Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and… (more)

Yun, Michael




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


Clean Cities: Detroit Clean Cities coalition  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

Detroit Clean Cities Coalition Detroit Clean Cities Coalition The Detroit Clean Cities coalition works with vehicle fleets, fuel providers, community leaders, and other stakeholders to reduce petroleum use in transportation. Detroit Clean Cities coalition Contact Information Aaron Champion 734-585-5720 x23 aaron@cec-mi.org Coalition Website Clean Cities Coordinator Aaron Champion Photo of Aaron Champion Aaron Champion is the Coordinator for Detroit Area Clean Cities and a Project Manager with Clean Energy Coalition, where he works on sustainable transportation solutions. Previously, he served as Programs Representative between the U.S. Department of Energy and the Oklahoma Department of Commerce, where he implemented and monitored more than 70 energy efficiency and alternative fuel vehicle projects. Additionally, Champion provided


Detroit blues women.  

E-Print Network (OSTI)

??ABSTRACT DETROIT BLUES WOMEN by Michael Duggan Murphy August 2011 Advisor: Dr. John J. Bukowczyk Major: History Degree: Doctor of Philosophy "Detroit Blues Women" explores… (more)

Murphy, Michael Duggan



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Detroit: Mapping a New Narrative.  

E-Print Network (OSTI)

??This thesis identifies the attractors of Detroit’s growth and divulges into the cultural, federal, socio-economic and urban deterrents that have afflicted Detroit for the past… (more)

Bedard, Joshua



Detroit as linear city.  

E-Print Network (OSTI)

??Detroit is a city in decline. Through strategic withdrawal into a linear city its main artery -Woodward Avenue- becomes an assembly line that holds different… (more)

Kuys, J.I.



Detroit : open city.  

E-Print Network (OSTI)

??Detroit is often regarded as America's largest city in decline, a metropolis that has failed to recover from an insidious cycle of deindustrialization, racism, suburban… (more)

Berry, Daniel (Daniel Kevin)



Sustaining development in Detroit  

E-Print Network (OSTI)

The intent of this thesis is to propose a strategy for stabilizing and increasing the disparate pieces of development that form the traces of the once great industrial city of Detroit. It focuses primarily on Fordism as a ...

Resnick, Noah Samuel, 1977-



Detroit : open city  

E-Print Network (OSTI)

Detroit is often regarded as America's largest city in decline, a metropolis that has failed to recover from an insidious cycle of deindustrialization, racism, suburban flight and laggard politics. This image of the city ...

Berry, Daniel (Daniel Kevin)



Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


Identifying Detroit: Representing Tension, Conflict, and Hope in Detroit Architecture.  

E-Print Network (OSTI)

??Since the 1950s, Detroit's businesses and residents have been steadily migrating to the suburbs, taking with them much of the cultural, social, and economic diversity… (more)




DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


Reclaiming the Ruin: Detroit's Second Coming?  

E-Print Network (OSTI)

13. 22. Ibid. 23. Solnit, “Detroit Arcadia,” p. 70. Above:2/3 (1977), pp. 3-23. 7. “Detroit. Demolition. Disneyland. :Lot! ” ”12. Rebecca Solnit, “Detroit Arcadia: Exploring the

Moon, Whitney



Detroit: Return of the cityzen.  

E-Print Network (OSTI)

??Detroit has steadily declined as a city since the height of its greatness in the 1950s. Deindustrialization, suburbanization, divisive racism, and disenfranchisement have taken a… (more)

Ratkowski, Eric


Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


PP-221 Detroit Edison Company  

Energy.gov (U.S. Department of Energy (DOE))

Presidential Permit authorizing Detroit Edison Company to construct, operate and maintain electric transmission facilities at the U.S. - Canada border.


The Heidelberg Project - Detroit, Michigan [EDRA / Places Awards, 2004 -- Design  

E-Print Network (OSTI)

The Heidelberg Project — Detroit, Michigan Tyree Guytona kid in a broken family, Detroit artist Tyree Guyton woreWhen Guyton was a child, Detroit burned; he still remembers

Nasar, Jack; Moffat, David



Detroit, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Michigan: Energy Resources Michigan: Energy Resources (Redirected from Detroit, MI) Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.331427°, -83.0457538° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.331427,"lon":-83.0457538,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


City of Detroit - SmartBuildings Detroit Grant Program | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City of Detroit - SmartBuildings Detroit Grant Program City of Detroit - SmartBuildings Detroit Grant Program City of Detroit - SmartBuildings Detroit Grant Program < Back Eligibility Commercial Institutional Local Government Multi-Family Residential State Government Savings Category Heating & Cooling Commercial Heating & Cooling Heating Home Weatherization Commercial Weatherization Sealing Your Home Cooling Other Design & Remodeling Windows, Doors, & Skylights Heat Pumps Appliances & Electronics Commercial Lighting Lighting Insulation Water Buying & Making Electricity Solar Water Heating Wind Maximum Rebate 25% of eligible costs Program Info Expiration Date 06/02/2013 State Michigan Program Type Local Grant Program Provider City of Detroit '''''Note: This program is no longer accepting applications. Check the


Detroit Commuter Hydrogen Project  

Science Conference Proceedings (OSTI)

This project was undertaken to demonstrate the viability of using hydrogen as a fuel in an internal combustion engine vehicle for use as a part of a mass transit system. The advantages of hydrogen as a fuel include renew-ability, minimal environmental impact on air quality and the environment, and potential to reduce dependence on foreign energy sources for the transportation sector. Recognizing the potential for the hydrogen fuel concept, the Southeast Michigan Congress of Governments (SEMCOG) determined to consider it in the study of a proposed regional mass transit rail system for southeast Michigan. SEMCOG wanted to evaluate the feasibility of using hydrogen fueled internal combustion engine (H2ICE) vehicles in shuttle buses to connect the Detroit Metro Airport to a proposed, nearby rail station. Shuttle buses are in current use on the airport for passenger parking and inter-terminal transport. This duty cycle is well suited to the application of hydrogen fuel at this time because of the ability to re-fuel vehicles at a single nearby facility, overcoming the challenge of restricted fuel availability in the undeveloped hydrogen fuel infrastructure. A cooperative agreement between SEMCOG and the DOE was initiated and two H2ICE buses were placed in regular passenger service on March 29, 2009 and operated for six months in regular passenger service. The buses were developed and built by the Ford Motor Company. Wayne County Airport Authority provided the location for the demonstration with the airport transportation contractor, Metro Cars Inc. operating the buses. The buses were built on Ford E450 chassis and incorporated a modified a 6.8L V-10 engine with specially designed supercharger, fuel rails and injectors among other sophisticated control systems. Up to 30 kg of on-board gaseous hydrogen were stored in a modular six tank, 350 bar (5000 psi) system to provide a 150 mile driving range. The bus chassis and body were configured to carry nine passengers with luggage. By collecting fuel use data for the two H2ICE buses, with both written driver logs and onboard telemetry devices, and for two conventional propane-gasoline powered buses in the same service, comparisons of operating efficiency and maintenance requirements were completed. Public opinion about the concept of hydrogen fuel was sampled with a rider survey throughout the demonstration. The demonstration was very effective in adding to the understanding of the application of hydrogen as a transportation fuel. The two 9 passenger H2ICE buses accumulated nearly 50,000 miles and carried 14,285 passengers. Data indicated the H2ICE bus fuel economy to be 9.4 miles/ gallon of gasoline equivalent (m/GGE) compared to the 10 passenger propane-gasoline bus average of 9.8 m/GGE over 32,400 miles. The 23- passenger bus averaged 7.4 m/GGE over 40,700 miles. Rider feedback from 1050 on-board survey cards was overwhelmingly positive with 99.6% indicating they would ride again on a hydrogen powered vehicle. Minimal maintenance was required for theses buses during the demonstration project, but a longer duration demonstration would be required to more adequately assess this aspect of the concept.

Brooks, Jerry; Prebo, Brendan



Transit-Oriented Development in Detroit.  

E-Print Network (OSTI)

??Working with the Detroit Department of Transportation, this project outlines a Transit?Oriented Development (TOD) plan in conjunction with the impending Woodward Avenue Light Rail Train… (more)

De Silva, Lauren; Krueger, Allison; Lee, Angela; Mansoor, Paul



Converging Identities: Islamic Architecture in Detroit.  

E-Print Network (OSTI)

??The development of identity and place within the Detroit Muslim community is explored in this thesis through the creation of an Islamic Center and research… (more)

Chinchilla, Najahyia Luna



Detroit Neighbourhood Stabilization: Burdens Become Assets.  

E-Print Network (OSTI)

??Detroit is just one example of a post-industrial city that has been struggling with the decline of the American industrial economy. In the past 100… (more)

Rutherford, Michael



Detroit Public Lighting Department - Commercial and Industrial...  

Open Energy Info (EERE)

with form History Share this page on Facebook icon Twitter icon Detroit Public Lighting Department - Commercial and Industrial Energy Wise Program This is the approved...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...


DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Where the Heart Is? A Geographic Analysis of Working-class Cultures in Detroit Neighborhoods, 1953  

E-Print Network (OSTI)

Peterson 1954. City of Detroit Election Commission. 1952.Precinct Level. Microfilm. Detroit City Hall. Clawson, Dan.You!" Footnotes 24:1,4. Detroit Metropolitan Area Traffic

Stepan-Norris, Judith; Southworth, Caleb



City of Detroit - SmartBuildings Detroit Green Fund Loan | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City of Detroit - SmartBuildings Detroit Green Fund Loan City of Detroit - SmartBuildings Detroit Green Fund Loan City of Detroit - SmartBuildings Detroit Green Fund Loan < Back Eligibility Commercial Institutional Local Government Multi-Family Residential State Government Savings Category Heating & Cooling Commercial Heating & Cooling Heating Home Weatherization Commercial Weatherization Sealing Your Home Cooling Other Heat Pumps Appliances & Electronics Commercial Lighting Lighting Insulation Design & Remodeling Windows, Doors, & Skylights Water Buying & Making Electricity Energy Sources Solar Water Heating Wind Maximum Rebate 40% of eligible costs, up to $100,000 Program Info Funding Source The American Reinvestment and Recovery Act (ARRA) of 2009; State Energy Program State Michigan Program Type Local Loan Program

Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


“Straight Up Detroit Shit”: Genre, Authenticity, and Appropriation in Detroit Ghettotech.  

E-Print Network (OSTI)

??This thesis is an analysis of the genre of Detroit dance music known as ghettotech based primarily on ethnographic data collected from music producers and… (more)

Mueller, Gavin C.



Detroit politics in a global perspective: a Marxist analysis of the 2009 Detroit mayoral primary.  

E-Print Network (OSTI)

??The 2009 Detroit mayoral primary ballot listed a candidate named D'Artagnon Collier. Collier is a member of the Socialist Equality Party. This thesis analyzes the… (more)

Stephens, Christopher Cody



Detroit Edison Co | Open Energy Information  

Open Energy Info (EERE)

Detroit Edison Co Detroit Edison Co Place Detroit, Michigan Utility Id 5109 Utility Location Yes Ownership I NERC Location RFC NERC RFC Yes Operates Generating Plant Yes Activity Generation Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Activity Retail Marketing Yes Activity Bundled Services Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] SGIC[3] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Detroit Edison Company Smart Grid Project was awarded $83,828,878 Recovery Act Funding with a total project value of $167,657,756.


Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

What&039;s your energypledge? What's your EnergyPledge? 1. Secretary Chu at the Detroit Auto Show Snapshots of the Year in Energy: 12 Awesome Photos from 2012 Day 12: Drive...


Southern California: The Detroit of Electric Cars?  

E-Print Network (OSTI)

University o f An early alternative to an electric car.CALIFORNIA: THE DETROIT O F ELECTRIC CARS? BY A L L E N J .center for producing electric cars? It's a mistake to assume

Scott, Allen J.



Detroit -- Focus: HOPE Center for Advanced Technologies [The Place of Work  

E-Print Network (OSTI)

troubled economic times. In Detroit, an abandoned, 50-year-by Focus: MOPE, a Detroit civil rights organization. CAT's

Bressi, Todd W; Marcus, Galith S



Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Detroit Auto Show 2012 Detroit Auto Show 2012 Detroit Auto Show 2012 Addthis 1 of 10 Energy Secretary Steven Chu with Chrysler Chief Executive Sergio Marchionne. Image: Hantz Leger (Energy Department Contractor) Date taken: 2012-01-10 00:00 2 of 10 Energy Secretary Steven Chu examines the Dodge Dart's four cylinder, 2.4-liter, 184 horsepower engine block. Image: Hantz Leger (Energy Department Contractor) Date taken: 2012-01-10 00:00 3 of 10 Energy Secretary Steven Chu gets behind the wheel of the new 2013 Dodge Dart. Image: Hantz Leger (Energy Department Contractor) Date taken: 2012-01-10 00:00 4 of 10 Energy Secretary Steven Chu examines the interior of the new 2013 Dodge Dart. Image: Hantz Leger (Energy Department Contractor) Date taken: 2012-01-10 00:00 5 of 10 Energy Secretary Steven Chu discusses the latest auto innovations with a


Secretary Chu's Remarks at Detroit Economic Club -- As Prepared for  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Detroit Economic Club -- As Prepared for Detroit Economic Club -- As Prepared for Delivery Secretary Chu's Remarks at Detroit Economic Club -- As Prepared for Delivery January 11, 2012 - 9:30am Addthis Thank you, President Simon, for the introduction. I also want to thank the Detroit Economic Club for hosting me. For more than 75 years, the Detroit Economic Club has promoted thoughtful conversation on the important issues facing Michigan and our country, and I am pleased to be a part of that tradition. Finally, I want to recognize Michigan's congressional delegation for its tireless work on behalf of the state's families and industries. It's an exciting time to be in Detroit, the heart of America's auto industry. Yesterday, I toured the auto show and saw the amazing products that will hit the roads soon. What began more than a century ago as a


Secretary Chu's Remarks at Detroit Economic Club -- As Prepared for  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Chu's Remarks at Detroit Economic Club -- As Prepared for Chu's Remarks at Detroit Economic Club -- As Prepared for Delivery Secretary Chu's Remarks at Detroit Economic Club -- As Prepared for Delivery January 11, 2012 - 9:30am Addthis Thank you, President Simon, for the introduction. I also want to thank the Detroit Economic Club for hosting me. For more than 75 years, the Detroit Economic Club has promoted thoughtful conversation on the important issues facing Michigan and our country, and I am pleased to be a part of that tradition. Finally, I want to recognize Michigan's congressional delegation for its tireless work on behalf of the state's families and industries. It's an exciting time to be in Detroit, the heart of America's auto industry. Yesterday, I toured the auto show and saw the amazing products that will hit the roads soon. What began more than a century ago as a


Like the Last 30 Years Never Happened: Understanding Detroit Rock Music Through Oral History.  

E-Print Network (OSTI)

??This study was conducted to better understand Detroit’s unusual amount of rock music success. From the 1960s on, Detroit has continuously produced some of the… (more)

Schmitt, Jason M.



Detroit to Durban: Black Workers' Common Struggle; Southern Africa/Black America: Same Struggles, Same Fight  

E-Print Network (OSTI)

DETROIT TO DURBAN: BlACK \\\\OOKERS CCM1>N STRUGGLE by Blackearliest parrphlet is Detroit to Durban . Although publishedstrikes of early 1973 and the Detroit riots of 1967 is a bit

Philips, John



The Social Coalition Character of the Democratic and Republican Precinct Cadres in Detroit, 1956-1984  

E-Print Network (OSTI)

Jones, Bryan D. et al. 1986 Detroit, an American city. TheThe Party Coalitions in Detroit in 1956: The Socio-Economicof Party Cadres in Detroit, 1956. Social Characteristics

Eldersveld, Samuel J.



The mechanics of race : the discursive production of Detroit's landscape of difference  

E-Print Network (OSTI)

Development, and Immigrants in Detroit, 1880-1920. Chicago:a Finer City in Postwar Detroit. Baltimore and London: TheRoss. 1985. “The Crisis of Detroit and the Emergence of

Kinney, Rebecca J.




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site



An Ethnographic Study of The Moth Detroit StorySLAM.  

E-Print Network (OSTI)

??The Moth Detroit StorySLAM is one of many storytelling events staged in urban bar environments. Unlike the increasingly aged audiences attending the National Storytelling Festival… (more)

Janssen, Catherine Jo



Environmental Justice and Fish Consumption Advisories on the Detroit River.  

E-Print Network (OSTI)

??The Detroit River serves as a source of recreation, food, transportation and is an international demarcation. Decades of industrial and municipal pollution have threatened this… (more)

Kalkirtz, Victoria; Martinez, Michelle



Wastewater Treatment Comes To Detroit: Law, Politics, Technology And Funding.  

E-Print Network (OSTI)

??Detroit was one of the cities identified by the International Joint Commission as polluting the Great Lakes in contravention of the Boundary Waters Treaty of… (more)

Johnson, Barry Neal



Connecting Culture and Nature in Detroit's Downtown Core: The Design of a Technical College Campus.  

E-Print Network (OSTI)

??This thesis addresses the City of Detroit`s transformation from a thriving center of trade and commerce to its present abandoned state. Due to the decentralization… (more)

Braithwaite, Peter



The mechanics of race : the discursive production of Detroit's landscape of difference.  

E-Print Network (OSTI)

??Positioning Detroit's "post-industrial" landscape as anything but "natural", this work seeks to understand and engage the racialized production of Detroit in the urban spatial imaginary… (more)

Kinney, Rebecca J.



Detroit Public Lighting Department - Residential Energy Wise Program |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Detroit Public Lighting Department - Residential Energy Wise Detroit Public Lighting Department - Residential Energy Wise Program Detroit Public Lighting Department - Residential Energy Wise Program < Back Eligibility Low-Income Residential Multi-Family Residential Residential Savings Category Heating & Cooling Cooling Appliances & Electronics Commercial Lighting Lighting Program Info State Michigan Program Type Utility Rebate Program Rebate Amount CFLs: $2-$10 LED Task Light: $10.00 LED Night light: $1.25 Energy Star Ceiling Fan: $10 Provider Detroit Public Lighting Department The Detroit Public Lighting Department (PLD) offers residential customers rebates for energy efficient lights. In addition, low-income residential customers may qualify for free compact fluorescent lights (CFLs). Specific rebate amounts, equipment requirements, and applications are available on

Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Detroit Edison Company Smart Grid Project | Open Energy Information  

Open Energy Info (EERE)

Detroit Edison Company Detroit Edison Company Country United States Headquarters Location Detroit, Michigan Recovery Act Funding $83,828,878.00 Total Project Value $167,657,756.00 Coverage Area Coverage Map: Detroit Edison Company Smart Grid Project Coordinates 42.331427°, -83.0457538° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NO. DE-FC05-00OR22805; DOE WAIVER DOCKET W(A)-01-012 ORO-764 Petitioner, Detroit Diesel Corporation, has made a timely request for an advance waiver to worldwide rights in...


Section 2: Landscapes of Capital - On Big Beaver Road: Detroit and the Diversity of American Metropolitan Landscapes  

E-Print Network (OSTI)

Center near Ann Arbor, Detroit News, April 12, 2005, p. 8.on Southern Plant,” Detroit News, October 28, 2006, p. 3.Pro?le: Michigan 2005 (Detroit: Southeast Michigan Council

Fishman, Robert



The Detroit Edison Company Smart Grid Demonstration Project | Open Energy  

Open Energy Info (EERE)

The Detroit Edison Company The Detroit Edison Company Country United States Headquarters Location Detroit, Michigan Recovery Act Funding $4,995,271.00 Total Project Value $10,877,258.00 Coordinates 42.331427°, -83.0457538° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


Detroit Public Lighting Department - Commercial and Industrial Energy Wise  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Detroit Public Lighting Department - Commercial and Industrial Detroit Public Lighting Department - Commercial and Industrial Energy Wise Program Detroit Public Lighting Department - Commercial and Industrial Energy Wise Program < Back Eligibility Commercial Industrial Savings Category Heating & Cooling Commercial Heating & Cooling Heating Home Weatherization Commercial Weatherization Cooling Other Sealing Your Home Design & Remodeling Windows, Doors, & Skylights Manufacturing Heat Pumps Appliances & Electronics Commercial Lighting Lighting Insulation Maximum Rebate $50,000 per customer/facility, or 100% of the project cost Program Info State Michigan Program Type Utility Rebate Program Rebate Amount Light Fixtures: $2-$200 Lighting Controls: $0.10-$65 HVAC Equipment: $10-$30/ton Programmable Thermostat: $80 Window Glazing: $0.30/square foot


Detroit Edison Comments on NRC Guidance for Operability Determinations  

E-Print Network (OSTI)

with the Nuclear Energy Institute (NEI) in the preparation of industry comments on the draft revision to NRC Manual Chapter 9900. Detroit Edison appreciates the efforts by NRC staff to update and clarify the guidance for operability determinations and the opportunity to provide comments prior to final issuance. Detroit Edison concurs with the specific comments on the referenced Federal Register notice provided by NEI and the associated recommendation that the NRC continue public dialogue on this topic. Should you have any questions or require additional information, please contact me at (734) 586-4258. Sincerely, Norman K. Peterson

Detroit Edison; Washington D C; Detroit Edison; Has Participated



Revving up the Motor City : targeted neighborhood redevelopment in Detroit  

E-Print Network (OSTI)

This thesis is an analysis of an ambitious redevelopment plan for a two square mile area in the city of Detroit, Michigan. This area is dominated by city-owned vacant lots, which make up half of the neighborhood. The plan, ...

Pauls, Edward, 1977-




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

BY DETROIT DIESEL CORPORATION (DDC) BY DETROIT DIESEL CORPORATION (DDC) FOR ADVANCE WAIVER OF U.S. AND FOREIGN RIGHTS TO INVENTIONS MADE UNDER MODIFICATION 17 TO CONTRACT DEN-3-329 [W(A)93-043] The Petitioner is asking for U.S. and foreign patent rights to all subject inventions made under DOE Contract DEN-3-329, Modification 17, entitled "Adiabetic Diesel Engine Component Development". This entire contract is being funded by DOE, but is being administered by the NASA Lewis Research Center. The entire contract has as its object the successful design, fabrication, and demonstration of five stationary and moving structural monolithic ceramic components in an extremely hostile Low Heat Rejection (LHR) environment. DDC was formed in January 1988 to design, manufacture, and sell diesel engines. It is a joint-venture company 80% owned by



Office of Legacy Management (LM)

* .t-* * .t-* . * * - -. _ _ ,.. .I AIT. 4 NOTES AND COMMENTS REVERE COPPER AR! BRASS DETROIT, MICHIGAN A preliminary (screening) survey was conducted in several areas of the Revere Copper and Brass Facility, 5851 W. Jefferson Street, Detroit, Michigan. The survey was conducted by the ANL Radiological Survey Group on April 22, 1981. The Survey Group, consisting of W. Smith, R. Mundis, K. Flynn (all of ANI), and E. Jascewsky (DOE-CH) met on site with J. Evans (Safety Engineer), D. Tratt (Asst. Engineer), -- M~37~se'Zanak~(Aeth6ds~De!@iFXi%itXiupe~isox$ and E. Betancourt (Personnel Manager) to discuss what information was available concerning the operations that transpired at the facility during the Manhattan Engineering District Atomic Energy Commission (MED/AEC) era. MrYWtisffaliab indicated that


A Look Inside the Detroit Auto Show | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A Look Inside the Detroit Auto Show A Look Inside the Detroit Auto Show A Look Inside the Detroit Auto Show January 12, 2011 - 1:15pm Addthis Kerry Duggan Waking up at 4:30AM is not my idea of fun. But after I witnessed the 6:30AM unveiling of the shiny new Porsche 918 RSR Hybrid at the North American International Auto Show, I got over it. To those who know cars, its lineage is in the #22 Porsche 917 race car, winner of the LeMans in 1971. With a top speed of 140 mph, the new 918 RSR combines the power of a 563-horsepower V-8 engine and a dual inertial flywheel system to produce a total 767-horsepower. On the efficiency side, a Kinetic Energy Recovery System (KERS) allows the two 75-kW flywheels to capture wasted energy when the brakes are applied. The Porsche president said that their goal is to achieve high fuel efficiency in extreme driving


City of Detroit, Michigan (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Detroit Detroit Place Michigan Utility Id 5107 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes Operates Generating Plant Yes Activity Generation Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.1050/kWh Commercial: $0.0994/kWh Transportation: $0.1060/kWh The following table contains monthly sales and revenue data for City of Detroit (Michigan). Month RES REV (THOUSAND $) RES SALES (MWH) RES CONS COM REV (THOUSAND $) COM SALES (MWH) COM CONS IND_REV (THOUSAND $) IND SALES (MWH) IND CONS OTH REV (THOUSAND $) OTH SALES (MWH) OTH CONS TOT REV (THOUSAND $) TOT SALES (MWH) TOT CONS


A Look Inside the Detroit Auto Show | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A Look Inside the Detroit Auto Show A Look Inside the Detroit Auto Show A Look Inside the Detroit Auto Show January 12, 2011 - 1:15pm Addthis Kerry Duggan Waking up at 4:30AM is not my idea of fun. But after I witnessed the 6:30AM unveiling of the shiny new Porsche 918 RSR Hybrid at the North American International Auto Show, I got over it. To those who know cars, its lineage is in the #22 Porsche 917 race car, winner of the LeMans in 1971. With a top speed of 140 mph, the new 918 RSR combines the power of a 563-horsepower V-8 engine and a dual inertial flywheel system to produce a total 767-horsepower. On the efficiency side, a Kinetic Energy Recovery System (KERS) allows the two 75-kW flywheels to capture wasted energy when the brakes are applied. The Porsche president said that their goal is to achieve high fuel efficiency in extreme driving


Conference Program "Detroit, Global City: The Motor City in the World"  

E-Print Network (OSTI)

, Nativism and Citizenship in 1920s Detroit" 12:10-2:00: Lunch Break 3. 2:10-3:40 Getting Beyond "Ruin Porn

Cinabro, David


The struggle for vibrancy : a study of local government intervention in Detroit's inner suburbs  

E-Print Network (OSTI)

Today, many communities located on the periphery of central cities confront traditionally "urban" problems. Detroit's inner suburbs struggle with aging infrastructure, limited governmental capacity, commercial disinvestment, ...

Kohn, Amy J. (Amy Jennifer)



Urban agriculture as a tool for neighborhood fabric repair in post-industrial Detroit.  

E-Print Network (OSTI)

??This thesis focuses on Detroit as a post-industrial city that suffers from abandonment, vacancy, and food security issues. I address this problem through the lens… (more)

Fairbank, Sandra Trubow



African-American and Arab American Muslim communities in the Detroit Ummah.  

E-Print Network (OSTI)

?? This paper provides overview of the two larger Muslim communities in Detroit (African-American and Arab American), their differing views on theology, racism, and women's… (more)

Omanson, Lisa Gail



The Spatial Injustice of Crisis-Driven Neoliberal Urban Restructuring in Detroit.  

E-Print Network (OSTI)

??Struggling to provide basic services due to a dwindling tax base and confronted with significant pockets of vacant land, Detroit has proposed a radical urban… (more)

Clement, Daniel



"Ruin Porn" or the Reality of Ruin?: A Rhetorical Analysis of Andrew Moore's Detroit Disassembled.  

E-Print Network (OSTI)

??Ruin photography, widely called "ruin porn" by critics, is an artistic trend that has entered the conscience of artists and consumers alike. Andrew Moore's Detroit… (more)

Nemeth, Katharine



Spatial And Temporal Relationships Between Blood Lead And Soil Lead Concentrations In Detroit, Michigan.  

E-Print Network (OSTI)

??This study explored variations in child blood lead levels (BLLs) relative to street-side soil lead in Detroit, Michigan. Findings showed that average BLLs steadily decreased… (more)

Bickel, Michael Jonathan



Language Assimilation Today: Bilingualism Persists More Than in the Past, But English Still Dominates  

E-Print Network (OSTI)

Somerset- Hunterdon, NJ Detroit, MI Table 2 Children’s homeSomerset- Hunterdon, NJ Detroit, MI Bergen-Passaic, NJSomerset- Hunterdon, NJ Detroit, MI Appendix Table 2

Alba, Richard


Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Non-traumatic Shoulder Dislocation  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, MI Supervising SectionFord Hospital, 2799 W. Grand Blvd, Detroit, MI 48201. Email

Manteuffel, Jacob




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CORPORATION, FOR AN ADVANCE WAIVER OF CORPORATION, FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN RIGHTS IN SUBJECT INVENTIONS MADE IN THE COURSE OF OR UNDER DEPARTMENT OF ENERGY COOPERATIVE AGREEMENT NO. DE-FC05-00OR22805; DOE WAIVER DOCKET W(A)-01-012 [ORO-764] Petitioner, Detroit Diesel Corporation, has made a timely request for an advance waiver to worldwide rights in Subject Inventions made in the course of or under Department of Energy (DOE) Cooperative Agreement No. DE-FC05-00OR22805. The scope of this work is to develop a commercially viable heavy-duty diesel technology package for truck applications targeted at achieving 50% thermal efficiency and meeting 2007 EPA mandated emissions. This work is sponsored by the Office of Transportation Technologies, Office of Heavy Vehicle Technologies.


City of Detroit Lakes, Minnesota (Utility Company) | Open Energy  

Open Energy Info (EERE)

Minnesota (Utility Company) Minnesota (Utility Company) Jump to: navigation, search Name City of Detroit Lakes Place Minnesota Utility Id 5111 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes ISO MISO Yes Activity Buying Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Area Lights - 100 Watt HPS (Unmetered) Lighting Area Lights - 100 Watt HPS (metered) Lighting Area Lights - 250 Watt HPS (Unmetered) Lighting Area Lights - 250 Watt HPS (metered) Lighting Area Lights - 400 Watt HPS (Unmetered) Lighting Area Lights - 400 Watt HPS (metered) Lighting


Simulation and Visualization of Airside Operations at Detroit Metropolitan Airport  

E-Print Network (OSTI)

In recent years, airline flight delays have been among the most troublesome problems in the national transportation system. Although bad weather has historically been the main cause of delays, a growing reason has been the inability of the nation’s air transport system to efficiently absorb all of the aircraft trying to use limited airspace or trying to take off or land at busy airports. Simulation modeling and visualization can be of substantial help in the efficient design of airport operations, which in turn can mitigate some of the abovementioned capacity problems. This study presents the simulation model and 3D animation of the airside airport operations at Detroit Metro Airport, Romulus, Michigan. The simulation model is developed in STROBOSCOPE (Martinez 1996) and the 3D animation is created using

Copyright Hiam; M. Khoury; Vineet R. Kamat; Vineet R. Kamat; Photios G. Ioannou; Photios G. Ioannou; Hiam M. Khoury; Hiam M. Khoury



City of Detroit (Michigan) EIA Revenue and Sales - May 2008 | Open Energy  

Open Energy Info (EERE)

City of Detroit (Michigan) EIA Revenue and Sales - May 2008 City of Detroit (Michigan) EIA Revenue and Sales - May 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for May 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-05 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-05-01 End Date 2008-06-01 Residential Revenue(Thousand $) 1.4 Residential Sales (MWh) 15.6 Residential Consumers 82 Commercial Revenue(Thousand $) 3889 Commercial Sales (MWh) 38146 Commercial Consumers 121 Other Revenue (Thousand $) 49 Other Sales (MWh) 376 Other Consumers 1 Total Revenue (Thousand $) 3939.4 Total Sales (MWh) 38537.6 Total Consumers 204 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1]


City of Detroit (Michigan) EIA Revenue and Sales - February 2009 | Open  

Open Energy Info (EERE)

City of Detroit for City of Detroit for February 2009. Monthly Electric Utility Sales and Revenue Data Short Name 2009-02 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2009-02-01 End Date 2009-03-01 Residential Revenue(Thousand $) 2.1 Residential Sales (MWh) 22.5 Residential Consumers 78 Commercial Revenue(Thousand $) 4175 Commercial Sales (MWh) 41864 Commercial Consumers 117 Other Revenue (Thousand $) 76.9 Other Sales (MWh) 786 Other Consumers 1 Total Revenue (Thousand $) 4254 Total Sales (MWh) 42672.5 Total Consumers 196 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_February_2009&oldid=12572


City of Detroit (Michigan) EIA Revenue and Sales - December 2008 | Open  

Open Energy Info (EERE)

City of Detroit for City of Detroit for December 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-12 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-12-01 End Date 2009-01-01 Residential Revenue(Thousand $) 1.8 Residential Sales (MWh) 18.3 Residential Consumers 80 Commercial Revenue(Thousand $) 3407 Commercial Sales (MWh) 34836 Commercial Consumers 118 Other Revenue (Thousand $) 38.9 Other Sales (MWh) 376 Other Consumers 1 Total Revenue (Thousand $) 3447.7 Total Sales (MWh) 35230.3 Total Consumers 199 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_December_2008&oldid=19459


City of Detroit (Michigan) EIA Revenue and Sales - August 2008 | Open  

Open Energy Info (EERE)

City of Detroit for City of Detroit for August 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-08 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-08-01 End Date 2008-09-01 Residential Revenue(Thousand $) 1.75 Residential Sales (MWh) 18.6 Residential Consumers 77 Commercial Revenue(Thousand $) 4689 Commercial Sales (MWh) 45432 Commercial Consumers 124 Other Revenue (Thousand $) 51 Other Sales (MWh) 403 Other Consumers 1 Total Revenue (Thousand $) 4741.75 Total Sales (MWh) 45853.6 Total Consumers 202 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_August_2008&oldid=17335


City of Detroit (Michigan) EIA Revenue and Sales - January 2009 | Open  

Open Energy Info (EERE)

City of Detroit for City of Detroit for January 2009. Monthly Electric Utility Sales and Revenue Data Short Name 2009-01 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2009-01-01 End Date 2009-02-01 Residential Revenue(Thousand $) 2.5 Residential Sales (MWh) 27 Residential Consumers 81 Commercial Revenue(Thousand $) 4964 Commercial Sales (MWh) 48160 Commercial Consumers 120 Other Revenue (Thousand $) 63.5 Other Sales (MWh) 513 Other Consumers 1 Total Revenue (Thousand $) 5030 Total Sales (MWh) 48700 Total Consumers 202 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_January_2009&oldid=12026


City of Detroit (Michigan) EIA Revenue and Sales - June 2008 | Open Energy  

Open Energy Info (EERE)

City of Detroit for City of Detroit for June 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-06 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-06-01 End Date 2008-07-01 Residential Revenue(Thousand $) 1.6 Residential Sales (MWh) 17.7 Residential Consumers 77 Commercial Revenue(Thousand $) 4376 Commercial Sales (MWh) 44180 Commercial Consumers 123 Other Revenue (Thousand $) 49 Other Sales (MWh) 386 Other Consumers 1 Total Revenue (Thousand $) 4426.6 Total Sales (MWh) 44583.7 Total Consumers 201 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_June_2008&oldid=16285


City of Detroit (Michigan) EIA Revenue and Sales - July 2008 | Open Energy  

Open Energy Info (EERE)

City of Detroit for City of Detroit for July 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-07 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-07-01 End Date 2008-08-01 Residential Revenue(Thousand $) 1.7 Residential Sales (MWh) 18.1 Residential Consumers 77 Commercial Revenue(Thousand $) 4597 Commercial Sales (MWh) 44891 Commercial Consumers 123 Other Revenue (Thousand $) 52 Other Sales (MWh) 408 Other Consumers 1 Total Revenue (Thousand $) 4650.7 Total Sales (MWh) 45317.1 Total Consumers 201 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from "http://en.openei.org/w/index.php?title=City_of_Detroit_(Michigan)_EIA_Revenue_and_Sales_-_July_2008&oldid=16810"


City of Detroit (Michigan) EIA Revenue and Sales - November 2008 | Open  

Open Energy Info (EERE)

City of Detroit (Michigan) EIA Revenue and Sales - November 2008 City of Detroit (Michigan) EIA Revenue and Sales - November 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for November 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-11 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-11-01 End Date 2008-12-01 Residential Revenue(Thousand $) 1.709 Residential Sales (MWh) 17.18 Residential Consumers 79 Commercial Revenue(Thousand $) 4219 Commercial Sales (MWh) 41796 Commercial Consumers 126 Other Revenue (Thousand $) 38.9 Other Sales (MWh) 376.3 Other Consumers 1 Total Revenue (Thousand $) 4259.609 Total Sales (MWh) 42189.48 Total Consumers 206 Source: Energy Information Administration. Form EIA-826 Database Monthly


City of Detroit (Michigan) EIA Revenue and Sales - March 2008 | Open Energy  

Open Energy Info (EERE)

City of Detroit (Michigan) EIA Revenue and Sales - March 2008 City of Detroit (Michigan) EIA Revenue and Sales - March 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for March 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-03 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-03-01 End Date 2008-04-01 Residential Revenue(Thousand $) 1.4 Residential Sales (MWh) 16 Residential Consumers 81 Commercial Revenue(Thousand $) 3467 Commercial Sales (MWh) 38666 Commercial Consumers 117 Other Revenue (Thousand $) 50 Other Sales (MWh) 455 Other Consumers 1 Total Revenue (Thousand $) 3518.4 Total Sales (MWh) 39137 Total Consumers 199 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1]


Anticipating Detroit : a collection of instruments as a catalyst for recovery  

E-Print Network (OSTI)

The social, political and economic history of Detroit has been inextricably linked to the development of its most dominant industry: automotive manufacturing. This thesis suggests a strategy to overcome the disadvantages ...

Bouwman, Laura Marcella, 1976-



Woodward Avenue, Detroit : a pedestrian zone for a changing downtown retail street  

E-Print Network (OSTI)

The thesis studies the changing direction of Detroit's central downtown shopping street, Woodward Avenue. During the last two decades, Woodward Avenue has lost most of its retail market to suburban shopping centers. The ...

Lewis, Philip Strickland



Urban agriculture as a tool for neighborhood fabric repair in post-industrial Detroit  

E-Print Network (OSTI)

This thesis focuses on Detroit as a post-industrial city that suffers from abandonment, vacancy, and food security issues. I address this problem through the lens of agriculture, asking how urban farming can be used to ...

Fairbank, Sandra Trubow



Subsidized Housing and Neighborhood Change  

E-Print Network (OSTI)

97 Figure 3-6a Detroit, MI PMSA Neighborhood Quintile98 Figure 3-6b Detroit, MI PMSA Neighborhood Quintileinterviewing from the Detroit Area Study. Neighborhood

Wilson, Florence Louise



Comparative Analysis of Urban Decay and Renewal in the Cities of Detroit and Pittsburgh, Postwar to Present: An Introductory Survey .  

E-Print Network (OSTI)

??The thesis represents the results of comparing and analyzing the social and economic circumstances of Detroit and Pittsburgh over the last seventy years in the… (more)

Tolksdorf, Alexander



Women and the high school principalship: metropolitan detroit principals' and superintendents' perceptions regarding barriers and facilitators for job attainment.  

E-Print Network (OSTI)


Schnabel Kattula, Heidi



Creative Reconstruction in the City: An Analysis of Art, Shrinking, and the Story of the American Dream in Detroit, MI.  

E-Print Network (OSTI)

??A right to the city is a human right that is overlooked in American cities. Cities reflect humanity in collective form, but are manipulated by… (more)

Marotta, Stephen J.


Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available



US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


City of Detroit (Michigan) EIA Revenue and Sales - February 2008 | Open  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon » City of Detroit (Michigan) EIA Revenue and Sales - February 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for February 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-02 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-02-01 End Date 2008-03-01 Residential Revenue(Thousand $) 1.5 Residential Sales (MWh) 17 Residential Consumers 76 Commercial Revenue(Thousand $) 4083 Commercial Sales (MWh) 43432 Commercial Consumers 123 Other Revenue (Thousand $) 55 Other Sales (MWh) 494


Detroit Lakes energy systems study: Phase I feasibility. Final report, February 1, 1978--July 31, 1978  

DOE Green Energy (OSTI)

The objective of the Detroit Lakes Energy Systems Study is to determine the economic feasibility of alternative renewable energy system configurations in the northern latitudes. A forecast through both 1990 and the year 2000 is made of the demand for electrical energy in the Detroit Lakes area. An assessment of renewable energy resources including biomass, wind, and insolation is provided. A detailed analysis is made of system costs including biomass, wind, solar thermal, solar photovoltaic, selected hybrids, and conventional fuel systems. Lessons learned and recommendations for prototype fabrication are highlighted. (MHR)




Field Demonstration of a 24-kV Superconducting Cable at Detroit Edison: Final Report  

Science Conference Proceedings (OSTI)

Following up the successful testing of a complete 50 m, 115 kV high temperature superconducting (HTS) power cable system prototype, EPRI, Pirelli Power Cables and Systems, the Department of Energy, Detroit Edison, and American Superconductor Corporation undertook a project to design, install, and operate a 24 kV HTS power cable at Detroit Edison's Frisbie substation to serve customer load. The demonstration cable circuit ran approximately 120 m between the 24 kV bus distribution bus and a 120 kV-24 kV tr...



U.S. Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI : 140 : 2011-2013: Marysville, MI: 176 : 1,080: 14 : 2011-2013: St. Clair, MI: 1,562: 1,422: 2 : 26 : 2011-2013: Noyes, MN: 13,380: 14,460: 20,624: 33,889 ...


U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI: 3.80 : 4.50 : 2011-2013: Marysville, MI: 3.63: 3.65 : 4.57: 4.70 : 2011-2013: St. Clair, MI: 3.75: 3.67: 4.09: 4.41 : 4.35: 2011-2013: Noyes, MN: 3.74: 3 ...


Former Worker Program - Defunct Beryllium Vendor Screening Program  

NLE Websites -- All DOE Office Websites (Extended Search)

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Wolverine Tube Division (Detroit, MI); National Beryllia (Haskell, NJ);...


Beryllium Vender Screening Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Speedring Systems, Inc. (Detroit, MI); Wolverine Tube Division...


Field Demonstration of a 24-kV Warm Dielectric Cable at Detroit Edison: FY2002 Annual Progress Report for the Detroit Edison HTS Cab le Field Demonstration Project  

Science Conference Proceedings (OSTI)

A project sponsored by EPRI, Pirelli Power Cables and Systems, the Department of Energy, Detroit Edison, and American Superconductor Corporation was initiated in 1998 to install and operate a 24 kV high temperature superconductor (HTS) power cable in a Detroit Edison substation to serve customer load. The previous years of activity have focused on design, testing, manufacturing, and installation of the cable system as described in the FY2000 and FY2001 status reports. The successful implementation of thi...



"Arab Americans and Segmented Assimilation: Looking Beyond the Theory to the Reality in the Detroit Metro Area".  

E-Print Network (OSTI)

??This thesis aims to apply Segmented Assimilation Theory to the Arab-American community in Metropolitan Detroit. Segmented assimilation theory relates to second-generation immigrants, and proposes three… (more)

Weaver, Kristin



Black and white do not make grey| Narratives of women's friendship across a racial divide in metro Detroit.  

E-Print Network (OSTI)

?? Interracial friendship between African Americans and whites in metro Detroit requires bridge-building across a socially constructed divide. This ethnographically-inflected, interview-based case study of the… (more)

Van't Hof, Marcia



DTE Energy Technologies With Detroit Edison Co. and Kinectrics Inc.: Distributed Resources Aggregation Modeling and Field Configuration Testing  

Science Conference Proceedings (OSTI)

Summarizes the work of DTE Energy Technologies, Detroit Edison, and Kinectrics, under contract to DOE's Distribution and Interconnection R&D, to develop distributed resources aggregation modeling and field configuration testing.

Not Available



Field Demonstration of a 24-KV Warm Dielectric Cable at Detroit Edison: FY2001 Annual Progress Report  

Science Conference Proceedings (OSTI)

A project sponsored by EPRI, Pirelli Power Cables and Systems, the U.S. Department of Energy, Detroit Edison, and American Superconductor Corporation was initiated in 1998 to install and operate a 24 kV high-temperature superconducting (HTS) power cable in a Detroit Edison substation to serve customer load. The scope of this demonstration will result in the world's first underground installation of an HTS cable system using an existing duct network. Furthermore, the project involves installing the necess...



City of Detroit (Michigan) EIA Revenue and Sales - January 2008 | Open  

Open Energy Info (EERE)

January 2008 January 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for January 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-01 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-01-01 End Date 2008-02-01 Residential Revenue(Thousand $) 1.7 Residential Sales (MWh) 19 Residential Consumers 76 Commercial Revenue(Thousand $) 4458 Commercial Sales (MWh) 47480 Commercial Consumers 123 Other Revenue (Thousand $) 63.3 Other Sales (MWh) 537 Other Consumers 1 Total Revenue (Thousand $) 4523 Total Sales (MWh) 48036 Total Consumers 200 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from


City of Detroit (Michigan) EIA Revenue and Sales - April 2008 | Open Energy  

Open Energy Info (EERE)

April 2008 April 2008 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for April 2008. Monthly Electric Utility Sales and Revenue Data Short Name 2008-04 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2008-04-01 End Date 2008-05-01 Residential Revenue(Thousand $) 1.2 Residential Sales (MWh) 13 Residential Consumers 81 Commercial Revenue(Thousand $) 4537 Commercial Sales (MWh) 41373 Commercial Consumers 121 Other Revenue (Thousand $) 55 Other Sales (MWh) 400 Other Consumers 1 Total Revenue (Thousand $) 4593.2 Total Sales (MWh) 41786 Total Consumers 203 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from


City of Detroit (Michigan) EIA Revenue and Sales - March 2009 | Open Energy  

Open Energy Info (EERE)

9 9 Jump to: navigation, search EIA Monthly Electric Utility Sales and Revenue Data for City of Detroit for March 2009. Monthly Electric Utility Sales and Revenue Data Short Name 2009-03 Utility Company City of Detroit (Michigan) Place Michigan Start Date 2009-03-01 End Date 2009-04-01 Residential Revenue(Thousand $) 2.1 Residential Sales (MWh) 20.7 Residential Consumers 79 Commercial Revenue(Thousand $) 3720 Commercial Sales (MWh) 36330 Commercial Consumers 112 Other Revenue (Thousand $) 60.4 Other Sales (MWh) 560 Other Consumers 1 Total Revenue (Thousand $) 3782.5 Total Sales (MWh) 36910.7 Total Consumers 192 Source: Energy Information Administration. Form EIA-826 Database Monthly Electric Utility Sales and Revenue Data [1] Previous | Next Retrieved from


Detroit Lakes Energy Systems Study. Quarterly technical progress report, February 1, 1978--April 30, 1978  

DOE Green Energy (OSTI)

The initial phase of the Detroit Lakes Energy Systems Study was designed to assemble and analyze sufficient data from which to recommend specific classes of alternative energy supplies. Most of the information on meteorological conditions and biomass materials have been obtained. This is being compiled into a useful form for future evaluation. Research into legal and economic areas are underway. Analysis of this data is being conducted and results will be used in assessing the impact of alternative energy systems. Current technical information on solar thermal, solar photovoltaic, wind and hybrid power systems is being evaluated. Potential systems are being considered in light of their impact on the Detroit Lakes region and the northern latitudes in general. Final evaluation of the data is expected well within schedule.

DeVillers, K.E.


Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


“I Can’t Walk!” Acute Thrombosis of Descending Aorta Causing Paraplegia  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, Michigan Supervising SectionWest Grand Boulevard, CFP-258, Detroit, MI 48202. Email:

Mitchell, Matthew Lee; Yucebey, Elif; Weaver, Mitchell R; Jaehne, A Kathrin; Rivers, Emanuel P



miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


Higher than those of their race of less fortunate advantages:Race, ethnicity, and West Indian political leadership in Detroit's African American community, 1885-1940.  

E-Print Network (OSTI)

??This dissertation explores West Indian immigrants in the city of Detroit and their leadership of key institutions in the African American community from 1885 to… (more)

Beard, Kathryn Lorraine



Girls Will Be Boys: Cross-Dressed Women and the Legitimation of American Silent Cinema  

E-Print Network (OSTI)

in American Film. Detroit: Wayne State University Press,159. “Washington--The Prince and the Pauper. ” Detroit News.Detroit, MI, December 6, 1915. Waters, Sarah. “‘A Girton

Horak, Laura



Advanced Communication and Control of Distributed Energy Resources at Detroit Edison  

DOE Green Energy (OSTI)

The project objective was to create the communication and control system, the process and the economic procedures that will allow owners (e.g., residential, commercial, industrial, manufacturing, etc.) of Distributed Energy Resources (DER) connected in parallel to the electric distribution to have their resources operated in a manner that protects the electric utility distribution network and personnel that may be working on the network. The Distribution Engineering Workstation (DEW) (a power flow and short circuit modeling tool) was modified to calculate the real-time characteristics of the distribution network based on the real-time electric distribution network information and provide DER operating suggestions to the Detroit Edison system operators so that regional electric stability is maintained. Part of the suggestion algorithm takes into account the operational availability of DER’s, which is known by the Energy Aggregator, DTE Energy Technologies. The availability information will be exchanged from DTE Energy Technologies to Detroit Edison. For the calculated suggestions to be used by the Detroit Edison operators, procedures were developed to allow an operator to operate a DER by requesting operation of the DER through DTE Energy Technologies. Prior to issuing control of a DER, the safety of the distribution network and personnel needs to be taken into account. This information will be exchanged from Detroit Edison to DTE Energy Technologies. Once it is safe to control the DER, DTE Energy Technologies will issue the control signal. The real-time monitoring of the DECo system will reflect the DER control. Multi-vendor DER technologies’ representing approximately 4 MW of capacity was monitored and controlled using a web-based communication path. The DER technologies included are a photovoltaic system, energy storage, fuel cells and natural gas/diesel internal combustion engine generators. This report documents Phase I result for the Detroit Edison (Utility) led team, which also includes: DTE Energy Technology (DER provider & Aggregator), Electrical Distribution Design (Virginia Tech company supporting DEW); Systems Integration Specialists Company (real-time protocol integrator); and OSIsoft (software system for managing real-time information). This work was performed in anticipation of being selected for Phase II of the Advanced Communication and Control of Distributed Energy Resources project.

Haukur Asgeirsson; Richard Seguin




NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


Applications in the Nuclear Industry for Thermal Spray Amorphous Metal and Ceramic Coatings  

E-Print Network (OSTI)

Science & Technology 2007, Detroit, MI, Sept. 16– 20, 2007,2007, Sept. 16–20, 2007, Detroit, MI, American CeramicExhib. , Sept. 16–20, 2007, Detroit, MI, American Ceramic

Blink, J.; Farmer, J.; Choi, J.; Saw, C.



Field Demonstration of a 24-kV Warm Dielectric Superconducting Cable at Detroit Edison: FY2003 Annual Progress Report  

Science Conference Proceedings (OSTI)

A project sponsored by EPRI, Pirelli Power Cables and Systems, the Department of Energy, Detroit Edison, and American Superconductor Corporation was initiated in 1998 to install and operate a 24 kV HTS power cable in a Detroit Edison substation to serve customer load. The previous years of activity have focused on design, testing, manufacturing, and installation of the cable system as described in the FY2000 and FY2001 status reports. The FY2002 status report focused on leak detection. The cornerstone of...



DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


E Pluribus...Separation: Deepening Double Segregation for More Students  

E-Print Network (OSTI)

TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-

Orfield, Gary; Kucsera, John; Siegel-Hawley, Genevieve



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CORPORATION FOR AN CORPORATION FOR AN ADVANCE WAIVER OF DOMESTIC AND FOREIGN RIGHTS IN SUBJECT INVENTIONS MADE IN THE COURSE OF OR UNDER DEPARTMENT OF ENERGY CONTRACT NO. DE- FC05-970R22581; DOE WAIVER DOCKET W(A)-97-009 [ORO-653] Detroit Diesel Corporation (DDC) has made a timely request for an advance waiver to worldwide rights in Subject Inventions made in the course of or under Department of Energy (DOE) Contract No. DE-FC05-970R22581. The scope of the work calls for the development of advanced materials for low emissions, high efficiency diesel engine components. The work is sponsored by the Office of Transportation Technologies. The dollar amount of the contract is $6,811,639 with DDC cost sharing $3,405,819, or 50% of the contract. DDC is a world leader in the design, development, and production of diesel engines. It has a


Field Demonstration of a 24-kV Superconducting Cable at Detroit Edison  

SciTech Connect

Customer acceptance of high temperature superconducting (HTS) cable technology requires a substantial field demonstration illustrating both the system's technical capabilities and its suitability for installation and operation within the utility environment. In this project, the world's first underground installation of an HTS cable using existing ductwork, a 120 meter demonstration cable circuit was designed and installed between the 24 kV bus distribution bus and a 120 kV-24 kV transformer at Detroit Edison's Frisbie substation. The system incorporated cables, accessories, a refrigeration system, and control instrumentation. Although the system was never put in operation because of problems with leaks in the cryostat, the project significantly advanced the state-of-the-art in the design and implementation of Warm Dielectric cable systems in substation applications. Lessons learned in this project are already being incorporated in several ongoing demonstration projects.

Kelley, Nathan; Corsaro, Pietro



Evaluation of Fish Passage Conditions for Juvenile Salmonids Using Sensor Fish at Detroit Dam, Oregon  

DOE Green Energy (OSTI)

Fish passage conditions through two spillways at Detroit Dam on the North Santiam River in Oregon were evaluated by Pacific Northwest National Laboratory for the U.S. Army Corps of Engineers (USACE), Portland District, using Sensor Fish devices. The objective of the study was to describe and compare passage exposure conditions through Spillbay 3 and Spillbay 6 at 1.5- and 3.5-ft gate openings, identifying potential fish injury regions of the routes. The study was performed in July 2009, concurrent with HI-Z balloon-tag studies by Normandeau Associates, Inc. Sensor Fish and live fish were deployed at elevations approximately 3 ft above structure at depths determined using a computational fluid dynamics model. Data collected were analyzed to estimate 1) exposure conditions, particularly exposure to severe collision and shear events by passage route sub-regions; 2) differences in passage conditions between passage routes; and 3) relationships to live-fish injury and mortality data estimates.

Duncan, Joanne P.



Microsoft Word - Sandalow Detroit National Summit Speech 6-17.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

REMARKS PREPARED FOR DELIVERY REMARKS PREPARED FOR DELIVERY REMARKS OF DAVID SANDALOW ASSISTANT SECRETARY FOR POLICY & INTERNATIONAL AFFAIRS U.S. DEPARTMENT OF ENERGY DETROIT ECONOMIC CLUB NATIONAL SUMMIT JUNE 17, 2009 [Acknowledgements.] It's good to be home in Michigan. I grew up a mile from the Michigan Football Stadium - close enough to hear the roar of the crowd from the front yard when the Wolverines scored. My first job after graduation was at the Michigan Department of Commerce. That was many years ago. In the past several months, my new position with the U.S. Department of Energy has taken me far away - to six countries on three continents. Those trips - often exhausting - have taught me a lot. One constant lesson, which I saw especially clearly last week in Beijing, is


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical

Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Air traffic control communication at Detroit Metro Wayne County Airport August 17, 1987  

E-Print Network (OSTI)

This report contains a transcript of radio communications between air traffic controllers and pilots. The transcript was prepared as part of the ATC Interaction Research Project (AIR Project) at the Oregon Graduate Institute, which has been investigating computational representations of air traffic control (ATC) communication. The transcript was made from a tape prepared and narrated by Lawrence L. Porter, a consultant in the field of air traffic control and aircraft accidents. It follows Northwest Airlines Flight 255 as it landed and took off from Detroit Metro Wayne County Airport on August 17, 1987, showing the pilot's interaction with each of the controller positions (Arrival Radar, Local Control, Ground Control, and Clearance Delivery). A copy of this recording on cassette may be obtained by writing to the Department of Computer Science and Engineering of the Oregon Graduate Institute. The authors thank Mr. Porter for providing the recording and narration. The transcript is in two parts. The section entitled "Full Transcript" depicts all exchanges chronologically as they occurred. However, air traffic control dialogue can be viewed as many interleaved yet fairly independent conversations, so in the "Separated Transcripts" section utterances are grouped by aircraft to show the course of each individual conversation. The utterance numbers from the full transcript are preserved in the separated transcripts so that the utterance context may be located easily. The notation and transcription conventions used in these transcripts are described in Appendix A. Appendix B contains charts describing the airspace around Detroit Metro Wayne County Airport.. The utterances in this transcript contain specialized terms and usages specific to the Air Traffic Control (ATC) domain. B...

Karen Ward; David Novick; Carolyn Sousa



MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Detroit Lakes Energy Systems Study: Phase I extension. Final report, August 1, 1978-January 15, 1979. [Biomass for power plant  

DOE Green Energy (OSTI)

An assessment of the resource availability of biomass and the potential of utilization of renewable energy systems in Detroit Lakes, Minnesota is presented. The feasibility of retrofitting the existing power plant to house a biomass energy system is discussed. Survey and evaluation of current off-the-shelf farm implement equipment which can be adapted to the handling of selected biomass materials is presented. Density studies on sunflower stalks, grain straw, and forest residues are included. (DC)

Not Available



"1. Monroe","Coal","Detroit Edison Co",2944 "2. Donald C Cook","Nuclear","Indiana Michigan Power Co",2069  

U.S. Energy Information Administration (EIA) Indexed Site

Michigan" Michigan" "1. Monroe","Coal","Detroit Edison Co",2944 "2. Donald C Cook","Nuclear","Indiana Michigan Power Co",2069 "3. Ludington","Pumped Storage","Consumers Energy Co",1872 "4. Midland Cogeneration Venture","Gas","Midland Cogeneration Venture",1849 "5. Dan E Karn","Coal","Consumers Energy Co",1791 "6. Belle River","Coal","Detroit Edison Co",1518 "7. J H Campbell","Coal","Consumers Energy Co",1451 "8. St Clair","Coal","Detroit Edison Co",1397 "9. Fermi","Nuclear","Detroit Edison Co",1133


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


The Detroit Diesel DELTA Engine for Light Trucks and SUVs - Year 2000 Update  

DOE Green Energy (OSTI)

Detroit Diesel Corporation (DDC) is developing the DELTA 4.0L V6 engine, specifically for the North American light truck market. This market poses unique requirements for a diesel engine, necessitating a clean sheet engine design. DELTA was developed from a clean sheet of paper, with the first engine firing just 228 days later. The process began with a Quality Function Deployment (QFD) analysis, which prioritized the development criteria. The development process integrated a co-located, fully cross-functional team. Suppliers were fully integrated and maintained on-site representation. The first demonstration vehicle moved under its own power 12 weeks after the first engine fired. It was demonstrated to the automotive press 18 days later. DELTA has repeatedly demonstrated its ability to disprove historical North American diesel perceptions and compete directly with gasoline engines. This paper outlines the Generation 0.0 development process and briefly defines the engine. A brief indication of the Generation 0.5 development status is given.

Nabil S. Hakim; Charles E. Freese; Stanley P. Miller



Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mäkinen; Jorma Tarhio



Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


Transfac 2009: Home Page  

Science Conference Proceedings (OSTI)

TRANSFAC 2009 • OCT. 31 - NOV. 3, 2009 • DETROIT, MI • USA ... and Materials (KIM), Metsoc Metallurgical Society of CIM, ASM International Detroit Chaper ...


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Microsoft Word - Sample Abstract and Format Instructions.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Dearborn, MI 48128, Wayne State University 2 , Department of Physics and Astronomy, Detroit, MI 48202, Kettering University 3 , Flint, MI 48504, University of Paris-Sud 4 ,...


Wildlife and Wildlife Habitat Loss Assessment at Detroit Big Cliff Dam and Reservoir Project, North Santiam River, Oregon, 1985 Final Report.  

DOE Green Energy (OSTI)

A habitat based assessment was conducted of the US Army Corps of Engineers' Detroit/Big Cliff Dam and Reservoir Project (Detroit Project) on the North Santiam River, Oregon, to determine losses or gains resulting from the development and operation of the hydroelectric-related components of the project. Preconstruction, postconstruction, and recent vegetation cover types at the project site were mapped based on aerial photographs from 1939, 1956, and 1979, respectively. Vegetation cover types were identified within the affected area and acreages of each type at each time period were determined. Ten wildlife target species were selected to represent a cross-section of species groups affected by the project. An interagency team evaluated the suitability of the habitat to support the target species at each time period. An evaluation procedure which accounted for both the quantity and quality of habitat was used to aid in assessing impacts resulting from the project. The Detroit Project extensively altered or affected 6324 acres of land and river in the North Santiam River drainage. Impacts to wildlife centered around the loss of 1,608 acres of conifer forest and 620 acres of riparian habitat. Impacts resulting from the Detroit Project included the loss of winter range for black-tailed deer and Roosevelt elk, and the loss of year-round habitat for deer, river otter, beaver, ruffed grouse, pileated woodpecker, spotted owl, and many other wildlife species. Bald eagle and osprey were benefited by an increase in foraging habitat. The potential of the affected area to support wildlife was greatly altered as a result of the Detroit Project. Losses or gains in the potential of the habitat to support wildlife will exist over the life of the project.

Noyes, J.H.



Hydroacoustic Evaluation of Juvenile Salmonid Passage and Distribution at Detroit Dam, 2011  

Science Conference Proceedings (OSTI)

Pacific Northwest National Laboratory evaluated juvenile salmonid passage and distribution at Detroit Dam (DET) on the North Santiam River, Oregon for the U.S. Army Corps of Engineers (USACE) to provide data to support decisions on long-term measures to enhance downstream passage at DET and others dams in USACE’s Willamette Valley Project. This study was conducted in response to regulatory requirements necessitated by the listing of Upper Willamette River Spring Chinook salmon (Oncorhynchus tshawytscha) and Upper Willamette River steelhead (O. mykiss) as threatened under the Endangered Species Act. The goal of the study was to provide information of juvenile salmonid passage and distribution at DET from February 2011 through February 2012. The results of the hydroacoustic study provide new and, in some cases, first-ever data on passage estimates, run timing, distributions, and relationships between fish passage and environmental variables at the dam. This information will inform management decisions on the design and development of surface passage and collection devices to help restore Chinook salmon populations in the North Santiam River watershed above DET. During the entire study period, an estimated total of 182,526 smolt-size fish (±4,660 fish, 95% CI) passed through turbine penstock intakes. Run timing peaked in winter and early spring months. Passage rates were highest during late fall, winter and early spring months and low during summer. Horizontal distribution for hours when both turbine units were operated simultaneously indicated Unit 2 passed almost twice as much fish as Unit 1. Diel distribution for smolt-size fish during the study period was fairly uniform, indicating fish were passing the turbines at all times of the day. A total of 5,083 smolt-size fish (± 312 fish, 95% CI) were estimated passed via the spillway when it was open between June 23 and September 27, 2011. Daily passage was low at the spillway during the June-August period, and increased somewhat in September 2011. When the spillway was operated simultaneously with the turbines, spillway efficiency (efficiency is estimated as spillway passage divided by total project passage) was 0.72 and effectiveness (fish:flow ratio—proportion fish passage at a route (e.g., spillway) divided by proportion water through that route out of the total project) was 2.69. That is, when the spillway was open, 72% of the fish passing the dam used the spillway and 28% passed into the turbine penstocks. Diel distribution for smolt-size fish at the spillway shows a distinct peak in passage between mid-morning and mid-afternoon and low passage at night. We estimated that 23,339 smolt-size fish (± 572 fish, 95% CI) passed via the Regulating Outlet (RO) when it was open from October 29 through November 12, 2011, January 2-6, and January 20 through February 3, 2012. During the October–November period, RO passage peaked at 1,086 fish on November 5, with a second peak on November 7 (1,075 fish). When the RO was operated simultaneously with the turbines, RO efficiency was 0.33 and effectiveness was 0.89. In multiple regression analyses, a relatively parsimonious model was selected that predicted the observed fish passage data well. The best model included forebay temperature at depth, forebay elevation, total discharge, hours of daylight, and the operation period. The vertical distribution of fish in the forebay near the face of the dam where the transducers sampled showed fish were generally distributed throughout the water column during all four operational periods. During the refill and full pool periods, vertical distribution was bi-modal with surface-layer and mid-water modes. Patterns for day and night distributions were variable. Fish were distributed above and below the thermocline when it was present (full pool and drawdown periods).

Khan, Fenton; Royer, Ida M.; Johnson, Gary E.; Ham, Kenneth D.



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Reducing the Environmental Footprint and Economic Costs of Automotive Manufacturing through an Alternative Energy Supply  

E-Print Network (OSTI)

in urban areas like the Detroit region. In such a situation,energy supply based on in Detroit, MI, region in the Unitedsupply figures for the Detroit region where much of the U.S.

Yuan, Chris; Dornfeld, David



St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP

Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


Mn deposition on Ni{sub 2}MnGa(100)  

Science Conference Proceedings (OSTI)

We report the study of Mn adlayers on a Mn deficient Ni{sub 2}MnGa(100) surface by using low energy electron diffraction (LEED). The spot profile analysis indicates that after 0.2 monolayer (ML) deposition, the LEED spots become very sharp. This pattern indicates the removal of Mn vacancies formed on the surface due to Mn deficiency. But with further growth of Mn layers on this surface, the LEED spots become broad.

Nayak, J.; Rai, Abhishek; D'Souza, S. W.; Maniraj, M.; Barman, S. R. [UGC-DAE Consortium for Scientific Research, Khandwa Road, Indore, 452001, M.P. (India)



Determining the Appropriate Package and Transportation Methodology for the Detroit Edison, Fermi II Msrs and Associated Components  

SciTech Connect

During the spring of 2005, Detroit Edison, Enrico Fermi II Nuclear Power Station (Fermi) decided to disposition two MSRs and associated components scheduled for replacement in the spring of 2006 during the MSR Replacement Outage. Of concern to Fermi was the proper packaging and transportation methodology when dis-positioning a component measuring approximately 110' in length and 13' in diameter and weighing over 300 tons. Upon removal from the Turbine Deck the retired MSRs and associated components were turned over to the Rad Waste Group for packaging and final disposition. Fermi requested quotations from vendors to package, transport, and disposition the MSRs and associated components. However, multiple Vendors informed Fermi that the size and weight of the MSRs were questionable in passing permitting requirements and would require segmentation and volume reduction on site or at a waste processor. Fermi contracted with MHF Logistical Solutions (MHF-LS) based on their ability to receive clearances for shipping the MSRs in one piece via two heavy haul rail conveyances acting as a bolstered load with professionally engineered blocking and bracing configured to support the retired MSRs. (authors)

Weber, B. [Detroit Edison Company/Enrico Fermi II Nuclear Power Station, Newport, MI (United States); Dempsey, S. [MHF Logistical Solutions, Oak Ridge, TN (United States)



Category:Minneapolis, MN | Open Energy Information  

Open Energy Info (EERE)

MN MN Jump to: navigation, search Go Back to PV Economics By Location Media in category "Minneapolis, MN" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png SVFullServiceRestauran... 89 KB SVHospital Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png SVHospital Minneapolis... 85 KB SVLargeHotel Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png SVLargeHotel Minneapol... 85 KB SVLargeOffice Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png SVLargeOffice Minneapo... 82 KB SVMediumOffice Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png SVMediumOffice Minneap... 83 KB SVMidriseApartment Minneapolis MN Northern States Power Co (Minnesota) Excel Energy.png


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


Preserving the U.S. Underground and Alternative Press of the 1960s and '70s: History, Prospects, and Microform Sources  

E-Print Network (OSTI)

Reporter, Washington, DC, 1985- , UMI Navajo Times, WindowWashington, DC Native Sun, Detroit, MI Navajo Times, Window

Tsang, Daniel C



REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



Characterization of Fish Passage Conditions through a Francis Turbine, Spillway, and Regulating Outlet at Detroit Dam, Oregon, Using Sensor Fish, 2009  

Science Conference Proceedings (OSTI)

Fish passage conditions through two spillways, a Francis turbine, and a regulating outlet (RO) at Detroit Dam on the North Santiam River in Oregon were evaluated by Pacific Northwest National Laboratory for the U.S. Army Corps of Engineers (USACE), Portland District, using Sensor Fish devices. The objective of the study was to describe and compare passage exposure conditions, identifying potential fish injury regions within the routes. The study was performed in July, October, and December 2009 concurrent with HI-Z balloon-tag studies by Normandeau Associates, Inc. Sensor Fish data were analyzed to estimate 1) exposure conditions, particularly exposure to severe strike, collision, and shear events by passage route sub-regions; 2) differences in passage conditions between passage routes; and 3) relationships to live-fish injury and mortality data estimates. Comparison of the three passage routes evaluated at Detroit Dam indicates that the RO passage route through the 5-ft gate opening was relatively the safest route for fish passage under the operating conditions tested; turbine passage was the most deleterious. These observations were supported also by the survival and malady estimates obtained from live-fish testing. Injury rates were highest for turbine and spillway passage. However, none of the passage routes tested is safe for juvenile salmonid passage.

Duncan, Joanne P.; Carlson, Thomas J.



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Microsoft Word - Mn.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

5 5 Structural Determination of Marine Bacteriogenic Manganese Oxides John R. Bargar, Samuel M. Webb (Stanford Synchrotron Radiation Laboratory), and Bradley M. Tebo (Oregon Health and Science University) Bacterial oxidation of Mn(II) impacts the global geochemical cycling of carbon, nitrogen, sulfur, nutrients, and contaminants in the environment. Manganese is abundant in the biosphere (~10 14 Kg of suspended and dissolved manganese in the oceans) and is second only to iron in relative terrestrial abun- dance of transition metals. Manganese is an important nutrient in the marine water column and is fundamentally required for photosynthesis. The acquisition of manganese by organisms and the biogeochemistry of manganese in the oceans is therefore an


DOE - Office of Legacy Management -- Elk River Reactor - MN 01  

Office of Legacy Management (LM)

Elk River Reactor - MN 01 FUSRAP Considered Sites Site: Elk River Reactor (MN.01 ) Eliminated from consideration under FUSRAP - Reactor was dismantled and decommissioned by 1974...


Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.




Science Conference Proceedings (OSTI)

Residual impurities in manganese (Mn) are a big obstacle to obtaining high-performance CdMnTe (CMT) X-ray and gamma-ray detectors. Generally, the zone-refining method is an effective way to improve the material's purity. In this work, we purified the MnTe compounds combining the zone-refining method with molten Te, which has a very high solubility for most impurities. We confirmed the improved purity of the material by glow-discharge mass spectrometry (GDMS). We also found that CMT crystals from a multiply-refined MnTe source, grown by the vertical Bridgman method, yielded better performing detectors.

Kim, K.H.; Bolotnikov, A.E.; Camarda, G.S.; Tappero, R.; Hossain, A.; Cui, Y.; Yang, G.; Gul, R.; and James, R.B.


Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Solid Solution Phases in Olivine-Type LiMnPO4/MnP4System  

NLE Websites -- All DOE Office Websites (Extended Search)

Solid Solution Phases in Olivine-Type LiMnPO4MnP4System Title Solid Solution Phases in Olivine-Type LiMnPO4MnP4System Publication Type Journal Article Year of Publication 2009...


Category:SecondarySchool | Open Energy Information  

Open Energy Info (EERE)

IA MidAmerican Energy Co (Iowa).png SVSecondarySchool Des ... 68 KB SVSecondarySchool Detroit MI Detroit Edison Co.png SVSecondarySchool Detr... 66 KB SVSecondarySchool El Paso TX...


MN Office of Energy Security | Open Energy Information  

Open Energy Info (EERE)

MN Office of Energy Security MN Office of Energy Security Jump to: navigation, search Name MN Office of Energy Security Place St. Paul, MN Website http://www.mnofficeofenergysec References MN Office of Energy Security[1] Information About Partnership with NREL Partnership with NREL Yes Partnership Type Test & Evaluation Partner Partnering Center within NREL Electricity Resources & Building Systems Integration LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! MN Office of Energy Security is a company located in St. Paul, MN. References ↑ "MN Office of Energy Security" Retrieved from "http://en.openei.org/w/index.php?title=MN_Office_of_Energy_Security&oldid=379158" Categories: Clean Energy Organizations Companies Organizations


Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY


Composition-structure-property-performance relationship inMn-substituted LiMn2O4  

DOE Green Energy (OSTI)

The spinel LiMn{sub 2}O{sub 4} has been extensively studied as a positive electrode active material in lithium rechargeable batteries. Partial substitution of Mn by another metal has also been the subject of recent study in an effort to improve the cycling performance. In general, the literature has shown that Mn substitution results in improved cycling stability at the expense of capacity (1,2). Resistance to the formation of tetragonal phase upon lithiation of the starting spinel (via a higher nominal Mn oxidation state in the substituted spinel) has been suggested as a mechanism for the improved performance. The degree of substitution is an important factor to optimize in order to minimize capacity loss and costs. The spectroscopic investigations on LiMn{sub 2}O{sub 4} described in the previous paper (LixMn2O4) confirmed that the cooperative Jahn-Teller effect (CJTE) from the [Mn{sup 3+}O{sub 6}] octahedra is the mechanism for the cubic to tetragonal phase transformation. The driving force for the CJTE is based upon the electronic structure, therefore changes in electronic structure should lead to changes in the phase behavior. The fact that the LiMn{sub 1.5}Ni{sub 0.5}O{sub 4} does not form tetragonal phase upon discharging (FUJI3, MUCK?), unlike the 100% Mn{sup 4+} spinel Li{sub 4}Mn{sub 5}O{sub 12} (THAC5), led to the hypothesis that an increased degree of covalency as a source for the behavior. An increased covalence would remove the driving force for the transformation, the increased electronic stability achieved in tetragonally-distorted [Mn{sup 3+}O{sub 6}] octahedra, due to a change in electron density and widening of the Mn 3d bands. The STH field is dependent upon the amount of unpaired spin density transferred between the magnetic (transition-metal) and diamagnetic ions through an intermittent oxygen ion, attributable to overlap and electron transfer effects. Therefore, the magnitude of the STH coupling constant reflects the degree of covalency (GESC, HUAN). In the case of LiMn{sub 2-y}Me{sub y}O{sub 4}, the STH coupling constant characterizes the amount of unpaired spin density transferred to the Li{sup +} from the Mn, Co, or Ni. Similarly, the La/Lb ratio of the Mn L-XES is sensitive to the amount of electron density at the Mn site as a higher ratio indicates that the Mn 3d{sub 5/2} level is more populated (GRUS1). An investigation into the effects of Mn-substitution on the electronic structure along with the ramifications to the phase behavior upon changing lithium content was carried out. To accomplish this, a set of LiMn{sub 2-y}Me{sub y}O{sub 4} with Me = Li, Co, or Ni over a range of y were synthesized, characterized, and subjected to changes in lithium content by various techniques.

Horne, Craig R.; Richardson, Thomas J.; Gee, B.; Tucker, Mike; Grush, Melissa M.; Bergmann, Uwe; Striebel, Kathryn A.; Cramer, StephenP.; Reimer, Jeffrey A.; Cairns, Elton J.



Category:International Falls, MN | Open Energy Information  

Open Energy Info (EERE)

MN MN Jump to: navigation, search Go Back to PV Economics By Location Media in category "International Falls, MN" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant International Falls MN Northern States Power Co (Minnesota) Excel Energy.png SVFullServiceRestauran... 88 KB SVHospital International Falls MN Northern States Power Co (Minnesota) Excel Energy.png SVHospital Internation... 84 KB SVLargeHotel International Falls MN Northern States Power Co (Minnesota) Excel Energy.png SVLargeHotel Internati... 85 KB SVLargeOffice International Falls MN Northern States Power Co (Minnesota) Excel Energy.png SVLargeOffice Internat... 83 KB SVMediumOffice International Falls MN Northern States Power Co (Minnesota) Excel Energy.png


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


Magnetoelastic Coupling in NiMnGa Ferromagnetic Shape ...  

Science Conference Proceedings (OSTI)

... Magnetoelastic Coupling in NiMnGa Ferromagnetic Shape Memory Alloys. Peng Zhao (Dept. of Materials Science and ...


First Principles Calculation for Magnetic Properties of Mn Alloys  

Science Conference Proceedings (OSTI)

The results indicate that the ? of MnAl and MnAlGe are extremely small because of ... Alloy Design and Powder Processing of Mn-Al Based Materials for Rare Earth ... Device Arrays Using Self-limiting Low-energy Glow-discharge Processing.


Electrochemical Performances of LiMnPO4 Synthesized from Non-Stoichiometric Li/Mn Ratio  

Science Conference Proceedings (OSTI)

In this paper we report the influences of the initial lithium content on the structural, electrochemical and magnetic properties of nonstoichiometric LixMnPO4 (0.5?x?1.2) nano-particles. It has been revealed Mn2P2O7 is the main impurity when Li1.0. The different functions of Mn2P2O7 and Li3PO¬4 impurities in the non-stoichiometric compounds have been investigated systematically. At a slow rate of C/50 the reversible capacity of both Li0.5MnPO4 and Li0.8MnPO4 increases with cycling indicating a gradual activation of more sites to accommodate a reversible diffusion of Li+ ions which may be related to the interaction between Mn2P2O7 and LiMnPO4 nanoparticles. Among all the different compositions, Li1.1MnPO4 exhibits the most stable cycling ability probably due to the existence of a trace amount of Li3PO4 impurity which functions as a solid state electrolyte on the surface. The magnetic properties and X-ray absorption spectroscopy (XAS) of MnPO4?H2O precursor, pure and carbon coated LiMnPO4 and all the other non-stoichiometric LixMnPO4 are also investigated to identify the key steps to prepare a high performance LiMnPO4.

Xiao, Jie; Chernova, Natalya; Upreti, Shailesh; Chen, Xilin; Li, Zheng; Deng, Zhiqun; Choi, Daiwon; Xu, Wu; Nie, Zimin; Graff, Gordon L.; Liu, Jun; Whittingham, M. S.; Zhang, Jiguang



1 Introduction  

E-Print Network (OSTI)

1Department of Mathematics, Wayne State University, Detroit, MI 48202 (boris@ math.wayne.edu). Research of this author was partly supported by the National ...


1 Introduction  

E-Print Network (OSTI)

2Department of Mathematics, Wayne State University, Detroit, MI 48202, USA; email: boris@math.wayne.edu. Research of this author was also partly supported  ...


Approximate Maximum Principle for Discrete Approximations of ...  

E-Print Network (OSTI)

Detroit, MI 48202. Email: boris@math.wayne.edu. ILYA SHVARTSMAN. Department of Mathematics and Computer Science. Penn State University - Harrisburg.


Hölder Metric Subregularity with Applications to Proximal Point Method  

E-Print Network (OSTI)

Feb 2, 2012 ... ‡Department of Mathematics, Wayne State University, Detroit, MI 48202, USA. Email: boris@math.wayne.edu. Research of this author was also ...


1 Introduction  

E-Print Network (OSTI)

Strategic Reference Framework under grant PTDC/MAT/111809/2009. 3Doctoral Student, Department of Mathematics, Wayne State University, Detroit, MI 48202 ...

Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



U.S. Energy Information Administration (EIA)

... , "Detroit, MI",, ,Coking,Steam 2000,61542,1142280 2005,177414,8456023 2010,160896,6187802 Jan-Aug 2011,9323,1227071 ,, "Mobile, AL", ...


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DTE Energy PMCPVT FY2012Appx. 11 months Rondle Harp Detroit, MI GM Battery Pack Assembly Plant - Electric Substation Upgrade General business actions to support the EDV battery...


1 Introduction  

E-Print Network (OSTI)

2Department of Mathematics, Wayne State University, Detroit, MI 48202, USA; email: boris@math.wayne.edu. Research of this author was also partially ...



Science Conference Proceedings (OSTI)

Room: 330A. Session Chairperson: J.E. Benci, Wayne State University, Dept. of Materials Science and Engineering, Detroit, MI 48202 ...



U.S. Energy Information Administration (EIA)

... is through August, the latest data available",,,,, ,"Norfolk, VA","Baltimore, MD","Mobile, AL","New Orleans, LA","Detroit, MI","Seattle, ...


1 Introduction  

E-Print Network (OSTI)

2Department of Mathematics, Wayne State University, Detroit, MI 48202 (boris@ math.wayne.edu). Re- search of this author was also partly supported by the ...


New Fractional Error Bounds for Nonconvex Polynomial Systems ...  

E-Print Network (OSTI)

Jan 7, 2013 ... †Department of Mathematics, Wayne State University, Detroit, MI 48202, USA. Email: boris@math.wayne.edu. Re- search of this author was ...


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- Clean Energy Coalition Michigan Green Fleets Improvements andor upgrades to existing CNG refueling station in Detroit, MI. This CX form is for one location in this project...


Individual Particle-Analysis of Ambient PM2.5 Using Advanced...  

NLE Websites -- All DOE Office Websites (Extended Search)

communities near southwestern Detroit, MI (close to multiple combustion sources including motor vehiclediesel, incinerators, and oil and coal combustion sources) and Steubenville,...


Materials for Transportation Applications: Selected Proceedings ...  

Science Conference Proceedings (OSTI)

Sep 16, 2007 ... A collection of papers from MS&T'07 held in Detroit, MI, September 16-20, 2007, covering topics related to Materials for Transportation ...


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PVTD 2009 S. Richardson 102009 - 122013 Detroit, MI Installation of Retail Biofuel Infrastructure Supporting I-75 Green Corridor Project Install retail biofuel fueling...


NETL: Mercury Emissions Control Technologies - Pilot Testing...  

NLE Websites -- All DOE Office Websites (Extended Search)

Utilities, ND; Detroit Edison, MI; and SaskPower, Canada. Contacts: For further information on this project, contact NETL Project Manager, Barbara Carney or Alan Bland from WRI...


1 Introduction  

E-Print Network (OSTI)

cal/bilevel structures, stochastic programming with applications to electricity spot market. 1Department of Mathematics, Wayne State University, Detroit, MI 48202 ...



U.S. Energy Information Administration (EIA)

SEPT02MI 1. Monroe Coal Detroit Edison Co 2. Donald C Cook Nuclear Indiana Michigan Power Co 3. Ludington Pumped Storage Consumers Energy Co 4. ...


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Upgrade Compressed Natural Gas Facility at existing station located in Detroit, MI. This CX form is for one location in this project selected under Clean Cities FOA...


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Low-temperature magnetization of (Ga,Mn) As semiconductors  

E-Print Network (OSTI)

We report on a comprehensive study of the ferromagnetic moment per Mn atom in (Ga,Mn)As ferromagnetic semiconductors. Theoretical discussion is based on microscopic calculations and on an effective model of Mn local moments antiferromagnetically coupled to valence band hole spins. The validity of the effective model over the range of doping studied is assessed by comparing with microscopic tight-binding/coherent-potential approximation calculations. Using the virtual crystal k center dot p model for hole states, we evaluate the zero-temperature mean-field contributions to the magnetization from the hole kinetic and exchange energies, and magnetization suppression due to quantum fluctuations of Mn moment orientations around their mean-field ground state values. Experimental low-temperature ferromagnetic moments per Mn are obtained by superconducting quantum interference device and x-ray magnetic circular dichroism measurements in a series of (Ga,Mn)As semiconductors with nominal Mn doping ranging from similar to 2 to 8%. Hall measurements in as-grown and annealed samples are used to estimate the number of uncompensated substitutional Mn moments. Based on our comparison between experiment and theory we conclude that all these Mn moments in high quality (Ga,Mn)As materials have nearly parallel ground state alignment.

Jungwirth, T.; Masek, J.; Wang, KY; Edmonds, KW; Sawicki, M.; Polini, M.; Sinova, Jairo; MacDonald, AH; Campion, RP; Zhao, LX; Farley, NRS; Johal, TK; van der Laan, G.; Foxon, CT; Gallagher, BL.



City of Detroit - SmartBuildings Detroit Grant Program | Open...  

Open Energy Info (EERE)

insulation, glazing treatments, windows, doors, weatherstripping, insulated roofs, solar panels, geothermal installations, wind, hydroelectric, thermal load reduction, HVAC,...


Electrochemical Performance of LiFeMnPO4  

Science Conference Proceedings (OSTI)

Symposium, Energy Storage: Materials, Systems, and Applications. Presentation Title, Electrochemical Performance of LiFeMnPO4: A Comparison of Synthesis ...


,"Warroad, MN Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Warroad, MN Natural Gas Pipeline Exports to Canada (Million Cubic Feet)",1,"Annual",2003 ,"Release Date:","172014"...

Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


,"Warroad, MN Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Warroad, MN Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"International Falls, MN Natural Gas Pipeline Imports From Canada...  

U.S. Energy Information Administration (EIA) Indexed Site

International Falls, MN Natural Gas Pipeline Imports From Canada (MMcf)" ,"Click worksheet name or tab at bottom for data" ,"Worksheet Name","Description"," Of...


,"Noyes, MN Natural Gas Pipeline Imports From Canada (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Noyes, MN Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Microstructural Characterization of Fe-Mn-C Ternary Alloy under ...  

Science Conference Proceedings (OSTI)

Mercury Oxidation and Capture over SCR Catalysts in Simulated Coal Combustion Flue Gas · Microstructural Characterization of Fe-Mn-C Ternary Alloy under ...


Characterization of Mn-Co Electrodeposition for SOFC Interconnect ...  

Science Conference Proceedings (OSTI)

Presentation Title, Characterization of Mn-Co Electrodeposition for SOFC Interconnect Applications by QCM. Author(s), Junwei Wu, Ayyakkannu Manivannan, ...


Electrodeposited Mn-Co Alloy Coating For SOFC Interconnects  

Science Conference Proceedings (OSTI)

Presentation Title, Electrodeposited Mn-Co Alloy Coating For SOFC Interconnects. Author(s), Heather McCrabb, Tim Hall, Junwei Wu, Hui Zhang, Xingbo Liu, ...


Microstructure and Coercivity of Nitrided Mn-Sn Based Alloy  

Science Conference Proceedings (OSTI)

Alloy Design and Powder Processing of Mn-Al Based Materials for Rare Earth ... Enhancement of the Refrigerant Capacity in Partially Crystallized Gd-Fe-Al-B ...


Ni(II) Sorption on Biogenic Mn-Oxides with Varying Mn  

E-Print Network (OSTI)

Lightsource (SSRL), Menlo Park, CA. EXAFS spectra from Ni(II) organic standards were collected in transmission-3 at SSRL. This method is described in detail in Zhu et al. (6). Results Sorption Isotherms and Dissolved Mn,anationaluserfacilityoperatedbyStanfordUniversity on behalf of the U.S. Department of Energy, Office of Basic Energy Sciences. The SSRL Structural Molecular

Sparks, Donald L.


Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)



High-Resolution Structure of the Photosynthetic Mn4Ca Catalyst from X-ray Spectroscopy  

E-Print Network (OSTI)

the Photosynthetic Mn 4 Ca Catalyst from X-ray Spectroscopystructure of the Mn 4 Ca catalyst at high-resolution whichthe structure of Mn 4 Ca catalyst as it cycles through the

Yano, Junko



MN471018, Work Planning and Control Manual  

NLE Websites -- All DOE Office Websites (Extended Search)

18, Work Planning and Control Manual 18, Work Planning and Control Manual Sponsor: Michael W. Hazen, 4000 Issue Date: January 3, 2007 Revision Date: June 1, 2009 This document is no longer a CPR. This document implements the requirements of Corporate procedure ESH100.1.WPC.1, Plan and Control Work. IMPORTANT NOTICE: A printed copy of this document may not be the document currently in effect. The official version is the online version located on the Sandia Restricted Network (SRN) MN471018 - WORK PLANNING AND CONTROL MANUAL Subject Matter Expert: Brad Elkin; CA Counterpart: Aden Jackson MN471018 Revision Date: June 1, 2009; Replaces Document: October 28, 2008 Implementation Notice: The requirements outlined in this document must be incorporated into approved comprehensive organizational procedures on or before June 30, 2009. New work planned and conducted after June 30, 2009 shall be performed in accordance with this document. Ongoing work, conducted under an existing, current, and approved PHS and TWD (if required), is authorized until the expiration of the applicable PHS, TWD, or June 30, 2010.


50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale


Electronic structure and magnetism in BaMn2As2 and BaMn2Sb2  

Science Conference Proceedings (OSTI)

We study the properties of ThCr{sub 2}Si{sub 2} structure BaMn{sub 2}As{sub 2} and BaMn{sub 2}Sb{sub 2} using density functional calculations of the electronic and magnetic properties as well as experimental measurements on single crystal samples of BaMn{sub 2}As{sub 2}. These materials are local moment magnets with moderate band gap antiferromagnetic semiconducting ground states. The electronic structures show substantial Mn-pnictogen hybridization, which stabilizes an intermediate spin configuration for the nominally d{sup 5} Mn. The results are discussed in the context of possible thermoelectric applications and the relationship with the corresponding iron/cobalt/nickel compounds Ba(Fe,Co,Ni){sub 2}As{sub 2}.

An, Jiming [ORNL; Safa-Sefat, Athena [ORNL; Singh, David J [ORNL; Du, Mao-Hua [ORNL



Study of intergranular embrittlement in Fe-12Mn alloys  

Science Conference Proceedings (OSTI)

A high resolution scanning Auger microscopic study has been performed on the intergranular fracture surfaces of Fe-12Mn steels in the as-austenitized condition. Fracture mode below the ductile-brittle transition temperature was intergranular whenever the alloy was quenched from the austenite field. The intergranular fracture surface failed to reveal any consistent segregation of P, S, As, O, or N. The occasional appearance of S or O on the fracture surface was found to be due to a low density precipitation of MnS and MnO/sub 2/ along the prior austenite boundaries. An AES study with Ar/sup +/ ion-sputtering showed no evidence of manganese enrichment along the prior austenite boundaries, but a slight segregation of carbon which does not appear to be implicated in the tendency toward intergranular fracture. Addition of 0.002% B with a 1000/sup 0/C/1h/WQ treatment yielded a high Charpy impact energy at liquid nitrogen temperature, preventing the intergranular fracture. High resolution AES studies showed that 3 at. % B on the prior austenite grain boundaries is most effective in increasing the grain boundary cohesive strength in an Fe-12Mn alloy. Trace additions of Mg, Zr, or V had negligible effects on the intergranular embrittlement. A 450/sup 0/C temper of the boron-modified alloys was found to cause tempered martensite embrittlement, leading to intergranular fracture. The embrittling treatment of the Fe-12Mn alloys with and without boron additions raised the ductile-brittle transition by 150/sup 0/C. This tempered martensite embrittlement was found to be due to the Mn enrichment of the fracture surface to 32 at. % Mn in the boron-modified alloy and 38 at. % Mn in the unmodified alloy. The Mn-enriched region along the prior austenite grain boundaries upon further tempering is believed to cause nucleation of austenite and to change the chemistry of the intergranular fracture surfaces. 61 figures.

Lee, H.J.



File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



The Role of Manganese Dioxide (MnO2) Deposition in Microbiologically Influenced Corrosion  

Science Conference Proceedings (OSTI)

This report documents the role of manganese dioxide (MnO2) in microbiologically influenced corrosion.


Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Twin Cities Ammunition - MN 0-01  

NLE Websites -- All DOE Office Websites (Extended Search)

Twin Cities Ammunition - MN 0-01 Twin Cities Ammunition - MN 0-01 FUSRAP Considered Sites Site: TWIN CITIES AMMUNITION (MN.0-01) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: None Location: New Brighton , Minnesota MN.0-01-1 Evaluation Year: 1987 MN.0-01-2 Site Operations: Site was formerly licensed under 10CFR 70 by the NRC. MN.0-01-1 MN.0-01-2 Site Disposition: Eliminated - No Authority - Referred to DOD MN.0-01-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD MN.0-01-2 Also see Documents Related to TWIN CITIES AMMUNITION MN.0-01-1 - DOE Letter; Mott to Spence; Listings of Military


Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Effects of Mn Doping on the Dielectric Properties of Nnanostructured ...  

Science Conference Proceedings (OSTI)

In order to further improve the insulation resistance, manganese (Mn) was introduced (0.005 at%-1.0 at%) into the TiO2 system by a powder coating process ...


International Falls, MN Natural Gas Pipeline Imports From Canada...  

U.S. Energy Information Administration (EIA) Indexed Site

per Thousand Cubic Feet) International Falls, MN Natural Gas Pipeline Imports From Canada (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5...


International Falls, MN Natural Gas Pipeline Imports From Canada...  

U.S. Energy Information Administration (EIA) Indexed Site

Million Cubic Feet) International Falls, MN Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8...


Diluted magnetic semiconductor effects in Mn-implanted silicon carbide  

Science Conference Proceedings (OSTI)

Light transmission and Faraday rotation spectra measured at the temperature of 2 K were compared for silicon carbide single crystals of 4H polytype (4H-SiC), implanted with 3.8 x 10{sup 16} cm{sup -2} of Mn ions at the beam energy of 190 keV, and a control 4H-SiC single crystal sample, which was not implanted. Mn ion implantation led to the creation of a Mn-doped surface layer with the average Mn concentration of 10{sup 21} cm{sup -3} and a thickness of approximately 0.2 {mu}m. Transmission of light through the implanted crystal changed only slightly in comparison with the control sample, which however, corresponded to a relatively strong attenuation in the implanted layer. This was interpreted as a result of scattering, which emerges in the surface layer due to optical nonuniformities, created by the high energy ion irradiation. The presence of a thin Mn-ion-containing surface layer led, despite its small thickness, to noticeable changes in the sample Faraday rotation spectra. The estimated values of the Verdet constant for this layer were about three orders of magnitude larger and of opposite sign compared to the Verdet constant values of the undoped sample. Magnetic field dependencies of the Faraday rotation contribution from the implanted layer were found to be saturating functions, which points to a proportionality of the Faraday rotation to the magnetization of the paramagnetic Mn ion subsystem. Based on these findings we conclude that the Mn-implanted SiC layer exhibits magneto-optical properties typical of a diluted magnetic semiconductor. At the same time, no ferromagnetic ordering was observed in the studied (Si, Mn)C sample.

Komarov, A. V.; Ryabchenko, S. M. [Institute of Physics of the National Academy of Sciences of Ukraine, 46 Nauki Ave., Kiev 03028 (Ukraine); Los, A. V. [ISS Ltd., Semiconductors and Circuits Lab, 15 Bozhenko Street, Kiev 03680 (Ukraine); Freescale Semiconductor Ukraine LLC., 15 Bozhenko Street, Kiev 03680 (Ukraine); Romanenko, S. M. [ISS Ltd., Semiconductors and Circuits Lab, 15 Bozhenko Street, Kiev 03680 (Ukraine)



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Studies on a novel secondary battery: MH/MnO{sub 2} rechargeable battery. 2: Characteristics of the MnO{sub 2} cathode  

SciTech Connect

The characteristics of the MnO{sub 2} cathode of a MH/MnO{sub 2} battery have been studied by cyclic voltammetry, x-ray diffraction, and potentiostatic techniques. It was found that the addition of Ni(OH){sub 2} to the MnO{sub 2} can prevent overcharge of the MnO{sub 2} and decrease the imbalance of the charge/discharge states of the positive and negative electrodes, raise the working voltage of the MH/MnO{sub 2} cell, and prevent the formation of Mn{sub 3}O{sub 4}, thereby improving the rechargeability of the MnO{sub 2} electrode. The discharge mechanism is also discussed.

Xia, X.; Guo, Z. [Xinjiang Univ., Urumqi, Xinjiang (China). Dept. of Chemistry



Molecular beam epitaxy growth of exchange-biased PtMn/NiFe bilayers with a spontaneously ordered PtMn layer  

Science Conference Proceedings (OSTI)

We report the direct epitaxial growth of equiatomic ordered antiferromagnetic PtMn layers by molecular beam epitaxy. Such layers are used in giant magnetoresistance spin valve sensors as the antiferromagnetic pinning layer. Structural characterization and phase identification confirmed the spontaneous formation of the chemically ordered face-centered-tetragonal (L1{sub 0}) phase of PtMn with about 87.4% ordering. Based on the antiferromagnetic PtMn layer, we prepared exchange-biased PtMn/NiFe bilayers with various PtMn thicknesses. The exchange anisotropy field of the bilayer with NiFe grown on PtMn stabilizes at about 50 Oe beyond a PtMn thickness of 15 nm. Although the exchange anisotropy field is small compared to that of the polycrystalline system, the antiferromagnetic domain structure is stable over repetitive external magnetic field cycling and no training effect is observed.

Choi, Y. S.; Petford-Long, A. K.; Ward, R. C. C.; Fan, R.; Goff, J. P.; Hase, T. P. A. [Department of Materials, University of Oxford, Parks Road, Oxford OX1 3PH (United Kingdom); Clarendon Laboratory, University of Oxford, Parks Road, Oxford OX1 3PU (United Kingdom); Department of Physics, University of Liverpool, Liverpool L69 7ZE (United Kingdom); Department of Physics, University of Durham, Durham DH1 3LE (United Kingdom)



MN471004, Electrical Safety Manual Sponsor: Michael W. Hazen, 4000  

NLE Websites -- All DOE Office Websites (Extended Search)

MN471004, Electrical Safety Manual MN471004, Electrical Safety Manual Sponsor: Michael W. Hazen, 4000 Revision Date: June 9, 2011 Replaces Document Dated: September 4, 2007 This document is no longer a CPR. This document implements the requirements of Corporate Procedure ESH100.2.ELC.1, Manage Electrical Hazards. IMPORTANT NOTICE: A printed copy of this document may not be the document currently in effect. The official version is the online version located on the Sandia Restricted Network (SRN). Subject Matter Experts: Marc Williams and David Paoletta MN471004, Issue S Revision Date: June 9, 2011; Replaces Document Dated: April 29, 2008 Review Date: August 29, 2007 Administrative Changes: February 5, 2008, June 28, 2010, July 28, 2010, May 26, 2011, June 9, 2011, November 28, 2011, February 1, 2012


Magnetic properties of a metal-organic antiferromagnet Mn,,hfipbb...py,,H2O...0.5  

E-Print Network (OSTI)

crystallographically independent Mn atoms Mn1 and Mn2 exist in this structure, and an alternate connection ­Mn1­ Mn2­Mn are discovered. Here we report the synthesis, structure, and magnetic properties of a metal-organic coordination 0.195, 0.5 mmol , py 2 ml , and H2O 5 ml was sealed in a Teflon-lined acid digestion bomb and heated

Li, Jing


Rechargeable Zn-MnO sub 2 alkaline batteries  

SciTech Connect

In this paper progress in the development of rechargeable alkaline zinc-manganese dioxide cells is described. The advantages and limitations of the system are evaluated. Laboratory tests run on commercial primary alkaline cells as well as model simulations of a bipolar MnO{sub 2} electrode show that the rechargeable alkaline battery may be able to compete with lead-acid, nickel-cadmium, and secondary lithium cells for low- to moderate-rate applications. However, because of this poor performance at high rates and low temperatures, the alkaline MnO{sub 2} battery is not suitable for present automotive starting applications.

Wruck, W.J.; Reichman, B.; Bullock, K.R.; Kao, W.H. (Corporate Applied Research, Johnson Controls, Inc., Milwaukee, WI (US))



Thermal Instability of Olivine-type LiMnPO4 Cathodes  

NLE Websites -- All DOE Office Websites (Extended Search)

Thermal Instability of Olivine-type LiMnPO4 Cathodes Title Thermal Instability of Olivine-type LiMnPO4 Cathodes Publication Type Journal Article Year of Publication 2010 Authors...


Electrodeposited Al-Mn Alloys with Microcrystalline, Nanocrystalline, Amorphous and Nano-quasicrystalline Structures  

E-Print Network (OSTI)

Al–Mn alloys with Mn content ranging from 0 to 15.8 at.% are prepared by electrodeposition from an ionic liquid at room temperature, and exhibit a remarkably broad range of structures. The alloys are characterized through ...

Ruan, Shiyun


Disentangling the Mn moments on different sublattices in the half-metallic ferrimagnet Mn3?xCoxGa  

SciTech Connect

Ferrimagnetic Mn{sub 3-x}Co{sub x}Ga compounds have been investigated by magnetic circular dichroism in x-ray absorption (XMCD). Compounds with x > 0.5 crystallize in the CuHg{sub 2}Ti structure. A tetragonal distortion of the cubic structure occurs for x {le} 0.5. For the cubic phase, magnetometry reveals a linearly increasing magnetization of 2x Bohr magnetons per formula unit obeying the generalized Slater-Pauling rule. XMCD confirms the ferrimagnetic character with Mn atoms occupying two different sublattices with antiparallel spin orientation and different degrees of spin localization and identifies the region 0.6 < x {le} 0.8 as most promising for a high spin polarization at the Fermi level. Individual Mn moments on inequivalent sites are compared to theoretical predictions.

Klaer, P.; Jenkins, C.A.; Alijani, V.; Winterlik, J.; Balke, B.; Felser, C.; Elmers, H.J.



Assessment of the Diffusive Gradients in Thin-films (DGT) technique to assess the plant availability of Mn in soils.  

E-Print Network (OSTI)

predicts copper availability to plants. EnvironmentalAttempts to assess Mn availability have been impeded due towill influence the Mn availability. Often flooding of soils

Mundus, Simon; Husted, Søren; Lombi, Enzo



Control of magnetic properties of MnBi and MnBiCu thin films by Kr{sup +} ion irradiation  

SciTech Connect

Mn{sub 52}Bi{sub 48} (15 nm) and Mn{sub 54}Bi{sub 24}Cu{sub 21} (15 nm) thin films were prepared by the magnetron sputtering and vacuum annealing at 350 deg. C, and the variations of their structures and magnetic properties with 30 keV Kr{sup +} ion irradiation were studied. The MnBi and MnBiCu films exhibited saturation magnetizations M{sub s} of 180 emu/cc and 210 emu/cc, the coercivities H{sub c} of 10 kOe and 3.4 kOe, respectively. The M{sub s} and H{sub c} of the MnBi abruptly vanished by the irradiation of ion dose at 3 x 10{sup 14} ions/cm{sup 2}, while those of the MnBiCu film gradually decreased with increasing the ion dose and became zero at 5 x 10{sup 13} ions/cm{sup 2}. The different trend on the ion irradiation between MnBi and MnBiCu films is understood by the surface structure of the film, i.e., the MnBi has convex islands on its surface, which protect the underneath NiAs-type MnBi from the irradiation, while the MnBiCu has rather flat surface, and its crystal structure was uniformly modified by the irradiation. From the surface flatness and the uniformity of the MnBiCu film, as well as the low annealing temperature of 350 deg. C, it was concluded that the MnBiCu film is one of the attractive materials for high-density ion irradiation bit patterned media.

Xu Qianqian; Kanbara, Ryutarou; Kato, Takeshi; Iwata, Satoshi [Department of Quantum Engineering, Nagoya University Furo-cho, Chikusa-ku, Nagoya, 464-8603 (Japan); Tsunashima, Shigeru [Department of Research, Nagoya Industrial Science Research Institute, 1-13 Yotsuya-dori, Chikusa-ku, Nagoya 460-0819 (Japan)



Microsoft Word - table_11.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 2000 2001 2002 2003 2004 State Volume Price Volume Price Volume Price Volume Price Volume Price Pipeline (Canada) Eastport, ID............... 0 -- 0 -- 176 4.40 15 4.34 48 5.36 Detroit, MI ................. 36,007 3.74 35,644 4.57 7,431 3.03 19,737 5.47 40,030 6.47 Marysville, MI............ 5,320 2.91 3,651 3.92 0 -- 811 5.06 4,455 6.83 Sault Ste. Marie, MI .. 0 -- 0 -- 0 -- 605 4.94 6,666 6.38 St. Clair, MI............... 29,654 3.73 122,293 3.82 164,084 3.42 R 238,444 6.13 317,797 6.56 Noyes, MN................ 0 -- 0 -- 71 1.99 172 5.43 2,193 5.77 Warroad, MN ............ 0 -- 0 -- 0 -- R 0 -- 0 -- Babb, MT .................. 0 -- 549 3.55 143 2.28 38 6.48 1,429 4.98 Havre, MT................. 1,606 3.25 2,428 3.40 15,892 2.74 8,851 4.80 21,950 5.32 Port of Morgan, MT... 0 -- 0 -- 1 3.47 0


Microsoft Word - Table_11.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 1999 2000 2001 2002 2003 State Volume Price Volume Price Volume Price Volume Price Volume Price Pipeline (Canada) Eastport, ID............... NA NA NA NA NA NA 176 4.40 15 4.34 Detroit, MI ................. 25,049 2.30 36,007 3.74 35,644 4.57 7,431 3.03 19,737 5.47 Marysville, MI............ 691 2.47 5,320 2.91 3,651 3.92 NA NA 811 5.06 Sault Ste. Marie, MI .. NA NA NA NA NA NA NA NA 605 4.94 St. Clair, MI............... 11,258 2.51 29,654 3.73 122,293 3.82 164,084 3.42 261,101 6.13 Noyes, MN................ NA NA NA NA NA NA 71 1.99 172 5.43 Warroad, MN ............ NA NA NA NA NA NA NA NA 640 7.88 Babb, MT .................. NA NA NA NA 549 3.55 143 2.28 38 6.48 Havre, MT................. 1,510 2.05 1,606 3.25 2,428 3.40 15,892 2.74 8,851 4.80 Port of Morgan, MT... NA NA NA NA NA NA 1 3.47 NA


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 1999 2000 2001 2002 2003 State Volume Price Volume Price Volume Price Volume Price Volume Price Pipeline (Canada) Eastport, ID..................... 800,345 2.04 830,351 3.79 802,182 4.71 759,647 2.83 623,635 4.72 Calais, ME ...................... NA NA 123,521 4.50 152,486 4.47 124,991 3.49 108,342 5.86 Detroit, MI ....................... 7,671 2.51 6,171 3.82 405 9.34 1,948 3.56 2,514 5.96 Marysville, MI.................. 135 2.06 NA NA NA NA 74 3.95 NA NA St. Clair, MI..................... 33,388 2.62 17,198 4.45 21,747 4.54 28,441 3.19 5,202 5.84 International Falls, MN .... 4,857 2.33 3,022 2.77 617 4.85 602 3.01 NA NA Noyes, MN...................... 506,866 2.29 469,361 3.75 448,898 4.19 402,621 3.09 359,640 5.04 Warroad, MN .................. 412 2.06 4,576 3.95 5,318

Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


State Volume Price Volume Price Volume Price Volume Price Volume Price  

Gasoline and Diesel Fuel Update (EIA)

7 7 2000 2001 2002 2003 2004 State Volume Price Volume Price Volume Price Volume Price Volume Price Pipeline (Canada) Eastport, ID..................... 830,351 3.79 802,182 4.71 759,647 2.83 R 623,652 4.72 707,885 5.30 Calais, ME ...................... 123,521 4.50 152,486 4.47 124,991 3.49 R 115,301 R 5.85 102,292 6.44 Detroit, MI ....................... 6,171 3.82 405 9.34 1,948 3.56 2,514 5.96 1,117 6.27 Marysville, MI.................. 0 -- 0 -- 74 3.95 0 -- 303 7.80 St. Clair, MI..................... 17,198 4.45 21,747 4.54 28,441 3.19 5,202 5.84 22,853 6.50 International Falls, MN .... 3,022 2.77 617 4.85 602 3.01 0 -- 0 -- Noyes, MN...................... 469,361 3.75 448,898 4.19 402,621 3.09 R 359,801 5.04 399,298 5.77 Warroad, MN .................. 4,576 3.95 5,318 4.52


U.S. Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA) Indexed Site

2007 2008 2009 2010 2011 2012 View 2007 2008 2009 2010 2011 2012 View History U.S. Total 3,836,770 3,632,403 3,299,402 3,309,747 3,119,753 2,963,140 1985-2012 From Canada 3,782,708 3,589,089 3,271,107 3,279,752 3,117,081 2,962,827 1973-2012 Eastport, ID 704,429 688,782 693,892 708,806 606,099 634,194 1996-2012 Calais, ME 106,643 121,295 114,081 131,035 149,736 76,540 1998-2012 Detroit, MI 81 753 21 79 19 0 1996-2012 Marysville, MI 876 2,252 5,651 5,694 9,946 8,099 1996-2012 St. Clair, MI 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 International Falls, MN 1996-2006 Noyes, MN 499,863 476,948 478,368 447,079 544,135 401,717 1996-2012 Warroad, MN 4,813 4,800 4,380 4,325 4,551 4,610 1996-2012 Babb, MT 4,580 4,057 6,702 6,671 12,807 15,525 1996-2012


Thermoelectric figure of merit of LSCoO-Mn perovskites  

Science Conference Proceedings (OSTI)

Oxide ceramics with nominal composition of La"0"."8Sr"0"."2Co"1"-"xMn"xO"3(0= Keywords: 72.20.Pa, 84.60.Bk, 84.60.Rb, 85.80.Fi, LSCoO compounds, Thermoelectric figure of merit, Thermoelectric materials

J. E. Rodríguez; D. Cadavid; L. C. Moreno



Clarification of enhanced ferromagnetism in Be-codoped InMnP fabricated using Mn/InP:Be bilayers grown by molecular beam epitaxy  

Science Conference Proceedings (OSTI)

The p-type InMnP:Be epilayers were prepared by the sequential growth of Mn/InP:Be bilayers using molecular-beam-epitaxy and the subsequent in-situ annealing at 200-300 deg. C. In triple-axis x-ray diffraction patterns, the samples revealed a shoulder peak indicative of intrinsic InMnP. The ferromagnetic transition in InMnP:Be was observed to occur at the elevated temperature of {approx}140 K, and the ferromagnetic spin-domains clearly appeared in magnetic force microscopy images. The improved ferromagnetic properties are attributed to the increased p-d hybridation due to high p-type conductivity of InMnP:Be (p {approx} 10{sup 20 }cm{sup -3}). The results suggest that enhanced ferromagnetism can be effectively obtained from Be-codoped InMnP.

Shon, Yoon; Lee, Sejoon; Taek Yoon, Im; Jeon, H. C.; Lee, D. J.; Kang, T. W. [Quantum-functional Semiconductor Research Center, Dongguk University-Seoul, Seoul 100-715 (Korea, Republic of); Song, J. D. [Center for Spintronics Research, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Yoon, Chong S. [Department of Materials Science and Engineering, Hanyang University, Seoul 133-791 (Korea, Republic of); Kim, D. Y. [Department of Semiconductor Science, Dongguk University-Seoul, Seoul 100-715 (Korea, Republic of); Park, C. S. [School of Electrical Engineering, Korea University, Anam-dong, Seongbuk-gu, Seoul 136-713 (Korea, Republic of)



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


The Mn effect on magnetic structure of FeMn-B amorphous metals , D.M.C. Nicholson2  

E-Print Network (OSTI)

usually less than 1mm in thickness, because fast cooling rate is (~ 106 °K/sec) required for retaining] for a historical summary on the discovery of bulk amorphous metals.) They have been proposed for a range in transformers and electrical motors. Lately, high Mn content, Fe-based bulk amorphous metals have been

Widom, Michael


Plutonium Oxidation and Subsequent Reduction by Mn (IV) Minerals  

Science Conference Proceedings (OSTI)

Plutonium sorbed to rock tuff was preferentially associated with manganese oxides. On tuff and synthetic pyrolusite (Mn{sup IV}O{sub 2}), Pu(IV) or Pu(V) was initially oxidized, but over time Pu(IV) became the predominant oxidation state of sorbed Pu. Reduction of Pu(V/VI), even on non-oxidizing surfaces, is proposed to result from a lower Gibbs free energy of the hydrolyzed Pu(IV) surface species versus that of the Pu(V) or Pu(VI) surface species. This work suggests that despite initial oxidation of sorbed Pu by oxidizing surfaces to more soluble forms, the less mobile form of Pu, Pu(IV), will dominate Pu solid phase speciation during long term geologic storage. The safe design of a radioactive waste or spent nuclear fuel geologic repository requires a risk assessment of radionuclides that may potentially be released into the surrounding environment. Geochemical knowledge of the radionuclide and the surrounding environment is required for predicting subsurface fate and transport. Although difficult even in simple systems, this task grows increasingly complicated for constituents, like Pu, that exhibit complex environmental chemistries. The environmental behavior of Pu can be influenced by complexation, precipitation, adsorption, colloid formation, and oxidation/reduction (redox) reactions (1-3). To predict the environmental mobility of Pu, the most important of these factors is Pu oxidation state. This is because Pu(IV) is generally 2 to 3 orders of magnitude less mobile than Pu(V) in most environments (4). Further complicating matters, Pu commonly exists simultaneously in several oxidation states (5, 6). Choppin (7) reported Pu may exist as Pu(IV), Pu(V), or Pu(VI) oxic natural groundwaters. It is generally accepted that plutonium associated with suspended particulate matter is predominantly Pu(IV) (8-10), whereas Pu in the aqueous phase is predominantly Pu(V) (2, 11-13). The influence of the character of Mn-containing minerals expected to be found in subsurface repository environments on Pu oxidation state distributions has been the subject of much recent research. Kenney-Kennicutt and Morse (14), Duff et al. (15), and Morgenstern and Choppin (16) observed oxidation of Pu facilitated by Mn(IV)-bearing minerals. Conversely, Shaughnessy et al. (17) used X-ray Absorption near-edge spectroscopy (XANES) to show reduction of Pu(VI) by hausmannite (Mn{sup II}Mn{sub 2}{sup III}O{sub 4}) and manganite ({gamma}-Mn{sup III}OOH) and Kersting et al., (18) observed reduction of Pu(VI) by pyrolusite (Mn{sup IV}O{sub 2}). In this paper, we attempt to reconcile the apparently conflicting datasets by showing that Mn-bearing minerals can indeed oxidize Pu, however, if the oxidized species remains on the solid phase, the oxidation step competes with the formation of Pu(IV) that becomes the predominant solid phase Pu species with time. The experimental approach we took was to conduct longer term (approximately two years later) oxidation state analyses on the Pu sorbed to Yucca Mountain tuff (initial analysis reported by Duff et al., (15)) and measure the time-dependant changes in the oxidation state distribution of Pu in the presence of the Mn mineral pyrolusite.




Electrodeposited Mn-Co Alloy Coating For SOFC Interconnects  

NLE Websites -- All DOE Office Websites (Extended Search)

Electrodeposited Electrodeposited Mn-Co Alloy Coating For SOFC Interconnects H. McCrabb * , T. Hall * , J. Wu # , H. Zhang # , X. Liu # , E.J. Taylor * * Faraday Technology Inc., 315 Huls Dr., Clayton, OH 45315, USA # West Virginia University, Dept. of Mechanical and Aerospace Eng.ESB, Morgantown, WV, 26506, USA Overall Objective Overall Objective Principal Investigator: Heather McCrabb, Company Name: Faraday Technology, Inc., Address: 315 Huls Drive, Clayton, OH 45315, Phone: 937-836-7749, E-mail: heathermccrabb@faradaytechnology.com, Company website: faradaytechnology.com Previous Work at WVU Results Develop an inexpensive manufacturing process for depositing (Mn,Co) 3 O 4 spinel coatings onto SOFC interconnects. Introduction The decrease in the SOFC operating temperatures from 1000°C to between 650 and 850°C has enabled the use of chromia-forming ferritic stainless steels as interconnects


Charge transport properties of CdMnTe radiation detectors  

Science Conference Proceedings (OSTI)

Growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe)radiation detectors have been described. Alpha-particle spectroscopy measurements and time resolved current transient measurements have yielded an average charge collection efficiency approaching 100 %. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of tellurium inclusions within the detector bulk. Further, it has been shown that the role of tellurium inclusions in degrading chargecollection is reduced with increasing values of bias voltage. The electron transit time was determined from time of flight measurements. From the dependence of drift velocity on applied electric field the electron mobility was found to be n = (718 55) cm2/Vs at room temperature.

Kim K.; Rafiel, R.; Boardman, M.; Reinhard, I.; Sarbutt, A.; Watt, G.; Watt, C.; Uxa, S.; Prokopovich, D.A.; Belas, E.; Bolotnikov, A.E.; James, R.B.



High-Resolution Mn EXAFS of the Oxygen-Evolving Complex inPhotosystem II: Structural Implications for the Mn4Ca Cluster  

DOE Green Energy (OSTI)

The biological generation of oxygen by the oxygen-evolving complex in photosystem II (PS II) is one of natures most important reactions. The recent X-ray crystal structures, while limited by resolutions of 3.2 to 3.5 A, have located the electron density associated with the Mn4Ca complex within the multi-protein PS II complex. Detailed structures critically depend on input from spectroscopic techniques such as EXAFS and EPR/ENDOR, as the XRD resolution does not allow for accurate determination of the position of Mn/Ca or the bridging and terminal ligand atoms. The number and distances of Mn-Mn/Ca/ligand interactions determined from EXAFS provide important constraints for the structure of the Mn cluster. Here we present data from a high-resolution EXAFS method using a novel multi-crystal monochromator that show three short Mn-Mn distances between 2.7 and 2.8 A and hence the presence of three di-mu-oxobridged units in the Mn4Ca cluster. This result imposes clear limitations on the proposed structures based on spectroscopic and diffraction data and provides input for refining such structures.

Yano, Junko; Pushkar, Yulia; Glatzel, Pieter; Lewis, Azul; Sauer,Kenneth; Messinger, Johannes; Bergmann, Uwe; Yachandra, Vittal



Structural and magnetic properties of MnAs nanoclusters formed by Mn ion implantation in GaAs  

SciTech Connect

Ferromagnetic (FM) nanostructures embedded in semiconductors are of fundamental interest since their physical properties could be used in new devices such as memories, sensors or spintronics. In this work, we present results obtained on the synthesis and characterization of nanosized MnAs ferromagnets buried in GaAs. These nanocrystals are formed either by single Mn implantation or Mn + As co-implantation at room temperature into GaAs wafers at 141 and 180 keV respectively. Two doses, 1 x 10{sup 16} and 2 x 10{sup 16} ions {center_dot} cm{sup -2} for each impurity, are tested. Pieces of the wafers are then annealed by RTA or classical furnace annealing at various temperatures under N{sub 2} atmosphere for increasing times. HRTEM and diffraction analysis show that under such conditions MnAs precipitates form with a regular hexagonal structure, the 3m orientation-relationship of precipitates with respect to the matrix offers the most energetically stable configuration. Size distributions are systematically extracted from statistical analysis of ''2 beam'' TEM images. The precipitate mean diameters of nanocrystals populations range from 9 to 13 nm depending on the annealing conditions. Magnetization measurements by SQUID magnetometry on the same samples reveal a progressive transition from a superparamagnetic behavior at room temperature to an FM one at 2K, reflecting a distribution of blocking temperature, due to distribution of size and to dipolar interactions. Curie temperatures in the range of 360K were measured.

Serres, A.; Benassayag, G.; Respaud, M.; Armand, C.; Pesant, J.C.; Mari, A.; Liliental-Weber, Z.; Claverie, A.



Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Effect of a high electric field on the conductivity of MnGa{sub 2}S{sub 4}, MnIn{sub 2}S{sub 4}, and MnGaInS{sub 4} single crystals  

Science Conference Proceedings (OSTI)

The results of studying the effect of a high electric field on the conductivity of MnGa{sub 2}S{sub 4}, MnIn{sub 2}S{sub 4}, and MnGaInS{sub 4} single crystals are reported. The activation energy is determined in high and low electric fields. It is established that the decrease in the activation energy with increasing the external voltage is associated with decreasing the depth of the potential well, in which the electron is located.

Niftiev, N. N. [Azerbaijan State Pedagogical University (Azerbaijan); Tagiev, O. B. [National Academy of Sciences of Azerbaijan, Institute of Physics (Azerbaijan)



U.S. Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA)

Detroit, MI: 22,904: 27,220: 43,980: 44,275: 43,690: 50,347: 1996-2011: Marysville, MI: 9,158: 8,756: 14,925: 22,198: 41,964: 42,866: 1996-2011: Sault Ste. Marie, MI ...


U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI: 8.28: 6.58: 4.53: 8.37: 5.17 : 1996-2011: Marysville, MI: 7.59: 8.59: 3.80: 4.44: 4.42: 2.99: 1996-2012: St. Clair, MI: 6.97: 10.03: 5.10: 4.97: 4.29: 2 ...


U.S. Price of Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA)

Detroit, MI: 6.88: 8.37: 4.01: 4.69: 4.26: 3.10: 1996-2012: Marysville, MI: 7.77: 7.48: 4.85: 4.87: 4.48: 3.18: 1996-2012: Sault Ste. Marie, MI: 7.13: 8.75: 5.04: 5 ...


Time resolved magneto-optical studies of ferromagnetic InMnSb films  

SciTech Connect

We report time resolved magneto-optical measurements in InMnSb ferromagnetic films with 2% and 2.8% Mn contents grown by low temperature molecular beam epitaxy. In order to probe a possible interaction between the spins of photoexcited carriers and the Mn ions, we measured spin dynamics before and after aligning the Mn ions by applying an external magnetic field at temperatures above and below the samples' Curie temperatures. We observed no significant temperature or magnetic field dependence in the relaxation times and attribute the observed dynamics entirely to the relaxation of photoexcited electrons in the conduction band where the s-d coupling with the localized Mn ions is significantly weaker compared to the p-d exchange coupling. We observed several differences in the optical response of our InMnSb samples which could have been influenced mainly by the samples' growth conditions.

Frazier, M.; Kini, R. N.; Nontapot, K.; Khodaparast, G. A. [Department of Physics, Virginia Tech, Blacksburg, Virginia 24061 (United States); Wojtowicz, T. [Institute of Physics, Polish Academy of Sciences 02-668 Warsaw (Poland); Liu, X.; Furdyna, J. K. [Department of Physics, University of Notre Dame, Notre Dame, Indiana 46556 (United States)


Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Investigation of structure, magnetic, and transport properties of Mn-doped SiC films  

SciTech Connect

Mn-doped SiC films were fabricated by radio frequency magnetron sputtering technique. The structure, composition, and magnetic and transport properties of the films were investigated. The results show the films have the 3C-SiC crystal structure and the doped Mn atoms in the form of Mn{sup 2+} ions substitute for C sites in SiC lattice. All the films are ferromagnetic at 300 K, and the ferromagnetism in films arises from the doped Mn atoms and some extended defects. In addition, the saturation magnetization increases with the Mn-doped concentration increasing. The Mn doping does not change the semiconductor characteristics of the SiC films.

Sun Xianke [School of Material Science and Engineering, Tianjin University, Tianjin 300172 (China); Tianjin Key Laboratory for Photoelectric Materials and Devices, Tianjin University of Technology, Tianjin 300384 (China); Guo Ruisong [School of Material Science and Engineering, Tianjin University, Tianjin 300172 (China); An Yukai [Tianjin Key Laboratory for Photoelectric Materials and Devices, Tianjin University of Technology, Tianjin 300384 (China); School of Material Science and Engineering, Tianjin University of Technology, Tianjin 300384 (China); Liu Jiwen [School of Material Science and Engineering, Tianjin University, Tianjin 300172 (China); Tianjin Key Laboratory for Photoelectric Materials and Devices, Tianjin University of Technology, Tianjin 300384 (China); School of Material Science and Engineering, Tianjin University of Technology, Tianjin 300384 (China)



Ga{sub 1-x}Mn{sub x}N epitaxial films with high magnetization  

Science Conference Proceedings (OSTI)

We report on the fabrication of pseudomorphic wurtzite Ga{sub 1-x}Mn{sub x}N grown on GaN with Mn concentrations up to 10% using molecular beam epitaxy. According to Rutherford backscattering, the Mn ions are mainly at the Ga-substitutional positions, and they are homogeneously distributed according to depth-resolved Auger-electron spectroscopy and secondary-ion mass-spectroscopy measurements. A random Mn distribution is indicated by transmission electron microscopy, and no Mn-rich clusters are present for optimized growth conditions. A linear increase of the c-lattice parameter with increasing Mn concentration is found using x-ray diffraction. The ferromagnetic behavior is confirmed by superconducting quantum-interference measurements showing saturation magnetizations of up to 150 emu/cm{sup 3}.

Kunert, G.; Kruse, C.; Figge, S.; Hommel, D. [Semiconductor Epitaxy, Institute of Solid State Physics, University of Bremen, D-28359 Bremen (Germany); Dobkowska, S.; Jakiela, R.; Stefanowicz, W.; Sawicki, M. [Institute of Physics, Polish Academy of Science, PL-02-668 Warszawa (Poland); Li, Tian; Bonanni, A. [Institute for Semiconductor and Solid State Physics, Johannes Kepler University Linz, A 4040 Linz (Austria); Reuther, H.; Grenzer, J.; Borany, J. von [Helmholtz-Zentrum Dresden-Rossendorf, Institute of Ion Beam Physics and Materials Research, Bautzner Landstrasse 400, 01328 Dresden (Germany); Dietl, T. [Institute of Physics, Polish Academy of Science, PL-02-668 Warszawa (Poland); Institute of Theoretical Physics, Faculty of Physics, University of Warsaw, PL-00-681 Warszawa (Poland)



Electronic Structure and Oxidation State Changes in the Mn (4) Ca Cluster of Photosystem II  

Science Conference Proceedings (OSTI)

Oxygen-evolving complex (Mn{sub 4}Ca cluster) of Photosystem II cycles through five intermediate states (S{sub i}-states, i = 0-4) before a molecule of dioxygen is released. During the S-state transitions, electrons are extracted from the OEC, either from Mn or alternatively from a Mn ligand. The oxidation state of Mn is widely accepted as Mn{sub 4}(III{sub 2},IV{sub 2}) and Mn{sub 4}(III,IV{sub 3}) for S{sub 1} and S{sub 2} states, while it is still controversial for the S{sub 0} and S{sub 3} states. We used resonant inelastic X-ray scattering (RIXS) to study the electronic structure of Mn{sub 4}Ca complex in the OEC. The RIXS data yield two-dimensional plots that provide a significant advantage by obtaining both K-edge pre-edge and L-edge-like spectra (metal spin state) simultaneously. We have collected data from PSII samples in the each of the S-states and compared them with data from various inorganic Mn complexes. The spectral changes in the Mn 1s2p{sub 3/2} RIXS spectra between the S-states were compared to those of the oxides of Mn and coordination complexes. The results indicate strong covalency for the electronic configuration in the OEC, and we conclude that the electron is transferred from a strongly delocalized orbital, compared to those in Mn oxides or coordination complexes. The magnitude for the S{sub 0} to S{sub 1}, and S{sub 1} to S{sub 2} transitions is twice as large as that during the S{sub 2} to S{sub 3} transition, indicating that the electron for this transition is extracted from a highly delocalized orbital with little change in charge density at the Mn atoms.

Yano, J.; Pushkar, Y.; Messinger, J.; Bergmann, U.; Glatzel, P.; Yachandra, V.K.; /SLAC



Distinct local electronic structure and magnetism for Mn in amorphous Si and Ge  

SciTech Connect

Transition metals such as Mn generally have large local moments in covalent semiconductors due to their partially filled d shells. However, Mn magnetization in group-IV semiconductors is more complicated than often recognized. Here we report a striking crossover from a quenched Mn moment (<0.1 {mu}{sub B}) in amorphous Si (a-Si) to a large distinct local Mn moment ({ge}3{mu}{sub B}) in amorphous Ge (a-Ge) over a wide range of Mn concentrations (0.005-0.20). Corresponding differences are observed in d-shell electronic structure and the sign of the Hall effect. Density-functional-theory calculations show distinct local structures, consistent with different atomic density measured for a-Si and a-Ge, respectively, and the Mn coordination number N{sub c} is found to be the key factor. Despite the amorphous structure, Mn in a-Si is in a relatively well-defined high coordination interstitial type site with broadened d bands, low moment, and electron (n-type) carriers, while Mn in a-Ge is in a low coordination substitutional type site with large local moment and holes (p-type) carriers. Moreover, the correlation between N{sub c} and the magnitude of the local moment is essentially independent of the matrix; the local Mn moments approach zero when N{sub c} > 7 for both a-Si and a-Ge.

Zeng, Li; Cao, J. X.; Helgren, E.; Karel, J.; Arenholz, E.; Ouyang, Lu; Smith, David J.; Wu, R. Q.; Hellman, F.



Ion-exchanged MnO2 nanoparticles as cathodes of lithium ion ...  

Science Conference Proceedings (OSTI)

Presentation Title, Ion-exchanged MnO2 nanoparticles as cathodes of lithium ion batteries at elevated temperatures. Author(s), Dawei Liu, Jasper Wright, Wei ...


Ageing and Toughness of a Mn-Ni-Mo PWR Steel  

Science Conference Proceedings (OSTI)

Abstract Scope, Mn-Ni-Mo steels are widely used in the fabrication of pressurisers, steam generators and pressure vessels of pressurised water reactors (PWR).


Investigation of Structural Stability of Monolayer MnO 2 Sheet under ...  

Science Conference Proceedings (OSTI)

Presentation Title, Investigation of Structural Stability of Monolayer MnO2 Sheet under Electron Beam Irradiation. Author(s), Yong Wang, Chenghua Sun, Jin Zou  ...


Optimization of Na 0.44 MnO 2 Cathode Material - Programmaster.org  

Science Conference Proceedings (OSTI)

Symposium, Energy Storage: Materials, Systems, and Applications. Presentation Title, Optimization of Na0.44MnO2 Cathode Material for Use in Aqueous ...


Low-energy structure of 61Mn populated following $\\beta$ decay of 61Cr  

E-Print Network (OSTI)

$\\beta$ decay of the $^{61}$Cr$_{37}$ ground state has been studied. A new half-life of 233 +/- 11 ms has been deduced, and seven delayed $\\gamma$ rays have been assigned to the daughter, $^{61}$Mn$_{36}$. The low-energy level structure of $^{61}$Mn$_{36}$ is similar to that of the less neutron-rich $^{57,59}$Mn nuclei. The odd-A $_{25}$Mn isotopes follow the systematic trend in the yrast states of the even-even, Z + 1 $_{26}$Fe isotopes, and not that of the Z - 1 $_{24}$Cr isotopes, where a possible onset of collectivity has been suggested to occur already at N = 36.

Crawford, H L; Berryman, J S; Broda, R; Fornal, B; Hoffman, C R; Hoteling, N; Janssens, R V F; Lenzi, S M; Pereira, J; Stoker, J B; Tabor, S L; Walters, W B; Wang, X; Zhu, S



Low-energy structure of 61Mn populated following $?$ decay of 61Cr  

E-Print Network (OSTI)

$\\beta$ decay of the $^{61}$Cr$_{37}$ ground state has been studied. A new half-life of 233 +/- 11 ms has been deduced, and seven delayed $\\gamma$ rays have been assigned to the daughter, $^{61}$Mn$_{36}$. The low-energy level structure of $^{61}$Mn$_{36}$ is similar to that of the less neutron-rich $^{57,59}$Mn nuclei. The odd-A $_{25}$Mn isotopes follow the systematic trend in the yrast states of the even-even, Z + 1 $_{26}$Fe isotopes, and not that of the Z - 1 $_{24}$Cr isotopes, where a possible onset of collectivity has been suggested to occur already at N = 36.

H. L. Crawford; P. F. Mantica; J. S. Berryman; R. Broda; B. Fornal; C. R. Hoffman; N. Hoteling; R. V. F. Janssens; S. M. Lenzi; J. Pereira; J. B. Stoker; S. L. Tabor; W. B. Walters; X. Wang; S. Zhu



F-8: Modeling of Mn-Ni-Si-Cu Precipitation in Reactor Pressure ...  

Science Conference Proceedings (OSTI)

Presentation Title, F-8: Modeling of Mn-Ni-Si-Cu Precipitation in Reactor .... Steels 316 and Comparison with the Rate Theory Model of a Multicomponent System.


Annual Energy Outlook 2013 Early Release Reference Case  

U.S. Energy Information Administration (EIA) Indexed Site

Vehicle Choice Modeling and Vehicle Choice Modeling and Projections for the Annual Energy Outlook John Maples Office of Energy Analysis, Energy Efficiency and End Use January 25, 2013 | Detroit, MI Outline John Maples, Vehicle Choice Models and Markets Detroit, MI, January 25, 2013 2 * Overview of model structure and inputs * Battery electric vehicles and current state of the market * Projections of battery electric vehicles in the Annual Energy Outlook 2013 * High Battery Technology case in the Annual Energy Outlook 2012 Overview of model structure and inputs 3 John Maples, Vehicle Choice Models and Markets Detroit, MI, January 25, 2013 Light duty vehicle technology market penetration John Maples, Vehicle Choice Models and Markets Detroit, MI, January 25, 2013 4 * Technologies affecting light-duty vehicle fuel economy are


Level schedule implementation in unstable manufacturing environments  

E-Print Network (OSTI)

American Axle & Manufacturing Inc. (AAM), headquartered in Detroit (MI) is one of the major Tier 1 suppliers in the automotive industry. The main challenge in AAM plant 2 is production rate unstability due to downtime, ...

López de Haro, Santiago




E-Print Network (OSTI)

?Department of Mathematics, Wayne State University, Detroit, MI 48202, USA. ( boris@math.wayne.edu) ...... alent to the fundamental metric regularity property of the inverse F?1. The latter ...... Handbook of Semidefinite Program- ming: Theory  ...


U.S. Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA) Indexed Site

215,438 228,558 228,644 228,087 227,437 228,043 1997-2013 215,438 228,558 228,644 228,087 227,437 228,043 1997-2013 From Canada 215,418 228,544 228,616 227,905 227,273 227,895 1973-2013 Eastport, ID 56,795 55,526 58,195 60,900 58,601 56,407 2011-2013 Calais, ME 1,846 1,368 1,910 1,831 1,356 3,925 2011-2013 Detroit, MI 140 2011-2013 Marysville, MI 1,080 14 21 194 2011-2013 St. Clair, MI 2 26 151 211 2011-2013 Noyes, MN 20,624 33,889 31,352 11,189 13,943 20,155 2011-2013 Warroad, MN 452 328 308 292 271 290 2011-2013 Babb, MT 1,028 931 1,946 2,200 2,103 2,386 2011-2013 Port of Del Bonita, MT 20 22 18 20 21 21 2011-2013 Port of Morgan, MT 55,965 58,896 59,252 59,822 61,514 57,958 2011-2013 Sweetgrass, MT 25 991 2011-2013 Whitlash, MT



Gasoline and Diesel Fuel Update (EIA)

Table. Table. 10 Summary of U.S. Natural Gas Imports By Point of Entry, 1997-2001 (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet) State 1997 1998 1999 2000 2001 Volume Price Volume Price Volume Price Volume Price Volume Price Pipeline (Canada) Eastport, ID ......................... 856,503 1.60 879,840 1.60 800,345 2.04 830,351 3.79 802,182 4.71 Calais, ME........................... NA NA NA NA NA NA 123,521 4.50 152,486 4.47 Detroit, MI ........................... 11,501 2.51 10,925 2.43 7,671 2.51 6,171 3.82 405 9.34 Marysville, MI ...................... NA NA 1,827 2.17 135 2.06 NA NA NA NA St. Clair, MI ......................... 11,855 3.16 34,592 2.07 33,388 2.62 17,198 4.45 21,747 4.54 International Falls, MN ........ 6,544 2.03 6,103 2.00 4,857 2.33 3,022 2.77 617 4.85 Noyes, MN .......................... 395,650 2.46 468,576 2.07 506,866 2.29


Table 10. Summary of U.S. natural gas imports by point of entry, 2007-2011  

Gasoline and Diesel Fuel Update (EIA)

7 7 Table 10. Summary of U.S. natural gas imports by point of entry, 2007-2011 (volumes in million cubic feet, prices in dollars per thousand cubic feet) See footnotes at end of table. Pipeline (Canada) Eastport, ID 704,429 6.31 688,782 7.88 693,892 3.86 708,806 4.19 606,099 3.90 Calais, ME 106,643 7.57 121,295 9.77 114,081 4.48 131,035 4.94 149,736 4.40 Detroit, MI 81 8.28 753 6.58 21 4.53 79 8.37 19 5.17 Marysville, MI 876 7.59 2,252 8.59 5,651 3.80 5,694 4.44 9,946 4.42 St. Clair, MI 9,633 6.97 9,104 10.03 6,544 5.10 5,591 4.97 5,228 4.29 Noyes, MN 499,863 6.72 476,948 8.48 478,368 4.21 447,079 4.49 544,135 4.15 Warroad, MN 4,813 6.75 4,800 8.50 4,380 4.24 4,325 4.69 4,551 4.17



Gasoline and Diesel Fuel Update (EIA)

Table. 10 Summary of U.S. Natural Gas Imports By Point of Entry, 1996-2000 (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet) State 1996 1997 1998 1999 2000 Volume Price Volume Price Volume Price Volume Price Volume Price Pipeline (Canada) Eastport, ID........................ 842,114 1.22 856,503 1.60 879,840 1.60 800,345 2.04 830,351 3.79 Calais, ME ......................... NA NA NA NA NA NA NA NA 123,521 4.50 Detroit, MI .......................... 14,901 2.75 11,501 2.51 10,925 2.43 7,671 2.51 6,171 3.82 Marrysville, MI ................... 10 3.48 NA NA 1,827 2.17 135 2.06 NA NA St. Clair, MI........................ 14,132 3.04 11,855 3.16 34,592 2.07 33,388 2.62 17,198 4.45 International Falls, MN....... 6,373 1.71 6,544 2.03 6,103 2.00 4,857 2.33 3,022 2.77 Noyes, MN ......................... 394,415 2.40 395,650 2.46 468,576 2.07 506,866 2.29


Energy Information Administration / Natural Gas Annual 2007 22  

Gasoline and Diesel Fuel Update (EIA)

2 2 Table 10. Summary of U.S. Natural Gas Imports By Point of Entry, 2003-2007 (Volumes in Million Cubic Feet, Prices in Nominal Dollars per Thousand Cubic Feet) Pipeline (Canada) Eastport, ID......................... 623,652 4.72 707,885 5.30 624,468 7.13 690,781 6.22 704,429 6.31 Calais, ME .......................... 115,301 5.85 102,292 6.44 135,162 9.40 105,650 7.73 106,643 7.57 Detroit, MI ........................... 2,514 5.96 1,117 6.27 0 -- 0 -- 81 8.28 Marysville, MI...................... 0 -- 303 7.80 0 -- 24 7.07 876 7.59 St. Clair, MI ......................... 5,202 5.84 22,853 6.50 18,281 9.93 10,410 7.44 9,633 6.97 International Falls, MN ........ 0 -- 0 -- 22 11.20 0 -- 0 -- Noyes, MN .......................... 359,801 5.04 399,298 5.77 467,595 8.01 419,284 6.82 499,863


Energy Information Administration / Natural Gas Annual 2006 20  

Gasoline and Diesel Fuel Update (EIA)

0 0 Table 10. Summary of U.S. Natural Gas Imports By Point of Entry, 2002-2006 (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet) Pipeline (Canada) Eastport, ID......................... 759,647 2.83 623,652 4.72 707,885 5.30 624,468 7.13 690,781 6.22 Calais, ME .......................... 124,991 3.49 115,301 5.85 102,292 6.44 135,162 9.40 105,650 7.73 Detroit, MI ........................... 1,948 3.56 2,514 5.96 1,117 6.27 0 -- 0 -- Marysville, MI...................... 74 3.95 0 -- 303 7.80 0 -- 24 7.07 St. Clair, MI ......................... 28,441 3.19 5,202 5.84 22,853 6.50 18,281 9.93 10,410 7.44 International Falls, MN ........ 602 3.01 0 -- 0 -- 22 11.20 0 -- Noyes, MN .......................... 402,621 3.09 359,801 5.04 399,298 5.77 467,595 8.01 419,284

Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Energy Information Administration / Natural Gas Annual 2005 20  

Gasoline and Diesel Fuel Update (EIA)

0 0 Table 10. Summary of U.S. Natural Gas Imports By Point of Entry, 2001-2005 (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet) Pipeline (Canada) Eastport, ID......................... 802,182 4.71 759,647 2.83 623,652 4.72 707,885 5.30 624,468 7.13 Calais, ME .......................... 152,486 4.47 124,991 3.49 115,301 5.85 102,292 6.44 135,162 9.40 Detroit, MI ........................... 405 9.34 1,948 3.56 2,514 5.96 1,117 6.27 0 -- Marysville, MI...................... 0 -- 74 3.95 0 -- 303 7.80 0 -- St. Clair, MI ......................... 21,747 4.54 28,441 3.19 5,202 5.84 22,853 6.50 18,281 9.93 International Falls, MN ........ 617 4.85 602 3.01 0 -- 0 -- 22 11.20 Noyes, MN .......................... 448,898 4.19 402,621 3.09 359,801 5.04 399,298



Gasoline and Diesel Fuel Update (EIA)

Table. 10 Summary of U.S. Natural Gas Imports By Point of Entry, 1998-2002 (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet) State 1998 1999 2000 2001 2002 Volume Price Volume Price Volume Price Volume Price Volume Price Pipeline (Canada) Eastport, ID ......................... 879,840 1.60 800,345 2.04 830,351 3.79 802,182 4.71 759,647 2.83 Calais, ME ........................... NA NA NA NA 123,521 4.50 152,486 4.47 124,991 3.49 Detroit, MI............................ 10,925 2.43 7,671 2.51 6,171 3.82 405 9.34 1,948 3.56 Marysville, MI ...................... 1,827 2.17 135 2.06 NA NA NA NA 74 3.95 St. Clair, MI ......................... 34,592 2.07 33,388 2.62 17,198 4.45 21,747 4.54 28,441 3.19 International Falls, MN ........ 6,103 2.00 4,857 2.33 3,022 2.77 617 4.85 602 3.01 Noyes, MN........................... 468,576 2.07 506,866 2.29 469,361


Table 9. Summary of U.S. natural gas imports by point of entry, 2008-2012  

U.S. Energy Information Administration (EIA) Indexed Site

6 6 Table 9. Summary of U.S. natural gas imports by point of entry, 2008-2012 (volumes in million cubic feet, prices in dollars per thousand cubic feet) See footnotes at end of table. Pipeline (Canada) Eastport, ID 688,782 7.88 693,892 3.86 708,806 4.19 606,099 3.90 634,194 2.59 Calais, ME 121,295 9.77 114,081 4.48 131,035 4.94 149,736 4.40 76,540 3.44 Detroit, MI 753 6.58 21 4.53 79 8.37 19 5.17 0 -- Marysville, MI 2,252 8.59 5,651 3.80 5,694 4.44 9,946 4.42 8,099 2.99 St. Clair, MI 9,104 10.03 6,544 5.10 5,591 4.97 5,228 4.29 3,531 2.64 Noyes, MN 476,948 8.48 478,368 4.21 447,079 4.49 544,135 4.15 401,717 2.86 Warroad, MN 4,800 8.50 4,380 4.24 4,325 4.69 4,551 4.17 4,610 3.06


Energy Information Administration / Natural Gas Annual 2010 23  

Gasoline and Diesel Fuel Update (EIA)

3 3 Table 10. Summary of U.S. Natural Gas Imports By Point of Entry, 2006-2010 (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet) Pipeline (Canada) Eastport, ID......................... 690,781 6.22 704,429 6.31 688,782 7.88 693,892 3.86 708,806 4.19 Calais, ME .......................... 105,650 7.73 106,643 7.57 121,295 9.77 114,081 4.48 131,035 4.94 Detroit, MI ........................... 0 -- 81 8.28 753 6.58 21 4.53 79 8.37 Marysville, MI...................... 24 7.07 876 7.59 2,252 8.59 5,651 3.80 5,694 4.44 St. Clair, MI ......................... 10,410 7.44 9,633 6.97 9,104 10.03 6,544 5.10 5,591 4.97 Noyes, MN .......................... 419,284 6.82 499,863 6.72 476,948 8.48 478,368 4.21 447,079 4.49 Warroad, MN ......................


Detroit, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

27°, -83.0457538° 27°, -83.0457538° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.331427,"lon":-83.0457538,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Detroit Public Lighting Department - Commercial and Industrial...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

HVAC Equipment: 10-30ton Programmable Thermostat: 80 Window Glazing: 0.30square foot Window Film: 0.20 Chillers: 7 - 40ton Variable Frequency Drives: 70-180...


Detroit Public Lighting Department - Residential Energy Wise...  

Open Energy Info (EERE)

Multi-Family Residential, Residential Eligible Technologies Ceiling Fan, Lighting, LED Lighting Active Incentive Yes Implementing Sector Utility Energy Category Energy...


Detroit Edison Co | Open Energy Information  

Open Energy Info (EERE)



Southern California: The Detroit of Electric Cars?  

E-Print Network (OSTI)

electric cars as a potential solution. and susceptible to rapid change; (c) con- ulations governing vehicle safety

Scott, Allen J.



Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Clean Fleets Announcement 1 of 14 Clean Fleets Announcement Untitled Secretary Chu Visits Dublin, Ireland 110410-110510 Keep Your Home Office Efficient with ENERGY STAR. Home...


The Regeneration of Urban Empty Space / Detroit.  

E-Print Network (OSTI)

??The depopulation of once-major central cities is no longer an uncommon occurrence. Between the years 1950 and 2010, over 350 large cities worldwide lost a… (more)

Hall, Philip A.



Sub[urban] Detroit: Mediating the Expression.  

E-Print Network (OSTI)

??In an era commodified by images and sounds throughout the global public landscape, architecture is not only being transformed by new technology, but by the… (more)

Karalambo, Paul N.



Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A New Energy-Efficient Home in the D.C. Community Solar Decathlon at Home in the D.C. Community Record-Breaking Solar Game-Changing Advancements in Solar Energy Energy Pumpkin...


Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Supercomputers' Pictorial Superpowers How the Smart Grid Helps Homeowners Reduce Their Energy Use EcoCAR Challenge Finish Line Event 1 of 8 Students Earn Street Cred With the...


Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Management Trade Show Supercomputers' Pictorial Superpowers How the Smart Grid Helps Homeowners Reduce Their Energy Use EcoCAR Challenge Finish Line Event 1 of 8 Students Earn...


Southern California: The Detroit of Electric Cars?  

E-Print Network (OSTI)

by building a new electric-vehicle industry in Southerntime being, the electric vehicle industry electric-vehicleindustry into the electric-vehicle industry. • Inclusion of

Scott, Allen J.



Detroit Auto Show 2012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Saving Energy and Resources Revolutionizing Manufacturing INFOGRAPHIC: Wind Energy in America National Wind Technology Center - Colorado America's Wind Testing Facilities Beyond...


Giant tunneling magnetoresistance in Co{sub 2}MnSi/Al-O/Co{sub 2}MnSi magnetic tunnel junctions  

SciTech Connect

Magnetic tunnel junctions (MTJs) with a stacking structure of Co{sub 2}MnSi/Al-O/Co{sub 2}MnSi were fabricated using magnetron sputtering system. Fabricated MTJ exhibited an extremely large tunneling magnetoresistance (TMR) ratio of 570% at low temperature, which is the highest TMR ratio reported to date for an amorphous Al-O tunneling barrier. The observed dependence of tunneling conductance on bias voltage clearly reveals the half-metallic energy gap of Co{sub 2}MnSi. The origins of large temperature dependence of TMR ratio were discussed on the basis of the present results.

Sakuraba, Y.; Hattori, M.; Oogane, M.; Ando, Y.; Kato, H.; Sakuma, A.; Miyazaki, T.; Kubota, H. [Department of Applied Physics, Graduate School of Engineering, Tohoku University, Aoba-yama 6-6-05, Aramaki, Aoba-ku, Sendai 980-8579 (Japan); Nanoelectronics Research Institute, National Institute of Advanced Industrial Science and Technology (AIST), 1-1-1 Umezono, Tsukuba 305-8568 (Japan)



Large energy absorption in Ni-Mn-Ga/polymer composites  

SciTech Connect

Ferromagnetic shape memory alloys can respond to a magnetic field or applied stress by the motion of twin boundaries and hence they show large hysteresis or energy loss. Ni-Mn-Ga particles made by spark erosion have been dispersed and oriented in a polymer matrix to form pseudo 3:1 composites which are studied under applied stress. Loss ratios have been determined from the stress-strain data. The loss ratios of the composites range from 63% to 67% compared to only about 17% for the pure, unfilled polymer samples.

Feuchtwanger, Jorge; Richard, Marc L.; Tang, Yun J.; Berkowitz, Ami E.; O'Handley, Robert C.; Allen, Samuel M. [Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States); University of California, San Diego, La Joya, California 92093 (United States); Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States)



Microsoft Word - table_11.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 Table 11. Summary of U.S. Natural Gas Exports By Point of Exit, 2005-2009 (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet) Pipeline (Canada) Calais, ME .......................... 0 -- 0 -- 0 -- 0 -- 2,131 5.62 Detroit, MI ........................... 40,255 8.12 22,156 7.61 22,904 6.88 27,220 8.37 43,980 4.01 Eastport, ID......................... 0 -- 0 -- 0 -- 252 7.43 113 4.49 Marysville, MI...................... 5,222 7.92 3,483 7.36 9,158 7.77 8,756 7.48 14,925 4.85 Sault Ste. Marie, MI ............ 5,537 8.13 5,070 8.11 4,389 7.13 3,122 8.75 2,044 5.04 St. Clair, MI ......................... 286,804 7.77 286,582 7.39 418,765 7.24 R 492,235 R 8.96 612,369 4.62 Noyes, MN .......................... 0 -- 0 -- 0 -- 0 -- 0 -- Babb, MT ............................

Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - table_11.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 Table 11. Summary of U.S. Natural Gas Exports By Point of Exit, 2003-2007 (Volumes in Million Cubic Feet, Prices in Nominal Dollars per Thousand Cubic Feet) Pipeline (Canada) Eastport, ID......................... 15 4.34 48 5.36 0 -- 0 -- 0 -- Detroit, MI ........................... 19,737 5.47 40,030 6.47 40,255 8.12 22,156 7.61 22,904 6.88 Marysville, MI...................... 811 5.06 4,455 6.83 5,222 7.92 3,483 7.36 9,158 7.77 Sault Ste. Marie, MI ............ 605 4.94 6,666 6.38 5,537 8.13 5,070 8.11 4,389 7.13 St. Clair, MI ......................... 238,444 6.13 317,797 6.56 286,804 7.77 286,582 7.39 418,765 7.24 Noyes, MN .......................... 172 5.43 2,193 5.77 0 -- 0 -- 0 -- Babb, MT ............................ 38 6.48 1,429 4.98 0 -- 0 -- 0 -- Havre, MT ...........................


Microsoft Word - table_11.doc  

Gasoline and Diesel Fuel Update (EIA)

4 4 Table 11. Summary of U.S. Natural Gas Exports By Point of Exit, 2001-2005 (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet) Pipeline (Canada) Eastport, ID......................... 0 -- 176 4.40 15 4.34 48 5.36 0 -- Detroit, MI ........................... 35,644 4.57 7,431 3.03 19,737 5.47 40,030 6.47 40,255 8.12 Marysville, MI...................... 3,651 3.92 0 -- 811 5.06 4,455 6.83 5,222 7.92 Sault Ste. Marie, MI ............ 0 -- 0 -- 605 4.94 6,666 6.38 5,537 8.13 St. Clair, MI ......................... 122,293 3.82 164,084 3.42 238,444 6.13 317,797 6.56 286,804 7.77 Noyes, MN .......................... 0 -- 71 1.99 172 5.43 2,193 5.77 0 -- Babb, MT ............................ 549 3.55 143 2.28 38 6.48 1,429 4.98 0 -- Havre, MT ...........................


Table 11. Summary of U.S. natural gas exports by point of exit, 2008-2012  

U.S. Energy Information Administration (EIA) Indexed Site

1 1 Table 11. Summary of U.S. natural gas exports by point of exit, 2008-2012 (volumes in million cubic feet, prices in dollars per thousand cubic feet) See footnotes at end of table. Pipeline (Canada) Eastport, ID 252 7.43 113 4.49 12 5.85 10 4.74 0 -- Calais, ME 0 -- 2,131 5.62 452 4.53 1,028 4.46 6,952 4.30 Detroit, MI 27,220 8.37 43,980 4.01 44,275 4.69 43,690 4.26 50,347 3.10 Marysville, MI 8,756 7.48 14,925 4.85 22,198 4.87 41,964 4.48 42,866 3.18 Sault Ste. Marie, MI 3,122 8.75 2,044 5.04 4,011 5.27 9,555 4.23 24,913 3.20 St. Clair, MI 492,235 8.96 612,369 4.62 650,590 4.86 781,058 4.45 754,494 3.11 Noyes, MN 0 -- 0 -- 0 -- 3,975 3.90 11,768 3.46 Babb, MT 0 -- 0


U.S. Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA) Indexed Site

25,575 142,032 133,749 128,589 130,297 122,391 1997-2013 25,575 142,032 133,749 128,589 130,297 122,391 1997-2013 To Canada 70,735 81,695 75,846 66,473 68,325 69,733 1973-2013 Eastport, ID 6 2011-2013 Calais, ME 2,021 1,528 433 652 122 185 2011-2013 Detroit, MI 3,571 4,430 3,769 3,933 4,131 3,885 2011-2013 Marysville, MI 2,983 1,470 995 1,856 1,521 1,400 2011-2013 Sault Ste. Marie, MI 1,531 1,171 935 1,231 849 911 2011-2013 St. Clair, MI 43,917 56,075 54,114 42,609 45,524 47,795 2011-2013 Noyes, MN 76 171 316 1,331 447 445 2011-2013 Babb, MT 2011-2011 Havre, MT 184 188 174 177 183 166 2011-2013 Pittsburg, NH 2011-2013 Grand Island, NY 47 20 10 10 11 2011-2013 Massena, NY 2012-2012 Niagara Falls, NY 13,738 13,789 13,174 13,904 13,939 13,022 2011-2013 Waddington, NY


Microsoft Word - table_11.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 Table 11. Summary of U.S. Natural Gas Exports By Point of Exit, 2004-2008 (Volumes in Million Cubic Feet, Prices in Nominal Dollars per Thousand Cubic Feet) Pipeline (Canada) Eastport, ID......................... 48 5.36 0 -- 0 -- 0 -- 252 7.43 Detroit, MI ........................... 40,030 6.47 40,255 8.12 22,156 7.61 22,904 6.88 27,220 8.37 Marysville, MI...................... 4,455 6.83 5,222 7.92 3,483 7.36 9,158 7.77 8,756 7.48 Sault Ste. Marie, MI ............ 6,666 6.38 5,537 8.13 5,070 8.11 4,389 7.13 3,122 8.75 St. Clair, MI ......................... 317,797 6.56 286,804 7.77 286,582 7.39 418,765 7.24 524,065 8.98 Noyes, MN .......................... 2,193 5.77 0 -- 0 -- 0 -- 0 -- Babb, MT ............................ 1,429 4.98 0 -- 0 -- 0 -- 0 -- Havre, MT ...........................


Specific DNA cleavage mediated by [SalenMn(III)][sup +  

Science Conference Proceedings (OSTI)

The combination of [SalenMn(III)][sup +] and a terminal oxidant affords efficient and specific cleavage of right-handed double-helical DNA in regions rich in A:T base pairs. Metal complexes of the tetradentate chelating ligands Salen (Salen = N,N[prime]-ethylenebis(salicylideneaminato)) have been part of the inorganic chemistry literature for several decades. The cationic manganese(III) complex [SalenMn(III)][sup +] (1) is an efficient catalyst for the epoxidation of olefins with terminal oxidants such as iodosylbenzene. 1 also catalyzes oxidative C-H bond activation. The flat, crescent shape of 1, its aromatic and cationic nature, and its ability to catalyze hydrocarbon oxidation are features shared in whole or in part by metal complexes which bind to DNA and cleave it via oxidative processes. These similarities prompted the authors to evaluate the DNA-cleaving properties of 1, and they now report that 1 mediates specific cleavage of right-handed double-helical DNA in a reaction requiring a terminal oxidant. 20 refs., 3 figs., 1 tab.

Gravert, D.J.; Griffin, J.H. (Stanford Univ., CA (United States))



Dietary resveratrol administration increases MnSOD expression and activity in mouse brain  

E-Print Network (OSTI)

SOD protein level (140%) and activity (75%). The increase in MnSOD was not due to a substantial proliferationDietary resveratrol administration increases MnSOD expression and activity in mouse brain Ellen L oxidative stress. In vitro studies have shown an increase in antioxidant enzyme activities following

Stuart, Jeffrey A.


Synthesis and Characterization of MnO2-Based Mixed Oxides as Supercapacitors  

E-Print Network (OSTI)

Synthesis and Characterization of MnO2-Based Mixed Oxides as Supercapacitors Hansung Kim. Available electronically January 28, 2003. The development of a high-power-density supercapacitor made to develop supercapacitors based on non-noble oxides.13 Hydrous manganese oxide (a-MnO2 · nH2O

Popov, Branko N.


Element-specific study of the temperature dependent magnetization of Co-Mn-Sb thin films  

SciTech Connect

Magnetron sputtered thin Co-Mn-Sb films were investigated with respect to their element-specific magnetic properties. Stoichiometric Co{sub 1}Mn{sub 1}Sb{sub 1} crystallized in the C1{sub b} structure has been predicted to be half-metallic and is therefore of interest for spintronics applications. It should show a characteristic antiferromagnetic coupling of the Mn and Co magnetic moments and a transition temperature T{sub C} of about 480K. Although the observed transition temperature of our 20nm thick Co{sub 32.4}Mn{sub 33.7}Sb{sub 33.8}, Co{sub 37.7}Mn{sub 34.1}Sb{sub 28.2} and Co{sub 43.2}Mn{sub 32.6}Sb{sub 24.2} films is in quite good agreement with the expected value, we found a ferromagnetic coupling of the Mn and Co magnetic moments which indicates that the films do not crystallize in the C1{sub b} structure and are probably not fully spin-polarized. The ratio of the Co and Mn moments does not change up to the transition temperature and the temperature dependence of the magnetic moments can be well described by the mean field theory.

Schmalhorst, J.; Ebke, D.; Meinert, M.; Thomas, A.; Reiss, G.; Arenholz, E.



Cation Effects on the Layer Structure of Biogenic Mn-Oxides  

E-Print Network (OSTI)

Radiation Lightsource (SSRL). Wet sample slurries were placed in an aluminum sample cell with Lexan windows-bs (Samuel Webb, SSRL). Two Mn-oxide references, triclinic birnessite (TcBir) and -MnO2 were synthesized and Environmental and Quality (ISEQ) Graduate Fellowship. M.Z. also thanks Dr. Samuel Webb at SSRL for his help

Sparks, Donald L.


[Characterization of lignin and Mn peroxidases from Phanerochaete chrysosporium]. Progress report  

DOE Green Energy (OSTI)

Lignin peroxidases were investigated with respect to enzyme kinetics and NMR spectroscopy of the heme domain. MN peroxidases were studied with respect to the role of oxalate in enzyme activity, the NMR spectroscopy of the heme domain. Gene expression of both lignin and MN peroxidases were examined as well as expression of site-directed mutants aimed at scale up production of these enzymes.

Not Available



Electric-Field Modulation of Curie Temperature in (Ga, Mn)As Field-Effect Transistor Structures with Varying Channel Thickness and Mn Compositions  

SciTech Connect

We have investigated the change of T{sub C} of ferromagnetic semiconductor (Ga, Mn)As by changing hole concentration p. The field effect transistor structure was utilized to change p. The relation T{sub C}propor top{sup 0.2} is obtained for three samples, despite the difference of their Mn composition and thickness, indicating that the relation holds over 2 decades of p.

Nishitani, Y.; Endo, M. [Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Chiba, D. [Semiconductor Spintronics Project, Exploratory Research for Advanced Technology, Japan Science and Technology Agency, Sanban-cho 5, Chiyoda-ku, Tokyo 102-0075 (Japan); Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Matsukura, F.; Ohno, H. [Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Semiconductor Spintronics Project, Exploratory Research for Advanced Technology, Japan Science and Technology Agency, Sanban-cho 5, Chiyoda-ku, Tokyo 102-0075 (Japan)



Estudo das propriedades termomecânicas da liga cu 78,3% - al 9,8% mn 11,9%.  

E-Print Network (OSTI)

??The alloys Cu 78,3% - Al 9,8% - Mn 11,9 and 77.5% Cu - Al 9.8% - Mn 11,9% -% Nb 0.5 - 0.3% Ni… (more)

Rafael Evaristo Caluête



Scanning tunneling microscopy reveals LiMnAs is a room temperature anti-ferromagnetic semiconductor  

SciTech Connect

We performed scanning tunneling microscopy and spectroscopy on a LiMnAs(001) thin film epitaxially grown on an InAs(001) substrate by molecular beam epitaxy. While the in situ cleavage exposed only the InAs(110) non-polar planes, the cleavage continued into the LiMnAs thin layer across several facets. We combined both topography and current mappings to confirm that the facets correspond to LiMnAs. By spectroscopy we show that LiMnAs has a band gap. The band gap evidenced in this study, combined with the known Neel temperature well above room temperature, confirms that LiMnAs is a promising candidate for exploring the concepts of high temperature semiconductor spintronics based on antiferromagnets.

Wijnheijmer, A. P.; Koenraad, P. M. [COBRA Inter-University Research Institute, Department of Applied Physics, Eindhoven University of Technology, P. O. Box 513, NL-5600 MB Eindhoven (Netherlands); Marti, X. [Faculty of Mathematics and Physics, Charles University in Prague, Ke Karlovu 3, 121 16 Prague 2 (Czech Republic); Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Prague 6 (Czech Republic); Holy, V. [Faculty of Mathematics and Physics, Charles University in Prague, Ke Karlovu 3, 121 16 Prague 2 (Czech Republic); Cukr, M.; Novak, V. [Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Prague 6 (Czech Republic); Jungwirth, T. [Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Prague 6 (Czech Republic); School of Physics and Astronomy, University of Nottingham, Nottingham NG7 2RD (United Kingdom)



Improvement of Thermal Stability of Li-Ion Batteries by Polymer Coating of LiMn2O4  

E-Print Network (OSTI)

lithium-ion battery by arresting the Mn + dissolution, thereby increasing the battery stability. Key Words: Lithium Battery, Cathode,

Stroeve, Pieter; Vidu, Ruxandra



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Manganese trends in a sample of thin and thick disk stars. The origin of Mn  

E-Print Network (OSTI)

CONTEXT: Manganese is an iron-peak element and although the nucleosynthesis path that leads to its formation is fairly well understood, it remains unclear which objects, SN II and/or SN Ia, that contribute the majority of Mn to the interstellar medium. It also remains unclear to which extent the supernovae Mn yields depend on the metallicity of the progenitor star or not. AIMS: By using a well studied and well defined sample of 95 dwarf stars we aim at further constraining the formation site(s) of Mn. METHODS: We derive Mn abundances through spectral synthesis of four Mn I lines at 539.4, 549.2, 601.3, and 601.6 nm. Stellar parameters and data for oxygen are taken from Bensby et al. (2003, 2004, 2005). RESULTS: When comparing our Mn abundances with O abundances for the same stars we find that the abundance trends in the stars with kinematics of the thick disk can be explained by metallicity dependent yields from SN II. We go on and combine our data for dwarf stars in the disks with data for dwarf and giant stars in the metal-poor thick disk and halo from the literature. We find that dwarf and giant stars show the same trends, which indicates that neither non-LTE nor evolutionary effects are a major concern for Mn. Furthermore, the [Mn/O] vs [O/H] trend in the halo is flat. CONCLUSIONS: We conclude that the simplest interpretation of our data is that Mn is most likely produced in SN II and that the Mn yields for such SNae must be metallicity dependent. Contribution from SN Ia in the metal-rich thin disk can not, however, be excluded.

S. Feltzing; M. Fohlman; T. Bensby



Low temperature hydrothermally synthesized nanocrystalline orthorhombic LiMnO2 cathode material for lithium-ion cells  

Science Conference Proceedings (OSTI)

Nanocrystalline orthorhombic LiMnO2 particles with an average particle size of about 35 nm in diameter were successfully synthesized by a hydrothermal process at 160-180 °C from trimanganese tetroxide (Mn3O4) prepared ... Keywords: hydrothermal process, lithium ion battery, nanocrystalline, orthorhombic LiMnO2, solvothermal process

Mengqiang Wu; Ai Chen; Rongqing Xu; Yue Li



A rational self-sacrificing template route to LiMn2O4nanotubes and nanowires  

Science Conference Proceedings (OSTI)

Single-crystalline LiMn2O4 nanotubes and nanowires have been synthesized via a low-temperature molten salt synthesis method, using the prepared ?-MnO2 nanotubes and ?-MnO2 nanowires as the precursors ...

Baojun Yang; Xinsong Yuan; Duoli Chai



Recrystallization behavior of a supersaturated Al Mn alloy  

SciTech Connect

The effect of concurrent precipitation on recrystallization behavior during the isothermal annealing of a supersaturated and deformed Al-Mn alloy was investigated. It is found that concurrent precipitation strongly affects the recrystallization behavior of this alloy. At low temperatures, concurrent precipitation retards recrystallization and results in large flat grains. The size of recrystallized grains decreases significantly with increasing temperature. The kinetics of recrystallization was determined by measurements of hardness. The JMAK exponent decreases from 3.0 to 0.8 as the annealing temperature increases from 371 C to 427 C. The activation energy for recrystallization of the alloy is about 456 kJ/mol. Concurrent precipitation enhances the activation energy for recrystallization of aluminum alloys.

Radhakrishnan, Balasubramaniam [ORNL; Liu, W C [Yanshan University


Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Metalloantibiotic Mn(II)-bacitracin complex mimicking manganese superoxide dismutase  

SciTech Connect

Superoxide dismutase (SOD) activities of various metallobacitracin complexes were evaluated using the riboflavin-methionine-nitro blue tetrazolium assay. The radical scavenging activity of various metallobacitracin complexes was shown to be higher than those of the negative controls, e.g., free transition metal ions and metal-free bacitracin. The SOD activity of the complex was found to be in the order of Mn(II) > Cu(II) > Co(II) > Ni(II). Furthermore, the effect of bacitracin and their complexation to metals on various microorganisms was assessed by antibiotic susceptibility testing. Moreover, molecular modeling and quantum chemical calculation of the metallobacitracin complex was performed to evaluate the correlation of electrostatic charge of transition metal ions on the SOD activity.

Piacham, Theeraphon [Department of Clinical Microbiology, Faculty of Medical Technology, Mahidol University, Bangkok 10700 (Thailand); Pure and Applied Biochemistry, Chemical Center, Lund University, P.O. Box 124, 22100 Lund (Sweden); Isarankura-Na-Ayudhya, Chartchalerm [Department of Clinical Microbiology, Faculty of Medical Technology, Mahidol University, Bangkok 10700 (Thailand); Nantasenamat, Chanin [Department of Clinical Microbiology, Faculty of Medical Technology, Mahidol University, Bangkok 10700 (Thailand); Yainoy, Sakda [Department of Clinical Microbiology, Faculty of Medical Technology, Mahidol University, Bangkok 10700 (Thailand); Ye Lei [Pure and Applied Biochemistry, Chemical Center, Lund University, P.O. Box 124, 22100 Lund (Sweden); Buelow, Leif [Pure and Applied Biochemistry, Chemical Center, Lund University, P.O. Box 124, 22100 Lund (Sweden); Prachayasittikul, Virapong [Department of Clinical Microbiology, Faculty of Medical Technology, Mahidol University, Bangkok 10700 (Thailand)]. E-mail: mtvpr@mucc.mahidol.ac.th



Interfacial studies of a thin-film Li2Mn4O9 electrode  

NLE Websites -- All DOE Office Websites (Extended Search)

Interfacial studies of a thin-film Li2Mn4O9 electrode Interfacial studies of a thin-film Li2Mn4O9 electrode Title Interfacial studies of a thin-film Li2Mn4O9 electrode Publication Type Journal Article Year of Publication 1999 Authors Kostecki, Robert, Fanping Kong, Yoshiaki Matsuo, and Frank R. McLarnon Journal Electrochimica Acta Volume 45 Pagination 225-233 Keywords interfacial films, manganese oxide electrode Abstract A thin-film spinel Li2Mn4O9 electrode was prepared by spin coating onto a Pt substrate. Spectroscopic ellipsometry, X-ray diffraction and current-sensing atomic force microscopy (CSAFM) were used to characterize interfacial processes and film formation at this electrode in the presence of 1.0 M LiPF6, EC:DMC (1:1 by volume) electrolyte. Prolonged exposure of the film to the electrolyte at ambient temperature resulted in spontaneous decomposition of the spinel to λ-MnO2 without disruption of the original structure. The surface of the resulting λ-MnO2 film exhibited no significant change in morphology, however a thin passive electrode surface layer was detected by the CSAFM probe. This electrode surface layer exhibited insulating properties and most likely contained Li2O, a by-product of Li2Mn4O9 decomposition.


Ferromagnetism in Mn-Implanted Epitaxially Grown Ge on Si(100)  

SciTech Connect

We have studied ferromagnetism of Mn-implanted epitaxial Ge films on silicon. The Ge films were grown by ultrahigh vacuum chemical vapor deposition using a mixture of germane (GeH{sub 4}) and methylgermane (CH{sub 3}GeH{sub 3}) gases with a carbon concentration of less than 1 at. %, and observed surface rms roughness of 0.5 nm, as measured by atomic force microscopy. Manganese ions were implanted in epitaxial Ge films grown on Si (100) wafers to an effective concentration of 16, 12, 6, and 2 at. %. Superconducting quantum interference device measurements showed that only the three highest Mn concentration samples are ferromagnetic, while the fourth sample, with [Mn] = 2 at. %, is paramagnetic. X-ray absorption spectroscopy and x-ray magnetic circular dichroism measurements indicate that localized Mn moments are ferromagnetically coupled below the Curie temperature. Isothermal annealing of Mn-implanted Ge films with [Mn] = 16 at. % at 300 C for up to 1200 s decreases the magnetization but does not change the Curie temperature, suggesting that the amount of the magnetic phase slowly decreases with time at this anneal temperature. Furthermore, transmission electron microscopy and synchrotron grazing incidence x-ray diffraction experiments show that the Mn-implanted region is amorphous, and we believe that it is this phase that is responsible for the ferromagnetism. This is supported by our observation that high-temperature annealing leads to recrystallization and transformation of the material into a paramagnetic phase.

Guchhait, S.; Jamil, M.; Ohldag, H.; Mehta, A.; Arenholz, E.; Lian, G.; Li Fatou, A.; Ferrer, D. A.; Markert, J. T.; Colombo, L.; Banerjee, S. K.



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 – 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Energy Transfer Dynamics and Dopant Luminescence in Mn-Doped CdS/ZnS Core/Shell Nanocrystals  

E-Print Network (OSTI)

Mn-doped II-VI semiconductor nanocrystals exhibit bright dopant photoluminescence that has potential usefulness for light emitting devices, temperature sensing, and biological imaging. The bright luminescence comes from the 4T1?6A1 transition of the Mn2+ d electrons after the exciton-dopant energy transfer, which reroutes the exciton relaxation through trapping processes. The driving force of the energy transfer is the strong exchange coupling between the exciton and Mn2+ due to the confinement of exciton in the nanocrystal. The exciton-Mn spatial overlap affecting the exchange coupling strength is an important parameter that varies the energy transfer rate and the quantum yield of Mn luminescence. In this dissertation, this correlation is studied in radial doping location-controlled Mn-doped CdS/ZnS nanocrystals. Energy transfer rate was found decreasing when increasing the doping radius in the nanocrystals at the same core size and shell thickness and when increasing the size of the nanocrystals at a fixed doping radius. In addition to the exciton-Mn energy transfer discussed above, two consecutive exciton-Mn energy transfers can also occur if multiple excitons are generated before the relaxation of Mn (lifetime ~10^-4 - 10^-2 s). The consecutive exciton-Mn energy transfer can further excite the Mn2+ d electrons high in conduction band and results in the quenching of Mn luminescence. The highly excited electrons show higher photocatalytic efficiency than the electrons in undoped nanocrystals. Finally, the effect of local lattice strain on the local vibrational frequency and local thermal expansion was observed via the temperature-dependent Mn luminescence spectral linewidth and peak position in Mn-doped CdS/ZnS nanocrystals. The local lattice strain on the Mn2+ ions is varied using the large core/shell lattice mismatch (~7%) that creates a gradient of lattice strain at various radial locations. When doping the Mn2+ closer to the core/shell interface, the stronger lattice strain softens the vibrational frequency coupled to the 4T1?6A1 transition of Mn2+ (Mn luminescence) by ~50%. In addition, the lattice strain also increases the anharmonicity, resulting in larger local thermal expansion observed from the nearly an order larger thermal shift of the Mn luminescence compared to the Mn-doped ZnS nanocrystals without the core/shell lattice mismatch.

Chen, Hsiang-Yun



Ni spin switching induced by magnetic frustration in FeMn/Ni/Cu(001)  

SciTech Connect

Epitaxially grown FeMn/Ni/Cu(001) films are investigated by Photoemission Electron Microscopy and Magneto-Optic Kerr Effect. We find that as the FeMn overlayer changes from paramagnetic to antiferromagnetic state, it could switch the ferromagnetic Ni spin direction from out-of-plane to in-plane direction of the film. This phenomenon reveals a new mechanism of creating magnetic anisotropy and is attributed to the out-of-plane spin frustration at the FeMn-Ni interface.

Wu, J.; Choi, J.; Scholl, A.; Doran, A.; Arenholz, E.; Hwang, Chanyong; Qiu, Z. Q.



Quantum Anomalous Hall Effect in Hg_1-yMn_yTe Quantum Wells  

SciTech Connect

The quantum Hall effect is usually observed when the two-dimensional electron gas is subjected to an external magnetic field, so that their quantum states form Landau levels. In this work we predict that a new phenomenon, the quantum anomalous Hall effect, can be realized in Hg{sub 1-y}Mn{sub y}Te quantum wells, without the external magnetic field and the associated Landau levels. This effect arises purely from the spin polarization of the Mn atoms, and the quantized Hall conductance is predicted for a range of quantum well thickness and the concentration of the Mn atoms. This effect enables dissipationless charge current in spintronics devices.

Liu, Chao-Xing; /Tsinghua U., Beijing /Stanford U., Phys. Dept.; Qi, Xiao-Liang; /Stanford U., Phys. Dept.; Dai, Xi; Fang, Zhong; /Beijing, Inst. Phys.; Zhang, Shou-Cheng; /Stanford U., Phys. Dept.



Demonstration of molecular beam epitaxy and a semiconducting band structure for I-Mn-V compounds  

SciTech Connect

Our ab initio theory calculations predict a semiconducting band structure of I-Mn-V compounds. We demonstrate on LiMnAs that high-quality materials with group-I alkali metals in the crystal structure can be grown by molecular beam epitaxy. Optical measurements on the LiMnAs epilayers are consistent with the theoretical electronic structure. Our calculations also reproduce earlier reports of high antiferromagnetic ordering temperature and predict large, spin-orbit-coupling-induced magnetic anisotropy effects. We propose a strategy for employing antiferromagnetic semiconductors in high-temperature semiconductor spintronics.

Jungwirth, T. [Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Praha 6 (Czech Republic); School of Physics and Astronomy, University of Nottingham, Nottingham NG7 2RD (United Kingdom); Novak, V.; Cukr, M.; Zemek, J. [Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Praha 6 (Czech Republic); Marti, X.; Horodyska, P.; Nemec, P.; Holy, V. [Faculty of Mathematics and Physics, Charles University in Prague, Ke Karlovu 3, 121 16 Prague 2 (Czech Republic); Maca, F.; Shick, A. B.; Masek, J.; Kuzel, P. [Institute of Physics ASCR, v.v.i., Na Slovance 2, 182 21 Praha 8 (Czech Republic); Nemec, I. [Faculty of Science, Charles University in Prague, Hlavova 2030, 128 40 Prague 2 (Czech Republic); Gallagher, B. L.; Campion, R. P.; Foxon, C. T. [School of Physics and Astronomy, University of Nottingham, Nottingham NG7 2RD (United Kingdom); Wunderlich, J. [Institute of Physics ASCR, v.v.i., Cukrovarnicka 10, 162 53 Praha 6 (Czech Republic); Hitachi Cambridge Laboratory, Cambridge CB3 0HE (United Kingdom)



Anomalous Stoichiometry Layered Structure and Magnetic Ordering of the Prussian Blue Analog [NEt4]2MnII3(CN)8  

Science Conference Proceedings (OSTI)

Atypical of Prussian blue structured materials, Mn{sup II} and [NEt{sub 4}]CN react to form [NEt{sub 4}]{sub 2}Mn{sub 3}(CN){sub 8} possessing layers of octahedral [Mn{sup II}(CN){sub 6}]{sup 4-} bonded to two high-spin tetrahedral Mn{sup II} sites.

J Her; P Stephens; C Kareis; J Moore; J Miller



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: © 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



100- The Effect of Mn and Pr Co-Doping on Electrical Properties of ...  

Science Conference Proceedings (OSTI)

144- The Role of Mn Content on Microstructure and Phases of High Alloyed White Cast Irons · 145- The Synergy of XRD and XRF in a Shale and Slate Analysis.


Characterization of LiNi?.?Mn?.?O? Thin Film Cathode Prepared by Pulsed Laser Deposition  

E-Print Network (OSTI)

LiNi?.?Mn?.?O? thin films have been grown by pulsed laser deposition (PLD) on stainless steel (SS) substrates. The crystallinity and structure of thin films were investigated by X-ray diffraction (XRD). Microstructure and ...

Xia, Hui


D11: Thermodynamic and Electrochemical Properties of the Mg-Mn ...  

Science Conference Proceedings (OSTI)

B7: Synthesis and Electrical Properties of K2NiF4-Type (Ca2-xLnx)MnO4 (Ln=Nd and Sm) · B8: Monitoring Oxygen Diffusion in Gd-Doped Ceria by Null ...


Mn solid solutions in self-assembled Ge/Si (001) quantum dot heterostructures  

SciTech Connect

Heteroepitaxial Ge{sub 0.98}Mn{sub 0.02} quantum dots (QDs) on Si (001) were grown by molecular beam epitaxy. The standard Ge wetting layer-hut-dome-superdome sequence was observed, with no indicators of second phase formation in the surface morphology. We show that Mn forms a dilute solid solution in the Ge quantum dot layer, and a significant fraction of the Mn partitions into a sparse array of buried, Mn-enriched silicide precipitates directly underneath a fraction of the Ge superdomes. The magnetic response from the ultra-thin film indicates the absence of robust room temperature ferromagnetism, perhaps due to anomalous intermixing of Si into the Ge quantum dots.

Kassim, J.; Nolph, C.; Reinke, P.; Floro, J. [Department of Materials Science and Engineering, University of Virginia, Charlottesville, Virginia 22904 (United States); Jamet, M. [Institut Nanosciences et Cryogenie/SP2M, CEA-UJF, F-38054 Grenoble (France)



Synthesis, characterization, and microwave-absorbing properties of polypyrrole/MnFe2O4 nanocomposite  

Science Conference Proceedings (OSTI)

Conductive polypyrrole (PPy)-manganese ferrite (MnFe2O4) nanocomposites with core-shell structure were synthesized by in situ polymerization in the presence of dodecyl benzene sulfonic acid (DBSA) as the surfactant and dopant and ...

Seyed Hossein Hosseini; Ahmad Asadnia



Aliovalent titanium substitution in layered mixed Li Ni-Mn-Co oxides for lithium battery applications  

Science Conference Proceedings (OSTI)

Improved electrochemical characteristics are observed for Li[Ni1/3Co1/3-yMyMn1/3]O2 cathode materials when M=Ti and ycapacity.

Kam, Kinson; Doeff, Marca M.



Electrophysical properties of semimagnetic solid solutions Hg 1?x Mn x Te  

Science Conference Proceedings (OSTI)

A comprehensive study of the electrophysical properties of the semimagnetic ternary solid solution Hg 1?x Mn x Te an alternative material to Hg 1?x Cd x Te is reported. The charge-carrier scattering

I. M. Nesmelova; V. N. Ryzhkov; M. I. Ibragimova; V. Yu. PetukhovKazan Physicotechnical Institute, Kazan Research Center of the Russian Academy of Sciences, Kazan?420029, Russia



Spin current switching and spin-filtering effects in Mn-doped boron nitride nanoribbons  

Science Conference Proceedings (OSTI)

The spin transport properties are investigated by means of the first principle approach for boron nitride nanoribbons with one or two substitutional Mn impurities, connected to graphene electrodes. The spin current polarization is evaluated using the ...

G. A. Nemnes



Mn Monolayer Modified Rh for Syngas-to-Ethanol Conversion: A First-Principles Study  

SciTech Connect

Rh is unique in its ability to convert syngas to ethanol with the help of promoters. We performed systematic first-principles computations to examine the catalytic performance of pure and Mn modified Rh(100) surfaces for ethanol formation from syngas. CO dissociation on the surface as well as CO insertion between the chemisorbed CH{sub 3} and the surface are the two key steps. The CO dissociation barrier on the Mn monolayer modified Rh(100) surface is remarkably lowered by {approx}1.5 eV compared to that on Rh(100). Moreover, the reaction barrier of CO insertion into the chemisorbed CH{sub 3} group on the Mn monolayer modified Rh(100) surface is 0.34 eV lower than that of methane formation. Thus the present work provides new mechanistic insight into the role of Mn promoters in improving Rh's selectivity to convert syngas to ethanol.

Li, Fengyu [University of Puerto Rico; Jiang, Deen [ORNL; Zeng, X.C. [University of Nebraska, Lincoln; Chen, Zhongfang [University of Puerto Rico


Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Southwest MN IPM STUFF All the pestilence that's fit to print  

E-Print Network (OSTI)

and soybeans during hot dry weather. Twospotted spider mites are favored by high temperatures and drought Southwest Research and Outreach Center 23669 130th Street Lamberton, MN 56152 Phone: 507.752.5066 Cell: 507

Amin, S. Massoud


Southwest MN IPM STUFF All the pestilence that's fit to print  

E-Print Network (OSTI)

started to show up. This could be a bad year for this disease. Cool wet spring and hot, dry late seasons Research and Outreach Center 23669 130th Street Lamberton, MN 56152 Phone: 507.752.5066 Cell: 507

Amin, S. Massoud


Formation of nano-crystalline todorokite from biogenic Mn Xiong Han Feng a,1  

E-Print Network (OSTI)

Formation of nano-crystalline todorokite from biogenic Mn oxides Xiong Han Feng a,1 , Mengqiang Zhu oxides in the environment. Additionally this method may be a viable biosynthesis route for porous, nano

Sparks, Donald L.


Building of a Novel Mn12 Single Molecule Magnet by Assembly of Anisotropic  

NLE Websites -- All DOE Office Websites (Extended Search)

Building of a Novel Mn12 Single Building of a Novel Mn12 Single Molecule Magnet by Assembly of Anisotropic Triangles Building of a Novel Mn12 Single Molecule Magnet by Assembly of Anisotropic Triangles Print Wednesday, 06 July 2011 12:58 Assembly of triangular {MnIII3(O)(salox)3}+ fragments mediated by azido ligands, results in the dodecanuclear [Mn12O4(salox)12(N3)4(MeOH)4(H2O)2] complex with S = 8 ground state and SMM response. After the discovery of the Single-Molecule-Magnet (SMM) behaviour of [Mn6(O)2(salox)6(R-COO)2] (salox = salicylaldoxime, R = Me, Ph) complexes in 2004,1 the chemistry of this family of [Mn6] clusters has been studied in depth: the systematic change of the carboxylato ligands, the study of substitutedR-saloxH2 related ligands,2 the effect of variation of the oxidation state,3 the response under pressure4 or the one-dimensional assembly of [Mn6] units into chains of clusters5 with Single-Chain-Magnet behaviour in some cases,5c,d turn this system into one of the best known in the SMM field. One of the main goals of this work, developed by Brechin et al. has been to modulate the value of the ground spin level, reaching the maximum possible spin S = 12 by means of the adequate choice of methyl or ethyl substituted salicylaldoximes and the understanding of the structural features that control the coupling inside the triangles. Article Link (PDF)


City of Detroit - SmartBuildings Detroit Green Fund Loan | Open...  

Open Energy Info (EERE)

insulation, glazing treatments, windows, doors, weatherstripping, insulated roofs, solar panels, geothermal installations, wind, hydroelectric, thermal load reduction, HVAC,...



SciTech Connect

The structure and chemical order of a Heusler alloy of non-stoichiometric composition Ni-Mn-Ga were studied using constant-wavelength (1.538 ) neutron diffraction at 363K and the diffraction pattern was refined using the FullProf software. At this temperature the structure is austenite (cubic) with Fm-3m space group and lattice constant of a = 5.83913(4) [ ]. The chemical order is of critical importance in these alloys, as Mn becomes antiferromagnetic when the atoms are closer than the radius of the 3d shell. In the studied alloy the refinement of the site occupancy showed that the 4b (Ga site) contained as much as 22% Mn; that significantly alters the distances between the Mn atoms in the crystal and, as a result, also the exchange energy between some of the Mn atoms. Based on the refinement, the composition was determined to be Ni1.91Mn1.29Ga0.8

Ari-Gur, Pnina [Western Michigan University; Garlea, Vasile O [ORNL



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI




Gasoline and Diesel Fuel Update (EIA)

Table. 11 Summary of U.S. Natural Gas Exports By Point of Exit, 1998-2002 (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet) Imports and Exports - Table 11 Pipeline (Canada) East Port, ID.............. NA NA NA NA NA NA NA NA 176 4.40 Detroit, MI.................. 24,908 2.26 25,049 2.30 36,007 3.74 35,644 4.57 7,431 3.03 Marysville, MI ............ 3,377 2.17 691 2.47 5,320 2.91 3,651 3.92 NA NA St. Clair, MI ............... 11,397 2.23 11,258 2.51 29,654 3.73 122,293 3.82 164,084 3.42 Noyes, MN ................ NA NA NA NA NA NA NA NA 71 1.99 Babb, MT................... NA NA NA NA NA NA 549 3.55 143 2.28 Havre, MT ................. NA NA 1,510 2.05 1,606 3.25 2,428 3.40 15,892 2.74 Port of Morgan, MT ... NA NA NA NA NA NA NA NA 1 3.47 Niagara Falls, NY ...... NA NA NA NA NA NA 594 2.49 39 5.04 Sumas, WA ............... 208 2.80 NA NA NA NA 1,529 4.44 1,477 2.59 Total..........................


Effects of laser irradiation on the self-assembly of MnAs nanoparticles in a GaAs matrix  

SciTech Connect

We investigate the effects of laser irradiation on the self-assembly of MnAs nanoparticles during solid-phase decomposition in a GaAs matrix. It is found that laser irradiation suppresses the growth of MnAs nanoparticles from small to large size, and that the median diameter D{sub 1} in the size distribution of small MnAs nanoparticles depends on the incident photon energy E following D{sub 1} {approx} E{sup -1/5}. We explain this behavior by the desorption of Mn atoms on the MnAs nanoparticle surface due to resonant optical absorption, in which incident photons excite intersubband electronic transitions between the quantized energy levels in the MnAs nanoparticles.

Hai, Pham Nam; Nomura, Wataru [Department of Electrical Engineering and Information Systems, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Yatsui, Takashi; Ohtsu, Motoichi; Tanaka, Masaaki [Department of Electrical Engineering and Information Systems, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan); Nanophotonics Research Center, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 (Japan)



Magnetic field-induced phase transformation and variant reorientation in Ni2MnGa and NiMnCoIn magnetic shape memory alloys  

E-Print Network (OSTI)

The purpose of this work is to reveal the governing mechanisms responsible for the magnetic field-induced i) martensite reorientation in Ni2MnGa single crystals, ii) stress-assisted phase transformation in Ni2MnGa single crystals and iii) phase transformation in NiMnCoIn alloys. The ultimate goal of utilizing these mechanisms is to increase the actuation stress levels in magnetic shape memory alloys (MSMAs). Extensive experimental work on magneto-thermo-mechanical (MTM) characterization of these materials enabled us to i) better understand the ways to increase the actuation stress and strain and decrease the required magnetic field for actuation in MSMAs, ii) determine the effects of main MTM parameters on reversible magnetic field induced phase transformation, such as magnetocrystalline anisotropy energy (MAE), Zeeman energy (ZE), stress hysteresis, thermal hysteresis, critical stress for the stress induced phase transformation and crystal orientation, iii) find out the feasibility of employing polycrystal MSMAs, and iv) formulate a thermodynamical framework to capture the energetics of magnetic field-induced phase transformations in MSMAs. Magnetic shape memory properties of Ni2MnGa single crystals were characterized by monitoring magnetic field-induced strain (MFIS) as a function of compressive stress and stress-induced strain as a function of magnetic field. It is revealed that the selection of the operating temperature with respect to martensite start and Curie temperatures is critical in optimizing actuator performance. The actuation stress of 5 MPa and work output of 157 kJm?3 are obtained by the field-induced variant reorientation in NiMnGa alloys. Reversible and one-way stress-assisted field-induced phase transformations are observed in Ni2MnGa single crystals under low field magnitudes (transformation and shape memory characteristics of NiMnCoIn single crystals are also studied. Reversible field-induced phase transformation is observed only under high magnetic fields (>4T). Necessary magnetic and mechanical conditions, and materials design and selection guidelines are proposed to search for field-induced phase transformation in other ferromagnetic materials that undergo thermoelastic martensitic phase transformation.

Karaca, Haluk Ersin



U.S. Price of Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA) Indexed Site

2007 2008 2009 2010 2011 2012 View 2007 2008 2009 2010 2011 2012 View History U.S. Total 6.96 8.62 4.34 4.75 4.35 3.08 1985-2012 To Canada 7.17 8.86 4.59 4.84 4.45 3.17 1985-2012 Eastport, ID -- 7.43 4.49 5.85 4.74 -- 1998-2012 Calais, ME -- -- 5.62 4.53 4.46 4.30 2007-2012 Detroit, MI 6.88 8.37 4.01 4.69 4.26 3.10 1996-2012 Marysville, MI 7.77 7.48 4.85 4.87 4.48 3.18 1996-2012 Sault Ste. Marie, MI 7.13 8.75 5.04 5.27 4.23 3.20 1999-2012 St. Clair, MI 7.24 8.96 4.62 4.86 4.45 3.11 1996-2012 Noyes, MN -- -- -- -- 3.90 3.46 1998-2012 Warroad, MN 1999-2002 Babb, MT -- -- -- -- 3.39 -- 1996-2012 Havre, MT 6.16 8.14 3.63 4.05 3.82 2.40 1998-2012 Port of Morgan, MT 1998-2006 Sherwood, ND 1999-2006 Pittsburg, NH -- 7.61 -- -- 7.54 2.62 2007-2012


Properties of Ga{sub 1-x}Mn{sub x}As with high x (>0.1)  

SciTech Connect

We have investigated the magnetic and the crystalline properties of a set of Ga{sub 1-x}Mn{sub x}As layers with high nominal Mn compositions (x=0.101-0.198). Magnetization measurements and combined channeling Rutherford backscattering (c-RBS) and particle induced x-ray emission (c-PIXE) measurements have been performed to determine the effective Mn composition x{sub eff} and the fraction of Mn atoms at various lattice sites. Here, x{sub eff} determined from magnetization measurements, which increases with increasing x, is consistent with the results determined from c-RBS-PIXE measurements.

Chiba, D. [Semiconductor Spintronics Project, Exploratory Research for Advanced Technology, Japan Science and Technology Agency, Sendai 980-0023 (Japan); Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Yu, K. M.; Walukiewicz, W. [Electronic Materials Program, Materials Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94549 (United States); Nishitani, Y. [Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Matsukura, F.; Ohno, H. [Laboratory for Nanoelectronics and Spintronics, Research Institute of Electrical Communication, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan); Semiconductor Spintronics Project, Exploratory Research for Advanced Technology, Japan Science and Technology Agency, Sendai 980-0023 (Japan)



Mn-Stabilized Zirconia: From Imitation Diamonds to a New Potential High-T{sub C} Ferromagnetic Spintronics Material  

SciTech Connect

From the basis of ab initio electronic structure calculations which include the effects of thermally excited magnetic fluctuations, we predict Mn-stabilized cubic zirconia to be ferromagnetic above 500 K. We find this material, which is well known both as an imitation diamond and as a catalyst, to be half-metallic with the majority and minority spin Mn impurity states lying in zirconia's wide gap. The Mn concentration can exceed 40%. The high-T{sub C} ferromagnetism is robust to oxygen vacancy defects and to how the Mn impurities are distributed on the Zr fcc sublattice. We propose this ceramic as a promising future spintronics material.

Ostanin, S. [Max-Planck-Institut fuer Mikrostrukturphysik, Weinberg 2, D-06120 Halle (Saale) (Germany); Department of Physics, University of Warwick, Coventry CV4 7AL (United Kingdom); Ernst, A.; Sandratskii, L. M.; Bruno, P. [Max-Planck-Institut fuer Mikrostrukturphysik, Weinberg 2, D-06120 Halle (Saale) (Germany); Daene, M.; Hergert, W.; Mertig, I. [Martin-Luther-Universitaet Halle-Wittenberg, Fachbereich Physik, D-06099 Halle (Germany); Hughes, I. D.; Staunton, J. B. [Department of Physics, University of Warwick, Coventry CV4 7AL (United Kingdom); Kudrnovsky, J. [Max-Planck-Institut fuer Mikrostrukturphysik, Weinberg 2, D-06120 Halle (Saale) (Germany); Institute of Physics, Academy of Sciences of the Czech Republic, Na Slovance 2, CZ-18221 Prague 8 (Czech Republic)



Magnetic order near 270 K in mineral and synthetic Mn 2 FeSbO 6 ilmenite  

Science Conference Proceedings (OSTI)

The structural and magnetic properties of Mn 2 FeSbO 6 single-crystalline mineral and ceramic samples synthesized under thermobaric treatment have been investigated

R. Mathieu; S. A. Ivanov; G. V. Bazuev; M. Hudl; P. Lazor; I. V. Solovyev; P. Nordblad



Flexible Zn2SnO4/MnO2 Core/Shell Nanocable-Carbon Microfiber ...  

Science Conference Proceedings (OSTI)

Presentation Title, Flexible Zn2SnO4/MnO2 Core/Shell Nanocable-Carbon Microfiber Hybrid Composites for High-Performance Supercapacitor Electrodes.


U.S. Natural Gas Pipeline Exports by Point of Exit  

Annual Energy Outlook 2012 (EIA)

Eastport, ID 0 252 113 12 10 1998-2011 Calais, ME 0 0 2,131 452 1,028 6,952 2007-2011 Detroit, MI 22,904 27,220 43,980 44,275 43,690 50,347 1996-2011 Marysville, MI 9,158 8,756...


U.S. Natural Gas Pipeline Exports by Point of Exit  

Annual Energy Outlook 2012 (EIA)

1973-2013 Eastport, ID 2011-2011 Calais, ME 1,824 1,853 2,021 1,528 433 652 2011-2011 Detroit, MI 4,331 4,801 3,571 4,430 3,769 3,933 2011-2011 Marysville, MI 4,807 5,273 2,983...


Novel Solar Energy Conversion Materials by Design of Mn(II) Oxides  

Science Conference Proceedings (OSTI)

Solar energy conversion materials need to fulfill simultaneously a number of requirements in regard of their band-structure, optical properties, carrier transport, and doping. Despite their desirable chemical properties, e.g., for photo-electrocatalysis, transition-metal oxides usually do not have desirable semiconducting properties. Instead, oxides with open cation d-shells are typically Mott or charge-transfer insulators with notoriously poor transport properties, resulting from large effective electron/hole masses or from carrier self-trapping. Based on the notion that the electronic structure features (p-d interaction) supporting the p-type conductivity in d10 oxides like Cu2O and CuAlO2 occurs in a similar fashion also in the d5 (high-spin) oxides, we recently studied theoretically the band-structure and transport properties of the prototypical binary d5 oxides MnO and Fe2O3 [PRB 85, 201202(R)]. We found that MnO tends to self-trap holes by forming Mn+III, whereas Fe2O3 self-traps electrons by forming Fe+II. However, the self-trapping of holes is suppressed by when Mn is tetrahedrally coordinated, which suggests specific routes to design novel solar conversion materials by considering ternary Mn(II) oxides or oxide alloys. We are presenting theory, synthesis, and initial characterization for these novel energy materials.

Lany, S.; Peng, H.; Ndione, P.; Zakutayev, A.; Ginley, D. S.



Carbon/lambda-MnO{sub 2} composites for supercapacitor electrodes  

Science Conference Proceedings (OSTI)

In the present work a composite of carbon with lambda-MnO{sub 2} have been synthesized by a simple two-step route. In the first step, to obtain LiMn{sub 2}O{sub 4}/carbon material, mesoporous activated carbon was impregnated with the solution of precursor metal salts and heated subsequently. As-prepared materials were acid treated which resulted in the formation of lambda-MnO{sub 2}/carbon. Physical properties, structure and specific surface area of electrode materials were studied by TEM, X-ray diffraction and nitrogen sorption measurements. Voltammetry cycling, galvanostatic charge/discharge and impedance spectroscopy measurements performed in two- and three-electrode cells have been applied in order to measure electrochemical parameters. TEM images confirmed well dispersed lambda-MnO{sub 2} particles on the surface of carbon material. The carbon in the composite plays an important role as the surface area enhancing component and a support of pseudocapacitive material. Furthermore, the through-connected porosity serves as a continuous pathway for electrolyte transport. A synergetic effect of the porous carbon framework and of the redox properties of the lambda-MnO{sub 2} is at the origin of improvement of specific capacitance values which has been observed for composites after delithiation. - Comparison of capacitance characteristics for initial carbon and synthesised composites for CB in 1 mol L{sup -1} Na{sub 2}SO{sub 4} solution.

Malak-Polaczyk, A., E-mail: agnieszka-malak@wp.p [Institute of Chemistry and Technical Electrochemistry, Poznan University of Technology, Piotrowo 3, 60-695 Poznan (Poland); Institut de Sciences des Materiaux de Mulhouse, CNRS LRC 7228, 15 Rue Starcky, 68057 Mulhouse (France); Matei-Ghimbeu, C.; Vix-Guterl, C. [Institut de Sciences des Materiaux de Mulhouse, CNRS LRC 7228, 15 Rue Starcky, 68057 Mulhouse (France); Frackowiak, E. [Institute of Chemistry and Technical Electrochemistry, Poznan University of Technology, Piotrowo 3, 60-695 Poznan (Poland)


Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


High-Resolution Structure of the Photosynthetic Mn4Ca Catalyst from X-ray Spectroscopy  

Science Conference Proceedings (OSTI)

The application of high-resolution X-ray spectroscopy methods to study the photosynthetic water oxidizing complex, which contains a unique hetero-nuclear catalytic Mn4Ca cluster, are described. Issues of X-ray damage especially at the metal sites in the Mn4Ca cluster are discussed. The structure of the Mn4Ca catalyst at high-resolution which has so far eluded attempts of determination by X-ray diffraction, EXAFS and other spectroscopic techniques has been addressed using polarized EXAFS techniques applied to oriented PS II membrane preparations and PS II single crystals. A review of how the resolution of traditional EXAFS techniques can be improved, using methods such as range-extended EXAFS is presented, and the changes that occur in the structure of the cluster as it advances through the catalytic cycle are described. X-ray absorption and emission techniques (XANES and K? emission) have been used earlier to determine the oxidation states of the Mn4Ca cluster, and in this report we review the use of X-ray resonant Raman spectroscopy to understand the electronic structure of the Mn4Ca cluster as it cycles through the intermediate S-states.

Yachandra, Vittal; Yano, Junko; Kern, Jan; Pushkar, Yulia; Sauer, Kenneth; Glatzel, Pieter; Bergmann, Uwe; Messinger, Johannes; Zouni, Athina; Yachandra, Vittal K.



Investigation of Modified Ni-Cr-Mn Base Alloys for SOFC Interconnect Applications  

Science Conference Proceedings (OSTI)

Two Ni-Cr-W-Mn base alloys based on Haynes 230 were developed and evaluated against criteria relevant to SOFC interconnect applications, which included oxidation behavior under SOFC operating conditions, scale electrical conductivity, and thermal expansion. It was found that, similar to the ferritic stainless steel Crofer22 APU, additions of Mn led to the formation of a unique scale that was comprised of a M3O4 (M=Mn, Cr, Ni, …) spinel-rich top layer and Cr2O3-rich sub-layer. The modified alloys demonstrated reasonable oxidation resistance under SOFC operating conditions, though the Mn additions increased the scale growth rate and thus sacrificed to some extent the oxidation resistance of the base alloy (Haynes 230). The formation of a spinel-rich top layer improved the scale conductivity, especially during the early stages of oxidation, but the higher scale growth rate resulted in a higher rate of increase in the area-specific electrical resistance. Due to their FCC crystal structure, the Ni-Cr-W-Mn base alloys demonstrated a CTE that was higher than that of anode-supported cells and candidate ferritic stainless steels such as Crofer22 APU.

Yang, Z Gary; Singh, Prabhakar; Stevenson, Jeffry W.; Xia, Gordon



A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



Xcel Energy - Solar*Rewards Program and MN Made PV Rebate Program |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Xcel Energy - Solar*Rewards Program and MN Made PV Rebate Program Xcel Energy - Solar*Rewards Program and MN Made PV Rebate Program Xcel Energy - Solar*Rewards Program and MN Made PV Rebate Program < Back Eligibility Commercial Local Government Nonprofit Residential Savings Category Solar Buying & Making Electricity Maximum Rebate $90,000 (as determined by the incentive level and maximum system size) Program Info Start Date 03/01/2010 State Minnesota Program Type Utility Rebate Program Rebate Amount REC Rebate Program 2010-2012:$2.25/W DC REC Rebate Program 2013:$1.50/W DC Minnesota Made Bonus 2010-2012:Up to an additional $2.75/W DC (paired with REC Rebate) Provider Xcel Energy '''''Note: All 2012 funding for the Solar*Rewards program and Minnesota Made Bonus has been reserved as of July 11, 2012. On October 1, 2012, the


In-situ spectro-microscopy on organic films: Mn-Phthalocyanine on Ag(100)  

SciTech Connect

Metal phthalocyanines are attracting significant attention, owing to their potential for applications in chemical sensors, solar cells and organic magnets. As the electronic properties of molecular films are determined by their crystallinity and molecular packing, the optimization of film quality is important for improving the performance of organic devices. Here, we present the results of in situ low-energy electron microscopy / photoemission electron microscopy (LEEM/PEEM) studies of incorporation-limited growth [1] of manganese-phthalocyanine (MnPc) on Ag(100) surfaces. MnPc thin films were grown on both, bulk Ag(100) surface and thin Ag(100)/Fe(100) films, where substrate spin-polarized electronic states can be modified through tuning the thickness of the Ag film [2]. We also discuss the electronic structure and magnetic ordering in MnPc thin films, investigated by angle- and spin-resolved photoemission spectroscopy.

Al-Mahboob A.; Vescovo, E.; Sadowski, J.T.



Magnetism, chemical spots, and stratification in the HgMn star phi Phoenicis  

E-Print Network (OSTI)

Mercury-manganese (HgMn) stars have been considered as non-magnetic and non-variable chemically peculiar (CP) stars for a long time. However, recent discoveries of the variability in spectral line profiles suggested an inhomogeneous surface distribution of chemical elements in some HgMn stars. From the studies of other CP stars it is known that magnetic field plays a key role in the formation of surface spots. All attempts to find magnetic fields in HgMn stars yielded negative results. In this study, we investigate a possible presence of the magnetic field in phi Phe (HD 11753) and reconstruct surface distribution of chemical elements that show variability in spectral lines. We also test a hypothesis that magnetic field is concentrated in chemical spots and look into the possibility that some chemical elements are stratified with depth in the stellar atmosphere.

Makaganiuk, V; Piskunov, N; Jeffers, S V; Johns-Krull, C M; Keller, C U; Rodenhuis, M; Snik, F; Stempels, H C; Valenti, J A



Growth and Magnetic Properties of Mn-doped Germanium near the Kinetic Solubility Limit  

Science Conference Proceedings (OSTI)

Growth of high-quality dilute magnetic semiconductor (DMS) material is often compromised by the low solubility of magnetic dopants, leading to formation of precipitates. Here, we explore the feasibility of growing precipitate-free Mn-doped Ge at doping levels near the kinetic solubility limit. Ge:Mn DMS films were grown at low temperature so as to minimize precipitate formation. Meanwhile, epitaxial quality was maintained by employing a very low growth rate. The magnetic properties of these lightly doped films exhibit both interesting contrasts and similarities with those of heavily-doped DMS reported in the literature, indicating that the substitutional Mn contents are very similar. Films grown at 95 degree C are free of intermetallic precipitates, offering useful opportunities for studying the fundamentals of carrier mediated exchange and metal insulator transitions without complications arising from precipitate formation.

Ozer, Mustafa M [University of Tennessee, Knoxville (UTK); Thompson, James R [ORNL; Weitering, Harm H [ORNL



Microwave-assisted fast vapor-phase transport synthesis of MnAPO-5 molecular sieves  

Science Conference Proceedings (OSTI)

MnAPO-5 was prepared by a microwave-assisted vapor-phase transport method at 180 deg. C in short times. The products were characterized by X-ray diffraction, scanning electron microscopy, Fourier transform infrared spectra, UV-vis spectroscopic measurement, NH{sub 3}-temperature-programmed desorption and esterification reaction. It was found that dry gels prepared with aluminum isopropoxide, phosphoric acid and manganese acetate could be transferred to MnAPO-5 in the vapors of triethylamine and water by the microwave-assisted vapor-phase transport method at 180 deg. C for less than 30 min. The crystallization time was greatly reduced by the microwave heating compared with the conventional heating. The resulting MnAPO-5 exhibited much smaller particle sizes, higher surface areas and slightly higher catalytic activity in the esterification of acetic acid and butyl alcohol than those prepared by the conventional vapor-phase transport method and hydrothermal synthesis.

Shao Hui [State Key Laboratory of Materials-Oriented Chemical Engineering, College of Chemistry and Chemical Engineering, Nanjing University of Technology, Nanjing 210009 (China); Department of Chemical Engineering, Jiangsu Polytechnic University, Changzhou 213016 (China); Yao Jianfeng; Ke Xuebin [State Key Laboratory of Materials-Oriented Chemical Engineering, College of Chemistry and Chemical Engineering, Nanjing University of Technology, Nanjing 210009 (China); Zhang Lixiong [State Key Laboratory of Materials-Oriented Chemical Engineering, College of Chemistry and Chemical Engineering, Nanjing University of Technology, Nanjing 210009 (China)], E-mail: lixiongzhang@yahoo.com; Xu Nanping [State Key Laboratory of Materials-Oriented Chemical Engineering, College of Chemistry and Chemical Engineering, Nanjing University of Technology, Nanjing 210009 (China)



Neutron and X-ray diffraction studies on the high temperature phase of Mn{sub 3}(VO{sub 4}){sub 2}, the new isostructural compound NaMn{sub 4}(VO{sub 4}){sub 3} and their mixed crystals Na{sub x}Mn{sub 4.5-x/2}(VO{sub 4}){sub 3} (0{<=}x{<=}1)  

SciTech Connect

This paper presents a detailed structure analysis (combined Rietveld analysis of X-ray and neutron powder diffraction data as well as quantum mechanical calculations) of the high temperature phase of Mn{sub 3}(VO{sub 4}){sub 2} (space group I4 Macron 2d). Special attention is directed to the analysis of the local coordination around Mn{sup 2+} ions or vacancies within a stella quadrangula configuration of anions. Furthermore, the new compound NaMn{sub 4}(VO{sub 4}){sub 3} is described as well as a range of mixed crystals between NaMn{sub 4}(VO{sub 4}){sub 3} and Mn{sub 3}(VO{sub 4}){sub 2} (described by the formula Na{sub x}Mn{sub 4.5-x/2}(VO{sub 4}){sub 3}, 0{<=}x{<=}1) which were synthesized by a solid state route. All compounds were shown to be isostructural to the high temperature phase Mn{sub 3}(VO{sub 4}){sub 2}. - Graphical abstract: The crystal structure of the new compound NaMn{sub 4}(VO{sub 4}){sub 3}. Highlights: Black-Right-Pointing-Pointer We present neutron and X-ray diffraction studies on high temperature-Mn{sub 3}(VO{sub 4}){sub 2}. Black-Right-Pointing-Pointer Structural details of partly filled stellae quadrangulae positions are discussed. Black-Right-Pointing-Pointer Refined structural parameters and theoretical calculations are compared. Black-Right-Pointing-Pointer We investigate the mixed crystal system Mn{sub 3}(VO{sub 4}){sub 2}-NaMn{sub 4}(VO{sub 4}){sub 3}.

Clemens, Oliver [Universitaet des Saarlandes, Institut fuer Anorganische und Analytische Chemie und Radiochemie, Am Markt, Zeile 5, 66125 Saarbruecken (Germany)] [Universitaet des Saarlandes, Institut fuer Anorganische und Analytische Chemie und Radiochemie, Am Markt, Zeile 5, 66125 Saarbruecken (Germany); Haberkorn, Robert [Universitaet des Saarlandes, Anorganische Festkoerperchemie, Am Markt, Zeile 3, 66125 Saarbruecken (Germany)] [Universitaet des Saarlandes, Anorganische Festkoerperchemie, Am Markt, Zeile 3, 66125 Saarbruecken (Germany); Springborg, Michael [Universitaet des Saarlandes, Physikalische und Theoretische Chemie, Campus B2 2, 66123 Saarbruecken (Germany)] [Universitaet des Saarlandes, Physikalische und Theoretische Chemie, Campus B2 2, 66123 Saarbruecken (Germany); Beck, Horst Philipp, E-mail: hp.beck@mx.uni-saarland.de [Universitaet des Saarlandes, Institut fuer Anorganische und Analytische Chemie und Radiochemie, Am Markt, Zeile 5, 66125 Saarbruecken (Germany)



Stoichiometric growth of high Curie temperature heavily alloyed GaMnAs  

SciTech Connect

Heavily alloyed, 100 nm Ga{sub 1-x}Mn{sub x}As (x>0.1) films are obtained via low-temperature molecular beam epitaxy by utilizing a combinatorial technique which allows systematic control of excess arsenic during growth. Reproducible electronic, magnetic, and structural properties are optimized in a narrow range of stoichiometric growth conditions. In contrast to a prediction of the Zener model of hole-mediated ferromagnetism, the Curie temperature of the stoichiometric material is independent of x (for x>0.1), while substitutional Mn content is proportional to x within a large window of growth conditions.

Mack, S.; Myers, R. C.; Heron, J. T.; Gossard, A. C.; Awschalom, D. D. [Center for Spintronics and Quantum Computation, University of California, Santa Barbara, California 93106 (United States)



Ultrafast Enhancement of Ferromagnetism via Photoexcited Holes inGaMnAs  

SciTech Connect

We report on the observation of ultrafast photo-enhanced ferromagnetism in GaMnAs. It is manifested as a transient magnetization increase on a 100-ps time scale, after an initial sub-ps demagnetization. The dynamic magnetization enhancement exhibits a maximum below the Curie temperature {Tc} and dominates the demagnetization component when approaching {Tc}. We attribute the observed ultrafast collective ordering to the p-d exchange interaction between photoexcited holes and Mn spins, leading to a correlation-induced peak around 20K and a transient increase in {Tc}.

Wang, J.; Cotoros, I.; Dani, K.M.; Liu, X.; Furdyna, J.K.; Chemla, D.S.



Relaxation of photoinduced spins and carriers in ferromagnetic InMnSb films  

SciTech Connect

The authors report time resolved measurements and control of photoinduced spin and carrier relaxations in InMnSb ferromagnetic films with 2% Mn content (grown by low-temperature molecular beam epitaxy) using femtosecond laser pulses, and compare them to analogous measurements on InBeSb and InSb films. In this work, magneto-optical Kerr effect and standard pump-probe techniques provided a direct measure of the photoexcited spin and carrier lifetimes, respectively. They observe decrease in relaxations times in the high laser fluence regime and an absence of temperature dependence of the relaxation times.

Nontapot, K.; Kini, R. N.; Gifford, A.; Merritt, T. R.; Khodaparast, G. A.; Wojtowicz, T.; Liu, X.; Furdyna, J. K. [Department of Physics, Virginia Tech, Blacksburg, Virginia 24061 (United States); Institute of Physics, Polish Academy of Sciences, 02-668 Warsaw (Poland); Department of Physics, University of Notre Dame, Notre Dame, Indiana 46556 (United States)



Fabrication of (Mn,Co)3O4 Surface Coatings onto Alloy Substrates  

DOE Green Energy (OSTI)

Ferritic stainless steels are promising candidates for IT-SOFC interconnect applications due to their low cost and resistance to oxidation at SOFC operating temperatures. However, several challenges remain, including long term electrical conductivity and surface stability under interconnect exposure conditions and chromia scale evaporation. One means of extending interconnect lifetime and improving performance is to apply a protective coating, such as (Mn,Co)3O4 spinel, to the cathode side of the interconnect. These coatings have proven effective in reducing scale growth kinetics and Cr volatility. This report describes several procedures developed at PNNL for fabricating (Mn,Co)3O4 spinel coatings onto ferritic stainless steels.

Yang, Zhenguo; Xia, Guanguang; Li, Xiaohong S.; Singh, Prabhakar; Stevenson, Jeffry W.



Multisegmented Au-MnO2/Carbon Nanotube Hybrid Coaxial Arrays for High-Power Supercapacitor Applications  

E-Print Network (OSTI)

Multisegmented Au-MnO2/Carbon Nanotube Hybrid Coaxial Arrays for High-Power SupercapacitorVised Manuscript ReceiVed: NoVember 4, 2009 The present work reports on synthesis and supercapacitor applications hybrid coaxial arrays are efficient electrodes for supercapacitor applications. Au-segmented MnO2/CNT

Ajayan, Pulickel M.


Energy Deputy Secretary Poneman Tours Minority-Owned Small Business in  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Deputy Secretary Poneman Tours Minority-Owned Small Business Energy Deputy Secretary Poneman Tours Minority-Owned Small Business in Detroit Energy Deputy Secretary Poneman Tours Minority-Owned Small Business in Detroit May 22, 2012 - 10:37am Addthis Deputy Secretary of Energy Daniel Poneman meets with owners and workers at Diversified Chemical Technologies, a small business in Detroit, MI. | Energy Department photo Deputy Secretary of Energy Daniel Poneman meets with owners and workers at Diversified Chemical Technologies, a small business in Detroit, MI. | Energy Department photo Bill Gibbons Deputy Press Secretary, Office of Public Affairs What does this mean for me? During National Small Business Week, Energy Department leaders are visiting small businesses across the country as a renewed promise to help their businesses grow, hire and succeed.


Growth of single-crystal {alpha}-MnO{sub 2} nanorods on multi-walled carbon nanotubes  

Science Conference Proceedings (OSTI)

Single-crystal {alpha}-MnO{sub 2} nanorods were grown on multi-walled carbon nanotubes (MWNTs) in H{sub 2}SO{sub 4} aqueous solution. The morphology and microstructure of the composites were examined by transmission electron microscopy, high-resolution transmission electron microscopy (HRTEM), X-ray diffractometry and energy dispersive spectroscopy (EDS). The results show that {alpha}-MnO{sub 2} single-crystal nanorods with a mean diameter of 15 nm were densely grown on the surface of MWNTs. Those MWNTs/MnO{sub 2} composites were used as an electrode material for supercapacitors, and it was found that the supercapacitor performance using MWNTs/MnO{sub 2} composites was improved largely compared to that using pure MWNTs and {alpha}-MnO{sub 2} nanorod mechanically mixed with MWNTs.

Chen Yong [Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Sciences, 72 Wenhua Road, Shenyang 110016 (China); Key Laboratory of Tropic Biological Resources, MOE, Hainan University, 58 Renmin Road, Haikou 570228 (China); Liu Chenguang; Liu Chang [Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Sciences, 72 Wenhua Road, Shenyang 110016 (China); Lu Gaoqing [ARC Centre for Functional Nanomaterials, Australian Institute of Bioengineering and Nanotechnology, University of Queensland, QLD 4072 (Australia); Cheng Huiming [Shenyang National Laboratory for Materials Science, Institute of Metal Research, Chinese Academy of Sciences, 72 Wenhua Road, Shenyang 110016 (China)], E-mail: cheng@imr.ac.cn



Effect of solution hardening on the shape memory effect of Fe-Mn based alloys  

SciTech Connect

Fe-high Mn-Si alloys, which undergo {gamma} (fcc) to {var_epsilon} (hcp) martensitic transformation, exhibit a pronounced shape memory effect. The origin of shape memory effect of these alloys is the reversion of stress-induced {var_epsilon} martensite. A shape change must hence be accomplish3ed by stress-induced martensitic transformation without permanent slip in austenite ({gamma}) in order to obtain a good shape memory effect. It is clear that the intrusion of permanent slip can be suppressed by increasing the strength of austenite and by decreasing the applied stress required for a shape change due to stress-induced martensitic transformation. It has been reported that the addition of the interstitial elements of C and N as well as the substitutional elements of Mo and V increases the 0.2% proof stress of austenite in Fe-high Mn alloys. However, there have been few studies on the effect of these alloying elements on the shape memory effect of Fe-high Mn based alloys. In the present study, it was aimed to improve the shape memory effect of Fe-high Mn based alloys by the strengthening of austenite through solution hardening due to C and Mo.

Tsuzaki, K.; Natsume, Y.; Maki, T. [Kyoto Univ. (Japan). Dept. of Materials Science and Engineering; Tomota, Y. [Ibaraki Univ., Hitachi (Japan)



Magnetic characterizations of sol-gel-produced mn-doped ZnO  

Science Conference Proceedings (OSTI)

Nanoparticles of ZnO doped with 6 at.% Mn were produced by a sol-gel method. X-ray diffraction confirms the hexagonal structure as that of the parent compound ZnO, and high-resolution electron transmission microscopy reveals a single-crystallite lattice. ...

R. Asmatulu; H. Haynes; M. Shinde; Y. H. Lin; Y. Y. Chen; J. C. Ho




E-Print Network (OSTI)

It is argued that the magnetic behavior of Sr2MnMoO6 is determined by the existence of two total energy minima corresponding to the metallic ferromagnetic and insulating antiferromagnetic states, which may be nearly degenerate depending on the magnitude of the breathing distortion. PACS: 71.20.Be; 71.70.Gm; 72.25.Ba; 75.30.Et

I. V. Solovyev



Electrodeposition of Mn-Co Alloys on Stainless Steels for SOFC Interconnect Application  

Science Conference Proceedings (OSTI)

Chromium-containing ferritic stainless steels are the most popular materials for solid oxide fuel cell (SOFC) interconnect applications because of its oxidation resistance and easy fabrication process. However, excessive scale growth and chromium evaporation will degrade the cell performance. Highly conductive coatings that resist oxide scale growth and chromium evaporation may prevent both of these problems. Mn1.5Co1.5O4 spinel is one of the most promising coatings for interconnect application because of its high conducitivy, good chromium retention capability, as well as good CTE match. Electroplating of alloys or thin film multilayers followed by controlled oxidation to the desired spinel phase offers an additional deposition option. In the present study binary Mn/Co alloys was fabricated by electrodeposition, and polarization curves were used to characterize the cathodic reactions on substrate surface. By controlling the current density precisely, coatings with Mn/Co around 1:1 has been successfully deposited in Mn/Co =10 solutions, SEM and EDX was used to characterize the surface morphology and composition.

Wu, J. (West Virginia University); Jiang, Y. (West Virginia University); Johnson, C.; Gong, M. (West Virginia University); Liu, X. (West Virginia University)


Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Modulation on Ni{sub 2}MnGa(001) surface  

SciTech Connect

We report periodic modulation on (001) surface of Ni2MnGa ferromagnetic shape memory alloy. For the stoichiometric surface, analysis of the low energy electron diffraction (LEED) spot profiles shows that the modulation is incommensurate. The modulation appears at 200 K, concomitant with the first order structural transition to the martensitic phase.

D'Souza, S. W.; Rai, Abhishek; Nayak, J.; Maniraj, M.; Dhaka, R. S.; Barman, S. R.; Schlagel, D. L.; Lograsso, T. A. [UGC-DAE Consortium for Scientific Research, Khandwa Road, Indore, 452001, Madhya Pradesh (India); Ames Laboratory U. S. DOE, Iowa State University, Ames, Iowa 50011-3020 (United States)



Cycling performance of nanocrystalline LiMn2O4 thin films via electrophoresis  

Science Conference Proceedings (OSTI)

The present study demonstrates a novel approach by which titanium foils coated with LiMn2O4 nanocrystals can be processed into a high-surface-area electrode for rechargeable batteries. A detailed study has been performed to elucidate ...

S. Parvathy; R. Ranjusha; K. Sujith; K. R. V. Subramanian; N. Sivakumar; Shantikumar V. Nair; Avinash Balakrishnan



Frustration and multiferroic behavior in Ca3CoMnO6  

Science Conference Proceedings (OSTI)

Lu{sub 2}MnCoO{sub 6} and Ca{sub 3}MnCoO{sub 6} satisfy one of the primary goals of multiferroics research, namely ferromagnetic-like magnetization coupled to ferroelectric-like polarization. Thus the mechanism for magnetoelectric coupling in these materials deserves careful study. New data shows that the physics of these compound may be related to the classic 'ANNNI' model. Frustration between ferromagnetic nearest-neighbor and antiferromagnetic next-nearest-neighbor interactions between Ising spins creates an 'up up down down' magnetic structure in zero magnetic field, along c-axis chains that consist of alternating Co and Mn ions. In applied magnetic fields 'up up down,' 'up up up down' and other metastable variations can evolve, yielding hysteretic ferromagnetic-like magnetization. The key is that the phase slips between regions of 'up' and 'down' carries an electric polarization due to broken spatial inversion symmetry. Thus these phase slips can be manipulated with both electric and magnetic fields. The result is a profusion of magnetic and electric states that are closely-spaced in temperature, electric, and magnetic field. We present experimental studies of the magnetic, electric, and structural properties of these two compounds. We include very new data up to 100 Ton Ca{sub 3}CoMnO{sub 6} that resolves a key controversy of over the magnetic structure and the size of the moments.

Zapf, Vivien [Los Alamos National Laboratory



Hydrogen Storage in a Microporous Metal-Organic Framework with Exposed Mn2+ Coordination Sites  

E-Print Network (OSTI)

Hydrogen Storage in a Microporous Metal-Organic Framework with Exposed Mn2+ Coordination Sites and 90 bar, which at 60 g H2/L provides a storage density 85% of that of liquid hydrogen. The material-358. (2) EERE: Hydrogen, Fuel Cells, & Infrastructure Technologies Program Homepage, www.eere.energy


Aliovalent titanium substitution in layered mixed Li Ni-Mn-Co oxides for lithium battery applications  

SciTech Connect

Improved electrochemical characteristics are observed for Li[Ni1/3Co1/3-yMyMn1/3]O2 cathode materials when M=Ti and y<0.07, compared to the baseline material, with up to 15percent increased discharge capacity.

Kam, Kinson; Doeff, Marca M.



Southwest MN IPM STUFF All the pestilence that's fit to print  

E-Print Network (OSTI)

in heavily infested fields in the near future. Hatch will continue for some time,. After a hot, humid day and Outreach Center 23669 130th Street Lamberton, MN 56152 Phone: 507.752.5066 Cell: 507.276.1184 Fax: 507

Amin, S. Massoud


Southwest MN IPM STUFF All the pestilence that's fit to print  

E-Print Network (OSTI)

of fields (hot spots) or field edges. Alate aphids depositing nymphs can rapidly increase the percentage for larva in square foot areas on the ground. During hot weather armyworms may hide under litter. In small 130th Street Lamberton, MN 56152 Phone: 507.752.5066 Cell: 507.276.1184 Fax: 507.752.5097 E

Amin, S. Massoud


Southwest MN IPM STUFF All the pestilence that's fit to print  

E-Print Network (OSTI)

indeed treated and the infestation was not a localized hot spot, this may signal the beginning of the end 23669 130th Street Lamberton, MN 56152 Phone: 507.752.5066 Cell: 507.276.1184 Fax: 507.752.5097 E

Amin, S. Massoud


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan



Local atomic and electronic structure in LaMnO{sub 3} across the orbital ordering transition  

SciTech Connect

The local atomic disorder and electronic structure in the environment of manganese atoms in LaMnO{sub 3} has been studied by x-ray absorption spectroscopy over a temperature range (300-870 K) covering the orbital ordering transition ({approx}710 K). The Mn-O distance splitting into short and long bonds (1.95 and 2.15 A) is kept across the transition temperature, so that the MnO{sub 6} octahedra remain locally Jahn-Teller distorted. Discontinuities in the Mn local structure are identified in the extended x-ray fine structure spectra at this temperature, associated with a reduction of the disorder in the superexchange angle and to the removal of the anisotropy in the radial disorder within the coordination shell. Subtle changes in the electronic local structure also take place at the Mn site at the transition temperature. The near-edge spectra show a small drop of the Mn 4p hole count and a small enhancement in the pre-edge structures at the transition temperature. These features are associated with an increase of the covalence of the Mn-O bonds. Our results shed light on the local electronic and structural phenomena in a model of order-disorder transition, where the cooperative distortion is overcome by the thermal disorder.

Souza, Raquel A.; Souza-Neto, Narcizo M.; Ramos, Aline Y.; Tolentino, Helio C.N.; Granado, Eduardo [Laboratorio Nacional de Luz Sincrotron (LNLS), P.O. Box 6192, 13084-971, Campinas, Sao Paulo, Brazil and (Brazil); Instituto de Fisica Gleb Wataghin, IFGW-UNICAMP, Campinas, SP (Brazil); Laboratorio Nacional de Luz Sincrotron (LNLS), P.O. Box 6192, 13084-971, Campinas, Sao Paulo, Brazil and (Brazil); Departamento de Fisica dos Materiais e Mecanica, DFMT-IF-USP, Sao Paulo, SP (Brazil); Laboratorio Nacional de Luz Sincrotron (LNLS), P.O. Box 6192, 13084-971, Campinas, Sao Paulo, Brazil and (Brazil); Laboratoire de Mineralogie-Cristallographie de Paris, LMCP-UMR 7590-CNRS, Paris (France); Laboratorio Nacional de Luz Sincrotron (LNLS), P.O. Box 6192, 13084-971, Campinas, Sao Paulo (Brazil); Laboratorio Nacional de Luz Sincrotron (LNLS), P.O. Box 6192, 13084-971, Campinas, Sao Paulo, Brazil and (Brazil); Instituto de Fisica Gleb Wataghin, IFGW-UNICAMP, Campinas, SP (Brazil)



In situ synchrotron x-ray studies of LiMn{sub 2}O{sub 4} cathodes  

DOE Green Energy (OSTI)

LiCoO{sub 2} cathodes are now used in most commercial lithium ion batteries. LiMn{sub 2}O{sub 4} is an attractive low cost alternative. However, it is difficult to make reproducibly. At Brookhaven National Laboratory two in situ synchrotron x-ray techniques, that are available at the National Synchrotron Light Source (NSLS), have been used to investigate LiMn{sub 2}O{sub 4}. The techniques are x-ray absorption and high resolution x-ray diffraction. With x-ray absorption it is possible to follow the changes in the Mn oxidation state and the changes in the Mn-O and Mn-Mn bond lengths on cycling. Also it is possible to detect amorphous phases. The high energy x-rays at the diffraction Beam Lines at the NSLS (up to 24 KeV) permit in situ x-ray diffraction, in the transmission mode, in thin lithium and lithium ion cells. The evolution of the structural chances that occur on cycling can be followed. These in situ measurements were done on Li/LiMn{sub 2}O{sub 4} cells with a liquid electrolyte (1 M LiPF{sub 6} in a 1:1:3 PC:EC:DMC solvent).

McBreen, J.; Mukerjee, S.; Yang, X.Q. [and others



Electrochemical and structural characterization of titanium-substituted manganese oxides based on Na0.44MnO2  

DOE Green Energy (OSTI)

A series of titanium-substituted manganese oxides, Li{sub x}Ti{sub y}Mn{sub 1-y}O{sub 2} (y = 0.11, 0.22, 0.33, 0.44, and 0.55) with the Na{sub 0.44}MnO{sub 2} structure were prepared from Na{sub x}Ti{sub y}Mn{sub 1-y}O{sub 2} (x {approx} 0.44) precursors. The electrochemical characteristics of these compounds, which retain the unique double-tunnel structure during ion exchange, were examined in lithium/polymer electrolyte cells operating at 85 C. All of the substituted cathode materials intercalated lithium reversibly, with Li{sub x}Ti{sub 0.22}Mn{sub 0.78}O{sub 2} exhibiting the highest capacity in polymer cells, about 10-20% greater than that of unsubstituted Li{sub x}MnO{sub 2} made from Na{sub 0.44}MnO{sub 2}. In common with Li{sub x}MnO{sub 2}, the Ti-substituted materials exhibited good capacity retention over one hundred or more cycles, with some compositions exhibiting a fade rate of less than 0.03% per cycle.

Doeff, Marca M.; Richardson, Thomas J.; Hwang, Kwang-Taek



Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:


U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA) Indexed Site

Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 View Apr-13 May-13 Jun-13 Jul-13 Aug-13 Sep-13 View History U.S. Total 3.96 3.93 3.73 3.37 3.01 3.01 1997-2013 From Canada 3.96 3.93 3.73 3.37 3.01 3.01 1989-2013 Eastport, ID 3.71 3.74 3.54 3.16 2.78 2.73 2011-2013 Calais, ME 4.09 4.58 4.41 4.29 3.75 3.70 2011-2013 Detroit, MI 4.50 2011-2013 Marysville, MI 4.57 4.70 4.22 4.17 2011-2013 St. Clair, MI 4.41 4.35 3.96 4.06 2011-2013 Noyes, MN 4.12 4.08 3.84 3.79 3.44 3.54 2011-2013 Warroad, MN 4.25 4.35 4.14 3.91 3.68 3.77 2011-2013 Babb, MT 3.66 3.74 3.45 2.94 2.65 2.44 2011-2013 Port of Del Bonita, MT 3.93 3.85 3.43 2.97 2.73 2.50 2011-2013 Port of Morgan, MT 3.62 3.69 3.50 3.06 2.72 2.58 2011-2013 Sweetgrass, MT 3.69 3.73 2011-2013


Magnetic order near 270 K in mineral and synthetic Mn{sub 2}FeSbO{sub 6} ilmenite  

SciTech Connect

The structural and magnetic properties of Mn{sub 2}FeSbO{sub 6} single-crystalline mineral and ceramic samples synthesized under thermobaric treatment have been investigated, and compared to theoretical predictions based on first-principles electronic structure calculations. This ilmenite system displays a sharp magnetic transition just below the room temperature related to a ferrimagnetic ordering of the Mn{sup 2+} and Fe{sup 3+} cations, which makes Mn{sub 2}FeSbO{sub 6} a promising candidate for designing functional magnetic materials.

Mathieu, R.; Hudl, M.; Nordblad, P. [Department of Engineering Sciences, Uppsala University, Box 534, SE-75121 Uppsala (Sweden); Ivanov, S. A. [Department of Engineering Sciences, Uppsala University, Box 534, SE-75121 Uppsala (Sweden); Department of Inorganic Materials, Karpov' Institute of Physical Chemistry, Vorontsovo pole, 10 105064, Moscow K-64 (Russian Federation); Bazuev, G. V. [Institute of Solid-State Chemistry, Ural Branch of the Russian Academy of Science, 620999, Ekaterinburg GSP-145 (Russian Federation); Lazor, P. [Department of Earth Sciences, Uppsala University, Villavaegen 16, SE-75236 Uppsala (Sweden); Solovyev, I. V. [National Institute for Materials Science, 1-2-1 Sengen, Tsukuba, Ibaraki 305-0047 (Japan)



In situ X-ray absorption fine structure studies of a manganese dioxide electrode in a rechargeable MnO{sub 2}/Zn alkaline battery environment  

DOE Green Energy (OSTI)

Electronic and structural aspects of a MnO{sub 2} electrode in a rechargeable MnO{sub 2}/Zn battery environment have been investigated by in situ Mn K-edge X-ray absorption fine structure (XAFS). The relative amplitudes of the three major Fourier transform shells of the EXAFS (extended XAFS) function of the rechargeable MnO{sub 2} electrode in the undischarged state were found to be similar to those found for ramsdellite, a MnO{sub 2} polymorph with substantial corner-sharing linkages among the basic MnO{sub 6} octahedral units. The analyses of the background-subtracted pre-edge peaks and absorption edge regions for the nominally 1-e{sup {minus}} discharged electrode were consistent with Mn{sup 3+} as being the predominant constituent species, rather than a mixture of Mn{sup 4+} and Mn{sup 2+} sites. Furthermore, careful inspection of both the XANES (X-ray absorption near edge structure) and EXAFS indicated that the full recharge of MnO, which had been previously discharged either by a 1- or 2-equivalent corner-sharing linkages compared to the original undischarged MnO{sub 2}.

Mo, Y.; Hu, Y.; Bae, I.T.; Miller, B.; Scherson, D.A. [Case Western Reserve Univ., Cleveland, OH (United States). Dept. of Chemistry; Antonio, M.R. [Argonne National Lab., IL (United States). Chemistry Div.



X-ray spectroscopic study of the charge state and local orderingof room-temperature ferromagnetic Mn oped ZnO  

Science Conference Proceedings (OSTI)

The charge state and local ordering of Mn doped into a pulsed laser deposited single-phase thin film of ZnO are investigated by using X-ray absorption spectroscopy at the O K-, Mn K- and L-edges, and X-ray emission spectroscopy at the O K- and Mn L-edge. This film is found to be ferromagnetic at room temperature. EXAFS measurement shows that Mn{sup 2+} replaces Zn site in tetrahedral symmetry, and there is no evidence for either metallic Mn or MnO in the film. Upon Mn doping, the top of O 2p valence band extends into the bandgap indicating additional charge carries being created.

Guo, J.-H.; Gupta, Amita; Sharma, Parmanand; Rao, K.V.; Marcus,M.A.; Dong, C.L.; Guillen, J.M.O.; Butorin, S.M.; Mattesini, M.; Glans,P.A.; Smith, K.E.; Chang, C.L.; Ahuja, R.



The preparation of carbon nanotube/MnO2 composite fiber and its application to flexible micro-supercapacitor  

Science Conference Proceedings (OSTI)

In recent years, flexible electronic devices pursued for potential applications. The design and the fabrication of a novel flexible nanoarchitecture by coating electrical conductive MWCNT fiber with ultrathin films of MnO2 to achieve high ...

Li Li, Chen Chen, Jing Xie, Zehuai Shao, Fuxin Yang



Preparation of Mn{sub 2}SnO{sub 4} nanoparticles as the anode material for lithium secondary battery  

Science Conference Proceedings (OSTI)

The ultrafine Mn{sub 2}SnO{sub 4} nanoparticles with diameters of 5-10 nm have been prepared by thermal decomposition of precursor MnSn(OH){sub 6}. The MnSn(OH){sub 6} nanoparticles precursor was synthesized by a hydrothermal microemulsion method. X-ray diffraction, transmission electron microscopy, high-resolution transmission electron microscopy and electron diffraction have been employed to characterize the crystal structures and morphologies of the as-prepared samples. High-resolution transmission electron microscopy observations revealed that the as-synthesized nanoparticles were single crystals. The thermal characterization was studied by differential thermal analysis and thermogravimetry analysis measurements. Electrochemical test showed that the Mn{sub 2}SnO{sub 4} nanoparticles exhibited a high initial charge-discharge capacity of 1320 mAh/g.

Lei Shuijin [School of Materials Science and Engineering, Nanchang University, No. 999, Xuefu Avenue Honggutan New District, Nanchang, Jiangxi 330031 (China)], E-mail: shjlei@ncu.edu.cn; Tang Kaibin [Nanomaterial and Nanochemistry, Hefei National Laboratory for Physical Sciences at Micro-scale, University of Science and Technology of China, Hefei, Anhui 230026 (China)], E-mail: kbtang@ustc.edu.cn; Chen Chunhua; Jin Yi [Department of Materials Science and Engineering, University of Science and Technology of China, Hefei, Anhui 230026 (China); Zhou Lang [School of Materials Science and Engineering, Nanchang University, No. 999, Xuefu Avenue Honggutan New District, Nanchang, Jiangxi 330031 (China)



Synthesis and Electrochemical Properties of Monoclinic LiMnBO[subscript 3] as a Li Intercalation Material  

E-Print Network (OSTI)

We investigated the structural stability and electrochemical properties of LiMnBO3 in the hexagonal and monoclinic form with ab initio computations and, for the first time, report electrochemical data on monoclinic ...

Kim, Jae Chul

Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Synthesis and Electrochemical Properties of Monoclinic LiMnBO[subscript 3] as a Li Intercalation Material  

E-Print Network (OSTI)

We investigated the structural stability and electrochemical properties of LiMnBO[subscript 3] in the hexagonal and monoclinic form with ab initio computations and, for the first time, report electrochemical data on ...

Kim, Jae Chul


Thermal Stabilities of Delithiated Olivine MPO[subscript 4] (M=Fe,Mn) Cathodes investigated using First Principles Calculations  

E-Print Network (OSTI)

We present an analysis of the thermal reduction of delithiated LiMnPO[subscript 4] and LiFePO[subscript 4] based on the quarternary phase diagrams as calculated from first principles. Our results confirm the recent ...

Ong, Shyue Ping


Electrode properties of Mn2O3 nanospheres synthesized by combined sonochemical/solvothermal method for use in electrochemical capacitors  

Science Conference Proceedings (OSTI)

We report here an efficient single step combined sonochemical and solvothermal synthesis process to obtain bulk quantities of nanospherical particles of cubic Mn2O3 and characterized its pseudocapacitive characteristics in relevance ...

Teressa Nathan; Michael Cloke; S. R. S. Prabaharan



Electrochemical and structural characterization of titanium-substituted manganese oxides based on Na0.44MnO2  

E-Print Network (OSTI)

by heating them in a molten salt- mixture of 68-mol% LiNOtakes place during the molten salt exchange. Because the850° C. c) prepared by molten salt exchange of Na x Ti y Mn

Doeff, Marca M.; Richardson, Thomas J.; Hwang, Kwang-Taek



Synthesis and Electrochemical Characterization of M2Mn3O8 (M=Ca, Cu) Compounds and Derivatives  

E-Print Network (OSTI)

surprising, because the molten salt environment at elevatedthe product of the molten salt reaction can be considered tothat is formed during the molten salt reaction with Ca 2 Mn

Park, Yong Joon; Doeff, Marca M.



RECIPIENT:Minnesota Department of Commerce, Office of Energy Security SEP ARRA STATE: MN  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Minnesota Department of Commerce, Office of Energy Security SEP ARRA STATE: MN Minnesota Department of Commerce, Office of Energy Security SEP ARRA STATE: MN PROJECT TITLE: SEP - Residential Ground Source Heat Pump Installation - Schmitz, Mary C. Funding Opportunity Announcement Number DE FOA 0000052 Procurement Instrument Number EE0000164 NEPA Control Number cm Number GFO-0000164-018 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical


File:USDA-CE-Production-GIFmaps-MN.pdf | Open Energy Information  

Open Energy Info (EERE)

MN.pdf MN.pdf Jump to: navigation, search File File history File usage Minnesota Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 311 KB, MIME type: application/pdf) Description Minnesota Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Minnesota External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,650 × 1,275 (311 KB) MapBot (Talk | contribs) Automated bot upload


Charge Melting & Polaron Collapse in LA1.2SR1.8MN207  

NLE Websites -- All DOE Office Websites (Extended Search)

Charge Melting & Polaron Collapse in LA1.2SR1.8MN207 Charge Melting & Polaron Collapse in LA1.2SR1.8MN207 Recent studies carried out on the Synchrotron Radiation Instrumentation Collaborative Access Team's beamline I-ID-C at the Advanced Photon Source provide new insights into charge melting and polaron collapse. X-ray and neutron scattering measurements directly demonstrate the existence of polarons in the paramagnetic phase of optimally doped colossal magnetoresistive oxides. The polarons exhibit short-range correlations that grow with decreasing temperature, but disappear abruptly at the ferromagnetic transition because of the sudden charge delocalization. The "melting" of the charge ordering as we cool through TC occurs with the collapse of the quasistatic polaron scattering, and provides important new



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MN-IAGEMENT CENTER MN-IAGEMENT CENTER NEPA DETERMINATION Page 1 of4 RECIPIENT:A1aska Energy Authority STATE: AK PROJECT TITLE: Alaska Wind Energy PrOject Funding Opportunity Announcement Number PnK:urcmcntlnstrumcnl Numbcr NEPA Control Number CID Number DE-FG-36-05GOO85038 DE-FG-36-05GOO85038 GFO-G085038-002 G085038 Bastd on my review orthe information concuning the proposed adion, as NEPA Compliance Officer (authorized under DOE Order 45 1.IA), I have made the following determination: ex, EA. [IS APPENDIX AND NUMBER: Description: 61 .19 Microwave, Siting, construction, modification. operation, and removal of microwave, radio communication, and meteorological , meteorological towers and assOCIated facilities, prOVided that the towers and associated facilitJes would


Optical transitions in MnGa{sub 2}Se{sub 4}  

Science Conference Proceedings (OSTI)

The dependence of the absorption coefficient on incident photon energy in a MnGa{sub 2}Se{sub 4} single crystal has been investigated in the temperature range 110-295 K. Using group-theory analysis of the electron state symmetry and comparison of the symmetry of the energy spectrum of MnGa{sub 2}Se{sub 4} and its isoelectronic analogs, a conclusion about the character of optical transitions has been drawn. It is shown that the features observed at 2.31 and 2.45 eV are related to the intracenter transitions {sup 6}A{sub 1}{sup 1} {yields} {sup 4}T{sub 2}({sup 4}G) and {sup 6}A{sub 1}{sup 2} {yields} {sup 4}T{sub 2}({sup 4}G). The {sup 6}A{sub 1} state is split by the crystal field.

Tagiev, B. G.; Kerimova, T. G., E-mail: ktaira@physics.ab.az; Tagiev, O. B.; Asadullayeva, S. G.; Mamedova, I. A. [National Academy of Sciences of Azerbaijan, Institute of Physics (Azerbaijan)



Structural and magnetic properties of MBE grown GeMnN2 thin films  

Science Conference Proceedings (OSTI)

Epitaxial GeMnN{sub 2} thin films are synthesized by plasma-assisted molecular beam epitaxy. Transmission electron microscopy and x-ray diffraction measurements confirm that it is the orthorhombic variant, consistent with the predictions of first-principles calculations. The magnetic properties of the films are related to defects, with samples grown under Ge-rich conditions exhibiting a net magnetic moment above room temperature. These results are explained by first-principles calculations, indicating that the preferential substitution of one magnetic sublattice of GeMnN{sub 2} by impurities and/or intrinsic defects such as Ge antisites produces a net magnetic moment in an antiferromagnetic background, and also introduces spin-polarized carriers near the Fermi level.

Liu, Y [University of Wisconsin, Milwaukee; Lazarov, V. K. [University of Wisconsin, Milwaukee; Cheung, S.H. [University of Wisconsin, Milwaukee; Keavney, D.J. [Argonne National Laboratory (ANL); Gai, Zheng [ORNL; Gajdardziska-Josifovska, M [University of Wisconsin, Milwaukee; Weinert, M [University of Wisconsin, Milwaukee; Li, Lian [University of Wisconsin, Milwaukee



High capacitive performance of nanostructured Mn-Ni-Co oxide composites for supercapacitor  

SciTech Connect

Nanostructured Mn-Ni-Co oxide composites (MNCO) were prepared by thermal decomposition of the precursor obtained by chemical co-precipitation of Mn, Ni and Co salts. The chemical composition and morphology were characterized by X-ray diffraction (XRD), energy dispersive spectroscopy (EDS) and scanning electron microscopy (SEM). The electrochemical capacitance of MNCO electrode was examined by cyclic voltammetry, impedance and galvanostatic charge-discharge measurements. The results showed that MNCO electrode exhibited the good electrochemical characteristics. A maximum capacitance value of 1260 F g{sup -1} could be obtained within the potential range of -0.1 to 0.4 V versus saturated calomel electrode (SCE) in 6 mol L{sup -1} KOH electrolyte.

Luo Jianmin [Institute of Applied Chemistry, Xinjiang University, Urumqi 830046 (China); Gao Bo [College of Material Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 210016 (China); Zhang Xiaogang [College of Material Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 210016 (China)], E-mail: azhangxg@163.com



Irradiation-controlled giant magnetoresistance of PtMn-based spin valve  

Science Conference Proceedings (OSTI)

He{sup +}-ion irradiation resulted in the direct ordering of PtMn without postannealing. Samples were irradiated with 2 MeV He{sup +} ions and a beam current of 1.08 {mu}A/cm{sup 2} such that the corresponding surface temperature was 190 deg. C. The exchange bias direction was set in situ during irradiation in a field of 900 Oe. A high giant magnetoresistance (GMR) ratio of 11% was obtained in PtMn-based spin valves after He{sup +} irradiation. The GMR is completely eliminated after it is irradiated with oxygen ions at 42 keV. Combining He{sup +} with oxygen-ion irradiation can provide magnetic patterning for GMR sensors.

Huang, S.-H.; Lai, C.-H.; Chiang, C. C.; Yang, C.-H. [Department of Materials Science and Engineering, National Tsing Huang University, 101, Section 2, Kuang Fu Road, Hsinchu, Taiwan 30013 (China)



FTIR and Raman Study of LixTiyMn1-y2(y=0,0.11) Cathodes in  

NLE Websites -- All DOE Office Websites (Extended Search)

FTIR and Raman Study of LixTiyMn1-y2(y=0,0.11) Cathodes in FTIR and Raman Study of LixTiyMn1-y2(y=0,0.11) Cathodes in Pyrrolidinium-based Ionic Liquid Electrolyte Systems Title FTIR and Raman Study of LixTiyMn1-y2(y=0,0.11) Cathodes in Pyrrolidinium-based Ionic Liquid Electrolyte Systems Publication Type Journal Article Year of Publication 2009 Authors Hardwick, Laurence J., Juliette A. Saint, Ivan T. Lucas, Marca M. Doeff, and Robert Kostecki Journal J. Electrochemical Society Volume 156 Issue 2 Pagination A120-A127 Keywords electrochemical electrodes, Fourier transform spectra, infrared spectra, lithium compounds, manganese compounds, Raman spectra, titanium compounds Abstract This work demonstrates the protective effect of partial titanium substitution in LixTi0.11Mn0.89O2 against surface decomposition in room-temperature ionic liquid (RTILs) cells. Raman microscopy and reflectance Fourier transform IR (FTIR) spectroscopy were used to analyze electrodes recovered from cycled Li/LixTiyMn1-yO2 (y=0,0.11) cells containing the 0.5mol/kg LiTFSI in P13FSI RTIL electrolyte. [TFSI=bis(trifluoromethanesulfonyl)imide .] Raman and FTIR spectra of cycled LixMnO2 cathodes showed many distinct bands that can be attributed to both the electrolyte and electrode decomposition products. The thickness of the amorphous porous layer on the LixMnO2 cathode increased during cycling. The surface degradation of LixMnO2 and precipitation of electrolyte decomposition products contributed to the film growth. Improved cycling behavior was observed in cells containing LixTi0.11Mn0.89O2 , yet Raman spectroscopy also showed possible surface degradation. The FTIR spectra of cycled LixMnO2 and LixTi0.11Mn0.89O2 cathodes displayed bands characteristic for LiSO3CF3 and Li2NSO2CF3 , which originate from the reaction of the TFSI anion with traces of water present in the cell.


LiFe(x)Mn(1-x)PO(4): A Cathode for Lithium-ion Batteries  

DOE Green Energy (OSTI)

The high redox potential of LiMnPO{sub 4}, {approx}4.0 vs. (Li{sup +}/Li), and its high theoretical capacity of 170 mAh g{sup -1} makes it a promising candidate to replace LiCoO{sub 2} as the cathode in Li-ion batteries. However, it has attracted little attention because of its severe kinetic problems during cycling. Introducing iron into crystalline LiMnPO{sub 4} generates a solid solution of LiFe{sub x}Mn{sub 1-x}PO{sub 4} and increases kinetics; hence, there is much interest in determining the Fe-to-Mn ratio that will optimize electrochemical performance. To this end, we synthesized a series of nanoporous LiFe{sub x}Mn{sub 1-x}PO{sub 4} compounds (with x = 0, 0.05, 0.1, 0.15, and 0.2), using an inexpensive solid-state reaction. The electrodes were characterized using X-ray diffraction and energy-dispersive spectroscopy to examine their crystal structure and elemental distribution. Scanning-, tunneling-, and transmission-electron microscopy (viz., SEM, STEM, and TEM) were employed to characterize the micromorphology of these materials; the carbon content was analyzed by thermogravimetric analyses (TGAs). We demonstrate that the electrochemical performance of LiFe{sub x}Mn{sub 1-x}PO{sub 4} rises continuously with increasing iron content. In situ synchrotron studies during cycling revealed a reversible structural change when lithium is inserted and extracted from the crystal structure. Further, introducing 20% iron (e.g., LiFe{sub 0.2}Mn{sub 0.8}PO{sub 4}) resulted in a promising capacity (138 mAh g{sup -1} at C/10), comparable to that previously reported for nano-LiMnPO{sub 4}.

J Hong; F Wang; X Wang; J Graetz



Modeling, synthesis and characterization of LiMn{sub 2}O{sub 4} spinels  

DOE Green Energy (OSTI)

The authors report on an integrated program to understand the fundamentals of LiMn{sub 2}O{sub 4} performance as a cathode for lithium ion rechargeable batteries. Specifically, this program is designed to address the effects of doping on the crystal chemistry, lattice constants, and electrochemical performance. The work is being expanded to include studies on LiCoO{sub 2} and LiNiO{sub 2}.

Doughty, D.H.; Ingersoll, D.; Cygan, R.T.; Westrich, H.R.; Rodriguez, M.A.; Boyle, T.J.; Voigt, J.A. [Sandia National Labs., Albuquerque, NM (United States); Johnson, B.J. [3M Co., St. Paul, MN (United States). Specialty Chemicals Div.



Elastic Properties of the Zintl Ferromagnet Yb14MnSb11  

SciTech Connect

We report measurements of the elastic moduli as a function of temperature (5-300) K and magnetic field (0-2 T) for the Zintl ferromagnet Yb{sub 14}MnSb{sub 11}, which is believed to be a rare example of an underscreened Kondo lattice. The elastic moduli measured below the Curie temperature in this complex ferromagnet exhibit unusual lattice stiffening that is independent of the magnetic field and can be adequately modeled using the Landau theory.

Bhattacharya, Sriparna [University of Tennessee, Knoxville (UTK); Marinescu, D. C. [Clemson University; Morris, James R [ORNL; Sergienko, Ivan A [ORNL; Sales, Brian C [ORNL; Mandrus, D. [University of Tennessee, Knoxville (UTK) & Oak Ridge National Laboratory (ORNL); Keppens, V. [University of Tennessee, Knoxville (UTK)



Annealing effect on the giant magnetoresistance of La-Ca-Mn-O thin films  

SciTech Connect

Thin films of perovskite-like (La,Ca)MnO{sub {delta}} with (001) orientation were grown epitaxially on (100) MgO substrates by a simple facing-target sputtering technique. The as-deposited films already possess a significant low field giant magnetoresistance. Further post-annealing experiments on these samples indicate that the high electrical resistivity is not a prerequisite of the giant magnetoresistance effect.

Zeng, X.T.; Wong, H.K. [Chinese Univ. of Hong Kong, Chatin (Hong Kong). Physics Dept.



Inhomogeneous distribution of mercury on the surfaces of rapidly rotating HgMn stars  

E-Print Network (OSTI)

Starspots are usually associated with the action of magnetic fields at the stellar surfaces. However, recently an inhomogeneous chemical distribution of mercury was found for the mercury-manganese (HgMn) star alpha And -- a well-established member of a non-magnetic subclass of the chemically peculiar stars of the upper main sequence. In this study we present first results of the high-resolution survey of the HgII 3984 resonance line in the spectra of rapidly rotating HgMn stars with atmospheric parameters similar to those of alpha And. We use spectrum synthesis modelling and take advantage of the Doppler resolution of the stellar surfaces to probe horizontal structure of mercury distribution. Clear signatures of spots are found in the HgII 3984 line profiles of HR 1185 and HR 8723. Two observations of the latter star separated by two days give evidence for the line profile variability. We conclude that inhomogeneous distribution of Hg is a common phenomenon for the rapidly rotating HgMn stars in the 13000--13800 K effective temperature range independently of the stellar evolutionary stage. These results establish existence of a new class of spectrum variable spotted B-type stars. It is suggested that the observed Hg inhomogeneities arise from dynamical instabilities in the chemical diffusion processes and are unrelated to magnetic phenomena.

O. Kochukhov; N. Piskunov; M. Sachkov; D. Kudryavtsev



Redox Active Layer-by-Layer Structures containing MnO2 Nanoparticles  

Science Conference Proceedings (OSTI)

Nanoscale materials provide unique properties that will enable new technologies and enhance older ones. One area of intense activity in which nanoscale materials are being used is in the development of new functional materials for battery applications. This effort promises superior materials with properties that circumvent many of the problems associated with traditional battery materials. Previously we have worked on several approaches for using nanoscale materials for application as cathode materials in rechargeable Li batteries. Our recent work has focused on synthesizing MnO2 nanoparticles and using these in layer-by-layer (LbL) structures to probe the redox properties of the nanoparticles. We show that the aqueous colloidal nanoparticles produced by butanol reduction of tetramethylammonium permanganate can be trapped in thin films using a layer-by-layer deposition approach, and that these films are both redox active and exhibit kinetically facile electrochemical responses. We show cyclic voltammetry of MnO2 colloidal nanoparticles entrapped in a LbL thin film at an ITO electrode surface using poly(diallyldimethylammonium chloride) (PDDA). CV experiments demonstrate that Li+ insertion accompanies Mn(IV) reduction in LiClO4 supporting electrolytes, and that reduction is hindered in supporting electrolytes containing only tetrabutylammonium cations. We also show that electron propagation through multilayer films is facile, suggesting that electrons percolate through the films via electron exchange between nanoparticles.

Bazito, Fernanda; O'Brien, Robert; Buttry, Daniel A.


Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Thin-film Li-LiMn{sub 2}O{sub 4} batteries  

DOE Green Energy (OSTI)

Thin-film rechargeable Li-LiMn{sub 2}O{sub 4} batteries have been fabricated and characterized. Following deposition by electron beam evaporation of LiMn{sub 2}O{sub 4}, the amorphous as-deposited cathode films 1 cm{sup 2} in area by 0.3 to 4 {mu}m thick were annealed at 700{degree}C to 800{degree}C in oxygen in order to form the crystalline spinel phase. The capacity of the cells between 4.5 V to 3.8 V depended on the annealing conditions and ranged from 50 {mu}Ah/mg to 120 {mu}Ah/mg. When cycled over this range, the batteries exhibited excellent secondary performance with capacity losses as low as 0.001% per cycle. On charging to 5.3 V, a plateau with a median voltage of 5.1 V was observed. The total charge extracted between 3.8 V to 5.3 V corresponded to about 1Li/Mn{sub 2}O{sub 4}.

Bates, J.B.; Lubben, D.; Dudney, N.J.



Development of (Mn,Co)3O4 Protection Layers for Ferritic Stainless Steel Interconnects  

DOE Green Energy (OSTI)

A spinel-based surface protection layer has been developed for alloy SOFC current collectors and bi-polar gas separators. The (Mn,Co)3O4 spinel with a nominal composition of Mn1.5Co1.5O4 demonstrates an excellent electrical conductivity and thermal expansion match to ferritic stainless steel interconnects. A slurry-coating technique provides a viable approach for fabricating protective layers of the spinel onto the steel interconnects. Thermally grown protection layers of Mn1.5Co1.5O4 have been found not only to significantly decrease the contact resistance between a LSF cathode and stainless steel interconnect, but also inhibits the sub-scale growth on the stainless steel. The combination of the inhibited sub-scale growth, good thermal expansion matching between the spinel and the stainless steel, and the closed-pore structure contribute to the excellent structural and thermomechanical stability of these spinel protection layers, which was verified by a long-term thermal-cycling test. The spinel protection layers can also act effectively to prevent outward diffusion of chromium from the interconnect alloy, preventing subsequent chromium migration into the cathode and contact materials. PNNL is currently engaged in studies intended to optimize the composition, microstructure, and fabrication procedure for the spinel protection layers.

Yang, Zhenguo; Simner, Steven P.; Singh, Prabhakar; Xia, Guanguang; Stevenson, Jeffry W.



Investigation of the Charge Collection Efficiency of CdMnTe Radiation Detectors  

SciTech Connect

This paper presents the growth, fabrication and characterization of indium-doped cadmium manganese telluride (CdMnTe) crystals grown by the vertical Bridgman technique. The 10 x 10 x 1.9 mm{sup 3} samples have been fabricated, and the charge collection properties of the CdMnTe detectors have been measured. Alpha-particle spectroscopy measurements have yielded an average charge collection efficiency approaching 100%. Ion beam induced charge (IBIC) measurements have been performed by raster scanning focused 5.5 MeV {sup 4}He beams onto the detectors. Spatially resolved charge collection efficiency maps have been produced for a range of detector bias voltages. Inhomogeneities in the charge transport of the CdMnTe crystals have been associated with chains of Te inclusions within the detector bulk, and the reduction in charge collection efficiency in their locality has been quantified. It has been shown that the role of Te inclusions in degrading charge collection is reduced with increasing values of bias voltage. IBIC measurements for a range of low biases have highlighted the evolution of the charge collection uniformity across the detectors.

Bolotnikov A.; Rafiei, R.; Boardman, D.; Sarbutt, A.; Prokopovich, A.; Kim, K.; Reinhard, M.I.; James, R.B.



Carriers-mediated ferromagnetic enhancement in Al-doped ZnMnO dilute magnetic semiconductors  

SciTech Connect

Nano-crystalline Zn{sub 0.95-x}Mn{sub 0.05}Al{sub x}O (x = 0, 0.05, 0.10) dilute magnetic semiconductors (DMS) were synthesized by sol-gel derived auto-combustion. X-ray diffraction (XRD) analysis shows that the samples have pure wurtzite structure typical of ZnO without the formation of secondary phases or impurity. Crystallite sizes were approximated by Scherrer formula while surface morphology and grain sizes were measured by field emission scanning electron microscopy. Incorporation of Mn and Al into the ZnO structure was confirmed by energy-dispersive X-ray analysis. Temperature dependent electrical resistivity measurements showed a decreasing trend with the doping of Al in ZnMnO, which is attributable to the enhancement of free carriers. Vibrating sample magnetometer studies confirmed the presence of ferromagnetic behavior at room temperature. The results indicate that Al doping results in significant variation in the concentration of free carriers and correspondingly the carrier-mediated magnetization and room temperature ferromagnetic behavior, showing promise for practical applications. We attribute the enhanced saturation magnetization and electrical conductivity to the exchange interaction mediated by free electrons.

Saleem, Murtaza [Centre of Excellence in Solid State Physics, University of the Punjab, Lahore-54590 (Pakistan); Siddiqi, Saadat A. [Centre of Excellence in Solid State Physics, University of the Punjab, Lahore-54590 (Pakistan); Interdisciplinary Research Centre in Biomedical Materials (IRCBM), COMSATS Institute of Information Technology, Defence Road, Off Raiwind Road, Lahore (Pakistan); Atiq, Shahid, E-mail: shahidatiqpasrur@yahoo.com [Centre of Excellence in Solid State Physics, University of the Punjab, Lahore-54590 (Pakistan); Anwar, M. Sabieh; Hussain, Irshad [School of Science and Engineering (SSE), Lahore University of Management Sciences (LUMS), Opposite Sector U, D.H.A. Lahore Cantt-54792 (Pakistan); Alam, Shahzad [Pakistan Council for Scientific and Industrial Research (PCSIR) Laboratories Complex, Lahore (Pakistan)



Mn-doped Ga(As,P) and (Al,Ga)As ferromagnetic semiconductors: Electronic structure calculations  

E-Print Network (OSTI)

A remarkable progress towards functional ferromagnetic semiconductor materials for spintronics has been achieved in p-type (Ga,Mn)As. Robust hole-mediated ferromagnetism has, however, been observed also in other III-V hosts such as antimonides, GaP, or (Al,Ga)As, which opens a wide area of possibilities for optimizing the host composition towards higher ferromagnetic Curie temperatures. Here we explore theoretically hole-mediated ferromagnetism and Mn incorporation in Ga(As,P) and (Al,Ga)As ternary hosts. While alloying (Ga,Mn)As with Al has only a small effect on the Curie temperature we predict a sizable enhancement of Curie temperatures in the smaller lattice constant Ga(As,P) hosts. Mn-doped Ga(As,P) is also favorable, as compared to (Al,Ga)As, with respect to the formation of carrier and moment compensating interstitial Mn impurities. In (Ga,Mn) (As,P) we find a marked decrease of the partial concentration of these detrimental impurities with increasing P content.

Masek, J.; Kudrnovsky, J.; Maca, F.; Sinova, Jairo; MacDonald, A. H.; Campion, R. P.; Gallagher, B. L.; Jungwirth, T.



Fischer Tropsch synthesis : influence of Mn on the carburization rates and activities of Fe-based catalysts by TPR-EXAFS/XANES and catalyst testing.  

Science Conference Proceedings (OSTI)

Fe-based catalysts containing different amounts of Mn were tested for Fischer-Tropsch synthesis using a stirred tank reactor at 270 C, 1.21 MPa, and H{sub 2}:CO = 0.7. Catalyst activation by carburization with 10% CO/He was followed by Temperature Programmed Reduction/X-ray Absorption Spectroscopy (TPR-EXAFS/XANES) from room temperature to 300 C. {gamma}-Fe{sub 2}O{sub 3} was converted into iron carbides, whereas MnO{sub x} was reduced to oxygen deficient MnO. Mn hindered Fe carburization, such that the carburized catalyst displayed higher Fe{sub 3}O{sub 4} content than the catalyst without Mn. EXAFS fitting indicates that the carburized catalyst contained a mixture of Hgg carbide, Fe{sub 3}O{sub 4}, and Mn oxides. Increasing Mn content led to higher CH{sub 4} and light product selectivities, and lower light olefin selectivities. Higher and stable conversions were obtained with a catalyst containing an almost equimolar Fe/Mn ratio relative to the catalyst without Mn. Selectivity trends are attributed to the higher WGS rates observed on the FeMn catalysts, consistent with the structural differences observed.

Ribeiro, M. C.; Jacobs, G.; Pendyala, R.; Davis, B. H.; Cronauer, D. C.; Kropf, A. J.; Marshall, C. L. (Chemical Sciences and Engineering Division); (Univ. of Kentucky)



Ab initio calculations and synthesis of the off-stoichiometric half-Heusler phase Ni{sub 1-x}Mn{sub 1+x}Sb  

SciTech Connect

We perform a combined theoretical and experimental study of the phase stability and magnetism of the off-stoichiometric Ni{sub 1-x}Mn{sub 1+x}Sb in the half-Heusler crystal phase. Our work is motivated by the need for strategies to engineer the magnetism of potentially half-metallic materials, such as NiMnSb, for improved performance at elevated temperatures. By means of ab initio calculations we investigate Ni{sub 1-x}Mn{sub 1+x}Sb over the whole composition range 0{<=}x{<=}1 of Ni replacing Mn and show that at relevant temperatures, the half-Heusler phase should be thermodynamically stable up to at least x=0.20 with respect to the competing C38 structure of Mn{sub 2}Sb. Furthermore we find that half-Heusler Ni{sub 1-x}Mn{sub 1+x}Sb retains half-metallic band structure over the whole concentration range and that the magnetic moments of substitutional Mn{sub Ni} atoms display magnetic exchange interactions an order of magnitude larger than the Ni-Mn interaction in NiMnSb. We also demonstrate experimentally that the alloys indeed can be created by synthesizing off-stoichiometric Ni{sub 1-x}Mn{sub 1+x}Sb films on MgO substrates by means of magnetron sputtering.

Ekholm, M.; Larsson, P.; Alling, B.; Helmersson, U.; Abrikosov, I. A. [Department of Physics, Chemistry and Biology (IFM), Linkoeping University, SE-58183 Linkoeping (Sweden)



Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Why MnIn{sub 2}O{sub 4} spinel is not a transparent conducting oxide?  

SciTech Connect

The title compound has been synthesized by a citrate technique. The crystal structure has been investigated at room temperature from high-resolution neutron powder diffraction (NPD) data. It crystallizes in a cubic spinel structure, space group Fd3-bar m, Z=8, with a=9.0008(1) A at 295 K. It exhibits a crystallographic formula (Mn{sub 0.924(2)}In{sub 0.076(2)}){sub 8a}(In{sub 1.804(2)}Mn{sub 0.196(2)}){sub 16d}O{sub 4}, where 8a and 16d stand for the tetrahedral and octahedral sites of the spinel structure, respectively, with a slight degree of inversion, {lambda}=0.08. MnIn{sub 2}O{sub 4} shows antiferromagnetic interactions below T{sub N} Almost-Equal-To 40 K, due to the statistical distribution of Mn ions over the two available sites. Unlike the related MgIn{sub 2}O{sub 4} and CdIn{sub 2}O{sub 4} spinels, well known as transparent conducting oxides, MnIn{sub 2}O{sub 4} is not transparent and shows a poor conductivity ({sigma}=0.38 S cm{sup -1} at 1123 K): the presence of Mn ions, able to adopt mixed valence states, localizes the charges that, otherwise, would be delocalized in the spinel conduction band. - Graphical Abstract: From NPD data the crystallographic formula (Mn{sub 0.924(2)}In{sub 0.076(2)}){sub 8a}(In{sub 1.804(2)}Mn{sub 0.196(2)}){sub 16d}O{sub 4}, shows a slight degree of inversion, {lambda}=0.08 and a certain In deficiency. The presence of Mn ions, able to adopt mixed oxidation states, localize the charges that, otherwise, would be delocalized in the spinel conduction band; the presence of localized Mn{sup 2+} and Mn{sup 3+} ions provides the characteristic brown color. Highlights: Black-Right-Pointing-Pointer Accurate structural determination from NPD data: inversion degree (8%), and In deficiency. Black-Right-Pointing-Pointer Bond-valence indicates Mn{sup 2+}-Mn{sup 3+} ions; edge-sharing octahedra contain 90% In{sup 3+}+10% Mn{sup 3+} cations. Black-Right-Pointing-Pointer Conductivity several orders of magnitude lower than those of MgIn{sub 2}O{sub 4} or CdIn{sub 2}O{sub 4}. Black-Right-Pointing-Pointer Variability of Mn oxidation states cancels any electron-doping effect, emptying conduction band of mobile charge carriers. Black-Right-Pointing-Pointer Curie-Weiss behavior confirming the determined charge distribution.

Martinez-Lope, M.J. [Instituto de Ciencia de Materiales de Madrid, C.S.I.C., Cantoblanco E-28049 Madrid (Spain); Retuerto, M. [Instituto de Ciencia de Materiales de Madrid, C.S.I.C., Cantoblanco E-28049 Madrid (Spain); Department of Chemistry, Rutgers State University of New Jersey, Piscataway, NJ 08854-8087 (United States); Calle, C. de la [Instituto de Ciencia de Materiales de Madrid, C.S.I.C., Cantoblanco E-28049 Madrid (Spain); Porcher, Florence [Laboratoire Leon Brillouin, CEA/Saclay, 91191 Gif Sur Ivette Cedex, France. (France); Alonso, J.A., E-mail: ja.alonso@icmm.csic.es [Instituto de Ciencia de Materiales de Madrid, C.S.I.C., Cantoblanco E-28049 Madrid (Spain)



In situ XRD Studies of Li-ion Cells with Mixed LiMn2O4 and LiCo1/3Ni1/3Mn1/3O2 Composite Cathode  

Science Conference Proceedings (OSTI)

The structural changes of the composite cathode made by mixing spinel LiMn2O4 and layered LiNi1/3Co1/3Mn1/3O2 in 1:1 wt% in both Li-half and Li-ion cells during charge/discharge are studied by in situ XRD. During the first charge up to {approx}5.2 V vs. Li/Li+, the in situ XRD spectra for the composite cathode in the Li-half cell track the structural changes of each component. At the early stage of charge, the lithium extraction takes place in the LiNi1/3Co1/3Mn1/3O2 component only. When the cell voltage reaches at {approx}4.0 V vs. Li/Li+, lithium extraction from the spinel LiMn2O4 component starts and becomes the major contributor for the cell capacity due to the higher rate capability of LiMn2O4. When the voltage passed 4.3 V, the major structural changes are from the LiNi1/3Co1/3Mn1/3O2 component, while the LiMn2O4 component is almost unchanged. In the Li-ion cell using a MCMB anode and a composite cathode cycled between 2.5 V and 4.2 V, the structural changes are dominated by the spinel LiMn2O4 component, with much less changes in the layered LiNi1/3Co1/3Mn1/3O2 component, comparing with the Li-half cell results. These results give us valuable information about the structural changes relating to the contributions of each individual component to the cell capacity at certain charge/discharge state, which are helpful in designing and optimizing the composite cathode using spinel- and layered-type materials for Li-ion battery research.

Nam, K.; Yoon, W; Shin, H; Chung, K; Choi, S; Yang, X



Growth kinetics and micromorphology of NH{sub 4}Cl:Mn{sup 2+} crystals formed in the NH{sub 4}Cl-MnCl{sub 2}-H{sub 2}O-CONH{sub 3} system  

Science Conference Proceedings (OSTI)

The growth kinetics and elementary growth processes on the surface of NH{sub 4}Cl:Mn{sup 2+} heterogeneous crystals formed in the NH{sub 4}Cl-MnCl{sub 2}-H{sub 2}O-CONH{sub 3} system are experimentally studied. It is found that a change in the composition of complexes in an NH{sub 4}Cl crystal from Mn(NH{sub 4}){sub 2}Cl{sub 4} {center_dot} 2H{sub 2}O to MnCl{sub 2} {center_dot} 2CONH{sub 3} leads to the occurrence of a local maximum in the kinetic curve and a change in the shape of dislocation growth centers from flat to conical. The growth kinetics of {l_brace}100{r_brace} faces of heterogeneous NH{sub 4}Cl:Mn{sup 2+} crystals is described within the Bliznakov model using the Fowler-Guggenheim adsorption isotherm, which takes into account the lateral interaction of adsorbed particles.

Pyankova, L. A., E-mail: lyuba_pyan@mail.ru; Punin, Yu. O.; Bocharov, S. N.; Shtukenberg, A. G. [Petersburg State University (Russian Federation)



Probing The Electrode/Electrolyte Interface in The Lithium Excess Layered Oxide Li1.2Ni0.2Mn0.6O2  

Science Conference Proceedings (OSTI)

A detailed surface investigation of the lithium-excess nickel manganese layered oxide Li1.2Ni0.2Mn0.6O2 structure was carried out using x-ray photoelectron spectroscopy (XPS), total electron yield and transmission x-ray absorption spectroscopy (XAS), and electron energy loss spectroscopy (EELS) during the first two electrochemical cycles. All spectroscopy techniques consistently showed the presence of Mn4+ in the pristine material and a surprising reduction of Mn at the voltage plateau during the first charge. The Mn reduction is accompanied by the oxygen loss revealed by EELS. Upon the first discharge, the Mn at the surface never fully returns back to Mn4+. The electrode/electrolyte interface of this compound consists of the reduced Mn at the crystalline defect-spinel inner layer and an oxidized Mn species simultaneously with the presence of a superoxide species in amorphous outer layer. This proposed model signifies that oxygen vacancy formation and lithium removal result in electrolyte decomposition and superoxide formation, leading to Mn activation/dissolution and surface layer-spinel phase transformation. The results also indicate that the role of oxygen is complex and significant in contributing to the extra capacity of this class of high energy density cathode materials.

Carroll, Kyler J [University of California, San Diego; Qian, Danna [University of California, San Diego; Fell, Chris [University of Florida, Gainesville; Calvin, Scott [Sarah Lawrence College; Veith, Gabriel M [ORNL; Chi, Miaofang [ORNL; Dudney, Nancy J [ORNL; Meng, Ying Shirley [University of California, San Diego



In situ and ex situ spectroelectrochemical and X-ray absorption studies on rechargeable, chemically-modified and other MnO{sub 2} materials  

DOE Green Energy (OSTI)

A combined series of in situ and ex situ UV spectroelectrochemical and X-ray absorption studies have been made on MnO{sub 2}, chemically-modified by small amounts of Bi(III), and comparatively on other MnO{sub 2} materials such as a blank (Bi-free) and {gamma}-MnO{sub 2}. These procedures are applied in order to follow the oxidation-states of Bi and of Mn during the course of discharge and recharge of MnO{sub 2} as a battery cathode material, and the extents of rechargeability that can be achieved with such materials. Presence of Bi appears to provide a preferred ``heterogeneous`` discharge/recharge pathway involving a soluble Mn(III) intermediate, over the alternative ``electron-proton`` hopping, solid-state mechanism. From XAS results, it is concluded that presence of Bi, although not affecting the O-coordination, does influence the Mn-Mn coordination, determining the way the MnO{sub 2} coordination octahedra are connected.

Conway, B.E.; Qu, D.; McBreen, J. [Ottawa Univ., ON (Canada). Dept. of Chemistry]|[Brookhaven National Lab., Upton, NY (United States)



Effect of Mn Substitution for Multiferroic BiFeO3 Probed by High-Resolution Soft-X-Ray Spectroscopy  

E-Print Network (OSTI)

sensor devices. low electrical resistivity, which affectstemperature. The low electrical resistivity of BF thin filmsFurthermore, the electrical resistivity also increases by Mn

Hattori, T.



Novel synthesis process and structure refinements of Li{sub 4}Mn{sub 5}O{sub 12} for rechargeable lithium batteries  

DOE Green Energy (OSTI)

Well crystallized Li4Mn5O12 was prepared from LiOAc-Mn(NO3)2 under flowing oxygen. Rietveld refinement with XRD and neutron powder diffraction indicated that Li4Mn5O12 has cubic spinel structure in which the Li ions occupy both the tetrahedral sites 8a and part of the octahedral sites 16d but not the 16c sites, while all the Mn ions occupy the 16d sites of the space group Fd{bar 3}m. The lattice parameter was found to be sensitive to synthesis temperature owing to variation in Mn valence. Sample prepared at 500 C showed better electrode performance: a rechargeable capacity of 135 mAh/g for the cell Li/Li4Mn5O12 at cell voltages 2.5-3.6 V. It is found that Mn oxidation state in Li4Mn5O12 has a strong effect on electrode performance of Li/Li4Mn5O12 cell.

Takada, Toshimi; Hayakawa, Hiroshi; Akiba, Etsuo [National Inst. of Materials and Chemical Research, Tsukuba, Ibaraki (Japan); Izumi, Fujio [National Inst. for Research in Inorganic Materials, Tsukuba (Japan); Chakoumakos, B.C. [Oak Ridge National Lab., TN (United States)



Magnetic and electrical properties of layered magnets Tl(Cr,Mn,Co)Se{sub 2}  

Science Conference Proceedings (OSTI)

Tl(Cr,Mn,Co)Se{sub 2} crystals were synthesized at T {approx} 1050 K. X-ray diffraction analysis showed that TlCrSe{sub 2}, TlMnSe{sub 2}, and TlCoSe{sub 2} compounds crystallize in the hexagonal crystal system with the lattice parameters: a = 3.6999 A, c = 22.6901 A, c/a {approx} 6.133, z = 3, {rho}{sub x} = 6.209 g/cm{sup 3}; a = 6.53 A, c = 23.96 A, c/a {approx} 3.669, z = 8, {rho}{sub x} = 6.71 g/cm{sup 3}; and a = 3.747 A, c = 22.772 A, c/a {approx} 6.077, z = 3, {rho}{sub x} = 7.577 g/cm{sup 3}, respectively. Magnetic and electrical studies in the temperature range from 80-400 K showed that TlCrSe{sub 2} is a semiconductor ferromagnet, TlMnSe{sub 2} is a semiconductor antiferromagnet, and TlCoSe{sub 2} is a ferrimagnet with a conductivity characteristic of metals. A rather large deviation in the experimental effective magnetic moment for TlCrSe{sub 2} (3.05 {mu}B) from the theoretical value (3.85 {mu}B) is attributed to two-dimensional magnetic ordering in the paramagnetic region of the noticeably layered ferromagnet TlCrSe{sub 2}. In TlCrSe{sub 2}, a correlation between magnetic and electrical properties was detected.

Veliyev, R. G.; Sadikhov, R. Z.; Kerimova, E. M., E-mail: ekerimova@physics.ab.az; Asadov, Yu. G.; Jabbarov, A. I. [National Academy of Sciences of Azerbaijan, Institute of Physics (Azerbaijan)



Pressure and field tuning the magnetostructural phases of Mn3O4: Raman scattering and x-ray diffraction studies  

Science Conference Proceedings (OSTI)

We present temperature-, magnetic-field-, and pressure-dependent Raman scattering studies of single crystal Mn{sub 3}O{sub 4}, combined with temperature- and field-dependent x-ray diffraction studies, revealing the novel magnetostructural phases in Mn{sub 3}O{sub 4}. Our temperature-dependent studies showed that the commensurate magnetic transition at T{sub 2} = 33K in the binary spinel Mn{sub 3}O{sub 4} is associated with a structural transition from tetragonal to orthorhombic structures. Field-dependent studies showed that the onset and nature of this structural transition can be controlled with an applied magnetic field, and revealed evidence for a field-tuned quantum phase transition to a tetragonal spin-disordered phase for H {parallel} [1{bar 1}0]. Pressure-dependent Raman measurements showed that the magnetic easy axis direction in Mn{sub 3}O{sub 4} can be controlled - and the ferrimagnetic transition temperature increased - with applied pressure. Finally, combined pressure- and magnetic-field-tuned Raman measurements revealed a rich magnetostructural phase diagram - including a pressure- and field-induced magnetically frustrated tetragonal phase in the PH phase diagram - that can be generated in Mn{sub 3}O{sub 4} with applied pressure and magnetic field.

Kim, M.; Nelson, C.; Chen, X.M.; Wang, X.; Budakian, R.; Abbamonte, P. & Cooper, S.L.



Spinel LiMn(2)O(4)/Reduced Graphene Oxide Hybrid for High Rate Lithium Ion Batteries  

DOE Green Energy (OSTI)

A well-crystallized and nano-sized spinel LiMn{sub 2}O{sub 4}/reduced graphene oxide hybrid cathode material for high rate lithium-ion batteries has been successfully synthesized via a microwave-assisted hydrothermal method at 200 C for 30 min without any post heat-treatment. The nano-sized LiMn{sub 2}O{sub 4} particles were evenly dispersed on the reduced graphene oxide template without agglomeration, which allows the inherent high active surface area of individual LiMn{sub 2}O{sub 4} nanoparticles in the hybrid. These unique structural and morphological properties of LiMn{sub 2}O{sub 4} on the highly conductive reduced graphene oxide sheets in the hybrid enable achieving the high specific capacity, an excellent high rate capability and stable cycling performance. An analysis of the cyclic voltammogram data revealed that a large surface charge storage contribution of the LiMn{sub 2}O{sub 4}/reduced graphene oxide hybrid plays an important role in achieving faster charge/discharge.

Bak, S.M.; Nam, K.; Lee, C.-W.; Kim, K.-H.; Jung, H.-C.; Yang, X-Q.; Kim, K.-B.



Investigation of thermal, mechanical and magnetic behaviors of the Cu-11%Al alloy with Ag and Mn additions  

SciTech Connect

The investigation of thermal, mechanical and magnetic behaviors of the Cu-11%Al, Cu-11%Al-3%Ag, Cu-11%Al-10%Mn and Cu-11%Al-10%Mn-3%Ag alloys was made using microhardness measurements, differential scanning calorimetry, X-ray diffractometry, scanning electron microscopy, energy dispersion X-ray spectroscopy and magnetic moment change with applied field measurement. The results indicated that the Mn addition changes the phase stability range, the microhardness values and makes undetectable the eutectoid reaction in annealed Cu-11%Al and Cu-11%Al-3%Ag alloys while the presence of Ag does not modify the phase transformation sequence neither microhardness values of the annealed Cu-11%Al and Cu-11%Al-10%Mn alloys, but it increases the magnetic moment of this latter at about 2.7 times and decreases the rates of eutectoid and peritectoid reactions of the former. - Highlights: Black-Right-Pointing-Pointer The microstructure of Cu-Al alloy is modified in the Ag presence. Black-Right-Pointing-Pointer ({alpha} + {gamma}) phase is stabilized down to room temperature when Ag is added to Cu-Al alloy. Black-Right-Pointing-Pointer Ag-rich phase modifies the magnetic characteristics of Cu-Al-Mn alloy.

Silva, R.A.G., E-mail: galdino.ricardo@gmail.com [Departamento de Ciencias Exatas e da Terra-UNIFESP, Diadema-SP (Brazil)] [Departamento de Ciencias Exatas e da Terra-UNIFESP, Diadema-SP (Brazil); Paganotti, A.; Gama, S. [Departamento de Ciencias Exatas e da Terra-UNIFESP, Diadema-SP (Brazil)] [Departamento de Ciencias Exatas e da Terra-UNIFESP, Diadema-SP (Brazil); Adorno, A.T.; Carvalho, T.M.; Santos, C.M.A. [Instituto de Quimica - UNESP, Araraquara-SP (Brazil)] [Instituto de Quimica - UNESP, Araraquara-SP (Brazil)



Synthesis and Electrochemical Characterization of M2Mn3O8 (M=Ca,Cu) Compounds and Derivatives  

DOE Green Energy (OSTI)

M{sub 2}Mn{sub 3}O{sub 8} (M=Ca{sup 2+}, Cu{sup 2+}) compounds were synthesized and characterized in lithium cells. The M{sup 2+} cations, which reside in the van der Waal's gaps between adjacent sheets of Mn{sub 3}O{sub 8}{sup 4-}, may be replaced chemically (by ion-exchange) or electrochemically with Li. More than 7 Li{sup +}/Cu{sub 2}Mn{sub 3}O{sub 8} may be inserted electrochemically, with concomitant reduction of Cu{sup 2+} to Cu metal, but less Li can be inserted into Ca{sub 2}Mn{sub 3}O{sub 8}. In the case of Cu{sup 2+}, this process is partially reversible when the cell is charged above 3.5 V vs. Li, but intercalation of Cu{sup +} rather than Cu{sup 2+} and Li{sup +}/Cu{sup +} exchange occurs during the subsequent discharge. If the cell potential is kept below 3.4 V, the Li in excess of 4Li{sup +}/Cu{sub 2}Mn{sub 3}O{sub 8} can be cycled reversibly. The unusual mobility of +2 cations in a layered structure has important implications both for the design of cathodes for Li batteries and for new systems that could be based on M{sup 2+} intercalation compounds.

Park, Yong Joon; Doeff, Marca M.


Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tiling theory applied to the surface structure of icosahedral AlPdMn quasicrystals  

E-Print Network (OSTI)

Surfaces in i-Al68Pd23Mn9 as observed with STM and LEED experiments show atomic terraces in a Fibonacci spacing. We analyze them in a bulk tiling model due to Elser which incorporates many experimental data. The model has dodecahedral Bergman clusters within an icosahedral tiling T^*(2F) and is projected from the 6D face-centered hypercubic lattice. We derive the occurrence and Fibonacci spacing of atomic planes perpendicular to any 5fold axis, compute the variation of planar atomic densities, and determine the (auto-) correlation functions. Upon interpreting the planes as terraces at the surface we find quantitative agreement with the STM experiments.

Peter Kramer; Zorka Papadopolos; Harald Teuscher



Neutron scattering study of MnSi proving no exchange hole  

SciTech Connect

Neutron scattering experiments have been performed in MnSi below T/sub c/ with the double-axis powder scattering technique using unpolarized neutrons, and also with the polarization analysis technique. The magnetic scattering intensity has not shown any anomaly around q = 0.5 A/sup -1/, in contrast to the previous results of Ziebeck et al. who found a large intensity peak at this momentum transfer. Thus the hypothesis of Ziebeck et al. of observing an Exchange Hole is excluded.

Uemura, Y.J.; Majkrzak, C.F.; Shirane, G.; Ishikawa, Y.



Modeling Ambient Air Quality In The Detroit-Windsor Airshed.  

E-Print Network (OSTI)

??The spatial variability of airborne contaminants in an international airshed was investigated using geostatistics and air dispersion modeling. Analyses were conducted on contaminant species measured… (more)

Molaroni, Shannon Marie



The Detroit East RiverWalk: extend-connect-provide.  

E-Print Network (OSTI)

??Our water bodies have functioned as a critical transportation network, moving people, raw materials, products and goods across countries and continents. Starting as hubs of… (more)

Ward, Kyle



Riot or rebellion: media framing and the 1967 Detroit uprising.  

E-Print Network (OSTI)

??Frames make sense of complex issues and events, including identifying who is to blame and who or what is responsible for overcoming the problem. This… (more)

Ulbrich, Casandra E.



(248) 722?6978Transit in Metro Detroit 2 Acknowledgements  

E-Print Network (OSTI)

University. Many thanks for helping to refine my topic, for mentoring me during the writing process and throughout my time at Wayne State, and for your commitment to the development of livable cities.

unknown authors



The Import Threat : Detroit's Boundary Objects During the 1980s  

E-Print Network (OSTI)

ler who sold the car to the consumer, the bank that provided financing to the consumer, the marketing agency that created the advertisements that enticed the consumer to buy the car, the group of individuals who assembled the car, the corporation that hired and trained those individuals, the corporation that provided the tyres, the corporation that provided the rubber for the tyres,... and finally, the government that established the trade policies that made the creation of that car possible and profitable. Coordinating activity and information amongst these various actors is not an easy task. They each have different motivations and goal and lack a common perspective or language. Inter-organizational communication requires a special animal: the Boundary Object. Boundary Objects Star and Griesemer (1989) introduced the Boundary Object to the field of Science Studies. Although they were studying how scientists collected samples for a museum nearly a century ago, Boundary Objects have b

George Goodall




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to diverse markets. In these products they incorporate advanced materials such as ceramic piston rings, valves and valve guides, piston crowns, rocker arm bushings, clevis...



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

fabrication, and demonstration of five stationary and moving structural monolithic ceramic components in an extremely hostile Low Heat Rejection (LHR) environment. DDC was...


Detroit Beach, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

311563°, -83.3268753° 311563°, -83.3268753° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.9311563,"lon":-83.3268753,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Enhancement of spin-asymmetry by L2{sub 1}-ordering in Co{sub 2}MnSi/Cr/Co{sub 2}MnSi current-perpendicular-to-plane magnetoresistance devices  

SciTech Connect

Co{sub 2}MnSi/Cr/Co{sub 2}MnSi (001)-fully epitaxial current-perpendicular-to-plane giant magnetoresistance (CPP-GMR) devices were fabricated via an UHV magnetron sputtering system. The relationship between the degree of chemical ordering in Co{sub 2}MnSi (CMS) and the CPP-GMR characteristics was investigated systematically against the annealing temperature of the devices. X-ray diffraction profiles and reflection high-energy electron diffraction images indicated that annealing improved L2{sub 1}-ordering. The MR ratio also increased upon annealing and the maximum MR ratio of 5.2% and {delta}RA of 6.5 m{omega} {mu}m{sup 2} were achieved by annealing at 400 deg. C. These results indicate that promoting the degree of L2{sub 1}-ordering in CMS enhances the bulk and/or interface spin-asymmetry coefficients.

Sakuraba, Y.; Iwase, T.; Saito, K.; Mitani, S.; Takanashi, K. [Institute for Materials Research, Tohoku University, Katahira 2-1-1, Aoba-ku, Sendai 980-8577 (Japan)



Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


Low Dose Radiation Research Program: Regulation of NF-kB and MnSOD in Low  

NLE Websites -- All DOE Office Websites (Extended Search)

NF-kB and MnSOD in Low Dose Radiation-Induced Adaptive NF-kB and MnSOD in Low Dose Radiation-Induced Adaptive Responses in Mouse and Human Skin Cells Jian Jian Li School of Health Sciences, Purdue University West Lafayette, Indiana Why this Project? To determine if low dose ionizing radiation-induced adaptive responses in skin cells are mediated by activation of signaling networks. Project Goals To evaluate the signaling networks involving transcription factor NF-kB and the mitochondrial antioxidant protein MnSOD. To determine if NF-kB is activated by low dose radiation in vivo. To determine if NF-kB activation is critical in the pathways that produce adaptive responses. Experimental Approach Cells transfected with NF-kB luciferase responder genes will be used to define a dose-response relationship for activation of the NF-kB gene. NF-kB


MN Workshop  

Science Conference Proceedings (OSTI)

Page 1. NIST Special Publication 1093 Mass Notification Messages: Workshop Proceedings Erica D. Kuligowski Richard ...



Room temperature ferromagnetism in Mn, Ni and Co ions doped Cu{sub 2}O nanorods  

SciTech Connect

Here we report the synthesis and characterization of Cu{sub 2}O nanorods doped with Mn, Ni and Co transition metal ions and the study of their magnetic properties. Synthesis of the nanorods was carried out by the modified polyol method. Powder X-ray diffraction patterns clearly showed them to be polycrystalline single phase material. They exhibited ferromagnetic behavior at room temperature, however no such behavior was observed for the reference undoped sample, which indicated that unintentionally introduced magnetic impurities were not responsible for the observed phenomenon. Ferromagnetic behavior was found to be dependent on the dopant concentration and increased consistently with its increment in the material. The total magnetic moments contribution was calculated for the dopant concentration and was found to be insignificant to account for the observed ferromagnetism, therefore it was suggested that ferromagnetism could have conjured up from the induced magnetic moment in the defects created as cation vacancies in the material. The presence of the defects was supported by the room temperature photoluminescence study which showed that intensity of the peaks was dependent on the dopant concentration and increased consistently with it. There was strong correlation between the magnitude of the photoluminescence peak and the observed ferromagnetic property in the doped samples. -- Graphical Abstract: Room temperature ferromagnetism was observed in the Cu{sub 2}O nanorods doped with Mn, Ni and Co ions. The origin seems to be the defects of cation vacancies created by the dopant ions. Display Omitted

Ahmed, Asar [Department of Chemistry, SL-214, Southern Lab, Indian Institute of Technology Kanpur, Kanpur, Uttar Pradesh (India); Gajbhiye, Namdeo S., E-mail: nsg@iitk.ac.i [Department of Chemistry, SL-214, Southern Lab, Indian Institute of Technology Kanpur, Kanpur, Uttar Pradesh (India)



Microstructure and Magnetic Properties of PrMnO{sub 3} Bulk and Thin Film  

Science Conference Proceedings (OSTI)

Perovskite PrMnO{sub 3}(PMO) had been prepared in bulk by solid state reaction and thin films on corning glass, fused silica and MgO (100) glass substrate by pulsed laser deposition technique. SEM micrographs show that grains with size 2{approx}3 {mu}m is observed in bulk PMO while thin films PMO show strongly connected grain structure with particle size that not larger than 100 nm. X-ray diffraction analysis shows that all samples are in single phase with orthorhombic crystal structure. Bulk PMO sample had lattice strain of 0.134% which is the lowest value among others. However, larger lattice strain was observed in thin film samples due to lattice mismatch between film-substrate and caused the MnO{sub 6} to deform. All samples shown paramagnetic or antiferromagnetic behavior, enhancement in magnetization value occurred for all PMO grew as film. We believe that larger lattice strain favor the grain growth of PMO towards more order phase. In summary, formation of structure and microstructure of thin film PMO depends on type of substrate used and it affect the magnetic property.

Lim, K. P.; Halim, S. A.; Chen, S. K.; Ng, S. W.; Wong, J. K.; Gan, H. M. Albert [Department of Physics, Faculty of Science, Universiti Putra Malaysia, 43400 UPM Serdang, Selangor (Malaysia); Woon, H. S. [College of Engineering, Universiti Tenaga Nasional, Jalan IKRAM-UNITEN, 43000 Kajang, Selangor (Malaysia)



Defect Levels of Indium-doped CdMnTe Crystals  

Science Conference Proceedings (OSTI)

Using photoluminescence (PL) and current deep-level transient spectroscopy (I-DLTS), we investigated the electronic defects of indium-doped detector-grade CdMnTe:In (CMT:In) crystals grown by the vertical Bridgman method. We similarly analyzed CdZnTe:In (CZT:In) and undoped CdMnTe (CMT) crystals grown under the amount of same level of excess Te and/or indium doping level to detail the fundamental properties of the electronic defect structure more readily. Extended defects, existing in all the samples, were revealed by synchrotron white beam x-ray diffraction topography and scanning electron microscopy. The electronic structure of CMT is very similar to that of CZT, with shallow traps, A-centers, Cd vacancies, deep levels, and Te antisites. The 1.1-eV deep level, revealed by PL in earlier studies of CZT and CdTe, were attributed to dislocation-induced defects. In our I-DLTS measurements, the 1.1-eV traps showed different activation energies with applied bias voltage and an exponential dependence on the trap-filling time, which are typical characteristics of dislocation-induced defects. We propose a new defect-trap model for indium-doped CMT crystals.

K Kim; A Bolotinikov; G Camarda; R Gul; A Hossain; G Yang; Y Cui; R James



Exact Enumeration of the Phase Space of an Ising Model of Ni2MnGa  

Science Conference Proceedings (OSTI)

Exact evaluations of partition functions are generally prohibitively expensive due to exponential growth of phase space with the number of degrees of freedom. For an Ising model with sites the number of possible states is requiring the use of better scaling methods such as importance sampling Monte-Carlo calculations for all but the smallest systems. Yet the ability to obtain exact solutions for as large as possible systems can provide important benchmark results and opportunities for unobscured insight into the underlying physicsofthesystem.HerewepresentanIsingmodelforthemagneticsublatticesoftheimportantmagneto-caloricmaterialNi MnGa and use an exact enumeration algorithm to calculate the number of states for each energy and sublattice magne- tizations and . This allows the efficient calculation of the partition function and derived thermodynamic quantities such as specific heat and susceptibility. Utilizing the jaguarpf system at Oak Ridge we are able to calculate for systems of up to48sites,whichprovidesimportantinsightintothemechanismforthelargemagnet-caloriceffectinNi MnGaaswellasanimportant benchmark for Monte-Carlo (esp. Wang-Landau method).

Eisenbach, Markus [ORNL; Brown, Greg [ORNL; Rusanu, Aurelian [ORNL; Odbadrakh, Khorgolkhuu [ORNL; Nicholson, Don M [ORNL; McCarthy, Carrie V. [University of Georgia, Athens, GA



Magnetic phase diagram of disordered Ni-Mn near the multicritical point  

Science Conference Proceedings (OSTI)

From detailed magnetization data taken under various field-cooling conditions, the magnetic phase diagram of temperature versus composition is determined for disordered Ni-Mn of Mn concentration (x) near 25 at. %. With increasing x, the ferromagnetic Curie-point (T/sub c/) line descends and meets the ascending line for the spin-glass reentrance temperature (T/sub f//sub g/) at a multicritical point (MCP) located at x = 23.9, T = 102 K, from which the spin-glass freezing-temperature (T/sub g/) line emerges and reaches a maximum at higher x. The reentrant spin-glass (SG) ordering is accompanied by a net ferromagnetic (FM) moment, thus describing a mixed ferro-spin-glass (FSG) state, which is separated from the normal SG state by a boundary line that extends essentially vertically down in temperature from the MCP. Moreover, it is shown that the SG ordering of the FSG state probably persists into the FM regime above T/sub f//sub g/, where T/sub f//sub g/ (like T/sub g/) remains defined operationally by the appearance of irreversible and time-dependent magnetic effects.

Abdul-Razzaq, W.; Kouvel, J.S.



Tb0.5Bi0.5MnO3: New material. A DFT study  

Science Conference Proceedings (OSTI)

In the present work we have determined the band structure and the densities of states (DOS) of Tb0.5Bi0.5MnO3 in cubic phase using the density functional theory (DFT). The determination of the lattice constant was ... Keywords: 61.50.-f, 62.20.-x, 71.15.Nc, 71.20.-b, 71.55.Ht, 75.20.En, Band structure, DFT, Density of states, Magnetic properties, Mechanical and structural properties, Tb1-xBixMnO3

Miguel Grizalez; M. Jairo Arbey Rodríguez; Jesús Heiras; P. Prieto


Note: This page contains sample records for the topic "mi detroit mn" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Identification of Mn site in Pb(Zr,Ti)O{sub 3} by synchrotron x-ray absorption near-edge structure: Theory and experiment  

SciTech Connect

Synchrotron x-ray absorption near-edge structure (XANES) experiments are performed on Mn-doped PbZr{sub 1-x}Ti{sub x}O{sub 3} samples (PZT) and compared with first-principles XANES simulations. The features of the measured Mn K-edge XANES are consistent with the first-principles XANES of Mn on the Ti/Zr site and inconsistent with Mn on other sites. The clear agreement between measured and first-principles theoretical XANES spectra reported here is by far the strongest evidence of Mn substituting for Ti/Zr in PZT. This work illustrates that a first-principles supercell framework, which is popularly used to study impurities in crystals, can be used in conjunction with XANES measurement in order to identify an impurity structure with a high degree of confidence. This approach may thus be broadly applicable to study impurities in other crystals.

Limpijumnong, Sukit; Rujirawat, Saroj; Boonchun, Adisak; Smith, M. F.; Cherdhirunkorn, B. [National Synchrotron Research Center, Nakhon Ratchasima 30000, Thailand and School of Physics, Suranaree University of Technology, Nakhon Ratchasima 30000 (Thailand); National Synchrotron Research Center, Nakhon Ratchasima 30000 (Thailand); Department of Physics, Thammasat University, Patum Thani 12121 (Thailand)



Radiation-induced instability of MnS precipitates and its possible consequences on irradiation-induced stress corrosion cracking of austenitic stainless steels  

SciTech Connect

Irradiation-assisted stress corrosion cracking (IASCC) is a significant materials issue for the light water reactor (LWR) industry and may also pose a problem for fusion power reactors that will use water as coolant. A new metallurgical process is proposed that involves the radiation-induced release into solution of minor impurity elements not usually thought to participate in IASCC. MnS-type precipitates, which contain most of the sulfur in stainless steels, are thought to be unstable under irradiation. First, Mn transmutes strongly to Fe in thermalized neutron spectra. Second, cascade-induced disordering and the inverse Kirkendall effect operating at the incoherent interfaces of MnS precipitates are thought to act as a pump to export Mn from the precipitate into the alloy matrix. Both of these processes will most likely allow sulfur, which is known to exert a deleterious influence on intergranular cracking, to re-enter the matrix. To test this hypothesis, compositions of MnS-type precipitates contained in several unirradiated and irradiated heats of Type 304, 316, and 348 stainless steels (SSs) were analyzed by Auger electron spectroscopy. Evidence is presented that shows a progressive compositional modification of MnS precipitates as exposure to neutrons increases in boiling water reactors. As the fluence increases, the Mn level in MnS decreases, whereas the Fe level increases. The S level also decreases relative to the combined level of Mn and Fe. MnS precipitates were also found to be a reservoir of other deleterious impurities such as F and O which could be also released due to radiation-induced instability of the precipitates.

Chung, H.M.; Sanecki, J.E. [Argonne National Lab., IL (United States); Garner, F.A. [Pacific Northwest National Lab., Richland, WA (United States)



ASHRAE 2000 Annual Meeting, June 24-28, 2000, Minneapolis, MN, and published in ASHRAE Transactions, 106(2) 2000.  

E-Print Network (OSTI)

LBNL-44422 Mo-420 ASHRAE 2000 Annual Meeting, June 24-28, 2000, Minneapolis, MN, and published in ASHRAE Transactions, 106(2) 2000. This work was supported by the Assistant Secretary for Energy-factors of predominantly planar, vertical windows has been made by both ASHRAE and NFRC, and as increasing consensus has


EXAFS and FT-IR Characterization of Mn and Li Promoted Titania-Supported Rh Catalysts for CO Hydrogenation  

DOE Green Energy (OSTI)

The effect of Li and Mn promoters on the structure and selectivity of supported Rh catalysts for CO hydrogenation reaction was examined. Infrared spectrosco