Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Field Development Strategies for Bakken Shale Formation  

E-Print Network (OSTI)

July 2010 Field Development Strategies for Bakken Shale Formation SPE 139032 S.Zargari, S Bakken Formation is comprised of 3 Members: · Upper Shale Member­ Source & Seal · Middle "Siltstone" Member­ Reservoir & Migration Conduit · Lower Shale Member- Source & Seal #12;July 2010 Reservoir

Mohaghegh, Shahab


Bakken formation oil and gas drilling activity mirrors development ...  

U.S. Energy Information Administration (EIA)

Data Tools & Models ... Oil production growth in the Bakken shale play mirrors somewhat the growth in natural gas production ... U.S. Department of Energy USA.gov


Subtask 1.8 - Investigation of Improved Conductivity and Proppant Applications in the Bakken Formation  

SciTech Connect

Given the importance of hydraulic fracturing and proppant performance for development of the Bakken and Three Forks Formations within the Williston Basin, a study was conducted to evaluate the key factors that may result in conductivity loss within the reservoirs. Various proppants and reservoir rock cores were exposed to several different fracturing and formation fluids at reservoir conditions. The hardness of the rock cores and the strength of the proppants were evaluated prior to and following fluid exposure. In addition, the conductivity of various proppants, as well as formation embedment and spalling, was evaluated at reservoir temperatures and pressures using actual reservoir rock cores. The results of this work suggest that certain fluids may affect both rock and proppant strength, and therefore, fluid exposure needs to be considered in the field. In addition, conductivity decreases within the Bakken Formation appear to be a function of a variety of factors, including proppant and rock strength, as well as formation embedment and spalling. The results of this study highlight the need for advanced conductivity testing, coupled with quantification of formation embedment and spalling. Given the importance of proppant performance on conductivity loss and, ultimately, oil recovery, better understanding the effects of these various factors on proppant and rock strength in the field is vital for more efficient production within unconventional oil and gas reservoirs.

Bethany Kurz; Darren Schmidt; Steven Smith Christopher Beddoe; Corey Lindeman; Blaise Mibeck




Science Conference Proceedings (OSTI)

Production from the Bakken and Three Forks Formations continues to trend upward as forecasts predict significant production of oil from unconventional resources nationwide. As the U.S. Geological Survey reevaluates the 3.65 billion bbl technically recoverable estimate of 2008, technological advancements continue to unlock greater unconventional oil resources, and new discoveries continue within North Dakota. It is expected that the play will continue to expand to the southwest, newly develop in the northeastern and northwestern corners of the basin in North Dakota, and fully develop in between. Although not all wells are economical, the economic success rate has been near 75% with more than 90% of wells finding oil. Currently, only about 15% of the play has been drilled, and recovery rates are less than 5%, providing a significant future of wells to be drilled and untouched hydrocarbons to be pursued through improved stimulation practices or enhanced oil recovery. This study provides the technical characterizations that are necessary to improve knowledge, provide characterization, validate generalizations, and provide insight relative to hydrocarbon recovery in the Bakken and Three Forks Formations. Oil-saturated rock charged from the Bakken shales and prospective Three Forks can be produced given appropriate stimulation treatments. Highly concentrated fracture stimulations with ceramic- and sand-based proppants appear to be providing the best success for areas outside the Parshall and Sanish Fields. Targeting of specific lithologies can influence production from both natural and induced fracture conductivity. Porosity and permeability are low, but various lithofacies units within the formation are highly saturated and, when targeted with appropriate technology, release highly economical quantities of hydrocarbons.

Darren D. Schmidt; Steven A. Smith; James A. Sorensen; Damion J. Knudsen; John A. Harju; Edward N. Steadman



Annual Logging Symposium, June 19-23, 2010 Formation Evaluation in the Bakken Complex Using Laboratory Core Data  

E-Print Network (OSTI)

complex include the Middle Bakken dolomitic sand/siltstone and the Three Forks dolomite. The Upper basin (Energy Information Administration, 2006). The tight Mississippian age Lodgepole Limestone fine sand). Some of the samples were found to contain fractures. Fig. 8 Ternary diagram of sandstone


Bakken Shale Oil Production Trends  

E-Print Network (OSTI)

As the conventional reservoirs decrease in discovering, producing and reserving, unconventional reservoirs are more remarkable in terms of discovering, development and having more reserve. More fields have been discovered where Barnett Shale and Bakken Shale are the most recently unconventional reservoir examples. Shale reservoirs are typically considered self-sourcing and have very low permeability ranging from 10-100 nanodarcies. Over the past few decades, numerous research projects and developments have been studied, but it seems there is still some contention and misunderstanding surrounding shale reservoirs. One of the largest shale in the United State is the Bakken Shale play. This study will describe the primary geologic characteristics, field development history, reservoir properties,and especially production trends, over the Bakken Shale play. Data are available for over hundred wells from different companies. Most production data come from the Production Data Application (HDPI) database and in the format of monthly production for oil, water and gas. Additional 95 well data including daily production rate, completion, Pressure Volume Temperature (PVT), pressure data are given from companies who sponsor for this research study. This study finds that there are three Types of well production trends in the Bakken formation. Each decline curve characteristic has an important meaning to the production trend of the Bakken Shale play. In the Type I production trend, the reservoir pressure drops below bubble point pressure and gas releasingout of the solution. With the Type II production trend, oil flows linearly from the matrix into the fracture system, either natural fracture or hydraulic fracture. Reservoir pressure is higher than the bubble point pressure during the producing time and oil flows as a single phase throughout the production period of the well. A Type III production trend typically has scattering production data from wells with a different Type of trend. It is difficult to study this Type of behavior because of scattering data, which leads to erroneous interpretation for the analysis. These production Types, especially Types I and II will give a new type curve matches for shale oil wells above or below the bubble point.

Tran, Tan



New Models Help Optimize Development of Bakken Shale Resources | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Models Help Optimize Development of Bakken Shale Resources Models Help Optimize Development of Bakken Shale Resources New Models Help Optimize Development of Bakken Shale Resources February 7, 2012 - 12:00pm Addthis Washington, DC - Exploration and field development in the largest continuous oil play in the lower 48 states, located in North Dakota and eastern Montana, will be guided by new geo-models developed with funding from the Department of Energy's (DOE) Office of Fossil Energy (FE). The three-year project to develop exploration and reservoir models for the Bakken Shale resource play was conducted by the Colorado School of Mines (CSM), through research funded by FE's Oil and Natural Gas Program. A "play" is a shale formation containing significant accumulations of natural gas or oil. The U.S. Geological Survey estimates the Bakken Shale


New Models Help Optimize Development of Bakken Shale Resources | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

New Models Help Optimize Development of Bakken Shale Resources New Models Help Optimize Development of Bakken Shale Resources New Models Help Optimize Development of Bakken Shale Resources February 7, 2012 - 12:00pm Addthis Washington, DC - Exploration and field development in the largest continuous oil play in the lower 48 states, located in North Dakota and eastern Montana, will be guided by new geo-models developed with funding from the Department of Energy's (DOE) Office of Fossil Energy (FE). The three-year project to develop exploration and reservoir models for the Bakken Shale resource play was conducted by the Colorado School of Mines (CSM), through research funded by FE's Oil and Natural Gas Program. A "play" is a shale formation containing significant accumulations of natural gas or oil. The U.S. Geological Survey estimates the Bakken Shale


The Bakken-An Unconventional Petroleum and Reservoir System  

SciTech Connect

An integrated geologic and geophysical study of the Bakken Petroleum System, in the Williston basin of North Dakota and Montana indicates that: (1) dolomite is needed for good reservoir performance in the Middle Bakken; (2) regional and local fractures play a significant role in enhancing permeability and well production, and it is important to recognize both because local fractures will dominate in on-structure locations; and (3) the organic-rich Bakken shale serves as both a source and reservoir rock. The Middle Bakken Member of the Bakken Formation is the target for horizontal drilling. The mineralogy across all the Middle Bakken lithofacies is very similar and is dominated by dolomite, calcite, and quartz. This Member is comprised of six lithofacies: (A) muddy lime wackestone, (B) bioturbated, argillaceous, calcareous, very fine-grained siltstone/sandstone, (C) planar to symmetrically ripple to undulose laminated, shaly, very fine-grained siltstone/sandstone, (D) contorted to massive fine-grained sandstone, to low angle, planar cross-laminated sandstone with thin discontinuous shale laminations, (E) finely inter-laminated, bioturbated, dolomitic mudstone and dolomitic siltstone/sandstone to calcitic, whole fossil, dolomitic lime wackestone, and (F) bioturbated, shaly, dolomitic siltstone. Lithofacies B, C, D, and E can all be reservoirs, if quartz and dolomite-rich (facies D) or dolomitized (facies B, C, E). Porosity averages 4-8%, permeability averages 0.001-0.01 mD or less. Dolomitic facies porosity is intercrystalline and tends to be greater than 6%. Permeability may reach values of 0.15 mD or greater. This appears to be a determinant of high productive wells in Elm Coulee, Parshall, and Sanish fields. Lithofacies G is organic-rich, pyritic brown/black mudstone and comprises the Bakken shales. These shales are siliceous, which increases brittleness and enhances fracture potential. Mechanical properties of the Bakken reveal that the shales have similar effective stress as the Middle Bakken suggesting that the shale will not contain induced fractures, and will contribute hydrocarbons from interconnected micro-fractures. Organic-rich shale impedance increases with a reduction in porosity and an increase in kerogen stiffness during the burial maturation process. Maturation can be directly related to impedance, and should be seismically mappable. Fractures enhance permeability and production. Regional fractures form an orthogonal set with a dominant NE-SW trend parallel to ?1, and a less prominent NW-SE trend. Many horizontal wells are drilled perpendicular to the ?1 direction to intersect these fractures. Local structures formed by basement tectonics or salt dissolution generate both hinge parallel and hinge oblique fractures that may overprint and dominate the regional fracture signature. Horizontal microfractures formed by oil expulsion in the Bakken shales, and connected and opened by hydrofracturing provide permeability pathways for oil flow into wells that have been hydro-fractured in the Middle Bakken lithofacies. Results from the lithofacies, mineral, and fracture analyses of this study were used to construct a dual porosity Petrel geo-model for a portion of the Elm Coulee Field. In this field, dolomitization enhances reservoir porosity and permeability. First year cumulative production helps locate areas of high well productivity and in deriving fracture swarm distribution. A fracture model was developed based on high productivity well distribution, and regional fracture distribution, and was combined with favorable matrix properties to build a dual porosity geo-model.

Frederick Sarg



The Bakken - An Unconventional Petroleum and Reservoir System  

Science Conference Proceedings (OSTI)

An integrated geologic and geophysical study of the Bakken Petroleum System, in the Williston basin of North Dakota and Montana indicates that: (1) dolomite is needed for good reservoir performance in the Middle Bakken; (2) regional and local fractures play a significant role in enhancing permeability and well production, and it is important to recognize both because local fractures will dominate in on-structure locations; and (3) the organic-rich Bakken shale serves as both a source and reservoir rock. The Middle Bakken Member of the Bakken Formation is the target for horizontal drilling. The mineralogy across all the Middle Bakken lithofacies is very similar and is dominated by dolomite, calcite, and quartz. This Member is comprised of six lithofacies: (A) muddy lime wackestone, (B) bioturbated, argillaceous, calcareous, very fine-grained siltstone/sandstone, (C) planar to symmetrically ripple to undulose laminated, shaly, very fine-grained siltstone/sandstone, (D) contorted to massive fine-grained sandstone, to low angle, planar cross-laminated sandstone with thin discontinuous shale laminations, (E) finely inter-laminated, bioturbated, dolomitic mudstone and dolomitic siltstone/sandstone to calcitic, whole fossil, dolomitic lime wackestone, and (F) bioturbated, shaly, dolomitic siltstone. Lithofacies B, C, D, and E can all be reservoirs, if quartz and dolomite-rich (facies D) or dolomitized (facies B, C, E). Porosity averages 4-8%, permeability averages 0.001-0.01 mD or less. Dolomitic facies porosity is intercrystalline and tends to be greater than 6%. Permeability may reach values of 0.15 mD or greater. This appears to be a determinant of high productive wells in Elm Coulee, Parshall, and Sanish fields. Lithofacies G is organic-rich, pyritic brown/black mudstone and comprises the Bakken shales. These shales are siliceous, which increases brittleness and enhances fracture potential. Mechanical properties of the Bakken reveal that the shales have similar effective stress as the Middle Bakken suggesting that the shale will not contain induced fractures, and will contribute hydrocarbons from interconnected micro-fractures. Organic-rich shale impedance increases with a reduction in porosity and an increase in kerogen stiffness during the burial maturation process. Maturation can be directly related to impedance, and should be seismically mappable. Fractures enhance permeability and production. Regional fractures form an orthogonal set with a dominant NE-SW trend, and a less prominent NW-SE trend. Many horizontal 1 direction to intersect these fractures. Local structures formed by basement tectonics or salt dissolution generate both hinge parallel and hinge oblique fractures that may overprint and dominate the regional fracture signature. Horizontal microfractures formed by oil expulsion in the Bakken shales, and connected and opened by hydrofracturing provide permeability pathways for oil flow into wells that have been hydro-fractured in the Middle Bakken lithofacies. Results from the lithofacies, mineral, and fracture analyses of this study were used to construct a dual porosity Petrel geo-model for a portion of the Elm Coulee Field. In this field, dolomitization enhances reservoir porosity and permeability. First year cumulative production helps locate areas of high well productivity and in deriving fracture swarm distribution. A fracture model was developed based on high productivity well distribution, and regional fracture distribution, and was combined with favorable matrix properties to build a dual porosity geo-model.

Sarg, J.



Technology-Based Oil and Natural Gas Plays: Shale Shock! Could There Be Billions in the Bakken?  

Gasoline and Diesel Fuel Update (EIA)

Technology-Based Technology-Based Oil and Natural Gas Plays: Shale Shock! Could There Be Billions in the Bakken? Through the use of technology, U.S. oil and natural gas operators are converting previously uneconomic oil and natural gas resources into proved reserves and production. The Bakken Formation of the Williston Basin is a success story of horizontal drilling, fracturing, and completion technologies. The recent, highly productive oil field discoveries within the Bakken Formation did not come from venturing out into deep uncharted waters heretofore untapped by man, nor from blazing a trail into pristine environs never open to drilling before. Instead, success came from analysis of geologic data on a decades-old producing area, identification of uptapped resources, and application of the new drilling and completion technology necessary to exploit them. In short, it came from using technology


Today in Energy - Bakken formation oil and gas drilling activity ...  

U.S. Energy Information Administration (EIA)

Energy Information Administration - EIA - Official Energy Statistics from the U.S. Government ... (from green to red), the more gas is being produced.


Bakken formation oil and gas drilling activity mirrors development ...  

U.S. Energy Information Administration (EIA)

Petroleum & Other Liquids. Crude oil, gasoline, heating oil, diesel, propane, and other liquids including biofuels and natural gas liquids. Natural Gas


SPE-139032-PP Field Development Strategies for Bakken Shale Formation  

E-Print Network (OSTI)

, Trans, AIME. 1945. 12. R. N. Heistand, H. G. Humphries; Direct Determination of Organic Carbon in Oil Shale, Analytical Chemistry, Vol. 48, No. 8, July 1976, p 1193. #12;

Mohaghegh, Shahab


Bakken formation oil and gas drilling activity mirrors development ...  

U.S. Energy Information Administration (EIA)

Tools; Glossary All Reports ... weather; gasoline; capacity; exports; nuclear; forecast; View All Tags ...


David E. Bakken (Summary page) School of Electrical Engineering and Computer Science,  

E-Print Network (OSTI)

, and Automation. CRC Press, 2014. 4. Panel on high-profile US. Dept. of Energy panel on "Data Management1 David E. Bakken (Summary page) School of Electrical Engineering and Computer Science, Washington (minor: Electrical Engineering), Washington State University, 1985. B.S., Mathematics, Washington State

Bakken, Dave E.


Figure 97. Total U.S. tight oil production by geologic formation ...  

U.S. Energy Information Administration (EIA)

Sheet3 Sheet2 Sheet1 Figure 97. Total U.S. tight oil production by geologic formation, 2011-2040 (million barrels per day) Permian Basin Bakken Eagle Ford


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan



Bjorn Bakken  

NLE Websites -- All DOE Office Websites (Extended Search)

1989. His main areas of work include distributed energy systems, energy system planning, operation and control, ancillary services, frequency and power control, and power flow...


Bakken Formation Producing Wells W il sto nBa North Dakota ...  

U.S. Energy Information Administration (EIA)

USA CANADA SD MT ND Saskatchewan Manitoba Dunn Ward Dawson McLean McKenzie Morton W il ams Stark Richland R os ev lt Mountrail Divide Prairie McHenry Burke Sheridan

Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

development in the oil and gas industry and is being used on some shale formations. BAKKEN SHALE MuchTOP-DOWN MODELING; PRACTICAL, FAST TRACK, RESERVOIR SIMULATION & MODELING FOR SHALE FORMATIONS based on measure data, called Top-Down, Intelligent Reservoir Modeling for the shale formations

Mohaghegh, Shahab


PMG Mar1006 - bakken  

NLE Websites -- All DOE Office Websites (Extended Search)

Management Group Meeting March 10, 2006 Tier-1 Equipment Budget 7 Tier-1 Budget including overhead 0 2000 4000 6000 8000 K 1227 3160 6853 3119 5686 FY05 FY06 FY07 FY08 FY09 Jon...


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


North Dakota crude oil production continues to rise - Today in ...  

U.S. Energy Information Administration (EIA)

... in the Bakken formation are the result of accelerated development activity, primarily horizontal drilling combined with hydraulic fracturing.


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab


Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


Microsoft Word - JAS_Bakken_Mar10  

NLE Websites -- All DOE Office Websites (Extended Search)

Oil & Natural Gas Technology DOE Award No.: DE-FC26-08NT43291 Project Manager: John Terneus Final Report SUBTASK 1.2 - EVALUATION OF KEY FACTORS AFFECTING SUCCESSFUL OIL PRODUCTION...


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


U.S. monthly crude oil production reaches highest level since ...  

U.S. Energy Information Administration (EIA)

... Eagle Ford formation in South Texas and the Permian Basin in West Texas. North Dakota's increase in oil production comes from the Bakken formation in the ...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


Hydraulic fracture orientation for miscible gas injection EOR in the Elm Coulee field.  

E-Print Network (OSTI)

??There is tremendous potential for shale oil reservoirs, such as the Bakken Formation, Eagle Ford and Niobrara to have a lasting impact on the U.S (more)

Xu, Tao



NETL: Oil & Natural Gas Projects  

NLE Websites -- All DOE Office Websites (Extended Search)

Geomechanical Study of Bakken Formation for Improved Oil Recovery Last Reviewed 662013 DE-08NT0005643 Goal The goal of this project is to determine the geomechanical properties...


2011 Brief: Brent crude oil averages over $100 per barrel in ...  

U.S. Energy Information Administration (EIA)

Nuclear & Uranium. Uranium fuel, ... With low spare production ... Amid fast-rising crude oil production from the Bakken Shale formation and Canad ...


NETL: News Release -Website Provides Data for Key Oil Play in...  

NLE Websites -- All DOE Office Websites (Extended Search)

of Mineral Resources. Additional well completion data is planned for future release. Unconventional oil sources such as the Bakken and Three Forks Formations represent a...

Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


U.S. Crude Oil, Natural Gas, and Natural Gas Liquids Reserves  

U.S. Energy Information Administration (EIA)

... between the production of oil from the layers of shale within the Bakken Formation and the extraction of oil from oil shale plays. See ...


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Albany, OR * Fairbanks, AK * Morgantown, WV * Pittsburgh, PA * Houston, TX  

NLE Websites -- All DOE Office Websites (Extended Search)

NETL R&D Tackles Technological NETL R&D Tackles Technological Challenges of the Williston Basin's Bakken Formation Recent development of the Bakken Formation in the Williston Basin of western North Dakota and eastern Montana is a good example of persistent analysis of geologic data and adaptation of new completion technologies overcoming the challenges posed by unconventional reservoirs. However, as with most unconventional plays, as Bakken development continues, questions regarding


Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



Microsoft Word - Sample Abstract and Format Instructions.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Dearborn, MI 48128, Wayne State University 2 , Department of Physics and Astronomy, Detroit, MI 48202, Kettering University 3 , Flint, MI 48504, University of Paris-Sud 4 ,...


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Crude oil and condensate production rises at Bakken and other ...  

U.S. Energy Information Administration (EIA)

Liquids production (crude oil and condensate) is rising significantly at several shale plays in the United States as operators increasingly target the liquids-bearing ...


Bakken oil production forecast to top 1 million barrels per ...  

U.S. Energy Information Administration (EIA)

Home; Browse by Tag; Most Popular Tags. electricity; oil/petroleum; liquid fuels; natural gas; prices; ... Privacy/Security Copyright & Reuse Accessibility ...


Bakken crude oil price differential to WTI narrows over ...  

U.S. Energy Information Administration (EIA)

Petroleum & Other Liquids. Crude oil, gasoline, heating oil, diesel, propane, and other liquids including biofuels and natural gas liquids. ...

Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Site Characterization of Promising Geologic Formations for CO2 Storage |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Site Characterization of Promising Geologic Formations for CO2 Site Characterization of Promising Geologic Formations for CO2 Storage Site Characterization of Promising Geologic Formations for CO2 Storage In September 2009, the U.S. Department of Energy announced the award of 11 projects with a total project value of $75.5 million* to conduct site characterization of promising geologic formations for CO2 storage. These Recovery Act projects will increase our understanding of the potential for these formations to safely and permanently store CO2. The information gained from these projects (detailed below) will further DOE's efforts to develop a national assessment of CO2 storage capacity in deep geologic formations. Site Characterization of Promising Geologic Formations for CO2 Storage * Subsequently, the Board of Public Works project in Holland, MI has been


File Formats  

NLE Websites -- All DOE Office Websites (Extended Search)

Home Page Home Page File Formats MODIS Product Subsets Output Data File Format Descriptions The MODIS product subsets for North America and Worldwide are available in several formats, which are described in the following text. MODIS Land Product ASCII Data Image Data Files in ASCII Grid Format QC-Filtered Data and Statistics Generated for this Request Land Cover Data in ASCII Grid Format Statistical Data for MODIS Land Products in Comma Separated Format Underlying BRDF Parameters Used in Generating this Request (available with Albedo MOD43B and MCD43B only) MODIS Land Product ASCII Data Description of File File Content: Data as read from MODIS Land Product HDF-EOS data files. These data are the starting point for deriving the other subset data products. Data Type: As indicated by Land Product Code (e.g., MOD15A2).



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....


NETL: Oil & Natural Gas Projects  

NLE Websites -- All DOE Office Websites (Extended Search)

Subtask 1.2 – Evaluation of Key Factors Affecting Successful Oil Production in the Bakken Formation, North Dakota Subtask 1.2 – Evaluation of Key Factors Affecting Successful Oil Production in the Bakken Formation, North Dakota DE-FC26-08NT43291 – 01.2 Goal The goal of this project is to quantitatively describe and understand the Bakken Formation in the Williston Basin by collecting and analyzing a wide range of parameters, including seismic and geochemical data, that impact well productivity/oil recovery. Performer Energy & Environmental Research Center, Grand Forks, ND 58202-9018 Background The Bakken Formation is rapidly emerging as an important source of oil in the Williston Basin. The formation typically consists of three members, with the upper and lower members being shales and the middle member being dolomitic siltstone and sandstone. Total organic carbon (TOC) within the shales may be as high as 40%, with estimates of total hydrocarbon generation across the entire Bakken Formation ranging from 200 to 400 billion barrels. While the formation is productive in numerous reservoirs throughout Montana and North Dakota, with the Elm Coulee Field in Montana and the Parshall area in North Dakota being the most prolific examples of Bakken success, many Bakken wells have yielded disappointing results. While variable productivity within a play is nothing unusual to the petroleum industry, the Bakken play is noteworthy because of the wide variety of approaches and technologies that have been applied with apparently inconsistent and all too often underachieving results. This project will implement a robust, systematic, scientific, and engineering research effort to overcome these challenges and unlock the vast resource potential of the Bakken Formation in the Williston Basin.


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



NETL: Oil & Natural Gas Projects  

NLE Websites -- All DOE Office Websites (Extended Search)

Geomechanical Study of Bakken Formation for Improved Oil Recovery Last Reviewed 12/12/2013 Geomechanical Study of Bakken Formation for Improved Oil Recovery Last Reviewed 12/12/2013 DE-08NT0005643 Goal The goal of this project is to determine the geomechanical properties of the Bakken Formation in North Dakota, and use these results to increase the success rate of horizontal drilling and hydraulic fracturing in order to improve the ultimate recovery of this vast oil resource. Performer University of North Dakota, Grand Forks, ND 58202-7134 Background Compared to the success of producing crude oil from the Bakken Formation in eastern Montana, the horizontal drilling and hydraulic fracture stimulation technology applied in western North Dakota has been less successful, thus requiring the development of new completion and fracturing technologies.


Modeling gas injection into the shale oil reservoirs in the Sanish field, North Dakota.  

E-Print Network (OSTI)

??The Bakken Formation, a late Devonian-early Mississippian relatively thin unit, is deposited in the Williston Basin, covering 200,000 square miles of the north central United (more)

Dong, Cuiyu



CX-005588: Categorical Exclusion Determination  

Energy.gov (U.S. Department of Energy (DOE))

Investigation of Improved Conductivity and Proppant Applications in the Bakken FormationCX(s) Applied: B3.6Date: 04/11/2011Location(s): Grand Forks, North DakotaOffice(s): Fossil Energy, National Energy Technology Laboratory


Microsoft Word - Text  

NLE Websites -- All DOE Office Websites (Extended Search)



NETL: Oil & Natural Gas Projects  

NLE Websites -- All DOE Office Websites (Extended Search)

Subtask 1.2 Evaluation of Key Factors Affecting Successful Oil Production in the Bakken Formation, North Dakota DE-FC26-08NT43291 01.2 Goal The goal of this project is to...


Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Website Provides Data for Key Oil Play in North Dakota, Eastern Montana |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Website Provides Data for Key Oil Play in North Dakota, Eastern Website Provides Data for Key Oil Play in North Dakota, Eastern Montana Website Provides Data for Key Oil Play in North Dakota, Eastern Montana July 19, 2011 - 1:00pm Addthis Washington, DC - A new web-based geographic information system designed to improve oil production in North Dakota and eastern Montana has been launched with support from the U.S. Department of Energy. The Bakken Decision Support System (BDSS) assembles data for the Bakken and Three Forks Formations into an application that enables a user to visualize geologic and oil production information.The online tool, called the Bakken Decision Support System (BDSS), assembles data for the Bakken and Three Forks Formations into an application that enables a user to visualize geologic and oil production information. The system was developed by the



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab


Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Tropical Cyclone Formation  

Science Conference Proceedings (OSTI)

The physics of tropical cyclone formation is not well understood, and more is known about the mature hurricane than the formative mechanisms that produce it. It is believed part of the reason for this can be traced to insufficient upper-level ...

Michael T. Montgomery; Brian F. Farrell



WTI discount to Brent and premium to Bakken both rising in ...  

U.S. Energy Information Administration (EIA)

It is likely that concerns regarding oil transportation bottlenecks throughout the central United States and increasing production from shale ...


WTI discount to Brent and premium to Bakken both rising in early ...  

U.S. Energy Information Administration (EIA)

However, last month the owners of the Seaway pipeline announced the expected reversal of the line would not be completed until June 1, ...


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Modeling, History Matching, Forecasting and Analysis of Shale Reservoirs Performance Using Artificial Intelligence  

E-Print Network (OSTI)

matching, forecasting and analyzing oil and gas production in shale reservoirs. In this new approach and analysis of oil and gas production from shale formations. Examples of three case studies in Lower Huron and New Albany shale formations (gas producing) and Bakken Shale (oil producing) is presented

Mohaghegh, Shahab


Primary Radiation Damage Formation  

SciTech Connect

The physical processes that give rise to changes in the microstructure, and the physical and mechanical properties of materials exposed to energetic particles are initiated by essentially elastic collisions between atoms in what has been called an atomic displacement cascade. The formation and evolution of this primary radiation damage mechanism are described to provide an overview of how stable defects are formed by displacement cascades, as well as the nature and morphology of the defects themselves. The impact of the primary variables cascade energy and irradiation temperature are discussed, along with a range of secondary factors that can influence damage formation.

Stoller, Roger E [ORNL



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Warm Water Mass Formation  

Science Conference Proceedings (OSTI)

Poleward heat transport by the own implies warm Water mass formation, i.e., the retention by the tropical and subtropical ocean of some of its net radiant heat gain. Under what condition net heat retention becomes comparable to latent heat ...

G. T. Csanady



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Formation flow channel blocking  

SciTech Connect

A method is claimed for selectively blocking high permeability flow channels in an underground hydrocarbon material bearing formation having flow channels of high permeability and having flow channels of lesser permeability. The method includes the following steps: introducing a blocking material fluid comprising a blocking material in a carrier into the flow channels through an injection well in communication with the formation; introducing a buffer fluid into the formation through the injection well for the buffer fluid to displace the blocking material fluid away from the injection well; allowing the blocking material to settle in the channels to resist displacement by fluid flowing through the channels; introducing a quantity of an activating fluid into the channels through the injection well at a sufficient rate for the activating fluid to displace the buffer fluid and finger into the high permeability channels to reach the blocking material in the high permeability channels without reaching the blocking material in the low permeability channels, the activating fluid being adapted to activate the blocking material which it reaches to cause blocking of the high permeability channels.

Kalina, A.I.



Formation of Carbon Dwarfs  

E-Print Network (OSTI)

We consider the formation of dwarf carbon stars via accretion from a carbon AGB companion in light of the new 107 object sample of Downes et al. (2004). This sample is now large enough to allow good mass determination via comparison of a composite spectrum to theoretical atmospheric models. Carbon dwarfs of spectral type M are indeed main sequence M dwarfs with enhanced metallicity and carbon abundance. We also calculate the predicted abundance of both M and of F/G carbon dwarfs, and show that the latter should be falsifiable in the near future.

Charles L. Steinhardt; Dimitar D. Sasselov



Hypervelocity impact jet formation  

SciTech Connect

The hypervelocity impact of a particle on a surface generates a jet of shocked material which is thrown from the impact site. A simple analytic model has been developed to obtain expressions for the evolution of this jet of ejecta. The analysis is based on applying the conservation equations of mass and momentum to the problem of a normal impact of a sphere against a semi-infinite flat target. Expressions are developed for the evolution of the jet velocity, jet release point and the locus of points which describe the ejecta envelope. These analytical ejecta profiles are compared with high speed photographs of impact jet formation. 6 refs., 7 figs.

Ang, J.A.



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Self-formation in Microelectronics  

Science Conference Proceedings (OSTI)

The external formation of integrated circuits based on lithographic processes is not the only possible method for manufacturing electron devices, either integrated circuits or photovoltaic cells. Planar technology, based on external formation, requires ... Keywords: Artificial Systems, Development, Microelectronics, Reproduction, Self-Formation

Stepas Januonis


Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Optimal reorganization of agent formations  

Science Conference Proceedings (OSTI)

In this article we address the problem of determining how a structured formation of autonomous undistinguishable agents can be reorganized into another, eventually non-rigid, formation based on changes in the environment, perhaps unforeseeable. The methodology ... Keywords: combinatorial optimization, dynamic programming, formation reorganization

Dalila B. M. M. Fontes; Fernando A. C. C. Fontes



CX-002166: Categorical Exclusion Determination  

Energy.gov (U.S. Department of Energy (DOE))

Evaluation of Key Factors Affecting Successful Oil Production in the Bakken Formation, North DakotaCX(s) Applied: B3.6Date: 05/03/2010Location(s): Grand Forks, North DakotaOffice(s): Fossil Energy, National Energy Technology Laboratory


Center for transportation studies The NewAmerican  

E-Print Network (OSTI)

--such as shale oil and natural gas--are having a seismic impact on Upper Midwest transportation networks fracking really took off, the Bakken formation has become one of the most active shale oil fields fracturing, or fracking, techniques have transformed shale deposits from marginal sources of hydrocarbon fuel

Minnesota, University of


Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



EIA Drilling Productivity Report  

U.S. Energy Information Administration (EIA) Indexed Site

Drilling Productivity Report Drilling Productivity Report For Center on Global Energy Policy, Columbia University October 29, 2013 | New York, NY By Adam Sieminski, Administrator The U.S. has experienced a rapid increase in natural gas and oil production from shale and other tight resources Adam Sieminski, EIA Drilling Productivity Report October 29, 2013 2 0 5 10 15 20 25 30 35 2000 2002 2004 2006 2008 2010 2012 Rest of US Marcellus (PA and WV) Haynesville (LA and TX) Eagle Ford (TX) Bakken (ND) Woodford (OK) Fayetteville (AR) Barnett (TX) Antrim (MI, IN, and OH) 0.0 0.4 0.8 1.2 1.6 2.0 2.4 2.8 2000 2002 2004 2006 2008 2010 2012 Eagle Ford (TX) Bakken (MT & ND) Granite Wash (OK & TX) Bonespring (TX Permian) Wolfcamp (TX Permian) Spraberry (TX Permian) Niobrara-Codell (CO) Woodford (OK)


A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



Market Structure Across Retail Formats  

Science Conference Proceedings (OSTI)

We study how market structure within a product category varies across retail formats. Building on the literature on internal market structure, we estimate a joint store and brand choice model where the loading matrix of brand attributes are allowed to ... Keywords: brand maps, heterogeniety, market structure, retail formats

Karsten Hansen; Vishal Singh



formatting | OpenEI Community  

Open Energy Info (EERE)

formatting formatting Home Jweers's picture Submitted by Jweers(83) Contributor 7 August, 2013 - 18:23 New Robust References! citation citing developer formatting reference Semantic Mediawiki wiki Check out the new Reference Form. Adding a reference object to OpenEI using this form is the most complete way to cite a reference. After providing the name of your reference, the form will ask for your document type. Rmckeel's picture Submitted by Rmckeel(297) Contributor 25 June, 2013 - 07:39 How to create formatted blocks to hold OpenEI wiki content content formatting user interface wiki The OpenEI wiki frontpage uses "boxes" that help organize content. These boxes are frequently re-used across the site. Syndicate content 429 Throttled (bot load) Error 429 Throttled (bot load)


Mechanisms of Banner Cloud Formation  

Science Conference Proceedings (OSTI)

Banner clouds are clouds in the lee of steep mountains or sharp ridges. Their formation has previously been hypothesized as due to three different mechanisms: (i) vertical uplift in a lee vortex (which has a horizontal axis), (ii) adiabatic ...

Matthias Voigt; Volkmar Wirth



Hail Formation via Microphysical Recycling  

Science Conference Proceedings (OSTI)

It is suggested that alternation of low-density riming and wet growth processes play a role in hailstone formation. Such alternation of growth processes, which has been called microphysical recycling, is envisioned to operate in the following ...

John C. Pflaum



From the Office Document Format Battlefield  

Science Conference Proceedings (OSTI)

The two most common XML-based formats for office application suites are now international standards. Unfortunately, the Open Document Format and Office Open XML are similar but imperfectly compatible. Keywords: ODF, OOXML, XML, document format, office application

Jirka Kosek




SciTech Connect

Observations of nearby galaxies have firmly established, over a broad range of galactic environments and metallicities, that star formation occurs exclusively in the molecular phase of the interstellar medium (ISM). Theoretical models show that this association results from the correlation between chemical phase, shielding, and temperature. Interstellar gas converts from atomic to molecular only in regions that are well shielded from interstellar ultraviolet (UV) photons, and since UV photons are also the dominant source of interstellar heating, only in these shielded regions does the gas become cold enough to be subject to Jeans instability. However, while the equilibrium temperature and chemical state of interstellar gas are well correlated, the timescale required to reach chemical equilibrium is much longer than that required to reach thermal equilibrium, and both timescales are metallicity-dependent. Here I show that the difference in timescales implies that, at metallicities below a few percent of the solar value, well shielded gas will reach low temperatures and proceed to star formation before the bulk of it is able to convert from atomic to molecular. As a result, at extremely low metallicities, star formation will occur in a cold atomic phase of the ISM rather than a molecular phase. I calculate the observable consequences of this result for star formation in low-metallicity galaxies, and I discuss how some current numerical models for H{sub 2}-regulated star formation may need to be modified.

Krumholz, Mark R., E-mail: krumholz@ucolick.org [Department of Astronomy and Astrophysics, University of California, Santa Cruz, CA 95064 (United States)



Volume and accessibility of entrained (solution) methane in deep geopressured reservoirs - tertiary formations of the Texas Gulf Coast. Final report  

DOE Green Energy (OSTI)

The objective of this project was to appraise the total volume of in-place methane dissolved in formation waters of deep sandstone reservoirs of the onshore Texas Gulf Coast within the stratigraphic section extending from the base of significant hydrocarbon production (8000 ft)* to the deepest significant sandstone occurrence. The area of investigation is about 50,000 mi/sup 2/. Factors that determine the total methane resource are reservoir bulk volume, porosity, and methane solubility; the latter is controlled by the temperature, pressure, and salinity of formation waters. Regional assessment of the volume and the distribution of potential sandstone reservoirs was made from a data base of 880 electrical well logs, from which a grid of 24 dip cross sections and 4 strike cross sections was constructed. Solution methane content in each of nine formations or divisions of formations was determined for each subdivision. The distribution of solution methane in the Gulf Coast was described on the basis of five reservoir models. Each model was characterized by depositional environment, reservoir continuity, porosity, permeability, and methane solubility.

Gregory, A.R.; Dodge, M.M.; Posey, J.S.; Morton, R.A.




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Method of fracturing a geological formation  

DOE Patents (OSTI)

An improved method of fracturing a geological formation surrounding a well bore is disclosed. A relatively small explosive charge is emplaced in a well bore and the bore is subsequently hydraulically pressurized to a pressure less than the formation breakdown pressure and preferably greater than the fracture propagation pressure of the formation. The charge is denoted while the bore is so pressurized, resulting in the formation of multiple fractures in the surrounding formation with little or no accompanying formation damage. Subsequent hydraulic pressurization can be used to propagate and extend the fractures in a conventional manner. The method is useful for stimulating production of oil, gas and possibly water from suitable geologic formations.

Johnson, James O. (2679-B Walnut, Los Alamos, NM 87544)



Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Notices Accessible Format: Individuals with  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

472 Federal Register 472 Federal Register / Vol. 77, No. 83 / Monday, April 30, 2012 / Notices Accessible Format: Individuals with disabilities can obtain this document in an accessible format (e.g., braille, large print, audiotape, or computer diskette) on request to the program contact person listed under FOR FURTHER INFORMATION CONTACT. Electronic Access to This Document: The official version of this document is the document published in the Federal Register. Free Internet access to the official edition of the Federal Register and the Code of Federal Regulations is available via the Federal Digital System at: www.gpo.gov/fdsys. At this site you can view this document, as well as all other documents of this Department published in the Federal Register, in text or Adobe Portable Document


Development of a New Stratigraphic Trap Exploration Using Elastic-Wave Seismic Technology  

Science Conference Proceedings (OSTI)

Vecta acquired 9 square miles of 9-C seismic data in Mountrail County, North Dakota with the Mission Canyon shoreline as a primary target. Vecta contracted the Institute Francais du Petrole in order to co-develop a more rigorous multicomponent seismic interpretation product. The final interpretation was very unique in that it utilized not only the 9-C seismic data but also the new jointly developed software. A Mission Canyon anomaly was developed in 2006; however, it was of insufficient size to be a commercial target at the time. Therefore, Vecta analyzed the shear data for anisotropy within the Bakken formation and successfully reentered an abandoned producer within the project area and drilled a horizontal leg through the anomalous zones of the middle member of the Bakken formation. The well was open hole completed, swab tested, sand fraced, and swab tested some more. No shows of oil were ever seen from the Bakken formation, but the well yielded considerable amounts of formation water. The well has been abandoned as non-commercial. From the swab tests, one may conclude considerable permeability exists in the formation, thus confirming the utility of the shear wave to detect fractures within the targeted formation.

Bryan DeVault



Help:Formatting | Open Energy Information  

Open Energy Info (EERE)

Formatting Formatting Jump to: navigation, search You can format your text using wiki markup. This consists of normal characters like asterisks, single quotes or equation marks which have a special function in the wiki, sometimes depending on their position. For example, to format a word in italic, you include it in two single quotes like ''this'' Contents 1 Text formatting markup 2 Paragraphs 3 HTML 4 Other formatting Text formatting markup Description You type You get character formatting - applies anywhere Italic text ''italic'' italic Bold text '''bold''' bold Bold and italic '''''bold & italic''''' bold & italic Escape wiki markup no ''markup'' no ''markup'' section formatting - only at the beginning of the line Headings of different levels

Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Formation Testing Techniques | Open Energy Information  

Open Energy Info (EERE)

Formation Testing Techniques Formation Testing Techniques Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Technique: Formation Testing Techniques Details Activities (0) Areas (0) Regions (0) NEPA(0) Exploration Technique Information Exploration Group: Downhole Techniques Exploration Sub Group: Formation Testing Techniques Parent Exploration Technique: Downhole Techniques Information Provided by Technique Lithology: Stratigraphic/Structural: Hydrological: Thermal: Dictionary.png Formation Testing Techniques: No definition has been provided for this term. Add a Definition References No exploration activities found. Print PDF Retrieved from "http://en.openei.org/w/index.php?title=Formation_Testing_Techniques&oldid=601973" Categories: Downhole Techniques Exploration Techniques


Improved recovery using horizontal drilling in the Dundee Formation Michigan Basin  

SciTech Connect

The goal of this project is to demonstrate that oil production from selected fields in the Dundee Formation (Dev.) of Michigan can be substantially increased, perhaps restored to near--original production levels in some fields in Michigan, by utilizing horizontal drain wells. Devonian rocks have been the most prolific hydrocarbon producers of any system in the Michigan Basin. The Traverse, Dundee, and Lucas Formations have produced nearly all of the 525 Mbbls of oil and 150 Bcf of gas since the late 1920`s, 50% of the state`s oil and 7% of the state`s natural gas production. The Dundee Formation is Michigan`s all-time leader with 352 million barrels of oil and 42 billion cubic feet of gas. Crystal Field in Montcalm County, MI, selected as a field trial for this project is such a field. Analysis of production data for Crystal Field suggests that an additional 200,000 bbls of oil can be produced using 1 strategically located horizontal well. Total addition production from the Crystal Field could be as much as 6-8 Mbbls. Spin-offs from the technology developed in this project to other fields has the potential to increase Dundee production in Michigan by 35%, adding 80-100 Mbbls to the cumulative production. The approach combines proven, cost-effective horizontal drilling technology with modern reservoir characterization and management. A total of 30 Dundee fields will be characterized including the Crystal Field. Well logs, other well data, drilling, and production data and rock samples from the Dundee Fm. will be obtained, assembled, and input into digital databases designed for this project. Computer models describing the diagenetic, stratigraphic and thermal evolution of the Michigan Basin will be developed and applied to the Crystal Field reservoir. A post-mortem study is scheduled to monitor the effect of the horizontal well on Crystal Field production.

Harrison, W.B. III; Wood, J.R.; Huntoon, J.E.; Pennington, W.; Tester, C.; Taylor, E.



Wormhole formation in dissolving fractures  

E-Print Network (OSTI)

We investigate the dissolution of artificial fractures with three-dimensional, pore-scale numerical simulations. The fluid velocity in the fracture space was determined from a lattice-Boltzmann method, and a stochastic solver was used for the transport of dissolved species. Numerical simulations were used to study conditions under which long conduits (wormholes) form in an initially rough but spatially homogeneous fracture. The effects of flow rate, mineral dissolution rate and geometrical properties of the fracture were investigated, and the optimal conditions for wormhole formation determined.

Szymczak, P



Petrophysical evaluation of subterranean formations  

DOE Patents (OSTI)

Methods and systems are provided for evaluating petrophysical properties of subterranean formations and comprehensively evaluating hydrate presence through a combination of computer-implemented log modeling and analysis. Certain embodiments include the steps of running a number of logging tools in a wellbore to obtain a variety of wellbore data and logs, and evaluating and modeling the log data to ascertain various petrophysical properties. Examples of suitable logging techniques that may be used in combination with the present invention include, but are not limited to, sonic logs, electrical resistivity logs, gamma ray logs, neutron porosity logs, density logs, NRM logs, or any combination or subset thereof.

Klein, James D; Schoderbek, David A; Mailloux, Jason M



Help:FormattingResults | Open Energy Information  

Open Energy Info (EERE)

FormattingResults FormattingResults Jump to: navigation, search Contents 1 UL 2 Google Pie Charts 3 Outline 4 Calendar 5 Timeline 6 Gallery 7 Google Map 8 Geochart Ask Queries are used to pull results from semantic wiki content and can be displayed in a variety of formats. This page lists examples of the more common formats with the code used to generate them and when applicable, links to eternal help documents describing the options available for each format. When writing an ask query, one specifies the format with |format=. The examples below contain the ask query code used to generate them, including the format declaration. UL BioPower Atlas and BioFuels Atlas Biomass Energy Data Book CLIMWAT 2.0 CROPWAT 8.0 {{#ask:[[Category:Tools]] [[ProgramTopics::Resource assessment]] [[ProgramResources::Dataset]]


The Formation of Hurricane Frederic of 1979  

Science Conference Proceedings (OSTI)

A high-resolution global model forecast of the formation of Hurricane Frederic of 1979 is analyzed by means of several diagnostic computations on the model's output history. The formation is addressed from an analysis of limited-area energetics ...

T. N. Krishnamurthi; H. S. Bedi; Darlene Oosterhof; Vivek Hardiker



Western North Pacific Monsoon Depression Formation  

Science Conference Proceedings (OSTI)

Relatively few studies have been carried out as to the conditions leading to the formation of monsoon depressions in the western North Pacific. Two monsoon depression formations during July 2007 were analyzed using ECMWF analyses and satellite ...

Jodi C. Beattie; Russell L. Elsberry



Dynamics and control of electromagnetic satellite formations  

E-Print Network (OSTI)

Satellite formation flying is an enabling technology for many space missions, especially for space-based telescopes. Usually there is a tight formation-keeping requirement that may need constant expenditure of fuel or at ...

Ahsun, Umair, 1972-



Negative ion formation processes: A general review  

SciTech Connect

The principal negative ion formation processes will be briefly reviewed. Primary emphasis will be placed on the more efficient and universal processes of charge transfer and secondary ion formation through non-thermodynamic surface ionization. 86 refs., 20 figs.

Alton, G.D.



SAR polar format implementation with MATLAB.  

SciTech Connect

Traditional polar format image formation for Synthetic Aperture Radar (SAR) requires a large amount of processing power and memory in order to accomplish in real-time. These requirements can thus eliminate the possible usage of interpreted language environments such as MATLAB. However, with trapezoidal aperture phase history collection and changes to the traditional polar format algorithm, certain optimizations make MATLAB a possible tool for image formation. Thus, this document's purpose is two-fold. The first outlines a change to the existing Polar Format MATLAB implementation utilizing the Chirp Z-Transform that improves performance and memory usage achieving near realtime results for smaller apertures. The second is the addition of two new possible image formation options that perform a more traditional interpolation style image formation. These options allow the continued exploration of possible interpolation methods for image formation and some preliminary results comparing image quality are given.

Martin, Grant D.; Doerry, Armin Walter



Treating nahcolite containing formations and saline zones  

Science Conference Proceedings (OSTI)

A method for treating a nahcolite containing subsurface formation includes removing water from a saline zone in or near the formation. The removed water is heated using a steam and electricity cogeneration facility. The heated water is provided to the nahcolite containing formation. A fluid is produced from the nahcolite containing formation. The fluid includes at least some dissolved nahcolite. At least some of the fluid is provided to the saline zone.

Vinegar, Harold J



Unifying biological image formats with HDF5  

Science Conference Proceedings (OSTI)

The biosciences need an image format capable of high performance and long-term maintenance. Is HDF5 the answer?

Matthew T. Dougherty; Michael J. Folk; Erez Zadok; Herbert J. Bernstein; Frances C. Bernstein; Kevin W. Eliceiri; Werner Benger; Christoph Best



A metrics framework for evaluating group formation  

Science Conference Proceedings (OSTI)

Many approaches to learning and teaching rely upon students working in groups. So far, many Computer-Supported Group Formation systems have been designed to facilitate the formation of optimal groups in learning. However, evaluating the quality of automated ... Keywords: efficiency, group formation, optimization

Asma Ounnas; David E. Millard; Hugh C. Davis



Coring in deep hardrock formations  

DOE Green Energy (OSTI)

The United States Department of Energy is involved in a variety of scientific and engineering feasibility studies requiring extensive drilling in hard crystalline rock. In many cases well depths extend from 6000 to 20,000 feet in high-temperature, granitic formations. Examples of such projects are the Hot Dry Rock well system at Fenton Hill, New Mexico and the planned exploratory magma well near Mammoth Lakes, California. In addition to these programs, there is also continuing interest in supporting programs to reduce drilling costs associated with the production of geothermal energy from underground sources such as the Geysers area near San Francisco, California. The overall progression in these efforts is to drill deeper holes in higher temperature, harder formations. In conjunction with this trend is a desire to improve the capability to recover geological information. Spot coring and continuous coring are important elements in this effort. It is the purpose of this report to examine the current methods used to obtain core from deep wells and to suggest projects which will improve existing capabilities. 28 refs., 8 figs., 2 tabs.

Drumheller, D.S.



Energy Policy Act of 2005 (Ultra-deepwater and Unconventional Resources  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Policy Act of 2005 (Ultra-deepwater and Unconventional Resources Program) Energy Policy Act of 2005 (Ultra-deepwater and Unconventional Resources Program) NETL-ORD Project Information Resource Assessment | Drilling Under Extreme Conditions | Environmental Impacts Enhanced and Unconventional Oil Recovery Enhanced Oil Recovery from Fractured Media Read Detailed Project Information [PDF] Read project abstract Oil recovery from unconventional media is often difficult. However, significant hydrocarbon resources can be found in fractured reservoirs. As the supply of oil from conventional reservoirs is depleted, fractured media will provide a greater proportion of the country's oil reserves. One example of such a resource is the Bakken shale, part of the Williston Basin in North and South Dakota and Montana. It is estimated that over 100-176 billion barrels of oil are present in the Bakken shale. However, due to the low permeability of the formation and the apparent oil-wet nature of the shale, production from this formation presents considerable problems.


Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


ORNL DAAC, global climate data, GIS formats  

NLE Websites -- All DOE Office Websites (Extended Search)

Data in GIS Formats Data in GIS Formats ORNL DAAC has re-released a key climatology data set in two additional formats especially suitable for geographic information system (GIS) users. Version 2.1 of "Global 30-Year Mean Monthly Climatology, 1930-1960 (Cramer and Leemans)" now offers the data in ASCII GRID format and binary format. These formats can be read directly into software packages such as ESRI's ARC/INFO and ERDAS' IMAGINE. The Cramer and Leemans climatology data set contains monthly averages of mean temperature, temperature range, precipitation, rain days, and sunshine hours for the terrestrial surface of the globe. It is gridded at a 0.5-degree longitude/latitude resolution. The Cramer and Leemans data are also available in the original ASCII format, which can be read in FORTRAN or with programs such as SAS.


A study of coal formation  

SciTech Connect

Coal is a solid, brittle, more or less distinctly stratified, combustible, carbonaceous rock. It is being rediscovered as a reliable energy source, which, historically provided the resource base for the industrialization of the United States economy. A firm understanding of growth in coal development is important to the national energy scene so that the implications of factors influencing coal growth upon the industry`s ability to realize national energy objectives may be determined. As a result, the future of coal development will be facilitated by compiling basic facts on coal reserves, production, and utilization. In view of this, a review and assessment of facts pertaining to the nature and origin of coal is presented. The various properties and uses of coal are then described, followed by a discussion of the process of coal formation.

Jubert, K.; Stevens, G.; Masudi, H.



Clues to Nuclear Star Cluster Formation from Edge-on Spirals  

E-Print Network (OSTI)

We find 9 nuclear cluster candidates in a sample of 14 edge-on, late-type galaxies observed with HST/ACS. These clusters have magnitudes (M_I ~ -11) and sizes (r_eff ~ 3pc) similar to those found in previous studies of face-on, late-type spirals and dE galaxies. However, three of the nuclear clusters are significantly flattened and show evidence for multiple, coincident structural components. The elongations of these three clusters are aligned to within 10 degrees of the galaxies' major axes. Structurally, the flattened clusters are well fit by a combination of a spheroid and a disk or ring. The nuclear cluster disks/rings have F606W-F814W (~V-I) colors 0.3-0.6 magnitudes bluer than the spheroid components, suggesting that the stars in these components have ages nuclear clusters, we further constrain the stellar populations and provide a lower limit on the dynamical mass via spectroscopy. We also present tentative evidence that another of the nuclear clusters (in NGC 4206) may also host a supermassive black hole. Based on our observational results we propose an in situ formation mechanism for nuclear clusters in which stars form episodically in compact nuclear disks, and then lose angular momentum or heat vertically to form an older spheroidal structure. We estimate the period between star formation episodes to be 0.5 Gyr and discuss possible mechanisms for tranforming the disk-like components into spheroids. We also note the connection between our objects and massive globular clusters (e.g. $\\omega$ Cen), UCDs, and SMBHs. (Abridged)

Anil C. Seth; Julianne J. Dalcanton; Paul W. Hodge; Victor P. Debattista



NETL: NATCARB - CO2 Storage Formations  

NLE Websites -- All DOE Office Websites (Extended Search)

Storage Formations Storage Formations NATCARB CO2 Storage Formations CO2 Storage Resource Methodology NATCARB Viewer The NATCARB Viewer is available at: http://www.natcarbviewer.com. 2012 Atlas IV DOE's Regional Carbon Sequestration Partnerships (RCSPs) were charged with providing a high-level, quantitative estimate of carbon dioxide (CO2) storage resource available in subsurface environments of their regions. Environments considered for CO2 storage were categorized into five major geologic systems: oil and gas reservoirs, unmineable coal areas, saline formations, shale, and basalt formations. Where possible, CO2 storage resource estimates have been quantified for oil and gas reservoirs, saline formations, and unmineable coal in the fourth edition of the United States Carbon Utilization and Storage Atlas (Atlas IV). Shale and basalt

Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Minimizing formation damage during gravel pack operations  

Science Conference Proceedings (OSTI)

A method is described for minimizing formation damage caused by intrusive fluids prior to a gravel packing operation in loosely consolidated formations penetrated by at least one well. The method comprises: filling the casing of the well with an underbalanced completion fluid; placing within the well a removable packer capable of isolating the space between the casing and the formation from the downhole well pressure; setting through the packer a first tubing suitable for perforating and stabilizing the flow of fluids into the well; perforating the casing; and introducing a blocking agent into the formation via the perforations which agent upon solidification is sufficient to minimize formation damage by avoiding the introduction of formation fluids.

Jennings, A.R. Jr.




SciTech Connect

A model of core-clump accretion with equally likely stopping describes star formation in the dense parts of clusters, where models of isolated collapsing cores may not apply. Each core accretes at a constant rate onto its protostar, while the surrounding clump gas accretes as a power of protostar mass. Short accretion flows resemble Shu accretion and make low-mass stars. Long flows resemble reduced Bondi accretion and make massive stars. Accretion stops due to environmental processes of dynamical ejection, gravitational competition, and gas dispersal by stellar feedback, independent of initial core structure. The model matches the field star initial mass function (IMF) from 0.01 to more than 10 solar masses. The core accretion rate and the mean accretion duration set the peak of the IMF, independent of the local Jeans mass. Massive protostars require the longest accretion durations, up to 0.5 Myr. The maximum protostar luminosity in a cluster indicates the mass and age of its oldest protostar. The distribution of protostar luminosities matches those in active star-forming regions if protostars have a constant birthrate but not if their births are coeval. For constant birthrate, the ratio of young stellar objects to protostars indicates the star-forming age of a cluster, typically {approx}1 Myr. The protostar accretion luminosity is typically less than its steady spherical value by a factor of {approx}2, consistent with models of episodic disk accretion.

Myers, Philip C., E-mail: pmyers@cfa.harvard.edu [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States)



ICE 62755 Standard N42 Data Format  

Science Conference Proceedings (OSTI)

IEC 62755 Standard N42 Data Format. Summary: The purpose ... The structure of the data is described by an XML schema. The schema ...



result formats | OpenEI Community  

Open Energy Info (EERE)

result formats Home Jweers's picture Submitted by Jweers(83) Contributor 16 May, 2013 - 14:22 Multicolor Maps from Compound Queries ask queries compound queries developer Google...


Simplified Electrode Formation using Stabilized Lithium Metal ...  

A team of Berkeley Lab researchers led by Gao Liu has developed a doping process for lithium ion battery electrode formation that can boost a cells ...


Nanocrystal Formation in Glasses - Programmaster.org  

Science Conference Proceedings (OSTI)

Presentation Title, Nanocrystal Formation in Glasses ... copper have been treated in hydrogen atmospheres to form nanocrystals imbedded in a glassy matrix.


Heating systems for heating subsurface formations  

Science Conference Proceedings (OSTI)

Methods and systems for heating a subsurface formation are described herein. A heating system for a subsurface formation includes a sealed conduit positioned in an opening in the formation and a heat source. The sealed conduit includes a heat transfer fluid. The heat source provides heat to a portion of the sealed conduit to change phase of the heat transfer fluid from a liquid to a vapor. The vapor in the sealed conduit rises in the sealed conduit, condenses to transfer heat to the formation and returns to the conduit portion as a liquid.

Nguyen, Scott Vinh (Houston, TX); Vinegar, Harold J. (Bellaire, TX)



Simultaneous Planet and Sun Formation Evidence  

NLE Websites -- All DOE Office Websites (Extended Search)

Simultaneous Planet and Sun Formation Evidence Name: Christie Status: student Grade: 9-12 Location: SC Country: USA Date: May 2, 2011 Question: What specific evidence indicates...


TMS Proceedings Manuscript Instructions: One-Column Format  

Science Conference Proceedings (OSTI)

TMS ENERGY INITIATIVES KNOWLEDGE RESOURCE CENTER MATERIALS ... Formatting Guide (PDF) This file contains basic formatting instructions for...


NETL: Oil & Natural Gas Projects 00516 North Dakota Refining Capacity Study  

NLE Websites -- All DOE Office Websites (Extended Search)

North Dakota Refining Capacity Study North Dakota Refining Capacity Study DE-FE0000516 Goal The objective of the North Dakota Refining Capacity study is to assess the feasibility of increasing the oil refinery capacity in North Dakota, and, if possible, determine the scale of such an expansion, the slate of refined product(s) that would produce the most economic benefit, and the preferred ownership model, i.e., private, public or private-public. Performer North Dakota Association of Rural Electric Cooperatives (NDAREC) Corval Group, partnered with Purvin & Gertz and Mustang Engineering Background The genesis of this study came from an April 2008 report issued by the U.S. Geological Survey (USGS) asserting that North Dakota and Montana have an estimated 3.0 to 4.3 billion barrels of undiscovered, technically recoverable oil in an area known as the Bakken Formation. This assessment shows a 25-fold increase in the amount of recoverable oil compared to the USGS 1995 estimate of 151 million barrels of oil. The Bakken Formation estimate is larger than all other current USGS oil assessments of the lower 48 states and is the largest "continuous" oil accumulation ever assessed by the USGS. The new report points out that the new geologic models applied to the Bakken Formation, advances in drilling and production technologies, and recent oil discoveries have resulted in these substantially larger technically recoverable oil volumes. About 105 million barrels of oil were produced from the Bakken Formation by the end of 2007. In 2008, the formation produced another 27.2 million barrels of oil, which represented 43% of the state’s annual oil production of some 62.3 million barrels. Even though oil prices have dropped significantly in recent months, it appears that oil production from this formation will continue strong for decades to come. Most recently, a major production find has occurred in the Three Forks formation underlying the Bakken. This find is still undergoing significant testing, but early evidence suggests it represents another significant recoverable pool of oil in western North Dakota.


Deep Space Formation Flying Spacecraft Path Planning  

Science Conference Proceedings (OSTI)

Efficient algorithms for collision-free energy sub-optimal path planning for formations of spacecraft flying in deep space are presented. The idea is to introduce a set of way-points through which the spacecraft are required to pass, combined with ... Keywords: formation flying spacecraft, path planning for multiple mobile robot systems, trajectory generation

Cornel Sultan; Sanjeev Seereram; Raman K. Mehra



Methods for forming wellbores in heated formations  

DOE Patents (OSTI)

A method for forming a wellbore in a heated formation includes flowing liquid cooling fluid to a bottom hole assembly in a wellbore in a heated formation. At least a portion of the liquid cooling fluid is vaporized at or near a region to be cooled. Vaporizing the liquid cooling fluid absorbs heat from the region to be cooled.

Guimerans, Rosalvina Ramona; Mansure, Arthur James



Concept formation using incremental Gaussian mixture models  

Science Conference Proceedings (OSTI)

This paper presents a new algorithm for incremental concept formation based on a Bayesian framework. The algorithm, called IGMM (for Incremental Gaussian Mixture Model), uses a probabilistic approach for modeling the environment, and so, it can rely ... Keywords: Bayesian methods, EM algorithm, clustering, concept formation, finite mixtures, incremental learning, unsupervised learning

Paulo Martins Engel; Milton Roberto Heinen



CO2 Sequestration in Basalt Formations  

NLE Websites -- All DOE Office Websites (Extended Search)

CO CO 2 SequeStratiOn in BaSalt FOrmatiOnS Background There is growing concern that buildup of greenhouse gases, especially carbon dioxide (CO 2 ), in the atmosphere is contributing to global climate change. One option for mitigating this effect is to sequester CO 2 in geologic formations. Numerous site assessments for geologic sequestration of CO 2 have been conducted in virtually every region of the United States. For the most part, these studies have involved storing CO 2 in saline formation, deep coal seams, and depleted oil and gas reservoirs. Another option, however, is basalt formations. Basalt is a dark-colored, silica-rich, volcanic rock that contains cations-such as calcium, magnesium, and iron-that can combine with CO 2 to form carbonate minerals. Basalt formations have not received much


I/O Formats at NERSC  

NLE Websites -- All DOE Office Websites (Extended Search)

I/O Formats I/O Formats I/O Formats Software I/O continues to be one of the main bottlenecks for scientific applications. Here are two software packages that many application developers use to manage input/output of heterogeneous types of binary application data used on many different platforms. HDF5 and NETCDF are both implemented on top of MPI-IO and have gained popularity as alternatives to basic POSIX API. HDF5 is a machine-independent and self-documenting file format. Each HDF5 file "looks" like a directory tree, with subdirectories, and leaf nodes that contain the actual data. This means that data can be found in a file by referring to its name, rather than its location in the file. NetCDF is a file format and support library developed at the National Center for Atmospheric Research (NCAR).


Method for laser drilling subterranean earth formations  

DOE Patents (OSTI)

Laser drilling of subterranean earth formations is efficiently accomplished by directing a collimated laser beam into a bore hole in registry with the earth formation and transversely directing the laser beam into the earth formation with a suitable reflector. In accordance with the present invention, the bore hole is highly pressurized with a gas so that as the laser beam penetrates the earth formation the high pressure gas forces the fluids resulting from the drilling operation into fissures and pores surrounding the laser-drilled bore so as to inhibit deleterious occlusion of the laser beam. Also, the laser beam may be dynamically programmed with some time dependent wave form, e.g., pulsed, to thermally shock the earth formation for forming or enlarging fluid-receiving fissures in the bore.

Shuck, Lowell Z. (Morgantown, WV)



Recovery of bypassed oil in the Dundee Formation using horizontal drains. 2nd Quarterly report, April 1, 1994--June 30, 1994  

Science Conference Proceedings (OSTI)

A meeting of project personnel was held in Traverse City, MI, on June 8, 1994 to initiate the DOE contract. The drilling program, which will be the project`s first major undertaking, was discussed in detail. Data from 12 Dundee fields, including Crystal Field, have been entered in a computer database by project staff at WMU. Structure contour maps and isopach maps have been generated for all horizons in these fields using Terrasciences` TerraStation computer program. Arrangements have been made to purchase digitized logs of every well that produces or has produced from the Dundee Formation in the state of Michigan. Twenty to thirty cores of the Dundee Formation from wells throughout the state of Michigan are currently available. Cuttings samples are also available from 60 to 100 Michigan wells. A well in the project area has been designed and permitted and will soon be drilled. The well will have both a horizontal and a vertical leg. The vertical leg well will be cored through the producing interval of the Dundee Formation and the cores analyzed for porosity, permeability, and fluid saturations. A full set of well logs will be run, including gamma ray, porosity, resistivity, and geochemical logs. The horizontal leg will be drilled as a sidetrack from the vertical test well. If commercial amounts of hydrocarbons are encountered, the horizontal well will be placed on production. It is expected that drilling will commence in August, 1994, and will take 10 to 12 days to complete.

Wood, J.R.



From design experiments to formative interventions  

Science Conference Proceedings (OSTI)

The discussion of design experiments has largely ignored the Vygotskian tradition of formative interventions based on the principle of double stimulation. This tradition offers a radical approach to learning reasearch which focuses on the agency of the ...

Yrj Engestrm



Electromagnetic formation flight of satellite arrays  

E-Print Network (OSTI)

Proposed methods of actuating spacecraft in sparse aperture arrays use propellant as a reaction mass. For formation flying systems, propellant becomes a critical consumable which can be quickly exhausted while maintaining ...

Kwon, Daniel W., 1980-



Rapid Gas Hydrate Formation Process Opportunity  

NLE Websites -- All DOE Office Websites (Extended Search)

Gas Hydrate Formation Process Gas Hydrate Formation Process Opportunity The Department of Energy's National Energy Technology Laboratory (NETL) is seeking collaborative research and licensing partners interested in implementing United States Non-provisional Patent Application entitled "Rapid Gas Hydrate Formation Process." Disclosed in this application is a method and device for producing gas hydrates from a two-phase mixture of water and a hydrate forming gas such as methane (CH 4 ) or carbon dioxide (CO 2 ). The two-phase mixture is created in a mixing zone, which may be contained within the body of the spray nozzle. The two-phase mixture is subsequently sprayed into a reaction vessel, under pressure and temperature conditions suitable for gas hydrate formation. The reaction

Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Ice Formation in Gas-Diffusion Layers  

E-Print Network (OSTI)

of California. Ice Formation in Gas-Diffusion Layers Thomasconditions, ice forms in the gas-diffusion layer (GDL) of areaction of reactant gases (1). A number of strategies exist

Dursch, Thomas



Thermodynamic Aspects of Tropical Cyclone Formation  

Science Conference Proceedings (OSTI)

The thermodynamic aspects of tropical cyclone (TC) formation near the center of the wave pouch, a region of approximately closed Lagrangian circulation within the wave critical layer, are examined through diagnoses of a high-resolution numerical ...

Zhuo Wang



Eddy Formation in 2-Layer, Quasigeostrophic Jets  

Science Conference Proceedings (OSTI)

The formation of nonlinear eddies in unstable 2-layer, quasigeostrophic jets is investigated using a piecewise constant potential vorticity, contour dynamical model. Both infinite and semi-infinite jet dynamics are explored, considering a ...

Ilson C. A. da Silveira; Glenn R. Flierl



Essential Dynamics of Secondary Eyewall Formation  

Science Conference Proceedings (OSTI)

The authors conduct an analysis of the dynamics of secondary eyewall formation in two modeling frameworks to obtain a more complete understanding of the phenomenon. The first is a full-physics, three-dimensional mesoscale model in which the ...

Sergio F. Abarca; Michael T. Montgomery



Numerical Simulation of Macrosegregation Formation during ...  

Science Conference Proceedings (OSTI)

Direct Numerical Simulation of Inclusion Turbulent Deposition at Liquid ... Flow and Shrinkage Pipe Formation on Macrosegregation of Investment Cast -TiAl Alloys ... Numerical Modeling of the Interaction between a Foreign Particle an...


Interactive Cloud Formation and Climatic Temperature Perturbations  

Science Conference Proceedings (OSTI)

A one-dimensional climate model with an interactive cloud formation program is developed to investigate its effects on temperature perturbations due to various radiative forcings including doubling of CO2, a 2% increase of the solar constant and ...

Kuo-Nan Liou; S. C. S. Ou; P. J. Lu



Does Format of Pricing Contract Matter?  

E-Print Network (OSTI)

Working Paper No. XL05-002 Does Format of Pricing Contractquantity discount contract does not include a fixed fee andtariff. Also, division equivalence does not hold because the

Ho, Teck H; Zhang, Juanjuan



Predicting Nepheline Formation with Artificial Neural Networks  

Science Conference Proceedings (OSTI)

... model has been developed to predict nepheline (NaAlSiO4) formation in compositions of interest for waste glasses projected to be formed at the Hanford Site.


Fuzzy coalition formation among rational cooperative agents  

Science Conference Proceedings (OSTI)

Formation of coalitions in multi-agent systems (MAS) enables the development of efficient organizations. In the article, a model of fuzzy cooperative game with coalitions is described. It extends the model of the fuzzy coalition game with associated ...

Leonid B. Sheremetov; Jos C. Romero Corts



Modeling deposit formation in diesel injector nozzle  

E-Print Network (OSTI)

Formation of deposit in the diesel injector nozzle affects the injection behavior and hinders performance. Under running condition, deposit precursors are washed away by the ensuing injection. However, during the cool down ...

Sudhiesh Kumar, Chintoo



The Formation of New England Coastal Fronts  

Science Conference Proceedings (OSTI)

Coastal fronts are a frequent late fall and early winter feature of eastern New England weather. Data from a mesoscale observing network is used to describe the process of coastal frontogenesis and to determine the causes of formation. Three ...

John W. Nielsen



A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Formation damage in underbalanced drilling operations  

E-Print Network (OSTI)

Formation damage has long been recognized as a potential source of reduced productivity and injectivity in both horizontal and vertical wells. From the moment that the pay zone is being drilled until the well is put on production, a formation is exposed to a series of fluids and operations that can reduce its productive capacity. Any process that causes a loss in the productivity of an oil-, gas-, or water-saturated formation has a damaging effect on the reservoir. These damage mechanisms predominantly fall into three major classifications: mechanical, chemical, and biological. Underbalanced drilling operations involve drilling a portion of the wellbore at fluid pressures less than that of the target formation. This technology has been used to prevent or minimize problems associated with invasive formation damage, which often greatly reduces the productivity of oil and gas reservoirs, mainly in openhole horizontal-well applications. Underbalanced drilling is not a solution for all formation-damage problems. Damage caused by poorly designed and/or executed underbalanced drilling programs can equal or exceed that which may occur with a well-designed conventional overbalanced drilling program. Four techniques are currently available to achieve underbalanced conditions while drilling. These include using lightweight drilling fluids, injecting gas down the drillpipe, injecting gas into a parasite string, and using foam. This study provides an analysis of a number of potential damage mechanisms present when drilling underbalanced. It describes each one and its influence on the productivity of a well. Additionally it presents a general description of the different techniques that can be applied to carry out successful, cost-effective UBD operations, and discusses how these techniques may be used to reduce or eliminate formation damage.

Reyes Serpa, Carlos Alberto



The geomechanics of CO2 storage in deep sedimentary formations  

E-Print Network (OSTI)

formations, such as depleted oil and gas reservoirs,sedimentary formations, including oil and gas reservoirs andassociated with enhanced oil recovery (EOR). At the North-

Rutqvist, J.



Carbon Isotope Separation and Molecular Formation in Laser-Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

Carbon Isotope Separation and Molecular Formation in Laser-Induced Plasmas by Laser Ablation Molecular Isotopic Spectrometry Title Carbon Isotope Separation and Molecular Formation...


Focus Area 1 - Biomass Formation and Modification : BioEnergy...  

NLE Websites -- All DOE Office Websites (Extended Search)

Formation and Modification BESC biomass formation and modification research involves working directly with two potential bioenergy crops (switchgrass and Populus) to develop...


Characterizing the Formation of Secondary Organic Aerosols-Interim...  

NLE Websites -- All DOE Office Websites (Extended Search)

Characterizing the Formation of Secondary Organic Aerosols-Interim Report. Title Characterizing the Formation of Secondary Organic Aerosols-Interim Report. Publication Type Report...


In situ oxidation of subsurface formations  

DOE Patents (OSTI)

Methods and systems for treating a hydrocarbon containing formation described herein include providing heat to a first portion of the formation from a plurality of heaters in the first portion, producing produced through one or more production wells in a second portion of the formation, reducing or turning off heat provided to the first portion after a selected time, providing an oxidizing fluid through one or more of the heater wells in the first portion, providing heat to the first portion and the second portion through oxidation of at least some hydrocarbons in the first portion, and producing fluids through at least one of the production wells in the second portion. The produced fluids may include at least some oxidized hydrocarbons produced in the first portion.

Beer, Gary Lee (Houston, TX); Mo, Weijian (Sugar Land, TX); Li, Busheng (Houston, TX); Shen, Chonghui (Calgary, CA)



Category:Formatting Templates | Open Energy Information  

Open Energy Info (EERE)

source source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Category Edit History Facebook icon Twitter icon » Category:Formatting Templates Jump to: navigation, search Formatting Templates are Templates used primarily to achieve a certian layout or style on a wiki page. They can be generic, like Template:Clear or specific, like Template:Definition. For help on creating templates, see Help:Templates. Subcategories This category has only the following subcategory. Q [×] Query Results Templates‎ 4 pages Pages in category "Formatting Templates" The following 200 pages are in this category, out of 465 total. (previous 200) (next 200) A Abraham Hot Springs Geothermal Area


Formation of Cyanoformaldehyde in the interstellar space  

E-Print Network (OSTI)

Cyanoformaldehyde (HCOCN) molecule has recently been suspected towards the Sagittarius B2(N) by the Green Bank telescope, though a confirmation of this observation has not yet been made. In and around a star forming region, this molecule could be formed by the exothermic reaction between two abundant interstellar species, H$_2$CO and CN. Till date, the reaction rate coefficient for the formation of this molecule is unknown. Educated guesses were used to explain the abundance of this molecule by chemical modeling. In this paper, we carried out quantum chemical calculations to find out empirical rate coefficients for the formation of HCOCN and different chemical properties during the formation of HCOCN molecules. Though HCOCN is stable against unimolecular decomposition, this gas phase molecule could be destroyed by many other means, like: ion-molecular reactions or by the effect of cosmic rays. Ion-molecular reaction rates are computed by using the capture theories. We have also included the obtained rate coef...

Das, Ankan; Chakrabarti, Sandip K; Saha, Rajdeep; Chakrabarti, Sonali


Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Isocurvature Fluctuations Induce Early Star Formation  

E-Print Network (OSTI)

The early reionisation of the Universe inferred from the WMAP polarisation results, if confirmed, poses a problem for the hypothesis that scale-invariant adiabatic density fluctuations account for large-scale structure and galaxy formation. One can only generate the required amount of early star formation if extreme assumptions are made about the efficiency and nature of early reionisation. We develop an alternative hypothesis that invokes an additional component of a non-scale-free isocurvature power spectrum together with the scale-free adiabatic power spectrum for inflation-motivated primordial density fluctuations. Such a component is constrained by the Lyman alpha forest observations, can account for the small-scale power required by spectroscopic gravitational lensing, and yields a source of early star formation that can reionise the universe at z~20 yet becomes an inefficient source of ionizing photons by z~10, thereby allowing the conventional adiabatic fluctuation component to reproduce the late thermal history of the intergalactic medium.

Naoshi Sugiyama; Saleem Zaroubi; Joseph Silk



Induction heaters used to heat subsurface formations  

DOE Patents (OSTI)

A heating system for a subsurface formation includes an elongated electrical conductor located in the subsurface formation. The electrical conductor extends between at least a first electrical contact and a second electrical contact. A ferromagnetic conductor at least partially surrounds and at least partially extends lengthwise around the electrical conductor. The electrical conductor, when energized with time-varying electrical current, induces sufficient electrical current flow in the ferromagnetic conductor such that the ferromagnetic conductor resistively heats to a temperature of at least about 300.degree. C.

Nguyen, Scott Vinh (Houston, TX); Bass, Ronald M. (Houston, TX)



Parallel heater system for subsurface formations  

DOE Patents (OSTI)

A heating system for a subsurface formation is disclosed. The system includes a plurality of substantially horizontally oriented or inclined heater sections located in a hydrocarbon containing layer in the formation. At least a portion of two of the heater sections are substantially parallel to each other. The ends of at least two of the heater sections in the layer are electrically coupled to a substantially horizontal, or inclined, electrical conductor oriented substantially perpendicular to the ends of the at least two heater sections.

Harris, Christopher Kelvin (Houston, TX); Karanikas, John Michael (Houston, TX); Nguyen, Scott Vinh (Houston, TX)



High-resolution sequence-stratigraphic correlation between shallow-marine and terrestrial strata: Examples from the Sunnyside Member of the Cretaceous Blackhawk Formation Book Cliffs eastern Utah  

Science Conference Proceedings (OSTI)

The Sunnyside Member of the Upper Cretaceous Blackhawk Formation in the Book Cliffs of eastern Utah provides an ideal opportunity to investigate high-resolution sequence-stratigraphic correlation between shallow-marine and terrestrial strata in an area of outstanding outcrop exposure. The thick, laterally extensive coal seam that caps the Sunnyside Member is critical for correlating between its shallow-marine and terrestrial components. Petrographic analysis of 281 samples obtained from 7 vertical sections spanning more than 30 km (18 mi) of depositional dip enabled us to recognize a series of transgressive-regressive coal facies trends in the seam. On this basis, we were able to identify a high-resolution record of accommodation change throughout the deposition of the coal, as well as a series of key sequence-stratigraphic surfaces. The stratigraphic relationships between the coal and the siliciclastic components of the Sunnyside Member enable us to correlate this record with that identified in the time-equivalent shallow-marine strata and to demonstrate that the coal spans the formation of two marine parasequences and two high-frequency, fourth-order sequence boundaries. This study has important implications for improving the understanding of sequence-stratigraphic expression in terrestrial strata and for correlating between marine and terrestrial records of base-level change. It may also have implications for improving the predictability of vertical and lateral variations in coal composition for mining and coalbed methane projects.

Davies, R.; Howell, J.; Boyd, R.; Flint, S.; Diessel, C. [University of Bergen, Bergen (Norway)



Pressure measurements in low permeability formations  

DOE Green Energy (OSTI)

This paper examines the performance requirements and identifies candidate hardware implementations for pressure instrumentation that is needed to provide well test data in low permeability formations. Low permeability values are typically defined to be less than 1 microdarcy and are usually encountered in hard rock formations, such as granite, that are of interest in hot dry rock geothermal, deep exploration drilling, and fluid waste disposal. Groundwater flow in these tight formations has been shown to be dominated by flow-through fractures rather than through the formation's intrinsic permeability. In these cases, we cannot use Darcy's law or the usual dimensionless coefficients to estimate the expected scale factors and dynamic responses necessary to properly select and setup the wellbore pressure instrument. This paper shows that the expected instrument responses can be estimated using some recent work by Wang, Narasimhan, and Witherspoon. This paper further describes the minimum electronic capability that the downhole pressure instrument must have in order to provide the required measurement resolution, dynamic range, and transient response. Three specific hardware implementations are presented based on the following transducers: a quartz resonator, a capacitance gauge, and a resistance strain gauge.

Veneruso, A.F.; McConnell, T.D.



Polyglots: crossing origins by crossing formats  

Science Conference Proceedings (OSTI)

In a heterogeneous system like the web, information is exchanged between components in versatile formats. A new breed of attacks is on the rise that exploit the mismatch between the expected and provided content. This paper focuses on the root cause ... Keywords: cross-domain, injection, polyglot, web security

Jonas Magazinius, Billy K. Rios, Andrei Sabelfeld



High temperature simulation of petroleum formation  

Science Conference Proceedings (OSTI)

Petroleum formation has been simulated in the laboratory with emphasis on the effects of temperature, mineral catalysis, and starting material structure on the yield and composition of the liquid and gaseous hydrocarbon products. In an attempt to prove the hypothesis that petroleum formation can be simulated using high temperatures, Green River Shale from Colorado, USA, was subjected to pyrolysis for 16 hours at temperatures ranging from 300 to 500/sup 0/C. The sequence of products formed over this temperature range was used as the basis for defining five different zones of maturation reaction: 1) a heterobond cracking zone; 2) a labile carbon bond cracking zone; 3) a free radical synthesis zone; 4) a wet gas formation zone; and 5) an aromatization zone. The role of some typical inorganic components of sedimentary rocks in the origin and maturation of petroleum has been investigated using this high temperature model. The importance of the structure of organic matter in petroelum formation has also been investigated using this high temperature model. Lignin and cellulose are poor sources of liquid hydrocarbons, but cellulose in the presence of carbonate gives a high yield of gaseous hydrocarbons. Protein pyrolysis gives a high oil yield with an alkane distribution similar to petroleum. The lipids produced the highest oil yield of the substances tested but the n-alkanes show an odd carbon length predominance unlike the distribution found in petroleum.

Evans, R.J.



Essential Dynamics of Secondary Eyewall Formation  

Science Conference Proceedings (OSTI)

We conduct an analysis of the dynamics of secondary eyewall formation, in two modeling frameworks to obtain a more complete understanding of the phenomenon. The first is a full-physics, three-dimensional mesoscale model in which we examine an ...

Sergio F. Abarca; Michael T. Montgomery


Photoionization and the formation of dwarf galaxies  

E-Print Network (OSTI)

It has been argued that a UV photoionizing background radiation field suppresses the formation of dwarf galaxies, and may even inhibit the formation of larger galaxies. In order to test this, we present gas-dynamical simulations of the formation of small objects in a CDM universe with and without a photoionizing background. The objects are selected from a collisionless simulation at a redshift of 2.4, and rerun at higher resolution including the effects of gas dynamics and using a hierarchical grid of particles. Five objects, each with a circular speed of 46 km/sec are simulated. The presence of the photoionizing background has only a small effect on the amount of gas that collapses in these objects, reducing the amount of cold collapsed gas by at most 30%. Analysis of the smaller objects found in the higher resolution simulation indicates that the photoionizing background only significantly affects the formation of objects with a virialized halo mass less than 10^9 soalr masses and circular speeds less than ...

Quinn, T; Efstathiou, G P; Quinn, Thomas; Katz, Neal; Efstathiou, George



Photoionization and the Formation of Dwarf Galaxies  

E-Print Network (OSTI)

It has been argued that a UV photoionizing background radiation field suppresses the formation of dwarf galaxies, and may even inhibit the formation of larger galaxies. In order to test this, we present gas-dynamical simulations of the formation of small objects in a CDM universe with and without a photoionizing background. The objects are selected from a collisionless simulation at a redshift of 2.4, and rerun at higher resolution including the effects of gas dynamics and using a hierarchical grid of particles. Five objects, each with a circular speed of 46 km/sec are simulated. The presence of the photoionizing background has only a small effect on the amount of gas that collapses in these objects, reducing the amount of cold collapsed gas by at most 30%. Analysis of the smaller objects found in the higher resolution simulation indicates that the photoionizing background only significantly affects the formation of objects with a virialized halo mass less than 10^9 soalr masses and circular speeds less than 23 km/sec. However, the ionization balance is greatly changed by the presence of the background radiation field. Typical lines of sight through the objects have 4 orders of magnitude less neutral hydrogen column density when the photoionizing background is included.

Thomas Quinn; Neal Katz; George Efstathiou



Engineering Documents into XML File Formats  

Science Conference Proceedings (OSTI)

XML has become the preferred language for representing information in documents. The goal of this research work is to allow a user to convert any document on Windows into a standard and open document format in XML (the Extensible Markup Language). One ...

Chia-Chu Chiang



Star Formation from Galaxies to Globules  

E-Print Network (OSTI)

The empirical laws of star formation suggest that galactic-scale gravity is involved, but they do not identify the actual triggering mechanisms for clusters in the final stages. Many other triggering processes satisfy the empirical laws too, including turbulence compression and expanding shell collapse. The self-similar nature of the gas and associated young stars suggests that turbulence is more directly involved, but the small scale morphology of gas around most embedded clusters does not look like a random turbulent flow. Most clusters look triggered by other nearby stars. Such a prominent local influence makes it difficult to understand the universality of the Kennicutt and Schmidt laws on galactic scales. A unified view of multi-scale star formation avoids most of these problems. Ambient self-gravity produces spiral arms and drives much of the turbulence that leads to self-similar structures, while localized energy input from existing clusters and field supernovae triggers new clusters in pre-existing clouds. The hierarchical structure in the gas made by turbulence ensures that the triggering time scales with size, giving the Schmidt law over a wide range of scales and the size-duration correlation for young star fields. The efficiency of star formation is determined by the fraction of the gas above a critical density of around 10^5 m(H2)/cc. Star formation is saturated to its largest possible value given the fractal nature of the interstellar medium.

Bruce G. Elmegreen



Specifying formative constructs in information systems research  

Science Conference Proceedings (OSTI)

While researchers go to great lengths to justify and prove theoretical links between constructs, the relationship between measurement items and constructs is often ignored. By default, the relationship between construct and item is assumed to be reflective, ... Keywords: composite constructs, formative constructs, latent constructs, measurement models, methodology, reflective constructs, statistical conclusion validity, type i and type II errors

Stacie Petter; Detmar Straub; Arun Rai



Electricity 5 E Lesson Plan Format  

E-Print Network (OSTI)

Electricity 5 E Lesson Plan Format Standards Grade 4- Force, Energy, and Motion- 4.3a & 4.3b. What their experimentation, students should gain a thorough understanding of electricity's characteristics and mode of travel, familiarity with the structure and function of a basic electrical circuit as well as the concept

Marsh, David



Science Conference Proceedings (OSTI)

This project addressed four major areas of investigation: i) characterization of formation of Cellulomonas uda biofilms on cellulose; ii) characterization of Clostridium phytofermentans biofilm development; colonization of cellulose and its regulation; iii) characterization of Thermobifida fusca biofilm development; colonization of cellulose and its regulation; and iii) description of the architecture of mature C. uda, C. phytofermentans, and T. fusca biofilms. This research is aimed at advancing understanding of biofilm formation and other complex processes involved in the degradation of the abundant cellulosic biomass, and the biology of the microbes involved. Information obtained from these studies is invaluable in the development of practical applications, such as the single-step bioconversion of cellulose-containing residues to fuels and other bioproducts. Our results have clearly shown that cellulose-decomposing microbes rapidly colonize cellulose and form complex structures typical of biofilms. Furthermore, our observations suggest that, as cells multiply on nutritive surfaces during biofilms formation, dramatic cell morphological changes occur. We speculated that morphological changes, which involve a transition from rod-shaped cells to more rounded forms, might be more apparent in a filamentous microbe. In order to test this hypothesis, we included in our research a study of biofilm formation by T. fusca, a thermophilic cellulolytic actinomycete commonly found in compost. The cellulase system of T. fusca has been extensively detailed through the work of David Wilson and colleagues at Cornell, and also, genome sequence of a T. fusca strain has been determine by the DOE Joint Genome Institute. Thus, T. fusca is an excellent subject for studies of biofilm development and its potential impacts on cellulose degradation. We also completed a study of the chitinase system of C. uda. This work provided essential background information for understanding how C. uda colonizes and degrades insoluble substrates. Major accomplishments of the project include: Development of media containing dialysis tubing (described by the manufacturer as regenerated cellulose) as sole carbon and energy source and a nutritive surface for the growth of cellulolytic bacteria, and development of various microscopic methods to image biofilms on dialysis tubing. Demonstration that cultures of C. phytofermentans, an obligate anaerobe, C. uda, a facultative aerobe, and T. fusca, a filamentous aerobe, formed microbial communities on the surface of dialysis tubing, which possessed architectural features and functional characteristics typical of biofilms. Demonstration that biofilm formation on the nutritive surface, cellulose, involves a complex developmental processes, including colonization of dialysis tubing, formation of cell clusters attached to the nutritive surface, cell morphological changes, formation of complex structures embedded in extracellular polymeric matrices, and dispersal of biofilm communities as the nutritive surface is degraded. Determination of surface specificity and regulatory aspects of biofilm formation by C. phytofermentans, C. uda, and T. fusca. Demonstration that biofilm formation by T. fusca forms an integral part of the life cycle of this filamentous cellulolytic bacterium, including studies on the role of mycelial pellet formation in the T. fusca life cycle and a comparison of mycelial pellets to surface-attached T. fusca biofilms. Characterization of T. fusca biofilm EPS, including demonstration of a functional role for EPS constituents. Correlation of T. fusca developmental life cycle and cellulase gene expression.

Leschine, Susan



Marked correlations in galaxy formation models  

E-Print Network (OSTI)

The two-point correlation function has been the standard statistic for quantifying how galaxies are clustered. The statistic uses the positions of galaxies, but not their properties. Clustering as a function of galaxy property, be it type, luminosity, color, etc., is usually studied by analysing a subset of the full population, the galaxies in the subset chosen because they have a similar range of properties. We explore an alternative technique---marked correlations---in which one weights galaxies by some property or `mark' when measuring clustering statistics. Marked correlations are particularly well-suited to quantifying how the properties of galaxies correlate with their environment. Therefore, measurements of marked statistics, with luminosity, stellar mass, color, star-formation rate, etc. as the mark, permit sensitive tests of galaxy formation models. We make measurements of such marked statistics in semi-analytic galaxy formation models to illustrate their utility. These measurements show that close pairs of galaxies are expected to be red, to have larger stellar masses, and to have smaller star formation rates. We also show that the simplest unbiased estimator of the particular marked statistic we use extensively is very simple to measure---it does not require construction of a random catalog---and provide an estimate of its variance. Large wide-field surveys of the sky are revolutionizing our view of galaxies and how they evolve. Our results indicate that application of marked statistics to this high quantity of high-quality data will provide a wealth of information about galaxy formation.

Ravi K. Sheth; Andrew J. Connolly; Ramin Skibba



Power systems utilizing the heat of produced formation fluid  

DOE Patents (OSTI)

Systems, methods, and heaters for treating a subsurface formation are described herein. At least one method includes treating a hydrocarbon containing formation. The method may include providing heat to the formation; producing heated fluid from the formation; and generating electricity from at least a portion of the heated fluid using a Kalina cycle.

Lambirth, Gene Richard (Houston, TX)



Carbon Monoxide Formation in Fires by High-Temperature ...  

Science Conference Proceedings (OSTI)

... experiments. Page 7. FORMATION BY ANAEROBIC WOOD PYROLYSIS 1461 . ... 1990. Milne, T,, in Biomass Gasification. ...



Varying heating in dawsonite zones in hydrocarbon containing formations  

DOE Patents (OSTI)

A method for treating an oil shale formation comprising dawsonite includes assessing a dawsonite composition of one or more zones in the formation. Heat from one or more heaters is provided to the formation such that different amounts of heat are provided to zones with different dawsonite compositions. The provided heat is allowed to transfer from the heaters to the formation. Fluids are produced from the formation.

Vinegar, Harold J. (Bellaire, TX); Xie, Xueying (Houston, TX); Miller, David Scott (Katy, TX)




SciTech Connect

Presented in this quarterly report is the Case History and Well Summary for the Vernon Field demonstration project in Isabella County, Michigan. This new case history and well summary format organizes and presents the technical and historical details of the Vernon Field demonstration, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion. Planning for the annual project meeting in Tampa, Florida has begun. This meeting will be held March 7-9, 2003 at the same site as the last three meetings. The goals of this project were to: (1) test the use of multi-lateral wells to recover bypassed hydrocarbons and (2) to access the potential of using surface geochemistry to reduce drilling risk. Two new demonstration wells, the State-Smock and the Bowers 4-25, were drilled to test the Dundee Formation at Vernon Field for bypassed oil. Neither well was commercial, although both produced hydrocarbon shows. An extensive geochemical survey in the vicinity of Vernon Field, covering much of Isabella County, has produced a base map for interpretation of anomalies in Michigan. Several potential new anomalies were discovered that could be further investigated.

James R. Wood; W. Quinlan


Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Factors of paleosol formation in a Late Cretaceous eolian sand sheet paleoenvironment, Marlia Formation, Southeastern Brazil  

E-Print Network (OSTI)

Formation, Southeastern Brazil Patrick Francisco Führ Dal' Bó a, , Giorgio Basilici a , Rômulo Simões), Brazil b IG ­ Universidade Federal do Pará, 66075-110, Belém (PA), Brazil a b s t r a c ta r t i c l e i Late Cretaceous The Marília Formation, which crops out in southeastern Brazil, is interpreted as a Late

Ahmad, Sajjad


Low voltage arc formation in railguns  

DOE Patents (OSTI)

A low voltage plasma arc is first established across the rails behind the projectile by switching a low voltage high current source across the rails to establish a plasma arc by vaporizing a fuse mounted on the back of the projectile, maintaining the voltage across the rails below the railgun breakdown voltage to prevent arc formation ahead of the projectile. After the plasma arc has been formed behind the projectile a discriminator switches the full energy bank across the rails to accelerate the projectile. A gas gun injector may be utilized to inject a projectile into the breech of a railgun. The invention permits the use of a gas gun or gun powder injector and an evacuated barrel without the risk of spurious arc formation in front of the projectile.

Hawke, R.S.



Low voltage arc formation in railguns  

DOE Patents (OSTI)

A low voltage plasma arc is first established across the rails behind the projectile by switching a low voltage high current source across the rails to establish a plasma arc by vaporizing a fuse mounted on the back of the projectile, maintaining the voltage across the rails below the railgun breakdown voltage to prevent arc formation ahead of the projectile. After the plasma arc has been formed behind the projectile a discriminator switches the full energy bank across the rails to accelerate the projectile. A gas gun injector may be utilized to inject a projectile into the breech of a railgun. The invention permits the use of a gas gun or gun powder injector and an evacuated barrel without the risk of spurious arc formation in front of the projectile.

Hawke, Ronald S. (Livermore, CA)



Low voltage arc formation in railguns  

DOE Patents (OSTI)

A low voltage plasma arc is first established across the rails behind the projectile by switching a low voltage high current source across the rails to establish a plasma arc by vaporizing a fuse mounted on the back of the projectile, maintaining the voltage across the rails below the railgun breakdown voltage to prevent arc formation ahead of the projectile. After the plasma arc has been formed behind the projectile a discriminator switches the full energy bank across the rails to accelerate the projectile. A gas gun injector may be utilized to inject a projectile into the breech of a railgun. The invention permits the use of a gas gun or gun powder injector and an evacuated barrel without the risk of spurious arc formation in front of the projectile. 2 figs.

Hawke, R.S.



Formation of Globular Clusters in Galaxy Mergers  

E-Print Network (OSTI)

We present a high-resolution simulation of globular cluster formation in a galaxy merger. For the first time in such a simulation, individual star clusters are directly identified and followed on their orbits. We quantitatively compare star formation in the merger to that in the unperturbed galaxies. The merging galaxies show a strong starburst, in sharp contrast to their isolated progenitors. Most star clusters form in the tidal tails. With a mass range of $5\\times10^{5}$--$5\\times 10^{6} M_{\\odot}$, they are identified as globular clusters. The merger remnant is an elliptical galaxy. Clusters with different mass or age have different radial distributions in the galaxy. The cluster mass spectrum appears to be roughly log-normal. Our results show that the high specific frequency and bimodal distribution of metallicity observed in elliptical galaxies are natural products of gas-rich mergers, supporting a merger origin for the ellipticals and their globular cluster systems.

Li, Y; Klessen, R S; Li, Yuexing; Low, Mordecai-Mark Mac; Klessen, Ralf S.



Formation of Globular Clusters in Galaxy Mergers  

E-Print Network (OSTI)

We present a high-resolution simulation of globular cluster formation in a galaxy merger. For the first time in such a simulation, individual star clusters are directly identified and followed on their orbits. We quantitatively compare star formation in the merger to that in the unperturbed galaxies. The merging galaxies show a strong starburst, in sharp contrast to their isolated progenitors. Most star clusters form in the tidal features. With a mass range of $5\\times10^{5}$--$5\\times 10^{6} M_{\\odot}$, they are identified as globular clusters. The merger remnant is an elliptical galaxy. Clusters with different mass or age have different radial distributions in the galaxy. Our results show that the high specific frequency and bimodal distribution of metallicity observed in elliptical galaxies are natural products of gas-rich mergers, supporting a merger origin for the ellipticals and their globular cluster systems.

Yuexing Li; Mordecai-Mark Mac Low; Ralf S. Klessen



QCD String formation and the Casimir Energy  

E-Print Network (OSTI)

Three distinct scales are identified in the excitation spectrum of the gluon field around a static quark-antiquark pair as the color source separation R is varied. The spectrum, with string-like excitations on the largest length scales of 2-3 fm, provides clues in its rich fine structure for developing an effective bosonic string description. New results are reported from the three-dimensional Z(2) and SU(2) gauge models, providing further insight into the mechanism of bosonic string formation. The precocious onset of string-like behavior in the Casimir energy of the static quark-antiquark ground state is observed below R=1 fm where most of the string eigenmodes do not exist and the few stable excitations above the ground state are displaced. We find no firm theoretical foundation for the widely held view of discovering string formation from high precision ground state properties below the 1 fm scale.

K. Jimmy Juge; J. Kuti; C. Morningstar



Ice Formation in Gas-Diffusion Layers  

SciTech Connect

Under sub-freezing conditions, ice forms in the gas-diffusion layer (GDL) of a proton exchange membrane fuel cell (PEMFC) drastically reducing cell performance. Although a number of strategies exist to prevent ice formation, there is little fundamental understanding of the mechanisms of freezing within PEMFC components. Differential scanning calorimetry (DSC) is used to elucidate the effects of hydrophobicity (Teflon loading) and water saturation on the rate of ice formation within three commercial GDLs. We find that as the Teflon loading increases, the crystallization temperature decreases due to a change in internal ice/substrate contact angle, as well as the attainable level of water saturation. Classical nucleation theory predicts the correct trend in freezing temperature with Teflon loading.

Dursch, Thomas; Radke, Clayton J.; Weber, Adam Z.



The Uflow Computational Model and Intermediate Format  

E-Print Network (OSTI)

This report motivates and defines a general-purpose, architecture independent, parallel computational model, which captures the intuitions which underlie the design of the United Functions and Objects programming language. The model has two aspects, which turn out to be a traditional dataflow model and an actor-like model, with a very simple interface between the two. Certain aspects of the model, particularly strictness, maximum parallelism, and lack of suspension are stressed. The implications of introducing stateful objects are carefully spelled out. The model has several purposes, although we largely describe it as it would be used for visualising the execution of programs. The model is embodied in a textual intermediate format, and in a set of UFO data structures. This report also serves as a definition of the intermediate format, and gives a brief overview of the data structures. 1 Introduction This report serves two purposes. Firstly, in sections 1 to 9, the Uflow computational...

John Sargeant; Chris Kirkham; Steve Anderson



Geothermal resources Frio Formation, South Texas  

DOE Green Energy (OSTI)

A preliminary study of the Frio sand distribution and formation temperatures and pressures was undertaken in order to define prospective areas in which a more detailed reservoir analysis is necessary prior to the selection of a site for a geothermal well. As a result two potential geothermal fairways were identified--one in the south part of the area in Hidalgo, Willacy, and Cameron Counties, and the other in the north part in north-central Nueces County.

Bebout, D.G.; Dorfman, M.H.; Agagu, O.K.



Formation of hydrocarbons by bacteria and algae  

SciTech Connect

A literature review has been performed summarizing studies on hydrocarbon synthesis by microorganisms. Certain algal and bacterial species produce hydrocarbons in large quantities, 70 to 80% of dry cell mass, when in a controlled environment. The nutritional requirements of these organisms are simple: CO/sub 2/ and mineral salts. The studies were initiated to determine whether or not microorganisms played a role in petroleum formation. 90 references. (DMC)

Tornabene, T.G.



Non Poisson intermittent events in price formation  

E-Print Network (OSTI)

The formation of price in a financial market is modelled as a chain of Ising spin with three fundamental figures of trading. We investigate the time behaviour of the model, and we compare the results with the real EURO/USD change rate. By using the test of local Poisson hypothesis, we show that this minimal model leads to clustering and "declustering" in the volatility signal, typical of the real market data.

Greco, A; Sorriso-Valvo, L; Carbone, Vincenzo; Greco, Antonella; Sorriso-Valvo, Luca



Aromatics oxidation and soot formation in flames  

SciTech Connect

Work during this contract period has been concerned with the mechanisms through which aromatics are formed and destroyed in flames, and the processes responsible for soot formation. Recent progress has been primarily in two areas: experiments and modeling of the soot nucleation process in low pressure benzene flames and preparation for experiments on the destruction mechanisms of benzene. In addition, we have incorporated weak collision'' formalisms into a fall-off computer code.

Howard, J.B.



New hypothesis for formation of Lengguru foldbelt, Irian Jaya, Indonesia  

Science Conference Proceedings (OSTI)

The Lengguru foldbelt, an area 300 km (180 mi) long with a maximum width of 100 km (60 mi), is near the western end of the island of New Guinea. Sedimentary rocks of the belt include Mesozoic marine sandstone and shale, Tertiary deep-water limestone, Tertiary shelf limestone, and upper Miocene to Pleistocene detritus. The slab of folded platform sedimentary rocks making up the Lengguru foldbelt was originally at the northern margin of the Australian continent and was thrust southwestward over the undeformed continental crust of the western part of New Guinea. The slab was also rotated clockwise by about 30/sup 0/ about a pivot at its northern end. During rotation, thrusting and decollement within the foldbelt caused a repetition by stacking of the stratigraphic section, and the belt was dragged along transcurrent faults to the south. This foldbelt is of interest for oil exploration because of proximity to the Salawati and Bintuni oil fields on the westernmost tip of the island.

Dow, D.B.; Robinson, G.P.; Ratman, N.



Photoionising feedback in star cluster formation  

E-Print Network (OSTI)

We present the first ever hydrodynamic calculations of star cluster formation that incorporate the effect of feedback from ionising radiation. In our simulations, the ionising source forms in the cluster core at the intersection of several dense filaments of inflowing gas. We show that these filaments collimate ionised outflows and suggest such an environmental origin for at least some observed outflows in regions of massive star formation. Our simulations show both positive feedback (i.e. promotion of star formation in neutral gas compressed by expanding HII regions) and negative feedback (i.e. suppression of the accretion flow in to the central regions). We show that the volume filling factor of ionised gas is very different in our simulations than would result from the case where the central source interacted with an azimuthally smoothed gas density distribution. As expected, gas density is the key parameter in determining whether clusters are unbound by photoionising radiation. Nevertheless, we find - on account of the acceleration of a small fraction of the gas to high velocities in the outflows - that the deposition in the gas of an energy that exceeds the binding energy of the cluster is not a sufficient criterion for unbinding the bulk of the cluster mass.

J. E. Dale; I. A. Bonnell; C. J. Clarke; M. R. Bate



Aromatics Oxidation and Soot Formation in Flames  

SciTech Connect

This project is concerned with the kinetics and mechanisms of aromatics oxidation and the growth process to polycyclic aromatic hydrocarbons (PAH) of increasing size, soot and fullerenes formation in flames. The overall objective of the experimental aromatics oxidation work is to extend the set of available data by measuring concentration profiles for decomposition intermediates such as phenyl, cyclopentadienyl, phenoxy or indenyl radicals which could not be measured with molecular-beam mass spectrometry to permit further refinement and testing of benzene oxidation mechanisms. The focus includes PAH radicals which are thought to play a major role in the soot formation process while their concentrations are in many cases too low to permit measurement with conventional mass spectrometry. The radical species measurements are used in critical testing and improvement of a kinetic model describing benzene oxidation and PAH growth. Thermodynamic property data of selected species are determined computationally, for instance using density functional theory (DFT). Potential energy surfaces are explored in order to identify additional reaction pathways. The ultimate goal is to understand the conversion of high molecular weight compounds to nascent soot particles, to assess the roles of planar and curved PAH and relationships between soot and fullerenes formation. The specific aims are to characterize both the high molecular weight compounds involved in the nucleation of soot particles and the structure of soot including internal nanoscale features indicative of contributions of planar and/or curved PAH to particle inception.

Howard, J. B.; Richter, H.



Toy Models for Galaxy Formation versus Simulations  

E-Print Network (OSTI)

We describe simple useful toy models for key processes of galaxy formation in its most active phase, at z > 1, and test the approximate expressions against the typical behaviour in a suite of high-resolution hydro-cosmological simulations of massive galaxies at z = 4-1. We address in particular the evolution of (a) the total mass inflow rate from the cosmic web into galactic haloes based on the EPS approximation, (b) the penetration of baryonic streams into the inner galaxy, (c) the disc size, (d) the implied steady-state gas content and star-formation rate (SFR) in the galaxy subject to mass conservation and a universal star-formation law, (e) the inflow rate within the disc to a central bulge and black hole as derived using energy conservation and self-regulated Q ~ 1 violent disc instability (VDI), and (f) the implied steady state in the disc and bulge. The toy models provide useful approximations for the behaviour of the simulated galaxies. We find that (a) the inflow rate is proportional to mass and to (...

Dekel, A; Tweed, D; Cacciato, M; Ceverino, D; Primack, J R



Production from multiple zones of a tar sands formation  

DOE Patents (OSTI)

A method for treating a tar sands formation includes providing heat to at least part of a hydrocarbon layer in the formation from a plurality of heaters located in the formation. The heat is allowed to transfer from the heaters to at least a portion of the formation. Fluids are produced from the formation through at least one production well that is located in at least two zones in the formation. The first zone has an initial permeability of at least 1 darcy. The second zone has an initial of at most 0.1 darcy. The two zones are separated by a substantially impermeable barrier.

Karanikas, John Michael; Vinegar, Harold J




SciTech Connect

We show that supersonic MHD turbulence yields a star formation rate (SFR) as low as observed in molecular clouds, for characteristic values of the free-fall time divided by the dynamical time, t{sub ff}/t{sub dyn}, the Alfvenic Mach number, M{sub a}, and the sonic Mach number, M{sub s}. Using a very large set of deep adaptive-mesh-refinement simulations, we quantify the dependence of the SFR per free-fall time, {epsilon}{sub ff}, on the above parameters. Our main results are (1) that {epsilon}{sub ff} decreases exponentially with increasing t{sub ff}/t{sub dyn}, but is insensitive to changes in M{sub s}, for constant values of t{sub ff}/t{sub dyn} and M{sub a}. (2) Decreasing values of M{sub a} (stronger magnetic fields) reduce {epsilon}{sub ff}, but only to a point, beyond which {epsilon}{sub ff} increases with a further decrease of M{sub a}. (3) For values of M{sub a} characteristic of star-forming regions, {epsilon}{sub ff} varies with M{sub a} by less than a factor of two. We propose a simple star formation law, based on the empirical fit to the minimum {epsilon}{sub ff}, and depending only on t{sub ff}/t{sub dyn}: {epsilon}{sub ff} Almost-Equal-To {epsilon}{sub wind}exp (- 1.6 t{sub ff}/t{sub dyn}). Because it only depends on the mean gas density and rms velocity, this law is straightforward to implement in simulations and analytical models of galaxy formation and evolution.

Padoan, Paolo [ICREA and ICC, University of Barcelona, Marti i Franques 1, E-08028 Barcelona (Spain); Haugbolle, Troels [Centre for Star and Planet Formation, University of Copenhagen, Oestervoldgade 5-7., DK-1350, Copenhagen (Denmark); Nordlund, Ake, E-mail: ppadoan@icc.ub.edu, E-mail: haugboel@nbi.dk, E-mail: aake@nbi.dk [Centre for Star and Planet Formation and Niels Bohr Institute, University of Copenhagen, Juliane Maries Vej 30, DK-2100, Copenhagen (Denmark)



Open Standards, Open Formats, and Open Source  

E-Print Network (OSTI)

The paper proposes some comments and reflections on the notion of openness and on how it relates to three important topics: open standards, open formats, and open source. Often, these terms are considered equivalent and/or mutually implicated: open source is the only way to enforce and exploit open standards. This position is misleading, as it increases the confusion about this complex and extremely critical topic. The paper clarifies the basic terms and concepts. This is instrumental to suggest a number of actions and practices aiming at promoting and defending openness in modern ICT products and services.

Davide Cerri; Alfonso Fuggetta; Davide Cerri; Alfonso Fuggetta; Cefriel Politecnico Di Milano


Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Consumption externalities, habit formation and equilibrium efficiency  

E-Print Network (OSTI)

We analyze the welfare properties of the competitive equilibrium in a capital accumulation model where individual preferences are subject to both habit formation and consumption spillovers. Using an additive specification for preferences, according to which the argument in the utility function is a linear combination of present and past values of own consumption and consumption spillovers, we analyze the circumstances under which these spillovers are a source of inefficiency. It is shown that consumption externalities have to interact with habits in order to generate an inefficient dynamic equilibrium. Finally, we characterize optimal tax policies aimed at restoring efficient decentralized paths.

Jaime Alonso-carrera; Jordi Caball; Xavier Raurich



Solar cell contact formation using laser ablation  

SciTech Connect

The formation of solar cell contacts using a laser is described. A method of fabricating a back-contact solar cell includes forming a poly-crystalline material layer above a single-crystalline substrate. The method also includes forming a dielectric material stack above the poly-crystalline material layer. The method also includes forming, by laser ablation, a plurality of contacts holes in the dielectric material stack, each of the contact holes exposing a portion of the poly-crystalline material layer; and forming conductive contacts in the plurality of contact holes.

Harley, Gabriel; Smith, David; Cousins, Peter



Massive Black Holes: formation and evolution  

E-Print Network (OSTI)

Supermassive black holes are nowadays believed to reside in most local galaxies. Observations have revealed us vast information on the population of local and distant black holes, but the detailed physical properties of these dark massive objects are still to be proven. Accretion of gas and black hole mergers play a fundamental role in determining the two parameters defining a black hole: mass and spin. We briefly review here the basic properties of the population of supermassive black holes, focusing on the still mysterious formation of the first massive black holes, and their evolution from early times to now.

Martin J. Rees; Marta Volonteri




SciTech Connect

Scalar fields, strongly coupled to matter, can be present in nature and still be invisible to local experiments if they are subject to a screening mechanism. The symmetron is one such mechanism that relies on restoration of a spontaneously broken symmetry in regions of high density to shield the scalar fifth force. We have investigated structure formation in the symmetron model by using N-body simulations and find observable signatures in both the linear and nonlinear matter power spectrum and on the halo mass function. The mechanism for suppressing the scalar fifth force in high-density regions is also found to work very well.

Davis, Anne-Christine; Li Baojiu [DAMTP, Centre for Mathematical Sciences, University of Cambridge, Wilberforce Road, Cambridge CB3 0WA (United Kingdom); Mota, David F.; Winther, Hans A. [Institute of Theoretical Astrophysics, University of Oslo, 0315 Oslo (Norway)



Observational Analysis of Tropical Cyclone Formation Associated with Monsoon Gyres  

Science Conference Proceedings (OSTI)

Large-scale monsoon gyres and the involved tropical cyclone formation over the western North Pacific have been documented in previous studies. The aim of this study is to understand how monsoon gyres affect tropical cyclone formation. An ...

Liguang Wu; Huijun Zong; Jia Liang



Dynamic and thermal control of an electromagnetic formation flight testbed  

E-Print Network (OSTI)

Formation flight of multiple spacecraft is an emerging method for completing complex space missions in an efficient manner. A limitation found in maintaining such formations is the need for precise control at all times. ...

Neave, Matthew D. (Matthew David)




E-Print Network (OSTI)


Loo, B.W.



CX-004679: Categorical Exclusion Determination | Department of...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Exclusion Determination CX-004679: Categorical Exclusion Determination Enhanced Oil Recovery from the Bakken Shale Using Surfactant Imbibition Couple with Gravity...


Enhanced Lattice Defect Formation Associated with Hydrogen and ...  

Science Conference Proceedings (OSTI)

Presentation Title, Enhanced Lattice Defect Formation Associated with Hydrogen and Hydrogen Embrittlement under Elastic Stress of High-Strength Steel.


Formation of Hydrogen Cottrell Atmosphere in Palladium: Theory ...  

Science Conference Proceedings (OSTI)

Symposium, Hydrogen Storage in Materials: Theory and Experiment. Presentation Title, Formation of Hydrogen Cottrell Atmosphere in Palladium: Theory and...


Formation mechanisms and quantification of organic nitrates in atmospheric aerosol  

E-Print Network (OSTI)

Atmospheric submicron aerosol . . . . . . . 2.3 Partitioningon SOA organic aerosol formation alkyl nitrate and secondaryPeroxy radical fate . . . . . . Aerosol . . . . . . . .

Rollins, Andrew Waite



Energy-Driven Pattern Formation Robert V. Kohn  

E-Print Network (OSTI)

Energy-Driven Pattern Formation Robert V. Kohn Grad Student and Postdoc Seminar April 22, 2011 Robert V. Kohn Energy-Driven Pattern Formation #12;Overview What is energy-driven pattern formation? Hard by singular perturbation Statics: minimum energy scaling laws Dynamics: patterns induced by steepest


Dynamics and flight control of the UAV formations  

Science Conference Proceedings (OSTI)

The purpose of this paper is to describe the flight of an Unmanned Aerial Vehicles (UAV) formation by using a 6 degrees of freedom (6 DOF) models. The problem of flight formation will be approached in a simple manner, by using a 3 DOF models, as well ... Keywords: UAV, control, dynamic, flight, formation

Teodor-Viorel Chelaru; Valentin Pana; Adrian Chelaru



Stability and control of the UAV formations flight  

Science Conference Proceedings (OSTI)

The purpose of this paper is to analyze the flight stability of an Unmanned Aerial Vehicles (UAV) formation by using 3 degrees of freedom (3 DOF) models. The problem of flight formation will be approached in a simple manner, by using 3 DOF nonlinear ... Keywords: automation, control, flight, formation, simulation, stability

Teodor-Viorel Chelaru; Valentin Pan?



Parameterized formatting of an XML document by XSL rules  

Science Conference Proceedings (OSTI)

The possibilities of formatting offered by database management systems (DBMS) are insufficient and do not allow emphasizing the various data results. It is the same for the usual browsing of an XML document without any particular rules of formatting. ... Keywords: DOM tree, XHTML document, XML document, XSL rules, XSLT, parameters of formatting

Madani Kenab; Tayeb Ould Braham; Pierre Bazex



Indian Statistical Institute: Using Multiple Metadata Formats in DSpace  

E-Print Network (OSTI)

of The University of Manitoba to provide etdms metadata format. However, the user community has often expressed the requirement for other metadata formats like VRA core, IMS etc. Support for many metadata formats will greatly enhance the use of DSpace and the type...

Prasad, A R D



Heating subsurface formations by oxidizing fuel on a fuel carrier  

SciTech Connect

A method of heating a portion of a subsurface formation includes drawing fuel on a fuel carrier through an opening formed in the formation. Oxidant is supplied to the fuel at one or more locations in the opening. The fuel is combusted with the oxidant to provide heat to the formation.

Costello, Michael; Vinegar, Harold J.



XML Representation of Constraint Networks: Format XCSP 2.1  

E-Print Network (OSTI)

We propose a new extended format to represent constraint networks using XML. This format allows us to represent constraints defined either in extension or in intension. It also allows us to reference global constraints. Any instance of the problems CSP (Constraint Satisfaction Problem), QCSP (Quantified CSP) and WCSP (Weighted CSP) can be represented using this format.

Roussel, Olivier



Method for completing wells in unconsolidated formations  

SciTech Connect

A method is described for producing fluids from a subterranean formation in a formation region of substantially unconsolidated sandlike particles comprising the steps of: penetrating the region to form an uncased wellbore cavity extending within the region; extending within the region; inserting filter means into the cavity, the filter means forming an interior space for gathering fluids from the region for production from the wellbore and the filter means including means for permitting the flow of solids fines into the space with the fluids from the region; causing fluids to flow into the cavity and through the filter means into the space to be produced from the region at a rate which will cause sand particles in the region to flow into and occupy the cavity to form an in situ packing around the filter means; producing fluids from the region through the cavity and into the space and having a limited quantity of solids fines entrained therein smaller than the solid particles retained in the cavity; and controlling the rate of production of fluids to form a cylindrical dilatant zone extending radially outward in the region from the cavity and which is mechanically stable.

Perkins, T.K.



Enthalpy of Formation of Nitrosylpentaammineruthenium(II)  

NLE Websites -- All DOE Office Websites (Extended Search)

Enthalpy of Formation of Nitrosylpentaammineruthenium(II) from NO+(aq) Enthalpy of Formation of Nitrosylpentaammineruthenium(II) from NO+(aq) and Aquopentaammineruthenium(II) James F. Wishart, Henry Taube, Kenneth J. Breslauer and Stephan S. Isied Inorg. Chem. 25, 1479-1481 (1986) Abstract: An estimate of the enthalpy change associated with the substitution of H2O on (NH3)5RuOH22+ with NO+(aq) has been made by thermochemical measurements on a cycle of reactions, which includes the reaction of (NH3)5RuOH22+ with NO2-(aq) and which involves the assumption that the heat of dissolution of NOBF4(s) to produce NO+(aq) + BF4-(aq) is close to the heat of dissolution of CsBF4(s). The chemistry is complicated because the reaction of (NH3)5RuOH22+ with NO2-(aq) ultimately produces trans-[(NH3)4Ru(OH)NO]2+(aq) rather than [(NH3)5RuNO]3+(aq). Reasonably

Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Magnetic Fields in Population III Star Formation  

DOE Green Energy (OSTI)

We study the buildup of magnetic fields during the formation of Population III star-forming regions, by conducting cosmological simulations from realistic initial conditions and varying the Jeans resolution. To investigate this in detail, we start simulations from identical initial conditions, mandating 16, 32 and 64 zones per Jeans length, and studied the variation in their magnetic field amplification. We find that, while compression results in some amplification, turbulent velocity fluctuations driven by the collapse can further amplify an initially weak seed field via dynamo action, provided there is sufficient numerical resolution to capture vortical motions (we find this requirement to be 64 zones per Jeans length, slightly larger than, but consistent with previous work run with more idealized collapse scenarios). We explore saturation of amplification of the magnetic field, which could potentially become dynamically important in subsequent, fully-resolved calculations. We have also identified a relatively surprising phenomena that is purely hydrodynamic: the higher-resolved simulations possess substantially different characteristics, including higher infall-velocity, increased temperatures inside 1000 AU, and decreased molecular hydrogen content in the innermost region. Furthermore, we find that disk formation is suppressed in higher-resolution calculations, at least at the times that we can follow the calculation. We discuss the effect this may have on the buildup of disks over the accretion history of the first clump to form as well as the potential for gravitational instabilities to develop and induce fragmentation.

Turk, Matthew J.; Oishi, Jeffrey S.; Abel, Tom; Bryan, Greg



On water ice formation in interstellar clouds  

E-Print Network (OSTI)

A model is proposed for the formation of water ice mantles on grains in interstellar clouds. This occurs by direct accretion of monomers from the gas, be they formed by gas or surface reactions. The model predicts the existence of a threshold in interstellar light extinction, A(v), which is mainly determined by the adsorption energy of water molecules on the grain material; for hydrocarbon material, chemical simulation places this energy between 0.5 and 2 kcal/mole, which sets the visible exctinction threshold at a few magnitudes, as observed. Once the threshold is crossed, all available water molecules in the gas are quickly adsorbed, forming an ice mantle, because the grain cools down and the adsorption energy on ice is higher than on bare grain. The model also predicts that the thickness of the mantle, and, hence, the optical thickness at 3 mu, grow linearly with A(v), as observed, with a slope which depends upon the total amount of water in the gas. Chemical simulation was also used to determine the adsorption sites and energies of O and OH on hydrocarbons, and study the dynamics of formation of water molecules by surface reactions with gaseous H atoms, as well as their chances of sticking in situ.

Renaud Papoular




Science Conference Proceedings (OSTI)

There are many carbonate reservoirs in US (and the world) with light oil and fracture pressure below its minimum miscibility pressure (or reservoir may be naturally fractured). Many carbonate reservoirs are naturally fractured. Waterflooding is effective in fractured reservoirs, if the formation is water-wet. Many fractured carbonate reservoirs, however, are mixed-wet and recoveries with conventional methods are low (less than 10%). Thermal and miscible tertiary recovery techniques are not effective in these reservoirs. Surfactant flooding (or huff-n-puff) is the only hope, yet it was developed for sandstone reservoirs in the past. The goal of this research is to evaluate dilute (hence relatively inexpensive) surfactant methods for carbonate formations and identify conditions under which they can be effective. We have conducted adsorption, phase behavior and wettability studies. Addition of Na{sub 2}CO{sub 3} decreases IFT with a minimum at about 0.2 M. Addition of surfactant decreases IFT further. In the absence of surfactant the minerals are oil wet after aging with crude oil. Addition of surfactant solution decreases the contact angle to intermediate wettability. Addition of Na{sub 2}CO{sub 3} decreases anionic surfactant adsorption on calcite surface. Plans for the next quarter include conducting adsorption, phase behavior and wettability studies.

Kishore K. Mohanty




SciTech Connect

There are many carbonate reservoirs in US (and the world) with light oil and fracture pressure below its minimum miscibility pressure (or reservoir may be naturally fractured). Many carbonate reservoirs are naturally fractured. Waterflooding is effective in fractured reservoirs, if the formation is water-wet. Many fractured carbonate reservoirs, however, are mixed-wet and recoveries with conventional methods are low (less than 10%). Thermal and miscible tertiary recovery techniques are not effective in these reservoirs. Surfactant flooding (or huff-n-puff) is the only hope, yet it was developed for sandstone reservoirs in the past. The goal of this research is to evaluate dilute (hence relatively inexpensive) surfactant methods for carbonate formations and identify conditions under which they can be effective. We have conducted adsorption, phase behavior, interfacial tension (IFT) and wettability studies. Addition of Na{sub 2}CO{sub 3} decreases IFT with a minimum at about 0.2 M. Addition of surfactant decreases IFT further. In the absence of surfactant the minerals are oil-wet after aging with crude oil. Addition of surfactant solution decreases the contact angle to intermediate-wet for many surfactants and water-wet for one surfactant. Addition of Na{sub 2}CO{sub 3} decreases anionic surfactant adsorption on calcite surface. Plans for the next quarter include conducting core adsorption, phase behavior, wettability and mobilization studies.

Kishore K. Mohanty




SciTech Connect

There are many carbonate reservoirs in US (and the world) with light oil and fracture pressure below its minimum miscibility pressure (or reservoir may be naturally fractured). Many carbonate reservoirs are naturally fractured. Waterflooding is effective in fractured reservoirs, if the formation is water-wet. Many fractured carbonate reservoirs, however, are mixed-wet and recoveries with conventional methods are low (less than 10%). Thermal and miscible tertiary recovery techniques are not effective in these reservoirs. Surfactant flooding (or huff-n-puff) is the only hope, yet it was developed for sandstone reservoirs in the past. The goal of this research is to evaluate dilute (hence relatively inexpensive) surfactant methods for carbonate formations and identify conditions under which they can be effective. We have conducted adsorption, phase behavior, interfacial tension (IFT) and wettability studies. Alfoterra-38 (0.05 wt%), Alfoterra-35 (0.05 wt%), SS-6656 (0.05 wt%), and DTAB (1 wt%) altered the wettability of the initially oil-wet calcite plate to an intermediate/water-wet state. Low IFT ({approx}10{sup -3} dynes/cm) is obtained with surfactants 5-166, Alfoterra-33 and Alfoterra-38. Plans for the next quarter include conducting wettability and mobilization studies.

Kishore K. Mohanty



Geologic Study of the Coso Formation  

DOE Green Energy (OSTI)

There have been great advances in the last 20 years in understanding the volcanic, structural, geophysical, and petrologic development of the Coso Range and Coso geothermal field. These studies have provided a wealth of knowledge concerning the geology of the area, including general structural characteristics and kinematic history. One element missing from this dataset was an understanding of the sedimentology and stratigraphy of well-exposed Cenozoic sedimentary strata - the Coso Formation. A detailed sedimentation and tectonics study of the Coso Formation was undertaken to provide a more complete picture of the development of the Basin and Range province in this area. Detailed mapping and depositional analysis distinguishes separate northern and southern depocenters, each with its own accommodation and depositional history. While strata in both depocenters is disrupted by faults, these faults show modest displacement, and the intensity and magnitude of faulting does no t record significant extension. For this reason, the extension between the Sierran and Coso blocks is interpreted as minor in comparison to range bounding faults in adjacent areas of the Basin and Range.

D. L. Kamola; J. D. Walker



Star Formation from Galaxies to Globules  

E-Print Network (OSTI)

The empirical laws of star formation suggest that galactic-scale gravity is involved, but they do not identify the actual triggering mechanisms for clusters in the final stages. Many other triggering processes satisfy the empirical laws too, including turbulence compression and expanding shell collapse. The self-similar nature of the gas and associated young stars suggests that turbulence is more directly involved, but the small scale morphology of gas around most embedded clusters does not look like a random turbulent flow. Most clusters look triggered by other nearby stars. Such a prominent local influence makes it difficult to understand the universality of the Kennicutt and Schmidt laws on galactic scales. A unified view of multi-scale star formation avoids most of these problems. Ambient self-gravity produces spiral arms and drives much of the turbulence that leads to self-similar structures, while localized energy input from existing clusters and field supernovae triggers new clusters in pre-existing cl...

Elmegreen, B G



Nuclear Reaction Rates and Carbon Star Formation  

E-Print Network (OSTI)

We have studied how the third dredge-up and the carbon star formation in low-mass Asymptotic Giant Branch stars depends on certain key nuclear reaction rates. We find from a set of complete stellar evolution calculations of a 2Msun model with Z=0.01 including mass loss, that varying either the N14(p,g)O15 or the 3-alpha reaction rate within their uncertainties as given in the NACRE compilation results in dredge-up and yields that differ by a factor of 2. Model tracks with a higher rate for the 3-alpha rate and a lower rate for the N14(p,g)O15 reaction both show more efficient third dredge-up. New experimental results for the N14(p,g)O15 reaction rates are surveyed, yielding a rate which is about 40% lower than the tabulated NACRE rate, and smaller than NACRE's lower limit. We discuss the possible implications of the revised nuclear reaction stellar evolution calculations that aim to reproduce the observed carbon star formation at low mass, which requires efficient third dredge-up.

Falk Herwig; Sam M. Austin



Subterranean formation permeability contrast correction methods  

SciTech Connect

This patent describes a method of correcting the permeability contrast in a subterranean formation penetrated by a well bore to improve the sweep efficiency of waterflooding operations carried out therein, the formation containing at least one high permeability zone lying adjacent to at least one low permeability zone, which zones are in fluid communication with one another at the boundary therebetween. It comprises isolating the high permeability zone from the low permeability zone; injecting a crosslinkable aqueous polymer solution into the high permeability zone in an amount sufficient to substantially fill some the zone therewith, the crosslinkable aqueous polymer solution being capable of plugging the high permeability zone when crosslinked; isolating the low permeability zone from the high permeability zone; injecting into the low permeability zone an aqueous liquid containing a crosslinking agent which upon contact with the aqueous polymer solution causes the solution to form a crosslinked gel; and displacing the aqueous liquid containing the crosslinking agent through the low permeability zone so that the crosslinking agent contact the aqueous polymer solution and forms a crosslinked gel at least at the boundary between the zones whereby fluid communication between the zones is reduced and subsequently injected flood water is substantially confined to the low permeability zone.

Beardmore, D.H.



Dilute Surfactant Methods for Carbonate Formations  

Science Conference Proceedings (OSTI)

There are many carbonate reservoirs in US (and the world) with light oil and fracture pressure below its minimum miscibility pressure (or reservoir may be naturally fractured). Many carbonate reservoirs are naturally fractured. Waterflooding is effective in fractured reservoirs, if the formation is water-wet. Many fractured carbonate reservoirs, however, are mixed-wet and recoveries with conventional methods are low (less than 10%). Thermal and miscible tertiary recovery techniques are not effective in these reservoirs. Surfactant flooding (or huff-n-puff) is the best hope, yet it was developed for sandstone reservoirs in the past. The goal of this research is to evaluate dilute (hence relatively inexpensive) surfactant methods for carbonate formations and identify conditions under which they can be effective. Laboratory-scale surfactant brine imbibition experiments give high oil recovery (35-62% OOIP) for initially oil-wet cores through wettability alteration and IFT reduction. Core-scale simulation results match those of the experiments. Initial capillarity-driven imbibition gives way to a final gravity-driven process. As the matrix block height increases, surfactant alters wettability to a lesser degree, or permeability decreases, oil production rate decreases. The scale-up to field scale will be further studied in the next quarter.

Kishore K. Mohanty



Controls on Gas Hydrate Formation and Dissociation  

SciTech Connect

The main objectives of the project were to monitor, characterize, and quantify in situ the rates of formation and dissociation of methane hydrates at and near the seafloor in the northern Gulf of Mexico, with a focus on the Bush Hill seafloor hydrate mound; to record the linkages between physical and chemical parameters of the deposits over the course of one year, by emphasizing the response of the hydrate mound to temperature and chemical perturbations; and to document the seafloor and water column environmental impacts of hydrate formation and dissociation. For these, monitoring the dynamics of gas hydrate formation and dissociation was required. The objectives were achieved by an integrated field and laboratory scientific study, particularly by monitoring in situ formation and dissociation of the outcropping gas hydrate mound and of the associated gas-rich sediments. In addition to monitoring with the MOSQUITOs, fluid flow rates and temperature, continuously sampling in situ pore fluids for the chemistry, and imaging the hydrate mound, pore fluids from cores, peepers and gas hydrate samples from the mound were as well sampled and analyzed for chemical and isotopic compositions. In order to determine the impact of gas hydrate dissociation and/or methane venting across the seafloor on the ocean and atmosphere, the overlying seawater was sampled and thoroughly analyzed chemically and for methane C isotope ratios. At Bush hill the pore fluid chemistry varies significantly over short distances as well as within some of the specific sites monitored for 440 days, and gas venting is primarily focused. The pore fluid chemistry in the tub-warm and mussel shell fields clearly documented active gas hydrate and authigenic carbonate formation during the monitoring period. The advecting fluid is depleted in sulfate, Ca Mg, and Sr and is rich in methane; at the main vent sites the fluid is methane supersaturated, thus bubble plumes form. The subsurface hydrology exhibits both up-flow and down-flow of fluid at rates that range between 0.5 to 214 cm/yr and 2-162 cm/yr, respectively. The fluid flow system at the mound and background sites are coupled having opposite polarities that oscillate episodically between 14 days to {approx}4 months. Stability calculations suggest that despite bottom water temperature fluctuations, of up to {approx}3 C, the Bush Hill gas hydrate mound is presently stable, as also corroborated by the time-lapse video camera images that did not detect change in the gas hydrate mound. As long as methane (and other hydrocarbon) continues advecting at the observed rates the mound would remain stable. The {_}{sup 13}C-DIC data suggest that crude oil instead of methane serves as the primary electron-donor and metabolic substrate for anaerobic sulfate reduction. The oil-dominated environment at Bush Hill shields some of the methane bubbles from being oxidized both anaerobically in the sediment and aerobically in the water column. Consequently, the methane flux across the seafloor is higher at Bush hill than at non-oil rich seafloor gas hydrate regions, such as at Hydrate Ridge, Cascadia. The methane flux across the ocean/atmosphere interface is as well higher. Modeling the methane flux across this interface at three bubble plumes provides values that range from 180-2000 {_}mol/m{sup 2} day; extrapolating it over the Gulf of Mexico basin utilizing satellite data is in progress.

Miriam Kastner; Ian MacDonald



Measurement of the rapidity and transverse momentum distributions of Z bosons in pp collisions at  

E-Print Network (OSTI)

from Bakken shale, Bazhenov shale, and Woodford shale. Our analysis, based on spatial autocorrelation of the Bakken shale series samples, a Bazhenov shale and a Woodford shale are shown in Figure 3. The C shale. Figure 3: SAM images of Bakken shales (bk), Bazhenov shale (bz, lower left), and Woodford shale

Adolphs, Ralph


WIUGC 2012 Report page 1 SPONSORS REPORT  

E-Print Network (OSTI)

og solfysikk. Tidligere kunne vi bare studere sola fra bakken. Informasjonen fikk vi ved solstrålene slutt når ned til oss på bakken. Vi skal også se litt på noen av de mange spennende studiene som hvordan de tilsynela- tende beveget seg over solskiven. Det Målinger fra bakken Vi kan bruke

Coulson, Ian M.



SciTech Connect

Two major accomplishments resulted from Phase I. One is the success of the surface geochemistry program, which collected over 800 samples from the site of the 1st demonstration well in Vernon Field and has pretty well provided us with the tools to delineate favorable ground from unfavorable. The second is the recent detailed mapping of the Central Michigan Basin that for the first time revealed the presence of at least two major faults that control the location of many of the reservoirs in the Michigan Basin. These faults were located from structure maps obtained by contouring the surface of the Dundee Formation using top picks from 9861 wells in 14 counties. Faults were inferred where the contour lines were most dense (''stacked'').

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan




SciTech Connect

In this reporting period, we extended the fault study to include more faults and developed new techniques to visualize the faults. We now have used data from the Dundee Formation to document 11 major faults in the Michigan Basin and are in the process of reviewing data from other horizons. These faults appear to control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new laboratory is now functional and has been fully staffed as of December. The annual project review has been set for March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan



Minimizing formation damage under adverse conditions during gravel pack operations  

Science Conference Proceedings (OSTI)

A method is described for minimizing formation damage caused by intrusive fluids prior to a gravel packing operation in loosely consolidated formations penetrated by at least one well comprising: (a) filling the casing of the well with an underbalanced completion fluid; (b) placing within the well a removable packer capable of isolating the space between the casing and the formation from the downhole well pressure; (c) setting through the packer a first tubing suitable for perforating and stabilizing the flow of fluids into the well; (d) perforating the casing; (e) introducing a blocking agent into the formation via the perforations which agent upon solidification is sufficient to minimize formation damage by avoiding the introduction of formation fluids where the agent is a gel; (f) causing the blocking agent to solidify while forming a solidified plug within the well and a solid mass within the adjacent washed out portion of the formation; (g) removing the first tubing from the well; (h) placing within the well a second tubing having a slotted portion therein sufficient to allow gravel packing of the well and the formation; (i) removing the solidified plug from the wellbore along with solidified gel from the washed-out portion of the formation; and (j) placing a gravel pack within the well and the washed-out portion of the formation via the second tubing which consolidates the formation.

Jennings, A.R. Jr.; Shu, P.



Basin-scale cyclostratigraphy of the Green River Formation, Wyoming W. Aswasereelert1,2,  

E-Print Network (OSTI)

to olive micrite and carbonate siltstone, kerogen-rich laminated mi- crite (oil shale), bedded evaporite and appear conformable with major oil shale beds and other lacustrine strata. METHODS Facies Associations kerogen-rich micrite (oil shale) and bedded evaporite, represents deep lacustrine environments. The oil

Meyers, Stephen R.


Best Practices for Portable Document Format (PDF) Creation | Scientific and  

Office of Scientific and Technical Information (OSTI)

Best Practices for Portable Document Format (PDF) Creation Best Practices for Portable Document Format (PDF) Creation Print page Print page Email page Email page Best Practices for Portable Document Format (PDF) Creation October 2013 The Office of Scientific and Technical Information (OSTI) is responsible for permanently storing the Department of Energy's (DOE) scientific and technical information (STI) collection. The STI must be collected in a digital format that can be preserved and accessible for years to come. In the late 1990's, OSTI selected the Portable Document Format (PDF) as the preferred format for receiving STI. OSTI continues to use this format for the submission and storage of STI documents. Preservation, content, and accessibility are enhanced by following these best practices for generating


Formation Micro-Imager Logs (FMI) | Open Energy Information  

Open Energy Info (EERE)

Formation Micro-Imager Logs (FMI) Formation Micro-Imager Logs (FMI) Jump to: navigation, search OpenEI Reference LibraryAdd to library Web Site: Formation Micro-Imager Logs (FMI) Author Shakeel Ahmed Published Publisher Not Provided, 2013 DOI Not Provided Check for DOI availability: http://crossref.org Online Internet link for Formation Micro-Imager Logs (FMI) Citation Shakeel Ahmed. Formation Micro-Imager Logs (FMI) [Internet]. 2013. [cited 2013/10/09]. Available from: http://petphy.blogspot.com/2011/12/formation-micro-imager-logs-fmi.html Retrieved from "http://en.openei.org/w/index.php?title=Formation_Micro-Imager_Logs_(FMI)&oldid=687994" Categories: References Geothermal References Uncited References What links here Related changes Special pages Printable version Permanent link Browse properties


The flip-side of galaxy formation: A combined model of Galaxy Formation and Cluster Heating  

E-Print Network (OSTI)

Only ~10% of baryons in the universe are in the form of stars, yet most models of luminous structure formation have concentrated on the properties of the luminous stellar matter. In this paper we focus on the "flip side" of galaxy formation and investigate the properties of the material that is not presently locked up in galaxies. This "by-product" of galaxy formation can be observed as an X-ray emitting plasma (the intracluster medium, hereafter ICM) in groups and clusters, and we present a version of the Durham semi-analytic galaxy formation model GALFORM that allows us to investigate the properties of the ICM. As we would expect on the basis of gravitational scaling arguments, the previous model (presented in Bower et al. 2006) fails to reproduce even the most basic observed properties of the ICM; however, we present a simple modification to the model to allow for heat input into the ICM from the AGN "radio mode" feedback. This heating acts to expel gas from the X-ray luminous central regions of the host halo. With this modification, the model reproduces the observed gas mass fractions and luminosity-temperature relation of groups and clusters. Introducing the heating process into the model requires changes to a number of model parameters in order to retain a good match to the observed galaxy properties. With the revised parameters, the best fitting luminosity function is comparable to that presented in Bower et al. (2006). The new model makes a fundamental step forward, providing a unified model of galaxy and cluster ICM formation. However, the detailed comparison with the data is not completely satisfactory, and we highlight key areas for improvement.

Richard G. Bower; Ian G. McCarthy; Andrew J. Benson


Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Venture Formation | BNL Technology Commercialization and Partnerships  

NLE Websites -- All DOE Office Websites (Extended Search)

Entrepreneurs and Investors Entrepreneurs and Investors Venture Formation Resources Entrepreneurship Resource Center - Entrepreneurship.org was created by the Ewing Marion Kauffman Foundation as a free, online international resource with a vast array of content designed to assist entrepreneurs, business mentors, policy makers, academics and investors through each phase of the entrepreneurial process. U.S. Small Business Administration - The U.S. Small Business Administration (SBA) is a federally funded organization developed to aid, counsel, assist and protect the interests of small business concerns and new ventures in the United States. Wall Street Journal Entrepreneur Resource - An online how to guide for small businesses and start ups with tips from The Wall Street Journal's reporters and columnists.


The Fluid Mechanics of Gravitational Structure Formation  

E-Print Network (OSTI)

The standard model for gravitational structure formation in astrophysics, astronomy, and cosmology is questioned. Cold dark matter (CDM) hierarchical clustering cosmology neglects particle collisions, viscosity, turbulence and diffusion and makes predictions in conflict with observations. From Jeans 1902 and CDMHC, the non-baryonic dark matter NBDM forms small clumps during the plasma epoch after the big bang that ``cluster'' into larger clumps. CDM halo clusters collect the baryonic matter (H and He) by gravity so that after 300 Myr of ``dark ages'', huge, explosive (Population III) first stars appear, and then galaxies and galaxy clusters. Contrary to CDMHC cosmology, ``hydro-gravitational-dynamics'' HGD cosmology suggests the diffusive NBDM material cannot clump and the clumps cannot cluster. From HGD, the big bang results from an exothermic turbulent instability at Planck scales (10^{-35} m). Turbulent stresses cause an inflation of space and fossil density turbulence remnants that trigger gravitational i...

Gibson, C H



Orbital entanglement in bond-formation processes  

E-Print Network (OSTI)

The accurate calculation of the (differential) correlation energy is central to the quantum chemical description of bond-formation and bond-dissociation processes. In order to estimate the quality of single- and multi-reference approaches for this purpose, various diagnostic tools have been developed. In this work, we elaborate on our previous observation [J. Phys. Chem. Lett. 3, 3129 (2012)] that one- and two-orbital-based entanglement measures provide quantitative means for the assessment and classification of electron correlation effects among molecular orbitals. The dissociation behavior of some prototypical diatomic molecules features all types of correlation effects relevant for chemical bonding. We demonstrate that our entanglement analysis is convenient to dissect these electron correlation effects and to provide a conceptual understanding of bond-forming and bond-breaking processes from the point of view of quantum information theory.

Boguslawski, Katharina; Barcza, Gergely; Legeza, Ors; Reiher, Markus



Star-Formation Knots in IRAS Galaxies  

E-Print Network (OSTI)

Images of IRAS galaxies with a range of IR properties are examined for bright knots, both within and outside the galaxy. These are found almost exclusively in galaxies with steep IR spectra, but over a wide range of IR luminosity, and usually without strong nuclear activity. In most cases, the knots are likely to be star-formation induced by tidal interactions, and are seen in the early stages of such interactions. Detailed photometry is presented of knots in six representative galaxies. The knots appear to have a wide range of colour and luminosity, but it is argued that many are heavily reddened. Knots formed outside the parent galaxy may be a new generation of what later become globular clusters, but they appear to have a wide range of luminosities.

J. B. Hutchings



Interstellar MHD Turbulence and Star Formation  

E-Print Network (OSTI)

This chapter reviews the nature of turbulence in the Galactic interstellar medium (ISM) and its connections to the star formation (SF) process. The ISM is turbulent, magnetized, self-gravitating, and is subject to heating and cooling processes that control its thermodynamic behavior. The turbulence in the warm and hot ionized components of the ISM appears to be trans- or subsonic, and thus to behave nearly incompressibly. However, the neutral warm and cold components are highly compressible, as a consequence of both thermal instability in the atomic gas and of moderately-to-strongly supersonic motions in the roughly isothermal cold atomic and molecular components. Within this context, we discuss: i) the production and statistical distribution of turbulent density fluctuations in both isothermal and polytropic media; ii) the nature of the clumps produced by thermal instability, noting that, contrary to classical ideas, they in general accrete mass from their environment; iii) the density-magnetic field correla...

Vazquez-Semadeni, Enrique



Mental Representations Formed From Educational Website Formats  

Science Conference Proceedings (OSTI)

The increasing popularity of web-based distance education places high demand on distance educators to format web pages to facilitate learning. However, limited guidelines exist regarding appropriate writing styles for web-based distance education. This study investigated the effect of four different writing styles on readers mental representation of hypertext. Participants studied hypertext written in one of four web-writing styles (e.g., concise, scannable, objective, and combined) and were then administered a cued association task intended to measure their mental representations of the hypertext. It is hypothesized that the scannable and combined styles will bias readers to scan rather than elaborately read, which may result in less dense mental representations (as identified through Pathfinder analysis) relative to the objective and concise writing styles. Further, the use of more descriptors in the objective writing style will lead to better integration of ideas and more dense mental representations than the concise writing style.

Elizabeth T. Cady; Kimberly R. Raddatz; Tuan Q. Tran; Bernardo de la Garza; Peter D. Elgin



The Formation of Pluto's Low Mass Satellites  

E-Print Network (OSTI)

Motivated by the New Horizons mission, we consider how Pluto's small satellites -- currently P5, Nix, P4, and Hydra -- grow in debris from the giant impact that forms the Pluto-Charon binary or in solid material captured from the protoplanetary debris disk. If the satellites have masses close to their minimum masses, our analysis suggests that capture of material into a circumplanetary or circumbinary debris disk is a viable mechanism for satellite formation. If the satellites are more massive, they probably form in debris from the giant impact. After the impact, Pluto and Charon accrete some of the debris and eject the rest from the binary orbit. During the ejection, high velocity collisions among debris particles produce a collisional cascade, leading to the ejection of some debris from the system and enabling the remaining debris particles to find stable orbits around the binary. Our numerical simulations of viscous diffusion, coagulation, and migration show that collisional evolution within a ring or disk...

Kenyon, Scott J



Lyman-alpha Emission from Structure Formation  

E-Print Network (OSTI)

The nature of the interaction between galaxies and the intergalactic medium (IGM) is one of the most fundamental problems in astrophysics. The accretion of gas onto galaxies provides fuel for star formation, while galactic winds transform the nearby IGM in a number of ways. One exciting technique to study this gas is through the imaging of hydrogen Lyman-alpha emission. We use cosmological simulations to study the Lyman-alpha signals expected from the growth of cosmic structure from z=0-5. We show that if dust absorption is negligible, recombinations following the absorption of stellar ionizing photons dominate the total Lyman-alpha photon production rate. However, galaxies are also surrounded by "Lyman-alpha coronae" of diffuse IGM gas. These coronae are composed of a combination of accreting gas and material ejected from the central galaxy by winds. The Lyman-alpha emission from this phase is powered by a combination of gravitational processes and the photoionizing background. While the former dominates at z~0, collisional excitation following photo-heating may well dominate the total emission at higher redshifts. The central regions of these systems are dense enough to shield themselves from the metagalactic ionizing background; unfortunately, in this regime our simulations are no longer reliable. We therefore consider several scenarios for the emission from the central cores, including one in which self-shielded gas does not emit at all. We show that the combination of star formation and cooling IGM gas can explain most of the observed "Lyman-alpha blobs" at z~3, with the important exception of the largest sources. On the other hand, except under the most optimistic assumptions, cooling IGM gas cannot explain the observations on its own.

Steven Furlanetto; Joop Schaye; Volker Springel; Lars Hernquist



Hierarchical Structure Formation and Modes of Star Formation in Hickson Compact Group 31  

E-Print Network (OSTI)

The handful of low-mass, late-type galaxies that comprise Hickson Compact Group 31 is in the midst of complex, ongoing gravitational interactions, evocative of the process of hierarchical structure formation at higher redshifts. With sensitive, multicolor Hubble Space Telescope imaging, we characterize the large population of <10 Myr old star clusters that suffuse the system. From the colors and luminosities of the young star clusters, we find that the galaxies in HCG 31 follow the same universal scaling relations as actively star-forming galaxies in the local Universe despite the unusual compact group environment. Furthermore, the specific frequency of the globular cluster system is consistent with the low end of galaxies of comparable masses locally. This, combined with the large mass of neutral hydrogen and tight constraints on the amount of intragroup light, indicate that the group is undergoing its first epoch of interaction-induced star formation. In both the main galaxies and the tidal-dwarf candida...

Gallagher, S C; Elmegreen, D M; Chandar, R; English, J; Charlton, J C; Gronwall, C; Young, J; Tzanavaris, P; Johnson, K E; de Oliveira, C Mendes; Whitmore, B; Hornschemeier, A E; Maybhate, A; Zabludoff, Ann




SciTech Connect

We use deep Hubble Space Telescope Advanced Camera for Surveys/High Resolution Channel observations of a field within M32 (F1) and an M31 background field (F2) to determine the star formation history (SFH) of M32 from its resolved stellar population. We find that 2-5 Gyr old stars contribute {approx}40% {+-} 17% of M32's mass, while {approx}55% {+-} 21% of M32's mass comes from stars older than 5 Gyr. The mass-weighted mean age and metallicity of M32 at F1 are (Age) = 6.8 {+-} 1.5 Gyr and ([M/H]) = -0.01 {+-} 0.08 dex. The SFH additionally indicates the presence of young (<2 Gyr old), metal-poor ([M/H] {approx} -0.7) stars, suggesting that blue straggler stars contribute {approx}2% of the mass at F1; the remaining {approx}3% of the mass is in young metal-rich stars. Line-strength indices computed from the SFH imply a light-weighted mean age and metallicity of 4.9 Gyr and [M/H] = -0.12 dex, and single stellar population-equivalent parameters of 2.9 {+-} 0.2 Gyr and [M/H] = 0.02 {+-} 0.01 dex at F1 ({approx}2.7 r{sub e} ). This contradicts spectroscopic studies that show a steep age gradient from M32's center to 1 r{sub e} . The inferred SFH of the M31 background field F2 reveals that the majority of its stars are old, with {approx}95% of its mass already acquired 5-14 Gyr ago. It is composed of two dominant populations; {approx}30% {+-} 7.5% of its mass is in a 5-8 Gyr old population, and {approx}65% {+-} 9% of the mass is in an 8-14 Gyr old population. The mass-weighted mean age and metallicity of F2 are (Age) = 9.2 {+-} 1.2 Gyr and ([M/H]) = -0.10 {+-} 0.10 dex, respectively. Our results suggest that the inner disk and spheroid populations of M31 are indistinguishable from those of the outer disk and spheroid. Assuming the mean age of M31's disk at F2 ({approx}1 disk scale length) to be {approx}5-9 Gyr, our results agree with an inside-out disk formation scenario for M31's disk.

Monachesi, Antonela; Trager, Scott C. [Kapteyn Astronomical Institute, P.O. Box 800, 9700 AV Groningen (Netherlands); Lauer, Tod R.; Mighell, Kenneth J. [National Optical Astronomy Observatory, P.O. Box 26732, Tucson, AZ 85726 (United States); Hidalgo, Sebastian L. [Instituto de Astrofisica de Canarias, Via Lactea s/n, E-38200 La Laguna, Tenerife (Spain); Freedman, Wendy; Dressler, Alan [The Observatories of the Carnegie Institution of Washington, 813 Santa Barbara Street, Pasadena, CA 91101 (United States); Grillmair, Carl, E-mail: antonela@umich.edu [Spitzer Science Center, 1200 East California Boulevard, Pasadena, CA 91125 (United States)




Science Conference Proceedings (OSTI)

The principal objective of the study was to test a new analytical technique, Solid-Phase Microextraction (SPME), for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. This involved measuring the effectiveness of SPME to extract hydrocarbons under controlled conditions in the laboratory. As part of the study, a field demonstration was undertaken to assess the validity and usefulness of the laboratory results. Presented in this quarterly report is the condensed version of the Case History and Well Summary for the Bear Lake area in Manistee County, Michigan. The full version will be in the annual report. The condensed case history presents the important technical details regarding the geochemistry and horizontal lateral for Bear Lake, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan




SciTech Connect

The fault study continues to find more faults and develop new techniques to visualize them. Data from the Dundee Formation has been used to document 11 major faults in the Michigan Basin which have now been verified using data from other horizons. These faults control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new GC laboratory is now functional and has been fully staffed as of December. The annual project review was held March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer. A request was made to extend the scope of the project to include the Willison Basin. A demonstration well has been suggested in Burke County, N. Dakota, following a review of 2D seismic and surface geochem. A 3D seismic survey is scheduled for the prospect.

James R. Wood; T.J. Bornhorst; William B. Harrison; W. Quinlan




SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, a field demonstration was undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a strong anomaly in the Myrtle Beach area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the 3D seismic data. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling. Presented in this quarterly report is the Case History and Well Summary for the Myrtle Beach area in Burke County, North Dakota. This case history presents the important technical details regarding the geochemistry and the two vertical wells that are part of this field demonstration, and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and is being used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan



Recovery of bypassed oil in the Dundee Formation (Devonian) of the Michigan Basin using horizontal drains. Final report, April 28, 1994--December 31, 1997  

SciTech Connect

Total hydrocarbon production in the Michigan Basin has surpassed 1 billion barrels (Bbbls) and total unrecovered reserves are estimated at 1--2 BBbls. However, hydrocarbon production in Michigan has fallen from 35 MMbbls/yr in 1979 to about 10 MMbbls/yr in 1996. In an effort to slow this decline, a field demonstration project designed around using a horizontal well to recover bypassed oil was designed and carried out at Crystal Field in Montcalm County, MI. The project had two goals: to test the viability of using horizontal wells to recover bypassed oil from the Dundee Formation, and to characterize additional Dundee reservoirs (29) that are look alikes to the Crystal Field. As much as 85 percent of the oil known to exist in the Dundee Formation in the Michigan Basin remains in the ground as bypassed oil. Early production techniques in the 137 fields were poor, and the Dundee was at risk of being abandoned, leaving millions of barrels of oil behind. Crystal Field in Montcalm County, Michigan is a good example of a worn out field. Crystal Field was once a prolific producer which had been reduced to a handful of wells, the best of which produced only 5 barrels per day. The demonstration well drilled as a result of this project, however, has brought new life to the Crystal Field. Horizontal drilling is one of the most promising technologies available for oil production. The new well was completed successfully in October of 1995 and has been producing 100 barrels of oil per day, 20 times better than the best conventional well in the field.

Wood, J.R.; Pennington, W.D.



Estimation of static formation temperatures in geothermal wells | Open  

Open Energy Info (EERE)

Estimation of static formation temperatures in geothermal wells Estimation of static formation temperatures in geothermal wells Jump to: navigation, search OpenEI Reference LibraryAdd to library Journal Article: Estimation of static formation temperatures in geothermal wells Abstract Stabilized formation temperatures were estimated at different depths in 40 wells from the Los Humeros geothermal field, Mexico, using the Horner and the spherical radial flow (SRF) methods. The results showed that the Horner method underestimates formation temperatures, while the SRF method gives temperatures that are closer to the true formation temperatures. This was supported by numerical simulation of a combined circulation and shut-in period in several wells, and results for well H-26 are presented. Numerical reproduction of logged temperature is more feasible if an initial


Cogeneration systems and processes for treating hydrocarbon containing formations  

Science Conference Proceedings (OSTI)

A system for treating a hydrocarbon containing formation includes a steam and electricity cogeneration facility. At least one injection well is located in a first portion of the formation. The injection well provides steam from the steam and electricity cogeneration facility to the first portion of the formation. At least one production well is located in the first portion of the formation. The production well in the first portion produces first hydrocarbons. At least one electrical heater is located in a second portion of the formation. At least one of the electrical heaters is powered by electricity from the steam and electricity cogeneration facility. At least one production well is located in the second portion of the formation. The production well in the second portion produces second hydrocarbons. The steam and electricity cogeneration facility uses the first hydrocarbons and/or the second hydrocarbons to generate electricity.

Vinegar, Harold J. (Bellaire, TX); Fowler, Thomas David (Houston, TX); Karanikas, John Michael (Houston, TX)




Science Conference Proceedings (OSTI)

Observationally confirming spatial homogeneity on sufficiently large cosmological scales is of importance to test one of the underpinning assumptions of cosmology, and is also imperative for correctly interpreting dark energy. A challenging aspect of this is that homogeneity must be probed inside our past light cone, while observations take place on the light cone. The star formation history (SFH) in the galaxy fossil record provides a novel way to do this. We calculate the SFH of stacked luminous red galaxy (LRG) spectra obtained from the Sloan Digital Sky Survey. We divide the LRG sample into 12 equal-area contiguous sky patches and 10 redshift slices (0.2 < z < 0.5), which correspond to 120 blocks of volume {approx}0.04 Gpc{sup 3}. Using the SFH in a time period that samples the history of the universe between look-back times 11.5 and 13.4 Gyr as a proxy for homogeneity, we calculate the posterior distribution for the excess large-scale variance due to inhomogeneity, and find that the most likely solution is no extra variance at all. At 95% credibility, there is no evidence of deviations larger than 5.8%.

Hoyle, Ben; Jimenez, Raul [Institut de Ciences del Cosmos (ICC), Universitat de Barcelona (IEEC-UB), Marti i Franques 1, E-08024 Barcelona (Spain); Tojeiro, Rita; Maartens, Roy [Institute of Cosmology and Gravitation, University of Portsmouth, Dennis Sciama Building, Portsmouth PO1 3FX (United Kingdom); Heavens, Alan [Imperial Centre for Inference and Cosmology, Astrophysics Group, Imperial College London, Blackett Laboratory, Prince Consort Road, London SW7 2AZ (United Kingdom); Clarkson, Chris [Astrophysics, Cosmology and Gravity Centre, and Department of Mathematics and Applied Mathematics, University of Cape Town, Rondebosch 7701 (South Africa)



Surface coating for prevention of crust formation  

DOE Patents (OSTI)

A flexible surface coating which promotes the removal of deposits as they reach the surface by preventing adhesion and crust formation. Flexible layers are attached to each side of a flexible mesh substrate comprising of a plurality of zones composed of one or more neighboring cells, each zone having a different compressibility than its adjacent zones. The substrate is composed of a mesh made of strands and open cells. The cells may be filled with foam. Studs or bearings may also be positioned in the cells to increase the variation in compressibility and thus the degree of flexing of the coating. Surface loading produces varying amounts of compression from point to point causing the coating to flex as deposits reach it, breaking up any hardening deposits before a continuous crust forms. Preferably one or more additional layers are also used, such as an outer layer of a non-stick material such as TEFLON, which may be pigmented, and an inner, adhesive layer to facilitate applying the coating to a surface.

Kronberg, James W. (Aiken, SC)



Molecular cloud regulated star formation in galaxies  

E-Print Network (OSTI)

We describe a numerical implementation of star formation in disk galaxies, in which the conversion of cooling gas to stars in the multiphase interstellar medium is governed by the rate at which molecular clouds are formed and destroyed. In the model, clouds form from thermally unstable ambient gas and get destroyed by feedback from massive stars and thermal conduction. Feedback in the ambient phase cycles gas into a hot galactic fountain or wind. We model the ambient gas hydrodynamically using smoothed particle hydrodynamics (SPH). However, we cannot resolve the Jeans mass in the cold and dense molecular gas and, therefore, represent the cloud phase with ballistic particles that coagulate when colliding. We show that this naturally produces a multiphase medium with cold clouds, a warm disk, hot supernova bubbles and a hot, tenuous halo. Our implementation of this model is based on the Gadget N-Body code. We illustrate the model by evolving an isolated Milky Way-like galaxy and study the properties of a disk formed in a rotating spherical collapse. Many observed properties of disk galaxies are reproduced well, including the molecular cloud mass spectrum, the molecular fraction as a function of radius, the Schmidt law, the stellar density profile and the appearance of a galactic fountain.

C. M. Booth; T. Theuns; T. Okamoto



Lyman-alpha Emission from Structure Formation  

E-Print Network (OSTI)

The nature of the interaction between galaxies and the intergalactic medium (IGM) is one of the most fundamental problems in astrophysics. The accretion of gas onto galaxies provides fuel for star formation, while galactic winds transform the nearby IGM in a number of ways. One exciting technique to study this gas is through the imaging of hydrogen Lyman-alpha emission. We use cosmological simulations to study the Lyman-alpha signals expected from the growth of cosmic structure from z=0-5. We show that if dust absorption is negligible, recombinations following the absorption of stellar ionizing photons dominate the total Lyman-alpha photon production rate. However, galaxies are also surrounded by "Lyman-alpha coronae" of diffuse IGM gas. These coronae are composed of a combination of accreting gas and material ejected from the central galaxy by winds. The Lyman-alpha emission from this phase is powered by a combination of gravitational processes and the photoionizing background. While the former dominates at ...

Furlanetto, S; Springel, V; Hernquist, L; Furlanetto, Steven; Schaye, Joop; Springel, Volker; Hernquist, Lars


Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Constructing Hydraulic Barriers in Deep Geologic Formations  

Science Conference Proceedings (OSTI)

Many construction methods have been developed to create hydraulic barriers to depths of 30 to 50 meters, but few have been proposed for depths on the order of 500 meters. For these deep hydraulic barriers, most methods are potentially feasible for soil but not for hard rock. In the course of researching methods of isolating large subterranean blocks of oil shale, the authors have developed a wax thermal permeation method for constructing hydraulic barriers in rock to depths of over 500 meters in competent or even fractured rock as well as soil. The technology is similar to freeze wall methods, but produces a permanent barrier; and is potentially applicable in both dry and water saturated formations. Like freeze wall barriers, the wax thermal permeation method utilizes a large number of vertical or horizontal boreholes around the perimeter to be contained. However, instead of cooling the boreholes, they are heated. After heating these boreholes, a specially formulated molten wax based grout is pumped into the boreholes where it seals fractures and also permeates radially outward to form a series of columns of wax-impregnated rock. Rows of overlapping columns can then form a durable hydraulic barrier. These barriers can also be angled above a geologic repository to help prevent influx of water due to atypical rainfall events. Applications of the technique to constructing containment structures around existing shallow waste burial sites and water shutoff for mining are also described. (authors)

Carter, E.E.; Carter, P.E. [Technologies Co, Texas (United States); Cooper, D.C. [Ph.D. Idaho National Laboratory, Idaho Falls, ID (United States)



Irregular spacing of heat sources for treating hydrocarbon containing formations  

SciTech Connect

A method for treating a hydrocarbon containing formation includes providing heat input to a first section of the formation from one or more heat sources located in the first section. Fluids are produced from the first section through a production well located at or near the center of the first section. The heat sources are configured such that the average heat input per volume of formation in the first section increases with distance from the production well.

Miller, David Scott (Katy, TX); Uwechue, Uzo Philip (Houston, TX)



Positronium formation in positron-hydrogen collisions with Debye potentials  

SciTech Connect

Positronium (Ps) formation cross sections (n = 1, 2) in positron-hydrogen collisions in Debye plasma environment are calculated using the screening approximation model for various Debye screening lengths from the Ps formation thresholds to 50 eV. The effect of the screened Coulomb potential on Ps formation process is investigated by using the Debye-Hueckel potential. The present results are compared with available theoretical calculations.

Ma, J.; Cheng, Y.; Wang, Y. C.; Zhou, Y. [Center for Theoretical Atomic and Molecular Physics, Academy of Fundamental and Interdisciplinary Sciences, Harbin Institute of Technology, Harbin 150080 (China)



Engineering Escherichia coli to Control Biofilm Formation, Dispersal, and Persister Cell Formation  

E-Print Network (OSTI)

Biofilms are formed in aquatic environments by the attachment of bacteria to submerged surfaces, to the air/liquid interface, and to each other. Although biofilms are associated with disease and biofouling, the robust nature of biofilms; for example, their ability to tolerate chemical and physical stresses, makes them attractive for beneficial biotechnology applications such as bioremediation and biofuels. Based on an understanding of diverse signals and regulatory networks during biofilm development, biofilms can be engineered for these applications by manipulating extracellular/intercellular signals and regulators. Here, we rewired the global regulator H-NS of Escherichia coli to control biofilm formation using random protein engineering. H-NS variant K57N was obtained that reduces biofilm formation 10-fold compared with wild-type H-NS (wild-type H-NS increases biofilm formation whereas H-NS K57N reduces it) via its interaction with the nucleoid-associated proteins Cnu and StpA. H-NS K57N leads to enhanced excision of the defective prophage Rac and results in cell lysis through the activation of a host killing toxin HokD. We also engineered another global regulator, Hha, which interacts with H-NS, to disperse biofilms. Hha variant Hha13D6 was obtained that causes nearly complete biofilm dispersal by increasing cell death by the activation of proteases. Bacterial quorum sensing (QS) systems are important components of a wide variety of engineered biological devices, since autoinducers are useful as input signals because they are small, diffuse freely in aqueous media, and are easily taken up by cells. To demonstrate that biofilms may be controlled for biotechnological applications such as biorefineries, we constructed a synthetic biofilm engineering circuit to manipulate biofilm formation. By using a population-driven QS switch based on the LasI/LasR system and biofilm dispersal proteins Hha13D6 and BdcAE50Q (disperses biofilms by titrating cyclic diguanylate), we displaced an existing biofilm and then removed the second biofilm. Persisters are a subpopulation of metabolically-dormant cells in biofilms that are resistant to antibiotics; hence, understanding persister cell formation is important for controlling bacterial infections. Here, we engineered toxin MqsR with greater toxicity and demonstrated that the more toxic MqsR increases persistence by decreasing the ability of the cell to respond to antibiotic stress through its RpoS-based regulation of acid resistance, multidrug resistance, and osmotic resistance systems.

Hong, Seok Hoon



Formation and Incorporation Energies of Fission Gases He, Xe, and ...  

Science Conference Proceedings (OSTI)

Presentation Title, Formation and Incorporation Energies of Fission Gases He, Xe , ... nuclear fuels are bcc alloys of uranium that swell under fission conditions,...


Influence of Feeding Flow and Shrinkage Pipe Formation on ...  

Science Conference Proceedings (OSTI)

Presentation Title, Influence of Feeding Flow and Shrinkage Pipe Formation on ... CFDBased Modelling on Interfacial Heat Transfer for Water Quenching.


Microsoft Word - Tab 2d - Project Descriptions Press Format ...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Project Descriptions Press Format - SAI TPPs - Final.doc More Documents & Publications Solar America Initiative Low Cost High Concentration PV Systems for Utility Power Generation...


Study of the Use of Saline Formations for Combined Thermoelectric...  

NLE Websites -- All DOE Office Websites (Extended Search)

Study of the Use of Saline Formations for Combined Thermoelectric Power Plant Water Needs and Carbon Sequestration at a Regional-Scale Background Thermoelectric power plants are...


Nanostructure Formation and Carbides Dissolution in Rail Steel ...  

Science Conference Proceedings (OSTI)

Feb 1, 2002 ... Nanostructure Formation and Carbides Dissolution in Rail Steel Deformed by High Pressure Torsion by Yu.V. Ivanisenko, R.Z. Valiev,...


Recovery Act: Site Characterization of Promising Geologic Formations...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Recovery Act: Site Characterization of Promising Geologic Formations for CO2 Storage A Report on the The Department of Energy's (DOE's) Carbon Sequestration Program within the...


Resource Recovery of Coal Bed Methane Formation Water.  

E-Print Network (OSTI)

??During the excavation of natural gas, petroleum hydrocarbon-polluted brine water, termed production water, is drawn from the coal bed methane formations (CBMF) along with the (more)

Bishop, Catherine Elizabeth



Influence of Substrate Temperature and RF Power on the Formation ...  

Science Conference Proceedings (OSTI)

Presentation Title, Influence of Substrate Temperature and RF Power on the Formation of ZnO Nanorods for Solar Driven Hydrogen Production. Author(s)...



SciTech Connect

The geochemical sampling team collected additional 148 samples at Vernon Field along 5 new traverses. Most of the locations were sampled for three types of analyses: microbial, iodine and enzyme leach; no results from the second batch of samples were available in time for this report. In addition to the sampling, a study was begun on the feasibility of collecting and analyzing hydrocarbon gases (C1-C8) directly. Although several companies offer these services, the cost ($200-300/sample w/o sampling fee) is high, on par with the cost of a 3D seismic survey, and may not include the raw data. However direct sampling of reservoir gases collecting in the soil appear to offer the best approach and should be included in this study. It would probably work well at Vernon Field. It may be possible to lower costs considerably; initial estimates of $20/sample for GCMS (Gas Chromatography--mass spectrometry) analysis are attractive and might induce to Michigan producers to include soil surveys in their routine field work-ups. A complete set of digital data was assembled for Vernon Field and nearby locations. The set consists of well locations, formation top picks, lithologies and scanned images of driller's reports and scout tickets. Well logs are still being located. The annual meeting for the Class Revisit work group is tentatively scheduled for the week of March 1-7 in Tampa, Fl. By that time all of the geochemical data will be available and final decisions regarding drilling can be made.

James R. Wood; T.J. Bornhorst; S.D. Chittichk; William B. Harrison; W. Quinlan



Status and outlook for shale gas and tight oil development in the U.S.  

Gasoline and Diesel Fuel Update (EIA)

Joint Forum on US Shale Gas & Pacific Gas Markets Joint Forum on US Shale Gas & Pacific Gas Markets May 14, 2013 | New York, NY By Adam Sieminski, Administrator U.S. Shale Gas 2 Adam Sieminski , May 14, 2013 Domestic production of shale gas has grown dramatically over the past few years Adam Sieminski , May 14, 2013 3 0 5 10 15 20 25 30 2000 2002 2004 2006 2008 2010 2012 Rest of US Marcellus (PA and WV) Haynesville (LA and TX) Eagle Ford (TX) Bakken (ND) Woodford (OK) Fayetteville (AR) Barnett (TX) Antrim (MI, IN, and OH) shale gas production (dry) billion cubic feet per day Sources: LCI Energy Insight gross withdrawal estimates as of March 2013 and converted to dry production estimates with EIA-calculated average gross-to-dry shrinkage factors by state and/or shale play. Shale gas leads growth in total gas production through 2040 to


Non-Standard Structure Formation Scenarios  

E-Print Network (OSTI)

Observations on galactic scales seem to be in contradiction with recent high resolution N-body simulations. This so-called cold dark matter (CDM) crisis has been addressed in several ways, ranging from a change in fundamental physics by introducing self-interacting cold dark matter particles to a tuning of complex astrophysical processes such as global and/or local feedback. All these efforts attempt to soften density profiles and reduce the abundance of satellites in simulated galaxy halos. In this contribution we are exploring the differences between a Warm Dark Matter model and a CDM model where the power on a certain scale is reduced by introducing a narrow negative feature (''dip''). This dip is placed in a way so as to mimic the loss of power in the WDM model: both models have the same integrated power out to the scale where the power of the Dip model rises to the level of the unperturbed CDM spectrum again. Using N-body simulations we show that that the new Dip model appears to be a viable alternative to WDM while being based on different physics: where WDM requires the introduction of a new particle species the Dip stems from a non-standard inflationary period. If we are looking for an alternative to the currently challenged standard LCDM structure formation scenario, neither the LWDM nor the new Dip model can be ruled out with respect to the analysis presented in this contribution. They both make very similar predictions and the degeneracy between them can only be broken with observations yet to come.

Alexander Knebe; Brett Little; Ranty Islam; Julien Devriendt; Asim Mahmood; Joe Silk



The Fluid Mechanics of Gravitational Structure Formation  

E-Print Network (OSTI)

The standard model for gravitational structure formation in astrophysics, astronomy, and cosmology is questioned. Cold dark matter (CDM) hierarchical clustering cosmology neglects particle collisions, viscosity, turbulence and diffusion and makes predictions in conflict with observations. From Jeans 1902 and CDMHC, the non-baryonic dark matter NBDM forms small clumps during the plasma epoch after the big bang that ``cluster'' into larger clumps. CDM halo clusters collect the baryonic matter (H and He) by gravity so that after 300 Myr of ``dark ages'', huge, explosive (Population III) first stars appear, and then galaxies and galaxy clusters. Contrary to CDMHC cosmology, ``hydro-gravitational-dynamics'' HGD cosmology suggests the diffusive NBDM material cannot clump and the clumps cannot cluster. From HGD, the big bang results from an exothermic turbulent instability at Planck scales (10^{-35} m). Turbulent stresses cause an inflation of space and fossil density turbulence remnants that trigger gravitational instability at protosupercluster masses (10^{46} kg) in the H-He plasma. These fragment along plasma turbulence vortex lines to form protogalaxy masses (10^{42} kg) just before the transition to gas. The gas has x10^{-13} smaller viscosity, so it fragments at planetary and globular-star-cluster masses (10^{25} and 10^{36} kg) to form the baryonic dark matter (BDM). Observations from the Hubble Space Telescope show protogalaxies (PGs) in linear clusters reflecting their likely fragmentation on plasma vortex lines. From merging BDM planets, these PGs gently form small stars in globular clusters <1 Myr after the big bang without the dark ages, superstars, or reionization of CDM cosmology.

Carl H. Gibson



Lisburne Formation fracture characterization and flow modeling  

E-Print Network (OSTI)

Evaluation of fractured reservoirs for fluid flow and optimal well placement is often very complicated. In general, fractures enhance permeability and increase access to matrix surface, but their random aspects create difficulties for analysis and performance prediction. Each reservoir has unique aspects which require individual assessment. This study examined fracture properties in a part of the Carboniferous Lisburne Formation. Field study of outcrops yielded information on two sets of large-scale fractures (NNW and ENE orientations) from the lower Wahoo Limestone in the eastern Sadlerochit Mountains. Several statistical methods were used on these data to find appropriate models describing the megafracture properties. For NNW fracture height and ENE fracture spacing, the gamma model appears to adequately describe the distribution. NNW fracture spacing and ENE fracture height are lognormally distributed. Results of the statistical analyses were used as input for fracture set generation and modeling using "FracMan". Modeling different borehole orientations in the fractured domain revealed that horizontal wells with 60? azimuth have an optimal trajectory, resulting in the maximum number and area of fracture connections. The orientation maximizing the number of fracture connections did not necessarily give the maximum area. Conductivity analysis showed that the fracture network is weakly anisotropic and above the percolation threshold. The fracture conductance is strongly dependent on the NNW fracture set; larger fractures influence fluid flow more than smaller fractures. Fracture strike and dip variability increased the system interconnectivity, but did not affect the optimal wellbore orientation. Incorporating ENE fracture termination against the NNW fractures decreased the system conductance and shifted the optimal wellbore trajectory towards the direction perpendicular to the NNW set. Reservoir engineering implications of this study include: guidelines for optimal wellbore orientations, the relative placement of injectors and producers along the bisectors between the two fracture sets, and the importance of including fracture terminations. Further work should investigate the influence of variations in fracture aperture and transmissivities, and drainage area, and extend the analysis to additional units of the Lisburne Group.

Karpov, Alexandre Valerievich



Fine ash formation during pulverized coal combustion  

Science Conference Proceedings (OSTI)

In this study, 15 pulverized coal samples were burnt in a drop-tube furnace to investigate the formation of fine particulates and the influence of coal ash properties on their emission. Coal combustion was carried out at 1673 K in air. Fine particles were collected by a cyclone and a low-pressure impactor. The elemental compositions of the collected particles were analyzed by scanning electron microscopy with energy-dispersive X-ray spectroscopy. We examined the chemical compositions of the fine particles as a function of particle diameter and examined the proportions of the elements in the parent coal samples. We determined that almost all particles less than 0.22 {mu}m in diameter were formed by means of volatilization-condensation of SiO{sub 2} and Al{sub 2}O{sub 3} in the coal. We also demonstrated that the amount of SiO{sub 2} in particle size less than 0.22 {mu}m in diameter was related to the amount of fine included quartz and clay minerals in the parent coal. The primary components of particles greater than 0.76 {mu}m in diameter were SiO{sub 2} and Al{sub 2}O{sub 3}, and as the diameter of the particles decrease, the mass fractions of iron, magnesium, calcium, and phosphorus increased. However, the particle diameter at which this tendency commenced differed depending on the element. Particles between 0.22 and 0.76 {mu}m in diameter were thought to have been formed by the fragmentation and coalescence of particles in the coal and by the simultaneous condensation of volatilized elements onto other particles. 17 refs., 12 figs., 1 tab.

Tsuyoshi Teramae; Takayuki Takarada [Idemitsu Kosan Company, Limited, Chiba (Japan). Coal and Environmental Research Laboratory



Numerical relativity and the formation of black holes  

E-Print Network (OSTI)

Numerical relativity and the formation of black holes J´er^ome Novak (Jerome in fiziko, Univerza v Ljubljani, March, 6th 2012 #12;Plan 1 Introduction 2 Core-collapse supernova 3 Black #12;Outline 1 Introduction 2 Core-collapse supernova 3 Black hole formation 4 General relativity 5

?umer, Slobodan


Methodology Formation Mitigation of Process Contaminants (3-MCPD)  

Science Conference Proceedings (OSTI)

3-MCPD (3-Monochloropropane-1,2-diol )Methodology,Formation,and Mitigation reference papers. Methodology Formation Mitigation of Process Contaminants (3-MCPD) 3-MCPD 2-diol 3-MCPD 3-MCPD Esters 3-monochloropropane-1 acid analysis aocs april articles cert

Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Mutual feedback between star formation and nuclear activity  

E-Print Network (OSTI)

In this invited contribution I review the justifications for the attempts, currently very popular, to include in semi-analytic models of galaxy formation prescriptions to describe the mutual link between the star formation and nuclear activity in galaxies, which has been for surprisingly long time neglected.

Gian Luigi Granato



Agent-Based Coalition Formation in Disaster Response Applications  

E-Print Network (OSTI)

Agent-Based Coalition Formation in Disaster Response Applications Ladislau B¨ol¨oni, Senior Member-based coalition formation ap- proach for disaster response applications. We assume that agents are operating 1. INTRODUCTION Efficient disaster response requires participants to form teams and coordinate

Bölöni, Ladislau L


Identification of stratigraphic formation interfaces using wavelet and Fourier transforms  

Science Conference Proceedings (OSTI)

The purpose of this study was to identify the formation interfaces from geophysical well log data using the wavelet transform, and a combination of the wavelet transform and the Fourier transform methods. In the wavelet transform method, the identification ... Keywords: Formation interface, Fourier transform, Geophysical well log, Stratigraphic interface, Wavelet transform

Shih-Yu Pan; Bieng-Zih Hsieh; Ming-Tar Lu; Zsay-Shing Lin



Spectroscopic Elucidation of First Steps of Supported Bimetallic Cluster Formation  

DOE Green Energy (OSTI)

Initial steps of bimetallic Ru-Os cluster formation on MgO in the presence of H{sub 2} are analyzed by EXAFS and IR spectroscopy. Ru-Os bond formation takes place after decarbonylation of Ru{sub 3} clusters and subsequently, at higher temperatures, of Os{sub 3} clusters to generate coordinative unsaturation.

Kulkarni, A.; Gates, B.C.; (UCD)



Discrete mechanics, optimal control and formation flying spacecraft  

E-Print Network (OSTI)

Discrete mechanics, optimal control and formation flying spacecraft Oliver Junge Center-Bl¨obaum partially supported by the CRC 376 Oliver Junge Discrete mechanics, optimal control and formation flying spacecraft p.1 #12;Outline mechanical optimal control problem direct discretization of the variational

Patrick, George


Quantum Imaging: Enhanced Image Formation Using Quantum States of Light  

E-Print Network (OSTI)

Quantum Imaging: Enhanced Image Formation Using Quantum States of Light Robert W. Boyd, Kam Wai, University of Rochester, Rochester, NY 14627, USA ABSTRACT We review recent research in the field of quantum imaging. Quantum imaging deals with the formation of images that possess higher resolution or better

Boyd, Robert W.


Process for the recovery of petroleum from subterranean formations  

SciTech Connect

An improved polymer flood process for the recovery of petroleum from a subterranean formation wherein a slug of a fresh water aqueous solution of a salt-insensitive polymer is injected into the formation prior to the undertaking of the polymer flood using a fresh water solution containing a partially hydrolyzed polyacrylamide.

Grodde, K.; Volz, H.



UFO (UnFold Operator) default data format  

SciTech Connect

The default format for the storage of x,y data for use with the UFO code is described. The format assumes that the data stored in a file is a matrix of values; two columns of this matrix are selected to define a function of the form y = f(x). This format is specifically designed to allow for easy importation of data obtained from other sources, or easy entry of data using a text editor, with a minimum of reformatting. This format is flexible and extensible through the use of inline directives stored in the optional header of the file. A special extension of the format implements encoded data which significantly reduces the storage required as compared wth the unencoded form. UFO supports several extensions to the file specification that implement execute-time operations, such as, transformation of the x and/or y values, selection of specific columns of the matrix for association with the x and y values, input of data directly from other formats (e.g., DAMP and PFF), and a simple type of library-structured file format. Several examples of the use of the format are given.

Kissel, L.; Biggs, F. (Sandia National Labs., Albuquerque, NM (USA)); Marking, T.R. (Applied Physics, Inc., Albuquerque, NM (USA))



Geologic Study of the Coso Formation | Open Energy Information  

Open Energy Info (EERE)

Study of the Coso Formation Study of the Coso Formation Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Report: Geologic Study of the Coso Formation Details Activities (1) Areas (1) Regions (0) Abstract: There have been great advances in the last 20 years in understanding the volcanic, structural, geophysical, and petrologic development of the Coso Range and Coso geothermal field. These studies have provided a wealth of knowledge concerning the geology of the area, including general structural characteristics and kinematic history. One element missing from this dataset was an understanding of the sedimentology and stratigraphy of well-exposed Cenozoic sedimentary strata - the Coso Formation. A detailed sedimentation and tectonics study of the Coso Formation was undertaken to provide a more complete picture of the



SciTech Connect

We present results from a systematic study of star formation in local galaxy clusters using 22 {mu}m data from the Wide-field Infrared Survey Explorer (WISE). The 69 systems in our sample are drawn from the Cluster Infall Regions Survey, and all have robust mass determinations. The all-sky WISE data enable us to quantify the amount of star formation, as traced by 22 {mu}m, as a function of radius well beyond R{sub 200}, and investigate the dependence of total star formation rate upon cluster mass. We find that the fraction of star-forming galaxies increases with cluster radius but remains below the field value even at 3R{sub 200}. We also find that there is no strong correlation between the mass-normalized total specific star formation rate and cluster mass, indicating that the mass of the host cluster does not strongly influence the total star formation rate of cluster members.

Chung, Sun Mi; Gonzalez, Anthony H. [Department of Astronomy, University of Florida, Gainesville, FL 32611-2055 (United States); Eisenhardt, Peter R.; Stern, Daniel [Jet Propulsion Laboratory, California Institute of Technology, Pasadena, CA 91109 (United States); Stanford, Spencer A. [Department of Physics, University of California, Davis, CA 95616 (United States); Brodwin, Mark [Harvard-Smithsonian Center for Astrophysics, Cambridge, MA 02138 (United States); Jarrett, Thomas, E-mail: schung@astro.ufl.edu [Infrared Processing and Analysis Center, California Institute of Technology, Pasadena, CA 91125 (United States)



Solution mining systems and methods for treating hydrocarbon containing formations  

Science Conference Proceedings (OSTI)

A method for treating an oil shale formation comprising nahcolite is disclosed. The method includes providing a first fluid to a portion of the formation through at least two injection wells. A second fluid is produced from the portion through at least one injection well until at least two injection wells are interconnected such that fluid can flow between the two injection wells. The second fluid includes at least some nahcolite dissolved in the first fluid. The first fluid is injected through one of the interconnected injection wells. The second fluid is produced from at least one of the interconnected injection wells. Heat is provided from one or more heaters to the formation to heat the formation. Hydrocarbon fluids are produced from the formation.

Vinegar, Harold J. (Bellaire, TX); de Rouffignac, Eric Pierre (Rijswijk, NL); Schoeling, Lanny Gene (Katy, TX)



Magnetic fields and radiative feedback in the star formation process  

E-Print Network (OSTI)

Star formation is a complex process involving the interplay of many physical effects, including gravity, turbulent gas dynamics, magnetic fields and radiation. Our understanding of the process has improved substantially in recent years, primarily as a result of our increased ability to incorporate the relevant physics in numerical calculations of the star formation process. In this contribution we present an overview of our recent studies of star cluster formation in turbulent, magnetised clouds using self-gravitating radiation-magnetohydrodynamics calculations (Price and Bate 2008, 2009). Our incorporation of magnetic fields and radiative transfer into the Smoothed Particle Hydrodynamics method are discussed. We highlight how magnetic fields and radiative heating of the gas around newborn stars can solve several of the key puzzles in star formation, including an explanation for why star formation is such a slow and inefficient process. However, the presence of magnetic fields at observed strengths in collaps...

Price, Daniel J



Monolithic or hierarchical star formation? A new statistical analysis  

E-Print Network (OSTI)

We consider an analytic model of cosmic star formation which incorporates supernova feedback, gas accretion and enriched outflows, reproducing the history of cosmic star formation, metallicity, supernovae type II rates and the fraction of baryons allocated to structures. We present a new statistical treatment of the available observational data on the star formation rate and metallicity that accounts for the presence of possible systematics. We then employ a Bayesian Markov Chain Monte Carlo method to compare the predictions of our model with observations and derive constraints on the 7 free parameters of the model. We find that the dust correction scheme one chooses to adopt for the star formation data is critical in determining which scenario is favoured between a hierarchical star formation model, where star formation is prolonged by accretion, infall and merging, and a monolithic scenario, where star formation is rapid and efficient. We distinguish between these modes by defining a characteristic minimum mass, M > 10^{11} M_solar, in our fiducial model, for early type galaxies where star formation occurs efficiently. Our results indicate that the hierarchical star formation model can achieve better agreement with the data, but that this requires a high efficiency of supernova-driven outflows. In a monolithic model, our analysis points to the need for a mechanism that drives metal-poor winds, perhaps in the form of supermassive black hole-induced outflows. Furthermore, the relative absence of star formation beyond z ~ 5 in the monolithic scenario requires an alternative mechanism to dwarf galaxies for reionizing the universe at z ~ 11, as required by observations of the microwave background. While the monolithic scenario is less favoured in terms of its quality-of-fit, it cannot yet be excluded.

Marios Kampakoglou; Roberto Trotta; Joe Silk




Science Conference Proceedings (OSTI)

Motivated by a new wave of kinematical tracers in the outer regions of early-type galaxies (ellipticals and lenticulars), we re-examine the role of angular momentum in galaxies of all types. We present new methods for quantifying the specific angular momentum j, focusing mainly on the more challenging case of early-type galaxies, in order to derive firm empirical relations between stellar j{sub *} and mass M{sub *} (thus extending earlier work by Fall). We carry out detailed analyses of eight galaxies with kinematical data extending as far out as 10 effective radii, and find that data at two effective radii are generally sufficient to estimate total j{sub *} reliably. Our results contravene suggestions that ellipticals could harbor large reservoirs of hidden j{sub *} in their outer regions owing to angular momentum transport in major mergers. We then carry out a comprehensive analysis of extended kinematic data from the literature for a sample of {approx}100 nearby bright galaxies of all types, placing them on a diagram of j{sub *} versus M{sub *}. The ellipticals and spirals form two parallel j{sub *}-M{sub *} tracks, with log-slopes of {approx}0.6, which for the spirals are closely related to the Tully-Fisher relation, but for the ellipticals derives from a remarkable conspiracy between masses, sizes, and rotation velocities. The ellipticals contain less angular momentum on average than spirals of equal mass, with the quantitative disparity depending on the adopted K-band stellar mass-to-light ratios of the galaxies: it is a factor of {approx}3-4 if mass-to-light ratio variations are neglected for simplicity, and {approx}7 if they are included. We decompose the spirals into disks and bulges and find that these subcomponents follow j{sub *}-M{sub *} trends similar to the overall ones for spirals and ellipticals. The lenticulars have an intermediate trend, and we propose that the morphological types of galaxies reflect disk and bulge subcomponents that follow separate, fundamental j{sub *}-M{sub *} scaling relations. This provides a physical motivation for characterizing galaxies most basically with two parameters: mass and bulge-to-disk ratio. Next, in an approach complementary to numerical simulations, we construct idealized models of angular momentum content in a cosmological context, using estimates of dark matter halo spin and mass from theoretical and empirical studies. We find that the width of the halo spin distribution cannot account for the differences between spiral and elliptical j{sub *}, but that the observations are reproduced well if these galaxies simply retained different fractions of their initial j complement ({approx}60% and {approx}10%, respectively). We consider various physical mechanisms for the simultaneous evolution of j{sub *} and M{sub *} (including outflows, stripping, collapse bias, and merging), emphasizing that the vector sum of all such processes must produce the observed j{sub *}-M{sub *} relations. We suggest that a combination of early collapse and multiple mergers (major or minor) may account naturally for the trend for ellipticals. More generally, the observed variations in angular momentum represent simple but fundamental constraints for any model of galaxy formation.

Romanowsky, Aaron J. [University of California Observatories, 1156 High Street, Santa Cruz, CA 95064 (United States); Fall, S. Michael [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States)



Modeling Molecular Hydrogen and Star Formation in Cosmological Simulations  

DOE Green Energy (OSTI)

We describe a phenomenological model for molecular hydrogen formation suited for applications in galaxy formation simulations, which includes on-equilibrium formation of molecular hydrogen on dust and approximate treatment of both its self-shielding and shielding by dust from the dissociating UV radiation. The model is applicable in simulations in which individual star forming regions--the giant molecular complexes--can be identified (resolution of tens of pc) and their mean internal density estimated reliably, even if internal structure is not resolved. In agreement with previous studies, calculations based on our model show that the transition from atomic to fully molecular phase depends primarily on the metallicity, which we assume is directly related to the dust abundance, and clumpiness of the interstellar medium. The clumpiness simply boosts the formation rate of molecular hydrogen, while dust serves both as a catalyst of molecular hydrogen formation and as an additional shielding from dissociating UV radiation. The upshot is that it is difficult to form fully-shielded giant molecular clouds while gas metallicity is low. However, once the gas is enriched to Z {approx} 0.01-0.1 solar, the subsequent star formation and enrichment can proceed at a much faster rate. This may keep star formation efficiency in the low-mass, low-metallicity progenitors of galaxies very low for a certain period of time with the effect similar to a strong 'feedback' mechanism.

Gnedin, Nickolay Y.; /Fermilab /KICP, Chicago /Chicago U., Astron. Astrophys. Ctr.; Tassis, Konstantinos; /Chicago U., Astron. Astrophys. Ctr. /KICP, Chicago; Kravtsov, Andrey V.; /KICP, Chicago /Chicago U., Astron. Astrophys. Ctr. /Chicago U., EFI




SciTech Connect

We combine new deep and wide field of view H{alpha} imaging of a sample of eight nearby (d Almost-Equal-To 17 Mpc) spiral galaxies with new and archival H I and CO imaging to study the star formation and the star formation regulation in the outer disk. We find that, in agreement with previous studies, star formation in the outer disk has low covering fractions, and star formation is typically organized into spiral arms. The star formation in the outer disk is at extremely low levels, with typical star formation rate surface densities of {approx}10{sup -5} to 10{sup -6} M{sub Sun} yr{sup -1} kpc{sup -2}. We find that the ratio of the radial extent of detected H II regions to the radius of the H I disk is typically {approx}>85%. This implies that in order to further our understanding of the implications of extended star formation, we must further our understanding of the formation of extended H I disks. We measure the gravitational stability of the gas disk, and find that the outer gaseous disk is typically a factor of {approx}2 times more stable than the inner star-forming disk. We measure the surface density of outer disk H I arms, and find that the disk is closer to gravitational instability along these arms. Therefore, it seems that spiral arms are a necessary, but not sufficient, requirement for star formation in the outer disk. We use an estimation of the flaring of the outer gas disk to illustrate the effect of flaring on the Schmidt power-law index; we find that including flaring increases the agreement between the power-law indices of the inner and outer disks.

Barnes, Kate L.; Van Zee, Liese [Department of Astronomy, Indiana University, Bloomington, IN 47405 (United States); Cote, Stephanie [Canadian Gemini Office, Herzberg Institute of Astrophysics, National Research Council of Canada, Victoria (Canada); Schade, David, E-mail: barneskl@astro.indiana.edu, E-mail: vanzee@astro.indiana.edu, E-mail: Stephanie.Cote@nrc-cnrc.gc.ca, E-mail: David.Schade@nrc-cnrc.gc.ca [Herzberg Institute of Astrophysics, National Research Council of Canada, Victoria (Canada)



into deeper and larger-volume saline formations. Researchers at  

NLE Websites -- All DOE Office Websites (Extended Search)

into deeper and larger-volume saline formations. Researchers at into deeper and larger-volume saline formations. Researchers at Cranfield have been monitoring the injected CO 2 with instrumentation installed nearly two miles beneath the surface to ensure the safe and permanent storage in the Lower Tuscaloosa Formations. The Cranfield project also has been successful in the deployment of pressure-response monitoring techniques in the injection zone ("in-zone") and above the injection zone ("above zone"). Real-time data collected since July 2008


Formation of molecular hydrogen on amorphous silicate surfaces  

E-Print Network (OSTI)

Experimental results on the formation of molecular hydrogen on amorphous silicate surfaces are presented and analyzed using a rate equation model. The energy barriers for the relevant diffusion and desorption processes are obtained. They turn out to be significantly higher than those obtained for polycrystalline silicates, demonstrating the importance of grain morphology. Using these barriers we evaluate the efficiency of molecular hydrogen formation on amorphous silicate grains under interstellar conditions. It is found that unlike polycrystalline silicates, amorphous silicate grains are efficient catalysts of H_2 formation in diffuse interstellar clouds.

Ling Li; Giulio Manico; Emanuele Congiu; Joe Roser; Sol Swords; Hagai B. Perets; Adina Lederhendler; Ofer Biham; John Robert Brucato; Valerio Pirronello; Gianfranco Vidali



Method for ion implantation induced embedded particle formation via reduction  

DOE Patents (OSTI)

A method for ion implantation induced embedded particle formation via reduction with the steps of ion implantation with an ion/element that will chemically reduce the chosen substrate material, implantation of the ion/element to a sufficient concentration and at a sufficient energy for particle formation, and control of the temperature of the substrate during implantation. A preferred embodiment includes the formation of particles which are nano-dimensional (<100 m-n in size). The phase of the particles may be affected by control of the substrate temperature during and/or after the ion implantation process.

Hampikian, Janet M (Decatur, GA); Hunt, Eden M (Atlanta, GA)



Unusual formations of the free electromagnetic field in vacuum  

E-Print Network (OSTI)

It is shown that there are exact solutions of the free Maxwell equations (FME) in vacuum allowing an existence of stable spherical formations of the free magnetic field and ring-like formations of the free electric field. It is detected that a form of these spheres and rings does not change with time in vacuum. It is shown that these convergent solutions are the result of an interference of some divergent solutions of FME. One can surmise that these electromagnetic formations correspond to Kapitsa's hypothesis about interference origin and a structure of fireball.

Andrew E. Chubykalo; Augusto Espinoza


Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Systems and methods for producing hydrocarbons from tar sands formations  

DOE Patents (OSTI)

A system for treating a tar sands formation is disclosed. A plurality of heaters are located in the formation. The heaters include at least partially horizontal heating sections at least partially in a hydrocarbon layer of the formation. The heating sections are at least partially arranged in a pattern in the hydrocarbon layer. The heaters are configured to provide heat to the hydrocarbon layer. The provided heat creates a plurality of drainage paths for mobilized fluids. At least two of the drainage paths converge. A production well is located to collect and produce mobilized fluids from at least one of the converged drainage paths in the hydrocarbon layer.

Li, Ruijian (Katy, TX); Karanikas, John Michael (Houston, TX)



Solution mining dawsonite from hydrocarbon containing formations with a chelating agent  

DOE Patents (OSTI)

A method for treating an oil shale formation comprising dawsonite includes providing heat from one or more heaters to the formation to heat the formation. Hydrocarbon fluids are produced from the formation. At least some dawsonite in the formation is decomposed with the provided heat. A chelating agent is provided to the formation to dissolve at least some dawsonite decomposition products. The dissolved dawsonite decomposition products are produced from the formation.

Vinegar, Harold J. (Bellaire, TX)



A Miocene Island-Arc Volcanic Seamount- The Takashibiyama Formation,  

Open Energy Info (EERE)

Island-Arc Volcanic Seamount- The Takashibiyama Formation, Island-Arc Volcanic Seamount- The Takashibiyama Formation, Shimane Peninsula, Sw Japan Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: A Miocene Island-Arc Volcanic Seamount- The Takashibiyama Formation, Shimane Peninsula, Sw Japan Details Activities (0) Areas (0) Regions (0) Abstract: The Miocene volcanic complex of the Takashibiyama Formation consists largely of subalkali, subaqueous basalt to andesite lavas and andesite to dacite subaqueous volcaniclastic flow deposits. Most of subaqueous lavas are moderately to intensely brecciated with rugged rough surfaces and ramp structures similar to subaerial block lava. Volcaniclastic flow deposits commonly include basalt to andesite lava fragments and/or pyroclastic materials, and are similar in internal


Jet Formation and Evolution in Baroclinic Turbulence with Simple Topography  

Science Conference Proceedings (OSTI)

Satellite altimetry and high-resolution ocean models indicate that the Southern Ocean comprises an intricate web of narrow, meandering jets that undergo spontaneous formation, merger, and splitting events, as well as rapid latitude shifts over ...

Andrew F. Thompson



Planetary formation theory developed, tested: predicts timeline for life  

NLE Websites -- All DOE Office Websites (Extended Search)

Planetary formation theory developed, tested: predicts timeline for Planetary formation theory developed, tested: predicts timeline for life After the Big Bang: Theory suggests first planets formed after first generations of stars The researchers' calculations predict properties of first planet and timeline for life. May 3, 2012 image description The researchers state that the formation of Earth-like planets is not itself a sufficient prerequisite for life. Early galaxies contained strong sources of life-threatening radiation, such as supernovae and black holes. Therefore, they conclude that the conditions for life emerged only after the earliest epoch of galaxy formation. Get Expertise Jarrett Johnson Nuclear and Particle Physics, Astrophysics and Cosmology Email Hui Li Nuclear and Particle Physics, Astrophysics and Cosmology


Band Formation in a New England Winter Storm  

Science Conference Proceedings (OSTI)

This case study addresses mechanisms of band formation in a New England winter storm. The structure of the bands and their environment are documented with synoptic observations, radar data, and analyses of instrumented aircraft flights through ...

Dawn G. Wolfsberg; Kerry A. Emanuel; Richard E. Passarelli



Characterization of SiC Nanostructure Formation and Growth Using ...  

Science Conference Proceedings (OSTI)

Previous studies showed the formation of SiC nanocones from the reaction between SiO and carbon shells with encapsulated iron at 1300C in an inert...


NDMA Formation during Chlorination and Chloramination of Aqueous Diuron Solutions  

E-Print Network (OSTI)

N D M A formation during chlorine disinfection of municipalformation by free-chlorine-enhanced nitrosation o fN D M A ) during chlorine disinfection of water containing

Young, Thomas M



Chemical and Physical Investigation of Secondary Organic Aerosol Formation  

E-Print Network (OSTI)

compounds (e.g. , 80% catechol formation from phenol, OlariuO 2 Isoprene Benzene Phenol Catechol Toluene o-/m- Cresol NObenzene, phenol, and catechol), ~0.5 for C 7 species (

Nakao, Shunsuke



Dynamics of Excimer Formation and Decay in Supercritical Krypton  

NLE Websites -- All DOE Office Websites (Extended Search)

Dynamics of Excimer Formation and Decay in Supercritical Krypton R. A. Holroyd, A. R. Cook and J. M. Preses J. Chem. Phys. 131, 224509 (2009). Find paper at Scitation Abstract:...


Multiblock grid generation for simulations in geological formations  

Science Conference Proceedings (OSTI)

Simulating fluid flow in geological formations requires mesh generation, lithology mapping to the cells, and computing geometric properties such as normal vectors and volume of cells. The purpose of this research work is to compute and process the geometrical ...

Sanjay Kumar Khattri



Formation of new materials in fullerenes by using nuclear recoil  

Science Conference Proceedings (OSTI)

The formation of Sb or Te atom-incorporated fullerenes has been investigated by using radionuclides produced by nuclear reactions. From the trace of radioactivities of 120 Sb( 122 Sb) or 121 Te after High Pressure Liquid Chromatography (HPLC)

T. Ohtsuki; K. Ohno; K. Shiga; Y. Kawazoe; Y. Maruyama; K. Shikano; K. Masumoto



Formation of radioactive fullerenes by using nuclear recoil  

Science Conference Proceedings (OSTI)

The formation of As and Se atom-incorporated fullerenes has been investigated by using radionuclides produced by nuclear reactions. From the trace of radioactivities of 72 As and 75 Se after High Pressure Liquid Chromatography (HPLC)

T. Ohtsuki; K. Ohno; K. Shiga; Y. Kawazoe; Y. Maruyama; K. Shikano; K. Masumoto



Formation and Stability of Impurity Snakes in Tokamak Plasmas  

E-Print Network (OSTI)

New observations of the formation and dynamics of long-lived impurity-induced helical snake modes in tokamak plasmas have recently been carried out on Alcator C-Mod. The snakes form as an asymmetry in the impurity ion ...

Delgado- Aparicio L., Alvaro


A Statistically Derived Prediction Procedure for Tropical Storm Formation  

Science Conference Proceedings (OSTI)

A statistical forecasting experiment was performed to test the capability of predictors derived from observational data (analysis) fields at 950, 700, 500 and 200 mb to forecast tropical storm formation (genesis). National Oceanographic and ...

Thomas J. Perrone; Paul R. Lowe



Numerical Simulations of the Formation of Hurricane Gabrielle (2001)  

Science Conference Proceedings (OSTI)

This study examines the formation of Hurricane Gabrielle (2001), focusing on whether an initial disturbance and vertical wind shear were favorable for development. This examination is performed by running numerical experiments using the fifth-...

K. D. Musgrave; C. A. Davis; M. T. Montgomery



The Formation of Concentric Vorticity Structures in Typhoons  

Science Conference Proceedings (OSTI)

An important issue in the formation of concentric eyewalls in a tropical cyclone is the development of a symmetric structure from asymmetric convection. It is proposed herein, with the aid of a nondivergent barotropic model, that concentric ...

H-C. Kuo; L-Y. Lin; C-P. Chang; R. T. Williams



The Santa Cruz Eddy. Part II: Mechanisms of Formation  

Science Conference Proceedings (OSTI)

The formation mechanism of the Santa Cruz eddy (SCE) is investigated using the fifth-generation Pennsylvania State UniversityNational Center for Atmospheric Research Mesoscale Model (MM5). Simulations of 2526 August 2000 showed that two eddy ...

Cristina L. Archer; Mark Z. Jacobson



Energetics of [alpha]-helix formation in peptides and proteins  

E-Print Network (OSTI)

This thesis focuses on the energetics of !-helix formation in peptides and proteins. The [alpha]-helix is the most prevalent type of secondary structure found in proteins, and has arguably dominated our thinking about ...

Schubert, Christian Reinhold



The Universe Adventure - Formation and Structure of the Universe  

NLE Websites -- All DOE Office Websites (Extended Search)

The Geometry of the Universe and Structure Formation BOOMERanG and the CMB CMB data collected by the balloon-based BOOMERanG and MAXIMA experiments provided crucial evidence in...

Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A Study of the Mechanisms of Acid Rain Formation  

Science Conference Proceedings (OSTI)

Samples of rain, snow, cloud water, aerosols and soil were collected in Colorado to study the mechanisms of acid rain formation. Chemical compositions of various types of samples were analyzed to investigate the stepwise incorporation of ...

Farn Parungo; Clarence Nagamoto; Robin Maddl



Water Mass Transformation and Formation in the Labrador Sea  

Science Conference Proceedings (OSTI)

Objectively analyzed surface hydrographic fields and NCEPNCAR reanalysis fluxes are used to estimate water mass transformation and formation rates in the Labrador Sea, focusing on Labrador Sea Water (LSW). The authors estimate a mean long-term ...

Paul G. Myers; Chris Donnelly



Rapid Gas Hydrate Formation Processes: Will They Work?  

SciTech Connect

Researchers at DOEs National Energy Technology Laboratory (NETL) have been investigating the formation of synthetic gas hydrates, with an emphasis on rapid and continuous hydrate formation techniques. The investigations focused on unconventional methods to reduce dissolution, induction, nucleation and crystallization times associated with natural and synthetic hydrates studies conducted in the laboratory. Numerous experiments were conducted with various high-pressure cells equipped with instrumentation to study rapid and continuous hydrate formation. The cells ranged in size from 100 mL for screening studies to proof-of-concept studies with NETLs 15-Liter Hydrate Cell. Results from this work demonstrate that the rapid and continuous formation of methane hydrate is possible at predetermined temperatures and pressures within the stability zone of a Methane Hydrate Stability Curve (see Figure 1).

Brown, T.D.; Taylor, C.E.; Bernardo, M.P.



Quasi Light Fields: A Model of Coherent Image Formation  

E-Print Network (OSTI)

We develop a model of coherent image formation that strikes a balance between the simplicity of the light field and the comprehensive predictive power of Maxwell's equations, by extending the light field to coherent radiation.

Accardi, Anthony J.


An interpretation of soliton formation and parametric instabilities. Interim report  

SciTech Connect

It is shown that soliton formation and the resulting plasma heating are nothing more than the description in configuration space of well-known parametric processes and quasilinear theory. (GRA)

Manheimer, W.M.; Papadopoulos, K.



Evaporation of Nonequilibrium Raindrops as a Fog Formation Mechanism  

Science Conference Proceedings (OSTI)

To gain insights into the poorly understood phenomenon of precipitation fog, this study assesses the evaporation of freely falling drops departing from equilibrium as a possible contributing factor to fog formation in rainy conditions. The study ...

Robert Tardif; Roy M. Rasmussen



Mutual Intrusion of a Gravity Current and Density Front Formation  

Science Conference Proceedings (OSTI)

A two-dimensional prognostic model was employed to examine the mutual intrusion of a gravity current and the formation of a density front. The results indicated strong vertical motion near the front and, with Earth rotation included, a baroclinic ...

Dono-Ping Wang



A Bayesian Forecast Model of Australian Region Tropical Cyclone Formation  

Science Conference Proceedings (OSTI)

A new and potentially skillful seasonal forecast model of tropical cyclone formation [tropical cyclogenesis (TCG)] is developed for the Australian region. The model is based on Poisson regression using the Bayesian approach. Predictor combinations ...

Angelika Werner; Neil J. Holbrook



Using auction based group formation for collaborative networking in Ubicomp  

Science Conference Proceedings (OSTI)

In many Ubicomp scenarios tiny wireless embedded sensor devices are used, and devices often collaborate to accomplish a common goal. This paper presents a group formation method designed for collaboration of devices. The paper analysis requirements for ...

Christian Decker; Emilian Peev; Till Riedel; Martin Berchtold; Michael Beigl; Daniel Roehr; Monty Beuster



Formation and Maintenance of Shelfbreak Fronts in an Unstratified Flow  

Science Conference Proceedings (OSTI)

A depth-averaged model with no density variations was used by Chapman to describe the formation of a passive tracer front at a shelfbreak. The relevance of this frontogenesis mechanism to cases that allow vertical variations is examined by ...

Glen Gawarkiewicz; David C. Chapman



Dense Water Formation beneath a Time-Dependent Coastal Polynya  

Science Conference Proceedings (OSTI)

Recent modeling studies of dense water formation beneath an idealized steady coastal polynya have provided simple analytical expressions for the maximum density anomaly achievable as a function of the polynya geometry and the imposed surface ...

David C. Chapman



NETL: News Release - DOE Targets Rural Indiana Geologic Formation...  

NLE Websites -- All DOE Office Websites (Extended Search)

Geologic Formation for CO2 Storage Field Test CO2 Injection Begins in Existing Production Well to Evaluate CO2 Storage Potential, Oil Recovery Washington, D.C. - A U.S. Department...


PQDIF (Power Quality Data Interchange Format) Application Guide  

Science Conference Proceedings (OSTI)

Over the last fifteen years, many power quality-monitoring instruments have been employed in the collection of power quality measurements from tens, hundreds, and sometimes thousands of monitoring points in transmission, distribution, and end-user systems. The reasons for monitoring vary and, consequently, so do the structure of data contained in these measurements. The IEEE Std 1159.3-2002 PQDIF (Power Quality Data Interchange Format) binary file format ?provides a compact, flexible, extensible means to...



Recipes for ULX formation: necessary ingredients and garnishments  

E-Print Network (OSTI)

I summarize the main observational features that seem to recur more frequently in the ULX population. I speculate that two of the most important physical requirements for ULX formation are low metal abundance, and clustered star formation triggered by external processes such as molecular cloud collisions. In this scenario, most ULX are formed from recent stellar processes, have BH masses < 100 Msun and do not require merger processes in super star clusters.

Roberto Soria



Recipes for ULX formation: necessary ingredients and garnishments  

E-Print Network (OSTI)

I summarize the main observational features that seem to recur more frequently in the ULX population. I speculate that two of the most important physical requirements for ULX formation are low metal abundance, and clustered star formation triggered by external processes such as molecular cloud collisions. In this scenario, most ULX are formed from recent stellar processes, have BH masses < 100 Msun and do not require merger processes in super star clusters.

Soria, R



Dynamics of precipitation pattern formation at geothermal hot springs  

E-Print Network (OSTI)

We formulate and model the dynamics of spatial patterns arising during the precipitation of calcium carbonate from a supersaturated shallow water flow. The model describes the formation of travertine deposits at geothermal hot springs and rimstone dams of calcite in caves. We find explicit solutions for travertine domes at low flow rates, identify the linear instabilities which generate dam and pond formation on sloped substrates, and present simulations of statistical landscape evolution.

Nigel Goldenfeld; Pak Yuen Chan; John Veysey



Removing of Formation Damage and Enhancement of Formation Productivity Using Environmentally Friendly Chemicals  

E-Print Network (OSTI)

Matrix acidizing is used in carbonate formations to create wormholes that connect the formation to the wellbore. Hydrochloric acid, organic acids, or mixtures of these acids are typically used in matrix acidizing treatments of carbonate reservoirs. However, the use of these acids in deep wells has some major drawbacks including high and uncontrolled reaction rate and corrosion to well tubulars, especially those made of chrome-based tubulars (Cr-13 and duplex steel), and these problems become severe at high temperatures. Hydrochloric acid (HCl) and its based fluids have a major drawback in stimulating shallow (low fracture gradient) formations as they may cause face dissolution (formation surface washout) if injected at low rates. The objective of stimulation of sandstone reservoirs is to remove the damage caused to the production zone during drilling or completion operations. Many problems may occur during sandstone acidizing with Hydrochloric/Hydrofluoric acids (HCl/HF) mud acid. Among those problems: decomposition of clays in HCl acids, precipitation of fluosilicates, the presence of carbonate can cause the precipitation of calcium fluorides, silica-gel filming, colloidal silica-gel precipitation, and mixing between various stages of the treatment. To overcome problems associated with strong acids, chelating agents were introduced and used in the field. However, major concerns with most of these chemicals are their limited dissolving power and negative environmental impact. Glutamic acid diacetic acid (GLDA) a newly developed environmentally friendly chelate was examined as stand-alone stimulation fluid in deep oil and gas wells. In this study we used GLDA to stimulate carbonate cores (calcite and dolomite). GLDA was also used to stimulate and remove the damage from different sandstone cores containing different compositions of clay minerals. Carbonate cores (calcite and dolomite) of 6 and 20 in. length and 1.5 in. diameter were used in the coreflood experiments. Coreflood experiments were run at temperatures ranging from 180 to 300oF. Ethylene diamine tetra acetic acid (EDTA), hydroxyl ethylethylene diaminetriacetic acid (HEDTA), and GLDA were used to stimulate and remove the damage from different sandstone cores at high temperatures. X-ray Computed Topography (CT) scans were used to determine the effectiveness of these fluids in stimulation calcite and dolomite cores and removing the damage from sandstone cores. The sandstone cores used in this study contain from 1 to 18 wt percent illite (swellable and migratable clay mineral). GLDA was found to be highly effective in creating wormholes over a wide range of pH (1.7-13) in calcite cores. Increasing temperature enhanced the reaction rate, more calcite was dissolved, and larger wormholes were formed for different pH with smaller volumes of GLDA solutions. GLDA has a prolonged activity and leads to a decreased surface spending resulting in face dissolution and therefore acts deeper in the formation. In addition, GLDA was very effective in creating wormholes in the dolomite core as it is a good chelate for magnesium. Coreflood experiments showed that at high pH values (pH =11) GLDA, HEDTA, and EDTA were almost the same in increasing the permeability of both Berea and Bandera sandstone cores. GLDA, HEDTA, and EDTA were compatible with Bandera sandstone cores which contains 10 wt percent Illite. The weight loss from the core was highest in case of HEDTA and lowest in case of GLDA at pH 11. At low pH values (pH =4) 0.6M GLDA performed better than 0.6M HEDTA in the coreflood experiments. The permeability ratio (final/initial) for Bandera sandstone cores was 2 in the case of GLDA and 1.2 in the case of HEDTA at pH of 4 and 300oF. At high pH HEDTA was the best chelating agent to stimulate different sandstone cores, and at low pH GLDA was the best one. For Berea sandstone cores EDTA at high pH of 11 was the best in increasing the permeability of the core at 300oF. The low pH GLDA based fluid has been especially designed for high temperature oil well stimulation i

Mahmoud, Mohamed Ahmed Nasr Eldin



Star Formation and Chemical Evolution of Lyman-Break Galaxies  

E-Print Network (OSTI)

The number density and clustering properties of Lyman-break galaxies (LBGs) observed at redshift $z\\sim 3$ are best explained by assuming that they are associated with the most massive haloes at $z\\sim 3$ predicted in hierarchical models of structure formation. In this paper we study, under the same assumption, how star formation and chemical enrichment may have proceeded in the LBG population. A consistent model, in which the amount of cold gas available for star formation must be regulated, is suggested. It is found that gas cooling in dark haloes provides a natural regulation process. In this model, the star formation rate in an LBG host halo is roughly constant over about 1 Gyr. The predicted star formation rates and effective radii are consistent with observations. The metallicity of the gas associated with an LBG is roughly equal to the chemical yield, or about the order of $1 Z_{\\odot}$ for a Salpeter IMF. The contribution to the total metals of LBGs is roughly consistent with that obtained from the observed cosmic star formation history. The model predicts a marked radial metallicity gradient in a galaxy, with the gas in the outer region having much lower metallicity. As a result, the metallicities for the damped Lyman-alpha absorption systems expected from the LBG population are low. Since LBG halos are filled with hot gas in this model, their contributions to the soft X-ray background and to the UV ionization background are calculated and discussed.

Chenggang Shu



Hybrid System Design for Formations of Autonomous Vehicles  

E-Print Network (OSTI)

Cooperative control of multiple unmanned aerial vehicles (UAVs) poses significant theoretical and technical challenges. Recent advances in sensing, communication and computation enable the conduct of cooperative multiple-UAV missions deemed impossible in the recent past. We are interested in solving the Formation Reconfiguration Planning (FRP) problem which is focused on determining a nominal state and input trajectory for each vehicle such that the group can start from the given initial configuration and reach its given final configuration at the specified time while satisfying a set of given inter- and intra- vehicle constraints. Each solution of a FRP problem represents a distinct reconfiguration mode. When coupled with formation keeping modes, they can form a hybrid automaton of formation maneuvers in which a transition from one formation maneuver to another formation maneuver is governed by a finite automaton. This paper focuses on the implementation of the optimized hybrid system approach to formation reconfiguration for a group of 1 real and 3 virtual UAVs. Experimental results performed in the Richmond Field Station by using a helicopter-based Berkeley Aerial Robot are presented. 1

Shannon Zelinski; T. John Koo; Shankar Sastry



Geology and hydrology of the Dakota formation in South Dakota  

SciTech Connect

A better understanding of the Cretaceous stratigraphy is obtained if the term Dakota is employed as used by Meek and Hayden in the type area. In this manner, the entire 400-ft section of sediments in the type area in NE. Nebraska is included in the Dakota Formation. The Dakota thins westward and is represented in the Black Hills by the newcastel tongues at the base and sporadic outcrops of the Mowry sands at the top; it includes no part of older sandstone bodies. The Inyan Kara Group which resembles the Dakota Formation and crops out in the Black Hills, is not represented either at the surface or in the subsurface at the type area of the Dakota. It is believed that the Inyan Kara Group and the Dakota Formation are separate stratigraphic and hydrologic units with distinctive water characteristics and hydraulic pressures. There are 3 distinct water types in the Dakota Formation-- sodium chloride in the W. half of the state, sodium sulfate in the E. part of the state, and a smaller area of calcium-sulfate type water in the SE. quarter of the state. The sodium-chloride water in the Dakota Formation of W. South Dakota is connate. In E. South Dakota where the Dakota yields a sodium-sulfate type water, the formation is recharged by the Roundtop-Inyan Kara interval. (63 refs.)

Schoon, R.A.


Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Formation evaluation using wavelet analysis on logs of the Chinji and Nagri Formations, northern Pakistan  

E-Print Network (OSTI)

The relatively new method of using wavelets in well log analysis is a powerful tool for defining multiple superimposed scales of lithic trends and contacts. Interpreting depositional processes associated with different scales of vertical variation within well log responses allows prediction of the lateral extent of sands and the distribution of internal flow barriers important for development of oil field recovery strategies. Wavelet analysis of grain-size variations in a 2.1 km thick fluvial section including the fluvial Chinji and Nagri Formations, northern Pakistan, revealed three major wavelengths. Reliability of the wavelength values was tested and confirmed by multiple sectioning of the dataset. These dominant wavelengths are interpreted to reflect vertical variations within individual channels, the stacking of channel belts within overbank successions due to river avulsion, and larger-scale channel stacking patterns within this foreland basin that may reflect allocyclic influences. Wavelet analysis allows quantification of the scales of periodic vertical variations that may not be strictly cyclic in nature. Comparison of total wavelet energies over all scales for each depth to the grain size and sand percentages yielded good correlations with sand proportion curves. Although changes in the wavelet energy profile were much more distinct with respect to grain size, lithic boundaries' locations were not detected based solely on the total of the wavelet energies. The data were also analyzed using Fourier transforms. Although Fourier transforms of the data yielded the smallest scale cyclicities, the higher-order cyclicities were not defined. This comparison demonstrates the power of wavelet analysis in defining types of repetitive, but not strictly cyclic, variations that are commonly observed in the sedimentary record. Assessments of Milankovitch cyclicities were performed for the Chinji and the Nagri Formations using statistical and analytical analysis methods. A clear match between Milankovitch frequency ratios and vertical lithic variations was not observed, and thus distinct climatic control on cyclic lithological trends was not demonstrated. Analysis using wavelets to determine wavelet coefficients helps quantify characteristic scales of vertical variations, cyclicities, zone thicknesses, and locations of abrupt lithic boundaries. Wavelet analysis provides methods that could be used to help automate well log analysis.

Tanyel, Emre Doruk



Horizontal oil well applications and oil recovery assessment. Volume 2: Applications overview, Final report  

Science Conference Proceedings (OSTI)

Horizontal technology has been applied in over 110 formations in the USA. Volume 1 of this study addresses the overall success of horizontal technology, especially in less-publicized formations, i.e., other than the Austin Chalk, Bakken, and Niobrara. Operators in the USA and Canada were surveyed on a formation-by-formation basis by means of a questionnaire. Response data were received describing horizontal well projects in 58 formations in the USA and 88 in Canada. Operators` responses were analyzed for trends in technical and economic success based on lithology (clastics and carbonates) and resource type (light oil, heavy oil, and gas). The potential impact of horizontal technology on reserves was also estimated. A forecast of horizontal drilling activity over the next decade was developed.

Deskins, W.G.; McDonald, W.J.; Knoll, R.G.; Springer, S.J.



The Star Formation History in a Hierarchical Universe  

E-Print Network (OSTI)

Observations now probe the star formation history of the Universe back to a redshift of $z\\sim5$. We investigate whether the predictions of semi-analytic models of galaxy formation based on hierarchical Cold Dark Matter (CDM) type models are in agreement with these direct observations and also with the ``fossil'' evidence contained in constraints on the ages of present day early-type galaxies. Previous models predicted that the star formation rate density falls off rather steeply at $z\\ga 2$, and correspondingly that the majority of the stars in the Universe formed at relatively low redshift. We investigate the effect of including a bursting mode of star formation, assuming that galaxy-galaxy mergers trigger starbursts and using the merger rate that arises naturally in the CDM merging hierarchy. The resulting starbursts substantially increase the global star formation rate at high redshift, leading to predictions that are in good agreement with the star formation rate density at $z\\sim3$ obtained from sub-millimeter observations (SCUBA) and optical/UV estimates after correction for dust extinction. The mass of stars formed at $z \\ge 3$ is correspondingly in better agreement with the fossil evidence. We also investigate complementary global quantities such as the mass of cold gas and the average metallicity of cold gas as a function of redshift, and the integrated extra-galactic background light. We argue that these observations, taken together, provide strong constraints on the star formation history of the Universe, and that hierarchical models of the CDM type are in reasonable agreement with these observations when starbursts are included.

Rachel S. Somerville; Joel R. Primack



Star Formation History and Other Properties of the Northern HDF  

E-Print Network (OSTI)

The original analysis of the star formation history in the NICMOS Deep images of the NHDF is extended to the entire NHDF utilizing NICMOS and WFPC2 archival data. The roughly constant star formation rate from redshifts 1 to 6 found in this study is consistent with the original results. Star formation rates from this study, Lyman break galaxies and sub-mm observations are now in concordance The spike of star formation at redshift 2 due to 2 ULIRGs in the small Deep NICMOS field is smoothed out in the larger area results presented here. The larger source base of this study allows comparison with predictions from hierarchical galaxy formation models. In general the observation are consistent with the predictions. The observed luminosity functions at redshifts 1-6 are presented for future comparisons with theoretical galaxy evolution calculations. Mid and far infrared properties of the sources are also calculated and compared with observations. A candidate for the VLA source VLA 3651+1221 is discussed.

Rodger I. Thompson



Molecular hydrogen regulated star formation in cosmological SPH simulations  

E-Print Network (OSTI)

It has been shown observationally that star formation (SF) correlates tightly with the presence of molecular hydrogen (H2). Therefore it would be important to investigate its implication on galaxy formation in a cosmological context. In the present work, we track the H2 mass fraction within our cosmological smoothed particle hydrodynamics (SPH) code GADGET-3 using an equilibrium analytic model by Krumholz et al. This model allows us to regulate the star formation in our simulation by the local abundance of H2 rather than the total cold gas density, and naturally introduce the dependence of star formation on metallicity. We investigate implications of the equilibrium H2-based SF model on galaxy population properties, such as the stellar-to-halo mass ratio (SHMR), baryon fraction, cosmic star formation rate density (SFRD), galaxy specific SFR, galaxy stellar mass functions (GSMF), and Kennicutt-Schmidt (KS) relationship. The advantage of our work over the previous ones is having a large sample of simulated gala...

Thompson, Robert; Jaacks, Jason; Choi, Jun-Hwan



Star Formation and Chemical Evolution of Lyman-Break Galaxies  

E-Print Network (OSTI)

The number density and clustering properties of Lyman-break galaxies (LBGs)observed at redshift $z\\sim 3$ are best explained by assuming that they areassociated with the most massive haloes at $z\\sim 3$ predicted in hierarchicalmodels of structure formation. In this paper we study, under the sameassumption, how star formation and chemical enrichment may have proceeded inthe LBG population. A consistent model, in which the amount of cold gasavailable for star formation must be regulated, is suggested. It is found thatgas cooling in dark haloes provides a natural regulation process. In thismodel, the star formation rate in an LBG host halo is roughly constant overabout 1 Gyr. The predicted star formation rates and effective radii areconsistent with observations. The metallicity of the gas associated with an LBGis roughly equal to the chemical yield, or about the order of $1 Z_{\\odot}$ fora Salpeter IMF. The contribution to the total metals of LBGs is roughlyconsistent with that obtained from the observed cosmic...

Shu, C



Chemical pathways for the formation of ammonia in Hanford wastes  

SciTech Connect

This report reviews chemical reactions leading to the formation of ammonia in Hanford wastes. The general features of the chemistry of the organic compounds in the Hanford wastes are briefly outlined. The radiolytic and thermal free radical reactions that are responsible for the initiation and propagation of the oxidative degradation reactions of the nitrogen-containing complexants, trisodium HEDTA and tetrasodium EDTA, are outlined. In addition, the roles played by three different ionic reaction pathways for the oxidation of the same compounds and their degradation products are described as a prelude to the discussion of the formation of ammonia. The reaction pathways postulated for its formation are based on tank observations, laboratory studies with simulated and actual wastes, and the review of the scientific literature. Ammonia derives from the reduction of nitrite ion (most important), from the conversion of organic nitrogen in the complexants and their degradation products, and from radiolytic reactions of nitrous oxide and nitrogen (least important). Reduction of nitrite ions is believed to be the most important source of ammonia. Whether by radiolytic or thermal routes, nitrite reduction reactions proceed through nitrogen dioxide, nitric oxide, the nitrosyl anion, and the hyponitrite anion. Nitrite ion is also converted into hydroxylamine, another important intermediate on the pathway to form ammonia. These reaction pathways additionally result in the formation of nitrous oxide and molecular nitrogen, whereas hydrogen formation is produced in a separate reaction sequence.

Stock, L.M.; Pederson, L.R.



Molecular Cloud Evolution II. From cloud formation to the early stages of star formation in decaying conditions  

E-Print Network (OSTI)

We study the formation of giant dense cloud complexes and of stars within them by means of SPH numerical simulations of the mildly supersonic collision of gas streams (``inflows'') in the warm neutral medium (WNM). The resulting compressions cause cooling and turbulence generation in the gas, forming a cloud that then becomes self-gravitating and undergoes global collapse. Simultaneously, the turbulent, nonlinear density fluctuations induce fast, local collapse events. The simulations show that: a) The clouds are not in a state of equilibrium. Instead, they undergo secular evolution. Initially, their mass and gravitational energy |Eg| increase steadily, while the turbulent energy Ek reaches a plateau. b) When |Eg| becomes comparable to Ek, global collapse begins, causing a simultaneous increase in both that maintains a near-equipartition condition |Eg| ~ 2 Ek. c) Longer inflow durations delay the onset of global and local collapse, by maintaining a higher turbulent velocity dispersion in the cloud over longer times. d) The star formation rate is large from the beginning, without any period of slow and accelerating star formation. e) The column densities of the local star-forming clumps are very similar to reported values of the column density required for molecule formation, suggesting that locally molecular gas and star formation occur nearly simultaneously. The MC formation mechanism discussed here naturally explains the apparent ``virialized'' state of MCs and the ubiquitous presence of HI halos around them. Within their assumptions, our simulations support the scenario of rapid star formation after MCs are formed, although long (>~ 15 Myr) accumulation periods do occur during which the clouds build up their gravitational energy, and which are expected to be spent in the atomic phase.

E. Vazquez-Semadeni; G. C. Gomez; A. K. Jappsen; J. Ballesteros-Paredes; R. F. Gonzalez; R. S. Klessen




E-Print Network (OSTI)

and Ambient Temperature Lithium Batteries, B. B. Owens and1 Soci ety FILM FORMATION ON LITHIUM IN PROPYLENE CARBONATECalifornia. Film Formation on Lithium 1n Propylene Carbonate

Geronov, Y.



Characteristics of Faculty Evaluation Formats for Promotion, Tenure, and Annual Review.  

E-Print Network (OSTI)

??The present study attempted to identify common and unique characteristics of faculty performance appraisal formats and procedures by analyzing characteristics of formats and procedures from (more)

Gardner, Angelette



Pseudo-lignin formation and its impact on enzymatic hydrolysis  

NLE Websites -- All DOE Office Websites (Extended Search)

formation formation and its impact on enzymatic hydrolysis Fan Hu, Seokwon Jung, Arthur Ragauskas ⇑ BioEnergy Science Center, School of Chemistry and Biochemistry, Institute of Paper Science and Technology, Georgia Institute of Technology, 500 10th Street, Atlanta, GA 30332, USA a r t i c l e i n f o Article history: Received 21 November 2011 Received in revised form 5 April 2012 Accepted 10 April 2012 Available online 21 April 2012 Keywords: Poplar Pseudo-lignin Dilute acid pretreatment a-Cellulose Holocellulose a b s t r a c t Pseudo-lignin, which can be broadly defined as aromatic material that yields a positive Klason lignin value and is not derived from native lignin, has been recently reported to form during the dilute acid pre- treatment of poplar holocellulose. To investigate the chemistry of pseudo-lignin formation, GPC, FT-IR and 13 C NMR were utilized to characterize pseudo-lignin


one mile underground into a deep saline formation. The injection  

NLE Websites -- All DOE Office Websites (Extended Search)

mile underground into a deep saline formation. The injection, mile underground into a deep saline formation. The injection, which will occur over a three-year period and is slated to start in early 2010, will compress up to 1 million metric tonnes of CO 2 from the ADM ethanol facility into a liquid-like, dense phase. The targeted rock formation, the Mt. Simon Sandstone, is the thickest and most widespread saline reservoir in the Illinois Basin, with an estimated CO 2 storage capacity of 27 to 109 billion metric tonnes. A comprehensive monitoring program, which will be evaluated yearly, will be implemented after the injection to ensure the injected CO 2 is stored safely and permanently. The RCSP Program was launched by the Office of Fossil Energy (FE)


Dark spot formation relative to ITO surface roughness for polyfluorene  

NLE Websites -- All DOE Office Websites (Extended Search)

Dark spot formation relative to ITO surface roughness for polyfluorene Dark spot formation relative to ITO surface roughness for polyfluorene devices Title Dark spot formation relative to ITO surface roughness for polyfluorene devices Publication Type Journal Article Year of Publication 2004 Authors Liu, Gao, John B. Kerr, and Stephen G. Johnson Journal Synthetic Metals Volume 144 Pagination 1-6 Keywords dark spot, failure mechanism, interface, ito surface, oled Abstract The failure behaviors of ITO/PEDOT;PSS/polyfluorene/Al devices are different depending on the surface roughness of the sputtered ITO anode film. The spikes on ITO surface are responsible for the initial local shorts of the device, which develop into dark spots very quickly. Indium adsorption is observed on the polymer and Al cathode interface. A chemical etching procedure is used to smoothen the ITO surface without changing the ITO thickness and the sheet resistance. Devices made out of smooth ITO show minimum changes at polymer-cathode interface during operation.


Molecular Hydrogen Formation on Amorphous Silicates Under Interstellar Conditions  

E-Print Network (OSTI)

Experimental results on the formation of molecular hydrogen on amorphous silicate surfaces are presented for the first time and analyzed using a rate equation model. The energy barriers for the relevant diffusion and desorption processes are obtained. They turn out to be significantly higher than those obtained earlier for polycrystalline silicates, demonstrating the importance of grain morphology. Using these barriers we evaluate the efficiency of molecular hydrogen formation on amorphous silicate grains under interstellar conditions. It is found that unlike polycrystalline silicates, amorphous silicate grains are efficient catalysts of H$_{2}$ formation within a temperature range which is relevant to diffuse interstellar clouds. The results also indicate that the hydrogen molecules are thermalized with the surface and desorb with low kinetic energy. Thus, they are unlikely to occupy highly excited states.

Hagai B. Perets; Adina Lederhendler; Ofer Biham; Gianfranco Vidali; Ling Li; Sol Swords; Emanuele Congiu; Joe Roser; Giulio Manico; John Robert Brucato; Valerio Pirronello



Formation mechanisms of spatially-directed zincblende gallium nitride nanocrystals  

Science Conference Proceedings (OSTI)

We report on the spatially selective formation of GaN nanocrystals embedded in GaAs. Broad-area N{sup +} implantation followed by rapid thermal annealing leads to the formation of nanocrystals at the depth of maximum ion damage. With additional irradiation using a Ga{sup +} focused ion beam, selective lateral positioning of the nanocrystals within the GaAs matrix is observed in isolated regions of increased vacancy concentration. Following rapid thermal annealing, the formation of zincblende GaN is observed in the regions of highest vacancy concentration. The nucleation of zincblende nanocrystals over the wurtzite phase of bulk GaN is consistent with the predictions of a thermodynamic model for the nanoscale size-dependence of GaN nucleation.

Wood, A. W. [Department of Physics, University of Michigan, Ann Arbor, Michigan 48109 (United States); Collino, R. R. [Department of Mechanical Engineering, University of Michigan, Ann Arbor, Michigan 48109 (United States); Cardozo, B. L. [Department of Materials Science and Engineering, University of Michigan, Ann Arbor, Michigan 48109 (United States); Naab, F. [Department of Nuclear Engineering and Radiological Sciences, University of Michigan, Ann Arbor, Michigan 48109 (United States); Wang, Y. Q. [Materials Science and Technology Division, Los Alamos National Lab, Los Alamos, New Mexico 87545 (United States); Goldman, R. S. [Department of Physics, University of Michigan, Ann Arbor, Michigan 48109 (United States); Department of Materials Science and Engineering, University of Michigan, Ann Arbor, Michigan 48109 (United States)



Chemical pathways for the formation of ammonia in Hanford wastes  

SciTech Connect

This report reviews chemical reactions leading to the formation of ammonia in Hanford wastes. The general features of the chemistry of the organic compounds in the Hanford wastes are briefly outlined. The radiolytic and thermal free radical reactions that are responsible for the initiation and propagation of the oxidative degradation reactions of the nitrogen-containing complexants, trisodium HEDTA and tetrasodium EDTA, are outlined. In addition, the roles played by three different ionic reaction pathways for the oxidation of the same compounds and their degradation products are described as a prelude to the discussion of the formation of ammonia. The reaction pathways postulated for its formation are based on tank observations, laboratory studies with simulated and actual wastes, and the review of the scientific literature. Ammonia derives from the reduction of nitrite ion (most important), from the conversion of organic nitrogen in the complexants and their degradation products, and from radiolytic reactions of nitrous oxide and nitrogen (least important).

Stock, L.M.; Pederson, L.R.



Effects of Supernova Feedback on the Formation of Galaxies  

E-Print Network (OSTI)

We study the effects of Supernova (SN) feedback on the formation of galaxies using hydrodynamical simulations in a Lambda-CDM cosmology. We use an extended version of the code GADGET-2 which includes chemical enrichment and energy feedback by Type II and Type Ia SN, metal-dependent cooling and a multiphase model for the gas component. We focus on the effects of SN feedback on the star formation process, galaxy morphology, evolution of the specific angular momentum and chemical properties. We find that SN feedback plays a fundamental role in galaxy evolution, producing a self-regulated cycle for star formation, preventing the early consumption of gas and allowing disks to form at late times. The SN feedback model is able to reproduce the expected dependence on virial mass, with less massive systems being more strongly affected.

Cecilia Scannapieco; Patricia B. Tissera; Simon D. M. White; Volker Springel



Fluid loss to formation stopped prior to gravel packing  

Science Conference Proceedings (OSTI)

Union Texas Petroleum has combined special techniques in offshore Louisiana gravel-packing operations to combat severe fluid loss that had jeopardized previous gravel-packed completions. By using an annulus pressure-controlled circulation valve and a crosslinked polymer gelled block, Union Texas was able to totally halt loss of fluid to a formation that had an 1,835-psi overbalanced (the hydrostatic pressure of well fluid in the treating string-to-casing annulus exceeded formation pressure by 1,835 psi). The pressure-controlled valve permitted process control without pipe movement, and the gelled block prevented fluid loss to the formation while the gravel pack was being installed. The well was perforated underbalanced, using tubing-conveyed guns, for perforation cleanup.

Quarnstrom, T.F. (Union Texas Petroleum, Houston, TX (US)); Cavender, T.W.; Shelton, G. (Vann Systems Houston, TX (US))



Spontaneous formation of double bars in dark matter dominated galaxies  

E-Print Network (OSTI)

Although nearly one-third of barred galaxies host an inner, secondary bar, the formation and evolution of double barred galaxies remain unclear. We show here an example model of a galaxy, dominated by a live dark matter halo, in which double bars form naturally, without requiring gas, and we follow its evolution for a Hubble time. The inner bar in our model galaxy rotates almost as slowly as the outer bar, and it can reach up to half of its length. The route to the formation of a double bar may be different from that of a single strong bar. Massive dark matter halo or dynamically hot stellar disc may play an important role in the formation of double bars and their subsequent evolution.

Saha, Kanak



Molecular cloud formation and magnetic fields in spiral galaxies  

E-Print Network (OSTI)

We present ongoing hydrodynamic and MHD simulations of molecular cloud formation in spiral galaxies. The hydrodynamic results show the formation of molecular gas clouds where spiral shocks compress atomic gas to high densities. The spiral shocks also produce structure in the spiral arms, provided the gas is cold (gas than when a single phase is assumed. We also discuss very recent results from galactic-scale MHD calculations. From observational comparisons of the magnetic and thermal pressure, magnetic fields are expected to be a major factor in explaining the dynamics of the ISM, from kpc scales to those of star formation. We describe the difference in structure of the spiral arms, and the evolution of the global magnetic field for a range of field strengths.

Clare Dobbs; Daniel Price; Ian Bonnell


Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Heating hydrocarbon containing formations in a line drive staged process  

DOE Patents (OSTI)

Method for treating a hydrocarbon containing formation are described herein. Methods may include providing heat to a first section of the formation with one or more first heaters in the first section. First hydrocarbons may be heated in the first section such that at least some of the first hydrocarbons are mobilized. At least some of the mobilized first hydrocarbons may be produced through a production well located in a second section of the formation. The second section may be located substantially adjacent to the first section. A portion of the second section may be provided some heat from the mobilized first hydrocarbons, but is not conductively heated by heat from the first heaters. Heat may be provided to the second section with one or more second heaters in the second section to further heat the second section.

Miller, David Scott (Katy, TX)




SciTech Connect

Star formation in galaxies is observed to be associated with gamma-ray emission, presumably from non-thermal processes connected to the acceleration of cosmic-ray nuclei and electrons. The detection of gamma rays from starburst galaxies by the Fermi Large Area Telescope (LAT) has allowed the determination of a functional relationship between star formation rate and gamma-ray luminosity. Since star formation is known to scale with total infrared (8-1000 {mu}m) and radio (1.4 GHz) luminosity, the observed infrared and radio emission from a star-forming galaxy can be used to quantitatively infer the galaxy's gamma-ray luminosity. Similarly, star-forming galaxies within galaxy clusters allow us to derive lower limits on the gamma-ray emission from clusters, which have not yet been conclusively detected in gamma rays. In this study, we apply the functional relationships between gamma-ray luminosity and radio and IR luminosities of galaxies derived by the Fermi Collaboration to a sample of the best candidate galaxy clusters for detection in gamma rays in order to place lower limits on the gamma-ray emission associated with star formation in galaxy clusters. We find that several clusters have predicted gamma-ray emission from star formation that are within an order of magnitude of the upper limits derived in Ackermann et al. based on non-detection by Fermi-LAT. Given the current gamma-ray limits, star formation likely plays a significant role in the gamma-ray emission in some clusters, especially those with cool cores. We predict that both Fermi-LAT over the course of its lifetime and the future Cerenkov Telescope Array will be able to detect gamma-ray emission from star-forming galaxies in clusters.

Storm, Emma M.; Jeltema, Tesla E.; Profumo, Stefano [Department of Physics, University of California, 1156 High Street, Santa Cruz, CA 95064 (United States)



Eddy formation and propagation in the eastern tropical Pacific  

E-Print Network (OSTI)

Observations of eddies in the eastern tropical Pacific from TOPEX altimetry data show that there are seasonal and interannual variations in eddy activity. Comparisons between time of eddy formation and corresponding wind data show that not all eddies are caused by winds blowing offshore from the coast of Central America. Plots of eddy tracks from TOPEX data show that some of these eddies last for over 6 months and travel more than 250 of longitude toward the west. Others go more towards the equator and dissipate quickly. A General Circulation Model is used to study the formation and propagation aspects of these eddies. Results from experiments exploring the formation mechanism show that high frequency wind bursts are sufficient but not necessary for eddy formation in the eastern tropical Pacific. Eddy activity remains almost the same if only the annual harmonic of the wind field is used to force the model. Forcing the model with only the high frequency wind component produces almost no eddies. The formation of eddies during periods of weak offshore winds suggests other possible mechanisms, such as unstable mean flows, for the formation of the eddies. Experiments done to study the propagation of the eddies show that the eddies are greatly affected by the structure of the background flow. Eddies formed in September or October encounter a strong westward flowing current and do not dissipate rapidly. These eddies do not travel south beyond the region of shear between the currents. They last for more than 6 months and travel westward for more than 250 of longitude. Eddies formed in March and April encounter a strong eastward flow dissipate quickly and propagate towards the equator where they disappear. These eddies last for less than four months and cover less than 150 of longitude. Eddies generated in January show properties between these two extreme cases.

Jhingran, Vikas Gopal



Field guide to Muddy Formation outcrops, Crook County, Wyoming  

Science Conference Proceedings (OSTI)

The objectives of this research program are to (1) determine the reservoir characteristics and production problems of shoreline barrier reservoirs; and (2) develop methods and methodologies to effectively characterize shoreline bamer reservoirs to predict flow patterns of injected and produced fluids. Two reservoirs were selected for detailed reservoir characterization studies -- Bell Creek field, Carter County, Montana that produces from the Lower Cretaceous (Albian-Cenomanian) Muddy Formation, and Patrick Draw field, Sweetwater County, Wyoming that produces from the Upper Cretaceous (Campanian) Almond Formation of the Mesaverde Group. An important component of the research project was to use information from outcrop exposures of the producing formations to study the spatial variations of reservoir properties and the degree to which outcrop information can be used in the construction of reservoir models. This report contains the data and analyses collected from outcrop exposures of the Muddy Formation, located in Crook County, Wyoming, 40 miles south of Bell Creek oil field. The outcrop data set contains permeability, porosity, petrographic, grain size and geologic data from 1-inch-diameter core plugs chilled from the outcrop face, as well as geological descriptions and sedimentological interpretations of the outcrop exposures. The outcrop data set provides information about facies characteristics and geometries and the spatial distribution of permeability and porosity on interwell scales. Appendices within this report include a micropaleontological analyses of selected outcrop samples, an annotated bibliography of papers on the Muddy Formation in the Powder River Basin, and over 950 permeability and porosity values measured from 1-inch-diameter core plugs drilled from the outcrop. All data contained in this resort are available in electronic format upon request. The core plugs drilled from the outcrop are available for measurement.

Rawn-Schatzinger, V.



Commercial Buildings Partnership Projects - Metered Data Format and Delivery  

Science Conference Proceedings (OSTI)

A number of the Commercial Building Partnership Projects (CBPs) will require metering, monitoring, data analysis and verification of savings after the retrofits are complete. Although monitoring and verification (M&V) agents are free to use any metering and monitoring devices that they chose, the data they collect should be reported to Pacific Northwest National Laboratory (PNNL) in a standard format. PNNL will store the data collected in its CBP database for further use by PNNL and U.S. Department of Energy. This document describes the data storage process and the deliver format of the data from the M&V agents.

Katipamula, Srinivas



Enthalpies of Formation of Rare-Earth Orthovanadates, REVO4  

Science Conference Proceedings (OSTI)

Rare earth orthovanadates, REVO4, having the zircon structure, form a series of materials interesting for magnetic, optical, sensor, and electronic applications. Enthalpies of formation of REVO4 compounds (RE=Sc, Y, Ce Nd, Sm Tm, Lu) were determined by oxide melt solution calorimetry in lead borate (2PbO {center_dot} 2B2O3) solvent at 1075 K. The enthalpies of formation from oxide components become more negative with increasing RE ionic radius. This trend is similar to that obtained for the rare earth phosphates.

Dorogova, M. [University of California, Davis; Navrotsky, Alexandra [University of California, Davis; Boatner, Lynn A [ORNL



Method and apparatus for production of subsea hydrocarbon formations  

DOE Patents (OSTI)

A system for controlling, separating, processing and exporting well fluids produced from subsea hydrocarbon formations is disclosed. The subsea well tender system includes a surface buoy supporting one or more decks above the water surface for accommodating equipment to process oil, gas and water recovered from the subsea hydrocarbon formation. The surface buoy includes a surface-piercing central flotation column connected to one or more external flotation tanks located below the water surface. The surface buoy is secured to the sea bed by one or more tendons which are anchored to a foundation with piles imbedded in the sea bed. The system accommodates multiple versions on the surface buoy configuration. 20 figures.

Blandford, J.W.



GEOGYN - a geological formation/drill string dynamics computer program  

DOE Green Energy (OSTI)

This paper describes the initial development phase of a finite element computer program, GEODYN, capable of simulating the three-dimensional transient, dynamic response of a polycrystalline diamond compact (PDC) bit interacting with a non-uniform formation. The ability of GEODYN to simulate response variations attributable to hole size, hole bottom surface shapes, and formation material non-uniformities is demonstrated. Planned developmental phases will address the detailed response of a bottom-hole assembly (BHA), a drill ahead (rock penetration and removal) simulation, and ultimately, the response of the entire string.

Caskey, B.



Method and apparatus for production of subsea hydrocarbon formations  

DOE Patents (OSTI)

A system for controlling, separating, processing and exporting well fluids produced from subsea hydrocarbon formations is disclosed. The subsea well tender system includes a surface buoy supporting one or more decks above the water surface for accommodating equipment to process oil, gas and water recovered from the subsea hydrocarbon formation. The surface buoy includes a surface-piercing central flotation column connected to one or more external floatation tanks located below the water surface. The surface buoy is secured to the seabed by one or more tendons which are anchored to a foundation with piles imbedded in the seabed. The system accommodates multiple versions on the surface buoy configuration.

Blandford, Joseph W. (15 Mott La., Houston, TX 77024)



Method for maximizing shale oil recovery from an underground formation  

DOE Patents (OSTI)

A method for maximizing shale oil recovery from an underground oil shale formation which has previously been processed by in situ retorting such that there is provided in the formation a column of substantially intact oil shale intervening between adjacent spent retorts, which method includes the steps of back filling the spent retorts with an aqueous slurry of spent shale. The slurry is permitted to harden into a cement-like substance which stabilizes the spent retorts. Shale oil is then recovered from the intervening column of intact oil shale by retorting the column in situ, the stabilized spent retorts providing support for the newly developed retorts.

Sisemore, Clyde J. (Livermore, CA)



Formation and Stability of Impurity "snakes" in Tokamak Plasmas  

SciTech Connect

New observations of the formation and dynamics of long-lived impurity-induced helical "snake" modes in tokamak plasmas have recently been carried-out on Alcator C-Mod. The snakes form as an asymmetry in the impurity ion density that undergoes a seamless transition from a small helically displaced density to a large crescent-shaped helical structure inside q < 1, with a regularly sawtoothing core. The observations show that the conditions for the formation and persistence of a snake cannot be explained by plasma pressure alone. Instead, many features arise naturally from nonlinear interactions in a 3D MHD model that separately evolves the plasma density and temperature

L. Delgado-Aparicio, et. al.



Energy Distributions and the Formation Times of Spheroidal Populations  

E-Print Network (OSTI)

I review recent progress in exploring the formation times of spheroidal stellar populations (elliptical galaxies and large spiral bulges) using spectrophotometric techniques. A quickly growing body of evidence shows that although massive spheroids can form at early times, there are strong environmental dependencies, and major transitions in star formation histories and even morphologies are detectable to surprisingly small redshifts (z ~ 0.2). These features are consistent with neither the strict monolithic collapse nor hierarchical merging scenarios. Restframe UV observations are a promising means of improving our understanding of spheroid evolution.

Robert W. O'Connell



Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


Numerical simulation of cloud droplet formation in a tank  

Science Conference Proceedings (OSTI)

Using the computational fluid dynamics (CFD) code FLUENT 6 together with the fine particle model (FPM), numerical simulations of droplet dynamics in a 12.4m^3 cloud tank were conducted. The coupled fields of water vapor, temperature, flow velocity, particle ... Keywords: Cloud droplet formation, Particle-dynamics modeling, Stirred tank, Turbulence

Matthias Schtze; Frank Stratmann


Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Science Conference Proceedings (OSTI)

The formation and evolution process and magnetic configuration of solar prominences remain unclear. In order to study the formation process of prominences, we examine continuous observations of a prominence in NOAA AR 10953 with the Solar Optical Telescope on the Hinode satellite. As reported in our previous Letter, we find a signature suggesting that a helical flux rope emerges from below the photosphere under a pre-existing prominence. Here we investigate more detailed properties and photospheric indications of the emerging helical flux rope, and discuss their relationship to the formation of the prominence. Our main conclusions are: (1) a dark region with absence of strong vertical magnetic fields broadens and then narrows in Ca II H-line filtergrams. This phenomenon is consistent with the emergence of the helical flux rope as photospheric counterparts. The size of the flux rope is roughly 30,000 km long and 10,000 km wide. The width is larger than that of the prominence. (2) No shear motion or converging flows are detected, but we find diverging flows such as mesogranules along the polarity inversion line. The presence of mesogranules may be related to the emergence of the helical flux rope. (3) The emerging helical flux rope reconnects with magnetic fields of the pre-existing prominence to stabilize the prominence for the next several days. We thus conjecture that prominence coronal magnetic fields emerge in the form of helical flux ropes that contribute to the formation and maintenance of the prominence.

Okamoto, Takenori J.; Tsuneta, Saku; Katsukawa, Yukio; Suematsu, Yoshinori [National Astronomical Observatory, Mitaka, Tokyo, 181-8588 (Japan); Lites, Bruce W.; Kubo, Masahito [High Altitude Observatory, National Center for Atmospheric Research, P.O. Box 3000, Boulder, CO 80307-3000 (United States); Yokoyama, Takaaki [Department of Earth and Planetary Science, School of Science, University of Tokyo, Hongo, Bunkyo, Tokyo, 113-0033 (Japan); Berger, Thomas E.; Shine, Richard A.; Tarbell, Theodore D.; Title, Alan M. [Lockheed Martin Solar and Astrophysics Laboratory, B/252, 3251 Hanover St., Palo Alto, CA 94304 (United States); Ichimoto, Kiyoshi; Nagata, Shin'ichi; Shibata, Kazunari [Kwasan and Hida Observatories, Kyoto University, Yamashina, Kyoto, 607-8471 (Japan); Shimizu, Toshifumi [ISAS/JAXA, Sagamihara, Kanagawa, 229-8510 (Japan)], E-mail: joten.okamoto@nao.ac.jp



The multi-team formation precursor of teamwork  

Science Conference Proceedings (OSTI)

We formulate the multi-team formation (M-TF) domain-independent problem and describe a generic solution for the problem. We illustrate the M-TF preference relation component in the domain of a large-scale disaster response simulation environment. The ...

Paulo Trigo; Helder Coelho




SciTech Connect

The environment surrounding Wolf-Rayet (W-R) star HD 211853 is studied in molecular, infrared, as well as radio, and H I emission. The molecular ring consists of well-separated cores, which have a volume density of 10{sup 3} cm{sup -3} and kinematic temperature {approx}20 K. Most of the cores are under gravitational collapse due to external pressure from the surrounding ionized gas. From the spectral energy distribution modeling toward the young stellar objects, the sequential star formation is revealed on a large scale in space spreading from the W-R star to the molecular ring. A small-scale sequential star formation is revealed toward core 'A', which harbors a very young star cluster. Triggered star formations are thus suggested. The presence of the photodissociation region, the fragmentation of the molecular ring, the collapse of the cores, and the large-scale sequential star formation indicate that the 'collect and collapse' process functions in this region. The star-forming activities in core 'A' seem to be affected by the 'radiation-driven implosion' process.

Liu Tie; Wu Yuefang; Zhang Huawei [Department of Astronomy, Peking University, 100871 Beijing (China); Qin Shengli, E-mail: liutiepku@gmail.com [I. Physikalisches Institut, Universitaet zu Koeln, Zuelpicher Str. 77, 50937 Koeln (Germany)



The Influence of Bismuth on Microstructure and Porosity Formation ...  

Science Conference Proceedings (OSTI)

The results show that a small amount of bismuth has no significant impact on the formation of ... A Multi-Scale 3D Model of the Vacuum Arc Remelting Process ... Deformation Prediction of a Heavy Hydro Turbine Blade During Casting Process



E-Print Network (OSTI)

Chapter SN A SUMMARY OF COAL IN THE COALMONT FORMATION (TERTIARY), NORTH PARK BASIN, COLORADO By S assessment of selected Tertiary coal beds and zones in the Northern RockyMountains and Great Plains region, U Resource assessment of selected Tertiary coal beds and zones in the Northern Rocky Mountains and Great


Mixing and Water-Mass Formation in the Australian Subantarctic  

Science Conference Proceedings (OSTI)

A cruise south of eastern Australia confirmed the formation of a Subantarctic Mode Water type in late winter on the equatorward side of the Subantarctic Front. This water type, mixed with the winter surface waters farther north, would form the T-...

Rory O. R. Y. Thompson; R. J. Edwards



Signalling pathway in appressorium formation in Magnaporthe grisea  

E-Print Network (OSTI)

We identified a synthetic hexapeptide that blocks Magnaporthe grisea appressorium formation, in artificial hydrophobic surface. The results suggest that peptides interfere with surface recognition. M. grisea non pathogenic pth1 mutants were complemented by N. crassa orthologous gene suggesting that the biochemical function of pth1 has not evolved specifically to play a role in appressorium development.

Filippi, Marta Cristina



Analysis of Star Formation in Galaxy-like Objects  

E-Print Network (OSTI)

Using cosmological hydrodynamical simulations, we investigate the effects of hierarchical aggregation on the triggering of star formation in galactic-like objects. We include a simple star formation model to transform the cold gas in dense regions into stars. Simulations with different parameters have been performed in order to quantify the dependence of the results on the parameters. We then resort to stellar population synthesis models to trace the color evolution of each object with red-shift and in relation to their merger histories. We find that, in a hierarchical clustering scenario, the process of assembling of the structure is one natural mechanism that may trigger star formation. The resulting star formation rate history for each individual galactic object is composed of a continuous one ($\\leq 3 \\rm{M_{\\odot}/yr}$) and a series of star bursts. We find that even the accretion of a small satellite can be correlated with a stellar burst. Massive mergers are found to be more efficient at transforming gas into stars

Patricia B. Tissera



Well completion process for formations with unconsolidated sands  

DOE Patents (OSTI)

A method for consolidating sand around a well, involving injecting hot water or steam through well casing perforations in to create a cement-like area around the perforation of sufficient rigidity to prevent sand from flowing into and obstructing the well. The cement area has several wormholes that provide fluid passageways between the well and the formation, while still inhibiting sand inflow.

Davies, David K. (Kingwood, TX); Mondragon, III, Julius J. (Redondo Beach, CA); Hara, Philip Scott (Monterey Park, CA)



Predicting Nickel Precipitate Formation in Contaminated Soils. (3717)  

E-Print Network (OSTI)

Predicting Nickel Precipitate Formation in Contaminated Soils. (3717) Authors: E. Peltier* - Univ in contaminated soils plays a crucial role in determining the long term fate of toxic metal pollutants speciation in laboratory contaminated soils with thermodynamic and kinetic analyses of precipitate stability

Sparks, Donald L.


Mineral formation during simulated leaks of Hanford waste tanks  

E-Print Network (OSTI)

Mineral formation during simulated leaks of Hanford waste tanks Youjun Deng a , James B. Harsh a at the US DOE Hanford Site, Washington, caus- ing mineral dissolution and re-precipitation upon contact mimicking tank leak conditions at the US DOE Hanford Site. In batch experiments, Si-rich solutions

Flury, Markus


Biomass Gasifier ''Tars'': Their Nature, Formation, and Conversion  

DOE Green Energy (OSTI)

The main purpose of this review is to update the information on gasification tar, the most cumbersome and problematic parameter in any gasification commercialization effort. The work aims to present to the community the scientific and practical aspects of tar formation and conversion (removal) during gasification as a function of the various technological and technical parameters and variables.

Milne, T. A.; Evans, R. J. (National Renewable Energy Laboratory); Abatzaglou, N. (Kemestrie, Inc.)



Layered evaluation of interactive adaptive systems: framework and formative methods  

Science Conference Proceedings (OSTI)

The evaluation of interactive adaptive systems has long been acknowledged to be a complicated and demanding endeavour. Some promising approaches in the recent past have attempted tackling the problem of evaluating adaptivity by "decomposing" and evaluating ... Keywords: Design, Evaluation framework, Formative evaluation methods, Layered evaluation

Alexandros Paramythis; Stephan Weibelzahl; Judith Masthoff



Compact data format for advertising and discovery in ubiquitous networks  

Science Conference Proceedings (OSTI)

In this paper, we describe a packet data size minimization method designed specifically for advertising and discovery in ubiquitous networks. The minimization is effective for achieving superior discovery performance characteristics such as discovery ... Keywords: compact data format, discovery system, service discovery

Pavel Poupyrev; Yoshihiro Kawahara; Peter Davis; Hiroyuki Morikawa




E-Print Network (OSTI)

utilizing all of the known techniques for NOx reduction. To be precise, the NOx formed within the flame] and several others [6, 7] have suggested certain reduction methods which are consistent with NOx formation, not solid waste. The results of NOx reduction techniques in coal combustion should be applied with caution

Columbia University


Molecular dynamics simulation of Li surface erosion and bubble formation  

E-Print Network (OSTI)

Molecular dynamics simulation of Li surface erosion and bubble formation Z. Insepov *, A. Hassanein Structure and dynamical properties of liquid Li containing He atoms were studied by the Molecular Dynamics devices. Molecular dynamics (MD) method is capable of studying important collision processes and providing

Harilal, S. S.


Ni-Pt silicide formation through Ti mediating layers  

Science Conference Proceedings (OSTI)

With Ni"1"-"xPt"xSi, the variation in queue time between the final surface cleaning and Ni-Pt deposition represents a significant manufacturability issue. A short queue time is often difficult to maintain, leading to the formation of an oxide layer on ... Keywords: Mediated reaction, Nickel silicide, Oxidation, Titanium

Paul Besser; Christian Lavoie; Ahmet Ozcan; Conal Murray; Jay Strane; Keith Wong; Michael Gribelyuk; Yun-Yu Wang; Christopher Parks; Jean Jordan-Sweet



Estimation of formation strength index of aquifer from neural networks  

Science Conference Proceedings (OSTI)

The purpose of this study is to construct a model that predicts an aquifer's formation strength index (the ratio of shear modulus and bulk compressibility, G/C"b) from geophysical well logs by using a back-propagation neural network (BPNN). The BPNN ... Keywords: Back-propagation neural networks, Geophysical well logs, Groundwater, Soft computing

Bieng-Zih Hsieh; Chih-Wen Wang; Zsay-Shing Lin



Self-stabilizing robot formations over unreliable networks  

Science Conference Proceedings (OSTI)

We describe how a set of mobile robots can arrange themselves on any specified curve on the plane in the presence of dynamic changes both in the underlying ad hoc network and in the set of participating robots. Our strategy is for the mobile robots to ... Keywords: Formal methods, cooperative mobile robotics, distributed algorithms, pattern formation, replicated state machines, self-stabilization

Seth Gilbert; Nancy Lynch; Sayan Mitra; Tina Nolte




SciTech Connect

We have explored the interplay of star formation and active galactic nucleus (AGN) activity in soft X-rays (0.5-2 keV) in two samples of Seyfert 2 galaxies (Sy2s). Using a combination of low-resolution CCD spectra from Chandra and XMM-Newton, we modeled the soft emission of 34 Sy2s using power-law and thermal models. For the 11 sources with high signal-to-noise Chandra imaging of the diffuse host galaxy emission, we estimate the luminosity due to star formation by removing the AGN, fitting the residual emission. The AGN and star formation contributions to the soft X-ray luminosity (i.e., L{sub x,AGN} and L{sub x,SF}) for the remaining 24 Sy2s were estimated from the power-law and thermal luminosities derived from spectral fitting. These luminosities were scaled based on a template derived from XSINGS analysis of normal star-forming galaxies. To account for errors in the luminosities derived from spectral fitting and the spread in the scaling factor, we estimated L{sub x,AGN} and L{sub x,SF} from Monte Carlo simulations. These simulated luminosities agree with L{sub x,AGN} and L{sub x,SF} derived from Chandra imaging analysis within a 3{sigma} confidence level. Using the infrared [Ne II]12.8 {mu}m and [O IV]26 {mu}m lines as a proxy of star formation and AGN activity, respectively, we independently disentangle the contributions of these two processes to the total soft X-ray emission. This decomposition generally agrees with L{sub x,SF} and L{sub x,AGN} at the 3{sigma} level. In the absence of resolvable nuclear emission, our decomposition method provides a reasonable estimate of emission due to star formation in galaxies hosting type 2 AGNs.

LaMassa, Stephanie M.; Heckman, T. M. [Johns Hopkins University, Department of Physics and Astronomy, Baltimore, MD 21218 (United States); Ptak, A. [NASA/Goddard Space Flight Center, Greenbelt, MD 20771 (United States)


Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Basics of Polar-Format algorithm for processing Synthetic Aperture Radar images.  

Science Conference Proceedings (OSTI)

The purpose of this report is to provide a background to Synthetic Aperture Radar (SAR) image formation using the Polar Format (PFA) processing algorithm. This is meant to be an aid to those tasked to implement real-time image formation using the Polar Format processing algorithm.

Doerry, Armin Walter



Effect of overbalance pressure on formation damage S.Z. Jilani a,b  

E-Print Network (OSTI)

wells is to produce maximum recoverable oil at minimum cost. Unfortunately, drilled wells are subject reduction of the flow capacity of an oil-, water-, or gas-bearing formation. The formation can be dam- aged formation comes first time in contact with a foreign fluid, i.e. drilling mud, which invades the formation

Al-Majed, Abdulaziz Abdullah


Solution mining and heating by oxidation for treating hydrocarbon containing formations  

DOE Patents (OSTI)

A method for treating an oil shale formation comprising nahcolite includes providing a first fluid to a portion of the formation. A second fluid is produced from the portion. The second fluid includes at least some nahcolite dissolved in the first fluid. A controlled amount of oxidant is provided to the portion of the formation. Hydrocarbon fluids are produced from the formation.

Vinegar, Harold J. (Bellaire, TX); Stegemeier, George Leo (Houston, TX)



Chip Formation Analysis in Laser-assisted Milling of Ti-6Al-4V  

Science Conference Proceedings (OSTI)

About this Abstract. Meeting, Materials Science & Technology 2013. Symposium, Advanced Manufacturing Technologies. Presentation Title, Chip Formation...


Descriptif de la formation avec ses particularits Pour la premire fois l'universit de Genve, une formation interfacultaire en linguistique et en  

E-Print Network (OSTI)

, une formation interfacultaire en linguistique et en psychologie est offerte aux étudiants de Lettres. Les étudiants de lettres pourront suivre une formation en Linguistique (branche A) et en Psychologie. Objectifs de la formation Ce Baccalauréat universitaire pluridisciplinaire en Linguistique et Psychologie

Loewith, Robbie


Modeling the Sequestration of CO2 in Deep Geological Formations  

NLE Websites -- All DOE Office Websites (Extended Search)

the Sequestration of CO the Sequestration of CO 2 in Deep Geological Formations K. Prasad Saripalli, B. Peter McGrail, and Mark D. White Pacific Northwest National Laboratory, Richland, Washington 99352 corresponding author Prasad Saripalli Senior Research Scientist Pacific Northwest National Laboratory 1313 Sigma V Complex (K6-81) Richland, WA 99352 ph: (509) 376-1667 fax: (509) 376-5368 prasad.saripalli@pnl.gov 2 Modeling the Sequestration of CO 2 in Deep Geological Formations K. Prasad Saripalli, B. Peter McGrail, and Mark D. White Pacific Northwest National Laboratory, Richland, Washington 99352 Modeling the injection of CO 2 and its sequestration will require simulations of a multi- well injection system in a large reservoir field. However, modeling at the injection well


Protected Loss of Flow Transient Simulation (Quicktime format, High  

NLE Websites -- All DOE Office Websites (Extended Search)

Engineering Analysis > Videos Engineering Analysis > Videos Engineering Analysis: Protected Loss of Flow Transient Simulation Quicktime format Quicktime Format - High Bandwidth | Size: 25.94 MB | Bit Rate: 1148 kbps Keywords: flow transient, plot, EBR-II, SAS4A, SASSYS-1, passive safety, protected loss of flow, PLOF, shutdown heat removal test, SHRT-17, SHRT17 Elevation plot showing detailed top of core temperatures in experimental assembly XX09 during a protected loss of flow transient in EBR-II. Surrounding assemblies are depicted using fuel average temperatures. Results show excellent decay heat removal capability of sodium through natural circulation and exceptionally low transient temperatures with metallic fuel. :: Please wait until video loads completely :: Closed Captioning Transcript


Optimal Geological Enviornments for Carbon Dioxide Storage in Saline Formations  

NLE Websites -- All DOE Office Websites (Extended Search)

susan D. Hovorka susan D. Hovorka Principal Investigator University of Texas at Austin Bureau of Economic Geology 10100 Burnet Road, Bldg. 130 P.O. Box X Austin, TX 78713 512-471-4863 susan.hovorka@beg.utexas.edu Optimal GeOlOGical envirOnments fOr carbOn DiOxiDe stOraGe in saline fOrmatiOns Background For carbon dioxide (CO 2 ) sequestration to be a successful component of the United States emissions reduction strategy, there will have to be a favorable intersection of a number of factors, such as the electricity market, fuel source, power plant design and operation, capture technology, a suitable geologic sequestration site, and a pipeline right-of-way from the plant to the injection site. The concept of CO 2 sequestration in saline water-bearing formations (saline reservoirs), isolated at


Conventional Positron Target for a Tesla Formatted Beam  

NLE Websites -- All DOE Office Websites (Extended Search)

3 3 SLAC-TN-03-072 November 2003 Abstract This note documents a set of expressions used to explore the issue of whether or not it is reasonable to consider a conventional positron source for a Tesla formatted beam. The critical issue is that of energy deposition in the conversion target and the comparison of the induced stress with the ultimate tensile strength of the target material. Since the length of the incident beam pulse is large in comparison to the ratio of beam size to the speed of sound, the concurrent pressure pulse dissipates in a time short compared to the overall pulse duration and one is left with only the Conventional Positron Target for a Tesla Formatted Beam John C. Sheppard Stanford Linear Accelerator Center


Matching the Observed Star Formation Intensity Distribution with Empirical Laws  

E-Print Network (OSTI)

This letter matches the shape of the star formation intensity distribution function to empirical laws such as the Schmidt law. The shape of the distribution at a redshift of one is reproduced from the empirical Schmidt law with a critical density, a Schechter distribution of galaxy masses and the assumption that star formation occurs mainly in exponential disks. The shape of the distribution depends primarily on two values, the characteristic mass m* in the Schechter mass distribution and the characteristic radius re in the exponential disk. As these characteristic values evolve they will affect the shape of the distribution function. The expected direction of evolution of the parameters partially cancels each other leaving the distribution shape relatively invariant.

Rodger I. Thompson




SciTech Connect

Studies of beam halo became unavoidable feature of high-intensity machines where uncontrolled beam loss should be kept to extremely small level. For a well controlled stable beam such a loss is typically associated with the low density halo surrounding beam core. In order to minimize uncontrolled beam loss or improve performance of an accelerator, it is very important to understand what are the sources of halo formation in a specific machine of interest. The dominant mechanisms are, in fact, different in linear accelerators, circular machines or Energy Recovering Linacs (ERL). In this paper, we summarize basic mechanisms of halo formation in high-intensity beams and discuss their application to various types of accelerators of interest, such as linacs, rings and ERL.




Formation of superheavy nuclei in cold fusion reactions  

E-Print Network (OSTI)

Within the concept of the dinuclear system (DNS), a dynamical model is proposed for describing the formation of superheavy nuclei in complete fusion reactions by incorporating the coupling of the relative motion to the nucleon transfer process. The capture of two heavy colliding nuclei, the formation of the compound nucleus and the de-excitation process are calculated by using an empirical coupled channel model, solving a master equation numerically and applying statistical theory, respectively. Evaporation residue excitation functions in cold fusion reactions are investigated systematically and compared with available experimental data. Maximal production cross sections of superheavy nuclei in cold fusion reactions with stable neutron-rich projectiles are obtained. Isotopic trends in the production of the superheavy elements Z=110, 112, 114, 116, 118 and 120 are analyzed systematically. Optimal combinations and the corresponding excitation energies are proposed.

Feng, Zhao-Qing; Li, Jun-Qing; Scheid, Werner



Formation of superheavy nuclei in cold fusion reactions  

E-Print Network (OSTI)

Within the concept of the dinuclear system (DNS), a dynamical model is proposed for describing the formation of superheavy nuclei in complete fusion reactions by incorporating the coupling of the relative motion to the nucleon transfer process. The capture of two heavy colliding nuclei, the formation of the compound nucleus and the de-excitation process are calculated by using an empirical coupled channel model, solving a master equation numerically and applying statistical theory, respectively. Evaporation residue excitation functions in cold fusion reactions are investigated systematically and compared with available experimental data. Maximal production cross sections of superheavy nuclei in cold fusion reactions with stable neutron-rich projectiles are obtained. Isotopic trends in the production of the superheavy elements Z=110, 112, 114, 116, 118 and 120 are analyzed systematically. Optimal combinations and the corresponding excitation energies are proposed.

Zhao-Qing Feng; Gen-Ming Jin; Jun-Qing Li; Werner Scheid



Haze Formation and Behavior in Liquid-Liquid Extraction Processes  

Science Conference Proceedings (OSTI)

Aqueous haze formation and behavior was studied in the liquid-liquid system tri-n-butyl phosphate in odorless kerosene and 3M nitric acid with uranyl nitrate and cesium nitrate representing the major solute and an impurity, respectively. A pulsed column, mixer-settler and centrifugal contactor were chosen to investigate the effect of different turbulence characteristics on the manifestation of haze since these contactors exhibit distinct mixing phenomena. The dispersive processes of drop coalescence and breakage, and water precipitation in the organic phase were observed to lead to the formation of haze drops of {approx}1 um in diameter. The interaction between the haze and primary drops of the dispersion was critical to the separation efficiency of the liquid-liquid extraction equipment. Conditions of high power input and spatially homogeneous mixing enabled the haze drops to become rapidly assimilated within the dispersion to maximize the scrub performance and separation efficiency of the equipment.

Arm, Stuart T.; Jenkins, J. A.



Ranging methods for developing wellbores in subsurface formations  

DOE Patents (OSTI)

A method for forming two or more wellbores in a subsurface formation includes forming a first wellbore in the formation. A second wellbore is directionally drilled in a selected relationship relative to the first wellbore. At least one magnetic field is provided in the second wellbore using one or more magnets in the second wellbore located on a drilling string used to drill the second wellbore. At least one magnetic field is sensed in the first wellbore using at least two sensors in the first wellbore as the magnetic field passes by the at least two sensors while the second wellbore is being drilled. A position of the second wellbore is continuously assessed relative to the first wellbore using the sensed magnetic field. The direction of drilling of the second wellbore is adjusted so that the second wellbore remains in the selected relationship relative to the first wellbore.

MacDonald, Duncan (Houston, TX)




E-Print Network (OSTI)

In this paper we investigate the portfolio performance of subjective forecasts given in different forms. In constructing the efficient frontier, the expectation formation processes based is on subjective forecasts and human behaviour, rather than past prices. The efficient portfolios are first constructed using point, interval and probabilistic forecasts. Next their performance is compared to those constructed using the standard approach of time series data. The subjective forecast are given by actual portfolio managers who forecast the prices of stocks actually traded on the stock exchange on a real time basis. The first contribution of the paper is to show that the portfolio performance of subjective forecasts are much more superior to those of standard time series modeling. The next contribution of the paper lies in the fact that it employs experts, professional fund managers with substantive expertise, as forecasters. Third, in this research, point, interval and probabilistic forecasts of expert subjects are investigated and therefore, findings are robust to the task format.

Gulnur Muradoglu; Aslihan Salih; Muhammet Mercan




Science Conference Proceedings (OSTI)

The formation of ketene (H{sub 2}CCO, ethenone) in polar and apolar ices was studied with in situ 0.8 MeV proton irradiation, far-UV photolysis, and infrared spectroscopic analyses at 10-20 K. Using isotopically enriched reagents, unequivocal evidence was obtained for ketene synthesis in H{sub 2}O-rich and CO{sub 2}-rich ices, and several reaction products were identified. Results from scavenging experiments suggested that ketene was formed by free-radical pathways, as opposed to acid-base processes or redox reactions. Finally, we use our results to draw conclusions about the formation and stability of ketene in the interstellar medium.

Hudson, Reggie L.; Loeffler, Mark J., E-mail: Reggie.Hudson@NASA.gov [Astrochemistry Laboratory, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States)



Multi-Phase Galaxy Formation and Quasar Absorption Systems  

E-Print Network (OSTI)

Abstract. The central problem of galaxy formation is understanding the cooling and condensation of gas in dark matter halos. It is now clear that to match observations this requires further physics than the simple assumptions of single phase gas cooling. A model of multi-phase cooling (Maller & Bullock 2004) can successfully account for the upper cutoff in the masses of galaxies and provides a natural explanation of many types of absorption systems (Mo & Miralda-Escude 1996). Absorption systems are our best probes of the gaseous content of galaxy halos and therefore provide important constraints on models for gas cooling into galaxies. All physical processes that effect gas cooling redistribute gas and therefore are detectable in absorption systems. Detailed studies of the nature of gas in galaxy halos using absorption systems are crucial for building a correct theory of galaxy formation.

P. R. Williams; C. Shu; B. Mnard; Ariyeh H. Maller



The Formation of the First Stars in the Universe  

E-Print Network (OSTI)

In this review, I survey our current understanding of how the very first stars in the universe formed, with a focus on three main areas of interest: the formation of the first protogalaxies and the cooling of gas within them, the nature and extent of fragmentation within the cool gas, and the physics -- in particular the interplay between protostellar accretion and protostellar feedback -- that serves to determine the final stellar mass. In each of these areas, I have attempted to show how our thinking has developed over recent years, aided in large part by the increasing ease with which we can now perform detailed numerical simulations of primordial star formation. I have also tried to indicate the areas where our understanding remains incomplete, and to identify some of the most important unsolved problems.

Simon C. O. Glover



The Formation of the First Stars in the Universe  

E-Print Network (OSTI)

In this review, I survey our current understanding of how the very first stars in the universe formed, with a focus on three main areas of interest: the formation of the first protogalaxies and the cooling of gas within them, the nature and extent of fragmentation within the cool gas, and the physics -- in particular the interplay between protostellar accretion and protostellar feedback -- that serves to determine the final stellar mass. In each of these areas, I have attempted to show how our thinking has developed over recent years, aided in large part by the increasing ease with which we can now perform detailed numerical simulations of primordial star formation. I have also tried to indicate the areas where our understanding remains incomplete, and to identify some of the most important unsolved problems.

Glover, S C O


Note: This page contains sample records for the topic "mi bakken formation" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Multi-Phase Galaxy Formation and Quasar Absorption Systems  

E-Print Network (OSTI)

The central problem of galaxy formation is understanding the cooling and condensation of gas in dark matter halos. It is now clear that to match observations this requires further physics than the simple assumptions of single phase gas cooling. A model of multi-phase cooling (Maller & Bullock 2004) can successfully account for the upper cutoff in the masses of galaxies and provides a natural explanation of many types of absorption systems (Mo & Miralda-Escude 1996). Absorption systems are our best probes of the gaseous content of galaxy halos and therefore provide important constraints on models for gas cooling into galaxies. All physical processes that effect gas cooling redistribute gas and therefore are detectable in absorption systems. Detailed studies of the nature of gas in galaxy halos using absorption systems are crucial for building a correct theory of galaxy formation.

Ariyeh H. Maller



Multi-Phase Galaxy Formation and Quasar Absorption Systems  

E-Print Network (OSTI)

The central problem of galaxy formation is understanding the cooling and condensation of gas in dark matter halos. It is now clear that to match observations this requires further physics than the simple assumptions of single phase gas cooling. A model of multi-phase cooling (Maller & Bullock 2004) can successfully account for the upper cutoff in the masses of galaxies and provides a natural explanation of many types of absorption systems (Mo & Miralda-Escude 1996). Absorption systems are our best probes of the gaseous content of galaxy halos and therefore provide important constraints on models for gas cooling into galaxies. All physical processes that effect gas cooling redistribute gas and therefore are detectable in absorption systems. Detailed studies of the nature of gas in galaxy halos using absorption systems are crucial for building a correct theory of galaxy formation.

Maller, A H



Primordial magnetic fields and formation of molecular hydrogen  

E-Print Network (OSTI)

We study the implications of primordial magnetic fields for the thermal and ionization history of the post-recombination era. In particular we compute the effects of dissipation of primordial magnetic fields owing to ambipolar diffusion and decaying turbulence in the intergalactic medium (IGM) and the collapsing halos and compute the effects of the altered thermal and ionization history on the formation of molecular hydrogen. We show that, for magnetic field strengths in the range $2 \\times 10^{-10} {\\rm G} \\la B_0 \\la 2 \\times 10^{-9} {\\rm G}$, the molecular hydrogen fraction in IGM and collapsing halo can increase by a factor 5 to 1000 over the case with no magnetic fields. We discuss the implication of the increased molecular hydrogen fraction on the radiative transfer of UV photons and the formation of first structures in the universe.

Shiv K Sethi; Biman B. Nath; Kandaswamy Subramanian



Exploitation and Optimization of Reservoir Performance in Hunton Formation, Oklahoma  

Science Conference Proceedings (OSTI)

Hunton formation in Oklahoma has been the subject of attention for the last ten years. The new interest started with the drilling of the West Carney field in 1995 in Lincoln County. Subsequently, many other operators have expanded the search for oil and gas in Hunton formation in other parts of Oklahoma. These fields exhibit many unique production characteristics, including: (1) decreasing water-oil or water-gas ratio over time; (2) decreasing gas-oil ratio followed by an increase; (3) poor prediction capability of the reserves based on the log data; and (4) low geological connectivity but high hydrodynamic connectivity. The purpose of this investigation is to understand the principal mechanisms affecting the production, and propose methods by which we can optimize the production from fields with similar characteristics.

Mohan Kelkar



Sensitivity Analysis of Ozone Formation and Transport for a Central  

NLE Websites -- All DOE Office Websites (Extended Search)

Sensitivity Analysis of Ozone Formation and Transport for a Central Sensitivity Analysis of Ozone Formation and Transport for a Central California Air Pollution Episode Title Sensitivity Analysis of Ozone Formation and Transport for a Central California Air Pollution Episode Publication Type Journal Article Year of Publication 2008 Authors Jin, Ling, Shaheen R. Tonse, Daniel S. Cohan, Xianglei Mao, Robert A. Harley, and Nancy J. Brown Journal Environmental Science & Technology Volume 42 Start Page 3683 Issue 10 Pagination 3683-3689 Date Published 05/2008 Abstract We developed a first- and second-order sensitivity analysis approach with the decoupled direct method to examine spatial and temporal variations of ozone-limiting reagents and the importance of local vs upwind emission sources in the San Joaquin Valley of central California for a 5 day ozone episode (Jul 29th to Aug 3rd, 2000). Despite considerable spatial variations, nitrogen oxides (NOx) emission reductions are overall more effective than volatile organic compound (VOC) control for attaining the 8 h ozone standard in this region for this episode, in contrast to the VOC control that works better for attaining the prior 1 h ozone standard. Interbasin source contributions of NOx emissions are limited to the northern part of the SJV, while anthropogenic VOC (AVOC) emissions, especially those emitted at night, influence ozone formation in the SJV further downwind. Among model input parameters studied here, uncertainties in emissions of NOx and AVOC, and the rate coefficient of the OH + NO2 termination reaction, have the greatest effect on first-order ozone responses to changes in NOx emissions. Uncertainties in biogenic VOC emissions only have a modest effect because they are generally not collocated with anthropogenic sources in this region.



SciTech Connect

Essentially all stars form in giant molecular clouds (GMCs). However, inside GMCs, most of the gas does not participate in star formation; rather, denser gas accumulates in clumps in the GMC, with the bulk of the stars in a given GMC forming in a few of the most massive clumps. In the Milky Way, these clumps have masses M{sub cl} {approx}< 5 Multiplication-Sign 10{sup -2} of the GMC, radii r{sub cl} {approx} 1 pc, and free-fall times {tau}{sub cl} {approx} 2 Multiplication-Sign 10{sup 5} yr. We show that clumps inside GMCs should accrete at a modified Bondi accretion rate, which depends on clump mass as M-dot{sub cl}{approx}M{sub cl}{sup 5/4}. This rate is initially rather slow, usually slower than the initial star formation rate inside the clump (we adopt the common assumption that inside the clump, M-dot{sub *}={epsilon}{sub ff}M{sub cl}/{tau}{sub cl}, with {epsilon}{sub ff} Almost-Equal-To 0.017). However, after {approx}2 GMC free-fall times {tau}{sub GMC}, the clump accretion rate accelerates rapidly; formally, the clump can accrete the entire GMC in {approx}3{tau}{sub GMC}. At the same time, the star formation rate accelerates, tracking the Bondi accretion rate. If the GMC is disrupted by feedback from the largest clump, half the stars in that clump form in the final {tau}{sub GMC} before the GMC is disrupted. The theory predicts that the distribution of effective star formation rates, measured per GMC free-fall time, is broad, ranging from {approx}0.001 up to 0.1 or larger and that the mass spectrum of star clusters is flatter than that of clumps, consistent with observations.

Murray, Norman; Chang, Philip, E-mail: murray@cita.utoronto.ca, E-mail: pchang@cita.utoronto.ca [Canadian Institute for Theoretical Astrophysics, 60 St. George Street, University of Toronto, Toronto, ON M5S 3H8 (Canada)




DOE Patents (OSTI)

A method for preventing the formation of scale in uranium solvent extraction apparatus is presented. The scale, consisting chiefly of precipitated silica and the sulfates uf calcium and lead, may be prevented by a combination of measures, chiefly by prior heating and agitation to crystallize and remove silica, and by a maintenance of uranyl nitrate concentration in the feed and extractant above certain levels to increase the solubility of the calcium and lead sulfates.

Delaplaine, J.W.



Kinetically driven helix formation during the homopolymer collapse process  

E-Print Network (OSTI)

Using Langevin simulations, we find that simple 'generic' bead-and-spring homopolymer chains in a sufficiently bad solvent spontaneously develop helical order during the process of collapsing from an initially stretched conformation. The helix formation is initiated by the unstable modes of the straight chain, which drive the system towards a long-lived metastable transient state. The effect is most pronounced if hydrodynamic interactions are screened.

Sid Ahmed Sabeur; Fatima Hamdache; Friederike Schmid



The chemistry of high-mass star formation  

E-Print Network (OSTI)

This paper reviews the chemistry of star-forming regions, with an emphasis on the formation of high-mass stars. We first outline the basic molecular processes in dense clouds, their implementation in chemical models, and techniques to measure molecular abundances. Then, recent observational, theoretical and laboratory developments are reviewed on the subjects of hot molecular cores, cosmic-ray ionization, depletion and deuteration, and oxygen chemistry. The paper concludes with a summary of outstanding problems and future opportunities.

Floris F. S. van der Tak



Water confined in nanopores: spontaneous formation of microcavities  

E-Print Network (OSTI)

Molecular Dynamics simulations of water confined in nanometer sized, hydrophobic channels show that water forms localized cavities for pore diameter ~ 2.0 nm. The cavities present non-spherical shape and lay preferentially adjacent to the confining wall inducing a peculiar form to the liquid exposed surface. The regime of localized cavitation appears to be correlated with the formation of a vapor layer, as predicted by the Lum-Chandler-Weeks theory, implying partial filling of the pore.

John Russo; Simone Melchionna; Francesco De Luca; Cinzia Casieri



Fracturing results in diatomaceous earth formations, South Belridge Field, California  

SciTech Connect

The company began fracturing diatomaceous earth zones in the San Joaquin Valley (CA) in 1976. Fracturing has proved an effective method of exploiting these previously noncommercial reservoirs. Nevertheless, productivity behavior is typified by high initial rates followed by rapid decline. Reasons for this decline have been evaluated and are discussed. Also discussed are laboratory experiments performed to determine an appropriate fracture design for this formation.

Strubhar, M.K.; Andreani, F.S.; Medlin, W.L.; Nabi, S.M.



Formation of thin-film resistors on silicon substrates  

DOE Patents (OSTI)

The formation of thin-film resistors by the ion implantation of a metallic conductive layer in the surface of a layer of phosphosilicate glass or borophosphosilicate glass which is deposited on a silicon substrate. The metallic conductive layer materials comprise one of the group consisting of tantalum, ruthenium, rhodium, platinum and chromium silicide. The resistor is formed and annealed prior to deposition of metal, e.g. aluminum, on the substrate.

Schnable, George L. (Montgomery County, PA); Wu, Chung P. (Hamilton Township, Mercer County, NJ)



Downhole burner systems and methods for heating subsurface formations  

DOE Patents (OSTI)

A gas burner assembly for heating a subsurface formation includes an oxidant conduit, a fuel conduit, and a plurality of oxidizers coupled to the oxidant conduit. At least one of the oxidizers includes a mix chamber for mixing fuel from the fuel conduit with oxidant from the oxidant conduit, an igniter, and a shield. The shield includes a plurality of openings in communication with the oxidant conduit. At least one flame stabilizer is coupled to the shield.

Farmayan, Walter Farman (Houston, TX); Giles, Steven Paul (Damon, TX); Brignac, Jr., Joseph Phillip (Katy, TX); Munshi, Abdul Wahid (Houston, TX); Abbasi, Faraz (Sugarland, TX); Clomburg, Lloyd Anthony (Houston, TX); Anderson, Karl Gregory (Missouri City, TX); Tsai, Kuochen (Katy, TX); Siddoway, Mark Alan (Katy, TX)




SciTech Connect

We derive the stacked 1.4 GHz flux from the FIRST survey for 811 K+A galaxies selected from the Sloan Digital Sky Survey Data Release 7. For these objects we find a mean flux density of 56 {+-} 9 {mu}Jy. A similar stack of radio-quiet white dwarfs yields an upper limit of 43 {mu}Jy at a 5{sigma} significance to the flux in blank regions of the sky. This implies an average star formation rate of 1.6 {+-} 0.3 M{sub Sun} yr{sup -1} for K+A galaxies. However, the majority of the signal comes from {approx}4% of K+A fiel