387,085 50 Emissions (thousand metric tons) Sulfur Dioxide 65 24 Nitrogen Oxide 40 30 Carbon Dioxide 24,461 34 Sulfur Dioxide (lbs/MWh) 3.9 12 Nitrogen Oxide (lbs/MWh) 2.4 9 Carbon Dioxide (lbs/MWh) 1,472 19 Total Retail Sales (megawatthours) 29,849,460 36 Full Service Provider Sales (megawatthours) 29,849,460 35

138

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Missouri Electricity Profile 2010 Missouri profile Missouri Electricity Profile 2010 Missouri profile Table 1. 2010 Summary Statistics (Missouri) Item Value U.S. Rank NERC Region(s) SERC/SPP Primary Energy Source Coal Net Summer Capacity (megawatts) 21,739 18 Electric Utilities 20,360 12 Independent Power Producers & Combined Heat and Power 1,378 39 Net Generation (megawatthours) 92,312,989 18 Electric Utilities 90,176,805 12 Independent Power Producers & Combined Heat and Power 2,136,184 46 Emissions (thousand metric tons) Sulfur Dioxide 233 8 Nitrogen Oxide 56 18 Carbon Dioxide 78,815 10 Sulfur Dioxide (lbs/MWh) 5.6 6 Nitrogen Oxide (lbs/MWh) 1.3 26 Carbon Dioxide (lbs/MWh) 1,882 7 Total Retail Sales (megawatthours) 86,085,117 17 Full Service Provider Sales (megawatthours) 86,085,117 15

139

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Dakota Electricity Profile 2010 North Dakota profile Dakota Electricity Profile 2010 North Dakota profile Table 1. 2010 Summary Statistics (North Dakota) Item Value U.S. Rank NERC Region(s) MRO Primary Energy Source Coal Net Summer Capacity (megawatts) 6,188 40 Electric Utilities 4,912 34 Independent Power Producers & Combined Heat and Power 1,276 40 Net Generation (megawatthours) 34,739,542 39 Electric Utilities 31,343,796 32 Independent Power Producers & Combined Heat and Power 3,395,746 41 Emissions (thousand metric tons) Sulfur Dioxide 116 17 Nitrogen Oxide 52 21 Carbon Dioxide 31,064 30 Sulfur Dioxide (lbs/MWh) 7.3 3 Nitrogen Oxide (lbs/MWh) 3.3 6 Carbon Dioxide (lbs/MWh) 1,971 6 Total Retail Sales (megawatthours) 12,956,263 42 Full Service Provider Sales (megawatthours) 12,956,263 41

140

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Minnesota Electricity Profile 2010 Minnesota profile Minnesota Electricity Profile 2010 Minnesota profile Table 1. 2010 Summary Statistics (Minnesota) Item Value U.S. Rank NERC Region(s) MRO Primary Energy Source Coal Net Summer Capacity (megawatts) 14,715 27 Electric Utilities 11,547 22 Independent Power Producers & Combined Heat and Power 3,168 31 Net Generation (megawatthours) 53,670,227 29 Electric Utilities 45,428,599 23 Independent Power Producers & Combined Heat and Power 8,241,628 32 Emissions (thousand metric tons) Sulfur Dioxide 57 27 Nitrogen Oxide 44 27 Carbon Dioxide 32,946 29 Sulfur Dioxide (lbs/MWh) 2.3 27 Nitrogen Oxide (lbs/MWh) 1.8 18 Carbon Dioxide (lbs/MWh) 1,353 21 Total Retail Sales (megawatthours) 67,799,706 23 Full Service Provider Sales (megawatthours) 67,799,706 22

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Louisiana Electricity Profile 2010 Louisiana profile Louisiana Electricity Profile 2010 Louisiana profile Table 1. 2010 Summary Statistics (Louisiana) Item Value U.S. Rank NERC Region(s) SERC/SPP Primary Energy Source Gas Net Summer Capacity (megawatts) 26,744 14 Electric Utilities 16,471 17 Independent Power Producers & Combined Heat and Power 10,272 10 Net Generation (megawatthours) 102,884,940 16 Electric Utilities 51,680,682 19 Independent Power Producers & Combined Heat and Power 51,204,258 8 Emissions (thousand metric tons) Sulfur Dioxide 126 15 Nitrogen Oxide 75 11 Carbon Dioxide 58,706 14 Sulfur Dioxide (lbs/MWh) 2.7 21 Nitrogen Oxide (lbs/MWh) 1.6 21 Carbon Dioxide (lbs/MWh) 1,258 27 Total Retail Sales (megawatthours) 85,079,692 18 Full Service Provider Sales (megawatthours) 85,079,692 16

142

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Utah Electricity Profile 2010 Utah profile Utah Electricity Profile 2010 Utah profile Table 1. 2010 Summary Statistics (Utah) Item Value U.S. Rank NERC Region(s) WECC Primary Energy Source Coal Net Summer Capacity (megawatts) 7,497 39 Electric Utilities 6,648 32 Independent Power Producers & Combined Heat and Power 849 44 Net Generation (megawatthours) 42,249,355 35 Electric Utilities 39,522,124 29 Independent Power Producers & Combined Heat and Power 2,727,231 43 Emissions (thousand metric tons) Sulfur Dioxide 25 34 Nitrogen Oxide 68 13 Carbon Dioxide 35,519 27 Sulfur Dioxide (lbs/MWh) 1.3 38 Nitrogen Oxide (lbs/MWh) 3.6 4 Carbon Dioxide (lbs/MWh) 1,853 9 Total Retail Sales (megawatthours) 28,044,001 37 Full Service Provider Sales (megawatthours) 28,044,001 36

143

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Virginia Electricity Profile 2010 Virginia profile Virginia Electricity Profile 2010 Virginia profile Table 1. 2010 Summary Statistics (Virginia) Item Value U.S. Rank NERC Region(s) RFC/SERC Primary Energy Source Nuclear Net Summer Capacity (megawatts) 24,109 16 Electric Utilities 19,434 15 Independent Power Producers & Combined Heat and Power 4,676 21 Net Generation (megawatthours) 72,966,456 21 Electric Utilities 58,902,054 16 Independent Power Producers & Combined Heat and Power 14,064,402 25 Emissions (thousand metric tons) Sulfur Dioxide 120 16 Nitrogen Oxide 49 24 Carbon Dioxide 39,719 25 Sulfur Dioxide (lbs/MWh) 3.6 15 Nitrogen Oxide (lbs/MWh) 1.5 23 Carbon Dioxide (lbs/MWh) 1,200 30 Total Retail Sales (megawatthours) 113,806,135 10 Full Service Provider Sales (megawatthours) 113,806,135 7

144

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Dakota Electricity Profile 2010 North Dakota profile Dakota Electricity Profile 2010 North Dakota profile Table 1. 2010 Summary Statistics (North Dakota) Item Value U.S. Rank NERC Region(s) MRO Primary Energy Source Coal Net Summer Capacity (megawatts) 6,188 40 Electric Utilities 4,912 34 Independent Power Producers & Combined Heat and Power 1,276 40 Net Generation (megawatthours) 34,739,542 39 Electric Utilities 31,343,796 32 Independent Power Producers & Combined Heat and Power 3,395,746 41 Emissions (thousand metric tons) Sulfur Dioxide 116 17 Nitrogen Oxide 52 21 Carbon Dioxide 31,064 30 Sulfur Dioxide (lbs/MWh) 7.3 3 Nitrogen Oxide (lbs/MWh) 3.3 6 Carbon Dioxide (lbs/MWh) 1,971 6 Total Retail Sales (megawatthours) 12,956,263 42 Full Service Provider Sales (megawatthours) 12,956,263 41

145

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Alaska Electricity Profile 2010 Alaska profile Alaska Electricity Profile 2010 Alaska profile Table 1. 2010 Summary Statistics (Alaska) Item Value U.S. Rank NERC Region(s) -- Primary Energy Source Gas Net Summer Capacity (megawatts) 2,067 48 Electric Utilities 1,889 39 Independent Power Producers & Combined Heat and Power 178 51 Net Generation (megawatthours) 6,759,576 48 Electric Utilities 6,205,050 40 Independent Power Producers & Combined Heat and Power 554,526 49 Emissions (thousand metric tons) Sulfur Dioxide 3 46 Nitrogen Oxide 16 39 Carbon Dioxide 4,125 46 Sulfur Dioxide (lbs/MWh) 1.0 41 Nitrogen Oxide (lbs/MWh) 5.2 1 Carbon Dioxide (lbs/MWh) 1,345 23 Total Retail Sales (megawatthours) 6,247,038 50 Full Service Provider Sales (megawatthours) 6,247,038 47

146

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Minnesota Electricity Profile 2010 Minnesota profile Minnesota Electricity Profile 2010 Minnesota profile Table 1. 2010 Summary Statistics (Minnesota) Item Value U.S. Rank NERC Region(s) MRO Primary Energy Source Coal Net Summer Capacity (megawatts) 14,715 27 Electric Utilities 11,547 22 Independent Power Producers & Combined Heat and Power 3,168 31 Net Generation (megawatthours) 53,670,227 29 Electric Utilities 45,428,599 23 Independent Power Producers & Combined Heat and Power 8,241,628 32 Emissions (thousand metric tons) Sulfur Dioxide 57 27 Nitrogen Oxide 44 27 Carbon Dioxide 32,946 29 Sulfur Dioxide (lbs/MWh) 2.3 27 Nitrogen Oxide (lbs/MWh) 1.8 18 Carbon Dioxide (lbs/MWh) 1,353 21 Total Retail Sales (megawatthours) 67,799,706 23 Full Service Provider Sales (megawatthours) 67,799,706 22

147

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Maryland Electricity Profile 2010 Maryland profile Maryland Electricity Profile 2010 Maryland profile Table 1. 2010 Summary Statistics (Maryland) Item Value U.S. Rank NERC Region(s) RFC Primary Energy Source Coal Net Summer Capacity (megawatts) 12,516 33 Electric Utilities 80 47 Independent Power Producers & Combined Heat and Power 12,436 9 Net Generation (megawatthours) 43,607,264 33 Electric Utilities 2,996 48 Independent Power Producers & Combined Heat and Power 43,604,268 9 Emissions (thousand metric tons) Sulfur Dioxide 45 28 Nitrogen Oxide 25 34 Carbon Dioxide 26,369 33 Sulfur Dioxide (lbs/MWh) 2.3 29 Nitrogen Oxide (lbs/MWh) 1.3 29 Carbon Dioxide (lbs/MWh) 1,333 24 Total Retail Sales (megawatthours) 65,335,498 24 Full Service Provider Sales (megawatthours) 36,082,473 31

148

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

York Electricity Profile 2010 New York profile York Electricity Profile 2010 New York profile Table 1. 2010 Summary Statistics (New York) Item Value U.S. Rank NERC Region(s) NPCC Primary Energy Source Gas Net Summer Capacity (megawatts) 39,357 6 Electric Utilities 11,032 25 Independent Power Producers & Combined Heat and Power 28,325 5 Net Generation (megawatthours) 136,961,654 9 Electric Utilities 34,633,335 31 Independent Power Producers & Combined Heat and Power 102,328,319 5 Emissions (thousand metric tons) Sulfur Dioxide 62 25 Nitrogen Oxide 44 28 Carbon Dioxide 41,584 22 Sulfur Dioxide (lbs/MWh) 1.0 40 Nitrogen Oxide (lbs/MWh) 0.7 44 Carbon Dioxide (lbs/MWh) 669 42 Total Retail Sales (megawatthours) 144,623,573 7 Full Service Provider Sales (megawatthours) 79,119,769 18

149

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Carolina Electricity Profile 2010 North Carolina profile Carolina Electricity Profile 2010 North Carolina profile Table 1. 2010 Summary Statistics (North Carolina) Item Value U.S. Rank NERC Region(s) SERC Primary Energy Source Coal Net Summer Capacity (megawatts) 27,674 12 Electric Utilities 25,553 6 Independent Power Producers & Combined Heat and Power 2,121 34 Net Generation (megawatthours) 128,678,483 10 Electric Utilities 121,251,138 3 Independent Power Producers & Combined Heat and Power 7,427,345 34 Emissions (thousand metric tons) Sulfur Dioxide 131 14 Nitrogen Oxide 57 16 Carbon Dioxide 73,241 13 Sulfur Dioxide (lbs/MWh) 2.2 31 Nitrogen Oxide (lbs/MWh) 1.0 34 Carbon Dioxide (lbs/MWh) 1,255 28 Total Retail Sales (megawatthours) 136,414,947 9 Full Service Provider Sales (megawatthours) 136,414,947 5

150

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Montana Electricity Profile 2010 Montana profile Montana Electricity Profile 2010 Montana profile Table 1. 2010 Summary Statistics (Montana) Item Value U.S. Rank NERC Region(s) MRO/WECC Primary Energy Source Coal Net Summer Capacity (megawatts) 5,866 41 Electric Utilities 2,340 38 Independent Power Producers & Combined Heat and Power 3,526 27 Net Generation (megawatthours) 29,791,181 41 Electric Utilities 6,271,180 39 Independent Power Producers & Combined Heat and Power 23,520,001 14 Emissions (thousand metric tons) Sulfur Dioxide 22 35 Nitrogen Oxide 21 35 Carbon Dioxide 20,370 35 Sulfur Dioxide (lbs/MWh) 1.6 35 Nitrogen Oxide (lbs/MWh) 1.6 22 Carbon Dioxide (lbs/MWh) 1,507 18 Total Retail Sales (megawatthours) 13,423,138 41 Full Service Provider Sales (megawatthours) 10,803,422 43

151

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Iowa Electricity Profile 2010 Iowa profile Iowa Electricity Profile 2010 Iowa profile Table 1. 2010 Summary Statistics (Iowa) Item Value U.S. Rank NERC Region(s) MRO/SERC Primary Energy Source Coal Net Summer Capacity (megawatts) 14,592 28 Electric Utilities 11,282 24 Independent Power Producers & Combined Heat and Power 3,310 30 Net Generation (megawatthours) 57,508,721 26 Electric Utilities 46,188,988 21 Independent Power Producers & Combined Heat and Power 11,319,733 30 Emissions (thousand metric tons) Sulfur Dioxide 108 18 Nitrogen Oxide 50 22 Carbon Dioxide 47,211 20 Sulfur Dioxide (lbs/MWh) 4.1 11 Nitrogen Oxide (lbs/MWh) 1.9 14 Carbon Dioxide (lbs/MWh) 1,810 10 Total Retail Sales (megawatthours) 45,445,269 31 Full Service Provider Sales (megawatthours) 45,445,269 28

152

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Illinois Electricity Profile 2010 Illinois profile Illinois Electricity Profile 2010 Illinois profile Table 1. 2010 Summary Statistics (Illinois) Item Value U.S. Rank NERC Region(s) MRO/RFC/SERC Primary Energy Source Nuclear Net Summer Capacity (megawatts) 44,127 5 Electric Utilities 4,800 35 Independent Power Producers & Combined Heat and Power 39,327 3 Net Generation (megawatthours) 201,351,872 5 Electric Utilities 12,418,332 35 Independent Power Producers & Combined Heat and Power 188,933,540 3 Emissions (thousand metric tons) Sulfur Dioxide 232 9 Nitrogen Oxide 83 8 Carbon Dioxide 103,128 6 Sulfur Dioxide (lbs/MWh) 2.5 25 Nitrogen Oxide (lbs/MWh) 0.9 38 Carbon Dioxide (lbs/MWh) 1,129 34 Total Retail Sales (megawatthours) 144,760,674 6 Full Service Provider Sales (megawatthours) 77,890,532 19

153

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Louisiana Electricity Profile 2010 Louisiana profile Louisiana Electricity Profile 2010 Louisiana profile Table 1. 2010 Summary Statistics (Louisiana) Item Value U.S. Rank NERC Region(s) SERC/SPP Primary Energy Source Gas Net Summer Capacity (megawatts) 26,744 14 Electric Utilities 16,471 17 Independent Power Producers & Combined Heat and Power 10,272 10 Net Generation (megawatthours) 102,884,940 16 Electric Utilities 51,680,682 19 Independent Power Producers & Combined Heat and Power 51,204,258 8 Emissions (thousand metric tons) Sulfur Dioxide 126 15 Nitrogen Oxide 75 11 Carbon Dioxide 58,706 14 Sulfur Dioxide (lbs/MWh) 2.7 21 Nitrogen Oxide (lbs/MWh) 1.6 21 Carbon Dioxide (lbs/MWh) 1,258 27 Total Retail Sales (megawatthours) 85,079,692 18 Full Service Provider Sales (megawatthours) 85,079,692 16

154

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

California Electricity Profile 2010 California profile California Electricity Profile 2010 California profile Table 1. 2010 Summary Statistics (California) Item Value U.S. Rank NERC Region(s) SPP/WECC Primary Energy Source Gas Net Summer Capacity (megawatts) 67,328 2 Electric Utilities 28,689 2 Independent Power Producers & Combined Heat and Power 38,639 4 Net Generation (megawatthours) 204,125,596 4 Electric Utilities 96,939,535 8 Independent Power Producers & Combined Heat and Power 107,186,061 4 Emissions (thousand metric tons) Sulfur Dioxide 3 47 Nitrogen Oxide 80 9 Carbon Dioxide 55,406 16 Sulfur Dioxide (lbs/MWh) * 49 Nitrogen Oxide (lbs/MWh) 0.9 41 Carbon Dioxide (lbs/MWh) 598 46 Total Retail Sales (megawatthours) 258,525,414 2 Full Service Provider Sales (megawatthours) 240,948,673 2

155

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Dakota Electricity Profile 2010 South Dakota profile Dakota Electricity Profile 2010 South Dakota profile Table 1. 2010 Summary Statistics (South Dakota) Item Value U.S. Rank NERC Region(s) MRO/WECC Primary Energy Source Hydroelectric Net Summer Capacity (megawatts) 3,623 45 Electric Utilities 2,994 37 Independent Power Producers & Combined Heat and Power 629 48 Net Generation (megawatthours) 10,049,636 46 Electric Utilities 8,682,448 36 Independent Power Producers & Combined Heat and Power 1,367,188 47 Emissions (thousand metric tons) Sulfur Dioxide 12 43 Nitrogen Oxide 12 43 Carbon Dioxide 3,611 47 Sulfur Dioxide (lbs/MWh) 2.6 23 Nitrogen Oxide (lbs/MWh) 2.6 8 Carbon Dioxide (lbs/MWh) 792 41 Total Retail Sales (megawatthours) 11,356,149 46 Full Service Provider Sales (megawatthours) 11,356,149 42

156

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Jersey Electricity Profile 2010 New Jersey profile Jersey Electricity Profile 2010 New Jersey profile Table 1. 2010 Summary Statistics (New Jersey) Item Value U.S. Rank NERC Region(s) RFC Primary Energy Source Nuclear Net Summer Capacity (megawatts) 18,424 22 Electric Utilities 460 43 Independent Power Producers & Combined Heat and Power 17,964 6 Net Generation (megawatthours) 65,682,494 23 Electric Utilities -186,385 50 Independent Power Producers & Combined Heat and Power 65,868,878 6 Emissions (thousand metric tons) Sulfur Dioxide 14 40 Nitrogen Oxide 15 41 Carbon Dioxide 19,160 37 Sulfur Dioxide (lbs/MWh) 0.5 45 Nitrogen Oxide (lbs/MWh) 0.5 48 Carbon Dioxide (lbs/MWh) 643 43 Total Retail Sales (megawatthours) 79,179,427 20 Full Service Provider Sales (megawatthours) 50,482,035 25

157

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Massachusetts Electricity Profile 2010 Massachusetts profile Massachusetts Electricity Profile 2010 Massachusetts profile Table 1. 2010 Summary Statistics (Massachusetts) Item Value U.S. Rank NERC Region(s) NPCC Primary Energy Source Gas Net Summer Capacity (megawatts) 13,697 31 Electric Utilities 937 42 Independent Power Producers & Combined Heat and Power 12,760 8 Net Generation (megawatthours) 42,804,824 34 Electric Utilities 802,906 43 Independent Power Producers & Combined Heat and Power 42,001,918 10 Emissions (thousand metric tons) Sulfur Dioxide 35 31 Nitrogen Oxide 17 38 Carbon Dioxide 20,291 36 Sulfur Dioxide (lbs/MWh) 1.8 34 Nitrogen Oxide (lbs/MWh) 0.9 39 Carbon Dioxide (lbs/MWh) 1,045 38 Total Retail Sales (megawatthours) 57,123,422 26 Full Service Provider Sales (megawatthours) 31,822,942 34

158

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Nebraska Electricity Profile 2010 Nebraska profile Nebraska Electricity Profile 2010 Nebraska profile Table 1. 2010 Summary Statistics (Nebraska) Item Value U.S. Rank NERC Region(s) MRO/SPP Primary Energy Source Coal Net Summer Capacity (megawatts) 7,857 38 Electric Utilities 7,647 30 Independent Power Producers & Combined Heat and Power 210 50 Net Generation (megawatthours) 36,630,006 36 Electric Utilities 36,242,921 30 Independent Power Producers & Combined Heat and Power 387,085 50 Emissions (thousand metric tons) Sulfur Dioxide 65 24 Nitrogen Oxide 40 30 Carbon Dioxide 24,461 34 Sulfur Dioxide (lbs/MWh) 3.9 12 Nitrogen Oxide (lbs/MWh) 2.4 9 Carbon Dioxide (lbs/MWh) 1,472 19 Total Retail Sales (megawatthours) 29,849,460 36 Full Service Provider Sales (megawatthours) 29,849,460 35

159

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Montana Electricity Profile 2010 Montana profile Montana Electricity Profile 2010 Montana profile Table 1. 2010 Summary Statistics (Montana) Item Value U.S. Rank NERC Region(s) MRO/WECC Primary Energy Source Coal Net Summer Capacity (megawatts) 5,866 41 Electric Utilities 2,340 38 Independent Power Producers & Combined Heat and Power 3,526 27 Net Generation (megawatthours) 29,791,181 41 Electric Utilities 6,271,180 39 Independent Power Producers & Combined Heat and Power 23,520,001 14 Emissions (thousand metric tons) Sulfur Dioxide 22 35 Nitrogen Oxide 21 35 Carbon Dioxide 20,370 35 Sulfur Dioxide (lbs/MWh) 1.6 35 Nitrogen Oxide (lbs/MWh) 1.6 22 Carbon Dioxide (lbs/MWh) 1,507 18 Total Retail Sales (megawatthours) 13,423,138 41 Full Service Provider Sales (megawatthours) 10,803,422 43

160

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Maine Electricity Profile 2010 Maine profile Maine Electricity Profile 2010 Maine profile Table 1. 2010 Summary Statistics (Maine) Item Value U.S. Rank NERC Region(s) NPCC Primary Energy Source Gas Net Summer Capacity (megawatts) 4,430 42 Electric Utilities 19 49 Independent Power Producers & Combined Heat and Power 4,410 25 Net Generation (megawatthours) 17,018,660 43 Electric Utilities 1,759 49 Independent Power Producers & Combined Heat and Power 17,016,901 22 Emissions (thousand metric tons) Sulfur Dioxide 12 42 Nitrogen Oxide 8 44 Carbon Dioxide 4,948 44 Sulfur Dioxide (lbs/MWh) 1.6 36 Nitrogen Oxide (lbs/MWh) 1.1 33 Carbon Dioxide (lbs/MWh) 641 44 Total Retail Sales (megawatthours) 11,531,568 45 Full Service Provider Sales (megawatthours) 151,588 51 Energy-Only Provider Sales (megawatthours) 11,379,980 10

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Texas Electricity Profile 2010 Texas profile Texas Electricity Profile 2010 Texas profile Table 1. 2010 Summary Statistics (Texas) Item Value U.S. Rank NERC Region(s) SERC/SPP/TRE/WECC Primary Energy Source Gas Net Summer Capacity (megawatts) 108,258 1 Electric Utilities 26,533 4 Independent Power Producers & Combined Heat and Power 81,724 1 Net Generation (megawatthours) 411,695,046 1 Electric Utilities 95,099,161 9 Independent Power Producers & Combined Heat and Power 316,595,885 1 Emissions (thousand metric tons) Sulfur Dioxide 430 2 Nitrogen Oxide 204 1 Carbon Dioxide 251,409 1 Sulfur Dioxide (lbs/MWh) 2.3 28 Nitrogen Oxide (lbs/MWh) 1.1 32 Carbon Dioxide (lbs/MWh) 1,346 22 Total Retail Sales (megawatthours) 358,457,550 1 Full Service Provider Sales (megawatthours) 358,457,550 1

162

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Florida Electricity Profile 2010 Florida profile Florida Electricity Profile 2010 Florida profile Table 1. 2010 Summary Statistics (Florida) Item Value U.S. Rank NERC Region(s) FRCC/SERC Primary Energy Source Gas Net Summer Capacity (megawatts) 59,147 3 Electric Utilities 50,853 1 Independent Power Producers & Combined Heat and Power 8,294 13 Net Generation (megawatthours) 229,095,935 3 Electric Utilities 206,062,185 1 Independent Power Producers & Combined Heat and Power 23,033,750 15 Emissions (thousand metric tons) Sulfur Dioxide 160 11 Nitrogen Oxide 101 5 Carbon Dioxide 123,811 2 Sulfur Dioxide (lbs/MWh) 1.5 37 Nitrogen Oxide (lbs/MWh) 1.0 35 Carbon Dioxide (lbs/MWh) 1,191 31 Total Retail Sales (megawatthours) 231,209,614 3 Full Service Provider Sales (megawatthours) 231,209,614 3

163

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Hawaii Electricity Profile 2010 Hawaii profile Hawaii Electricity Profile 2010 Hawaii profile Table 1. 2010 Summary Statistics (Hawaii) Item Value U.S. Rank NERC Region(s) -- Primary Energy Source Petroleum Net Summer Capacity (megawatts) 2,536 47 Electric Utilities 1,828 40 Independent Power Producers & Combined Heat and Power 708 47 Net Generation (megawatthours) 10,836,036 45 Electric Utilities 6,416,068 38 Independent Power Producers & Combined Heat and Power 4,419,968 38 Emissions (thousand metric tons) Sulfur Dioxide 17 36 Nitrogen Oxide 21 36 Carbon Dioxide 8,287 42 Sulfur Dioxide (lbs/MWh) 3.4 16 Nitrogen Oxide (lbs/MWh) 4.3 2 Carbon Dioxide (lbs/MWh) 1,686 13 Total Retail Sales (megawatthours) 10,016,509 48 Full Service Provider Sales (megawatthours) 10,016,509 44

164

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Connecticut Electricity Profile 2010 Connecticut profile Connecticut Electricity Profile 2010 Connecticut profile Table 1. 2010 Summary Statistics (Connecticut) Item Value U.S. Rank NERC Region(s) NPCC Primary Energy Source Nuclear Net Summer Capacity (megawatts) 8,284 35 Electric Utilities 160 46 Independent Power Producers & Combined Heat and Power 8,124 15 Net Generation (megawatthours) 33,349,623 40 Electric Utilities 65,570 45 Independent Power Producers & Combined Heat and Power 33,284,053 11 Emissions (thousand metric tons) Sulfur Dioxide 2 48 Nitrogen Oxide 7 45 Carbon Dioxide 9,201 41 Sulfur Dioxide (lbs/MWh) 0.1 48 Nitrogen Oxide (lbs/MWh) 0.5 49 Carbon Dioxide (lbs/MWh) 608 45 Total Retail Sales (megawatthours) 30,391,766 35 Full Service Provider Sales (megawatthours) 13,714,958 40

165

Adaptive web usage profiling  

Science Conference Proceedings (OSTI)

Web usage models and profiles capture significant interests and trends from past accesses. They are used to improve user experience, say through recommendation of pages, pre-fetching of pages, etc. While browsing behavior changes dynamically over time, ...

Bhushan Shankar Suryavanshi; Nematollaah Shiri; Sudhir P. Mudur

2005-08-01T23:59:59.000Z

166

Vertically Rising Microstructure Profiler  

Science Conference Proceedings (OSTI)

The vertically rising microstructure profiler was designed to measure temperature gradient and conductivity gradient microstructure in lakes, reservoirs and coastal seas. The instrument is totally independent of surface craft while collecting ...

G. D. Carter; J. Imberger

1986-09-01T23:59:59.000Z

167

Performance profiles style sheet  

U.S. Energy Information Administration (EIA)

investment throughout most of this period compared with the 1990s. Title: Performance profiles style sheet Author: Greg Filas Created Date: 12/23/2010 7:12:57 PM ...

168

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Connecticut Electricity Profile 2010 Connecticut profile Connecticut Electricity Profile 2010 Connecticut profile Table 1. 2010 Summary Statistics (Connecticut) Item Value U.S. Rank NERC Region(s) NPCC Primary Energy Source Nuclear Net Summer Capacity (megawatts) 8,284 35 Electric Utilities 160 46 Independent Power Producers & Combined Heat and Power 8,124 15 Net Generation (megawatthours) 33,349,623 40 Electric Utilities 65,570 45 Independent Power Producers & Combined Heat and Power 33,284,053 11 Emissions (thousand metric tons) Sulfur Dioxide 2 48 Nitrogen Oxide 7 45 Carbon Dioxide 9,201 41 Sulfur Dioxide (lbs/MWh) 0.1 48 Nitrogen Oxide (lbs/MWh) 0.5 49 Carbon Dioxide (lbs/MWh) 608 45 Total Retail Sales (megawatthours) 30,391,766 35 Full Service Provider Sales (megawatthours) 13,714,958 40

169

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Utah Electricity Profile 2010 Utah profile Utah Electricity Profile 2010 Utah profile Table 1. 2010 Summary Statistics (Utah) Item Value U.S. Rank NERC Region(s) WECC Primary Energy Source Coal Net Summer Capacity (megawatts) 7,497 39 Electric Utilities 6,648 32 Independent Power Producers & Combined Heat and Power 849 44 Net Generation (megawatthours) 42,249,355 35 Electric Utilities 39,522,124 29 Independent Power Producers & Combined Heat and Power 2,727,231 43 Emissions (thousand metric tons) Sulfur Dioxide 25 34 Nitrogen Oxide 68 13 Carbon Dioxide 35,519 27 Sulfur Dioxide (lbs/MWh) 1.3 38 Nitrogen Oxide (lbs/MWh) 3.6 4 Carbon Dioxide (lbs/MWh) 1,853 9 Total Retail Sales (megawatthours) 28,044,001 37 Full Service Provider Sales (megawatthours) 28,044,001 36

170

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Carolina Electricity Profile 2010 South Carolina profile Carolina Electricity Profile 2010 South Carolina profile Table 1. 2010 Summary Statistics (South Carolina) Item Value U.S. Rank NERC Region(s) SERC Primary Energy Source Nuclear Net Summer Capacity (megawatts) 23,982 17 Electric Utilities 22,172 9 Independent Power Producers & Combined Heat and Power 1,810 35 Net Generation (megawatthours) 104,153,133 14 Electric Utilities 100,610,887 6 Independent Power Producers & Combined Heat and Power 3,542,246 39 Emissions (thousand metric tons) Sulfur Dioxide 106 19 Nitrogen Oxide 30 33 Carbon Dioxide 41,364 23 Sulfur Dioxide (lbs/MWh) 2.2 30 Nitrogen Oxide (lbs/MWh) 0.6 45 Carbon Dioxide (lbs/MWh) 876 40 Total Retail Sales (megawatthours) 82,479,293 19 Full Service Provider Sales (megawatthours) 82,479,293 17

171

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Alaska Electricity Profile 2010 Alaska profile Alaska Electricity Profile 2010 Alaska profile Table 1. 2010 Summary Statistics (Alaska) Item Value U.S. Rank NERC Region(s) -- Primary Energy Source Gas Net Summer Capacity (megawatts) 2,067 48 Electric Utilities 1,889 39 Independent Power Producers & Combined Heat and Power 178 51 Net Generation (megawatthours) 6,759,576 48 Electric Utilities 6,205,050 40 Independent Power Producers & Combined Heat and Power 554,526 49 Emissions (thousand metric tons) Sulfur Dioxide 3 46 Nitrogen Oxide 16 39 Carbon Dioxide 4,125 46 Sulfur Dioxide (lbs/MWh) 1.0 41 Nitrogen Oxide (lbs/MWh) 5.2 1 Carbon Dioxide (lbs/MWh) 1,345 23 Total Retail Sales (megawatthours) 6,247,038 50 Full Service Provider Sales (megawatthours) 6,247,038 47

172

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Nevada Electricity Profile 2010 Nevada profile Nevada Electricity Profile 2010 Nevada profile Table 1. 2010 Summary Statistics (Nevada) Item Value U.S. Rank NERC Region(s) WECC Primary Energy Source Gas Net Summer Capacity (megawatts) 11,421 34 Electric Utilities 8,713 29 Independent Power Producers & Combined Heat and Power 2,708 33 Net Generation (megawatthours) 35,146,248 38 Electric Utilities 23,710,917 34 Independent Power Producers & Combined Heat and Power 11,435,331 29 Emissions (thousand metric tons) Sulfur Dioxide 7 44 Nitrogen Oxide 15 40 Carbon Dioxide 17,020 38 Sulfur Dioxide (lbs/MWh) 0.4 46 Nitrogen Oxide (lbs/MWh) 1.0 37 Carbon Dioxide (lbs/MWh) 1,068 37 Total Retail Sales (megawatthours) 33,772,595 33 Full Service Provider Sales (megawatthours) 32,348,879 32

173

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Washington Electricity Profile 2010 Washington profile Washington Electricity Profile 2010 Washington profile Table 1. 2010 Summary Statistics (Washington) Item Value U.S. Rank NERC Region(s) WECC Primary Energy Source Hydroelectric Net Summer Capacity (megawatts) 30,478 10 Electric Utilities 26,498 5 Independent Power Producers & Combined Heat and Power 3,979 26 Net Generation (megawatthours) 103,472,729 15 Electric Utilities 88,057,219 14 Independent Power Producers & Combined Heat and Power 15,415,510 23 Emissions (thousand metric tons) Sulfur Dioxide 14 39 Nitrogen Oxide 21 37 Carbon Dioxide 13,984 39 Sulfur Dioxide (lbs/MWh) 0.3 47 Nitrogen Oxide (lbs/MWh) 0.4 50 Carbon Dioxide (lbs/MWh) 298 49 Total Retail Sales (megawatthours) 90,379,970 16 Full Service Provider Sales (megawatthours) 88,116,958 14

174

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Oregon Electricity Profile 2010 Oregon profile Oregon Electricity Profile 2010 Oregon profile Table 1. 2010 Summary Statistics (Oregon) Item Value U.S. Rank NERC Region(s) WECC Primary Energy Source Hydroelectric Net Summer Capacity (megawatts) 14,261 29 Electric Utilities 10,846 27 Independent Power Producers & Combined Heat and Power 3,415 28 Net Generation (megawatthours) 55,126,999 27 Electric Utilities 41,142,684 26 Independent Power Producers & Combined Heat and Power 13,984,316 26 Emissions (thousand metric tons) Sulfur Dioxide 16 37 Nitrogen Oxide 15 42 Carbon Dioxide 10,094 40 Sulfur Dioxide (lbs/MWh) 0.6 44 Nitrogen Oxide (lbs/MWh) 0.6 47 Carbon Dioxide (lbs/MWh) 404 48 Total Retail Sales (megawatthours) 46,025,945 30 Full Service Provider Sales (megawatthours) 44,525,865 29

175

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Texas Electricity Profile 2010 Texas profile Texas Electricity Profile 2010 Texas profile Table 1. 2010 Summary Statistics (Texas) Item Value U.S. Rank NERC Region(s) SERC/SPP/TRE/WECC Primary Energy Source Gas Net Summer Capacity (megawatts) 108,258 1 Electric Utilities 26,533 4 Independent Power Producers & Combined Heat and Power 81,724 1 Net Generation (megawatthours) 411,695,046 1 Electric Utilities 95,099,161 9 Independent Power Producers & Combined Heat and Power 316,595,885 1 Emissions (thousand metric tons) Sulfur Dioxide 430 2 Nitrogen Oxide 204 1 Carbon Dioxide 251,409 1 Sulfur Dioxide (lbs/MWh) 2.3 28 Nitrogen Oxide (lbs/MWh) 1.1 32 Carbon Dioxide (lbs/MWh) 1,346 22 Total Retail Sales (megawatthours) 358,457,550 1 Full Service Provider Sales (megawatthours) 358,457,550 1

176

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Indiana Electricity Profile 2010 Indiana profile Indiana Electricity Profile 2010 Indiana profile Table 1. 2010 Summary Statistics (Indiana) Item Value U.S. Rank NERC Region(s) RFC Primary Energy Source Coal Net Summer Capacity (megawatts) 27,638 13 Electric Utilities 23,008 8 Independent Power Producers & Combined Heat and Power 4,630 23 Net Generation (megawatthours) 125,180,739 11 Electric Utilities 107,852,560 5 Independent Power Producers & Combined Heat and Power 17,328,179 20 Emissions (thousand metric tons) Sulfur Dioxide 385 4 Nitrogen Oxide 120 4 Carbon Dioxide 116,283 5 Sulfur Dioxide (lbs/MWh) 6.8 4 Nitrogen Oxide (lbs/MWh) 2.1 12 Carbon Dioxide (lbs/MWh) 2,048 4 Total Retail Sales (megawatthours) 105,994,376 11 Full Service Provider Sales (megawatthours) 105,994,376 8

177

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Oklahoma Electricity Profile 2010 Oklahoma profile Oklahoma Electricity Profile 2010 Oklahoma profile Table 1. 2010 Summary Statistics (Oklahoma) Item Value U.S. Rank NERC Region(s) SPP Primary Energy Source Gas Net Summer Capacity (megawatts) 21,022 20 Electric Utilities 16,015 18 Independent Power Producers & Combined Heat and Power 5,006 17 Net Generation (megawatthours) 72,250,733 22 Electric Utilities 57,421,195 17 Independent Power Producers & Combined Heat and Power 14,829,538 24 Emissions (thousand metric tons) Sulfur Dioxide 85 21 Nitrogen Oxide 71 12 Carbon Dioxide 49,536 17 Sulfur Dioxide (lbs/MWh) 2.6 24 Nitrogen Oxide (lbs/MWh) 2.2 11 Carbon Dioxide (lbs/MWh) 1,512 17 Total Retail Sales (megawatthours) 57,845,980 25 Full Service Provider Sales (megawatthours) 57,845,980 23

178

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Jersey Electricity Profile 2010 New Jersey profile Jersey Electricity Profile 2010 New Jersey profile Table 1. 2010 Summary Statistics (New Jersey) Item Value U.S. Rank NERC Region(s) RFC Primary Energy Source Nuclear Net Summer Capacity (megawatts) 18,424 22 Electric Utilities 460 43 Independent Power Producers & Combined Heat and Power 17,964 6 Net Generation (megawatthours) 65,682,494 23 Electric Utilities -186,385 50 Independent Power Producers & Combined Heat and Power 65,868,878 6 Emissions (thousand metric tons) Sulfur Dioxide 14 40 Nitrogen Oxide 15 41 Carbon Dioxide 19,160 37 Sulfur Dioxide (lbs/MWh) 0.5 45 Nitrogen Oxide (lbs/MWh) 0.5 48 Carbon Dioxide (lbs/MWh) 643 43 Total Retail Sales (megawatthours) 79,179,427 20 Full Service Provider Sales (megawatthours) 50,482,035 25

179

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Idaho Electricity Profile 2010 Idaho profile Idaho Electricity Profile 2010 Idaho profile Table 1. 2010 Summary Statistics (Idaho) Item Value U.S. Rank NERC Region(s) WECC Primary Energy Source Hydroelectric Net Summer Capacity (megawatts) 3,990 44 Electric Utilities 3,035 36 Independent Power Producers & Combined Heat and Power 955 42 Net Generation (megawatthours) 12,024,564 44 Electric Utilities 8,589,208 37 Independent Power Producers & Combined Heat and Power 3,435,356 40 Emissions (thousand metric tons) Sulfur Dioxide 7 45 Nitrogen Oxide 4 48 Carbon Dioxide 1,213 49 Sulfur Dioxide (lbs/MWh) 1.2 39 Nitrogen Oxide (lbs/MWh) 0.8 43 Carbon Dioxide (lbs/MWh) 222 50 Total Retail Sales (megawatthours) 22,797,668 38 Full Service Provider Sales (megawatthours) 22,797,668 37

180

Fermilab | Women's History Month - Profiles  

NLE Websites -- All DOE Office Websites (Extended Search)

Profiles The profiles on this page present a cross section of women from the Fermilab community. Fermilab hopes that profiles of these women will inspire young women everywhere to...

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Michigan Nuclear Profile - Power Plants  

U.S. Energy Information Administration (EIA)

snpt2mi Donald C Cook Unit 1, Unit 2 2,069 15,646 52.8 Indiana Michigan Power Co Fermi Unit 2 1,085 7,738 26.1 Detroit Edison Co Palisades Unit 1 793 ...

182

2001 Exhibition: Event Profile - TMS  

Science Conference Proceedings (OSTI)

2001 Exhibition: Event Profile ... Event Profile ... in transportation and other growing markets require the material to be designed for load bearing applications.

183

Importance of Elevation and Temperature Inversions for the Interpretat...  

Open Energy Info (EERE)

Importance of Elevation and Temperature Inversions for the Interpretation of Thermal Infrared Satellite Images Used in Geothermal Exploration Jump to: navigation, search GEOTHERMAL...

184

Design on Elevated-Temperature and Methanol-Blocking Proton ...  

Science Conference Proceedings (OSTI)

Presentation Title, Design on Elevated-Temperature and Methanol-Blocking Proton Exchange Membrane for Fuel Cell Application. Author(s), Yan Xiang.

185

Performance profiles style sheet  

Gasoline and Diesel Fuel Update (EIA)

Performance Profiles of Major Energy Producers 2009 Performance Profiles of Major Energy Producers 2009 vii Major Findings This edition of Performance Profiles reviews financial and operating data for the calendar year 2009 and discusses important trends and emerging issues relevant to U.S. energy company operations. Major U.S.-based oil and natural gas producers and petroleum refiners submit the data in this report annually on Form EIA-28, the Financial Reporting System (FRS). FRS companies' net income declined to the lowest level since 2002.  Net income fell 66 percent (in constant 2009 dollars) to $30 billion in 2009 from $88 billion in 2008. Substantial reductions in oil and natural gas prices in 2009 slowed revenue growth. FRS companies cut operating costs but by less than the decline in revenue, resulting in a 69-percent drop in operating income.

186

State Nuclear Profiles 2010  

U.S. Energy Information Administration (EIA) Indexed Site

State Nuclear Profiles 2010 State Nuclear Profiles 2010 April 2012 Independent Statistics & Analysis www.eia.gov U.S. Department of Energy Washington, DC 20585 This report was prepared by the U.S. Energy Information Administration (EIA), the statistical and analytical agency within the U.S. Department of Energy. By law, EIA's data, analyses, and forecasts are independent of approval by any other officer or employee of the United States Government. The views in this report therefore should not be construed as representing those of the Department of Energy or other Federal agencies. U.S. Energy Information Administration | State Nuclear Profiles 2010 i Contacts This report was prepared by the staff of the Renewables and Uranium Statistics Team, Office of Electricity,

187

U-030: Apache Tomcat Lets Untrusted Web Applications Gain Elevated  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

30: Apache Tomcat Lets Untrusted Web Applications Gain Elevated 30: Apache Tomcat Lets Untrusted Web Applications Gain Elevated Privileges U-030: Apache Tomcat Lets Untrusted Web Applications Gain Elevated Privileges November 9, 2011 - 8:30am Addthis PROBLEM: Apache Tomcat Lets Untrusted Web Applications Gain Elevated Privileges. PLATFORM: Apache Tomcat 7.0.0-7.0.21. ABSTRACT: An untrusted web application can access Manager application functions. reference LINKS: Apache Tomcat 7.x vulnerabilities SecurityTracker Alert ID: 1026295 CVE-2011-3376 IMPACT ASSESSMENT: Medium Discussion: A vulnerability was reported in Apache Tomcat. A local user (application) can obtain elevated privileges on the target system. A local web application (that is not trusted) can access Manager application functions without being marked as privileged. This can be exploited to obtain

188

City and County of Denver - Elevations Energy Loans Program (Colorado) |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City and County of Denver - Elevations Energy Loans Program City and County of Denver - Elevations Energy Loans Program (Colorado) City and County of Denver - Elevations Energy Loans Program (Colorado) < Back Eligibility Commercial Residential Savings Category Home Weatherization Commercial Weatherization Heating & Cooling Commercial Heating & Cooling Cooling Appliances & Electronics Sealing Your Home Ventilation Heating Heat Pumps Commercial Lighting Lighting Manufacturing Water Heating Windows, Doors, & Skylights Solar Buying & Making Electricity Program Info State Colorado Program Type Local Loan Program Rebate Amount Residential: $500 - $25,000 Commercial: $1,000 - $150,000 Provider Elevations Credit Union The Elevations Energy Loan can be used to finance a wide variety of efficiency and renewable energy projects in homes and businesses. Homes and

189

A simple Bayesian estimate of direct RNAi gene regulation events from differential gene expression profiles  

E-Print Network (OSTI)

,13]. * Correspondence: paul.a.wilson@gsk.com 1Computational Biology, GlaxoSmithKline Medicine Research Centre, Gunnels Wood Road, Stevenage, SG1 2NY, UK Full list of author information is available at the end of the article Wilson and Plucinski BMC Genomics 2011, 12... differential expression profile. Hierarchical clustering and heat map representations of the most differentially expressed tran- scripts (Additional File 1 Figure S9) suggest that the KSHV-miR-k12-11 transfected dataset is more similar to the control data than...

Wilson, Paul A; Plucinski, Mathew

2011-05-20T23:59:59.000Z

190

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See Block 16C I  

National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

191

File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload

192

MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.

2011-05-01T23:59:59.000Z

193

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Mississippi Nuclear Profile 2010 Mississippi profile Mississippi Nuclear Profile 2010 Mississippi profile Mississippi total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,251 8.0 9,643 17.7 Coal 2,526 16.1 13,629 25.0 Natural Gas 11,640 74.2 29,619 54.4 Other 1 4 * 10 * Other Renewable1 235 1.5 1,504 2.8 Petroleum 35 0.2 18 0.1 Total 15,691 100.0 54,487 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. * = Absolute percentage less than 0.05. Notes: Totals may not equal sum of components due to independent rounding.

194

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Arkansas Nuclear Profile 2010 Arkansas profile Arkansas Nuclear Profile 2010 Arkansas profile Arkansas total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State ttal (percent) Nuclear 1,835 11.5 15,023 24.6 Coal 4,535 28.4 28,152 46.2 Hydro and Pumped Storage 1,369 8.6 3,658 6.0 Natural Gas 7,894 49.4 12,469 20.4 Other 1 - - 28 * Other Renewable1 326 2.0 1,624 2.7 Petroleum 22 0.1 45 0.1 Total 15,981 100.0 61,000 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable * = Absolute percentage less than 0.05.

195

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Kansas Nuclear Profile 2010 Kansas profile Kansas Nuclear Profile 2010 Kansas profile Kansas total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,160 9.2 9,556 19.9 Coal 5,179 41.3 32,505 67.8 Hydro and Pumped Storage 3 * 13 * Natural Gas 4,573 36.5 2,287 4.8 Other Renewable1 1,079 8.6 3,459 7.2 Petroleum 550 4.4 103 0.2 Total 12,543 100.0 47,924 100 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. * = Absolute percentage less than 0.05. Notes: Totals may not equal sum of components due to independent rounding.

196

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Pennsylvania Nuclear Profile 2010 Pennsylvania profile Pennsylvania Nuclear Profile 2010 Pennsylvania profile Pennsylvania total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 9,540 20.9 77,828 33.9 Coal 18,481 40.6 110,369 48.0 Hydro and Pumped Storage 2,268 5.0 1,624 0.7 Natural Gas 9,415 20.7 33,718 14.7 Other 1 100 0.2 1,396 0.6 Other Renewable1 1,237 2.7 4,245 1.8 Petroleum 4,534 9.9 571 0.2 Total 45,575 100.0 229,752 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

197

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Ohio Nuclear Profile 2010 Ohio profile Ohio Nuclear Profile 2010 Ohio profile Ohio total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 2,134 6.5 15,805 11.0 Coal 21,360 64.6 117,828 82.1 Hydro and Pumped Storage 101 0.3 429 0.3 Natural Gas 8,203 24.8 7,128 5.0 Other 1 123 0.4 266 0.2 Other Renewable1 130 0.4 700 0.5 Petroleum 1,019 3.1 1,442 1.0 Total 33,071 100.0 143,598 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. Notes: Totals may not equal sum of components due to independent rounding.

198

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Arizona Nuclear Profile 2010 Arizona profile Arizona Nuclear Profile 2010 Arizona profile Arizona total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,937 14.9 31,200 27.9 Coal 6,233 23.6 43,644 39.1 Hydro and Pumped Storage 2,937 11.1 6,831 6.1 Natural Gas 13,012 49.3 29,676 26.6 Other 1 - - 15 * Other Renewable1 181 0.7 319 0.3 Petroleum 93 0.4 66 0.1 Total 26,392 100.0 111,751 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. * = Absolute percentage less than 0.05.

199

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Kansas Nuclear Profile 2010 Kansas profile Kansas Nuclear Profile 2010 Kansas profile Kansas total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,160 9.2 9,556 19.9 Coal 5,179 41.3 32,505 67.8 Hydro and Pumped Storage 3 * 13 * Natural Gas 4,573 36.5 2,287 4.8 Other Renewable1 1,079 8.6 3,459 7.2 Petroleum 550 4.4 103 0.2 Total 12,543 100.0 47,924 100 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. * = Absolute percentage less than 0.05. Notes: Totals may not equal sum of components due to independent rounding.

200

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Florida Nuclear Profile 2010 Florida profile Florida Nuclear Profile 2010 Florida profile Florida total electric power industry, summer capacity and net generation, by energy source, 2010 Primary Energy Source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 3,924 6.6 23,936 10.4 Coal 9,975 16.9 59,897 26.1 Hydro and Pumped Storage 55 0.1 177 0.1 Natural Gas 31,563 53.4 128,634 56.1 Other1 544 0.9 2,842 1.2 Other Renewable1 1,053 1.8 4,487 2.0 Petroleum 12,033 20.3 9,122 4.0 Total 59,147 100.0 229,096 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

North Carolina Nuclear Profile 2010 North Carolina profile North Carolina Nuclear Profile 2010 North Carolina profile North Carolina total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 4,958 17.9 40,740 31.7 Coal 12,766 46.1 71,951 55.9 Hydro and Pumped Storage 2,042 7.4 4,757 3.7 Natural Gas 6,742 24.4 8,447 6.6 Other 1 50 0.2 407 0.3 Other Renewable1 543 2.0 2,083 1.6 Petroleum 573 2.1 293 0.2 Total 27,674 100.0 128,678 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

202

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

California Nuclear Profile 2010 California profile California Nuclear Profile 2010 California profile California total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 4,390 6.5 32,201 15.8 Coal 374 0.6 2,100 1.0 Hydro and Pumped Storage 13,954 20.7 33,260 16.3 Natural Gas 41,370 61.4 107,522 52.7 Other 1 220 0.3 2,534 1.2 Other Renewable1 6,319 9.4 25,450 12.5 Petroleum 701 1.0 1,059 0.5 Total 63,328 100.0 204,126 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

203

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Georgia Nuclear Profile 2010 Georgia profile Georgia Nuclear Profile 2010 Georgia profile Georgia total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 4,061 11.1 33,512 24.6 Coal 13,230 36.1 73,298 54.0 Hydro and Pumped Storage 3,851 10.5 3,044 2.7 Natural Gas 12,668 34.6 23,884 15.9 Other 1 - - 18 * Other Renewable1 637 1.7 3,181 2.2 Petroleum 2,189 6.0 641 0.5 Total 36,636 100.0 128,698 100 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. * = Absolute percentage less than 0.05.

204

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Mississippi Nuclear Profile 2010 Mississippi profile Mississippi Nuclear Profile 2010 Mississippi profile Mississippi total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,251 8.0 9,643 17.7 Coal 2,526 16.1 13,629 25.0 Natural Gas 11,640 74.2 29,619 54.4 Other 1 4 * 10 * Other Renewable1 235 1.5 1,504 2.8 Petroleum 35 0.2 18 0.1 Total 15,691 100.0 54,487 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. * = Absolute percentage less than 0.05. Notes: Totals may not equal sum of components due to independent rounding.

205

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Connecticut Nuclear Profile 2010 Connecticut profile Connecticut Nuclear Profile 2010 Connecticut profile Connecticut total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 2,103 25.4 16,750 50.2 Coal 564 6.8 2,604 7.8 Hydro and Pumped Storage 151 1.8 400 1.2 Natural Gas 2,292 27.7 11,716 35.1 Other 1 27 0.3 730 2.2 Other Renewable1 159 1.9 740 2.2 Petroleum 2,989 36.1 409 1.2 Total 8,284 100.0 33,350 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

206

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Massachusetts Nuclear Profile 2010 Massachusetts profile Massachusetts Nuclear Profile 2010 Massachusetts profile Massachusetts total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 685 5.0 5,918 13.8 Coal 1,669 12.2 8,306 19.4 Hydro and Pumped Storage 1,942 14.2 659 1.5 Natural Gas 6,063 44.3 25,582 59.8 Other 1 3 * 771 1.8 Other Renewable1 304 2.2 1,274 3.0 Petroleum 3,031 22.1 296 0.7 Total 13,697 100.0 42,805 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

207

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Michigan Nuclear Profile 2010 Michigan profile Michigan Nuclear Profile 2010 Michigan profile Michigan total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 3,947 13.2 29,625 26.6 Coal 11,531 38.7 65,604 58.8 Hydro and Pumped Storage 2,109 7.1 228 0.2 Natural Gas 11,033 37.0 12,249 11.0 Other 1 - - 631 0.6 Other Renewable1 571 1.9 2,832 2.5 Petroleum 640 2.1 382 0.3 Total 29,831 100.0 111,551 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

208

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Florida Nuclear Profile 2010 Florida profile Florida Nuclear Profile 2010 Florida profile Florida total electric power industry, summer capacity and net generation, by energy source, 2010 Primary Energy Source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 3,924 6.6 23,936 10.4 Coal 9,975 16.9 59,897 26.1 Hydro and Pumped Storage 55 0.1 177 0.1 Natural Gas 31,563 53.4 128,634 56.1 Other1 544 0.9 2,842 1.2 Other Renewable1 1,053 1.8 4,487 2.0 Petroleum 12,033 20.3 9,122 4.0 Total 59,147 100.0 229,096 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

209

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Missouri Nuclear Profile 2010 Missouri profile Missouri Nuclear Profile 2010 Missouri profile Missouri total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,190 5.5 8,996 9.7 Coal 12,070 55.5 75,047 81.3 Hydro and Pumped Storage 1,221 5.6 2,427 2.6 Natural Gas 5,579 25.7 4,690 5.1 Other 1 - - 39 * Other Renewable1 466 2.1 988 1.1 Petroleum 1,212 5.6 126 0.1 Total 21,739 100.0 92,313 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. * = Absolute percentage less than 0.05.

210

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Alabama Nuclear Profile 2010 Alabama profile Alabama Nuclear Profile 2010 Alabama profile Alabama total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 5,043 15.6 37,941 24.9 Coal 11,441 35.3 63,050 41.4 Hydro and Pumped Storage 3,272 10.1 8,704 5.7 Natural Gas 11,936 36.8 39,235 25.8 Other1 100 0.3 643 0.4 Other Renewable1 583 1.8 2,377 1.6 Petroleum 43 0.1 200 0.1 Total 32,417 100.0 152,151 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

211

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Arizona Nuclear Profile 2010 Arizona profile Arizona Nuclear Profile 2010 Arizona profile Arizona total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,937 14.9 31,200 27.9 Coal 6,233 23.6 43,644 39.1 Hydro and Pumped Storage 2,937 11.1 6,831 6.1 Natural Gas 13,012 49.3 29,676 26.6 Other 1 - - 15 * Other Renewable1 181 0.7 319 0.3 Petroleum 93 0.4 66 0.1 Total 26,392 100.0 111,751 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. * = Absolute percentage less than 0.05.

212

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Minnesota Nuclear Profile 2010 Minnesota profile Minnesota Nuclear Profile 2010 Minnesota profile Minnesota total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,549 10.8 13,478 25.1 Coal 4,789 32.5 28,083 52.3 Hydro and Pumped Storage 193 1.3 840 1.6 Natural Gas 4,936 33.5 4,341 8.1 Other 1 13 0.1 258 0.5 Other Renewable1 2,395 16.3 6,640 12.4 Petroleum 795 5.4 31 0.1 Total 14,715 100.0 53,670 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

213

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Pennsylvania Nuclear Profile 2010 Pennsylvania profile Pennsylvania Nuclear Profile 2010 Pennsylvania profile Pennsylvania total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 9,540 20.9 77,828 33.9 Coal 18,481 40.6 110,369 48.0 Hydro and Pumped Storage 2,268 5.0 1,624 0.7 Natural Gas 9,415 20.7 33,718 14.7 Other 1 100 0.2 1,396 0.6 Other Renewable1 1,237 2.7 4,245 1.8 Petroleum 4,534 9.9 571 0.2 Total 45,575 100.0 229,752 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

214

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Hampshire Nuclear Profile 2010 New Hampshire profile Hampshire Nuclear Profile 2010 New Hampshire profile New Hampshire total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,247 29.8 10,910 49.2 Coal 546 13.1 3,083 13.9 Hydro and Pumped Storage 489 11.7 1,478 6.7 Natural Gas 1,215 29.1 5,365 24.2 Other 1 - - 57 0.3 Other Renewable1 182 4.4 1,232 5.6 Petroleum 501 12.0 72 0.3 Total 4,180 100.0 22,196 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

215

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

North Carolina Nuclear Profile 2010 North Carolina profile North Carolina Nuclear Profile 2010 North Carolina profile North Carolina total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 4,958 17.9 40,740 31.7 Coal 12,766 46.1 71,951 55.9 Hydro and Pumped Storage 2,042 7.4 4,757 3.7 Natural Gas 6,742 24.4 8,447 6.6 Other 1 50 0.2 407 0.3 Other Renewable1 543 2.0 2,083 1.6 Petroleum 573 2.1 293 0.2 Total 27,674 100.0 128,678 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

216

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Hampshire Nuclear Profile 2010 New Hampshire profile Hampshire Nuclear Profile 2010 New Hampshire profile New Hampshire total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,247 29.8 10,910 49.2 Coal 546 13.1 3,083 13.9 Hydro and Pumped Storage 489 11.7 1,478 6.7 Natural Gas 1,215 29.1 5,365 24.2 Other 1 - - 57 0.3 Other Renewable1 182 4.4 1,232 5.6 Petroleum 501 12.0 72 0.3 Total 4,180 100.0 22,196 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

217

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Georgia Nuclear Profile 2010 Georgia profile Georgia Nuclear Profile 2010 Georgia profile Georgia total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 4,061 11.1 33,512 24.6 Coal 13,230 36.1 73,298 54.0 Hydro and Pumped Storage 3,851 10.5 3,044 2.7 Natural Gas 12,668 34.6 23,884 15.9 Other 1 - - 18 * Other Renewable1 637 1.7 3,181 2.2 Petroleum 2,189 6.0 641 0.5 Total 36,636 100.0 128,698 100 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. * = Absolute percentage less than 0.05.

218

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Michigan Nuclear Profile 2010 Michigan profile Michigan Nuclear Profile 2010 Michigan profile Michigan total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 3,947 13.2 29,625 26.6 Coal 11,531 38.7 65,604 58.8 Hydro and Pumped Storage 2,109 7.1 228 0.2 Natural Gas 11,033 37.0 12,249 11.0 Other 1 - - 631 0.6 Other Renewable1 571 1.9 2,832 2.5 Petroleum 640 2.1 382 0.3 Total 29,831 100.0 111,551 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

219

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Louisiana Nuclear Profile 2010 Louisiana profile Louisiana Nuclear Profile 2010 Louisiana profile Louisiana total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (nw) Share of State total (percent) Net generation (thousand nwh) Share of State total (percent) Nuclear 2,142 8.0 18,639 18.1 Coal 3,417 12.8 23,924 23.3 Hydro and Pumped Storage 192 0.7 1,109 1.1 Natural Gas 19,574 73.2 51,344 49.9 Other 1 213 0.8 2,120 2.1 Other Renewable1 325 1.2 2,468 2.4 Petroleum 881 3.3 3,281 3.2 Total 26,744 100.0 102,885 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

220

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Illinois Nuclear Profile 2010 Illinois profile Illinois Nuclear Profile 2010 Illinois profile Illinois total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 11,441 25.9 96,190 47.8 Coal 15,551 35.2 93,611 46.5 Hydro and Pumped Storage 34 0.1 119 0.1 Natural Gas 13,771 31.2 5,724 2.8 Other 1 145 0.3 461 0.2 Other Renewable1 2,078 4.7 5,138 2.6 Petroleum 1,106 2.5 110 0.1 Total 44,127 100.0 201,352 100 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Jersey Nuclear Profile 2010 New Jersey profile Jersey Nuclear Profile 2010 New Jersey profile New Jersey total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 4,108 22.3 32,771 49.9 Coal 2,036 11.1 6,418 9.8 Hydro and Pumped Storage 404 2.2 -176 -0.3 Natural Gas 10,244 55.6 24,902 37.9 Other 1 56 0.3 682 1.0 Other Renewable1 226 1.2 850 1.3 Petroleum 1,351 7.3 235 0.4 Total 18,424 100.0 65,682 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

222

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Iowa Nuclear Profile 2010 Iowa profile Iowa Nuclear Profile 2010 Iowa profile Iowa total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 601 4.1 4,451 7.7 Coal 6,956 47.7 41,283 71.8 Hydro and Pumped Storage 144 1.0 948 1.6 Natural Gas 2,299 15.8 1,312 2.3 Other Renewable1 3,584 24.6 9,360 16.3 Petroleum 1,007 6.9 154 .0.3 Total 14,592 100.0 57,509 100 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. Notes: Totals may not equal sum of components due to independent rounding.

223

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Minnesota Nuclear Profile 2010 Minnesota profile Minnesota Nuclear Profile 2010 Minnesota profile Minnesota total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,549 10.8 13,478 25.1 Coal 4,789 32.5 28,083 52.3 Hydro and Pumped Storage 193 1.3 840 1.6 Natural Gas 4,936 33.5 4,341 8.1 Other 1 13 0.1 258 0.5 Other Renewable1 2,395 16.3 6,640 12.4 Petroleum 795 5.4 31 0.1 Total 14,715 100.0 53,670 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

224

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Arkansas Nuclear Profile 2010 Arkansas profile Arkansas Nuclear Profile 2010 Arkansas profile Arkansas total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State ttal (percent) Nuclear 1,835 11.5 15,023 24.6 Coal 4,535 28.4 28,152 46.2 Hydro and Pumped Storage 1,369 8.6 3,658 6.0 Natural Gas 7,894 49.4 12,469 20.4 Other 1 - - 28 * Other Renewable1 326 2.0 1,624 2.7 Petroleum 22 0.1 45 0.1 Total 15,981 100.0 61,000 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable * = Absolute percentage less than 0.05.

225

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Nebraska Nuclear Profile 2010 Nebraska profile Nebraska Nuclear Profile 2010 Nebraska profile Nebraska total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,245 15.8 11,054 30.2 Coal 3,932 50.0 23,368 63.8 Hydro and Pumped Storage 278 3.5 1,314 3.6 Natural Gas 1,864 23.5 375 1.0 Other Renewable1 165 2.1 493 1.3 Petroleum 387 4.9 31 0.1 Total 7,857 100.0 36,630 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. Notes: Totals may not equal sum of components due to independent rounding.

226

Towards user psychological profile  

Science Conference Proceedings (OSTI)

Recents studies have demonstrated how useful and fundamental psychological aspects such as people Personality Traits and Emotions are during human decision-making process. Some research towards the identification and model of user's Emotions have been ... Keywords: personality traits, recommendation, reputation, user psychological profile

Maria Augusta S. N. Nunes; Stefano A. Cerri; Nathalie Blanc

2008-10-01T23:59:59.000Z

227

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Jersey Nuclear Profile 2010 New Jersey profile Jersey Nuclear Profile 2010 New Jersey profile New Jersey total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 4,108 22.3 32,771 49.9 Coal 2,036 11.1 6,418 9.8 Hydro and Pumped Storage 404 2.2 -176 -0.3 Natural Gas 10,244 55.6 24,902 37.9 Other 1 56 0.3 682 1.0 Other Renewable1 226 1.2 850 1.3 Petroleum 1,351 7.3 235 0.4 Total 18,424 100.0 65,682 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

228

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Maryland Nuclear Profile 2010 Maryland profile Maryland Nuclear Profile 2010 Maryland profile Maryland total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (Percent) Nuclear 1,705 13.6 13,994 32.1 Coal 4,886 39.0 23,668 54.3 Hydro and Pumped Storage 590 4.7 1,667 3.8 Natural Gas 2,041 16.3 2,897 6.6 Other 1 152 1.2 485 1.1 Other Renewable1 209 1.7 574 1.3 Petroleum 2,933 23.4 322 0.7 Total 12,516 100.0 43,607 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

229

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Alabama Nuclear Profile 2010 Alabama profile Alabama Nuclear Profile 2010 Alabama profile Alabama total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 5,043 15.6 37,941 24.9 Coal 11,441 35.3 63,050 41.4 Hydro and Pumped Storage 3,272 10.1 8,704 5.7 Natural Gas 11,936 36.8 39,235 25.8 Other1 100 0.3 643 0.4 Other Renewable1 583 1.8 2,377 1.6 Petroleum 43 0.1 200 0.1 Total 32,417 100.0 152,151 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

230

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Missouri Nuclear Profile 2010 Missouri profile Missouri Nuclear Profile 2010 Missouri profile Missouri total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,190 5.5 8,996 9.7 Coal 12,070 55.5 75,047 81.3 Hydro and Pumped Storage 1,221 5.6 2,427 2.6 Natural Gas 5,579 25.7 4,690 5.1 Other 1 - - 39 * Other Renewable1 466 2.1 988 1.1 Petroleum 1,212 5.6 126 0.1 Total 21,739 100.0 92,313 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. * = Absolute percentage less than 0.05.

231

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

California Nuclear Profile 2010 California profile California Nuclear Profile 2010 California profile California total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 4,390 6.5 32,201 15.8 Coal 374 0.6 2,100 1.0 Hydro and Pumped Storage 13,954 20.7 33,260 16.3 Natural Gas 41,370 61.4 107,522 52.7 Other 1 220 0.3 2,534 1.2 Other Renewable1 6,319 9.4 25,450 12.5 Petroleum 701 1.0 1,059 0.5 Total 63,328 100.0 204,126 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

232

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Maryland Nuclear Profile 2010 Maryland profile Maryland Nuclear Profile 2010 Maryland profile Maryland total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (Percent) Nuclear 1,705 13.6 13,994 32.1 Coal 4,886 39.0 23,668 54.3 Hydro and Pumped Storage 590 4.7 1,667 3.8 Natural Gas 2,041 16.3 2,897 6.6 Other 1 152 1.2 485 1.1 Other Renewable1 209 1.7 574 1.3 Petroleum 2,933 23.4 322 0.7 Total 12,516 100.0 43,607 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

233

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Connecticut Nuclear Profile 2010 Connecticut profile Connecticut Nuclear Profile 2010 Connecticut profile Connecticut total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 2,103 25.4 16,750 50.2 Coal 564 6.8 2,604 7.8 Hydro and Pumped Storage 151 1.8 400 1.2 Natural Gas 2,292 27.7 11,716 35.1 Other 1 27 0.3 730 2.2 Other Renewable1 159 1.9 740 2.2 Petroleum 2,989 36.1 409 1.2 Total 8,284 100.0 33,350 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

234

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

York Nuclear Profile 2010 New York profile York Nuclear Profile 2010 New York profile New York total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 5,271 13.4 41,870 30.6 Coal 2,781 7.1 13,583 9.9 Hydro and Pumped Storage 5,714 14.5 24,942 18.2 Natural Gas 17,407 44.2 48,916 35.7 Other 1 45 0.1 832 0.6 Other Renewable1 1,719 4.4 4,815 3.5 Petroleum 6,421 16.3 2,005 1.5 Total 39,357 100.0 136,962 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable.

235

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Nebraska Nuclear Profile 2010 Nebraska profile Nebraska Nuclear Profile 2010 Nebraska profile Nebraska total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,245 15.8 11,054 30.2 Coal 3,932 50.0 23,368 63.8 Hydro and Pumped Storage 278 3.5 1,314 3.6 Natural Gas 1,864 23.5 375 1.0 Other Renewable1 165 2.1 493 1.3 Petroleum 387 4.9 31 0.1 Total 7,857 100.0 36,630 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. Notes: Totals may not equal sum of components due to independent rounding.

236

Simple beam profile monitor  

Science Conference Proceedings (OSTI)

An inexpensive beam profile monitor is based on the well proven rotating wire method. The monitor can display beam position and shape in real time for particle beams of most energies and beam currents up to 200{mu}A. Beam shape, position cross-section and other parameters are displayed on a computer screen.

Gelbart, W.; Johnson, R. R.; Abeysekera, B. [ASD Inc. Garden Bay, BC (Canada); Best Theratronics Ltd Ottawa Ontario (Canada); PharmaSpect Ltd., Burnaby BC (Canada)

2012-12-19T23:59:59.000Z

237

Baldrige Award Recipients' Contacts and Profiles  

Science Conference Proceedings (OSTI)

... Small Business. Granite Rock Company contacts, profile. 1991. Small Business. Manufacturing. Marlow Industries, Inc. contacts, profile. ...

2013-05-06T23:59:59.000Z

238

Baldrige Award Recipients' Contacts and Profiles  

Science Conference Proceedings (OSTI)

... Pewaukee School District contacts, profile, award application summary ... application summary, Montgomery County Public Schools contacts, profile ...

2013-11-13T23:59:59.000Z

239

Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab

2007-03-01T23:59:59.000Z

240

Effects of elevated atmospheric CO[sub 2] on soybean and sorghum root growth  

Science Conference Proceedings (OSTI)

Aboveground plant responses to elevated CO[sub 2] concentration are well documented. However, very little is known about crop root responses to CO[sub 2] enrichment, especially under field environments. This study evaluates the effects of increased serial CO[sub 2] concentration on root systems of a C[sub 3] [soybean (Glycine max (L>) Merr.)] and C[sub 4] [sorghum (Sorghum bicolor (L.) Moench.)] crop. Plants were grown in open top field chambers under two levels of CO[sub 2]. Root systems were sampled at physiological maturity by uprooting the plant from the soil while concurrently measuring vertical pull resistance. Root variables (length, dry weight, and tissue density), except for number of roots, were significantly increased under elevated CO[sub 2]. The positive effects of extra CO[sub 2] on soybean roots partitioned into taproot and lateral roots were similar to patterns previously described. The number of soybean nodules increased under CO[sub 2]-enriched conditions, but no effect on nodule dry weight was seen. Elevated CO[sub 2] increased root dry weight more so than root length. The larger root systems observed under CO[sub 2] enrichment was reflected in an overall increase in vertical pull resistance. Several root variables exhibited significant CO[sub 2] X species interactions (except root number) with differences between CO[sub 2] levels seen with sorghum. Fine root data obtained from soil cores (30 cm) also showed that extra CO[sub 2] influenced root dry weight density more so than root length density. Under elevated CO[sub 2] conditions, root dry weight density more so than root tissue density values tended to be greater in the top 15 cm of the soil profile, but not lower in the profile (i.e., 15-30 cm). The fine root data exhibited few CO[sub 2] X species interactions. Results from this study indicate that additional atmospheric C[sub 2] will affect crop root systems.

Rogers, H.H.; Prior, S.A.; Runion, G.B. (National Dynamics Lab., Auburn, AL (United States))

1993-05-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

EIA - State Electricity Profiles  

Gasoline and Diesel Fuel Update (EIA)

Tennessee Electricity Profile 2010 Tennessee full report Tennessee Electricity Profile 2010 Tennessee full report Table 1. 2010 Summary Statistics (Tennessee) Item Value U.S. Rank NERC Region(s) RFC/SERC Primary Energy Source Coal Net Summer Capacity (megawatts) 21,417 19 Electric Utilities 20,968 11 Independent Power Producers & Combined Heat and Power 450 49 Net Generation (megawatthours) 82,348,625 19 Electric Utilities 79,816,049 15 Independent Power Producers & Combined Heat and Power 2,532,576 45 Emissions (thousand metric tons) Sulfur Dioxide 138 13 Nitrogen Oxide 33 31 Carbon Dioxide 48,196 18 Sulfur Dioxide (lbs/MWh) 3.7 14 Nitrogen Oxide (lbs/MWh) 0.9 40 Carbon Dioxide (lbs/MWh) 1,290 26 Total Retail Sales (megawatthours) 103,521,537 13 Full Service Provider Sales (megawatthours) 103,521,537 10

242

Chemical profiles of switchgrass  

NLE Websites -- All DOE Office Websites (Extended Search)

profiles profiles of switchgrass Zhoujian Hu a,b , Robert Sykes a,c , Mark F. Davis a,c , E. Charles Brummer a,d , Arthur J. Ragauskas a,b,e, * a BioEnergy Science Center, USA b School of Chemistry and Biochemistry, Institute of Paper Science and Technology, Georgia Institute of Technology, Atlanta, GA 30332, USA c National Renewable Energy Laboratory, 1617 Cole Blvd., Golden, CO 80401, USA d Institute for Plant Breeding, Genetics, and Genomics, Department of Crop and Soil Sciences, University of Georgia, Athens, GA 30602, USA e Forest Products and Chemical Engineering Department, Chemical and Biological Engineering, Chalmers University of Technology, SE-412 96 Göteborg, Sweden a r t i c l e i n f o Article history: Received 15 April 2009 Received in revised form 10 December 2009 Accepted 10 December 2009 Available online 13 January 2010 Keywords: Switchgrass Morphological components Chemical

243

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Tennessee Electricity Profile 2010 Tennessee full report Tennessee Electricity Profile 2010 Tennessee full report Table 1. 2010 Summary Statistics (Tennessee) Item Value U.S. Rank NERC Region(s) RFC/SERC Primary Energy Source Coal Net Summer Capacity (megawatts) 21,417 19 Electric Utilities 20,968 11 Independent Power Producers & Combined Heat and Power 450 49 Net Generation (megawatthours) 82,348,625 19 Electric Utilities 79,816,049 15 Independent Power Producers & Combined Heat and Power 2,532,576 45 Emissions (thousand metric tons) Sulfur Dioxide 138 13 Nitrogen Oxide 33 31 Carbon Dioxide 48,196 18 Sulfur Dioxide (lbs/MWh) 3.7 14 Nitrogen Oxide (lbs/MWh) 0.9 40 Carbon Dioxide (lbs/MWh) 1,290 26 Total Retail Sales (megawatthours) 103,521,537 13 Full Service Provider Sales (megawatthours) 103,521,537 10

244

Performance profiles style sheet  

Gasoline and Diesel Fuel Update (EIA)

06) 06) Distribution Category UC-950 Performance Profiles of Major Energy Producers 2006 December 2007 Energy Information Administration Office of Energy Markets and End Use U.S. Department of Energy Washington, DC 20585 This report was prepared by the Energy Information Administration, the independent statistical and analytical agency within the U.S. Department of Energy. The information contained herein should be attributed to the Energy Information Administration and should not be construed as advocating or reflecting any policy position of the Department of Energy or any other organization. Contacts Performance Profiles of Major Energy Producers 2006 is prepared by the Energy Information Administration, Office of Energy Markets and End Use, Energy Markets and Contingency Information Division, Financial

245

Profile-Based Adaption . . .  

E-Print Network (OSTI)

Cache decay is a set of leakage-reduction mechanisms that put cache lines that have not been accessed for a specific duration into a low-leakage standby mode. This duration is called the decay interval, and its optimal value varies across applications. This paper provides an extended discussion of the results previously presented in our journal paper [13]. It describes an adaptation technique that analytically finds the optimal decay interval through profiling, and shows that the most important variables required for finding the optimal decay interval can be estimated with a reasonable degree of accuracy using profiling. This work explicitly trades off the leakage power saved in putting both the live and dead lines into standby mode, against its performance and energy costs. It achieves energy savings close to what can be obtained with an omniscient choice of per-benchmark optimal decay interval.

Karthik Sankaranarayanan; Kevin Skadron

2004-01-01T23:59:59.000Z

246

Surface profiling interferometer  

DOE Patents (OSTI)

The design of a long-trace surface profiler for the non-contact measurement of surface profile, slope error and curvature on cylindrical synchrotron radiation (SR) mirrors. The optical system is based upon the concept of a pencil-beam interferometer with an inherent large depth-of-field. The key feature of the optical system is the zero-path-difference beam splitter, which separates the laser beam into two colinear, variable-separation probe beams. A linear array detector is used to record the interference fringe in the image, and analysis of the fringe location as a function of scan position allows one to reconstruct the surface profile. The optical head is mounted on an air bearing slide with the capability to measure long aspheric optics, typical of those encountered in SR applications. A novel feature of the optical system is the use of a transverse "outrigger" beam which provides information on the relative alignment of the scan axis to the cylinder optic symmetry axis.

Takacs, Peter Z. (P.O. Box 385, Upton, NY 11973); Qian, Shi-Nan (Hefei Synchrotron Radiation Laboratory, University of Science and, Hefei, Anhui, CN)

1989-01-01T23:59:59.000Z

247

Net mineralization of N at deeper soil depths as a potential mechanism for sustained forest production under elevated [CO2  

SciTech Connect

Elevated atmospheric [CO2] is projected to increase forest production, which could increase ecosystem carbon (C) storage. However, sustained forest production will depend on the nutrient balance of the forested ecosystem. Our aim was to examine the causes and consequences of increased fine-root production and mortality throughout the soil profile under elevated CO2 with respect to potential gross nitrogen (N) cycling rates. Our study was conducted in a CO2-enriched sweetgum (Liquidambar styraciflua L.) plantation in Oak Ridge, TN, USA. We used isotope pool dilution methodology to measure potential gross N cycling rates in laboratory incubations of soil from four depth increments to 60 cm. Our objectives were two-fold: (1) determine whether N is available for root acquisition in deeper soil, and (2) determine whether increased inputs of labile C from greater fine-root mortality at depth under elevated [CO2] had altered N cycling rates. While gross N fluxes declined with soil depth, we found that N is potentially available for roots to access, especially below 15 cm depth where microbial consumption of mineral N was reduced. Overall, up to 60% of potential gross N mineralization, and 100% of potential net N mineralization, occurred below 15-cm depth at this site. This finding was supported by in situ measurements from ion-exchange resins, where total inorganic N availability at 55 cm depth was equal to or greater than N availability at 15 cm depth. While it is likely that trees grown under elevated [CO2] are accessing a larger pool of inorganic N by mining deeper soil, we found no effect of elevated [CO2] on potential gross or net N cycling rates. Thus, increased root exploration of the soil volume under elevated [CO2] may be more important than changes in potential gross N cycling rates in sustaining forest responses to rising atmospheric CO2.

Iversen, Colleen M [ORNL; Hooker, Toby [Utah State University (USU); Classen, Aimee T [University of Tennessee, Knoxville (UTK); Norby, Richard J [ORNL

2011-01-01T23:59:59.000Z

248

Lidar Observation of Elevated Pollution Layers over Los Angeles  

Science Conference Proceedings (OSTI)

Elevated pollution layers are observed over Los Angeles with an aircraft equipped with a downward-looking lidar. For the first time, detailed ancillary upper-air kinematic and thermodynamic data were collected simultaneously to aid in the ...

Roger M. Wakimoto; James L. McElroy

1986-11-01T23:59:59.000Z

249

Property:Building/SPElectrtyUsePercElevators | Open Energy Information  

Open Energy Info (EERE)

SPElectrtyUsePercElevators SPElectrtyUsePercElevators Jump to: navigation, search This is a property of type String. Elevators Pages using the property "Building/SPElectrtyUsePercElevators" Showing 25 pages using this property. (previous 25) (next 25) S Sweden Building 05K0001 + 0.0 + Sweden Building 05K0002 + 0.125907012528 + Sweden Building 05K0003 + 7.93251470469 + Sweden Building 05K0004 + 0.0177143892458 + Sweden Building 05K0005 + 0.0 + Sweden Building 05K0006 + 0.0 + Sweden Building 05K0007 + 1.06750770532 + Sweden Building 05K0008 + 0.461813811056 + Sweden Building 05K0009 + 0.11704275811 + Sweden Building 05K0010 + 0.0 + Sweden Building 05K0011 + 0.0 + Sweden Building 05K0012 + 0.0 + Sweden Building 05K0013 + 0.237557009519 + Sweden Building 05K0014 + 1.64859225677 +

250

On Computing the Surface Horizontal Pressure Gradient over Elevated Terrain  

Science Conference Proceedings (OSTI)

Methods are proposed for calculating the surface horizontal pressure gradient or geostrophic wind in a local area over elevated terrain from randomly spaced surface observations. These procedures avoid many of the problems associated with sea-...

Maurice Danard

1989-06-01T23:59:59.000Z

251

Determination of Radiosonde Station Elevation from Observational Data  

Science Conference Proceedings (OSTI)

Correct radiosonde station elevation (balloon release height) is important in quality control of radiosonde soundings. Incorrect heights introduce errors in calculated temperature trends and numerical forecasts. Radiosonde metadata frequently ...

Oleg A. Alduchov; Robert E. Eskridge

2002-04-01T23:59:59.000Z

252

A Surface-Corrected Gaussian Model for Elevated Sources  

Science Conference Proceedings (OSTI)

A Gaussian model for continuous elevated sources is developed which uses a continuous distribution of ground-level sources to replace the use of the image source. For the case of Fickian diffusion with uniform wind, this model is mathematically ...

Thomas J. Overcamp

1983-06-01T23:59:59.000Z

253

PWR Field Experience with Elevated, Constant pH  

Science Conference Proceedings (OSTI)

This report analyzes chemistry data from several pressurized water reactors (PWRs) operating reactor coolant with elevated, constant pH to determine its effectiveness for managing core performance and dose rate problems stemming from corrosion product and activity transport. The operating data are supplemented with relevant shutdown and startup experience to identify the overall impact of elevated, constant pH on primary system operation.

2001-12-06T23:59:59.000Z

254

Load Scheduling with Profile Information  

E-Print Network (OSTI)

Within the past five years, many manufactures have added hardware performance counters to their microprocessors to generate profile data cheaply.

Gotz Lindenmaier Kathryn; Kathryn S. M C Kinley; Olivier Temam

2000-01-01T23:59:59.000Z

255

Optimally profiling and tracing programs  

Science Conference Proceedings (OSTI)

This paper describes algorithms for inserting monitoring code to profile and trace programs. These algorithms greatly reduce the cost of measuring programs with respect to the commonly used technique of placing code in each basic block. Program profiling ... Keywords: control-flow graph, instruction tracing, instrumentation, profiling

Thomas Ball; James R. Larus

1994-07-01T23:59:59.000Z

256

Alternate Material for Elevated Temperature Turbine Cooling Plate ...  

Science Conference Proceedings (OSTI)

maximum load, simulated mission fatigue cycling, and tensile test of specimens after stressed .... Fatigue cycle profiles performed for A) Sustained- peak LCF, B) ...

257

Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A

2008-01-01T23:59:59.000Z

258

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Vermont profile Vermont profile Vermont total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 620 55.0 4,782 72.2 Hydro and Pumped Storage 324 28.7 1,347 20.3 Natural Gas - - 4 0.1 Other Renewable1 84 7.5 482 7.3 Petroleum 100 8.9 5 0.1 Total 1,128 100.0 6,620 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. - = No data reported. Notes: Totals may not equal sum of components due to independent rounding. Other Renewable: Wood, black liquor, other wood waste, biogenic municipal solid waste, landfill gas, sludge waste, agriculture byproducts, other biomass, geothermal, solar thermal, photovoltaic energy, and wind.

259

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Tennessee profile Tennessee profile Tennessee total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 3,401 15.9 27,739 33.7 Coal 8,805 41.1 43,670 53.0 Hydro and Pumped Storage 4,277 20.0 7,416 9.0 Natural Gas 4,655 21.7 2,302 2.8 Other 1 - - 16 * Other Renewable1 222 1.0 988 1.2 Petroleum 58 0.3 217 0.3 Total 21,417 100.0 82,349 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. * = Absolute percentage less than 0.05.

260

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Virginia profile Virginia profile Virginia total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 3,501 14.5 26,572 36.4 Coal 5,868 24.3 25,459 34.9 Hydro and Pumped Storage 4,107 17.0 10 * Natural Gas 7,581 31.4 16,999 23.3 Other 1 - - 414 0.6 Other Renewable1 621 2.6 2,220 3.0 Petroleum 2,432 10.1 1,293 1.8 Total 24,109 100.0 72,966 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. * = Absolute percentage less than 0.05.

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

South Carolina profile South Carolina profile South Carolina total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 6,486 27.0 51,988 49.9 Coal 7,230 30.1 37,671 36.2 Hydro and Pumped Storage 4,006 16.7 1,442 1.4 Natural Gas 5,308 22.1 10,927 10.5 Other 1 - - 61 0.1 Other Renewable1 284 1.2 1,873 1.8 Petroleum 670 2.8 191 0.2 Total 23,982 100.0 104,153 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. - = No data reported.

262

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Virginia profile Virginia profile Virginia total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 3,501 14.5 26,572 36.4 Coal 5,868 24.3 25,459 34.9 Hydro and Pumped Storage 4,107 17.0 10 * Natural Gas 7,581 31.4 16,999 23.3 Other 1 - - 414 0.6 Other Renewable1 621 2.6 2,220 3.0 Petroleum 2,432 10.1 1,293 1.8 Total 24,109 100.0 72,966 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. * = Absolute percentage less than 0.05.

263

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Wisconsin profile Wisconsin profile Wisconsin total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,584 8.9 13,281 20.7 Coal 8,063 45.2 40,169 62.5 Hydro and Pumped Storage 492 2.8 2,112 3.3 Natural Gas 6,110 34.3 5,497 8.5 Other 1 21 0.1 63 0.1 Other Renewable1 775 4.3 2,474 3.8 Petroleum 790 4.4 718 1.1 Total 17,836 100.0 64,314 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. Notes: Totals may not equal sum of components due to independent rounding.

264

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Texas profile Texas profile Texas total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 4,966 4.6 41,335 10.0 Coal 22,335 20.6 150,173 36.5 Hydro and Pumped Storage 689 0.6 1,262 0.3 Natural Gas 69,291 64.0 186,882 45.4 Other 1 477 0.4 3,630 0.9 Other Renewable1 10,295 9.5 27,705 6.7 Petroleum 204 0.2 708 0.2 Total 108,258 100.0 411,695 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. Notes: Totals may not equal sum of components due to independent rounding.

265

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Vermont profile Vermont profile Vermont total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 620 55.0 4,782 72.2 Hydro and Pumped Storage 324 28.7 1,347 20.3 Natural Gas - - 4 0.1 Other Renewable1 84 7.5 482 7.3 Petroleum 100 8.9 5 0.1 Total 1,128 100.0 6,620 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. - = No data reported. Notes: Totals may not equal sum of components due to independent rounding. Other Renewable: Wood, black liquor, other wood waste, biogenic municipal solid waste, landfill gas, sludge waste, agriculture byproducts, other biomass, geothermal, solar thermal, photovoltaic energy, and wind.

266

Deflagration Wave Profiles  

SciTech Connect

Shock initiation in a plastic-bonded explosives (PBX) is due to hot spots. Current reactive burn models are based, at least heuristically, on the ignition and growth concept. The ignition phase occurs when a small localized region of high temperature (or hot spot) burns on a fast time scale. This is followed by a growth phase in which a reactive front spreads out from the hot spot. Propagating reactive fronts are deflagration waves. A key question is the deflagration speed in a PBX compressed and heated by a shock wave that generated the hot spot. Here, the ODEs for a steady deflagration wave profile in a compressible fluid are derived, along with the needed thermodynamic quantities of realistic equations of state corresponding to the reactants and products of a PBX. The properties of the wave profile equations are analyzed and an algorithm is derived for computing the deflagration speed. As an illustrative example, the algorithm is applied to compute the deflagration speed in shock compressed PBX 9501 as a function of shock pressure. The calculated deflagration speed, even at the CJ pressure, is low compared to the detonation speed. The implication of this are briefly discussed.

Menikoff, Ralph [Los Alamos National Laboratory

2012-04-03T23:59:59.000Z

267

EIA - State Nuclear Profiles  

Gasoline and Diesel Fuel Update (EIA)

Washington profile Washington profile Washington total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,097 3.6 9,241 8.9 Coal 1,340 4.4 8,527 8.2 Hydro and Pumped Storage 21,495 70.5 68,342 66.0 Natural Gas 3,828 12.6 10,359 10.0 Other 1 - - 354 0.3 Other Renewable1 2,703 8.9 6,617 6.4 Petroleum 15 * 32 * Total 30,478 100.0 103,473 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. * = Absolute percentage less than 0.05.

268

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Washington profile Washington profile Washington total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,097 3.6 9,241 8.9 Coal 1,340 4.4 8,527 8.2 Hydro and Pumped Storage 21,495 70.5 68,342 66.0 Natural Gas 3,828 12.6 10,359 10.0 Other 1 - - 354 0.3 Other Renewable1 2,703 8.9 6,617 6.4 Petroleum 15 * 32 * Total 30,478 100.0 103,473 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. * = Absolute percentage less than 0.05.

269

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

South Carolina profile South Carolina profile South Carolina total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 6,486 27.0 51,988 49.9 Coal 7,230 30.1 37,671 36.2 Hydro and Pumped Storage 4,006 16.7 1,442 1.4 Natural Gas 5,308 22.1 10,927 10.5 Other 1 - - 61 0.1 Other Renewable1 284 1.2 1,873 1.8 Petroleum 670 2.8 191 0.2 Total 23,982 100.0 104,153 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. - = No data reported.

270

EIA - State Nuclear Profiles  

U.S. Energy Information Administration (EIA) Indexed Site

Wisconsin profile Wisconsin profile Wisconsin total electric power industry, summer capacity and net generation, by energy source, 2010 Primary energy source Summer capacity (mw) Share of State total (percent) Net generation (thousand mwh) Share of State total (percent) Nuclear 1,584 8.9 13,281 20.7 Coal 8,063 45.2 40,169 62.5 Hydro and Pumped Storage 492 2.8 2,112 3.3 Natural Gas 6,110 34.3 5,497 8.5 Other 1 21 0.1 63 0.1 Other Renewable1 775 4.3 2,474 3.8 Petroleum 790 4.4 718 1.1 Total 17,836 100.0 64,314 100.0 1Municipal Solid Waste net generation is allocated according to the biogenic and non-biogenic components of the fuel; however, all Municipal Solid Waste summer capacity is classified as Renewable. Notes: Totals may not equal sum of components due to independent rounding.

271

Florida Billboards Elevate Renewable Energy Education | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Florida Billboards Elevate Renewable Energy Education Florida Billboards Elevate Renewable Energy Education Florida Billboards Elevate Renewable Energy Education July 9, 2010 - 10:26am Addthis A wind turbine tops a Lamar Advertising billboard in Pensacola, Florida | Photo courtesy of Karena Cawthon A wind turbine tops a Lamar Advertising billboard in Pensacola, Florida | Photo courtesy of Karena Cawthon Maya Payne Smart Former Writer for Energy Empowers, EERE Drivers along the Florida stretches of I-10, I-110, I-75 and other highways will soon see more than advertising messages on roadside signs. Lamar Advertising is converting almost 1500 of its Florida billboards to renewable energy devices. Solar panels and wind turbines will top the displays. The company hopes to communicate the value of renewable energy to millions

272

PowerShape Market Profiles  

Science Conference Proceedings (OSTI)

This guidebook contains a series of market profiles for customer segments within the commercial and residential sectors. Each profile is a stand-alone document that provides information about a sector, segment region, or technology. PowerShape Market Profiles provide key insights into the market, demographic, business, and energy characteristics of segments within the commercial and residential sectors. It provides vital information for contacting customers equipped with an understanding of their busines...

1999-02-02T23:59:59.000Z

273

DRAFT Microwave Radiometer Profiler Handbook  

NLE Websites -- All DOE Office Websites (Extended Search)

Microwave Radiometer Profiler Handbook Evaluation of a New Multi-Frequency Microwave Radiometer for Measuring the Vertical Distribution of Temperature, Water Vapor, and Cloud...

274

State Renewable Electricity Profiles 2010  

U.S. Energy Information Administration (EIA)

State Renewable Electricity Profiles 2010. March 2012 Independent Statistics & Analysis . www.eia.gov . U.S. Department of Energy . Washington, DC 20585

275

Evidence for Stratospheric Downwelling Associated with High-Elevation Topography  

SciTech Connect

The continued presence of elevated chlorine-36 in Sierra Nevada streams is commonly interpreted as residual nuclear fallout, but this prolonged storage contradicts accepted hydrologic models, which indicate much less short-term groundwater storage. Our hypothesis is that the chlorine-36 source is stratospheric downwelling during high-intensity storms by measuring beryllium-7 and -10, sodium-22, and chlorium-36 in precipitation, lake, and soil samples. These nuclides are produced in abundance in the stratosphere and, except for chlorine-36, did not occur as nuclear fallout. This project will either substantially change hydrologic models or reveal an unrecognized pathway for stratosphere-troposphere exchange. Either result will have substantial scientific impact. The test of the hypothesis is straightforward. If stratospheric downwelling occurs to the extent indicated by observed Sierran chlorine-36 levels, it should be detectable by elevated levels of beryllium-7 and -10, sodium-22, and chlorine-36 in storm precipitation. Samples will be collected from an established array of sampling locations. If elevated levels of these nuclides are not found, it would cast severe doubt on the hypothesis. In this case, Sierran hydrologic models will have to take into account high levels of long-term groundwater storage. If elevated levels of these nuclides are found in Sierran precipitation, it could only be from stratospheric input, both because nuclear fallout is no longer occurring and because beryllium-7 and -10 and sodium-22 are not produced by atmospheric nuclear tests.

Finkel, R

2009-01-28T23:59:59.000Z

276

A New Model to Construct Ice Stream Surface Elevation Profiles and Calculate Contributions to Sea-Level Rise  

E-Print Network (OSTI)

the injection of carbon dioxide and other greenhouse gasesdirect measurements of carbon dioxide atop Mauna Loa on theof fossil fuel-derived carbon dioxide in the atmosphere from

Adachi, Yosuke

2012-01-01T23:59:59.000Z

277

Field Verification of ADCP Surface Gravity Wave Elevation Spectra  

Science Conference Proceedings (OSTI)

Acoustic Doppler current profilers (ADCPs) can measure orbital velocities induced by surface gravity waves, yet the ADCP estimates of these velocities are subject to a relatively high noise level. The present paper introduces a linear filtration ...

A. J. F. Hoitink; H. C. Peters; M. Schroevers

2007-05-01T23:59:59.000Z

278

A particle swarm optimization algorithm for optimal car-call allocation in elevator group control systems  

Science Conference Proceedings (OSTI)

High-rise buildings require the installation of complex elevator group control systems (EGCSs). In vertical transportation, when a passenger makes a hall call by pressing a landing call button installed at the floor and located near the cars of the elevator ... Keywords: Elevator, Elevator group control system, Lift, Particle swarm optimization, Vertical transportation

Berna Bolat; O?Uz Altun; Pablo CortS

2013-05-01T23:59:59.000Z

279

Reflection seismic profiling in Wabash Valley fault system in southwestern Indiana  

SciTech Connect

During the summer of 1988 common-depth-point (CDP) reflection seismic profiling was initiated by ARPEX in southwestern Indiana in the Wabash Valley fault system. A 2.2-im (1.4-mi) east-west profile was shot across the Mt. Vernon graben in Posey County. Minihole shooting in 21-m (68.9-ft) patterns using 3.4 kg (7.5 lb) of seismic explosives distributed in five 3-m (10-ft) holes provided the energy source. Most shotholes were made with a reversible air-driven penetrating tool that was effective in dense clays. The 12-geophone array length was 43 m (141 ft), and the nominal far-trace offset was 2.1 km (7,000 ft). A 48-channel recording yielded 24-CDP coverage at 11-m (36-ft) intervals. Data were enhanced by gapped deconvolution, bandpass filtering, and CDP stack. The strongest and most continuous reflections at 0.75 and 1.6 sec are associated with the New Albany Shale (Devonian-Mississippian) and Eau Claire Formation (Cambrian), respectively. Within the Mt. Vernon graben and east of the Spenser Consolidated oil field, the depth to Eau Claire Formation apparently increases by approximately 60 m (197 ft) over a horizontal distance of 1.4 km (0.9 mi). Minor faulting east of the Spencer Consolidated field appears to be synthetic to the Hovey lake fault, which bounds the eastern side of the Mt. Vernon graben. Tentative interpretations of faulting and weak reflections from depths greater than 4.5 km (15,000 ft) may be clarified by additional data processing and by additional seismic profiling planned by ARPEX.

Rene, R.M.; Hester, N.C.; Stanonis, F.L. (Indiana Univ., Bloomington (USA))

1989-08-01T23:59:59.000Z

280

Downstream Heat Flux Profile vs. Midplane T Profile in Tokamaks  

SciTech Connect

The relationship between the midplane scrape-off-layer electron temperature profile and the parallel heat flux profile at the divertor in tokamaks is investigated. A model is applied which takes into account anisotropic thermal diffusion, in a rectilinear geometry with constant density. Eigenmode analysis is applied to the simplified problem with constant thermal diffusivities. A self-similar nonlinear solution is found for the more realistic problem with anisotropically temperature-dependent thermal diffusivities. Numerical solutions are developed for both cases, with spatially dependent heat flux emerging from the plasma. For both constant and temperature-dependent thermal diffusivities it is found that, below about one-half of its peak, the heat flux profile shape at the divertor, compared with the midplane temperature profile shape, is robustly described by the simplest two-point model. However the physical processes are not those assumed in the simplest two-point model, nor is the numerical coefficient relating q||div to Tmp ?||mp/L|| as predicted. For realistic parameters the peak in the heat flux, moreover, can be reduced by a factor of two or more from the two-point model scaling which fits the remaining profile. For temperature profiles in the SOL region above the x-point set by marginal stability, the heat flux profile to the divertor can be largely decoupled from the prediction of the two-point model. These results suggest caveats for data interpretation, and possibly favorable outcomes for divertor configurations with extended field lines.

Robert J. Goldston

2009-08-20T23:59:59.000Z

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance

282

Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester

2012-07-01T23:59:59.000Z

283

T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab

2012-02-11T23:59:59.000Z

284

Corrosion resistant coatings suitable for elevated temperature application  

DOE Patents (OSTI)

The present invention relates to corrosion resistance coatings suitable for elevated temperature applications, which employ compositions of iron (Fe), chromium (Cr), nickel (Ni) and/or aluminum (Al). The compositions may be configured to regulate the diffusion of metals between a coating and a substrate, which may then influence coating performance, via the formation of an inter-diffusion barrier layer. The inter-diffusion barrier layer may comprise a face-centered cubic phase.

Chan, Kwai S. (San Antonio, TX); Cheruvu, Narayana Sastry (San Antonio, TX); Liang, Wuwei (Austin, TX)

2012-07-31T23:59:59.000Z

285

Elevated Hydrogen Management for Three Mile Island Unit 1  

Science Conference Proceedings (OSTI)

The Chemistry, Fuel Reliability and Material Reliability Programs at the Electric Power Research Institute (EPRI) have developed a comprehensive Elevated Reactor Coolant System (RCS) Hydrogen Program that is focused on qualification of plant operation with dissolved hydrogen concentration in the RCS greater than 50 standard cubic centimeters per kilogram (scc/kg) and up to 60 scc/kg to mitigate primary water stress corrosion cracking (PWSCC) in nickel-based alloys. Currently, the industry-wide RCS upper ...

2010-12-22T23:59:59.000Z

286

Humidity Profiles over the Ocean  

Science Conference Proceedings (OSTI)

The distribution of water vapor in the atmosphere affects climate change through radiative balance and surface evaporation. The variabilities of atmospheric humidity profile over oceans from daily to interannual time scales were examined using ...

W. Timothy Liu; Wenqing Tang; Pearn P. Niiler

1991-10-01T23:59:59.000Z

287

Development of Wind Profiling Sodar  

Science Conference Proceedings (OSTI)

The present study group has developed a new wind profiling sodar with a phased array antenna. This system is superior to usual ones with parabolic reflectors in its portability. Preliminary experiments have shown the expected acoustic performance ...

Yoshiki Ito; Yasuhiro Kobori; Mitsuaki Horiguchi; Masato Takehisa; Yasushi Mitsuta

1989-10-01T23:59:59.000Z

288

Vibration of Tethered Microstructure Profilers  

Science Conference Proceedings (OSTI)

Although loosely tethered turbulence profilers have many advantages, they are prone to resonant vibrations at frequencies in the dissipation range when they are falling rapidly or when the tether is strummed. Using the Advanced Microstructure ...

Jack B. Miller; M. C. Gregg; Vernon W. Miller; Gordon L. Welsh

1989-12-01T23:59:59.000Z

289

Trends for Outer Disk Profiles  

E-Print Network (OSTI)

The surface-brightness profiles of galaxy disks fall into three main classes, based on whether they are simple exponentials (Type I), bend down at large radii (Type II, "truncations") or bend up at large radii (Type III, "antitruncations"). Here, we discuss how the frequency of these different profiles depends on Hubble type, environment, and the presence or absence of bars; these trends may herald important new tests for disk formation models.

Peter Erwin; Michael Pohlen; Leonel Gutierrez; John E. Beckman

2007-12-10T23:59:59.000Z

290

Principal Component Analysis of Wind Profiler Observations  

Science Conference Proceedings (OSTI)

Principal component analysis (PCA) is applied to wind profiler observations to study the vertical profile of the wind field and its temporal evolution. The rationale for decomposing timeheight wind profiler data using PCA is twofold. The ...

Christopher R. Williams

1997-06-01T23:59:59.000Z

291

An Acoustic Doppler and Electromagnetic Velocity Profiler  

Science Conference Proceedings (OSTI)

A freely failing current meter called the Absolute Velocity Profiler (AVP) is described. This profiler is an expansion of a previously developed instrument, the Electro-Magnetic Velocity Profiler (EMVP), with the additional capability of acoustic ...

Thomas B. Sanford; Robert G. Driver; John H. Dunlap

1985-06-01T23:59:59.000Z

292

JOBAID-ACCESSING AND MODIFYING TALENT PROFILE  

Energy.gov (U.S. Department of Energy (DOE))

The purpose of this job aid is to guide users through the step-by-step process of accessing their talent profiles, adding information to their profiles, and editing existing talent profile...

293

AND FINANCIAL 2011 Edition | EConoMiC And FinAnCiAL PRoFiLE oF QUBEC  

E-Print Network (OSTI)

ENERGY AGENCY. SOURCE: HYDRO-QU?BEC, COMPARISON OF ELECTRICITY PRICES IN MAJOR NORTH AMERICAN CITIES renewable energy, hydro-electricity in particular. It supports the development of wind power through its Energy Strategy 2006-2015, Hydro-Québec is actively pursuing development of Québec's hydroelectric

Rosei, Federico

294

Building Energy Software Tools Directory: Energy Profiler  

NLE Websites -- All DOE Office Websites (Extended Search)

in several widely used formats. Energy Profiler helps users to better understand their energy usage and associated costs. Keywords load profiles, rate comparisons, data...

295

Elevated atmospheric carbon dioxide in agroecosystems affects groundwater quality  

Science Conference Proceedings (OSTI)

Increasing atmospheric carbon dioxide (CO{sub 2}) concentration has led to concerns about global changes to the environment. One area of global change that has not been addressed is the effect of elevated atmospheric CO{sub 2} on groundwater quality below agroecosystems. Elevated CO{sub 2} concentration alterations of plant growth and C/N ratios may modify C and N cycling in soil and affect nitrate (NO{sub 3}{sup {minus}}) leaching to groundwater. This study was conducted to examine the effects of a legume (soybean [Glycine max (L.) Merr.]) and a nonlegume (grain sorghum [Sorghum bicolor (L.) Moench]) CO{sub 2}-enriched agroecosystems on NO{sub 3}{sup {minus}} movement below the root zone in a Blanton loamy sand (loamy siliceous, thermic, Grossarenic Paleudults). The study was a split-plot design replicated three times with plant species (soybean and grain sorghum) as the main plots and CO{sub 2} concentration ({approximately}360 and {approximately}720 {mu}L L{sup {minus}1} CO{sub 2}) as subplots using open-top field chambers. Fertilizer application was made with {sup 15}N-depleted NH{sub 4}NO{sub 3} to act as a fertilizer tracer. Soil solution samples were collected weekly at 90-cm depth for a 2-yr period and monitored for NO{sub 3}{sup {minus}}-N concentrations. Isotope analysis of soil solution indicated that the decomposition of organic matter was the primary source of No{sub 3}{sup {minus}}-N in soil solution below the root zone through most of the monitoring period. Significant differences were observed for NO{sub 3}{sup {minus}}-N concentrations between soybean and grain sorghum, with soybean having the higher NO{sub 3}{sup {minus}}-N concentration. Elevated CO{sub 2} increased total dry weight, total N content, and C/N ratio of residue returned to soil in both years. Elevated CO{sub 2} significantly decreased NO{sub 3}{sup {minus}}-N concentrations below the root zone in both soybean and grain sorghum. 37 refs., 2 figs., 2 tabs.

Torbert, H.A. [Blackland, Soil and Water Research Lab., Temple, TX (United States); Prior, S.A.; Rogers, H.H. [National Soil Dynamics Lab., Auburn, AL (United States); Schlesinger, W.H. [Duke Univ., Durham, NC (United States); Mullins, G.L.; Runion, G.B. [Auburn Univ., AL (United States)

1996-07-01T23:59:59.000Z

296

Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.

2003-12-01T23:59:59.000Z

297

The experience and image of American elevated railways : rapid transit infrastructure in the urban consciousness  

E-Print Network (OSTI)

At the turn of the twentieth century, elevated railways were built out of a practical need to literally "elevate" traffic above the street. In most cases, these lines served two distinct purposes. They served existing ...

Hansen, Gordon Benedict

2009-01-01T23:59:59.000Z

298

U-092: Sudo Format String Bug Lets Local Users Gain Elevated...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2: Sudo Format String Bug Lets Local Users Gain Elevated Privileges U-092: Sudo Format String Bug Lets Local Users Gain Elevated Privileges January 31, 2012 - 5:45am Addthis...

299

Determining Weather Radar Antenna Pointing Using Signals Detected from the Sun at Low Antenna Elevations  

Science Conference Proceedings (OSTI)

A method to determine the elevation and azimuth biases of the radar antenna using solar signals observed by a scanning radar is presented. Data recorded at low elevation angles where the atmospheric refraction has a significant effect on the ...

Asko Huuskonen; Iwan Holleman

2007-03-01T23:59:59.000Z

300

Irreversible transformations of native celluloses, upon exposure to elevated temperatures  

NLE Websites -- All DOE Office Websites (Extended Search)

Carbohydrate Polymers 100 (2014) 2- 8 Carbohydrate Polymers 100 (2014) 2- 8 Contents lists available at ScienceDirect Carbohydrate Polymers j o u r n a l h o m e p a g e : w w w . e l s e v i e r . c o m / l o c a t e / c a r b p o l Irreversible transformations of native celluloses, upon exposure to elevated temperatures R.S. Atalla a , M.F. Crowley b , M.E. Himmel b , R.H. Atalla a,c,∗ a Cellulose Sciences International, Madison, WI, United States b National Renewable Energy Laboratory, Golden, CO, United States c University of Wisconsin-Madison, Madison, WI, United States a r t i c l e i n f o Article history: Received 29 August 2012 Received in revised form 4 June 2013 Accepted 7 June 2013 Available online 15 June 2013 Keywords: Transformation Irreversible Celluloses Elevated Temperatures Native Accessibility Aggregation a b s t r a c t Current research, basic and applied, assumes that observed recalcitrance of celluloses is an inherent

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Rangeland Plant response to elevated CO{sub 2}  

SciTech Connect

Plots of a tallgrass prairie ecosystem were exposed to ambient and twice-ambient CO{sub 2} concentrations in open-top chambers and compared to unchambered ambient CO{sub 2} plots during the entire growing season from 1989 through 1993. Dominant species were Andropogon geradii, A. scoparius, and Sorghastrum nutans (C{sub 4}) and Poa pratensis (C{sub 3}). Aboveground biomass and leaf area were estimated by periodic sampling throughout the growing season in 1989 and 1990. In 1991, 1992, and 1993, peak biomass and leaf area were estimated by an early August harvest. Compared to ambient CO{sub 2} levels, elevated CO{sub 2} increased production of C{sub 4} grass species in 1989-1991, but in 1992 and 1993, wet years, there was no difference in C{sub 4} biomass production among treatments. Biomass production of C{sub 3} grass species did not differ among treatments any year. Root ingrowth biomass was greater in 1990 and 1991 on elevated CO{sub 2} plots compared to ambient or chambered-ambient plots. In 1992 and 1993, there was no difference in root ingrowth biomass among treatments.

Owensby, C.E.; Coyne, P.I.; Ham, J.M.; Parton, W.; Rice, C.; Auen, L.M.; Adam, N.

1994-12-31T23:59:59.000Z

302

Industry Profile | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Industry Profile Industry Profile Industry Profile November 1, 2013 - 11:40am Addthis The largest energy consuming industrial sectors account for the largest share of CHP capacity; namely: Chemicals (30%), Petroleum Refining (17%), and Paper Products (14%). Other industrial sectors include: Commercial/Institutional (12%), Food (8%), Primary Metals (5%), Other Manufacturing (8%), and Other Industrial (6%). Combined heat and power (CHP)-sometimes referred to as cogeneration-involves the sequential process of producing and utilizing electricity and thermal energy from a single fuel. CHP is widely recognized to save energy and costs, while reducing carbon dioxide (CO2) and other pollutants. CHP is a realistic, near-term option for large energy efficiency improvements and significant CO2 reductions.

303

Phenotype MicroArray Profiling  

NLE Websites -- All DOE Office Websites (Extended Search)

MicroArray MicroArray Profiling of Zymomonas mobilis ZM4 Barry Bochner & Vanessa Gomez & Michael Ziman & Shihui Yang & Steven D. Brown Received: 22 May 2009 / Accepted: 26 October 2009 # The Author(s) 2009. This article is published with open access at Springerlink.com Abstract In this study, we developed a Phenotype MicroArray(tm) (PM) protocol to profile cellular phenotypes in Zymomonas mobilis, which included a standard set of nearly 2,000 assays for carbon, nitrogen, phosphorus and sulfur source utilization, nutrient stimulation, pH and osmotic stresses, and chemical sensitivities with 240 inhibitory chemicals. We observed two positive assays for C-source utilization (fructose and glucose) using the PM screen, which uses redox chemistry and cell respiration as a universal reporter to profile growth phenotypes in a high-throughput 96-well plate-based format.

304

EIA - State Electricity Profiles - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Energy Information Administration ... solar, wind, geothermal, ... More Tables on New Jersey's Electricity Profile: Formats;

305

gprof Profiling Tools | Argonne Leadership Computing Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

Tuning MPI on BG/Q Tuning and Analysis Utilities (TAU) HPCToolkit HPCTW mpiP gprof Profiling Tools Darshan PAPI BG/Q Performance Counters BGPM Openspeedshop Scalasca BG/Q DGEMM Performance Software & Libraries IBM References Intrepid/Challenger/Surveyor Tukey Eureka / Gadzooks Policies Documentation Feedback Please provide feedback to help guide us as we continue to build documentation for our new computing resource. [Feedback Form] gprof Profiling Tools Contents Introduction Profiling on the Blue Gene Enabling Profiling Collecting Profile Information Profiling Threaded Applications Using gprof Routine Level Flat Profile Line Level Flat Profile Call Graph Analysis Routine Execution Count List Annotated Source Listing Issues in Interpreting Profile Data Profiling Concepts Programs in Memory

306

Country Energy Profile, South Africa  

Science Conference Proceedings (OSTI)

This country energy profile provides energy and economic information about South Africa. Areas covered include: Economics, demographics, and environment; Energy situation; Energy structure; Energy investment opportunities; Department of Energy (DOE) programs in South Africa; and a listing of International aid to South Africa.

NONE

1995-08-01T23:59:59.000Z

307

Profiles for the situated web  

Science Conference Proceedings (OSTI)

The World Wide Web is evolving into a medium that will soon make it possible for conceiving and implementing situation-aware services. A situation-aware or situated web application is one that renders the user with an experience (content, interaction ... Keywords: CC/PP, XML, profiles, situated-aware applications, vocabulary, web architecture

Lalitha Suryanarayana; Johan Hjelm

2002-05-01T23:59:59.000Z

308

Applications of Line Profile Analysis  

Science Conference Proceedings (OSTI)

Feb 16, 2010 ... Neutron and X-Ray Studies of Advanced Materials III : Applications of Line Profile ... Science: Robert Von Dreele1; 1APS/Argonne National Laboratory .... using an X-ray synchrotron beam line of the Advanced Photon Source.

309

Shallow Angle Wave Profiling Lidar  

Science Conference Proceedings (OSTI)

A lidar scanning system is described that is primarily designed to measure sea wave shape. The device is capable of measuring real-time spatial profiles over distances of hundreds of meters, and as the lidar must inevitably operate from modest ...

M. R. Belmont; J. M. K. Horwood; R. W. F. Thurley; J. Baker

2007-06-01T23:59:59.000Z

310

Complexation of Neptunium(V) with Fluoride at Elevated Temperatures  

SciTech Connect

Complexation of neptunium(V) with fluoride at elevated temperatures was studied by spectrophotometry and microcalorimetry. Two successive complexes, NpO{sub 2}F(aq) and NpO{sub 2}F{sub 2}{sup -}, were identified by spectrophotometry in the temperature range of 10-70 C. Thermodynamic parameters, including the equilibrium constants and enthalpy of complexation between Np(V) and fluoride at 10-70 C were determined. Results show that the complexation of Np(V) with fluoride is endothermic and that the complexation is enhanced by the increase in temperature - a two-fold increase in the stability constants of NpO{sub 2}F(aq) and more than five-fold increase in the stability constants of NpO{sub 2}F{sub 2}{sup -} as the temperature is increased from 10 to 70 C.

Rao, Linfeng; Tian, Guoxin; Xia, Yuanxian; Friese, Judah I.

2008-06-16T23:59:59.000Z

311

Microelectromechanical apparatus for elevating and tilting a platform  

DOE Patents (OSTI)

A microelectromechanical (MEM) apparatus is disclosed which has a platform that can be elevated above a substrate and tilted at an arbitrary angle using a plurality of flexible members which support the platform and control its movement. Each flexible member is further controlled by one or more MEM actuators which act to bend the flexible member. The MEM actuators can be electrostatic comb actuators or vertical zip actuators, or a combination thereof. The MEM apparatus can include a mirror coating to form a programmable mirror for redirecting or switching one or more light beams for use in a projection display. The MEM apparatus with the mirror coating also has applications for switching light beams between optical fibers for use in a local area fiber optic network, or for use in fiber optic telecommunications or data communications systems.

Miller, Samuel Lee (Albuquerque, NM); McWhorter, Paul Jackson (Albuquerque, NM); Rodgers, Murray Steven (Albuquerque, NM); Sniegowski, Jeffry J. (Edgewood, NM); Barnes, Stephen M. (Albuquerque, NM)

2003-04-08T23:59:59.000Z

312

Profiles  

NLE Websites -- All DOE Office Websites (Extended Search)

the antibiotics from working. We hope that this understanding may help in developing new drugs that will restore the efficacy of existing antibiotics by blocking these pumps. Our...

313

Profiles  

NLE Websites -- All DOE Office Websites (Extended Search)

S2 S3 reaction by the chaperone mechanism, J. Chem. Phys 134, 154508 (2011). S. D. Herring, T. C. Germann, and N. Grnbech-Jensen, Effects of void size, density, and...

314

Profiles  

NLE Websites -- All DOE Office Websites (Extended Search)

diseases including smallpox, anthrax, malaria, HIV, and influenza on... Paul S. White Genomics - Development of tools for discovery and application of genetic variation. Technology...

315

Profiles  

NLE Websites -- All DOE Office Websites (Extended Search)

and Y. pestis sample collection from nonporous surfaces by quantitative real-time PCR. Lett. Appl. Microbiol. 50: 431-7. Hong-Geller, E. and Micheva-Viteva, S. (2010)...

316

Combining Microwave Radiometer and Wind Profiler Radar Measurements for High-Resolution Atmospheric Humidity Profiling  

Science Conference Proceedings (OSTI)

A self-consistent remote sensing physical method to retrieve atmospheric humidity high-resolution profiles by synergetic use of a microwave radiometer profiler (MWRP) and wind profiler radar (WPR) is illustrated. The proposed technique is based ...

Laura Bianco; Domenico Cimini; Frank S. Marzano; Randolph Ware

2005-07-01T23:59:59.000Z

317

Definition: Electrical Profiling Configurations | Open Energy Information  

Open Energy Info (EERE)

Profiling Configurations Profiling Configurations Jump to: navigation, search Dictionary.png Electrical Profiling Configurations Electrical profiling is a DC resistivity survey which aims to trace lateral variations in the apparent resistivity structure of the subsurface. Traditionally, electrical profiling provides qualitative information of relative apparent resistivity values in order to detect anomalous geological features.[1] Also Known As Electrical mapping References ↑ http://www.amazon.com/Principles-Electric-Borehole-Geophysics-Geochemistry/dp/0444529942 Ret LikeLike UnlikeLike You like this.Sign Up to see what your friends like. rieved from "http://en.openei.org/w/index.php?title=Definition:Electrical_Profiling_Configurations&oldid=596184" Category: Definitions

318

IPM Profiling Tool at NERSC  

NLE Websites -- All DOE Office Websites (Extended Search)

IPM IPM IPM Description and Overview IPM is a portable profiling infrastructure which provide a high level report on the execution of a parallel job. IPM reports hardware counters data, MPI function timings, and memory usage. It provides a low overhead means to generate scaling studies or performance data for ERCAP submissions. When you run a job using the IPM module you will get a performance summary (see below) to stdout as well as a web accessible summary of all your IPM jobs. The two main objectives of IPM are ease-of-use and scalability in performance analysis. Usage % module load ipm On HPC architectures that support shared libraries that's all you need to do. Once the module is loaded you can run as you normally and get a performance profile once the job has successfully completed. You do not

319

Enterprise Service Bus Implementation Profile  

Science Conference Proceedings (OSTI)

The purpose of this report is to define an implementation profile for International Electrotechnical Commission (IEC) 61968 using technologies commonly found on an Enterprise Service Bus (ESB). More specifically, this document describes how message payloads defined by parts 3 through 9 of IEC 61968 are conveyed using Web Services and the Java Message Service (JMS). The goal is to provide details that are sufficient to enable implementations of IEC 61968 to be interoperable.

2009-04-30T23:59:59.000Z

320

State coal profiles, January 1994  

SciTech Connect

The purpose of State Coal Profiles is to provide basic information about the deposits, production, and use of coal in each of the 27 States with coal production in 1992. Although considerable information on coal has been published on a national level, there is a lack of a uniform overview for the individual States. This report is intended to help fill that gap and also to serve as a framework for more detailed studies. While focusing on coal output, State Coal Profiles shows that the coal-producing States are major users of coal, together accounting for about three-fourths of total US coal consumption in 1992. Each coal-producing State is profiled with a description of its coal deposits and a discussion of the development of its coal industry. Estimates of coal reserves in 1992 are categorized by mining method and sulfur content. Trends, patterns, and other information concerning production, number of mines, miners, productivity, mine price of coal, disposition, and consumption of coal are detailed in statistical tables for selected years from 1980 through 1992. In addition, coal`s contribution to the State`s estimated total energy consumption is given for 1991, the latest year for which data are available. A US summary of all data is provided for comparing individual States with the Nation as a whole. Sources of information are given at the end of the tables.

1994-02-02T23:59:59.000Z

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Simulations and Experiments on Modifying the q-Profile for Advanced Tokamak Discharges on Alcator C-Mod  

NLE Websites -- All DOE Office Websites (Extended Search)

and Experiments on and Experiments on Modifying the q-Profile for Advanced Tokamak Discharges on Alcator C-Mod C. E. Kessel 1 , A. E. Hubbard 2 P. Bonoli 2 , M. Greenwald, J. Ko 2 , Y. Lin 2 , R. Parker 2 , A. E. Schmidt 2 , S. Scott 1 , J. Snipes, D. Terry 2 , G. Wallace 2 , R. Wilson 1 , S. Wolfe 2 , S. Wukitch 2 1 Princeton Plasma Physics Laboratory 2 Plasma Science and Fusion Center, MIT APS Division of Plasma Physics, November 2007 Controlling the q-Profile in Alcator C-Mod * Lower Hybrid current drive provides a strong source of non- inductive current at large minor radius * ICRF provides central and off-axis heating * Cryopump provides density control * MSE/Faraday rotation provide current profile diagnostics * Goal is to produce 100% non-inductive plasma current with LHCD and bootstrap current * Goal is to elevate the safety factor and control the q-profile

322

Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available

2011-10-01T23:59:59.000Z

323

EIA - State Electricity Profiles - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Includes hydropower, solar, wind, geothermal, biomass and ethanol. Nuclear & Uranium. ... More Tables on Pennsylvania's Electricity Profile: Formats; Table 2.

324

EIA - State Electricity Profiles - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Maps. Maps by energy source and topic, ... Solar Energy in Brief. ... More Tables on United States's Electricity Profile: Formats;

325

EIA - State Electricity Profiles - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Consumption & Efficiency. Energy use in homes, commercial buildings, manufacturing, and transportation. ... More Tables on New Hampshire's Electricity Profile: Formats;

326

Regional Profiles: Pipeline Capacity and Service  

U.S. Energy Information Administration (EIA)

Regional Profiles: Pipeline Capacity ... large petrochemical and electric utility industries drawn there ... accounts for large electricity load ...

327

EIA - State Electricity Profiles - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Energy Information Administration - EIA - Official Energy Statistics from the U.S. Government ... Archived State Electricity Profiles. Choose a Year: ...

328

The Effect of Elevated Temperature on Concrete Materials and Structures - a Literature Review.  

Science Conference Proceedings (OSTI)

The objective of this limited study was to provide an overview of the effects of elevated temperature on the behavior of concrete materials and structures. In meeting this objective the effects of elevated temperatures on the properties of ordinary Portland cement concrete constituent materials and concretes are summarized. The effects of elevated temperature on high-strength concrete materials are noted and their performance compared to normal strength concretes. A review of concrete materials for elevated-temperature service is presented. Nuclear power plant and general civil engineering design codes are described. Design considerations and analytical techniques for evaluating the response of reinforced concrete structures to elevated-temperature conditions are presented. Pertinent studies in which reinforced concrete structural elements were subjected to elevated temperatures are described.

Naus, Dan J [ORNL

2006-03-01T23:59:59.000Z

329

Temperature profiles determine HRSG steam production  

Science Conference Proceedings (OSTI)

This article examine how temperature profiles affect steam production in heat recovery steam generators(HRSG). A typical gas/steam temperature profile for a HRSG is shown. Heat balance equations for the superheater, evaporator, and the complete HRSG are given along with examples for calculating the HRSG temperature profiles after assuming the pinch and approach point temperatures.

Ganapathy, V.

1993-05-01T23:59:59.000Z

330

Erosion-Corrosion of Iron and Nickel Alloys at Elevated Temperature...  

NLE Websites -- All DOE Office Websites (Extended Search)

gases flow 4. Erosion-corrosion occurs when the gas entrained coal ash impacts the boiler components in the elevated temperature combustion gas environment. This work...

331

Airborne Laser Altimetry Digital Elevation Model, Barrow Environmental Observatory, 0.5m spatial resolution  

SciTech Connect

The dataset is a digital elevation model, DEM, of a 2km by 7km region in the vicinity of the Barrow Environmental Observatory near Barrow, Ak.

Cathy Wilson; Chandana Gangodagamage; Joel Rowland

2013-12-08T23:59:59.000Z

332

Airborne Laser Altimetry Digital Elevation Model, Barrow Environmental Observatory, 0.5m spatial resolution  

DOE Data Explorer (OSTI)

The dataset is a digital elevation model, DEM, of a 2km by 7km region in the vicinity of the Barrow Environmental Observatory near Barrow, Ak.

Cathy Wilson; Chandana Gangodagamage; Joel Rowland

333

PWR AXIAL BURNUP PROFILE ANALYSIS  

Science Conference Proceedings (OSTI)

The purpose of this activity is to develop a representative ''limiting'' axial burnup profile for pressurized water reactors (PWRs), which would encompass the isotopic axial variations caused by different assembly irradiation histories, and produce conservative isotopics with respect to criticality. The effect that the low burnup regions near the ends of spent fuel have on system reactivity is termed the ''end-effect''. This calculation will quantify the end-effects associated with Pressurized Water Reactor (PWR) fuel assemblies emplaced in a hypothetical 21 PWR waste package. The scope of this calculation covers an initial enrichment range of 3.0 through 5.0 wt% U-235 and a burnup range of 10 through 50 GWd/MTU. This activity supports the validation of the process for ensuring conservative generation of spent fuel isotopics with respect to criticality safety applications, and the use of burnup credit for commercial spent nuclear fuel. The intended use of these results will be in the development of PWR waste package loading curves, and applications involving burnup credit. Limitations of this evaluation are that the limiting profiles are only confirmed for use with the B&W 15 x 15 fuel assembly design. However, this assembly design is considered bounding of all other typical commercial PWR fuel assembly designs. This calculation is subject to the Quality Assurance Requirements and Description (QARD) because this activity supports investigations of items or barriers on the Q-list (YMP 2001).

J.M. Acaglione

2003-09-17T23:59:59.000Z

334

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

335

The lean oxidation of iso-octane at elevated pressures  

DOE Green Energy (OSTI)

Both spark-ignition and compression-ignition engines burn large molecular-weight blended fuels, a class to which the primary reference fuels (PRF), n-heptane and iso-octane belong. In this study experiments were performed using iso-octane in a high pressure flow reactor at a temperature of 925 K, at 3, 6 and 9 atm pressure and with a fuel/air equivalence ratio of approximately 0.05. Many hydrocarbon and oxygenated hydrocarbon intermediates were identified and quantified as a function of time. These experimental results provide a strin- gent test of the low temperature chemistry portion of a kinetic model as they emphasise the importance of alkyl radical addition to molecular oxygen and internal H-atom isomerization reactions relative to alkyl radical decomposition reactions. A detailed chemical kinetic mechanism is used to simulate these experiments. We provide comparisons of model predictions with experimentally measured species profiles and describe how each species is formed as predicted by the detailed model.

Chen, J S; Curran, H J; Litzinger, T A

1998-10-30T23:59:59.000Z

336

Moisture Retention Curves of Topopah Spring Tuff at Elevated Temperatures  

SciTech Connect

Knowledge of unsaturated flow and transport in porous media is critical for understanding the movement of water and solute through the unsaturated zone. The suction potential of rock determines the imbibition of water and, therefore, the moisture retention in the matrix. That, in turn, affects the relative importance of matrix flow and fracture flow, and their interaction, because greater suction potential moves more water from fractures into the matrix and therefore retards fracture flow. The moisture content as a function of the suction potential is called a moisture retention curve or a characteristic curve. Moisture-retention data are important input for numerical models of water movement in unsaturated porous media. Also important are the effect of sample history on the moisture-retention curves and whether there is significant hysteresis between wetting and drying measurements. The Yucca Mountain Site Characterization Project (YMP) of the U.S. Department of Energy is studying the suitability of the tuffaceous rock at Yucca Mountain, Nevada, for a potential high-level nuclear waste repository. The potential repository horizon will be in the unsaturated zone of the Topopah Spring member (densely welded) of the Paintbrush Tuff unit at Yucca Mountain. This unit is highly fractured. Therefore, transport of water within the near field of the nuclear waste package in the repository is strongly influenced by the suction potential of the repository host rocks at elevated temperatures. In a high-level nuclear waste repository, the rock mass around the waste packages will become dry because of the thermal load of the waste but will then re-wet during the cool-down period as the thermal output of the waste packages declines. Much of this process will occur at temperatures above ambient temperature. The goal of our work is to determine the importance of temperature and the wetting-drying hysteresis on the measured moisture retention curves of the densely welded tuff. For Topopah Spring tuff the suction potential is assumed to be primary due to the matric potential.

Lin, W.; Roberts, J.; Carlberg, E.; Ruddle, D.; Pletcher, R.

2001-11-30T23:59:59.000Z

337

Classification of Multispectral High-Resolution Satellite Imagery Using LIDAR Elevation Data  

Science Conference Proceedings (OSTI)

This paper studies the influence of airborne LIDAR elevation data on the classification of multispectral SPOT5 imagery over a semi-urban area; to do this, multispectral and LIDAR elevation data are integrated in a single imagery file composed of independent ... Keywords: Classification, LIDAR, Satellite Imagery, Support Vector Machine

Mara C. Alonso; Jos A. Malpica

2008-12-01T23:59:59.000Z

338

The effect of multiple entrances on the elevator round trip time under up-peak traffic  

Science Conference Proceedings (OSTI)

The design of vertical transportation systems relies on the calculation of the interval as an indicator of the quality of service. This in turn involves the accurate calculation of the round trip time of a single elevator. The calculation of the round ... Keywords: Basement, Elevator, Interval, Lift, Round trip time, Up peak traffic

Lutfi Al-Sharif

2010-08-01T23:59:59.000Z

339

Sublimation of Intercepted Snow within a Subalpine Forest Canopy at Two Elevations  

Science Conference Proceedings (OSTI)

To determine how elevation affects the sublimation rate from intercepted snow within a subalpine forest canopy, a cut subalpine fir and an artificial conifer were weighed at each of two elevations (3230 and 2920 m) at a U.S. continental site (39...

James Montesi; Kelly Elder; R. A. Schmidt; Robert E. Davis

2004-10-01T23:59:59.000Z

340

V-101: McAfee VirusScan Enterprise Lets Local Users Gain Elevated  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1: McAfee VirusScan Enterprise Lets Local Users Gain Elevated 1: McAfee VirusScan Enterprise Lets Local Users Gain Elevated Privileges V-101: McAfee VirusScan Enterprise Lets Local Users Gain Elevated Privileges February 28, 2013 - 12:05am Addthis PROBLEM: McAfee VirusScan Enterprise Lets Local Users Gain Elevated Privileges PLATFORM: VSE 8.8 Patch 2 with Access Protection, including Self Protection, turned off ABSTRACT: A vulnerability was reported in McAfee VirusScan Enterprise. REFERENCE LINKS: McAfee Security Bulletins ID: SB10038 SecurityTracker Alert ID: 1028209 IMPACT ASSESSMENT: Medium DISCUSSION: When Access Protection has been disabled, a local user can gain full control of the target application IMPACT: A local user can obtain elevated privileges on the target system. SOLUTION: The vendor has issued a fix (8.8 Patch 2 with HF778101, 8.8 Patch 3)

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

U-194: Symantec LiveUpdate Administrator Lets Local Users Gain Elevated  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4: Symantec LiveUpdate Administrator Lets Local Users Gain 4: Symantec LiveUpdate Administrator Lets Local Users Gain Elevated Privledges U-194: Symantec LiveUpdate Administrator Lets Local Users Gain Elevated Privledges June 19, 2012 - 7:00am Addthis PROBLEM: Symantec LiveUpdate Administrator Lets Local Users Gain Elevated Privileges . PLATFORM: Version(s): 2.3 and prior versions Abstract: Users Gain Elevated Privileges reference LINKS: Vendor Advisory SecurityTracker Alert ID: 1027182 CVE-2012-0304 IMPACT ASSESSMENT: Medium Discussion: A vulnerability was reported in Symantec LiveUpdate Administrator. A local user can obtain elevated privileges on the target system.The default installation of Symantec LiveUpdate Administrator installs files with full control privileges granted to the 'Everyone' group.A local user can exploit

342

V-101: McAfee VirusScan Enterprise Lets Local Users Gain Elevated  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1: McAfee VirusScan Enterprise Lets Local Users Gain Elevated 1: McAfee VirusScan Enterprise Lets Local Users Gain Elevated Privileges V-101: McAfee VirusScan Enterprise Lets Local Users Gain Elevated Privileges February 28, 2013 - 12:05am Addthis PROBLEM: McAfee VirusScan Enterprise Lets Local Users Gain Elevated Privileges PLATFORM: VSE 8.8 Patch 2 with Access Protection, including Self Protection, turned off ABSTRACT: A vulnerability was reported in McAfee VirusScan Enterprise. REFERENCE LINKS: McAfee Security Bulletins ID: SB10038 SecurityTracker Alert ID: 1028209 IMPACT ASSESSMENT: Medium DISCUSSION: When Access Protection has been disabled, a local user can gain full control of the target application IMPACT: A local user can obtain elevated privileges on the target system. SOLUTION: The vendor has issued a fix (8.8 Patch 2 with HF778101, 8.8 Patch 3)

343

U-112: PostgreSQL Bugs Let Remote Authenticated Users Gain Elevated  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2: PostgreSQL Bugs Let Remote Authenticated Users Gain Elevated 2: PostgreSQL Bugs Let Remote Authenticated Users Gain Elevated Privileges, Inject SQL Commands, and Spoof Certificates U-112: PostgreSQL Bugs Let Remote Authenticated Users Gain Elevated Privileges, Inject SQL Commands, and Spoof Certificates February 28, 2012 - 8:45am Addthis PROBLEM: A vulnerability was reported in PostgreSQL. PLATFORM: Version(s): prior to 8.3.18, 8.4.11, 9.0.7, 9.1.3 ABSTRACT: A remote authenticated user can gain elevated privileges. A remote authenticated user can inject SQL commands. A remote user can spoof connections in certain cases. reference LINKS: Vendor Advisory Security Tracker ID 1026744 CVE-2012-0866 IMPACT ASSESSMENT: Medium Discussion: For trigger functions marked SECURITY DEFINER, a remote authenticated user can execute a trigger function and gain elevated privileges CVE-2012-0866.

344

U-068:Linux Kernel SG_IO ioctl Bug Lets Local Users Gain Elevated  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8:Linux Kernel SG_IO ioctl Bug Lets Local Users Gain Elevated 8:Linux Kernel SG_IO ioctl Bug Lets Local Users Gain Elevated Privileges U-068:Linux Kernel SG_IO ioctl Bug Lets Local Users Gain Elevated Privileges December 23, 2011 - 8:45am Addthis PROBLEM: Linux Kernel SG_IO ioctl Bug Lets Local Users Gain Elevated Privileges PLATFORM: Red Hat Enterprise Linux Desktop (v. 6) Red Hat Enterprise Linux HPC Node (v. 6) Red Hat Enterprise Linux Server (v. 6) Red Hat Enterprise Linux Server AUS (v. 6.2) Red Hat Enterprise Linux Server EUS (v. 6.2.z) Red Hat Enterprise Linux Workstation (v. 6) ABSTRACT: A local privileged user on the guest operating system can obtain elevated privileges on the target system. reference LINKS: Red Hat kernel security and bug fix update SecurityTracker Alert ID: 1026453 SecurityTracker Alert ID: 1026454

345

T-563: Red Hat Directory Server Bugs Let Local Users Gain Elevated  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3: Red Hat Directory Server Bugs Let Local Users Gain Elevated 3: Red Hat Directory Server Bugs Let Local Users Gain Elevated Privileges and Remote and Local Users Deny Service T-563: Red Hat Directory Server Bugs Let Local Users Gain Elevated Privileges and Remote and Local Users Deny Service February 23, 2011 - 7:00am Addthis PROBLEM: Red Hat Directory Server Bugs Let Local Users Gain Elevated Privileges and Remote and Local Users Deny Service. PLATFORM: Red Hat Directory Server v8 EL4, Red Hat Directory Server v8 EL5 ABSTRACT: Several vulnerabilities were reported in Red Hat Directory Server. A local user can obtain elevated privileges on the target system. A remote user can cause denial of service conditions. A local user can cause denial of service conditions. A remote user can send multiple simple paged search requests to cause the

346

U-040: HP-UX System Administration Manager Lets Local Users Gain Elevated  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0: HP-UX System Administration Manager Lets Local Users Gain 0: HP-UX System Administration Manager Lets Local Users Gain Elevated Privileges U-040: HP-UX System Administration Manager Lets Local Users Gain Elevated Privileges November 17, 2011 - 8:00am Addthis PROBLEM: HP-UX System Administration Manager Lets Local Users Gain Elevated Privileges. PLATFORM: HP-UX B.11.11, B.11.23, B.11.31; running Enterprise Mobility Suite (EMS) prior to A.04.20.11.04_01 ABSTRACT: A local user can obtain elevated privileges on the target system. reference LINKS: HP Support Center Document ID: c03089106 CVE-2011-4159 SecurityTracker Alert ID: 1026331 IMPACT ASSESSMENT: Medium Discussion: A vulnerability was reported in HP-UX System Administration Manager. A local user can obtain elevated privileges on the target system. A local user can gain full control of the target system.

347

U-040: HP-UX System Administration Manager Lets Local Users Gain Elevated  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

40: HP-UX System Administration Manager Lets Local Users Gain 40: HP-UX System Administration Manager Lets Local Users Gain Elevated Privileges U-040: HP-UX System Administration Manager Lets Local Users Gain Elevated Privileges November 17, 2011 - 8:00am Addthis PROBLEM: HP-UX System Administration Manager Lets Local Users Gain Elevated Privileges. PLATFORM: HP-UX B.11.11, B.11.23, B.11.31; running Enterprise Mobility Suite (EMS) prior to A.04.20.11.04_01 ABSTRACT: A local user can obtain elevated privileges on the target system. reference LINKS: HP Support Center Document ID: c03089106 CVE-2011-4159 SecurityTracker Alert ID: 1026331 IMPACT ASSESSMENT: Medium Discussion: A vulnerability was reported in HP-UX System Administration Manager. A local user can obtain elevated privileges on the target system. A local user can gain full control of the target system.

348

The Finescale Response of Lowered ADCP Velocity Profiles  

Science Conference Proceedings (OSTI)

Lowered acoustic Doppler current profiler (LADCP) velocity profiles are compared with simultaneous higher-resolution expendable current profiler (XCP) profiles to determine the lowered ADCP's response at short wavelengths. Although lowered ADCP ...

Kurt Polzin; Eric Kunze; Jules Hummon; Eric Firing

2002-02-01T23:59:59.000Z

349

Load Scheduling with Profile Information  

E-Print Network (OSTI)

. Within the past five years, many manufactures have added hardware performance counters to their microprocessors to generate profile data cheaply. We show how to use Compaq's DCPI tool to determine load latencies which are at a fine, instruction granularity and use them as fodder for improving instruction scheduling. We validate our heuristic for using DCPI latency data to classify loads as hits and misses against simulation numbers. We map our classification into the Multiflow compiler's intermediate representation, and use a locality sensitive Balanced scheduling algorithm. Our experiments illustrate that our algorithm improves run times by 1% on average, but up to 10% on a Compaq Alpha. 1 Introduction This paper explores how to use hardware performance counters to produce fine grain latency information to improve compiler scheduling. We use this information to hide latencies with any available instruction level parallelism (ILP). (ILP for an instruction is the number of o...

Gtz Lindenmaier; Kathryn S. McKinley; Olivier Temam

2000-01-01T23:59:59.000Z

350

Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan

2008-01-01T23:59:59.000Z

351

Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-

2009-01-01T23:59:59.000Z

352

Maryland - State Energy Profile Analysis - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Comprehensive data summaries, comparisons, analysis, ... Profile AnalysisPrint State Energy Profile ... The state is backing construction of a large ...

353

PCR Kit Name Manufacturer Kit Description Profiler Plus ...  

Science Conference Proceedings (OSTI)

Page 1. PCR Kit Name Manufacturer Kit Description Profiler Plus Applied Biosystems AmpFLSTR Profiler Plus (Part Number 4303326) ...

2010-06-29T23:59:59.000Z

354

ARM - Campaign Instrument - s-band-profiler  

NLE Websites -- All DOE Office Websites (Extended Search)

govInstrumentss-band-profiler govInstrumentss-band-profiler Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign Instrument : NOAA S-band (2835 Mhz) Profiler (S-BAND-PROFILER) Instrument Categories Cloud Properties, Atmospheric Profiling Campaigns CRYSTAL-FACE [ Download Data ] Off Site Campaign : various, including non-ARM sites, 2002.06.26 - 2002.08.01 Midlatitude Continental Convective Clouds Experiment (MC3E): Multi-Frequency Profilers [ Download Data ] Southern Great Plains, 2011.04.22 - 2011.06.06 Tropical Warm Pool - International Cloud Experiment (TWP-ICE) [ Download Data ] Tropical Western Pacific, 2006.01.21 - 2006.02.13 Primary Measurements Taken The following measurements are those considered scientifically relevant. Refer to the datastream (netcdf) file headers for the list of all available

355

Definition: Electromagnetic Profiling Techniques | Open Energy Information  

Open Energy Info (EERE)

Electromagnetic Profiling Techniques Electromagnetic Profiling Techniques Jump to: navigation, search Dictionary.png Electromagnetic Profiling Techniques Electromagnetic profiling techniques map lateral variations in subsurface resistivity.[1] View on Wikipedia Wikipedia Definition Exploration geophysics is the applied branch of geophysics which uses surface methods to measure the physical properties of the subsurface Earth, along with the anomalies in these properties, in order to detect or infer the presence and position of ore minerals, hydrocarbons, geothermal reservoirs, groundwater reservoirs, and other geological structures. Exploration geophysics is the practical application of physical methods (such as seismic, gravitational, magnetic, electrical and electromagnetic) to measure the physical properties of rocks, and in particular, to detect

356

Benchmarking optimization software with performance profiles  

E-Print Network (OSTI)

Mar 15, 2001 ... Abstract: We propose performance profiles -- probability distribution functions for a performance metric -- as a tool for benchmarking and...

357

Modeling Carbon Concentration Profiles in Austenitic Stainless ...  

Science Conference Proceedings (OSTI)

Presentation Title, Modeling Carbon Concentration Profiles in Austenitic Stainless Steels Carburized at Low Temperatures. Author(s), Gary M. Michal, Xiaoting...

358

Building Energy Software Tools Directory: Energy Profiler  

NLE Websites -- All DOE Office Websites (Extended Search)

can view and edit load shapes graphically, manage a database of energy rates, perform rate comparisons and generate estimated bills under a variety of scenarios. Energy Profiler...

359

Regional Energy Profile Forum on Energy Preparedness  

Gasoline and Diesel Fuel Update (EIA)

Regional Energy Profile West Texas Intermediate Crude Oil Prices U.S. Crude Oil Inventory Outlook U.S. Distillate Inventory Outlook Distillate Stocks Low - Especially On East...

360

DLMF: ProfileDaniel W. Lozier  

Science Conference Proceedings (OSTI)

... Profile Daniel W. Lozier. ... version (See MathML) . A Printed Companion is available. Frank W. J. OlverRonald F. Boisvert.

2013-05-03T23:59:59.000Z

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Anti-inflammatory Properties of Cowpea Phenotypes with different Phenolic Profiles  

E-Print Network (OSTI)

Cowpea (Vigna unguiculata) is a highly nutritious, drought tolerant crop with several agronomic advantages over other legumes. This study demonstrated the association of different cowpea phenotypes with specific phenolic profiles, antioxidants activity, anti-inflammatory properties on non-malignant colonic (CCD18co) cells challenged with a lipopolysaccharide (LPS), and the effect of boiling on their individual and total flavonoid content. Only the black and green phenotypes had detectable anthocyanins; and their levels were highest in the black IT95K-1105-5 variety. The red cowpea phenotypes had the highest level of flavonols (858 - 941 micrograms/g cowpea flour) and white Early Acre variety had the least. Quercetin derivatives were the major flavonols detected, followed by myricetin derivatives. Monomeric, dimeric and polymeric procyanidins also made up a large proportion of cowpea phenolics. The light brown 09FCV-CC27M cowpea variety had the highest average flavan-3-ol content (13,464 micrograms/g cowpea flour); whereas white and green varieties did not contain detectable levels of flavan-3-ols. Thus, seed-coat color was a good indicator of the accumulation of specific flavonoids in cowpeas. The black, red and light-brown cowpeas had the highest antioxidant activity measured by ORAC and ABTS methods, correlating with their higher total phenol content (TPC) and condensed tannin content (CTC); whereas the white and green varieties had the least. Boiling significantly affected the phenolic profiles, TPC and CTC of all cowpea varieties studied, as well as the antioxidant activity associated with these compounds. The net reduction in antioxidant activity after boiling was less than the net TPC reduction, indicating that the heat-induced phenolic products may still have radical scavenging capacity. Overall, proinflammatory genes regulation, intracellular ROS inhibition, and modulation of miR-126 and its target gene VCAM-1 by cowpea were found to be dependent on cowpea variety, phenolic composition and concentrations. The underlying mechanism by which cowpea induced miR-126 may be associated with inhibition of ROS and down-regulation of transcription factor NF-These results emphasize the importance of the cancer inhibitory potential of phenolic compounds from cowpea and their possible role in preventing anti-inflammatory disorders. Further in vivo studies with cowpea diets are required to validate their clinical relevance to human health.

Ojwang, Leonnard

2012-05-01T23:59:59.000Z

362

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI

2012-06-01T23:59:59.000Z

363

Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah

2011-04-21T23:59:59.000Z

364

Elevated CO2 and plant species diversity interact to slow root decomposition  

Science Conference Proceedings (OSTI)

Changes in plant species diversity can result in synergistic increases in decomposition rates, while elevated atmospheric CO2 can slow the decomposition rates; yet it remains unclear how diversity and changes in atmospheric CO2 may interact to alter root decomposition. To investigate how elevated CO2 interacts with changes in root-litter diversity to alter decomposition rates, we conducted a 120-day laboratory incubation. Roots from three species (Trifolium repens, Lespedeza cuneata, and Festuca pratense) grown under ambient or elevated CO2 were incubated individually or in combination in soils that were exposed to ambient or elevated CO2 for five years. Our experiment resulted in two main findings: (1) Roots from T. repens and L. cuneata, both nitrogen (N) fixers, grown under elevated CO2 treatments had significantly slower decomposition rates than similar roots grown under ambient CO2 treatments; but the decomposition rate of F. pratense roots (a non-N-fixing species) was similar regardless of CO2 treatment. (2) Roots of the three species grown under ambient CO2 and decomposed in combination with each other had faster decomposition rates than when they were decomposed as single species. However, roots of the three species grown under elevated CO2 had similar decomposition rates when they were incubated alone or in combination with other species. These data suggest that if elevated CO2 reduces the root decomposition rate of even a few species in the community, it may slow root decomposition of the entire plant community.

De Graaff, Marie-Anne [ORNL; Schadt, Christopher Warren [ORNL; Rula, Kelly L [ORNL; Six, Johan W U A [University of California, Davis; Schweitzer, Jennifer A [ORNL; Classen, Aimee T [University of Tennessee, Knoxville (UTK)

2011-01-01T23:59:59.000Z

365

A weighted profile intersection measure for profile-based authorship attribution  

Science Conference Proceedings (OSTI)

This paper introduces a new similarity measure called weighted profile intersection (WPI) for profile-based authorship attribution (PBAA). Authorship attribution (AA) is the task of determining which, from a set of candidate authors, wrote a given document. ...

Hugo Jair Escalante; Manuel Montes-y-Gmez; Thamar Solorio

2011-11-01T23:59:59.000Z

366

The Christmas Island Wind Profiler: A Prototype VHF Wind-Profiling Radar for the Tropics  

Science Conference Proceedings (OSTI)

After a decade of development, VHF wind profilers are being used for atmospheric research at several locations in the tropical Pacific. A prototype 50-MHz wind profiler was installed on Christmas Island in 1985 and has operated continuously since ...

K. S. Gage; J. R. Mcafee; W. L. Ecklund; D. A. Carter; C. R. Williams; P. E. Johnston; A. C. Riddle

1994-02-01T23:59:59.000Z

367

The Variational Assimilation Method for the Retrieval of Humidity Profiles with the Wind-Profiling Radar  

Science Conference Proceedings (OSTI)

Recently, a humidity estimation technique was developed by using the turbulence echo characteristics detected with a wind-profiling radar. This study is concerned with improvement of the retrieval algorithm for delineating a humidity profile from ...

Jun-ichi Furumoto; Shingo Imura; Toshitaka Tsuda; Hiromu Seko; Tadashi Tsuyuki; Kazuo Saito

2007-09-01T23:59:59.000Z

368

Load Scheduling with Profile Information  

E-Print Network (OSTI)

Abstract Within the past five years, many manufactureshave added hardware performance counters to their microprocessors to generate profile data cheaply.Translating aggregate data such as basic block execution frequencies from the executable to the com-piler intermediate representation is fairly straightforward. In this paper, we show how to use Com-paq's DCPI tool to determine load latencies which are at a fine, instruction granularity and then usethem to provide fodder for improving instruction scheduling. We validate our heuristic for usingDCPI latency data to classify loads as hits and misses against simulation numbers, demonstratingthat we can gather correct latencies cheaply at runtime. We map our classification into the Multiflowcompiler's intermediate representation, and use a locality sensitive Balanced scheduling algorithm. Ourexperiments illustrate that our algorithm has the potential to improve run times by up to 10 % on a Com-paq Alpha when compared to Balanced scheduling, but that a variety of pitfalls make consistent im-provements difficult to attain. 1 Introduction In this paper, we explore how to use hardware per-formance counters to produce fine grain latency information to improve compiler scheduling. We usethis information to hide latencies with any avail\\Lambda The authors

unknown authors

1999-01-01T23:59:59.000Z

369

Laser light absorption with density profile modifications  

SciTech Connect

Two-dimensional computer simulations studied plasma heating by electron plasma waves. The results emphasize the importance of nonlinear steepening of the density profile near the critical density. A typical simulation result is presented in order to illustrate these profile modifications. It is shown that large dc magnetic field generation is an inherent property of the absorption of obliquely-incident light. (MOW)

Kruer, W.; Valeo, E.; Estabrook, K.; Langdon, B.; Lasinski, B.

1974-12-01T23:59:59.000Z

370

Profiling all paths: A new profiling technique for both cyclic and acyclic paths  

Science Conference Proceedings (OSTI)

As an important technique in dynamic program analysis, path profiling collects the execution frequency of different paths, and has been widely used in a variety of areas. However, existing intra-procedural profiling techniques cannot effectively deal ... Keywords: Breakpoint, Cyclic paths, Dynamic analysis, Path backwalk, Path profiling, Probe instrumentation

Bixin Li; Lulu Wang; Hareton Leung; Fei Liu

2012-07-01T23:59:59.000Z

371

TOF Profile function used at POWGEN  

NLE Websites -- All DOE Office Websites (Extended Search)

TOF Profile function used at POWGEN: TOF Profile function used at POWGEN: Powgen uses a TOF profile function which is a variation on the standard profile function originally derived by VonDreele, Jorgensen and Windsor (VonDreele RB, Jorgensen JD and Windsor CG, "Rietveld Refinement with Spallation Neutron Powder Diffraction Data", J. Appl. Cryst. 15, 581 (1982). This function is implemented in GSAS (profile function 3, 4 & 5) and Fullprof NPROF 9 and is most applicable to diffractometers viewing ambient polyethylene or water moderators. The POWGEN diffractometer, however, views a poisoned cryogenic H 2 (liquid) moderator. The variation in peak shape and peak position with TOF (or d-spacing d) is calculated using a more complex function related to thermal and epithermal components of the neutron spectrum that was

372

T-601: Windows Kernel win32k.sys Lets Local Users Gain Elevated Privileges  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

01: Windows Kernel win32k.sys Lets Local Users Gain Elevated 01: Windows Kernel win32k.sys Lets Local Users Gain Elevated Privileges T-601: Windows Kernel win32k.sys Lets Local Users Gain Elevated Privileges April 13, 2011 - 5:12am Addthis PROBLEM: Windows Kernel win32k.sys Lets Local Users Gain Elevated Privileges PLATFORM: Windows XP Service Pack 3, Windows XP Professional x64 Edition Service Pack 2, Windows Server 2003 Service Pack 2, Windows Server 2003 x64 Edition Service Pack 2, Windows Server 2003 with SP2 for Itanium-based Systems, Windows Vista Service Pack 1 and Windows Vista Service Pack 2, Windows Vista x64 Edition Service Pack 1 and Windows Vista x64 Edition Service Pack 2, Windows Server 2008 for 32-bit Systems and Windows Server 2008 for 32-bit Systems Service Pack 2*, Windows Server 2008 for x64-based Systems

373

Rangeland - plant responses to elevated CO{sub 2}. Final report, October 1988--October 1993  

SciTech Connect

Research is described on plant (tallgrass) response to elevated carbon dioxide. Variables addressed include biomass production, as well as water use efficiency, photosynthetic capacity, decomposition, nutrient cycling, and forage quality.

NONE

1997-05-01T23:59:59.000Z

374

Vertical Dispersion from Surface and Elevated Releases: An Investigation of a Non-Gaussian Plume Model  

Science Conference Proceedings (OSTI)

The vertical diffusion of a passive tracer released from surface and elevated sources in a neutrally stratified boundary layer has been studied by comparing field and laboratory experiments with a non-Gaussian K-theory model that assumes power-...

Michael J. Brown; S. Pal Arya; William H. Snyder

1993-03-01T23:59:59.000Z

375

A Proposed Standard Fog Collector for Use in High-Elevation Regions  

Science Conference Proceedings (OSTI)

The collection of fog droplets by vegetation is an important wet deposition process. It can, in fact, dominate the chemical and hydrological input to certain high elevation watersheds. However, measurements of fog deposition are rarely made and, ...

Robert S. Schemenauer; Pilar Cereceda

1994-11-01T23:59:59.000Z

376

T-591: VMware vmrun Utility Lets Local Users Gain Elevated Privileges |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1: VMware vmrun Utility Lets Local Users Gain Elevated 1: VMware vmrun Utility Lets Local Users Gain Elevated Privileges T-591: VMware vmrun Utility Lets Local Users Gain Elevated Privileges March 30, 2011 - 3:05pm Addthis PROBLEM: A vulnerability was reported in VMware. A local user can obtain elevated privileges on the target system. PLATFORM: VMware Workstation 6.5.5 and 7.1.3 and prior; VIX API for Linux 1.10.2 and prior ABSTRACT: The VMware vmrun utility is susceptible to a local privilege escalation in non-standard configurations. reference LINKS: VM Advisory ID:VMSA-2011-0006 Secunia Advisory: SA43885 SecurityTracker Alert ID: 1025270 CVE-2011-1126 VM Post IMPACT ASSESSMENT: Medium Discussion: A security issue has been reported in VMware Workstation, which can be exploited by malicious, local users to gain potentially escalated

377

U-092: Sudo Format String Bug Lets Local Users Gain Elevated Privileges |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2: Sudo Format String Bug Lets Local Users Gain Elevated 2: Sudo Format String Bug Lets Local Users Gain Elevated Privileges U-092: Sudo Format String Bug Lets Local Users Gain Elevated Privileges January 31, 2012 - 5:45am Addthis PROBLEM: A vulnerability was reported in Sudo. A local user can obtain elevated privileges on the target system. PLATFORM: Linux (Any) Version(s): 1.8.0 - 1.8.3p1 ABSTRACT: A local user can supply a specially crafted command line argument to trigger a format string flaw and execute arbitrary commands on the target system with root privileges. reference LINKS: CVE-2012-0809 SecurityTracker Alert ID: 1026600 Vendor Site IMPACT ASSESSMENT: Medium Discussion: The vulnerability resides in the sudo_debug() function in 'src/sudo.c'. This can be exploited by local users, regardless of whether they are listed

378

Property:Building/SPBreakdownOfElctrcityUseKwhM2Elevators | Open Energy  

Open Energy Info (EERE)

Elevators Elevators Jump to: navigation, search This is a property of type String. Elevators Pages using the property "Building/SPBreakdownOfElctrcityUseKwhM2Elevators" Showing 25 pages using this property. (previous 25) (next 25) S Sweden Building 05K0001 + 0.0 + Sweden Building 05K0002 + 0.139664804469 + Sweden Building 05K0003 + 5.78356533453 + Sweden Building 05K0004 + 0.0116959064327 + Sweden Building 05K0005 + 0.0 + Sweden Building 05K0006 + 0.0 + Sweden Building 05K0007 + 0.699648105982 + Sweden Building 05K0008 + 0.192307692308 + Sweden Building 05K0009 + 0.0661775284132 + Sweden Building 05K0010 + 0.0 + Sweden Building 05K0011 + 0.0 + Sweden Building 05K0012 + 0.0 + Sweden Building 05K0013 + 0.163674492353 + Sweden Building 05K0014 + 2.7497571546 +

379

Direct Calculation of Thermodynamic Wet-Bulb Temperature as a Function of Pressure and Elevation  

Science Conference Proceedings (OSTI)

A simple analytical method was developed for directly calculating the thermodynamic wet-bulb temperature from air temperature and the vapor pressure (or relative humidity) at elevations up to 4500 m above MSL was developed. This methodology was ...

Sayed-Hossein Sadeghi; Troy R. Peters; Douglas R. Cobos; Henry W. Loescher; Colin S. Campbell

2013-08-01T23:59:59.000Z

380

Finestructure of Elevated Stable Layers Observed by Sounder and In Situ Tower Sensors  

Science Conference Proceedings (OSTI)

A study of the finestructure within elevated stable atmospheric layers is described. The observational program consisted of measurements made with fast-response turbulence sensors on a carriage traversing a 300 m tower and comparison of the ...

E. E. Gossard; J. E. Gaynor; R. J. Zamora; W. D. Neff

1985-10-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Spatial and Elevational Variations of Summer Rainfall in the Southwestern United States  

Science Conference Proceedings (OSTI)

This study examines the spatial variability of mean monthly summer rainfall in the southwestern United States, with special attention given to the effect elevation. Rain gauge data from a consistent 60-yr period show that mean rainfall increases ...

JenD. Michaud; Brian A. Auvine; Olga C. Penalba

1995-12-01T23:59:59.000Z

382

Surface Pressure Response to Elevated Tidal Heating Sources: Comparison of Earth and Mars  

Science Conference Proceedings (OSTI)

Modern atmospheric tidal theory has shown that the dominance of the terrestrial semidiurnal surface pressure oscillation, relative to its diurnal counterpart, is the result of the elevated heating source generated by solar heating of ...

Richard W. Zurek

1980-05-01T23:59:59.000Z

383

Reclaiming residual space from elevated transport infrastructure : time, space, and activity under the Chicago Brown Line  

E-Print Network (OSTI)

This thesis studies the non-transport functions of the residual space generated by elevated transport infrastructure and its relationship with abutting neighborhoods The space under the Chicago Brown Line, among all other ...

Su, Jing, S.M. Massachusetts Institute of Technology

2005-01-01T23:59:59.000Z

384

Direct Calculation of Thermodynamic Wet Bulb Temperature as a Function of Pressure and Elevation  

Science Conference Proceedings (OSTI)

A simple analytical method was developed for directly calculating the thermodynamic wet bulb temperature from air temperature and the vapor pressure (or relative humidity) at any desired elevation. This methodology was based on the fact that the ...

Sayed-Hossein Sadeghi; Troy R. Peters; Douglas R. Cobos; Henry W. Loescher; Colin S. Campbell

385

T-601: Windows Kernel win32k.sys Lets Local Users Gain Elevated...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

obtain elevated privileges on the target system. A local user can trigger a use-after free or null pointer dereference to execute arbitrary commands on the target system with...

386

A Technique for Eliminating Water Returns from Lidar Beach Elevation Surveys  

Science Conference Proceedings (OSTI)

Airborne light detecting and ranging (lidar) systems can survey hundreds of kilometers of shoreline with high spatial resolution (several elevation estimates per square meter). Sequential surveys yield spatial change maps of beach and dune sand ...

Marissa L. Yates; R. T. Guza; Roberto Gutierrez; Richard Seymour

2008-09-01T23:59:59.000Z

387

State electricity profiles, March 1999  

SciTech Connect

Due to the role electricity plays in the Nation`s economic and social well-being, interested parties have been following the electric power industry`s transition by keeping abreast of the restructuring and deregulation events that are taking place almost daily. Much of the attention centers around the States and how they are restructuring the business of electricity supply within their respective jurisdictions. This report is designed to profile each State and the District of Columbia regarding not only their current restructuring activities, but also their electricity generation and concomitant statistics from 1986 through 1996. Included are data on a number of subject areas including generating capability, generation, revenues, fuel use, capacity factor for nuclear plants, retail sales, and pollutant emissions. Although the Energy Information Administration (EIA) publishes this type of information, there is a lack of a uniform overview for each individual State. This report is intended to help fill that gap and also to serve as a framework for more detailed studies. In addition to basic statistics in tables and graphs, a textual section is provided for each State, discussing some of the points relative to electricity production that are noteworthy in, or unique to, that particular State. Also, each State is ranked according to the place it holds, as compared to the rest of the states, in various relevant areas, such as its average price of electricity per kilowatthour, its population, and its emissions of certain atmospheric pollutants. The final chapter covers the Nation as a whole. 451 figs., 520 tabs.

1999-03-01T23:59:59.000Z

388

Evaluation of Constant Elevated pH Demonstration at Comanche Peak Steam Electric Station  

Science Conference Proceedings (OSTI)

Laboratory data and limited field experience suggest that constant elevated pH, when optimized, will reduce the release of corrosion products from ex-core pressurized water reactor (PWR) surfaces and therefore the amount transported and deposited on fuel assemblies. However, the impact of elevated pH and higher lithium concentrations required to achieve the desired pH must first be evaluated and then demonstrated prior to widespread industry application. This interim report summarizes the results of oper...

2005-03-23T23:59:59.000Z

389

Soil Carbon Dynamics Along an Elevation Gradient in the Southern Appalachian Mountains  

Science Conference Proceedings (OSTI)

The role of soil C dynamics in the exchange of CO{sub 2} between the terrestrial biosphere and the atmosphere is at the center of many science questions related to global climate change. The purpose of this report is to summarize measured trends in environmental factors and ecosystem processes that affect soil C balance along elevation gradients in the southern Appalachian Mountains of eastern Tennessee and western North Carolina, USA. Three environmental factors that have potentially significant effects on soil C dynamics (temperature, precipitation, and soil N availability) vary in a predictable manner with altitude. Forest soil C stocks and calculated turnover times of labile soil C increase with elevation, and there is an apparent inverse relationship between soil C storage and mean annual temperature. Relationships between climate variables and soil C dynamics along elevation gradients must be interpreted with caution because litter chemistry, soil moisture, N availability, and temperature are confounded; all potentially interact in complex ways to regulate soil C storage through effects on decomposition. Some recommendations are presented for untangling these complexities. It is concluded that past studies along elevation gradients have contributed to a better but not complete understanding of environmental factors and processes that potentially affect soil C balance. Furthermore, there are advantages linked to the use of elevation gradients as an approach to climate change research when hypotheses are placed in a strong theoretical or mechanistic framework. Climate change research along elevation gradients can be both convenient and economical. More importantly, ecosystem processes and attributes affecting soil C dynamics along elevation gradients are usually the product of the long-term interactions between climate, vegetation, and soil type. Investigations along elevation gradients are a useful approach to the study of environmental change, and its effect on soil processes, which can complement data obtained from controlled, large-scale, field experiments as well as other empirical and theoretical approaches to climate change research.

Garten Jr., C.T.

2004-04-13T23:59:59.000Z

390

Armstrong PepsiCo Teaming Profile  

NLE Websites -- All DOE Office Websites (Extended Search)

Armstrong International, Inc. Pepsi Beverages Company Armstrong International, Inc. Pepsi Beverages Company 816 Maple Street 1 Pepsi Way Three Rivers, MI 49093 Somers, NY 10589 Business: Steam, Air & Hot Water Utility Systems Business: Beverage Bottling Cam Spence Rob Turner Director of Global Food Markets Engineering Director 269-279-3149 914-767-7763 cam@armstronginternational.com Rob.Turner@pepsiamericas.com Armstrong's Complete Thermal Exchange (CTE) technology reduces natural gas consumed by Pepsi Americas by 37% and reduces CO 2 emissions by 4,125 tons/year Project Scope Using CTE technology, Armstrong designed, engineered, and turnkey installed Flo-Direct gas-fired hot water heating systems to complete can/bottle warmer optimizations on thirteen production lines at eight Pepsi facilities.

391

Genetic and tabu search approaches for optimizing the hall call-Car allocation problem in elevator group systems  

Science Conference Proceedings (OSTI)

The most common problem in vertical transportation using elevator group appears when a passenger wants to travel from a floor to other different floor in a building. The passenger makes a hall call by pressing a landing call button installed at the floor ... Keywords: Car dispatching, Elevator, Elevator group system, Genetic algorithm, Lift, Tabu search, Vertical transportation

Berna Bolat; Pablo Corts

2011-03-01T23:59:59.000Z

392

Performance Profiles of Major Energy Producers 1993  

Gasoline and Diesel Fuel Update (EIA)

3) 3) Distribution Category UC-950 Performance Profiles of Major Energy Producers 1993 Energy Information Administration Office of Energy Markets and End Use U.S. Department of Energy Washington, DC 20585 Energy Information Administration/ Performance Profiles of Major Energy Producers 1993 ii This report was prepared by the Energy Information Administration, the independent statistical and analytical agency within the Department of Energy. The information contained herein should not be construed as advocating or reflecting any policy position of the Department of Energy or any other organization. Energy Information Administration/ Performance Profiles of Major Energy Producers 1993 iii The Financial Reporting System, 1977-1993 diskette is available from the Energy Information Administration.

393

Electromagnetic Profiling Techniques | Open Energy Information  

Open Energy Info (EERE)

Electromagnetic Profiling Techniques Electromagnetic Profiling Techniques Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Technique: Electromagnetic Profiling Techniques Details Activities (0) Areas (0) Regions (0) NEPA(0) Exploration Technique Information Exploration Group: Geophysical Techniques Exploration Sub Group: Electrical Techniques Parent Exploration Technique: Ground Electromagnetic Techniques Information Provided by Technique Lithology: Rock composition, mineral and clay content Stratigraphic/Structural: Detection of permeable pathways, fracture zones, faults Hydrological: Resistivity influenced by porosity, grain size distribution, permeability, fluid saturation, fluid type and phase state of the pore water Thermal: Resistivity influenced by temperature

394

Vertical Seismic Profiling | Open Energy Information  

Open Energy Info (EERE)

Vertical Seismic Profiling Vertical Seismic Profiling Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Technique: Vertical Seismic Profiling Details Activities (4) Areas (3) Regions (1) NEPA(0) Exploration Technique Information Exploration Group: Downhole Techniques Exploration Sub Group: Borehole Seismic Techniques Parent Exploration Technique: Borehole Seismic Techniques Information Provided by Technique Lithology: Rock unit density influences elastic wave velocities. Stratigraphic/Structural: Structural geology- faults, folds, grabens, horst blocks, sedimentary layering, discontinuities, etc. Hydrological: Combining compressional and shear wave results can indicate the presence of fluid saturation in the formation. Thermal: High temperatures and pressure impact the compressional and shear wave velocities.

395

Electrical Profiling Configurations | Open Energy Information  

Open Energy Info (EERE)

Electrical Profiling Configurations Electrical Profiling Configurations Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Technique: Electrical Profiling Configurations Details Activities (0) Areas (0) Regions (0) NEPA(0) Exploration Technique Information Exploration Group: Geophysical Techniques Exploration Sub Group: Electrical Techniques Parent Exploration Technique: Direct-Current Resistivity Survey Information Provided by Technique Lithology: Rock composition, mineral and clay content Stratigraphic/Structural: Detection of permeable pathways, fracture zones, faults Hydrological: Resistivity influenced by porosity, grain size distribution, permeability, fluid saturation, fluid type and phase state of the pore water Thermal: Resistivity influenced by temperature

396

PHOTOSYNTHESIS AND RESOURCE ALLOCATION OF THREE MOJAVE DESERT GRASSES IN RESPONSE TO ELEVATED ATMOSPHERIC CO2  

DOE Green Energy (OSTI)

Gas exchange, biomass and N allocation were compared among three Mojave Desert grasses representing different functional types to determine if photosynthetic responses and the associated allocation of resources within the plant changed after prolonged exposure to elevated CO{sub 2}. Leaf gas exchange characteristics were measured for Bromus madritensis ssp. rubens (C{sub 3} invasive annual), Achnatherum hymenoides (C{sub 3} native perennial) and Pleuraphis rigida (C{sub 4} native perennial) exposed to 360 {micro}mol mol{sup -1} (ambient) and 1000 {micro}mol mol{sup -1} (elevated) CO{sub 2} concentrations in a glasshouse experiment, and tissue biomass and total N pools were quantified from three harvests during development. The maximum rate of carboxylation by the N-rich enzyme Rubisco (Vc{sub max}), which was inferred from the relationship between net CO{sub 2} assimilation (A{sub net}) and intracellular CO{sub 2} concentration (c{sub i}), declined in the C{sub 3} species Bromus and Achnatherum across all sampling dates, but did not change at elevated CO{sub 2} for the C{sub 4} Pleuraphis. Whole plant N remained the same between CO{sub 2} treatments for all species, but patterns of allocation differed for the short- and long-lived C{sub 3} species. For Bromus, leaf N used for photosynthesis was reallocated to reproduction at elevated CO{sub 2} as inferred from the combination of lower Vc{sub max} and N per leaf area (NLA) at elevated CO{sub 2}, but similar specific leaf area (SLA, cm{sup 2} g{sup -1}), and of greater reproductive effort (RE) for the elevated CO{sub 2} treatment. Vc{sub max}, leaf N concentration and NLA declined for the perennial Achnatherum at elevated CO{sub 2} potentially due to accumulation of carbohydrates or changes in leaf morphology inferred from lower SLA and greater total biomass at elevated CO{sub 2}. In contrast, Vc{sub max} for the C{sub 4} perennial Pleuraphis did not change at elevated CO{sub 2}, and tissue biomass and total N were the same between CO{sub 2} treatments. Adjustments in photosynthetic capacity at elevated CO{sub 2} may optimize N allocation of C{sub 3} species in the Mojave Desert, which may influence plant performance and plant-plant interactions of these co-occurring species.

L. A. DEFALCO; C. K. IVANS; P. VIVIN; J. R. SEEMANN; R. S. NOWAK

2004-01-01T23:59:59.000Z

397

A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.

2008-06-01T23:59:59.000Z

398

Blood proteolytic activity elevation and plasma protein degradation in spontaneously hypertensive rat models  

E-Print Network (OSTI)

lymphoblastoid cell lines (LCLs) derived from individualsby profiling gene expression in LCLs derived from livingsubjects. LCLs derived from (1) three monozygotic twin pairs

Chow, Jason C

2011-01-01T23:59:59.000Z

399

Natural gas annual 1992: Supplement: Company profiles  

SciTech Connect

The data for the Natural Gas Annual 1991 Supplement : Company Profiles are taken from Form EIA-176, (open quotes) Annual Report of Natural and Supplemental Gas Supply and Disposition (close quotes). Other sources include industry literature and corporate annual reports to shareholders. The companies appearing in this report are major interstate natural gas pipeline companies, large distribution companies, or combination companies with both pipeline and distribution operations. The report contains profiles of 45 corporate families. The profiles describe briefly each company, where it operates, and any important issues that the company faces. The purpose of this report is to show the movement of natural gas through the various States served by the 45 large companies profiled.

Not Available

1994-01-01T23:59:59.000Z

400

An Autonomous Doppler Sodar Wind Profiling System  

Science Conference Proceedings (OSTI)

An autonomous Doppler sodar wind profiling system has been designed, built, tested, and then deployed for 2 years at a remote site in Coats Land, Antarctica. The system is designed around a commercially available phased-array sodar (a Scintec ...

Philip S. Anderson; Russell S. Ladkin; Ian A. Renfrew

2005-09-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Equatorial Velocity Profiles. Part II: Zonal Component  

Science Conference Proceedings (OSTI)

Vertical profiles of horizontal velocity made along 53E in the western Indian Ocean, during and after he onset of the southwest monsoon in 1976, show features in zonal velocity of relatively small vertical scale. Persistence of the features over ...

Kathleen O'Neill; James R. Luyten

1984-12-01T23:59:59.000Z

402

Diabatic Heating Profiles in Recent Global Reanalyses  

Science Conference Proceedings (OSTI)

Diabatic heating profiles are extremely important to the atmospheric circulation in the tropics and therefore to the earths energy and hydrological cycles. However, their global structures are poorly known because of limited information from in ...

Jian Ling; Chidong Zhang

2013-05-01T23:59:59.000Z

403

load profile | OpenEI Community  

Open Energy Info (EERE)

load profile Home Sfomail's picture Submitted by Sfomail(48) Member 17 May, 2013 - 13:03 Commercial and Residential Hourly Load Data Now Available on OpenEI building load building...

404

Miami Dade County Public School Financing Profile  

NLE Websites -- All DOE Office Websites (Extended Search)

Profile of Success Miami-Dade County Public Schools Miami-Dade County Public Schools-Stats at a Glance Finance Vehicle Tax-exempt lease purchase agreement (via master lease)...

405

The Colorado Wind-Profiling Network  

Science Conference Proceedings (OSTI)

Remote sensing instrumentation has advanced to the point where serious consideration is being given to a next-generation tropospheric sounding system that uses radars and radiometers to provide profiles of tropospheric variables continuously and ...

R. G. Strauch; D. A. Merritt; K. P. Moran; K. B. Earnshaw; D. Van De Kamp

1984-03-01T23:59:59.000Z

406

Analytic Representations of Standard Atmosphere Temperature Profiles  

Science Conference Proceedings (OSTI)

Analytic functions which approximate six commonly used standard temperature profiles (the AFGL set, and the 1976 U.S. Standard) are described. These provide a uniform way of rounding off the sharp corners of the original models, and have been ...

Stephen B. Fels

1986-01-01T23:59:59.000Z

407

Quantitative Interpretation of Laser Ceilometer Intensity Profiles  

Science Conference Proceedings (OSTI)

The authors have used a commercially available laser ceilometer to measure vertical profiles of the optical extinction in rain. This application requires special signal processing to correct the raw data for the effects of receiver noise, high-...

R. R. Rogers; M-F. Lamoureux; L. R. Bissonnette; R. M. Peters

1997-06-01T23:59:59.000Z

408

Equatorial Velocity Profiles. Part I: Meridional Component  

Science Conference Proceedings (OSTI)

A time series or vertical profiles of horizontal velocity was collected in the western equatorial Indian Ocean during late spring of 1976. The meridional velocity component is examined here, the zonal component in Part II of this paper. The ...

Kathleen O'Neill

1984-12-01T23:59:59.000Z

409

Definition: Vertical Seismic Profiling | Open Energy Information  

Open Energy Info (EERE)

Profiling Profiling Jump to: navigation, search Dictionary.png Vertical Seismic Profiling Vertical Seismic Profile (VSP) is a technique of seismic measurements used for high resolution seismic imaging. It can also be used for correlation with surface seismic data providing velocity information and information for processing such as deconvolution parameters. The defining characteristic of a VSP is that the detectors are in a borehole.[1][2][3] View on Wikipedia Wikipedia Definition Also Known As Advanced Borehole Seismology (ABS), Related Terms Seismic Techniques, High Resolution Imaging and Monitoring References ↑ Bob Hardage VSP Principles ↑ High resolution 3D seismic imaging using 3C data from large downhole seismic arrays Paulsson et al. (2004) ↑ Mueller Soroka Paulsson (2010)

410

Standard Ozone Profiles from Balloon and Satellite Data Sets  

Science Conference Proceedings (OSTI)

Standard profiles based on upper level averaged profiles From BUV and lower level averaged profiles from balloon measurements are presented in a parametric representation as a function of time of year and latitude. The representation is a simple ...

K. F. Klenk; P. K. Bhartia; E. Hilsenrath; A. J. Fleig

1983-12-01T23:59:59.000Z

411

A New Parametric Tropical Cyclone Tangential Wind Profile Model  

Science Conference Proceedings (OSTI)

A new parametric tropical cyclone (TC) wind profile model is presented for depicting representative surface pressure profiles corresponding to multiple-maxima wind profiles that exhibit single-, dual-, and triple-maximum concentric-eyewall wind ...

Vincent T. Wood; Luther W. White; Hugh E. Willoughby; David P. Jorgensen

2013-06-01T23:59:59.000Z

412

Terms of Reference Low Profile Groundline Workshops  

E-Print Network (OSTI)

Large whales can be seriously injured or killed by entanglement in fishing gear used in the water off the eastern United States. Entanglement can involve floating rope or lines used to connect pots/traps along the ocean bottom (i.e. groundline). One modification to reduce entanglement in groundline is to lower the profile of groundline to the ocean bottom through the use of sinking/neutrally buoyant line. An alternative gear modification that has been suggested is lowering the profile of groundline to a specified height above the ocean bottom in certain rock, coral or wreck areas where sinking/neutrally buoyant line has been reported to be operationally infeasible. NMFS and others are presently researching low profile groundline issues. Further information is needed on various aspects including what is know about prey distribution, as well as large whale distribution and behaviour, to help assist in discussions regarding low profile groundline. Further specifics are needed on areas and circumstances that make the use of sinking/neutrally buoyant groundline not operationally feasible. Research updates and suggestions on the methods for reducing the profile of groundline are also needed. NMFS has stated previously that considerations for low profile line

unknown authors

2005-01-01T23:59:59.000Z

413

Soil carbon and nitrogen cycling and storage throughout the soil profile in a sweetgum plantation after 11 years of CO2-enrichment  

Science Conference Proceedings (OSTI)

Increased partitioning of carbon (C) to fine roots under elevated [CO2], especially deep in the soil profile, could alter soil C and nitrogen (N) cycling in forests. After more than 11 years of free-Air CO2 enrichment in a Liquidambar styraciflua L. (sweetgum) plantation in Oak Ridge, TN, USA, greater inputs of fine roots resulted in the incorporation of new C (i.e., C with a depleted 13C) into root-derived particulate organic matter (POM) pools to 90-cm depth. Even though production in the sweetgum stand was limited by soil N availability, soil C and N content increased over time, and were greater throughout the soil profile under elevated [CO2] at the conclusion of the experiment. However, greater C inputs under elevated [CO2] did not result in increased net N immobilization or C mineralization rates in long-term laboratory incubations, and did not appear to prime the decomposition of older SOM. The 13CO2 of the C mineralized from the incubated soil closely tracked the 13C of the labile POM pool in the elevated [CO2] treatment, especially in shallower soil, and did not indicate the decomposition of older (i.e., pre-experiment) SOM. While potential C mineralization rates were positively and linearly related to total soil organic matter (SOM) C content in the top 30 cm of soil, this relationship did not hold in deeper soil. Taken together with an increased mean residence time of C in deeper soil pools, these findings indicate that C inputs from relatively deep roots under elevated [CO2] may have increased potential for long-term storage. Expanded representation of biogeochemical cycling throughout the soil profile may improve model projections of future forest responses to rising atmospheric [CO2].

Iversen, Colleen M [ORNL; Keller, Dr. Jason K. [Chapman University; Garten Jr, Charles T [ORNL; Norby, Richard J [ORNL

2012-01-01T23:59:59.000Z

414

Temperature Profile Measurements in a Newly Constructed 30-Stage 5 cm Centrifugal Contactor pilot Plant  

Science Conference Proceedings (OSTI)

An annular centrifugal contactor pilot plant incorporating 30 stages of commercial 5 cm CINC V-02 units has been built and operated at INL during the past year. The pilot plant includes an automated process control and data acquisitioning system. The primary purpose of the pilot plant is to evaluate the performance of a large number of inter-connected centrifugal contactors and obtain temperature profile measurements within a 30-stage cascade. Additional solvent extraction flowsheet testing using stable surrogates is also being considered. Preliminary hydraulic testing was conducted with all 30 contactors interconnected for continuous counter-current flow. Hydraulic performance and system operational tests were conducted successfully but with higher single-stage rotor speeds found necessary to maintain steady interstage flow at flowrates of 1 L/min and higher. Initial temperature profile measurements were also completed in this configuration studying the performance during single aqueous and two-phase counter-current flow at ambient and elevated inlet solution temperatures. Temperature profile testing of two discreet sections of the cascade required additional feed and discharge connections. Lamp oil, a commercially available alkane mixture of C14 to C18 chains, and tap water adjusted to pH 2 were the solution feeds for all the testing described in this report. Numerous temperature profiles were completed using a newly constructed 30-stage centrifugal contactor pilot plant. The automated process control and data acquisition system worked very well throughout testing. Temperature data profiles for an array of total flowrates (FT) and contactor rpm values for both single-phase and two-phase systems have been collected with selected profiles and comparisons reported. Total flowrates (FT) ranged from 0.5-1.4 L/min with rotor speeds from 3500-4000 rpm. Solution inlet temperatures ranging from ambient up to 50 C were tested. Ambient temperature testing shows that a small amount of heat is added to the processed solution by the mechanical energy of the contactors. The temperature profiles match the ambient temperature of the laboratory but are nearly 10 C higher toward the middle of the cascade. Heated input solution testing provides temperature profiles with smaller temperature gradients and are more influenced by the temperature of the inlet solutions than the ambient laboratory temperature. The temperature effects of solution mixing, even at 4000 rpm, were insignificant in any of the studies conducted on lamp oil and water.

Troy G. Garn; Dave H. Meikrantz; Mitchell R. Greenhalgh; Jack D. Law

2008-09-01T23:59:59.000Z

415

U-178: VMware vMA Library Loading Error Lets Local Users Gain Elevated  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

8: VMware vMA Library Loading Error Lets Local Users Gain 8: VMware vMA Library Loading Error Lets Local Users Gain Elevated Privileges U-178: VMware vMA Library Loading Error Lets Local Users Gain Elevated Privileges May 29, 2012 - 7:00am Addthis PROBLEM: A vulnerability was reported in VMware vMA PLATFORM: Version(s): vMA 4.0, 4.1, 5 patch 1 (5.0.0.1) ABSTRACT: A local user can obtain elevated privileges on the target system. Reference Links: SecurityTracker Alert ID: 1027099 CVE-2012-2752 Vendor Advisory IMPACT ASSESSMENT: High Discussion: A local user can exploit a library loading error to cause arbitrary code to be executed on the target system with elevated privileges. Impact: Privilege escalation Solution: The vendor has issued a fix (vSphere Management Assistant 5.0 Patch 2 (5.0.0.2)). Addthis Related Articles T-591: VMware vmrun Utility Lets Local Users Gain Elevated Privileges

416

MicroRNA expression profiling of human breast cancer identifies new markers of tumour subtype  

E-Print Network (OSTI)

Abstract Background MicroRNAs (miRNAs), a class of short non-coding RNAs found in many plants and animals, often act post-transcriptionally to inhibit gene expression. Results Here we report the analysis of miRNA expression in 93 primary human...

Blenkiron, Cherie; Goldstein, Leonard D; Thorne, Natalie P; Spiteri, Inmaculada; Chin, Suet-Feung; Dunning, Mark J; Barbosa-Morais, Nuno L; Teschendorff, Andrew E; Green, Andrew R; Ellis, Ian O; Tavare, Simon; Caldas, Carlos; Miska, Eric A

2007-10-08T23:59:59.000Z

417

LopezPersonalProfile.pdf | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

LopezPersonalProfile.pdf LopezPersonalProfile.pdf More Documents & Publications Wattmanbio.pdf FAQS Reference Guide - Aviation Manager FAQS Reference Guide - Aviation Safety...

418

Profiles in Energy Efficiency Boiler Upgrades Save Money & Energy...  

NLE Websites -- All DOE Office Websites (Extended Search)

State and local government resources Profiles in Energy Efficiency Boiler Upgrades Save Money & Energy: AstraZeneca - Newark This profiles explains how Astrazeneca's Newark...

419

Profiles in Energy Efficiency Boiler Upgrades Save Money & Energy...  

NLE Websites -- All DOE Office Websites (Extended Search)

State and local government resources Profiles in Energy Efficiency Boiler Upgrades Save Money & Energy: Allergan - Westport This profiles explains how Allergan's Westport facility...

420

Profiles in Energy Efficiency Boiler Upgrades Save Money & Energy...  

NLE Websites -- All DOE Office Websites (Extended Search)

State and local government resources Profiles in Energy Efficiency Boiler Upgrades Save Money & Energy: Boeing Philadelphia This profiles explains how Beoing's Philadelphia plant...

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Profiles in Energy Efficiency Boiler Upgrades Save Money & Energy...  

NLE Websites -- All DOE Office Websites (Extended Search)

State and local government resources Profiles in Energy Efficiency Boiler Upgrades Save Money & Energy: Cargill Krefeld This profiles explains how Cargill's Krefeld mill saved...

422

Profiles in Energy Efficiency Boiler Upgrades Save Money & Energy...  

NLE Websites -- All DOE Office Websites (Extended Search)

State and local government resources Profiles in Energy Efficiency Boiler Upgrades Save Money & Energy: GM Marion & Orion This profiles explains how GM's Marion & Orion facilities...

423

Building America Top Innovations Hall of Fame Profile - Basement...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Basement Insulation Systems Building America Top Innovations Hall of Fame Profile - Basement Insulation Systems This Building America Innovations profile describes Building America...

424

EIA - State Electricity Profiles - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

North Dakota Electricity Profile 2010 North Dakota profile. Table 1. 2010 Summary Statistics (North Dakota) Item Value U.S. Rank; NERC Region(s) MRO: Primary Energy ...

425

Elevated Nitrogen Slows Carbon Decay in Forest Soils | U.S. DOE Office of  

NLE Websites -- All DOE Office Websites (Extended Search)

Elevated Nitrogen Slows Carbon Decay in Forest Soils Elevated Nitrogen Slows Carbon Decay in Forest Soils Biological and Environmental Research (BER) BER Home About Research Facilities Science Highlights Searchable Archive of BER Highlights External link Benefits of BER Funding Opportunities Biological & Environmental Research Advisory Committee (BERAC) News & Resources Contact Information Biological and Environmental Research U.S. Department of Energy SC-23/Germantown Building 1000 Independence Ave., SW Washington, DC 20585 P: (301) 903-3251 F: (301) 903-5051 E: sc.ber@science.doe.gov More Information » February 2013 Elevated Nitrogen Slows Carbon Decay in Forest Soils New clues emerge about microbial decomposition mechanisms. Print Text Size: A A A Subscribe FeedbackShare Page Click to enlarge photo. Enlarge Photo

426

V-093: Symantec PGP Desktop Buffer Overflows Let Local Users Gain Elevated  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3: Symantec PGP Desktop Buffer Overflows Let Local Users Gain 3: Symantec PGP Desktop Buffer Overflows Let Local Users Gain Elevated Privileges V-093: Symantec PGP Desktop Buffer Overflows Let Local Users Gain Elevated Privileges February 18, 2013 - 12:53am Addthis PROBLEM: Symantec PGP Desktop Buffer Overflows Let Local Users Gain Elevated Privileges PLATFORM: Symantec PGP Desktop 10.2.x,10.1.x,10.0.x Symantec Encryption Desktop 10.3.0 ABSTRACT: Two vulnerabilities were reported in Symantec PGP Desktop. REFERENCE LINKS: Symantec Security Advisory SYM13-001 Bugtraq ID: 57170 SecurityTracker Alert ID: 1028145 CVE-2012-4351 CVE-2012-4352 IMPACT ASSESSMENT: Medium DISCUSSION: A local user can trigger an integer overflow in 'pgpwded.sys' to execute arbitrary code on the target system [CVE-2012-4351]. On Windows XP and Windows Sever 2003, a local user can trigger a buffer

427

Profiling-as-a-Service: adaptive scalable resource profiling for the cloud in the cloud  

Science Conference Proceedings (OSTI)

Runtime profiling of Web-based applications and services is an effective method to aid in the provisioning of required resources, for monitoring service-level objectives, and for detecting implementation defects. Unfortunately, it is difficult to obtain ... Keywords: application profiling, cloud computing, resource monitoring

Nima Kaviani; Eric Wohlstadter; Rodger Lea

2011-12-01T23:59:59.000Z

428

Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan

2008-09-30T23:59:59.000Z

429

Debugging & Profiling | Argonne Leadership Computing Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

Debugging & Profiling Debugging & Profiling Allinea DDT Core File Settings Determining Memory Use Using VNC with a Debugger bgq_stack gdb Coreprocessor TotalView on BG/Q Systems Performance Tools & APIs Software & Libraries IBM References Intrepid/Challenger/Surveyor Tukey Eureka / Gadzooks Policies Documentation Feedback Please provide feedback to help guide us as we continue to build documentation for our new computing resource. [Feedback Form] Debugging & Profiling Initial setups Core file settings - this page contains some environment variables that allow you to control code file creation and contents. Using VNC with a Debugger - when displaying an X11 client (e.g. Totalview) remotely over the network, interactive response is typically slow. Using the VNC server can often help you improve the situation.

430

DOE Solar Decathlon: News Blog » Profiles  

NLE Websites -- All DOE Office Websites (Extended Search)

Profiles Profiles Below you will find Solar Decathlon news from the Profiles archive, sorted by date. Instrumentation for Dummies Sunday, September 29, 2013 By Alexis Powers If your head spins at the thought of 105 sensors collecting 12 data points every 15 minutes for all 19 houses competing in the U.S. Department of Energy Solar Decathlon 2013, you might want to pay a visit to Miss Barbara. This bodiless mannequin acts as the student liaison for the instrumentation team. Perhaps the steadiest head on the competition site, Miss Barbara helps student decathletes locate the instrumentation trailer when questions arise about measured contests. Photo of a mannequin's head looking out of a construction trailer's window. The unwavering gaze of Miss Barbara serves as a beacon for decathletes who

431

Natural gas annual 1993 supplement: Company profiles  

Science Conference Proceedings (OSTI)

The Natural Gas Annual provides information on the supply and disposition of natural gas to a wide audience including industry, consumers, Federal and State agencies, and educational institutions. This report, the Natural Gas Annual 1993 Supplement: Company Profiles, presents a detailed profile of 45 selected companies in the natural gas industry. The purpose of this report is to show the movement of natural gas through the various States served by the companies profiled. The companies in this report are interstate pipeline companies or local distribution companies (LDC`s). Interstate pipeline companies acquire gas supplies from company owned production, purchases from producers, and receipts for transportation for account of others. Pipeline systems, service area maps, company supply and disposition data are presented.

Not Available

1995-02-01T23:59:59.000Z

432

Bunch Profiling Using a Rotating Mask  

Science Conference Proceedings (OSTI)

The current method for measuring profiles of proton bunches in accelerators is severely lacking. One must dedicate a great deal of time and expensive equipment to achieve meaningful results. A new method to complete this task uses a rotating mask with slots of three different orientations to collect this data. By scanning over the beam in three different directions, a complete profile for each bunch is built in just seconds, compared to the hours necessary for the previous method. This design was successfully tested using synchrotron radiation emitted by SPEAR3. The profile of the beam was measured in each of the three desired directions. Due to scheduled beam maintenance, only one set of data was completed and more are necessary to solve any remaining issues. The data collected was processed and all of the RMS sizes along the major and minor axes, as well as the tilt of the beam ellipse were measured.

Miller, Mitchell; /SLAC /IIT, Chicago

2012-08-24T23:59:59.000Z

433

Commercial Building Profiles | OpenEI  

Open Energy Info (EERE)

Building Profiles Building Profiles Dataset Summary Description This dataset includes simulation results from a national-scale study of the commercial buildings sector. Electric load profiles contain the hour-by-hour demand for electricity for each building. Summary tables describe individual buildings and their overall annual energy performance. The study developed detailed EnergyPlus models for 4,820 different samples in 2003 CBECS. Simulation output is available for all and organized by CBECS's identification number in public use datasets. Three modeling scenarios are available: existing stock (with 2003 historical weather), stock as if rebuilt new (with typical weather), and the stock if rebuilt using maximum efficiency technology (with typical weather). The following reports describe how the dataset was developed:

434

Performance Profiles Table Browser: T-17. Exploration and ...  

U.S. Energy Information Administration (EIA)

EIA FRS Performance Profiles Table Browser. Browse financial data collected from Major Energy Producers.

435

Performance Profiles Table Browser: T-14.Selected U.S ...  

U.S. Energy Information Administration (EIA)

EIA FRS Performance Profiles Table Browser. Browse financial data collected from Major Energy Producers.

436

Performance Profiles Table Browser: T-1. Selected Financial Items  

U.S. Energy Information Administration (EIA)

EIA FRS Performance Profiles Table Browser. Browse financial data collected from Major Energy Producers.

437

Performance Profiles Table Browser: T-15. Oil and Natural Gas ...  

U.S. Energy Information Administration (EIA)

EIA FRS Performance Profiles Table Browser. Browse financial data collected from Major Energy Producers.

438

Beam profiles from multiple aperture sources  

SciTech Connect

Using a rapidly convergent approximation scheme, formulas are given for beam intensity profiles everywhere. In the first approximation, formulas are found for multiple aperture sources, such as a TFTR design, and integrated power for rectangular plates downstream for Gaussian beamlets. This analysis is duplicated for Lorentzian beamlets which should provide a probable upper bound for off-axis loading as Gaussian beamlets provide a probable lower bound. Formulas for beam intensity profiles are found everywhere. In first approximation, formulas are found for downstream intensity of multiple sources and integrated power for rectangular plates.

Whealton, J.H.

1979-02-01T23:59:59.000Z

439

Process for forming retrograde profiles in silicon  

SciTech Connect

A process for forming retrograde and oscillatory profiles in crystalline and polycrystalline silicon. The process consisting of introducing an n- or p-type dopant into the silicon, or using prior doped silicon, then exposing the silicon to multiple pulses of a high-intensity laser or other appropriate energy source that melts the silicon for short time duration. Depending on the number of laser pulses directed at the silicon, retrograde profiles with peak/surface dopant concentrations which vary from 1-1e4 are produced. The laser treatment can be performed in air or in vacuum, with the silicon at room temperature or heated to a selected temperature.

Weiner, Kurt H. (San Jose, CA); Sigmon, Thomas W. (Phoenix, AZ)

1996-01-01T23:59:59.000Z

440

Nonthermal effects on hydrogen-line profiles  

DOE Green Energy (OSTI)

Experimentally determined level populations of hydrogen excited states from a low-density Z pinch are used as initial conditions in a simulation to derive electron-velocity distributions. These velocity distributions show excess electrons in the high velocity end of the distribution when compared to a Maxwellian velocity distribution. The non-Maxwellian velocity distributions are used to find the nonequilibrium structure factors which are a main component in the plasma line broadening of hydrogen lines. The line profiles generated using the structure factors show plasmon satellites on the wings of the Balmer-..cap alpha..- and -..beta..-line profiles.

Lee, R.W.; Morgan, W.L.

1985-07-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

V-115: Apple iOS Bugs Let Local Users Gain Elevated Privileges | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5: Apple iOS Bugs Let Local Users Gain Elevated Privileges 5: Apple iOS Bugs Let Local Users Gain Elevated Privileges V-115: Apple iOS Bugs Let Local Users Gain Elevated Privileges March 20, 2013 - 12:08am Addthis PROBLEM: Apple iOS Bugs Let Local Users Gain Elevated Privileges PLATFORM: Version(s): prior to 6.1.3 ABSTRACT: Several vulnerabilities were reported in Apple iOS REFERENCE LINKS: Apple security Article: HT1222 SecurityTracker Alert ID: 1028314 CVE-2013-0977 CVE-2013-0978 CVE-2013-0979 CVE-2013-0981 IMPACT ASSESSMENT: High DISCUSSION: A local user can exploit a flaw in the handling of Mach-O executable files with overlapping segments to execute unsigned code on the target system [CVE-2013-0977]. A local user can exploit a flaw in the ARM prefetch abort handling to determine the address of structures in the kernel [CVE-2013-0978].

442

Elevated Trace Element Concentrations in Southern Toads, Bufo terrestris, Exposed to Coal Combustion Waste  

E-Print Network (OSTI)

Elevated Trace Element Concentrations in Southern Toads, Bufo terrestris, Exposed to Coal, and behavioral abnormalities in amphibians to coal combustion wastes (coal ash). Few studies, however, have determined trace element concentrations in amphibians exposed to coal ash. In the current study we compare

Hopkins, William A.

443

Elevated voltage level I.sub.DDQ failure testing of integrated circuits  

DOE Patents (OSTI)

Burn in testing of static CMOS IC's is eliminated by I.sub.DDQ testing at elevated voltage levels. These voltage levels are at least 25% higher than the normal operating voltage for the IC but are below voltage levels that would cause damage to the chip.

Righter, Alan W. (Albuquerque, NM)

1996-01-01T23:59:59.000Z

444

A real models laboratory and an elevator model controlled through programmable controller (PLC)  

Science Conference Proceedings (OSTI)

The paper is focused on description of laboratory models that are used in the process of education at our faculty. The models are connected to programmable logical controllers (PLC) and through these equipments the models are controlled. As the first ... Keywords: PLC, automatic control, education, elevator, real control, real equipment models

Tomas Sysala; Ondrej Vrzal

2011-05-01T23:59:59.000Z

445

Hurricane-Generated Depth-Averaged Currents and Sea Surface Elevation  

Science Conference Proceedings (OSTI)

A theory of the depth-averaged currents and sea surface elevation generated by a moving hurricane in a stratified ocean with flat bottom is presented. Using a scale analysis of the depth-integrated momentum and continuity equations, it is found ...

Isaac Ginis; Georgi Sutyrin

1995-06-01T23:59:59.000Z

446

A Simple Analytic Approximation of the Ground-Level Concentration for Elevated Line Sources  

Science Conference Proceedings (OSTI)

By an analytical treatment of the advection-diffusion equation, the upper and lower bounds of the ground-level concentration (glc) have been found for a continuous, elevated line source. These two bounds have been used to construct a Fickian-type ...

Renzo Lupini; Tiziano Tirabassi

1981-05-01T23:59:59.000Z

447

Multi-scale modeling and experimental investigations of geopolymeric gels at elevated temperatures  

Science Conference Proceedings (OSTI)

Geopolymers are an emerging class of cementitious binders formed by aluminum-silica rich activating materials. Experimental results indicate that geopolymer concrete is relatively stable at elevated temperatures, and could be possibly utilized in applications ... Keywords: Geopolymer concrete, High temperature applications, Microstructure characterization, Multi-scale modeling

Kunal Kupwade-Patil, Fernando Soto, Ancy Kunjumon, Erez N. Allouche, Daniela S. Mainardi

2013-06-01T23:59:59.000Z

448

Building Outline Extraction from Digital Elevation Models Using Marked Point Processes  

Science Conference Proceedings (OSTI)

This work presents an automatic algorithm for extracting vectorial land registers from altimetric data in dense urban areas. We focus on elementary shape extraction and propose a method that extracts rectangular buildings. The result is a vectorial land ... Keywords: MCMC, RJMCMC, building detection, dense urban area, digital elevation models, image processing, inhomogeneous Poisson point process, land register, laser data, simulated annealing, stochastic geometry

Mathias Ortner; Xavier Descombes; Josiane Zerubia

2007-04-01T23:59:59.000Z

449

Study of Elevator Safety Performance Test System Based on LabVIEW  

Science Conference Proceedings (OSTI)

The upgrading of China's coal mine detection equipment and technical means are very backward, mainly distributed instruments and devices, low efficiency, poor accuracy, detection and testing of the limitations of the data, testing methods, data-processing ... Keywords: Elevator, LabVIEW, test system

Bingsheng Wu; Chaozhi Cai

2009-11-01T23:59:59.000Z

450

Wavefront reconstruction of elevation circular synthetic aperture aperture radar imagery using a cylindrical Green's function  

Science Conference Proceedings (OSTI)

Elevation Circular Synthetic Aperture Radar (E-CSAR) is a novel radar modality used to form radar images from data sets acquired along a complete or even a segment of a cylindrical geometry above a given scan area. Due to the nonlinear nature of the ...

Daniel Flores-Tapia; Gabriel Thomas; Stephen Pistorius

2010-01-01T23:59:59.000Z

451

http://rcc.its.psu.edu/hpc Low Elevation Aerial Photogrammetry for 3D Reconstructions of  

E-Print Network (OSTI)

-wing aerial photogrammetry. Conducting a topographic survey using laser transits and total stations is time topographic data over large areas. However, in the case of most fixed-wing aerial photographic surveyshttp://rcc.its.psu.edu/hpc Low Elevation Aerial Photogrammetry for 3D Reconstructions

Bjørnstad, Ottar Nordal

452

EFFECTS OF ELEVATED CO2 ON ROOT FUNCTION AND SOIL RESPIRATION IN A MOJAVE DESERT ECOSYSTEM  

DOE Green Energy (OSTI)

Increases in atmospheric CO{sub 2} concentration during the last 250 years are unequivocal, and CO{sub 2} will continue to increase at least for the next several decades (Houghton et al. 2001, Keeling & Whorf 2002). Arid ecosystems are some of the most important biomes globally on a land surface area basis, are increasing in area at an alarming pace (Dregne 1991), and have a strong coupling with regional climate (Asner & Heidebrecht 2005). These water-limited ecosystems also are predicted to be the most sensitive to elevated CO{sub 2}, in part because they are stressful environments where plant responses to elevated CO{sub 2} may be amplified (Strain & Bazzaz 1983). Indeed, all C{sub 3} species examined at the Nevada Desert FACE Facility (NDFF) have shown increased A{sub net} under elevated CO{sub 2} (Ellsworth et al. 2004, Naumburg et al. 2003, Nowak et al. 2004). Furthermore, increased shoot growth for individual species under elevated CO{sub 2} was spectacular in a very wet year (Smith et al. 2000), although the response in low to average precipitation years has been smaller (Housman et al. 2006). Increases in perennial cover and biomass at the NDFF are consistent with long term trends in the Mojave Desert and elsewhere in the Southwest, indicating C sequestration in woody biomass (Potter et al. 2006). Elevated CO{sub 2} also increases belowground net primary production (BNPP), with average increases of 70%, 21%, and 11% for forests, bogs, and grasslands, respectively (Nowak et al. 2004). Although detailed studies of elevated CO{sub 2} responses for desert root systems were virtually non-existent prior to our research, we anticipated that C sequestration may occur by desert root systems for several reasons. First, desert ecosystems exhibit increases in net photosynthesis and primary production at elevated CO{sub 2}. If large quantities of root litter enter the ecosystem at a time when most decomposers are inactive, significant quantities of carbon may be stored belowground in relatively recalcitrant forms. Indeed, a model-based analysis predicted that the arid/semiarid southwestern bioclimatic region had one of the highest rates of net carbon storage in the United States over the past century (Schimel et al. 2000). Second, root systems of desert plants are often extensive (Foxx et al. 1984, Hartle et al. 2006) with relatively large proportions of roots deep in the soil (Schenk & Jackson 2002). Thus, an understanding of belowground processes in desert ecosystems provides information on the potential for terrestrial carbon sequestration in desert ecosystems.

Nowak, Robert S.

2007-12-19T23:59:59.000Z

453

Composition and decomposition of soybean and sorghum tissues grown under elevated atmospheric carbon dioxide  

Science Conference Proceedings (OSTI)

It has been hypothesized that changes in both quantity and quality of plant residue inputs to soils as atmospheric carbon dioxide (CO{sub 2}) concentration increases may alter carbon (C) and nitrogen (N) turnover rates and pool sizes. We determined the effect of elevated atmospheric CO{sub 2} on plant tissue quality, and how modifications in tissue quality affect C and N mineralization. Soybean and sorghum were grown under elevated (704.96 {plus_minus} 0.33 {mu}mol CO{sub 2} mol{sup {minus}1}) and ambient (357.44 {plus_minus} 0.12 {mu}mol CO{sub 2} mol{sup {minus}1}) atmospheric CO{sub 2} in open-top chambers. Leaf and stem tissues were separated form harvested plants and analyzed for C,N, lignin, and cellulose. Tissues were applied to Norfolk loamy sand (fine-loamy, siliceous, thermic Typic Kandiudult) and aerobically incubated for 70-d to determine C and N mineralization, C turnover, relative N mineralization, and C/N mineralized. Elevated CO{sub 2} had no effect on plant residue C concentration, but N concentration of soybean leaves and stems and sorghum stems was reduced; however, CO{sub 2} enrichment increased C/N ratio and lignin concentration for only sorghum stems and soybean leaves, respectively. Source of plant residue (i.e., produced under either elevated or ambient CO{sub 2}) had no impact on soil C turnover, relative N mineralization, cumulative C and N mineralization, and C/N mineralized. These data suggest that increasing atmospheric CO{sub 2} will have little effect on composition or decomposition of field crop residues. Thus, since CO{sub 2} enrichment results in increased photosynthetic C fixation, the possibility exists for increased soil C storage under field crops in an elevated CO{sub 2} world. 29 refs., 4 figs., 4 tabs.

Henning, F.P. [Cooperative Ext. Serv., Dunwoody, GA (United States); Wood, C.W. [Auburn Univ., AL (United States); Rogers, H.H.; Runion, G.B.; Prior, S.A. [National Soil Dynamics Lab., Auburn, AL (United States)

1996-07-01T23:59:59.000Z

454

Reconstruction of Pressure Profile Evolution during  

E-Print Network (OSTI)

of plasma current and plasma pressure profiles from external measurements of the equilibrium magnetic field currents, eddy currents flowing in the vacuum vessel, constant magnetic flux linking the superconductor, and new flux loops located near the hot plasma in order to closely couple to plasma current and dipole

455

A Multisodar Approach to Wind Profiling  

Science Conference Proceedings (OSTI)

This paper presents the development of a multisodar mode from a five-beam sodar whereby a wind speed vector is found for sets of three acoustic beams. If the vertical beam is used, this mode enables the profiling of four wind speed measurements ...

Paul Behrens; Stuart Bradley; Travis Wiens

2010-07-01T23:59:59.000Z

456

Integrating gene expression profiling and clinical data  

Science Conference Proceedings (OSTI)

We propose a combination of machine learning techniques to integrate predictive profiling from gene expression with clinical and epidemiological data. Starting from BioDCV, a complete software setup for predictive classification and feature ranking without ... Keywords: BioDCV, Biomarkers, Classification, DNA microarray, Feature selection, Functional genomics, SVM, Statistical learning

Silvano Paoli; Giuseppe Jurman; Davide Albanese; Stefano Merler; Cesare Furlanello

2008-01-01T23:59:59.000Z

457

Route profile analysis system and method  

DOE Patents (OSTI)

A system for recording terrain profile information is disclosed. The system accurately senses incremental distances traveled by a vehicle along with vehicle inclination, recording both with elapsed time. The incremental distances can subsequently be differentiated with respect to time to obtain acceleration. The computer acceleration can then be used to correct the sensed inclination.

Mullenhoff, D.J.; Wilson, S.W.

1982-07-29T23:59:59.000Z

458

Profiling Atmospheric Water Vapor by Microwave Radiometry  

Science Conference Proceedings (OSTI)

High-altitude microwave radiometric observations at frequencies near 92 and 183.3 GHz were used to study the potential of retrieving atmospheric water vapor profiles over both land and water. An algorithm based on an extended Kaiman-Bucy filter ...

J. R. Wang; J. L. King; T. T. Wilheit; G. Szejwach; L. H. Gesell; R. A. Nieman; D. S. Niver; B. M. Krupp; J. A. Gagliano

1983-05-01T23:59:59.000Z

459

A study on information wrapper protection profile  

Science Conference Proceedings (OSTI)

How to help the end-users to identify and analyze the attacks in cyberspace has become extremely important to the information security task. Based on the standard of the Information Security Audit and Alarms Framework published by ISO, in this paper ... Keywords: common criteria (CC), information security audit and alarms, protection profile (PP), security assurance, security functional

Kwo-Jean Farn; Shu-Kuo Lin; Jiann-Ming Hwang

2007-04-01T23:59:59.000Z

460

Efficient broadcast encryption with user profiles  

Science Conference Proceedings (OSTI)

Broadcast encryption (BE) deals with secure transmission of a message to a group of users such that only an authorized subset of users can decrypt the message. Some of the most effective BE schemes in the literature are the tree-based schemes of complete ... Keywords: Broadcast encryption, CS scheme, SD scheme, User profiles

Murat Ak; Kamer Kaya; Kaan Onarl?o?lu; Ali Ayd?n Seluk

2010-03-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Using an application profile based service registry  

Science Conference Proceedings (OSTI)

The aim of the JISC Information Environment Service Registry (IESR) is to assist other applications, to discover and devolve materials that match their users' interests in their research, learning and teaching. This paper describes the experience of ... Keywords: application profile, metadata schema, service registry

Ann Apps

2007-08-01T23:59:59.000Z

462

NONPROFIT ORG DETROIT, MI  

E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor

463

Adaptive smoothing of valleys in DEMs using TIN interpolation from ridgeline elevations: An application to morphotectonic aspect analysis  

Science Conference Proceedings (OSTI)

This paper presents a smoothing method that eliminates valleys of various Strahler-order drainage lines from a digital elevation model (DEM), thus enabling the recovery of local and regional trends in a terrain. A novel method for automated extraction ... Keywords: Aspect analysis, Digital drainage analysis, Digital elevation model, Digital terrain modelling, Rose diagram, Smoothing, Tectonic geomorphology

Gyozo Jordan

2007-05-01T23:59:59.000Z

464

A viral system algorithm to optimize the car dispatching in elevator group control systems of tall buildings  

Science Conference Proceedings (OSTI)

Nowadays is very common the presence of tall buildings in the business centres of the main cities of the world. Such buildings require the installation of numerous lifts that are coordinated and managed under a unique control system. Population working ... Keywords: Bio-inspired algorithms, Elevator, Elevator group control system, Lift, Vertical transportation, Viral system

Pablo CortS; Luis Onieva; JesS MuUzuri; Jos Guadix

2013-01-01T23:59:59.000Z

465

The effect of morphological smoothening by reconstruction on the extraction of peaks and pits from digital elevation models  

Science Conference Proceedings (OSTI)

In this paper, the effect of morphological smoothening by reconstruction on the extraction of peaks and pits from digital elevation models (DEMs) is studied. First, a mathematical morphological based algorithm to extract peaks and pits from DEMs is developed. ... Keywords: DEM smoothening, Digital elevation models, Kernel, Morphological smoothening by reconstruction, Peaks and pits

Dinesh Sathyamoorthy

2007-09-01T23:59:59.000Z

466

An experimental and kinetic study of syngas/air combustion at elevated temperatures and the effect of water addition  

E-Print Network (OSTI)

An experimental and kinetic study of syngas/air combustion at elevated temperatures and the effect 20 December 2011 Keywords: Syngas combustion Elevated temperatures Water addition Laminar flame speed a b s t r a c t Laminar flame speeds of premixed syngas/air mixtures were measured at various fuel

Qiao, Li

467

A Database of Herbaceous Vegetation Responses to Elevated Atmospheric CO2  

NLE Websites -- All DOE Office Websites (Extended Search)

Herbaceous Vegetation Responses to Elevated Atmospheric CO2 Herbaceous Vegetation Responses to Elevated Atmospheric CO2 (NDP-073) image Data image PDF file image Contributed by Michael H. Jones Peter S. Curtis Department of Evolution, Ecology, and Organismal Biology The Ohio State University Columbus, Ohio Prepared by Robert M. Cushman and Antoinette L. Brenkert Carbon Dioxide Information Analysis Center Environmental Sciences Division Publication No. 4909 Date Published: November 1999 Prepared for the Environmental Sciences Division Office of Biological and Environmental Research Budget Activity Number KP 12 04 01 0 Prepared by the Carbon Dioxide Information Analysis Center OAK RIDGE NATIONAL LABORATORY Oak Ridge, Tennessee 37831-6290 managed by LOCKHEED MARTIN ENERGY RESEARCH CORP. for the U.S. DEPARTMENT OF ENERGY under contract DE-AC05-96OR22464

468

Elevation angle alignment of quasi optical receiver mirrors of collective Thomson scattering diagnostic by sawtooth measurements  

Science Conference Proceedings (OSTI)

Localized measurements of the fast ion velocity distribution function and the plasma composition measurements are of significant interest for the fusion community. Collective Thomson scattering (CTS) diagnostics allow such measurements with spatial and temporal resolution. Localized measurements require a good alignment of the optical path in the transmission line. Monitoring the alignment during the experiment greatly benefits the confidence in the CTS measurements. An in situ technique for the assessment of the elevation angle alignment of the receiver is developed. Using the CTS diagnostic on TEXTOR without a source of probing radiation in discharges with sawtooth oscillations, an elevation angle misalignment of 0.9 Degree-Sign was found with an accuracy of 0.25 Degree-Sign .

Moseev, D. [FOM DIFFER - Dutch Institute for Fundamental Energy Research, Association EURATOM-FOM, Nieuwegein (Netherlands); Max-Planck-Institut fuer Plasmaphysik, Euratom Association-IPP, 85748 Garching (Germany); Meo, F.; Korsholm, S. B.; Leipold, F.; Michelsen, P. K.; Nielsen, S. K.; Salewski, M.; Stejner, M. [Association EURATOM - DTU, Department of Physics, Technical University of Denmark, Riso Campus, 4000 Roskilde (Denmark); Bindslev, H. [Faculty of Science and Technology, Aarhus University, Ny Munkegade 120, DK-8000 Aarhus C (Denmark); Furtula, V. [Chalmers University of Technology, SE-412 96 Gothenburg (Sweden); Kantor, M. [FOM DIFFER - Dutch Institute for Fundamental Energy Research, Association EURATOM-FOM, Nieuwegein (Netherlands); FZ Juelich GmbH, EURATOM, Trilateral Euregio Cluster, D-52425 Juelich (Germany); Ioffe Institute, RAS, Saint Petersburg 194021 (Russian Federation)

2012-10-15T23:59:59.000Z

469

Response of vegetation to carbon dioxide - sorghum at elevated levels of CO{sub 2}  

SciTech Connect

Enhancement of plant growth is an important effect of the rising concentration of atmospheric CO{sub 2}. Crops vary in response to elevated CO{sub 2}. Growth often appears greater in C{sub 3} plants than in C{sub 4} plants. But relatively little work has been done with C{sub 4} plants, and most of it has been with corn. The few existing C{sub 4} data conflict. Some studies indicate that the yield of C{sub 4} plants at elevated CO{sub 2} is about one-fourth that of C{sub 3} crops, but other studies show that C{sub 4} plants with increased CO{sub 2} yield at a rate the average for all crops.

Burnett, R.B.; Chaudhuri, U.N.; Kanemasu, E.T.; Kirkham, M.B.

1985-12-31T23:59:59.000Z

470

Evaluation of weldment creep and fatigue strength-reduction factors for elevated-temperature design  

SciTech Connect

New explicit weldment strength criteria in the form of creep and fatigue strength-reduction factors were recently introduced into the American Society of Mechanical Engineers Code Case N-47, which governs the design of elevated-temperature nuclear plants components in the United States. This paper provides some of the background and logic for these factors and their use, and it describes the results of a series of long-term, confirmatory, creep-rupture and fatigue tests of simple welded structures. The structures (welded plates and tubes) were made of 316 stainless steel base metal and 16-8-2 weld filler metal. Overall, the results provide further substantiation of the validity of the strength-reduction factor approach for ensuring adequate life in elevated-temperature nuclear component weldments. 16 refs., 7 figs.

Corum, J.M.

1989-01-01T23:59:59.000Z

471

Effects of Vegetation Structure and Elevation on Lower Keys Marsh Rabbit Density  

E-Print Network (OSTI)

The Lower Keys marsh rabbit (Sylvilagus palustris hefneri, LKMR), 1 of 3 subspecies of Sylvilagus palustris, is endemic to the Lower Florida Keys. The LKMR is listed as an endangered species due to predation by feral and free roaming domestic cats (Felis catus) and raccoons (Procyon lotor), road mortality, effects of storm surges, sea level rise, the small declining metapopulation size, and possible habitat loss from hardwood encroachment. The purpose of this study was to determine the current LKMR density on lands managed by the United States Navy, Naval Air Station Key West and evaluate how vegetation structure and patch elevation effect LKMR population density. I conducted fecal pellet counts to determine LKMR density, collected vegetation data using percent composition of ground cover, Robel range pole, and point-centered quarter methods, and obtained data on patch area and elevation. I used simple linear regression to assess the relationship between LKMR density and 9 measured vegetation characteristics, patch area, and patch elevation to determine which variables have an influence on LKMR density and the relationship between them. In my examination of the simple regression models, 6 out of the 11 variables appeared to influence LKMR population density. The average per patch percent composition of nonliving material and grasses, maximum height of vegetation at the range pole, distance to nearest woody vegetation, patch elevation, and visual obstruction readings (VOR) individually accounted for 26.4%, 30.4% , 18.1%, 8.5%, 6.8%, and 1.4% of the variability in LKMR density, respectively. According to the regression models, LKMR density increased in patches with greater amounts of grasses and with greater distance to woody vegetation. Habitat management is vital to the recovery of the LKMR and needs to focus on providing greater amounts of grasses and reducing the amount of woody vegetation encroachment to enhance LKMR population density.

Dedrickson, Angela

2011-12-01T23:59:59.000Z

472

Computational and Experimental Design of Iron-Based Superalloys for Elevated Temperature Applications  

NLE Websites -- All DOE Office Websites (Extended Search)

Design Design of Iron-Based Superalloys for Elevated Temperature Applications Background The Department of Energy's (DOE) Ultra-Supercritical Steam Boiler and Turbines Program calls for an increase of steam temperature, from 593 to 760 degrees Celsius (°C), by the year 2020. The National Energy Technology Laboratory (NETL) is sponsoring projects to improve the thermal efficiency of steam turbines by developing materials

473

AOA Chemistry Diagnostic: Fuel Deposit Source Term Reduction by Elevated pH  

Science Conference Proceedings (OSTI)

This Interim Report documents operating chemistry/radiochemistry data and in some cases shutdown data for selected PWR plants shifting pH control of primary water chemistry to elevated coordinated pH programs. Increasing pH (T) retards steam generator corrosion product release thereby reducing a source term available for deposition on fuel. A subsequent, final report will assess relevance of these on-going pH programs to source term control in axial offset anomaly (AOA) plants.

1999-12-09T23:59:59.000Z

474

Guidelines and procedures for design of Class 1 elevated temperature nuclear system components  

Science Conference Proceedings (OSTI)

This standard provides guidelines and procedures which may be used by the manufacturer in satisfying the requirements given for design of class 1 elevated temperature nuclear system components. Guidance is given regarding planning and control of design analysis. A sequence for calculations is recommended. Methods of analysis, including procedures to account for environmental effects, are given which are acceptable in principle to the owner. A format is provided for use in documentation of design analyses.

Not Available

1986-09-01T23:59:59.000Z

475

The ontogeny of individual vs. stand-level responses to elevated CO[sub 2  

SciTech Connect

Plant species appear to differ widely in terms of growth responses to elevated CO[sub 2]; however, most existing comparative data are limited to observations made early in the ontogeny on plants grown an isolated individuals. We examined growth responses to elevated CO[sub 2] in nine species of herbaceous plants, including three erect annuals (genera included Abutilon, Ambrosia, and Cassia) three grasses (Dactylis, Lolium, Panicum), and three rosette species (Plantago, Rumex, and Taraxacum), each grown as isolated individuals and as dense monocultures in ambient (350 ppm) and 2X ambient (700 ppm) CO[sub 2] atmospheres in a glasshouse over 5-6 mo. Soil texture, depth, and nutrient conditions matched those of waste areas in western Massachusetts. On the basis of non-destructive estimates of leaf area index (LAI), all species exhibited large early growth responses to CO[sub 2], ranging up to 50-120%. However, later in stand ontogeny LAI consistently converged between CO[sub 2] treatments, eventually becoming lower at ambient than at elevated CO[sub 2] in most species. Final total biomass effects at the stand level were in the range of 0-10% enhancements, with no consistent differences among growth forms. Reproductive output was significantly reduced by elevated CO[sub 2] in several species, including some with very high early growth enhancements. Our results strongly suggest that CO[sub 2] effects on early growth of individual plants greatly overestimate longer term effects on species performance and net ecosystem carbon gain.

Thomas, S.C.; Jasienski, M.; Bazzaz, F.A. (Harvard Univ., Cambridge, MA (United States))

1994-06-01T23:59:59.000Z

476

The Effect of Elevated Conductor and Ambient Temperatures on Polymer Insulators  

Science Conference Proceedings (OSTI)

Greater demand for power throughput on new and existing transmission lines will result in conductors being operated at progressively higher temperatures due to increased currents. The effect of these elevated conductor temperatures on polymer suspension insulators attached to the conductor is of concern. The maximum permissible conductor temperature has been generally limited by the maximum allowable conductor sag, which in turn is determined by conductor clearance regulations. Conductor sag is a functio...

2007-10-30T23:59:59.000Z

477

Forest soil carbon inventories and dynamics along an elevation gradient in the southern Appalachian Mountains  

Science Conference Proceedings (OSTI)

Soil organic carbon (SOC) was partitioned between unprotected and protected pools in six forests along an elevation gradient in the southern Appalachian Mountains using two physical methods: flotation in aqueous CaCl{sub 2} (1.4 g/mL) and wet sieving through a 0.053 mm sieve. Both methods produced results that were qualitatively and quantitatively similar. Along the elevation gradient, 28 to 53% of the SOC was associated with an unprotected pool that included forest floor O-layers and other labile soil organic matter (SOM) in various stages of decomposition. Most (71 to 83%) of the C in the mineral soil at the six forest sites was identified as protected because of its association with a heavy soil fraction (> 1.4 g/mL) or a silt-clay soil fraction. Total inventories of SOC in the forests (to a depth of 30 cm) ranged from 384 to 1244 mg C/cm{sup 2}. The turnover time of the unprotected SOC was negatively correlated (r = -0.95, p < 0.05) with mean annual air temperature (MAT) across the elevation gradient. Measured SOC inventories, annual C returns to the forest floor, and estimates of C turnover associated with the protected soil pool were used to parameterize a simple model of SOC dynamics. Steady-state predictions with the model indicated that, with no change in C inputs, the low- (235-335 m), mid- (940-1000 m), and high- (1650-1670 m) elevation forests under study might surrender {approx} 40 to 45% of their current SOC inventory following a 4 C increase in MAT. Substantial losses of unprotected SOM as a result of a warmer climate could have long-term impacts on hydrology, soil quality, and plant nutrition in forest ecosystems throughout the southern Appalachian Mountains.

Garten Jr, Charles T [ORNL; Post, Wilfred M [ORNL; Hanson, Paul J [ORNL; Cooper, Lee W [ORNL

1999-05-01T23:59:59.000Z

478

Assessment of Comanche Peak, Ringhals, and Diablo Canyon Elevated pH Programs  

Science Conference Proceedings (OSTI)

The formation and transport of activated corrosion products within the primary reactor coolant system (RCS) can adversely affect fuel performance, plant operation, and out-of-core radiation fields. Controlling the high temperature pH (pHT) of the Pressurized Water Reactor (PWR) primary circuit can successfully mitigate this process. This report assesses the effects of implementing elevated pH programs to determine the impact of the pH program changes on various plant indicators relating ...

2012-12-20T23:59:59.000Z

479

Performance testing of hydrogen transport membranes at elevated temperatures and pressures.  

DOE Green Energy (OSTI)

The development of hydrogen transport ceramic membranes offers increased opportunities for hydrogen gas separation and utilization. Commercial application of such membranes will most likely take place under conditions of elevated temperature and pressure, where industrial processes producing and or utilizing hydrogen occur, and where such membranes are theoretically expected to have the greatest permeability. Hydrogen separation membrane performance data at elevated temperature is quite limited, and data at elevated pressures is conspicuously lacking. This paper will describe the design, construction, and recent experimental results obtained from a membrane testing unit located at the U.S. Department of Energy's Federal Energy Technology Center (FETC). The membrane testing unit is capable of operating at temperatures up to 900 C and pressures up to 500 psi. Mixed-oxide ceramic ion-transport membranes, fabricated at Argonne National Laboratory (ANL), were evaluated for hydrogen permeability and characterized for surface changes and structural integrity using scanning electron microscopy/X-ray microanalysis (SEM/EDS), X-ray photoelectron spectroscopy (XPS) and atomic force microscopy (AFM), as a function of temperature, pressure, and hydrogen exposure.

Balachandran, U.; Cugini, A. V.; Dorris, S. E.; Fisher, E. P.; Graham, W. J.; Martello, D. V.; Poston, J. A.; Rothenberger, K. S.; Siriwardane, R. W.

1999-06-16T23:59:59.000Z

480

Nitrogen saturation and soil N availability in a high-elevation spruce and fir forest  

Science Conference Proceedings (OSTI)

A field study was conducted during the summer of 1995 to gain abetter understanding of the causes of nitrate (NO{sub 3}-N) leaching and ongoing changes in soil nitrogen (N) availability in high-elevation (1524-2000 m) spruce (Picea rubens) and fir (Abies fraseri) forests of the Great Smoky Mountains National Park, Tennessee and North Carolina, U.S.A. Indicators of soil N availability (total soil N concentrations, extractable NH{sub 4}-N, extractable NO{sub 3}-N, and C/N ratios) were measured in Oa and A horizons at 33 study plots. Dynamic measures included potential net soil N mineralization determined in 12-week aerobic laboratory incubations at 22 C. Potential net nitrification in the A horizon was correlated (r = + 0.83, P < 0.001) with total soil n concentrations. mostmeasures of soil n availability did not exhibit significanttrends with elevation, but there were topographic differences. Potential net soil N mineralization and net nitrification in the A horizon were higher in coves than on ridges. Relative amounts of particulate and organomineral soil organic matter influenced potential net N mineralization and nitrification in the A horizon. Calculations indicate that soil N availability and NO{sub 3}-N leaching in high-elevation spruce and fir forests of the Great Smoky Mountains National Park will increase in response to regional warming.

Garten Jr, Charles T [ORNL

2000-06-01T23:59:59.000Z

Note: This page contains sample records for the topic "mi elevation profile" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

DOE Solar Decathlon: News Blog » Profiles  

NLE Websites -- All DOE Office Websites (Extended Search)

'Profiles' 'Profiles' Instrumentation for Dummies Sunday, September 29, 2013 By Alexis Powers If your head spins at the thought of 105 sensors collecting 12 data points every 15 minutes for all 19 houses competing in the U.S. Department of Energy Solar Decathlon 2013, you might want to pay a visit to Miss Barbara. This bodiless mannequin acts as the student liaison for the instrumentation team. Perhaps the steadiest head on the competition site, Miss Barbara helps student decathletes locate the instrumentation trailer when questions arise about measured contests. Photo of a mannequin's head looking out of a construction trailer's window. The unwavering gaze of Miss Barbara serves as a beacon for decathletes who are searching for answers related to monitored performance-and baked

482

Experiment Profile: MINERvA NAME:  

NLE Websites -- All DOE Office Websites (Extended Search)

Profile: MINERvA Profile: MINERvA NAME: Main Injector Experiment for v-A, or MINERvA ORIGIN OF THE NAME: The Main Injector is the name of the link in the Fermilab accelerator chain that takes protons and accelerates them before "injecting" them in a beamline to hit a target. Nuclear physics uses the term "v-A" as shorthand for atomic number studies. WHAT WILL MINERvA TELL US ABOUT THE WORLD? * MINERvA opens a new window for seeing how matter evolved from simple particles to more complex composites of particles, which eventually created everything you see. * Data from MINERvA provides crucial first steps so that current and future neutrino experiments can answer the following questions: * Were neutrinos key to the evolution of the galaxy by allowing

483

Industrial SSP Partner Teaming Profile SWEPCO Intertape  

NLE Websites -- All DOE Office Websites (Extended Search)

Industrial SPP / Partner Teaming Profile Industrial SPP / Partner Teaming Profile Industrial Partner Intertape Polymer Group 1101 Eagle Springs Rd. Danville, VA 24540 Business: Specialized Polyolefin Plastic/Paper Products Mike Jones Manager of Engineering Phone: 434-797-8359 Email: mbjones@itape.com Service/Product Provider Southwestern Petroleum Corporation 534 N. Main St Fort Worth, TX 76164 Business: High Performance Lubricants Paul J. Dickerson Senior Vice President & COO Phone: 817-348-7275 Email: pjd@swepcousa.com Southwestern Petroleum Corporation (SWEPCO) captures "low-hanging fruit" with superior lubricants for Intertape Polymer Project Scope SWEPCO analyzed four problematic gear boxes at the Intertape Polymer Group facility in Danville, VA, which over-heated and tripped the circuit due to high amperage overload. SWEPCO implemented

484

Performance Profiles of Major Energy Producers 1995  

Gasoline and Diesel Fuel Update (EIA)

5) 5) Distribution Category UC-950 Performance Profiles of Major Energy Producers 1995 January 1997 Energy Information Administration Office of Energy Markets and End Use U.S. Department of Energy Washington, DC 20585 This report was prepared by the Energy Information Administration, the independent statistical and analytical agency within the Department of Energy. The information contained herein should not be construed as advocating or reflecting any policy position of the Department of Energy or any other organization. Energy Information Administration/ Performance Profiles of Major Energy Producers 1995 ii To download the Financial Reporting System 1977-1995 data files, access the Energy Information Center's FTP site, at ftp: //ftp.eia.doe.gov or access the Energy Information Administration's Home Page at http://www.eia.doe.gov.

485

Performance Profiles of Major Energy Producers 1996  

Gasoline and Diesel Fuel Update (EIA)

6) 6) Distribution Category UC-950 Performance Profiles of Major Energy Producers 1996 January 1998 Energy Information Administration Office of Energy Markets and End Use U.S. Department of Energy Washington, DC 20585 This report was prepared by the Energy Information Administration, the independent statistical and analytical agency within the U.S. Department of Energy. The information contained herein should be attributed to the Energy Information Administration and should not be construed as advocating or reflecting any policy position of the Department of Energy or any other organization. Energy Information Administration/ Performance Profiles of Major Energy Producers 1996 ii The Financial Reporting System 1977-1996 data files can be downloaded from the Energy Information

486

Performance Profiles of Major Energy Producers 1997  

Gasoline and Diesel Fuel Update (EIA)

7) 7) Distribution Category UC-950 Performance Profiles of Major Energy Producers 1997 January 1999 Energy Information Administration Office of Energy Markets and End Use U.S. Department of Energy Washington, DC 20585 This report was prepared by the Energy Information Administration, the independent statistical and analytical agency within the U.S. Department of Energy. The information contained herein should be attributed to the Energy Information Administration and should not be construed as advocating or reflecting any policy position of the Department of Energy or any other organization. Energy Information Administration/ Performance Profiles of Major Energy Producers 1997 ii The Financial Reporting System 1977-1997 data files can be downloaded from the Energy Information Administration's

487

Balance Engineering - Eli Lilly Teaming Profile  

NLE Websites -- All DOE Office Websites (Extended Search)

Industrial SPP / Partner Teaming Profile Industrial SPP / Partner Teaming Profile UService/Product Provider Balance Engineering Inc. 3711 East Carmel Drive Carmel, IN 46033 Business: Consulting Engineering Jack F. Staley President Phone: 317-844-3178 Email: HTUjack@balanceeng.comUT U I ndustrial Partner Eli Lilly and Company Lilly Corporate Center Indianapolis, IN 46285 Business: Pharmaceuticals David S. Drzewiecki Group Leader, Energy & Utilities Phone: 317-433-0336 Email: HTUDrzewiecki_David_S@Lilly.comUT Balance Engineering identifies $3 million in energy savings at Lilly facility Project Scope Balance Engineering conducted a facility energy assessment of the Eli Lilly Clinton Laboratories, a large multi-building pharmaceutical campus. The goals of the assessment were to determine the major uses of

488

Profile Guided Load Marking for Memory Renaming  

E-Print Network (OSTI)

Memory operations remain a significant bottleneck in dynamically scheduled pipelined processors, due in part to the inability to statically determine the existence of memory address dependencies. Hardware memory renaming techniques have been proposed which predict which stores a load might be dependent upon. These prediction techniques can be used to speculatively forward a value from a predicted store dependency to a load through a value prediction table; however, these techniques require large and time-consuming hardware tables. In this paper we propose a software-guided approach for identifying dependencies between store and load instructions and the Load Marking (LM) architecture to communicate these dependencies to the hardware. Compiler analysis and profiles are used to find important store/load relationships, and these relationships are identified during execution via hints or an n-bit tag. For those loads that are not marked for renaming, we then use additional profiling inform...

Glenn Reinman; Brad Calder; Dean Tullsen; Gary Tyson; Todd Austin

1998-01-01T23:59:59.000Z

489

Profile-based adaptation for cache decay  

E-Print Network (OSTI)

Cache decay is a leakage-reduction mechanism that puts cache lines that have not been accessed for a specific duration into a lowleakage standby mode. This duration is called the decay interval, and its optimal value varies across applications. This paper describes an adaptation technique that analytically finds the optimal decay interval through profiling, and shows that the most important variables required for finding the optimal decay interval can be estimated using profiling with a reasonable degree of accuracy. Unlike previous methods that attempt to put only dead lines into standby mode, this work explicitly trades off the leakage power saved in putting live lines into standby against its performance and energy costs. It also combines traditional DVS with cache decay using an analysis and obtains results close to what can be obtained with an omniscient choice of per-benchmark optimal decay interval. 1

Karthik Sankaranarayanan

2004-01-01T23:59:59.000Z

490

Analysis Methodology for Industrial Load Profiles  

E-Print Network (OSTI)

A methodology is provided for evaluating the impact of various demand-side management (DSM) options on industrial customers. The basic approach uses customer metered load