Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Scottsdale, AZ  

Science Conference Proceedings (OSTI)

... Vice President, Communications, and Chief Marketing Officer, Henry ... Sonora Quest Laboratories Rose Glenn Arizona State Award ... Scottsdale, AZ d ...



Tucson, AZ  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0 0 Tucson, AZ New coal technologies could lower utility costs By Richaed T. Newesnb lee uf( Engineerlng, and the national posslblity orst lest doubllng the with Its reactor safty and wast dis tility deregulallun hls laborstorlee, such as Los Alasn, net efficiency of cool-bMed power towal problemas. ralied public concerns conlinr the easiteoce of Innovative generetion while at the ame time The mpUctlons In all ofthis for bhout meneng the demunds solutlon in the form of low- and producing a ream of carbon dior- Arlaoes are tignlfcant. Our state for electricity t remaonable cot In zero emlsslon dclan coal (ZEC) tch- Ide that can be aely and poertu has both a wU-elenblhd coal growing states such Arizona with- nolngle. nently sequestered urndrgrouwmL ndustry and a reputatlon for clean


Enhancing Tensile and Compressive Strength of AZ41 Magnesium ...  

Science Conference Proceedings (OSTI)

Al and 1 wt.% Al with 1.5 vol.% nano-sized Al2O3 (50 nm) particulates in to AZ31 magnesium alloy, respectively, using disintegrated melt deposition technique.


Category:Tucson, AZ | Open Energy Information  

Open Energy Info (EERE)

Tucson, AZ Tucson, AZ Jump to: navigation, search Go Back to PV Economics By Location Media in category "Tucson, AZ" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Tucson AZ Arizona Public Service Co.png SVFullServiceRestauran... 75 KB SVHospital Tucson AZ Arizona Public Service Co.png SVHospital Tucson AZ A... 88 KB SVLargeHotel Tucson AZ Arizona Public Service Co.png SVLargeHotel Tucson AZ... 82 KB SVLargeOffice Tucson AZ Arizona Public Service Co.png SVLargeOffice Tucson A... 86 KB SVMediumOffice Tucson AZ Arizona Public Service Co.png SVMediumOffice Tucson ... 75 KB SVMidriseApartment Tucson AZ Arizona Public Service Co.png SVMidriseApartment Tuc... 73 KB SVOutPatient Tucson AZ Arizona Public Service Co.png SVOutPatient Tucson AZ...


Category:Phoenix, AZ | Open Energy Information  

Open Energy Info (EERE)

AZ AZ Jump to: navigation, search Go Back to PV Economics By Location Media in category "Phoenix, AZ" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Phoenix AZ Arizona Public Service Co.png SVFullServiceRestauran... 75 KB SVHospital Phoenix AZ Arizona Public Service Co.png SVHospital Phoenix AZ ... 88 KB SVLargeHotel Phoenix AZ Arizona Public Service Co.png SVLargeHotel Phoenix A... 85 KB SVLargeOffice Phoenix AZ Arizona Public Service Co.png SVLargeOffice Phoenix ... 87 KB SVMediumOffice Phoenix AZ Arizona Public Service Co.png SVMediumOffice Phoenix... 75 KB SVMidriseApartment Phoenix AZ Arizona Public Service Co.png SVMidriseApartment Pho... 73 KB SVOutPatient Phoenix AZ Arizona Public Service Co.png SVOutPatient Phoenix A...


Category:Flagstaff, AZ | Open Energy Information  

Open Energy Info (EERE)

AZ AZ Jump to: navigation, search Go Back to PV Economics By Location Media in category "Flagstaff, AZ" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Flagstaff AZ Salt River Project.png SVFullServiceRestauran... 70 KB SVHospital Flagstaff AZ Salt River Project.png SVHospital Flagstaff A... 83 KB SVLargeHotel Flagstaff AZ Salt River Project.png SVLargeHotel Flagstaff... 77 KB SVLargeOffice Flagstaff AZ Salt River Project.png SVLargeOffice Flagstaf... 83 KB SVMediumOffice Flagstaff AZ Salt River Project.png SVMediumOffice Flagsta... 73 KB SVMidriseApartment Flagstaff AZ Salt River Project.png SVMidriseApartment Fla... 70 KB SVOutPatient Flagstaff AZ Salt River Project.png SVOutPatient Flagstaff... 74 KB SVPrimarySchool Flagstaff AZ Salt River Project.png


AZ Biodiesel | Open Energy Information  

Open Energy Info (EERE)

AZ Biodiesel AZ Biodiesel Jump to: navigation, search Name AZ Biodiesel Place Chandler, Arizona Zip 85225 Product AZ Biodiesel is a biodiesel producer that announced plans in July 2008 to relocate and reopen its main processing facility to Gilbert, Arizona. Coordinates 32.307977°, -95.479539° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":32.307977,"lon":-95.479539,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Douglas, AZ Natural Gas Pipeline Exports to Mexico (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) Douglas, AZ Natural Gas Pipeline Exports to Mexico (Million Cubic Feet) Douglas, AZ Natural Gas Pipeline Exports to Mexico...


Nogales, AZ Natural Gas Pipeline Exports to Mexico (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) Nogales, AZ Natural Gas Pipeline Exports to Mexico (Million Cubic Feet) Nogales, AZ Natural Gas Pipeline Exports to Mexico...


US Mnt(S) AZ Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

Mnt(S) AZ Mnt(S) AZ Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US Mnt(S) AZ Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 3,000 6,000 9,000 12,000 15,000 US Mnt(S) AZ Site Consumption kilowatthours $0 $500 $1,000 $1,500 $2,000 US Mnt(S) AZ Expenditures dollars ELECTRICITY ONLY average per household * Arizona households use 66 million Btu of energy per home, 26% less than the U.S. average. * The combination of lower than average site consumption of all energy, but above average electricity which is relatively expensive, results in Arizona households spending 3% less for energy than the U.S. average. * More reliance on air conditioning keeps average site electricity consumption in the state high relative to other parts of the U.S.


US Mnt(S) AZ Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

Mnt(S) AZ Mnt(S) AZ Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US Mnt(S) AZ Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 3,000 6,000 9,000 12,000 15,000 US Mnt(S) AZ Site Consumption kilowatthours $0 $500 $1,000 $1,500 $2,000 US Mnt(S) AZ Expenditures dollars ELECTRICITY ONLY average per household * Arizona households use 66 million Btu of energy per home, 26% less than the U.S. average. * The combination of lower than average site consumption of all energy, but above average electricity which is relatively expensive, results in Arizona households spending 3% less for energy than the U.S. average. * More reliance on air conditioning keeps average site electricity consumption in the state high relative to other parts of the U.S.


Waste Toolkit A-Z Battery recycling  

E-Print Network (OSTI)

Waste Toolkit A-Z Battery recycling How can I recycle batteries? The University Safety Office is responsible for arranging battery recycling for departments (see Contact at bottom of page). Colleges must make their own arrangements through a registered hazardous waste carrier. Batteries must not be put

Melham, Tom


Waste Toolkit A-Z Light bulbs  

E-Print Network (OSTI)

Waste Toolkit A-Z Light bulbs Can I recycle light bulbs? It depends what type of bulbs you have for the `hazardous' symbol on the packaging or on the light bulb (crossed out wheelie bin symbol). How can I recycle light bulbs? Standard filament bulbs Put in the waste bin (landfill waste) as these are not classified

Melham, Tom


Tank 241-AZ-102 tank characterization plan  

Science Conference Proceedings (OSTI)

The Defense Nuclear Facilities Safety Board has advised the DOE to concentrate the near-term sampling and analysis activities on identification and resolution of safety issues. The Data Quality Objective (DQO) process was chosen as a tool to be used in the resolution of safety issues. As a result, a revision in the Federal Facilities Agreement and Consent Order (Tri-Party Agreement) milestone M-44 has been made, which states that ``A Tank Characterization Plan (TCP) will also be developed for each double-shell tank (DST) and single-shell tank (SST) using the DQO process ... Development of TCPs by the DQO process is intended to allow users to ensure their needs will be met and that resources are devoted to gaining only necessary information``. This document satisfies that requirement for tank 241-AZ-102 (AZ-102) sampling activities. Tank AZ-102 is currently a non-Watch List tank, so the only DQOs applicable to this tank are the safety screening DQO and the compatibility DQO, as described below. The current contents of Tank AZ-102, as of October 31, 1994, consisted of 3,600 kL (950 kgal) of dilute non-complexed waste and aging waste from PUREX (NCAW, neutralized current acid waste). Tank AZ-102 is expected to have two primary layers. The bottom layer is composed of 360 kL of sludge, and the top layer is composed of 3,240 kL of supernatant, with a total tank waste depth of approximately 8.9 meters.

Schreiber, R.D.



Tank 241-AZ-101 tank characterization plan  

Science Conference Proceedings (OSTI)

The Defense Nuclear Facilities Safety Board has advised the DOE to concentrate the near-term sampling and analysis activities on identification and resolution of safety issues. The Data Quality Objective (DQO) process was chosen as a tool to be used in the resolution of safety issues. As a result, A revision in the Federal Facilities Agreement and Consent Order (Tri-Party Agreement) milestone M-44 has been made, which states that ``A Tank Characterization Plan (TCP) will also be developed for each double-shell tank (DST) and single-shell tank (SST) using the DQO process. Development of TCPs by the DQO process is intended to allow users to ensure their needs will be met and that resources are devoted to gaining only necessary information``. This document satisfies that requirement for Tank 241-AZ-101 (AZ-101) sampling activities. Tank AZ-101 is currently a non-Watch List tank, so the only DQOs applicable to this tank are the safety screening DQO and the compatibility DQO, as described below. The contents of Tank AZ-101, as of October 31, 1994, consisted of 3,630 kL (960 kgal) of dilute non-complexed waste and aging waste from PUREX (NCAW, neutralized current acid waste). Tank AZ-101 is expected to have two primary layers. The bottom layer is composed of 132 kL of sludge, and the top layer is composed of 3,500 kL of supernatant, with a total tank waste depth of approximately 8.87 meters.

Schreiber, R.D.



Formation of Vanadate Conversion Coating on AZ31 Magnesium Alloy  

Science Conference Proceedings (OSTI)

In the present investigation, a chromate-free, corrosion-resistant conversion coating using vanadium based solution was applied to AZ31 magnesium alloy.



Science Conference Proceedings (OSTI)

This report presents the analyses results for three samples obtained under RPP-PLAN-28509, Sampling and Analysis Plan for Building 241 702-AZ A Train. The sampling and analysis was done in response to problem evaluation request number PER-2004-6139, 702-AZ Filter Rooms Need Radiological Cleanup Efforts.




241-AZ Farm Annulus Extent of Condition Baseline Inspection  

Science Conference Proceedings (OSTI)

This report provides the results of the comprehensive annulus visual inspection for tanks 241- AZ-101 and 241-AZ-102 performed in fiscal year 2013. The inspection established a baseline covering about 95 percent of the annulus floor for comparison with future inspections. Any changes in the condition are also included in this document.

Engeman, Jason K.; Girardot, Crystal L.; Vazquez, Brandon J.



702AZ aging waste ventilation facility year 2000 test procedure  

SciTech Connect

This test procedure was developed to determine if the 702AZ Tank Ventilation Facility system is Year 2000 Compliant. The procedure provides detailed instructions for performing the operations necessary and documenting the results. This verification procedure will document that the 702AZ Facility Systems are year 2000 compliant and will correctly meet the criteria established in this procedure.

Winkelman, W.D.



Tank 241-AZ-101 and Tank 241-AZ-102 Airlift Circulator Operation Vapor Sampling and Analysis Plan  

DOE Green Energy (OSTI)

This sampling and analysis plan (SAP) identifies characterization objectives pertaining to sample collection, laboratory analytical evaluation, and reporting requirements for vapor samples obtained during the operation of the tank 241-AZ-101 and 241-AZ-102 airlift circulators (ALCs) and during the initial operation (''bump'') of the tank 241-AZ-101 mixer pumps. The purpose of the ALC operation is to support portions of the operational test procedure (OTP) for Project W-030 (OTP-W030-001) and to perform functional test in support of Project W-151. Project W-030 is the 241-A-702 ventilation upgrade project (241-142-702) and Project W-151 is the 241-AZ-101 Mixer Pump Test. The functional tests will check the operability of the tank 241-AZ-101 ALCs. Process Memo's No. 2E98-082 and No. 2E99-001 (LMHC 1999a, LMHC 1999b) direct the operation of the ALCs and the Industrial Hygiene monitoring respectively. A series of tests will be conducted in which the ALCs in tanks 241-AZ-101 and 241-AZ-102 will be operated at different air flow rates. Vapor samples will be obtained to determine constituents that may be present in the tank headspace during ALC operation at tanks 241-AZ-101 and 241-AZ-102 as the waste is disturbed. During the testing, vapor samples will be obtained from the headspace of tanks 241-AZ-101 and 241-AZ-102 via the unused port on the standard hydrogen monitoring system (SHMS). In addition the last two vapor samples will be collected from the headspace of tank 241-AZ-101 during the operation of the mixer pumps. Each mixer pump will be operated for approximately 5 minutes. Results will be used to provide the waste feed delivery program with environmental air permitting data for tank waste disturbing activities. Because of radiological concerns, the samples will be filtered for particulates. It is recognized that this may remove some organic compounds. The following sections provide the general methodology and procedures to be used in the preparation, retrieval, transport, analysis, and reporting of results from vapor samples retrieved during the ALC testing.



Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


City of Williams - AZ, Arizona (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Williams - AZ, Arizona (Utility Company) Williams - AZ, Arizona (Utility Company) Jump to: navigation, search Name City of Williams - AZ Place Arizona Utility Id 56535 Utility Location Yes Ownership M NERC Location WECC NERC WECC Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Buying Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png City owned Lights(20,000 Lumens,400 W MV-Pole) Lighting City owned Lights(4,000 Lumens-Pole) Lighting City owned Lights(7,000 Lumens, 175 W MV-Pole) Lighting Customer owned Lights(20,000 Lumens 400 W MV-Pole) Commercial Customer owned Lights(4,000 Lumens-Pole) Lighting


Influence of Cerium on Stress Corrosion Cracking in AZ91D  

Science Conference Proceedings (OSTI)

This paper considers the effect of cerium additions on the stress corrosion cracking in the Mg-Al-Zn alloy AZ91D. The two dominant phases in the AZ91D...


AZ-101 Mixer Pump Test Qualification Test Procedures (QTP)  

SciTech Connect

Describes the Qualification test procedure for the AZ-101 Mixer Pump Data Acquisition System (DAS). The purpose of this Qualification Test Procedure (QTP) is to confirm that the AZ-101 Mixer Pump System has been properly programmed and hardware configured correctly. This QTP will test the software setpoints for the alarms and also check the wiring configuration from the SIMcart to the HMI. An Acceptance Test Procedure (ATP), similar to this QTP will be performed to test field devices and connections from the field.




A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. ...


Nogales, AZ Liquefied Natural Gas Exports to Mexico (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Million Cubic Feet) Nogales, AZ Liquefied Natural Gas Exports to Mexico (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2012 8.938 8.916 5.241 3.570 4.280...


Mixer pump test plan for double shell tank AZ-101  

Science Conference Proceedings (OSTI)

Mixer pump systems have been chosen as the method for retrieval of tank wastes contained in double shell tanks at Hanford. This document describes the plan for testing and demonstrating the ability of two 300 hp mixer pumps to mobilize waste in tank AZ-101. The mixer pumps, equipment and instrumentation to monitor the test were installed by Project W-151.




Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.



U.S. Energy Information Administration (EIA) Indexed Site

Liquids Reserve Class Liquids Reserve Class No 2001 liquids reserves 0.1 - 10 Mbbl 10.1 - 100 Mbbl 100.1 - 1,000 Mbbl 1,000.1- 10,000 Mbbl 10,000.1 - 100,000 Mbbl Basin Outline AZ UT NM CO 1 2 Index Map for 2 Paradox-San Juan Panels 2001 Reserve Summary for All Paradox-San Juan Basin Fields Total Total Total Number Liquid Gas BOE of Reserves Reserves Reserves Fields (Mbbl) (MMcf) (Mbbl) Paradox-San Juan 250 174,193 20,653,622 3,616,464 Basin CO NM IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO BASIN BASIN BLAN CO BLAN CO BASIN BASIN BASIN BASIN BASIN BASIN BISTI BAL LAR D BASIN BISTI BLA NCO S OT ERO BAL LAR D LIND RITH W BASIN BLA NCO BLA NCO S BLA NCO S TAPAC ITO GAVIL AN BASIN BLA NCO The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by



U.S. Energy Information Administration (EIA) Indexed Site

BOE Reserve Class BOE Reserve Class No 2001 reserves 0.1 - 10 MBOE 10.1 - 100 MBOE 100.1 - 1,000 MBOE 1,000.1- 10,000 MBOE 10,000.1 - 100,000 MBOE > 100,000 MBOE Basin Outline AZ UT NM CO 1 2 Index Map for 2 Paradox-San Juan Panels 2001 Reserve Summary for All Paradox-San Juan Basin Fields Total Total Total Number Liquid Gas BOE of Reserves Reserves Reserves Fields (Mbbl) (MMcf) (Mbbl) Paradox-San Juan 250 174,193 20,653,622 3,616,464 Basin CO NM IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO BASIN BASIN BLAN CO BLAN CO BASIN BASIN BASIN BASIN BASIN BASIN BISTI BAL LAR D BASIN BISTI BLA NCO S OT ERO BAL LAR D LIND RITH W BASIN BLA NCO BLA NCO S BLA NCO S TAPAC ITO GAVIL AN BASIN BLA NCO The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by



U.S. Energy Information Administration (EIA) Indexed Site

Gas Reserve Class Gas Reserve Class No 2001 gas reserves 0.1 - 10 MMCF 10.1 - 100 MMCF 100.1 - 1,000 MMCF 1,000.1- 10,000 MMCF 10,000.1 - 100,000 MMCF > 100,000 MMCF Basin Outline AZ UT NM CO 1 2 Index Map for 2 Paradox-San Juan Panels 2001 Reserve Summary for All Paradox-San Juan Basin Fields Total Total Total Number Liquid Gas BOE of Reserves Reserves Reserves Fields (Mbbl) (MMcf) (Mbbl) Paradox-San Juan 250 174,193 20,653,622 3,616,464 Basin CO NM IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO BASIN BASIN BLAN CO BLAN CO BASIN BASIN BASIN BASIN BASIN BASIN BISTI BAL LAR D BASIN BISTI BLA NCO S OT ERO BAL LAR D LIND RITH W BASIN BLA NCO BLA NCO S BLA NCO S TAPAC ITO GAVIL AN BASIN BLA NCO The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by


Safety analysis for tank 241-AZ-101 mixer pump process test  

Science Conference Proceedings (OSTI)

This document establishes the safety envelope for Project W-151,the process test of two mixer pumps in AWF waste tank 241-AZ-101.

Milliken, N.J., Westinghouse Hanford



A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A-Z Topics lists topics with relevance to a broad cross-section of our Web site's audiences. The items are representative of popular topics or publications, ...


ICME Modeling of a Super Vacuum Die Cast (SVDC) AZ91 ...  

Science Conference Proceedings (OSTI)

... of a super vacuum die cast (SVDC) AZ91 automotive shock tower component. .... PI-7: A Three-dimensional Lattice Boltzmann Model for Columnar Dendrite...


241-AZ Tank Farm Construction Extent of Condition Review for Tank Integrity  

SciTech Connect

This report provides the results of an extent of condition construction history review for tanks 241-AZ-101 and 241-AZ-102. The construction history of the 241-AZ tank farm has been reviewed to identify issues similar to those experienced during tank AY-102 construction. Those issues and others impacting integrity are discussed based on information found in available construction records, using tank AY-102 as the comparison benchmark. In the 241-AZ tank farm, the second DST farm constructed, both refractory quality and tank and liner fabrication were improved.

Barnes, Travis J.; Boomer, Kayle D.; Gunter, Jason R.; Venetz, Theodore J.



COUNTRY INSTITUTION DATE WEB ADDRESS AZERBAIJAN Azerbaijan Medical University 15.03.2011 http://amu.edu.az/  

E-Print Network (OSTI)

COUNTRY INSTITUTION DATE WEB ADDRESS AZERBAIJAN Azerbaijan Medical University 15.03.2011 http://amu.edu.az/ AZERBAIJAN Baku State University 23.09.2011 http://bsu.edu.az/en/ AZERBAIJAN University of Architecture

Di Pillo, Gianni


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed

Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE Challenge Home Case Study, Mandalay Homes, Phoenix, AZ, Affordable  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mandalay Mandalay Homes Phoenix, AZ BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.


Influence of Aluminum Content on Grain Refinement and Strength of AZ31 Magnesium GTA Weld Metal  

SciTech Connect

The goal is to characterize the effect of Al content on AZ31 weld metal, the grain size and strength, and examine role of Al on grain refinement. The approach is to systematically vary the aluminum content of AZ31 weld metal, Measure average grain size in weld metal, and Measure cross-weld tensile properties and hardness. Conclusions are that: (1) increased Al content in AZ31 weld metal results in grain refinement Reason: higher undercooling during solidification; (2) weld metal grain refinement resulted in increased strength & hardness Reason: grain boundary strengthening; and (3) weld metal strength can be raised to wrought base metal levels.

Babu, N. Kishore [Singapore Institute of Manufacturing Technology; Cross, Carl E. [Los Alamos National Laboratory




NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


DOE - Office of Legacy Management -- Monument Valley Mill Site - AZ 0-01  

Office of Legacy Management (LM)

Monument Valley Mill Site - AZ 0-01 Monument Valley Mill Site - AZ 0-01 FUSRAP Considered Sites Site: Monument Valley Mill Site (AZ.0-01) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: Also see Monument Valley, Arizona, Processing Site Documents Related to Monument Valley Mill Site Data Validation Package for the June 2009 Water Sampling at the Monument Valley, Arizona, Processing Site; LMS/MON/S0609; October 2009 Natural and Enhanced Attenuation of Soil and Ground Water at Monument Valley, Arizona, and Shiprock, New Mexico 2006 Status Report June 2008 Data Validation Package for 2007 Groundwater Sampling at the Monument Valley, AZ Processing Site


A Review on Severe Plastic Deformation of the Magnesium Alloy AZ31  

Science Conference Proceedings (OSTI)

... Ukraine, Poland, Korea, Iran, Israel and China. In this paper an effort is made to review the work done on AZ31 using SPD processes to improve its properties.


System Description for Tank 241-AZ-101 Waste Retrieval Data Acquisition System  

SciTech Connect

The proposed activity provides the description of the Data Acquisition System for Tank 241-AZ-101. This description is documented in HNF-5572, Tank 241-AZ-101 Waste Retrieval Data Acquisition System (DAS). This activity supports the planned mixer pump tests for Tank 241-AZ-101. Tank 241-AZ-101 has been selected for the first full-scale demonstration of a mixer pump system. The tank currently holds over 960,000 gallons of neutralized current acid waste, including approximately 12.7 inches of settling solids (sludge) at the bottom of the tank. As described in Addendum 4 of the FSAR (LMHC 2000a), two 300 HP mixer pumps with associated measurement and monitoring equipment have been installed in Tank 241-AZ-101. The purpose of the Tank 241-AZ-101 retrieval system Data Acquisition System (DAS) is to provide monitoring and data acquisition of key parameters in order to confirm the effectiveness of the mixer pumps utilized for suspending solids in the tank. The suspension of solids in Tank 241-AZ-101 is necessary for pretreatment of the neutralized current acid waste and eventual disposal as glass via the Hanford Waste Vitrification Plant. HNF-5572 provides a basic description of the Tank 241-AZ-101 retrieval system DAS, including the field instrumentation and application software. The DAS is provided to fulfill requirements for data collection and monitoring. This document is not an operations procedure or is it intended to describe the mixing operation. This USQ screening provides evaluation of HNF-5572 (Revision 1) including the changes as documented on ECN 654001. The changes include (1) add information on historical trending and data backup, (2) modify DAS I/O list in Appendix E to reflect actual conditions in the field, and (3) delete IP address in Appendix F per Lockheed Martin Services, Inc. request.




Final results of double-shell tank 241-AZ-101 ultrasonic inspection  

SciTech Connect

This document presents the results and documentation of the nondestructive ultrasonic examination of tank 241-AZ-101. A tank inspection supplier was retained to provide and use an ultrasonic examination system (equipment, procedures, and inspectors) to scan a limited area of double-shell tank 241-AZ-101 primary tank wall and welds. The inspection found one reportable indication of thinning and no reportable pitting, corrosion, or cracking.




DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


EIS-0440: Quartzsite Solar Energy Project, La Paz County, AZ | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0: Quartzsite Solar Energy Project, La Paz County, AZ 0: Quartzsite Solar Energy Project, La Paz County, AZ EIS-0440: Quartzsite Solar Energy Project, La Paz County, AZ Summary This EIS evaluates the environmental impacts of interconnecting a proposed 100-megawatt concentrating solar power plant to Western's Bouse-Kofa 161-kilovolt transmission line. The proposal includes amending the Bureau of Land Management Resource Management Plan. Cooperating agencies in the preparation of this EIS are Bureau of Land Management (Yuma Field Office ), U.S. Army Corps of Engineers, U.S. Army Garrison (Yuma Proving Grounds), Arizona Game and Fish Department, and the Arizona Department of Environmental Quality. Further information is available for this Project on the Western Area Power Administration Website Public Comment Opportunities


DOE - Office of Legacy Management -- Tuba City Mill Site - AZ 0-02  

Office of Legacy Management (LM)

Mill Site - AZ 0-02 Mill Site - AZ 0-02 FUSRAP Considered Sites Site: Tuba City Mill Site (AZ.0-02 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: Also see Tuba City, Arizona, Disposal Site Documents Related to Tuba City Mill Site 2012 Annual Site Inspection and Monitoring Report for Uranium Mill Tailings Radiation Control Act Title I Disposal Sites-Tuba City, Arizona, Disposal Site. LMS/S09461. February 2013 2008 UMTRCA Title I Annual Report January 2009 Tuba City, Arizona February 2009 Groundwater and Surface Water Sampling at the Tuba City, Arizona Disposal Site May 2009 This fact sheet provides information about the Uranium Mill Tailings


DOE Solar Decathlon: News Blog » AZ State/New Mexico  

NLE Websites -- All DOE Office Websites (Extended Search)

AZ State/New Mexico AZ State/New Mexico Below you will find Solar Decathlon news from the AZ State/New Mexico archive, sorted by date. Transportation Issues Challenge Teams on the Second Day of Assembly Tuesday, September 24, 2013 By Richard King On the second day of assembly, everyone seems to be settling in for the long haul. Either they were exhausted from working 18 hours straight on Monday or the adrenalin of the first day excitement had worn off. Either way, there was a constant but steadier pace to the work today. The U.S. Department of Energy Solar Decathlon is a marathon, not a sprint, and the teams understand that. Photo of two decathletes wearing hard hats, safety glasses, and safety vests. Safety is our number one priority. Here, two members of the Vienna University of Technology team display their safety equipment, including


EIS-0440: Quartzsite Solar Energy Project, La Paz County, AZ | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

40: Quartzsite Solar Energy Project, La Paz County, AZ 40: Quartzsite Solar Energy Project, La Paz County, AZ EIS-0440: Quartzsite Solar Energy Project, La Paz County, AZ Summary This EIS evaluates the environmental impacts of interconnecting a proposed 100-megawatt concentrating solar power plant to Western's Bouse-Kofa 161-kilovolt transmission line. The proposal includes amending the Bureau of Land Management Resource Management Plan. Cooperating agencies in the preparation of this EIS are Bureau of Land Management (Yuma Field Office ), U.S. Army Corps of Engineers, U.S. Army Garrison (Yuma Proving Grounds), Arizona Game and Fish Department, and the Arizona Department of Environmental Quality. Further information is available for this Project on the Western Area Power Administration Website Public Comment Opportunities


Tank 241-AZ-101 Mixer Pump Test Vapor Sampling and Analysis Plan  

Science Conference Proceedings (OSTI)

This sampling and analysis plan (SAP) identifies characterization objectives pertaining to sample collection, laboratory analytical evaluation, and reporting requirements for vapor samples obtained during the operation of mixer pumps in tank 241-AZ-101. The primary purpose of the mixer pump test (MPT) is to demonstrate that the two 300 horsepower mixer pumps installed in tank 241-AZ-101 can mobilize the settled sludge so that it can be retrieved for treatment and vitrification. Sampling will be performed in accordance with Tank 241-AZ-101 Mixer Pump Test Data Quality Objective (Banning 1999) and Data Quality Objectives for Regulatory Requirements for Hazardous and Radioactive Air Emissions Sampling and Analysis (Mulkey 1999). The sampling will verify if current air emission estimates used in the permit application are correct and provide information for future air permit applications.




Tank 241-AZ-101 Mixer Pump Test Vapor Sampling and Analysis Plan  

Science Conference Proceedings (OSTI)

This sampling and analysis plan (SAP) identifies characterization objectives pertaining to sample collection, laboratory analytical evaluation, and reporting requirements for vapor samples obtained during the operation of mixer pumps in tank 241-AZ-101. The primary purpose of the mixer pump test (MPT) is to demonstrate that the two 300 horsepower mixer pumps installed in tank 241-AZ-101 can mobilize the settled sludge so that it can be retrieved for treatment and vitrification. Sampling will be performed in accordance with Tank 241-AZ-101 Mixer Pump Test Data Quality Objective (Banning 1999) and Data Quality Objectives for Regulatory Requirements for Hazardous and Radioactive Air Emissions Sampling and Analysis (Mulkey 1999). The sampling will verify if current air emission estimates used in the permit application are correct and provide information for future air permit applications.




Tank 241-AZ-101 Mixer Pump Test Vapor Sampling and Analysis Plan  

SciTech Connect

This sampling and analysis plan (SAP) identifies characterization objectives pertaining to sample collection, laboratory analytical evaluation, and reporting requirements for vapor samples obtained during the operation of mixer pumps in tank 241-AZ-101. The primary purpose of the mixer pump test (MPT) is to demonstrate that the two 300 horsepower mixer pumps installed in tank 241-AZ-101 can mobilize the settled sludge so that it can be retrieved for treatment and vitrification Sampling will be performed in accordance with Tank 241-AZ-101 Mixer Pump Test Data Quality Objective (Banning 1999) and Data Quality Objectives for Regulatory Requirements for Hazardous and Radioactive Air Emissions Sampling and Analysis (Mulkey 1999). The sampling will verify if current air emission estimates used in the permit application are correct and provide information for future air permit applications.



Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


H2A.Z Acidic Patch Couples Chromatin Dynamics to Regulation of Gene Expression Programs during ESC Differentiation  

E-Print Network (OSTI)

The histone H2A variant H2A.Z is essential for embryonic development and for proper control of developmental gene expression programs in embryonic stem cells (ESCs). Divergent regions of amino acid sequence of H2A.Z likely ...

Subramanian, Vidya


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


Category:Albuquerque, NM | Open Energy Information  

Open Energy Info (EERE)

Albuquerque, NM Albuquerque, NM Jump to: navigation, search Go Back to PV Economics By Location Media in category "Albuquerque, NM" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Albuquerque NM Public Service Co of NM.png SVFullServiceRestauran... 66 KB SVQuickServiceRestaurant Albuquerque NM Public Service Co of NM.png SVQuickServiceRestaura... 65 KB SVHospital Albuquerque NM Public Service Co of NM.png SVHospital Albuquerque... 80 KB SVLargeHotel Albuquerque NM Public Service Co of NM.png SVLargeHotel Albuquerq... 64 KB SVLargeOffice Albuquerque NM Public Service Co of NM.png SVLargeOffice Albuquer... 82 KB SVMediumOffice Albuquerque NM Public Service Co of NM.png SVMediumOffice Albuque... 69 KB SVMidriseApartment Albuquerque NM Public Service Co of NM.png



SciTech Connect

This report documents the preparation of three actual Hanford tank waste samples for shipment to the Savannah River National Laboratory (SRNL). Two of the samples were dissolved saltcakes from tank 241-AN-103 (hereafter AN-103) and tank 241-SX-105 (hereafter SX-105); one sample was a supernate composite from tanks 241-AZ-101 and 241-AZ-102 (hereafter AZ-101/102). The preparation of the samples was executed following the test plans LAB-PLAN-10-00006, Test Plan for the Preparation of Samples from Hanford Tanks 241-SX-105, 241-AN-103, 241-AN-107, and LAB-PLN-l0-00014, Test Plan for the Preparation of a Composite Sample from Hanford Tanks 241-AZ-101 and 241-AZ-102 for Steam Reformer Testing at the Savannah River National Laboratory. All procedural steps were recorded in laboratory notebook HNF-N-274 3. Sample breakdown diagrams for AN-103 and SX-105 are presented in Appendix A. The tank samples were prepared in support of a series of treatability studies of the Fluidized Bed Steam Reforming (FBSR) process using a Bench-Scale Reformer (BSR) at SRNL. Tests with simulants have shown that the FBSR mineralized waste form is comparable to low-activity waste glass with respect to environmental durability (WSRC-STI-2008-00268, Mineralization of Radioactive Wastes by Fluidized Bed Steam Reforming (FBSR): Comparisons to Vitreous Waste Forms and Pertinent Durability Testing). However, a rigorous assessment requires long-term performance data from FBSR product formed from actual Hanford tank waste. Washington River Protection Solutions, LLC (WRPS) has initiated a Waste Form Qualification Program (WP-5.2.1-2010-001, Fluidized Bed Steam Reformer Low-level Waste Form Qualification) to gather the data required to demonstrate that an adequate FBSR mineralized waste form can be produced. The documentation of the selection process of the three tank samples has been separately reported in RPP-48824, Sample Selection Process for Bench-Scale Steam Reforming Treatability Studies Using Hanford Waste Samples.




A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A. Abbreviations, energy related; About ...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. G. Gabon Country Energy Profile;


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. L. Landfill Gas; Laos Country Energy Profile ;


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A. Abbreviations, energy related; About U.S ...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. F. Factors Affecting Natural Gas Prices ...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. D. Daily Spot Prices of Crude Oil; Dealer Tank Wagon ...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. O. Ocean Thermal Energy Conversion ...


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Tank 241-AZ-101 criticality assessment resulting from pump jet mixing: Sludge mixing simulation  

SciTech Connect

Tank 241-AZ-101 (AZ-101) is one of 28 double-shell tanks located in the AZ farm in the Hanford Site`s 200 East Area. The tank contains a significant quantity of fissile materials, including an estimated 9.782 kg of plutonium. Before beginning jet pump mixing for mitigative purposes, the operations must be evaluated to demonstrate that they will be subcritical under both normal and credible abnormal conditions. The main objective of this study was to address a concern about whether two 300-hp pumps with four rotating 18.3-m/s (60-ft/s) jets can concentrate plutonium in their pump housings during mixer pump operation and cause a criticality. The three-dimensional simulation was performed with the time-varying TEMPEST code to determine how much the pump jet mixing of Tank AZ-101 will concentrate plutonium in the pump housing. The AZ-101 model predicted that the total amount of plutonium within the pump housing peaks at 75 g at 10 simulation seconds and decreases to less than 10 g at four minutes. The plutonium concentration in the entire pump housing peaks at 0.60 g/L at 10 simulation seconds and is reduced to below 0.1 g/L after four minutes. Since the minimum critical concentration of plutonium is 2.6 g/L, and the minimum critical plutonium mass under idealized plutonium-water conditions is 520 g, these predicted maximums in the pump housing are much lower than the minimum plutonium conditions needed to reach a criticality level. The initial plutonium maximum of 1.88 g/L still results in safety factor of 4.3 in the pump housing during the pump jet mixing operation.

Onishi, Y.; Recknagle, K.



Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



File:NREL-az-80m.pdf | Open Energy Information  

Open Energy Info (EERE)

az-80m.pdf az-80m.pdf Jump to: navigation, search File File history File usage Arizona Annual Average Wind Speed at 80 Meters Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 1.24 MB, MIME type: application/pdf) Description Arizona Annual Average Wind Speed at 80 Meters Sources National Renewable Energy Laboratory Related Technologies Wind Creation Date 2010-01-15 Extent State Countries United States UN Region Northern America States Arizona File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 15:00, 21 December 2010 Thumbnail for version as of 15:00, 21 December 2010 1,275 × 1,650 (1.24 MB) MapBot (Talk | contribs) Automated upload from NREL's "mapsearch" data

Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


File:USDA-CE-Production-GIFmaps-AZ.pdf | Open Energy Information  

Open Energy Info (EERE)

AZ.pdf AZ.pdf Jump to: navigation, search File File history File usage Arizona Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 249 KB, MIME type: application/pdf) Description Arizona Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Arizona External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:11, 27 December 2010 Thumbnail for version as of 16:11, 27 December 2010 1,650 × 1,275 (249 KB) MapBot (Talk | contribs) Automated bot upload


DOE - Office of Legacy Management -- Tuba City AEC Ore Buying Station - AZ  

NLE Websites -- All DOE Office Websites (Extended Search)

AEC Ore Buying Station - AEC Ore Buying Station - AZ 0-02A FUSRAP Considered Sites Site: Tuba City AEC Ore Buying Station (AZ.0-02A) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: The history of domestic uranium procurement under U.S. Atomic Energy Commission (AEC) contracts identifies a number of ore buying stations (sampling and storage sites) that were operated during the period late-1949 through the mid-1960s. During this period the AEC established ore-buying stations in new uranium producing areas where it appeared that ore production would be sufficient to support a uranium milling operation. The ideal scenario was to accumulate a sufficient stockpile of ore and


Anemometer Data (Wind Speed, Direction) for Pascua Yaqui, AZ (2003 - 2004)  

Open Energy Info (EERE)

Pascua Yaqui, AZ (2003 - 2004) Pascua Yaqui, AZ (2003 - 2004) Dataset Summary Description Wind data collected from Pascua Yaqui Indian Reservation in Arizona from an anemometer as part of the Native American anemometer loan program. Monthly mean wind speed is available for 2003 through 2004, as is wind direction and turbulence data. Data is reported from a height of 20 m. The data was originally made available by Wind Powering America, a DOE Office of Energy Efficiency & Renewable Energy (EERE) program. A dynamic map displaying all available data from DOE anemometer loan programs is available http://www.windpoweringamerica.gov/anemometerloans/projects.asp. Source EERE Date Released December 02nd, 2010 (3 years ago) Date Updated December 02nd, 2010 (3 years ago) Keywords wind


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA) Indexed Site

A-Z Index A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ A Abbreviations, energy related About U.S. Natural Gas Pipelines (U.S. & state) Acid rain (U.S., Census division, & state) Definition Emissions data Overview Acquisitions and Divestitures by Foreign Direct Investors in U.S. Energy (report) Activities for kids Additions to storage (natural gas; includes U.S. & state) Underground, by all operators Underground, by storage type Liquefied natural gas additions and withdrawals Addresses of electric companies Utility Nonutility AEO (See Annual Energy Outlook) AER (Annual Energy Review - report with annual U.S. data back to 1949) Afghanistan Country Analysis Brief Africa - Country Analysis Briefs Air-conditioning, number of households with



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


Sandia National Laboratory (NM) Former Workers, Construction...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Former Workers, Construction Worker Screening Projects Sandia National Laboratory (NM) Former Workers, Construction Worker Screening Projects...


DOE - Office of Legacy Management -- Chupadera Mesa NM Site - NM 04  

Office of Legacy Management (LM)

Chupadera Mesa NM Site - NM 04 Chupadera Mesa NM Site - NM 04 FUSRAP Considered Sites Chupadera Mesa, NM Alternate Name(s): None Location: Approximately 28 miles northeast of the Trinity nuclear test site on the White Sands Missile Range, Northeast of Bingham, New Mexico NM.04-5 Historical Operations: Received the deposition of longer-lived radionuclides in the fallout from the nuclear test, primarily cesium-137, strontium-90, plutonium-239, cobalt-60, and europium-155. NM.04-2 NM.04-5 Eligibility Determination: No further action required. Radiation levels below cleaunup criteria. NM.04-1 NM.04-2 Radiological Survey(s): Assessment Surveys NM.04-3 NM.04-4 Site Status: NA - No Further Action Required NM.04-1 NM.04-2 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


DOE - Office of Legacy Management -- Bayo Canyon NM Site - NM 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Bayo Canyon NM Site - NM 01 Bayo Canyon NM Site - NM 01 FUSRAP Considered Sites Bayo Canyon, NM Alternate Name(s): Bayo Canyon Area Bayo Canyon (TA-10) Site NM.01-2 Location: Canyon in the Pajarito Plateau Region in Los Alamos County, Los Alamos, NM NM.01-3 Historical Operations: Used in 1944-1961 by the MED and later AEC at Los Alamos National Laboratory as a firing site for conventional and high-explosives experiments involving natural and depleted uranium, strontium, and lanthanum as a radiation source for blast diagnosis. NM.01-3 NM.01-5 Eligibility Determination: Eligible NM.01-1 Radiological Survey(s): Assessment Survey NM.01-3 Site Status: Certified- Certification Basis NM.01-5 NM.01-6 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Analysis of natural gases, Rocky Mtn. Region (AZ, CO, MT, NM, UT and WY), 1951-1991 (for microcomputers). Data file  

Science Conference Proceedings (OSTI)

The U.S. Bureau of Mines diskette contains analysis and related source data for 2,545 natural gas samples collected from Rocky Mountain Region, which include the following states: Arizona, Colorado, Montana, New Mexico, Utah, and Wyoming. All samples were obtained and analyzed as part of the Bureau's investigations of the occurrences of helium in natural gases of countries with free market economies. The survey has been conducted since 1917. The analysis contained on the diskette: READ.ME, RCKMTN.TXT, RCKMTN.DBF, USHEANAL.DBF, and BASINCDE.TXT. The READ.ME file contains documentation. The RCKMTN.TXT file contains 2,545 natural gas analysis records in ASCII nondelimited, fixed-length format. The length of each record is 411 characters.

Not Available



Evaluation of 241-AZ tank farm supporting phase 1 privatization waste feed delivery  

Science Conference Proceedings (OSTI)

This evaluation is one in a series of evaluations determining the process needs and assessing the adequacy of existing and planned equipment in meeting those needs at various double-shell tank farms in support of Phase 1 privatization. A number of tank-to-tank transfers and waste preparation activities are needed to process and feed waste to the private contractor in support of Phase 1 privatization. The scope of this evaluation is limited to process needs associated with 241-AZ tank farm during the Phase 1 privatization.




Review of technology for 157-nm lithography  

Science Conference Proceedings (OSTI)

This paper outlines the critical issues facing the implementation of 157-nm lithography as a sub-100-nm technology. The status of the present technology for mask materials, pellicles, optical materials, coatings, and resists is presented.

A. K. Bates; M. Rothschild; T. M. Bloomstein; T. H. Fedynyshyn; R. R. Kunz; V. Liberman; M. Switkes



,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


CSER 96-014: criticality safety of project W-151, 241-AZ-101 retrieval system process test  

Science Conference Proceedings (OSTI)

This Criticality Safety Evaluation Report (CSER) documents a review of the criticality safety implications of a process test to be performed in tank 241-AZ-101 (101-AZ). The process test will determine the effectiveness of the retrieval system for mobilization of solids and the practicality of the system for future use in the underground storage tanks at Hanford. The scope of the CSER extends only to the testing and operation of the mixer pumps and does not include the transfer of waste from the tank. Justification is provided that a nuclear criticality is extremely unlikely, if not impossible, in this tank.

Vail, T.S., Fluor Daniel Hanford



Archaeological data recovery at drill hole U19az, Nevada Test Site, Nye County, Nevada  

Science Conference Proceedings (OSTI)

At the request of the Department of Energy, Nevada Field Office (DOE/NV), the Desert Research Institute (DRI) conducted archaeological data recovery at drill hole U19az on the Nevada Test Site in February 1988 and April 1990. The work focused on a site that was recommended as eligible to the National Register of Historic Places. DOE/NV chose to mitigate adverse impacts to the site though a data recovery program. The mapping and collection of artifacts took place in two discrete areas, covering almost 10 hectares (24.71 acres). In addition to surface collection, 11 test pits and 12 surface scrapes were excavated. Information was sought to address four research questions concerned with the age of the site, the subsistence and demography of the site's inhabitants, and the behavioral implications of their lithic technology. This report describes and presents the results of the data recovery at drill hole U19az. The analyses of the artifacts indicate that the site was inhabited between 5,000 years ago and historic times. Relative artifact abundance indicates the most intense use occurred from about 4,000 to 1,500 years ago.

Lancaster, J.



Archaeological data recovery at drill hole U19az, Nevada Test Site, Nye County, Nevada  

SciTech Connect

At the request of the Department of Energy, Nevada Field Office (DOE/NV), the Desert Research Institute (DRI) conducted archaeological data recovery at drill hole U19az on the Nevada Test Site in February 1988 and April 1990. The work focused on a site that was recommended as eligible to the National Register of Historic Places. DOE/NV chose to mitigate adverse impacts to the site though a data recovery program. The mapping and collection of artifacts took place in two discrete areas, covering almost 10 hectares (24.71 acres). In addition to surface collection, 11 test pits and 12 surface scrapes were excavated. Information was sought to address four research questions concerned with the age of the site, the subsistence and demography of the site`s inhabitants, and the behavioral implications of their lithic technology. This report describes and presents the results of the data recovery at drill hole U19az. The analyses of the artifacts indicate that the site was inhabited between 5,000 years ago and historic times. Relative artifact abundance indicates the most intense use occurred from about 4,000 to 1,500 years ago.

Lancaster, J.



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.

Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


157-nm lithography with high numerical aperture lens for sub-70 nm node  

Science Conference Proceedings (OSTI)

For sub-70 nm semiconductor devices, 157 nm lithography using F2 lasers is one of the most important technologies. Several candidates for critical components of 157 nm lithography, such as the exposure tool, resist materials and processing ... Keywords: 157 nm lithography, F2 laser, fluoropolymer resist, phase-shifting mask

Toshiro Itani; Wataru Wakamiya; Julian Cashmore; Malcolm Gower



Pump Jet Mixing and Pipeline Transfer Assessment for High-Activity Radioactive Wastes in Hanford Tank 241-AZ-102  

SciTech Connect

The authors evaluated how well two 300-hp mixer pumps would mix solid and liquid radioactive wastes stored in Hanford double-shell Tank 241-AZ-102 (AZ-102) and confirmed the adequacy of a three-inch (7.6-cm) pipeline system to transfer the resulting mixed waste slurry to the AP Tank Farm and a planned waste treatment (vitrification) plant on the Hanford Site. Tank AZ-102 contains 854,000 gallons (3,230 m{sup 3}) of supernatant liquid and 95,000 gallons (360 m{sup 3}) of sludge made up of aging waste (or neutralized current acid waste). The study comprises three assessments: waste chemistry, pump jet mixing, and pipeline transfer. The waste chemical modeling assessment indicates that the sludge, consisting of the solids and interstitial solution, and the supernatant liquid are basically in an equilibrium condition. Thus, pump jet mixing would not cause much solids precipitation and dissolution, only 1.5% or less of the total AZ-102 sludge. The pump jet mixing modeling indicates that two 300-hp mixer pumps would mobilize up to about 23 ft (7.0 m) of the sludge nearest the pump but would not erode the waste within seven inches (0.18 m) of the tank bottom. This results in about half of the sludge being uniformly mixed in the tank and the other half being unmixed (not eroded) at the tank bottom.

Y Onishi; KP Recknagle; BE Wells



WM'05 Conference, February 27 March 3, 2005, Tucson, AZ WM-5202 INTERNATIONAL APPROACH TO MONITORING FOR RADIOACTIVELY  

E-Print Network (OSTI)

acceptable scrap metal radiation monitoring and response protocol. Second, international training programs radiation exposure to workers and the public, this unwanted radioactive scrap material causes environmentalWM'05 Conference, February 27 ­ March 3, 2005, Tucson, AZ WM-5202 1 INTERNATIONAL APPROACH



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5 5 Recipient: County ut Pinal, AZ ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM Activities Determination/ Categorical Exclusion Reviewer's Specific Instructions and Rationale (Restrictions and Allowable Activity) Activity 1 - Energy Efficiency Audits A9, All This NEPA determination is limited to conducting audits/compiling the results of the audits/and making recommendations only. (see Activity 4 for audit implementation activities) Activity 2 - Energy Efficiency Municipal Partnership A9, All, B5.1 Waste Stream Clause Historic Preservation Clause Engineering clause Activity 3 - Ironwood-Gantzel Roadway Traffic Lights Synchronization A9 None Activity 4 - Energy Efficiency Corrective Measures Implementation A9, All, B5.1 Waste Stream Clause Historic Preservation Clause



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

emergency wood pole emergency wood pole replacement at 59 structures located along the Coolidge-Oracle 115-kV T.L. , near Cooiidge, Florence & Oracle Junction, Pinal County, AZ, RECORD OF CATEGORICAL EXCLUSION DETERMINATION A. Proposed Action: Western plans to replace deteriorated wood poles, cross arms and X-braces at 59 existing H-frame or 3-pole-turning structures (Table 1) located along the Coolidge-Oracle 115-kV Transmission Line in Pinal County, Arizona (Figure 1), Built in 1943, its aging components are beyond repair and require replacement. These poles performed poorly during structural tests, and we consider them unstable, This project ensures the safety of Western's workers and the public as well as reliability of the bulk electric system, Western will accomplish the work by clearing vegetation and blading a level pad at


Tank 241-AZ-101 prototype corrosion probe four month status report  

SciTech Connect

High-level nuclear wastes at the Hanford Site are stored underground in carbon steel double-shell and single-shell tanks. The installation of a prototype corrosion monitoring system into double-shell tank 241-AZ-101 was completed in August, 1996. The system monitors fluctuations in corrosion current and potential (electrochemical noise) occurring on three electrode arrays immersed in the waste liquid and in the vapor space above the waste. The system also supports the use of Tafel and linear polarization resistance testing. By monitoring and analyzing the data from these techniques, changes in the corrosive characteristics of the waste have been rapidly detected and correlated with operational changes in the tank.

Edgemon, G.L., Westinghouse Hanford



Evaluation of cracking in the 241-AZ tank farm ventilation line at the Hanford Site  

Science Conference Proceedings (OSTI)

In the period from April to October of 1988, a series of welding operations on the outside of the AZ Tank Farm ventilation line piping at the Hanford Site produced unexpected and repeated cracking of the austenitic stainless steel base metal and of a seam weld in the pipe. The ventilation line is fabricated from type 304L stainless steel pipe of 24 inch diameter and 0.25 inch wall thickness. The pipe was wrapped in polyethylene bubble wrap and buried approximately 12 feet below grade. Except for the time period between 1980 and 1987, impressed current cathodic protection has been applied to the pipe since its installation in 1974. The paper describes the history of the cracking of the pipe, the probable cracking mechanisms, and the recommended future action for repair/replacement of the pipe.




St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


241-AZ-101 Mixer Pump Demonstration Test Gamma Cart Acceptance Test Procedure and Quality Test Plan (ATP and QTP)  

Science Conference Proceedings (OSTI)

Shop Test of the Gamma Cart System to be used in the AZ-101 Mixer Pump Demonstration Test. Tests hardware and software. This procedure involves testing the Instrumentation involved with the Gamma Cart System, local and remote, including: depth indicators, speed controls, interface to data acquisition software and the raising and lowering functions. This Procedure will be performed twice, once for each Gamma Cart System. This procedure does not test the accuracy of the data acquisition software.




241-AZ-101 Mixer Pump Demonstration Test Gamma Cart Acceptance Test Procedure and Quality Test Plan (ATP and QTP)  

SciTech Connect

Shop test of the sludge mobilization cart system to be used in the AZ-101 Mixer Pump Demonstration Test Tests hardware and software. This procedure involves testing the Instrumentation involved with the Gamma Cart System, local and remote, including depth indicators, speed controls, interface to data acquisition software and the raising and lowering functions. This Procedure will be performed twice, once for each Gamma Cart System. This procedure does not test the accuracy of the data acquisition software.




DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


Power Consumption at 40 and 45 nm  

E-Print Network (OSTI)

At 40 and 45 nm process nodes, power has become the primary factor for FPGA selection. This white paper details how Xilinx designed for this new reality in its recently introduced Spartan-6 (45 nm) and Virtex-6 (40 nm) FPGA families, achieving dramatic power reductions over previous generation Spartan-3A and Virtex-5 devices. Accomplishing such a significant reduction in power consumption required major engineering innovations. At 40 and 45 nm, transistor leakage increases exponentially, making static power a major challenge. Additionally, the desire for higher performance continues to drive core clock rates higher, increasing dynamic power. This white paper describes how Xilinx addressed theses challenges by using engineering innovations in Spartan-6 and Virtex-6 FPGAs that keep these families ahead of the curve. 2009 Xilinx, Inc. XILINX, the Xilinx logo, Virtex, Spartan, ISE, and other designated brands included herein are trademarks of Xilinx in the United States and other countries. All other trademarks are the property of their respective owners.

Matt Klein



MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper


Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Estimate of the Distribution of Solids Within Mixed Hanford Double-Shell Tank AZ-101: Implications for AY-102  

SciTech Connect

This paper describes the current level of understanding of the suspension of solids in Hanford double-shell waste tanks while being mixed with the baseline configuration of two 300-horsepower mixer pumps. A mixer pump test conducted in Tank AZ-101 during fiscal year 2000 provided the basis for this understanding. Information gaps must be filled to demonstrate the capability of the baseline feed delivery system to effectively mix, sample, and deliver double-shell tank waste to the Hanford Tank Waste Treatment and Immobilization Plant (WTP) for vitrification.

Wells, Beric E.; Ressler, Jennifer J.



Hydrocarbon-free resonance transition 795 nm rubidium laser  

E-Print Network (OSTI)

transition 795-nm rubidium laser," Opt. Lett. 32, 2423- S.transition 795- nm rubidium laser using 3 He buffer gas",transition 795-nm Rubidium laser with He buffer gas" (

Wu, Sheldon Shao Quan



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



DOE - Office of Legacy Management -- Trinity Test Site - NM 17  

Office of Legacy Management (LM)

Trinity Test Site - NM 17 Trinity Test Site - NM 17 FUSRAP Considered Sites Site: TRINITY TEST SITE (NM.17 ) Eliminated from consideration under FUSRAP - U.S. Army controls site Designated Name: Not Designated Alternate Name: None Location: missile range - 30 miles west of Carrizozo , White Sands , New Mexico NM.17-1 Evaluation Year: 1985 NM.17-1 Site Operations: Detonation of the first atomic bomb occurred at this site. NM.17-1 Site Disposition: Eliminated NM.17-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Fission fragments NM.17-1 Radiological Survey(s): NM.17-1 Site Status: Eliminated from consideration under FUSRAP - U.S. Army controls site NM.17-1 Also see Documents Related to TRINITY TEST SITE NM.17-1 - DOE Memorandum/Checklist; Jones to File; Subject:


3610 N. 44th Street, Suite 250, Phoenix, AZ 85018 ● Phone 602-808-2004 ●  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

10 N. 44th Street, Suite 250, Phoenix, AZ 85018 ● Phone 602-808-2004 ● Fax 602-808-2099 ● www.sunzia.net 10 N. 44th Street, Suite 250, Phoenix, AZ 85018 ● Phone 602-808-2004 ● Fax 602-808-2099 ● www.sunzia.net October 17, 2013 Transmitted via electronic mail to juliea.smith@hq.doe.gov and christopher.lawrence@hq.doe.gov Subject: SunZia Southwest Transmission Project comments on Department of Energy's August 29, 2013 Federal Register Notice regarding Improving Performance of Federal Permitting and Review of Infrastructure Projects. The following comments are provided to the Department of Energy (DOE) in response to the agency's request for information on (RFI) the draft Integrated Interagency Pre-Application (IIP) Process. These comments reflect the views and suggestions of the SunZia Southwest Transmission Project (SunZia). The Bureau of Land Management is the lead agency for processing our right-of-


A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Sandia National Laboratory (NM), Former Production Workers Screening...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

, Former Production Workers Screening Projects Sandia National Laboratory (NM), Former Production Workers Screening Projects...


DOE - Office of Legacy Management -- Acid Pueblo Canyon - NM 03  

NLE Websites -- All DOE Office Websites (Extended Search)

Acid Pueblo Canyon - NM 03 Acid Pueblo Canyon - NM 03 FUSRAP Considered Sites Acid/Pueblo Canyon, NM Alternate Name(s): Radioactive Liquid Waste Treatment Plant (TA-45) Acid/Pueblo and Los Alamos Canyon NM.03-3 Location: Canyons in the Pajarito Plateau Region in Los Alamos County, Los Alamos, NM NM.03-3 Historical Operations: Late 1943 or early 1944, head of the south fork of Acid Canyon received untreated liquid waste containing tritium and isotopes of strontium, cesium, uranium, plutonium, and americium discharged from main acid sewer lines and subsequently from the TA-3 plutonium treatment plant. NM.03-3 Eligibility Determination: Radiological Survey(s): Verification Surveys NM.03-5 NM.03-6 Site Status: Certified- Certification Basis and Federal Register Notice NM.03-2


Hybrid Al/SiC Composite Optics for IFE Applications W. Kowbel, MER Corp., Tucson, AZ And M. Tillack, UCSD, La Jolla, CA  

E-Print Network (OSTI)

Hybrid Al/SiC Composite Optics for IFE Applications W. Kowbel, MER Corp., Tucson, AZ And M. Tillack support of the mirror is a SiC composite. The SiC composite is chosen for the following reasons: 1) Very the mechanical deformations of the mirror's surface are minimized. 3) SiC is a low activation material, so

Tillack, Mark


Evaluating the improvement of corrosion residual strength by adding 1.0 wt.% yttrium into an AZ91D magnesium alloy  

SciTech Connect

The influence of yttrium on the corrosion residual strength of an AZ91D magnesium alloy was investigated detailedly. Scanning electron microscope was employed to analyze the microstructure and the fractography of the studied alloys. The microstructure of AZ91D magnesium alloy is remarkably refined due to the addition of yttrium. The electrochemical potentiodynamic polarization curve of the studied alloy was performed with a CHI 660b electrochemical station in the three-electrode system. The result reveals that yttrium significantly promotes the overall corrosion resistance of AZ91D magnesium alloy by suppressing the cathodic reaction in corrosion process. However, the nucleation and propagation of corrosion pits on the surface of the 1.0 wt.% Y modified AZ91D magnesium alloy indicate that pitting corrosion still emerges after the addition of yttrium. Furthermore, stress concentration caused by corrosion pits should be responsible for the drop of corrosion residual strength although the addition of yttrium remarkably weakens the effect of stress concentration at the tip of corrosion pits in loading process.

Wang Qiang [Key Laboratory of Automobile Materials (Jilin University), Ministry of Education, College of Materials Science and Engineering, Jilin University, Changchun, 130025 (China); Liu Yaohui, E-mail: liuyaohui2005@yahoo.com [Key Laboratory of Automobile Materials (Jilin University), Ministry of Education, College of Materials Science and Engineering, Jilin University, Changchun, 130025 (China); Fang Shijie [Department of Mechanical and Electrical Engineering, Luoyang Institute of Science and Technology, Luoyang 471023 (China); Song Yulai; Zhang Dawei; Zhang Lina; Li Chunfang [Key Laboratory of Automobile Materials (Jilin University), Ministry of Education, College of Materials Science and Engineering, Jilin University, Changchun, 130025 (China)



Solar irradiance models and measurements: a comparison in the 220 nm to 240 nm wavelength band  

E-Print Network (OSTI)

Solar irradiance models that assume solar irradiance variations to be due to changes in the solar surface magnetic flux have been successfully used to reconstruct total solar irradiance on rotational as well as cyclical and secular time scales. Modelling spectral solar irradiance is not yet as advanced, and also suffers from a lack of comparison data, in particular on solar-cycle time scales. Here we compare solar irradiance in the 220 nm to 240 nm band as modelled with SATIRE-S and measured by different instruments on the UARS and SORCE satellites. We find good agreement between the model and measurements on rotational time scales. The long-term trends, however, show significant differences. Both SORCE instruments, in particular, show a much steeper gradient over the decaying part of cycle 23 than the modelled irradiance or that measured by UARS/SUSIM.

Unruh, Yvonne C; Krivova, Natalie A



Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY



Gasoline and Diesel Fuel Update (EIA)




Gasoline and Diesel Fuel Update (EIA)




Annual Energy Outlook 2012 (EIA)



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



DOE - Office of Legacy Management -- LASL Tract OO - NM 06  

Office of Legacy Management (LM)

Tract OO - NM 06 Tract OO - NM 06 FUSRAP Considered Sites Site: LASL TRACT OO (NM.06 ) Eliminated from consideration under FUSRAP - Site was released by the AEC for sale and unrestricted use in 1976 Designated Name: Not Designated Alternate Name: None Location: Los Alamos , New Mexico NM.06-1 Evaluation Year: 1987 NM.06-1 Site Operations: Site consists of an area of 3.85 acres on the Los Alamos Scientific Laboratory compound. This tract of land was a location for a fire alarm equipment building and part of power plant and several warehouses. NM.06-2 Site Disposition: Eliminated - Radiological survey report declares the area to be free of residual radioactive contamination from site operations NM.06-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None

Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



SciTech Connect

This report documents melter and off-gas performance results obtained on the DM 1200 HLW Pilot Melter during processing of simulated HLW AZ-101 feed. The principal objectives of the DM1200 melter testing were to determine the achievable glass production rates for simulated HLW AZ-101 feed; determine the effect of bubbling rate and feed solids content on production rate; characterize melter off-gas emissions; characterize the performance of the prototypical off-gas system components as well as their integrated performance; characterize the feed, glass product, and off-gas effluents; and to perform pre- and post-test inspections of system components. The test objectives (including test success criteria), along with how they were met, are outlined in a table.




HLW Feed Delivery AZ101 Batch Transfer to the Private Contractor Transfer and Mixing Process Improvements [Initial Release at Rev 2  

SciTech Connect

The primary purpose of this business case is to provide Operations and Maintenance with a detailed transfer process review for the first High Level Waste (HLW) feed delivery to the Privatization Contractor (PC), AZ-101 batch transfer to PC. The Team was chartered to identify improvements that could be implemented in the field. A significant penalty can be invoked for not providing the quality, quantity, or timely delivery of HLW feed to the PC.




OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Microsoft PowerPoint - WAPA Transmission Developments in NM ...  

NLE Websites -- All DOE Office Websites (Extended Search)

authorities: NM, CO, WY, KS, ND, UT, SD & ID Tasked with planning and financing of transmission lines within their respective states RETA has the additional requirement that...


FAPAC-NM Executive Board | National Nuclear Security Administration  

National Nuclear Security Administration (NNSA)

Executive Board FAPAC-NM Executive Board "Promoting Equal Opportunity and Cultural Diversity for APAs in Government" Ligaya White Chairperson Administrative Support Assistant...


Generation and use of high power 213 nm and 266 nm laser radiation and tunable 210-400 nm laser radiation with BBO crystal matrix array  

SciTech Connect

A 213 nm laser beam is capable of single photon ablative photodecomposition for the removal of a polymer or biological material substrate. Breaking the molecular bonds and displacing the molecules away from the substrate in a very short time period results in most of the laser photon energy being carried away by the displaced molecules, thus minimizing thermal damage to the substrate. The incident laser beam may be unfocussed and is preferably produced by quintupling the 1064 nm radiation from a Nd:YAG solid state laser, i.e., at 213 nm. In one application, the 213 nm laser beam is expanded in cross section and directed through a plurality of small beta barium borate (BBO) crystals for increasing the energy per photon of the laser radiation directed onto the substrate. The BBO crystals are arranged in a crystal matrix array to provide a large laser beam transmission area capable of accommodating high energy laser radiation without damaging the BBO crystals. The BBO crystal matrix array may also be used with 266 nm laser radiation for carrying out single or multi photon ablative photodecomposition. The BBO crystal matrix array may also be used in an optical parametric oscillator mode to generate high power tunable laser radiation in the range of 210-400 nm.

Gruen, Dieter M. (Downers Grove, IL)



Characterization of High Strain Rate Mechanical behavior of AZ31 magnesium alloy using 3D Digital Image Correlation  

Science Conference Proceedings (OSTI)

Characterization of the material mechanical behavior at sub-Hopkinson regime (0.1 to 1000 s{sup -1}) is very challenging due to instrumentation limitations and the complexity of data analysis involved in dynamic loading. In this study, AZ31 magnesium alloy sheet specimens are tested using a custom designed servo-hydraulic machine in tension at nominal strain rates up to 1000 s{sup -1}. In order to resolve strain measurement artifacts, the specimen displacement is measured using 3D Digital Image correlation instead from actuator motion. The total strain is measured up to {approx} 30%, which is far beyond the measurable range of electric resistance strain gages. Stresses are calculated based on the elastic strains in the tab of a standard dog-bone shaped specimen. Using this technique, the stresses measured for strain rates of 100 s{sup -1} and lower show little or no noise comparing to load cell signals. When the strain rates are higher than 250 s{sup -1}, the noises and oscillations in the stress measurements are significantly decreased from {approx} 250 to 50 MPa. Overall, it is found that there are no significant differences in the elongation, although the material exhibits slight work hardening when the strain rate is increased from 1 to 100 s{sup -1}.

Wang, Yanli [ORNL; Xu, Hanbing [ORNL; ERDMAN III, DONALD L [ORNL; Starbuck, J Michael [ORNL; Simunovic, Srdjan [ORNL




SciTech Connect

This report documents the preparation of three actual Hanford tank waste samples for shipment to the Savannah River National Laboratory (SRNL). Two of the samples were dissolved saltcakes from tank 241-AN-103 (hereafter AN-103) and tank 241-SX-105 (hereafter SX-105); one sample was a supernate composite from tanks 241-AZ-101 and 241-AZ-102 (hereafter AZ-101/102). The preparation of the samples was executed following the test plans LAB-PLAN-10-00006, Test Plan for the Preparation of Samples from Hanford Tanks 241-SX-105, 241-AN-103, 241-AN-107, and LAB-PLN-10-00014, Test Plan for the Preparation of a Composite Sample from Hanford Tanks 241-AZ-101 and 241-AZ-102 for Steam Reformer Testing at the Savannah River National Laboratory. All procedural steps were recorded in laboratory notebook HNF-N-274 3. Sample breakdown diagrams for AN-103 and SX-105 are presented in Appendix A. The tank samples were prepared in support of a series of treatability studies of the Fluidized Bed Steam Reforming (FBSR) process using a Bench-Scale Reformer (BSR) at SRNL. Tests with simulants have shown that the FBSR mineralized waste form is comparable to low-activity waste glass with respect to environmental durability (WSRC-STI-2008-00268, Mineralization of Radioactive Wastes by Fluidized Bed Steam Reforming (FBSR): Comparisons to Vitreous Waste Forms and Pertinent Durability Testing). However, a rigorous assessment requires long-term performance data from FB SR product formed from actual Hanford tank waste. Washington River Protection Solutions, LLC (WRPS) has initiated a Waste Form Qualification Program (WP-S.2.1-20 1 0-00 1, Fluidized Bed Steam Reformer Low-level Waste Form Qualification) to gather the data required to demonstrate that an adequate FBSR mineralized waste form can be produced. The documentation of the selection process of the three tank samples has been separately reported in RPP-48824, 'Sample Selection Process for Bench-Scale Steam Reforming Treatability Studies Using Hanford Waste Samples.'




Photo Album Of FAPAC - NM Activities | National Nuclear Security  

National Nuclear Security Administration (NNSA)

Photo Album Of FAPAC - NM Activities | National Nuclear Security Photo Album Of FAPAC - NM Activities | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Photo Album Of FAPAC - NM Activities Home > About Us > Our Locations > Albuquerque Complex > Federal Asian Pacific American Council - New Mexico Chapter Albuquerque, NM > Photo Album Of FAPAC - NM Activities



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NM-TRIBE-PUEBLO OF POJOAQUE HOUSING CORPORATION NM-TRIBE-PUEBLO OF POJOAQUE HOUSING CORPORATION Location: Tribe NM-TRIBE- PUEBLO OF POJOAQUE HOUSING CORPORATION NM American Recovery and Reinvestment Act: Proposed Action or Project Description The Pueblo of Pojoaque Housing Corporation plans to improve the energy efficiency of six tribal homes located in White Sands Village by removing and replacing inefficient single-pane windows with double- pane, metal-clad wood windows. Conditions: None Categorical Exclusion(s) Applied: B2.5, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21 This action would not: threaten a violation of applicable statutory, regulatory, or permit requirements for environment, safety, and health,


Photorefractive effect at 775 nm in doped lithium niobate crystals  

SciTech Connect

The photorefractive effect induced by 775-nm laser light on doped lithium niobate crystals is investigated by the direct observation in the far field of the transmitted-beam distortion as a function of time. Measurements performed at various Zr-doping concentrations and different light intensities show that the 775-nm light beam induces a steady-state photorefractive effect comparable to that of 532-nm light, but the observed build-up time of the photovoltaic field is longer by three-orders of magnitude. The 775-nm photorefractivity of lithium niobate crystals doped with 3 mol. % ZrO{sub 2} or with 5.5 mol. % MgO is found to be negligible.

Nava, G.; Minzioni, P.; Cristiani, I.; Degiorgio, V. [Department of Electrical, Computer, and Biomedical Engineering, and CNISM, University of Pavia, 27100 Pavia (Italy); Argiolas, N.; Bazzan, M.; Ciampolillo, M. V.; Pozza, G.; Sada, C. [Physics and Astronomy Departement, University of Padova, 35131 Padova (Italy)



Design and Implementation of High Speed Memory in 130 nm  

Science Conference Proceedings (OSTI)

This paper deals with the design and analysis of high speed SRAM memory using ATD (Address Transition Detector) technique in 130 nm with the capacitive load of the memory is 5pF

Sampath Kumar; Arti Noor; Sanjay Kr. Singh



Paving the Way to Nanoelectronics 16 nm and Smaller  

NLE Websites -- All DOE Office Websites (Extended Search)

Wallow, "The SEMATECH Berkeley MET pushing EUV development beyond 22-nm half pitch," Proc. SPIE 7636, 76361J (2010); P. Naulleau, C. Anderson, L. Baclea-an, P. Denham, S. George,...


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


Paving the Way to Nanoelectronics 16 nm and Smaller  

NLE Websites -- All DOE Office Websites (Extended Search)

Paving the Way to Paving the Way to Nanoelectronics 16 nm and Smaller Paving the Way to Nanoelectronics 16 nm and Smaller Print Wednesday, 30 March 2011 00:00 As the nanoelectronics industry pushes towards feature sizes of 22 nm and smaller, conventional single-exposure refractive lithography systems used to print circuit patterns onto computer chips will no longer be feasible. Extreme ultraviolet (EUV) lithography, utilizing reflective optics and 13-nm-wavelength light to print chips, is the leading candidate to meet the industry's future needs. Despite strong progress in EUV lithography over the past decade, significant challenges remain, including defect-free mask fabrication (see Science Highlight Investigating Extreme Ultraviolet Lithography Mask Defects), and the development of ultrahigh-resolution photoresist-a light-sensitive material used to form a patterned coating-that simultaneously supports low line-edge roughness (LER), high sensitivity, and sub-22-nm resolution. Using the SEMATECH Berkeley Microfield Exposure Tool (MET) at ALS Beamline, advanced EUV photoresist research can be performed while high-power stand-alone light sources are still being developed. High-quality 16-nm lines and spaces have been printed using the MET, representing the highest resolution ever achieved from a single-exposure projection optical lithography tool.


Paving the Way to Nanoelectronics 16 nm and Smaller  

NLE Websites -- All DOE Office Websites (Extended Search)

Paving the Way to Nanoelectronics 16 nm and Smaller Print Paving the Way to Nanoelectronics 16 nm and Smaller Print As the nanoelectronics industry pushes towards feature sizes of 22 nm and smaller, conventional single-exposure refractive lithography systems used to print circuit patterns onto computer chips will no longer be feasible. Extreme ultraviolet (EUV) lithography, utilizing reflective optics and 13-nm-wavelength light to print chips, is the leading candidate to meet the industry's future needs. Despite strong progress in EUV lithography over the past decade, significant challenges remain, including defect-free mask fabrication (see Science Highlight Investigating Extreme Ultraviolet Lithography Mask Defects), and the development of ultrahigh-resolution photoresist-a light-sensitive material used to form a patterned coating-that simultaneously supports low line-edge roughness (LER), high sensitivity, and sub-22-nm resolution. Using the SEMATECH Berkeley Microfield Exposure Tool (MET) at ALS Beamline, advanced EUV photoresist research can be performed while high-power stand-alone light sources are still being developed. High-quality 16-nm lines and spaces have been printed using the MET, representing the highest resolution ever achieved from a single-exposure projection optical lithography tool.

Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Paving the Way to Nanoelectronics 16 nm and Smaller  

NLE Websites -- All DOE Office Websites (Extended Search)

Paving the Way to Nanoelectronics 16 nm and Smaller Print Paving the Way to Nanoelectronics 16 nm and Smaller Print As the nanoelectronics industry pushes towards feature sizes of 22 nm and smaller, conventional single-exposure refractive lithography systems used to print circuit patterns onto computer chips will no longer be feasible. Extreme ultraviolet (EUV) lithography, utilizing reflective optics and 13-nm-wavelength light to print chips, is the leading candidate to meet the industry's future needs. Despite strong progress in EUV lithography over the past decade, significant challenges remain, including defect-free mask fabrication (see Science Highlight Investigating Extreme Ultraviolet Lithography Mask Defects), and the development of ultrahigh-resolution photoresist-a light-sensitive material used to form a patterned coating-that simultaneously supports low line-edge roughness (LER), high sensitivity, and sub-22-nm resolution. Using the SEMATECH Berkeley Microfield Exposure Tool (MET) at ALS Beamline, advanced EUV photoresist research can be performed while high-power stand-alone light sources are still being developed. High-quality 16-nm lines and spaces have been printed using the MET, representing the highest resolution ever achieved from a single-exposure projection optical lithography tool.


DOE - Office of Legacy Management -- TA-1 Manhattan Laboratory - NM 11  

Office of Legacy Management (LM)

TA-1 Manhattan Laboratory - NM 11 TA-1 Manhattan Laboratory - NM 11 FUSRAP Considered Sites Site: TA-1 MANHATTAN LABORATORY (NM.11 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Main Technical Area LASL LANL NM.11-1 NM.11-2 NM.11-3 Location: Los Alamos , New Mexico NM.11-3 Evaluation Year: 1985 NM.11-1 Site Operations: Nuclear weapons research and development. NM.11-1 NM.11-3 Site Disposition: Site Disposition NM.11-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium , Plutonium, Fission Products NM.11-1 NM.11-3 Radiological Survey(s): Yes NM.11-2 NM.11-3 Site Status: Eliminated from consideration under FUSRAP NM.11-1 Also see Documents Related to TA-1 MANHATTAN LABORATORY NM.11-1 - DOE Memorandum/Checklist; Jones to File; Subject:


Zuni Mountains Nm Geothermal Area | Open Energy Information  

Open Energy Info (EERE)

Zuni Mountains Nm Geothermal Area Zuni Mountains Nm Geothermal Area Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Geothermal Resource Area: Zuni Mountains Nm Geothermal Area Contents 1 Area Overview 2 History and Infrastructure 3 Regulatory and Environmental Issues 4 Exploration History 5 Well Field Description 6 Geology of the Area 7 Geofluid Geochemistry 8 NEPA-Related Analyses (0) 9 Exploration Activities (2) 10 References Area Overview Geothermal Area Profile Location: New Mexico Exploration Region: Other GEA Development Phase: 2008 USGS Resource Estimate Mean Reservoir Temp: Estimated Reservoir Volume: Mean Capacity: Click "Edit With Form" above to add content History and Infrastructure Operating Power Plants: 0 No geothermal plants listed. Add a new Operating Power Plant


Federal Asian Pacific American Council - New Mexico Chapter Albuquerque, NM  

National Nuclear Security Administration (NNSA)

Asian Pacific American Council - New Mexico Chapter Albuquerque, NM Asian Pacific American Council - New Mexico Chapter Albuquerque, NM | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering the Nuclear Navy Emergency Response Recapitalizing Our Infrastructure Continuing Management Reform Countering Nuclear Terrorism About Us Our Programs Our History Who We Are Our Leadership Our Locations Budget Our Operations Media Room Congressional Testimony Fact Sheets Newsletters Press Releases Speeches Events Social Media Video Gallery Photo Gallery NNSA Archive Federal Employment Apply for Our Jobs Our Jobs Working at NNSA Blog Federal Asian Pacific American Council - New Mexico Chapter Albuquerque, NM Home > About Us > Our Locations > Albuquerque Complex > Federal Asian Pacific American Council - New ...


A-Z Index  

NLE Websites -- All DOE Office Websites (Extended Search)

Demand Response Demand Response Quick Assessment Tool (DRQAT) DER-CAM Design Intent Tool Distributed Energy DOE-2...


A-Z Index  

NLE Websites -- All DOE Office Websites (Extended Search)

China Energy Group Climate Combustion Technologies Group Commercial Buildings Commercial Buildings Communications Office Contact Us Cookstove Efficiency and Emissions Testing...


A-Z Index  

NLE Websites -- All DOE Office Websites (Extended Search)

BATT Fabrication Laboratory Batteries and Fuel Cells Building Controls Virtual Test Bed Building Technology and Urban Systems Buildings Energy Efficiency...


A-Z Index  

NLE Websites -- All DOE Office Websites (Extended Search)

Electricity Grid Electricity Markets Electricity Reliability Electrochemical Technologies Group Electronics, Lighting and Networks Group Energy Analysis Energy Analysis and...


A-Z Index  

NLE Websites -- All DOE Office Websites (Extended Search)

Productivity High Technology and Industrial Systems Home Energy Saver for Consumers Home Energy Saver for Professionals...


Laser ablation of nanoscale particles with 193 nm light  

NLE Websites -- All DOE Office Websites (Extended Search)

Laser ablation of nanoscale particles with 193 nm light Laser ablation of nanoscale particles with 193 nm light Title Laser ablation of nanoscale particles with 193 nm light Publication Type Journal Article Year of Publication 2007 Authors Choi, Jong Hyun, Donald Lucas, and Catherine P. Koshland Journal Journal of Physics: Conference Series Volume 59 Start Page 54 Issue 1 Pagination 54-59 Abstract Laser interaction with nanoscale particles is distinct and different from laser-bulk material interaction, where a hot plasma is normally created. Here, we review our studies on 193 nm laser ablation of various nanoscale particles including NaCl, soot, polystyrene, and gold. The 20 ns laser beam with fluences up to 0.3 J/cm2 irradiates nanoparticles in a gas stream at laser repetition rates from 10 to 100 Hz. The particle size distributions before and after irradiation are measured with a scanning mobility particle sizer (SMPS), and particle morphology is examined with electron microscopy. All the nanomaterials studied exhibit a similar disintegration pattern and similar particle formation characteristics. No broadband emission associated with particle heating or optical breakdown is observed. The nanoparticles formed after irradiation have a smaller mean diameter and an order of magnitude higher number concentration with a more spherical shape compared to the original particles. We use the photon-atom ratio (PAR) to interpret the laser-particle interaction energetics.


Two methods of realising 10nm T-gate lithography  

Science Conference Proceedings (OSTI)

This paper presents two separate methods for the fabrication of 10nm footprint T-gates using a two-step gate process. We examine the limits of lithographic and pattern transfer processes using the exposure of ZEP520A resist by electron beam lithography, ... Keywords: Electron beam lithography, HEMT, ICP, RIE, Reactive ion etching, T-gate

S. Bentley; X. Li; D. A. J. Moran; I. G. Thayne



miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



File:INL-geothermal-nm.pdf | Open Energy Information  

Open Energy Info (EERE)

nm.pdf nm.pdf Jump to: navigation, search File File history File usage New Mexico Geothermal Resources Size of this preview: 466 × 599 pixels. Other resolution: 467 × 600 pixels. Full resolution ‎(3,727 × 4,791 pixels, file size: 1.5 MB, MIME type: application/pdf) Description New Mexico Geothermal Resources Sources Idaho National Laboratory Authors Patrick Laney; Julie Brizzee Related Technologies Geothermal Creation Date 2003-11-01 Extent State Countries United States UN Region Northern America States New Mexico File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 12:41, 16 December 2010 Thumbnail for version as of 12:41, 16 December 2010 3,727 × 4,791 (1.5 MB) MapBot (Talk | contribs) Automated upload from NREL's "mapsearch" data


The Role of Friction Stir Welding on the Microstructure and Mechanical Properties of AZ31B-H24 Mg alloy  

Science Conference Proceedings (OSTI)

In this study, an attempt was made to join AZ31B magnesium alloy by friction stir welding (FSW) process. A single tool with cylindrical screw threaded pin was used to investigate the effect of welding parameters on microstructure and mechanical properties of stir zone (SZ). Several welds were made at different rotational ({omega}) and traverse ({upsilon}) speeds, while the {omega}/{upsilon} ratios were kept constant. The optical and scanning electron microscopy were used to study the variation of microstructure across the welds. Moreover, micro-hardness and tensile tests were carried out to evaluate the mechanical properties of joints. It was found that {omega} plays more significant role on the resulted grain structure than {upsilon}, and at a constant {omega}/{upsilon} ratio, decreasing rotational speed decreased the size of grains, and hence, improved the hardness value and the tensile strength of the SZ.

Darzi, Kh.; Saeid, T. [Advanced Materials Research Center - Faculty of Materials Engineering, Sahand University of Technology - Tabriz (Iran, Islamic Republic of)



Time-Temperature-Transformation Study of Simulated Hanford Tank Waste (AZ-101) and Optimization of Glass Formulation for Processing Such Waste  

SciTech Connect

This paper presents the current results of a study for the optimization of the quality of the wasteform to be produced by vitrification of Hanford High Level Waste (HLW). A simulant of the content of Hanford Tank AZ-101 has been used for the experiments. A first phase of the research focused on the wasteform composition and showed that a high quality and chemical-resistant wasteform can be formed incorporating 60 weight % of dried waste into a borosilicate glass enriched with zinc oxide and boric acid and provided some indication about the heat treatment of the melt. A second phase of the study, still in progress, refines these findings. A detailed crystallinity survey of the waste form after various heat treatments has been performed, culminating in the development of a time-temperature-transformation (TTT) diagram. The results of the first phase of research and preliminary results from the second phase are described.

Ramsey, W. G.; Kauffman, B. M.; Bricka, M.; Meaker, T. F.; Giordana, A.; Smith, J. D.; Miller, F. S.; Bohannan, E.; Powell, J.; Reich, M.; Jordan, J.; Venter, L.; Barletta, R. E.; Ramsey, A. A.; Maise, G. M.; Manowitz, B.; Steinberg, M.; Salzano, F.



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


DOE - Office of Legacy Management -- LASL Land Parcels A B C E K LN PL - NM  

Office of Legacy Management (LM)

Land Parcels A B C E K LN PL - Land Parcels A B C E K LN PL - NM 07 FUSRAP Considered Sites Site: LASL LAND PARCELS A, B, C, E, K, LN, PL (NM.07 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Los Alamos County , New Mexico NM.07-2 Evaluation Year: 1986 NM.07-1 Site Operations: No specific operations identified for these tracts of land. NM.07-1 NM.07-2 Site Disposition: Eliminated - Radiation levels below criteria. Declared as surplus real property and offered for public sale in 1972. NM.07-1 NM.07-2 Radioactive Materials Handled: None Specifically Indicated NM.07-1 NM.07-2 Primary Radioactive Materials Handled: None Specifically Indicated Radiological Survey(s): Yes NM.07-2 Site Status: Eliminated from consideration under FUSRAP


Public Service Co of NM | Open Energy Information  

Open Energy Info (EERE)

(Redirected from PNM) (Redirected from PNM) Jump to: navigation, search Name Public Service Co of NM Place New Mexico Utility Id 15473 Utility Location Yes Ownership I NERC Location WECC NERC WECC Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 10A Irrigation 10A Irrigation within Grant, Lincoln, Hidalgo and Otero counties

Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Database of average-power damage thresholds at 1064 nm  

Science Conference Proceedings (OSTI)

We have completed a database of average-power, laser-induced, damage thresholds at 1064 nm on a variety of materials. Measurements were made with a newly constructed laser to provide design input for moderate and high average-power laser projects. The measurements were conducted with 16-ns pulses at pulse-repetition frequencies ranging from 6 to 120 Hz. Samples were typically irradiated for time ranging from a fraction of a second up to 5 minutes (36,000 shots). We tested seven categories of samples which included antireflective coatings, high reflectors, polarizers, single and multiple layers of the same material, bare and overcoated metal surfaces, bare polished surfaces, and bulk materials. The measured damage threshold ranged from 46 J/cm/sup 2/ for a bare polished glass substrate. 4 refs., 7 figs., 1 tab.

Rainer, F.; Hildum, E.A.; Milam, D.



Public Service Co of NM | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Jump to: navigation, search Name Public Service Co of NM Place New Mexico Utility Id 15473 Utility Location Yes Ownership I NERC Location WECC NERC WECC Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 10A Irrigation 10A Irrigation within Grant, Lincoln, Hidalgo and Otero counties 10B Irrigation TOU


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



FY09 assessment of mercury reduction at SNL/NM.  

Science Conference Proceedings (OSTI)

This assessment takes the result of the FY08 performance target baseline of mercury at Sandia National Laboratories/New Mexico, and records the steps taken in FY09 to collect additional data, encourage the voluntary reduction of mercury, and measure success. Elemental (metallic) mercury and all of its compounds are toxic, and exposure to excessive levels can permanently damage or fatally injure the brain and kidneys. Elemental mercury can also be absorbed through the skin and cause allergic reactions. Ingestion of inorganic mercury compounds can cause severe renal and gastrointestinal damage. Organic compounds of mercury such as methyl mercury, created when elemental mercury enters the environment, are considered the most toxic forms of the element. Exposures to very small amounts of these compounds can result in devastating neurological damage and death.1 SNL/NM is required to report annually on the site wide inventory of mercury for the Environmental Protection Agency's (EPA) Toxics Release Inventory (TRI) Program, as the site's inventory is excess of the ten pound reportable threshold quantity. In the fiscal year 2008 (FY08) Pollution Prevention Program Plan, Section 5.3 Reduction of Environmental Releases, a performance target stated was to establish a baseline of mercury, its principle uses, and annual quantity or inventory. This was accomplished on July 29, 2008 by recording the current status of mercury in the Chemical Information System (CIS).

McCord, Samuel Adam



High Resolution Irradiance Spectrum from 300 to 1000 nm  

E-Print Network (OSTI)

The FTS scans that made up the Kitt Peak Solar Flux Atlas by Kurucz, Furenlid, Brault, and Testerman (1984) have been re-reduced. An approximate telluric atmospheric model was determined for each FTS scan. Large-scale features produced by O3 and O2 dimer were computed and divided out. The solar continuum level was found by fitting a smooth curve to high points in each scan. The scans were normalized to the fitted continuum to produce a residual flux spectrum for each FTS scan. The telluric line spectrum was computed using HITRAN and other line data for H2O, O2, and CO2. The line parameters were adjusted for an approximate match to the observed spectra. The scans were divided by the computed telluric spectra to produce residual irradiance spectra. Artifacts from wavelength mismatches, deep lines, etc, were removed by hand and replaced by linear interpolation. Overlapping scans were fitted together to make a continuous spectrum from 300 to 1000 nm. All the above steps were iterative. The monochromatic error var...

Kurucz, R L



High Resolution Irradiance Spectrum from 300 to 1000 nm  

E-Print Network (OSTI)

The FTS scans that made up the Kitt Peak Solar Flux Atlas by Kurucz, Furenlid, Brault, and Testerman (1984) have been re-reduced. An approximate telluric atmospheric model was determined for each FTS scan. Large-scale features produced by O3 and O2 dimer were computed and divided out. The solar continuum level was found by fitting a smooth curve to high points in each scan. The scans were normalized to the fitted continuum to produce a residual flux spectrum for each FTS scan. The telluric line spectrum was computed using HITRAN and other line data for H2O, O2, and CO2. The line parameters were adjusted for an approximate match to the observed spectra. The scans were divided by the computed telluric spectra to produce residual irradiance spectra. Artifacts from wavelength mismatches, deep lines, etc, were removed by hand and replaced by linear interpolation. Overlapping scans were fitted together to make a continuous spectrum from 300 to 1000 nm. All the above steps were iterative. The monochromatic error varies from 0.1 to 1.0 percent. The residual spectrum was calibrated two different ways: First by normalizing it to the continuum of theoretical solar model ASUN (Kurucz 1992), and second, by degrading the spectrum to the resolution of the observed irradiance (Thuillier et al. 2004) to determine a normalization function that was then applied to the high resolution spectrum.

Robert L. Kurucz



Origins of the extragalactic background at 1mm from a combined analysis of the AzTEC and MAMBO data in GOODS-N  

E-Print Network (OSTI)

We present a study of the cosmic infrared background, which is a measure of the dust obscured activity in all galaxies in the Universe. We venture to isolate the galaxies responsible for the background at 1mm; with spectroscopic and photometric redshifts we constrain the redshift distribution of these galaxies. We create a deep 1.16mm map (sigma ~ 0.5mJy) by combining the AzTEC 1.1mm and MAMBO 1.2mm datasets in GOODS-N. This combined map contains 41 secure detections, 13 of which are new. By averaging the 1.16mm flux densities of individually undetected galaxies with 24um flux densities > 25uJy, we resolve 31--45 per cent of the 1.16mm background. Repeating our analysis on the SCUBA 850um map, we resolve a higher percentage (40--64 per cent) of the 850um background. A majority of the background resolved (attributed to individual galaxies) at both wavelengths comes from galaxies at z > 1.3. If the ratio of the resolved submillimeter to millimeter background is applied to a reasonable scenario for the origins o...

Penner, Kyle; Chapin, Edward L; Greve, Thomas R; Bertoldi, Frank; Brodwin, Mark; Chary, Ranga-Ram; Conselice, Christopher J; Coppin, Kristen; Giavalisco, Mauro; Hughes, David H; Ivison, Rob J; Perera, Thushara; Scott, Douglas; Scott, Kimberly; Wilson, Grant



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Ion Exclusion by Sub 2-nm Carbon Nanotube Pores  

Science Conference Proceedings (OSTI)

Carbon nanotubes offer an outstanding platform for studying molecular transport at nanoscale, and have become promising materials for nanofluidics and membrane technology due to their unique combination of physical, chemical, mechanical, and electronic properties. In particular, both simulations and experiments have proved that fluid flow through carbon nanotubes of nanometer size diameter is exceptionally fast compared to what continuum hydrodynamic theories would predict when applied on this length scale, and also, compared to conventional membranes with pores of similar size, such as zeolites. For a variety of applications such as separation technology, molecular sensing, drug delivery, and biomimetics, selectivity is required together with fast flow. In particular, for water desalination, coupling the enhancement of the water flux with selective ion transport could drastically reduce the cost of brackish and seawater desalting. In this work, we study the ion selectivity of membranes made of aligned double-walled carbon nanotubes with sub-2 nm diameter. Negatively charged groups are introduced at the opening of the carbon nanotubes by oxygen plasma treatment. Reverse osmosis experiments coupled with capillary electrophoresis analysis of permeate and feed show significant anion and cation rejection. Ion exclusion declines by increasing ionic strength (concentration) of the feed and by lowering solution pH; also, the highest rejection is observed for the A{sub m}{sup Z{sub A}} C{sub n}{sup Z{sub C}} salts (A=anion, C=cation, z= valence) with the greatest Z{sub A}/Z{sub C} ratio. Our results strongly support a Donnan-type rejection mechanism, dominated by electrostatic interactions between fixed membrane charges and mobile ions, while steric and hydrodynamic effects appear to be less important. Comparison with commercial nanofiltration membranes for water softening reveals that our carbon nanotube membranes provides far superior water fluxes for similar ion rejection capabilities.

Fornasiero, F; Park, H G; Holt, J K; Stadermann, M; Grigoropoulos, C P; Noy, A; Bakajin, O



DOE - Office of Legacy Management -- LASL Tracks Eastern Area No 3 - NM 10  

Office of Legacy Management (LM)

Tracks Eastern Area No 3 - NM Tracks Eastern Area No 3 - NM 10 FUSRAP Considered Sites Site: LASL TRACKS EASTERN AREA NO. 3 (NM.10 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Area No. 3 , Los Alamos County , New Mexico NM.10-1 Evaluation Year: 1987 NM.10-2 Site Operations: These tracts were part of LASL and were subject to contamination from laboratory operations. NM.10-2 Site Disposition: Eliminated - Radiation levels below criteria per environmental radiation survey NM.10-3 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Indicated Radiological Survey(s): Yes NM.10-3 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to LASL TRACKS EASTERN AREA NO. 3


Demonstration of an 8.85 nm Gain-Saturated Table-Top Soft X-Ray Laser and Lasing down to 7.4 nm  

Science Conference Proceedings (OSTI)

We report the efficient generation of a gain-saturated 8.85 nm wavelength table-top soft x-ray laser operating at 1 Hz repetition rate and the observation of lasing at wavelengths as short as 7.36 nm in lanthanide ions.

Wang, Yong [Colorado State University, Fort Collins; Alessi, David [Colorado State University, Fort Collins; Luther, Brad [Colorado State University, Fort Collins; Yin, Liang [Colorado State University, Fort Collins; Martz, Dale [Colorado State University, Fort Collins; Berrill, Mark A [ORNL; Jorge, Rocca [Colorado State University, Fort Collins




Science Conference Proceedings (OSTI)

This document provides the final report on data and results obtained from a series of nine tests performed on the one-third scale DuraMelter{trademark} 1200 (DM1200) HLW Pilot Melter system that has been installed at VSL with an integrated prototypical off-gas treatment system. That system has replaced the DM1000 system that was used for HLW throughput testing during Part B1 [1]. Both melters have similar melt surface areas (1.2 m{sup 2}) but the DM1200 is prototypical of the present RPP-WTP HLW melter design whereas the DM1000 was not. These tests were performed under a corresponding RPP-WTP Test Specification and associated Test Plans. The nine tests reported here were preceded by an initial series of short-duration tests conducted to support the start-up and commissioning of this system. This report is a followup to the previously issued Preliminary Data Summary Reports. The DM1200 system was deployed for testing and confirmation of basic design, operability, flow sheet, and process control assumptions as well as for support of waste form qualification and permitting. These tests include data on processing rates, off-gas treatment system performance, recycle stream compositions, as well as process operability and reliability. Consequently, this system is a key component of the overall HLW vitrification development strategy. The primary objective of the present series of tests was to determine the effects of a variety of parameters on the glass production rate in comparison to the RPP-WTP HL W design basis of 400 kg/m{sup 2}/d. Previous testing on the DMIOOO system [1] concluded that achievement of that rate with simulants of projected WTP melter feeds (AZ-101 and C-106/AY-102) was unlikely without the use of bubblers. As part of those tests, the same feed that was used during the cold-commissioning of the West Valley Demonstration Project (WVDP) HLW vitrification system was run on the DM1000 system. The DM1000 tests reproduced the rates that were obtained at the larger WVDP facility, lending confidence to the tests results [1]. Since the inclusion or exclusion of a bubbler has significant design implications, the Project commissioned further tests to address this issue. In an effort to identify factors that might increase the glass production rate for projected WTP melter feeds, a subsequent series of tests was performed on the DM100 system. Several tests variables led to glass production rate increases to values significantly above the 400 kg/m2/d requirement. However, while small-scale melter tests are useful for screening relative effects, they tend to overestimate absolute glass production rates, particularly for un-bubbled tests. Consequently, when scale-up effects were taken into account, it was not clear that any of the variables investigated would conclusively meet the 400 kg/m{sup 2}/d requirement without bubbling. The present series of tests was therefore performed on the DM1200 one-third scale HLW pilot melter system to provide the required basis for a final decision on whether bubblers would be included in the HLW melter. The present tests employed the same AZ-101 waste simulant and glass composition that was used for previous testing for consistency and comparability with the results from the earlier tests.




Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Efficient Excitation of Gain-Saturated Sub-9-nm-Wavelength Tabletop Soft-X-Ray Lasers and Lasing Down to 7.36 nm  

Science Conference Proceedings (OSTI)

We have demonstrated the efficient generation of sub-9-nm-wavelength picosecond laser pulses of microjoule energy at 1-Hz repetition rate with a tabletop laser. Gain-saturated lasing was obtained at =8.85 nm in nickel-like lanthanum ions excited by collisional electron-impact excitation in a precreated plasma column heated by a picosecond optical laser pulse of 4-J energy. Furthermore, isoelectronic scaling along the lanthanide series resulted in lasing at wavelengths as short as =7.36 nm. Simulations show that the collisionally broadened atomic transitions in these dense plasmas can support the amplification of subpicosecond soft-x-ray laser pulses.

Alessi, David [Colorado State University, Fort Collins; Wang, Yong [Colorado State University, Fort Collins; Luther, Brad [Colorado State University, Fort Collins; Yin, Liang [Colorado State University, Fort Collins; Martz, Dale [Colorado State University, Fort Collins; Woolston, Mark [Colorado State University, Fort Collins; Liu, Yanwei [University of California, Berkeley & LBNL; Berrill, Mark A [ORNL; Jorge, Rocca [Colorado State University, Fort Collins




SciTech Connect

This report documents melter and off-gas performance results obtained on the DM1200 HLW Pilot Melter during processing of AZ-101 HLW simulants. The tests reported herein are a subset of six tests from a larger series of tests described in the Test Plan for the work; results from the other tests have been reported separately. The solids contents of the melter feeds were based on the WTP baseline value for the solids content of the feeds from pretreatment which changed during these tests from 20% to 15% undissolved solids resulting in tests conducted at two feed solids contents. Based on the results of earlier tests with single outlet 'J' bubblers, initial tests were performed with a total bubbling rate of 651 pm. The first set of tests (Tests 1A-1E) addressed the effects of skewing this total air flow rate back and forth between the two installed bubblers in comparison to a fixed equal division of flow between them. The second set of tests (2A-2D) addressed the effects of bubbler depth. Subsequently, as the location, type and number of bubbling outlets were varied, the optimum bubbling rate for each was determined. A third (3A-3C) and fourth (8A-8C) set of tests evaluated the effects of alternative bubbler designs with two gas outlets per bubbler instead of one by placing four bubblers in positions simulating multiple-outlet bubblers. Data from the simulated multiple outlet bubblers were used to design bubblers with two outlets for an additional set of tests (9A-9C). Test 9 was also used to determine the effect of small sugar additions to the feed on ruthenium volatility. Another set of tests (10A-10D) evaluated the effects on production rate of spiking the feed with chloride and sulfate. Variables held constant to the extent possible included melt temperature, plenum temperature, cold cap coverage, the waste simulant composition, and the target glass composition. The feed rate was increased to the point that a constant, essentially complete, cold cap was achieved, which was used as an indicator of a maximized feed rate for each test. The first day of each test was used to build the cold cap and decrease the plenum temperature. The remainder of each test was split into two- to six-day segments, each with a different bubbling rate, bubbler orientation, or feed concentration of chloride and sulfur.




L3, Fabrication of Top-Gated Sub-10 nm Epitaxial Graphene ...  

Science Conference Proceedings (OSTI)

HSQ lines (width ~10 nm) on graphene were fabricated and then the HSQ line .... Electroluminescent Devices with a Low Turn-on Voltage and High Brightness.


Hexagonally Arranged Nanopore Film Fabricated via Selective Etching by 172-nm Vacuum Ultraviolet Light Irradiation  

Science Conference Proceedings (OSTI)

Technical Paper / Selected papers from 20th Target Fabrication Meeting, May 20-24, 2012, Santa Fe, NM, Guest Editor: Robert C. Cook

Motonori Komura; Kaori Kamata; Tomokazu Iyoda; Keiji Nagai


Demonstration of 12 nm resolution Fresnel zone plate lens based soft x-ray microscopy  

Science Conference Proceedings (OSTI)

To extend soft x-ray microscopy to a resolution of order 10 nm or better, we developed a new nanofabrication process for Fresnel zone plate lenses. The new process, based on the double patterning technique, has enabled us to fabricate high quality gold zone plates with 12 nm outer zones. Testing of the zone plate with the full-field transmission x-ray microscope, XM-1, in Berkeley, showed that the lens clearly resolved 12 nm lines and spaces. This result represents a significant step towards 10 nm resolution and beyond.

Chao, W.; Kim, J.; Rekawa, S.; Fischer, P.; Anderson, E. H.



AZ CO2 Storage Pilot  

NLE Websites -- All DOE Office Websites (Extended Search)

CO2 Storage Pilot Regional Carbon Sequestration Partnerships Initiative Review Meeting Pittsburgh, Pennsylvania October 7, 2008 John Henry Beyer, Ph.D. WESTCARB Program Manager, Geophysicist 510-486-7954, jhbeyer@lbl.gov Lawrence Berkeley National Laboratory Earth Sciences Division, MS 90-1116 Berkeley, CA 94720 2 WESTCARB region has major CO2 point sources 3 WESTCARB region has many deep saline formations - candidates for CO2 storage WESTCARB also created GIS layers for oil/gas fields and deep coal basins Source: DOE Carbon Sequestration Atlas of the United States and Canada 4 - Aspen Environmental - Bevilacqua-Knight, Inc. Arizona Utilities CO2 Storage Pilot Contracting and Funding Flow Department of Energy National Energy Technology Laboratory Lawrence Berkeley National

Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


State Laboratory Contact Information AZ  

Science Conference Proceedings (OSTI)

... David Pfahler Brad Stover ... Joe Benavides Harvey Fischer Daniel Gibbons Preston Adachi Philip Wright Shauna Pereiro Lisa Corn Pat Sanders ...



Nearest-IR superluminescent diodes with a 100-nm spectral width  

Science Conference Proceedings (OSTI)

This paper presents an experimental study of quantum well superluminescent diodes with an extremely thin (InGa)As active layer. Under cw injection, the output power of such diodes is several milliwatts, with a centre wavelength of 830 nm and emission bandwidth of about 100 nm. (letters)

Il'chenko, S N; Ladugin, M A; Marmalyuk, Aleksandr A; Yakubovich, S D



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



Rock Sampling At Zuni Mountains Nm Area (Brookins, 1982) | Open Energy  

Open Energy Info (EERE)

Zuni Mountains Nm Area (Brookins, 1982) Zuni Mountains Nm Area (Brookins, 1982) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Rock Sampling At Zuni Mountains Nm Area (Brookins, 1982) Exploration Activity Details Location Zuni Mountains Nm Area Exploration Technique Rock Sampling Activity Date Usefulness not indicated DOE-funding Unknown Notes Radiogenic heat production analysis from U,Th,K concentrations. References D. G. Brookins (1982) Potassium, Uranium, Thorium Radiogenic Heat Contribution To Heat Flow In The Precambrian And Younger Silicic Rocks Of The Zuni And Florida Mountains, New Mexico (Usa) Retrieved from "http://en.openei.org/w/index.php?title=Rock_Sampling_At_Zuni_Mountains_Nm_Area_(Brookins,_1982)&oldid=387056" Category: Exploration Activities


Building blocks for future detectors: Silicon test masses and 1550 nm laser light  

E-Print Network (OSTI)

Current interferometric gravitational wave detectors use the combination of quasi-monochromatic, continuous-wave laser light at 1064 nm and fused silica test masses at room temperature. Detectors of the third generation, such as the Einstein-Telescope, will involve a considerable sensitivity increase. The combination of 1550 nm laser radiation and crystalline silicon test masses at low temperatures might be important ingredients in order to achieve the sensitivity goal. Here we compare some properties of the fused silica and silicon test mass materials relevant for decreasing the thermal noise in future detectors as well as the recent technology achievements in the preparation of laser radiation at 1064 nm and 1550 nm relevant for decreasing the quantum noise. We conclude that silicon test masses and 1550 nm laser light have the potential to form the future building blocks of gravitational wave detection.

R. Schnabel; M. Britzger; F. Brckner; O. Burmeister; K. Danzmann; J. Dck; T. Eberle; D. Friedrich; H. Lck; M. Mehmet; R. Nawrodt; S. Steinlechner; B. Willke



350nm CMOS test-chip for architecture verification of real-time QVGA color-video segmentation at the 90nm technology node  

Science Conference Proceedings (OSTI)

We designed a cell-network-based full-custom test-chip for gray-scale/color image segmentation of real-time video-signals in 350nm CMOS technology. From this digital test-chip design, fully-integrated QVGA-size video-picture-segmentation chips, with ...

Takashi Morimoto; Yohmei Harada; Tetsushi Koide; Hans Jrgen Mattausch



High silicon content silylating reagents for dry-developed positive-tone resists for extreme ultraviolet (13.5 nm) and deep ultraviolet (248 nm) microlithography  

SciTech Connect

Recent results in the use of disilanes as silylating reagents for near-surface imaging with deep-UV (248 nm) and EUV (13.5 nm) lithography are reported. A relatively thin imaging layer of a photo-cross-linking resist is spun over a thicker layer of hard-baked resist that functions as a planarizing layer and antireflective coating. Photoinduced acid generation and subsequent heating crosslinks and renders exposed areas impermeable to an aminodisilane that reacts with the unexposed regions. Subsequent silylation and reactive ion etching afford a positive-tone image. The use of disilanes introduces a higher concentration of silicon into the polymer than is possible with silicon reagents that incorporate only one silicon atom per reactive site. The higher silicon content in the silylated polymer increases etching selectivity between exposed and unexposed regions and thereby increases the contrast. Additional improvements that help to minimize flow during silylation are also discussed, including the addition of bifunctional disilanes. We have resolved high aspect ratio, very high quality 0.20 {mu}m line and space patterns at 248 nm with a stepper having a numerical aperture (NA)= 0.53, and have resolved {<=} 0.15 {mu}m line and spaces at 13.5 nm.

Wheeler, D.; Scharrer, E.; Kubiak, G. [and others



National Environmental Policy Act (NEPA) compliance at Sandia National Laboratories/New Mexico (SNL/NM)  

Science Conference Proceedings (OSTI)

This report on National Environmental Policy Act (NEPA) compliance at Sandia National Laboratories/New Mexico (SNL/NM) chronicles past and current compliance activities and includes a recommended strategy that can be implemented for continued improvement. This report provides a list of important references. Attachment 1 contains the table of contents for SAND95-1648, National Environmental Policy Act (NEPA) Compliance Guide Sandia National Laboratories (Hansen, 1995). Attachment 2 contains a list of published environmental assessments (EAs) and environmental impact statements (EISs) prepared by SNL/NM. Attachment 3 contains abstracts of NEPA compliance papers authored by SNL/NM and its contractors.

Wolff, T.A. [Sandia National Labs., Albuquerque, NM (United States). Community Involvement and Issues Management Dept.; Hansen, R.P. [Hansen Environmental Consultants, Englewood, CO (United States)




SciTech Connect

This report documents melter and off-gas performance results obtained on the DM1200 HLW Pilot Melter during processing of AZ-101 and C-106/AY-102 HLW simulants. The tests reported herein are a subset of three tests from a larger series of tests described in the Test Plan for the work; results from the remaining tests will be reported separately. Three nine day tests, one with AZ-101 and two with C-106/AY-102 feeds were conducted with variable amounts of added sugar to address the effects of redox. The test with AZ-101 included ruthenium spikes to also address the effects of redox on ruthenium volatility. One of tests addressed the effects of increased flow-sheet nitrate levels using C-106/AY-102 feeds. With high nitrate/nitrite feeds (such as WTP LAW feeds), reductants are required to prevent melt foaming and deleterious effects on glass production rates. Sugar is the baseline WTP reductant for this purpose. WTP HLW feeds typically have relatively low nitrate/nitrite content in comparison to the organic carbon content and, therefore, have typically not required sugar additions. However, HLW feed variability, particularly with respect to nitrate levels, may necessitate the use of sugar in some instances. The tests reported here investigate the effects of variable sugar additions to the melter feed as well as elevated nitrate levels in the waste. Variables held constant to the extent possible included melt temperature, bubbling rate, plenum temperature, cold cap coverage, the waste simulant composition, and the target glass composition. The principal objectives of the DM1200 melter testing were to determine the achievable glass production rates for simulated HLW feeds with variable amounts of added sugar and increased nitrate levels; characterize melter off-gas emissions; characterize the performance of the prototypical off-gas system components as well as their integrated performance; characterize the feed, glass product, and off-gas effluents; and perform pre- and post test inspections of system components. The specific objectives (including test success criteria) of this testing, along with how each objective was met, are outlined in a table.




Carbon nanotube assisted formation of sub-50 nm polymeric nano-structures  

E-Print Network (OSTI)

A novel processing method was developed for sub-50 nm structures by integrating quantum dots (QDs) on patterned polymer substrates. Poly(styrene-alt-maleic anhydride) (PSMa) was prepared by the initiated chemical vapor ...

Lee, Chia-Hua



Single Event Mechanisms in 90 nm Triple-well CMOS Devices.  

E-Print Network (OSTI)

??Triple-well NMOSFETs collect more charge as compared to dual-well NMOSFETs. Single event charge collection mechanisms in 90 nm triple-well NMOS devices are explained and compared (more)

Roy, Tania



Museum LOS ALAMOS, N.M., Sept. 5, 2013-Los Alamos National Laboratory...  

NLE Websites -- All DOE Office Websites (Extended Search)

lab director to link science education, national security in TEDxABQ talk September 5, 2013 Watch live stream at home or at Bradbury Science Museum LOS ALAMOS, N.M., Sept. 5,...


HSQ double patterning process for 12 nm resolution x-ray zone plates  

E-Print Network (OSTI)

source is focused by a condenser zone plate (CZP) onto thethe outer region of a 30 nm gold condenser zone plate (CZP).The condenser has 40820 zones and a diameter of 9.8 mm. The

Chao, Weilun



Airborne Doppler Lidar Investigation of Sea Surface Reflectance at a 355-nm Ultraviolet Wavelength  

Science Conference Proceedings (OSTI)

The analysis of the sea surface reflectance for different incidence angles based on observations of an airborne Doppler lidar at an ultraviolet wavelength of 355 nm is described. The results were compared to sea surface reflectance models, ...

Zhigang Li; Christian Lemmerz; Ulrike Paffrath; Oliver Reitebuch; Benjamin Witschas



LOS ALAMOS, N.M., August 7, 2013-Los Alamos National Laboratory...  

NLE Websites -- All DOE Office Websites (Extended Search)

Lab's Frontiers in Science lectures focus on epigenetics August 7, 2013 Is behavior hardwired by DNA or a product of environment? LOS ALAMOS, N.M., August 7, 2013-Los Alamos...


Effects of 810-nm Laser on Murine Bone-Marrow-Derived Dendritic Cells  

E-Print Network (OSTI)

Objective: The purpose of this study was to Investigate the effect of 810-nm low level laser therapy (LLLT) on dendritic cells (DC) in vitro. Background data: LLLT can enhance wound healing and increase cell proliferation ...

Chen, Aaron Chih-Hao


A Simple All Weather Model to Estimate Ultraviolet Solar Radiation (290385 nm)  

Science Conference Proceedings (OSTI)

A new expression to estimate the solar ultraviolet irradiance from parameters usually available in radiometric networks is presented. The authors have analyzed the relation between solar ultraviolet global irradiance (290385 nm), UV, and ...

I. Foyo-Moreno; J. Vida; L. Alados-Arboledas


Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


HSQ double patterning process for 12 nm resolution x-ray zone plates  

DOE Green Energy (OSTI)

Soft x-ray zone plate microscopy is a powerful nano-analytic technique used for a wide variety of scientific and technological studies. Pushing its spatial resolution to 10 nm and below is highly desired and feasible due to the short wavelength of soft x-rays. Instruments using Fresnel zone plate lenses achieve a spatial resolution approximately equal to the smallest, outer most zone width. We developed a double patterning zone plate fabrication process based on a high-resolution resist, hydrogen silsesquioxane (HSQ), to bypass the limitations of conventional single exposure fabrication to pattern density, such as finite beam size, scattering in resist and modest intrinsic resist contrast. To fabricate HSQ structures with zone widths in the order of 10 nm on gold plating base, a surface conditioning process with (3-mercaptopropyl) trimethoxysilane, 3-MPT, is used, which forms a homogeneous hydroxylation surface on gold surface and provides good anchoring for the desired HSQ structures. Using the new HSQ double patterning process, coupled with an internally developed, sub-pixel alignment algorithm, we have successfully fabricated in-house gold zone plates of 12 nm outer zones. Promising results for 10 nm zone plates have also been obtained. With the 12 nm zone plates, we have achieved a resolution of 12 nm using the full-field soft x-ray microscope, XM-1.

Chao, Weilun; Kim, Jihoon; Rekawa, Senajith; Fischer, Peter; Anderson, Erik H.



Characterization of an asynchronous source of heralded single photons generated at a wavelength of 1550 nm  

E-Print Network (OSTI)

We make a thorough analysis of heralded single photon sources regarding how factors such as the detector gate-period, the photon rates, the fiber coupling efficiencies, and the system losses affect the performance of the source. In the course of this we give a detailed description of how to determine fiber coupling efficiencies from experimentally measurable quantities. We show that asynchronous sources perform, under most conditions, better than synchronous sources with respect to multiphoton events, but only for nearly perfect coupling efficiencies. We apply the theory to an asynchronous source of heralded single photons based on spontaneous parametric downconversion in a periodically poled, bulk, KTiOPO4 crystal. The source generates light with highly non-degenerate wavelengths of 810 nm and 1550 nm, where the 810 nm photons are used to announce the presence of the 1550 nm photons inside a single-mode optical fiber. For our setup we find the probability of having a 1550 nm photon present in the single-mode fiber, as announced by the 810 nm photon, to be 48%. The probability of multiphoton events is strongly suppressed compared to a Poissonian light source, giving highly sub-Poisson photon statistics.

Maria Tengner; Daniel Ljunggren



Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



4.1.2 NANO FOUNTAIN PROBE WITH 40 NM WRITING RESOLUTION K.-H. Kim, N. Moldovan, H. D. Espinosa; "A Novel Nano Fountain Probe with sub-100 nm  

E-Print Network (OSTI)

4.1.2 NANO FOUNTAIN PROBE WITH 40 NM WRITING RESOLUTION K.-H. Kim, N. Moldovan, H. D. Espinosa; "A Novel Nano Fountain Probe with sub-100 nm Molecular Writing Resolution", Small, 2005, ASAP. Patent the first "nano-fountain pen" capable of depositing organic ink molecules in patterns as small as 40 nm

Shull, Kenneth R.


New Zone Plate for Soft X-Ray Microscopy at 15-nm Spatial Resolution  

NLE Websites -- All DOE Office Websites (Extended Search)

New Zone Plate for Soft X-Ray Microscopy at 15-nm Spatial Resolution Print New Zone Plate for Soft X-Ray Microscopy at 15-nm Spatial Resolution Print Analytical tools that combine spatial resolution with elemental and chemical identification at the nanometer scale along with large penetration depth are indispensable for the life and physical sciences. The XM-1 soft x-ray microscope at the ALS produces images that not only reveal structures but can identify their chemical elements and measure magnetic and other properties as well. Now a new method for creating optical devices with nanoscale accuracy has allowed researchers in Berkeley Lab's Center for X-Ray Optics (CXRO), which built and operates the XM-1, to achieve an extraordinary resolution of better than 15 nm, with the promise of even higher resolution in the near future.


DOI-BLM-NM-L000-2012-0111-DNA | Open Energy Information  

Open Energy Info (EERE)

NM-L000-2012-0111-DNA NM-L000-2012-0111-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NM-L000-2012-0111-DNA DNA at Lightning Dock Geothermal Area for Geothermal/Exploration, {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Lightning Dock Geothermal Inc Geothermal Area Lightning Dock Geothermal Area Project Location New Mexico Project Phase Geothermal/Exploration Techniques Drilling Techniques Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office BLM Las Cruces District Office Managing Field Office none provided Funding Agencies none provided Surface Manager none provided Mineral Manager BLM Selected Dates


New Zone Plate for Soft X-Ray Microscopy at 15-nm Spatial Resolution  

NLE Websites -- All DOE Office Websites (Extended Search)

New Zone Plate for Soft X-Ray Microscopy at 15-nm Spatial Resolution Print New Zone Plate for Soft X-Ray Microscopy at 15-nm Spatial Resolution Print Analytical tools that combine spatial resolution with elemental and chemical identification at the nanometer scale along with large penetration depth are indispensable for the life and physical sciences. The XM-1 soft x-ray microscope at the ALS produces images that not only reveal structures but can identify their chemical elements and measure magnetic and other properties as well. Now a new method for creating optical devices with nanoscale accuracy has allowed researchers in Berkeley Lab's Center for X-Ray Optics (CXRO), which built and operates the XM-1, to achieve an extraordinary resolution of better than 15 nm, with the promise of even higher resolution in the near future.


New Zone Plate for Soft X-Ray Microscopy at 15-nm Spatial Resolution  

NLE Websites -- All DOE Office Websites (Extended Search)

New Zone Plate for Soft X-Ray New Zone Plate for Soft X-Ray Microscopy at 15-nm Spatial Resolution New Zone Plate for Soft X-Ray Microscopy at 15-nm Spatial Resolution Print Wednesday, 31 August 2005 00:00 Analytical tools that combine spatial resolution with elemental and chemical identification at the nanometer scale along with large penetration depth are indispensable for the life and physical sciences. The XM-1 soft x-ray microscope at the ALS produces images that not only reveal structures but can identify their chemical elements and measure magnetic and other properties as well. Now a new method for creating optical devices with nanoscale accuracy has allowed researchers in Berkeley Lab's Center for X-Ray Optics (CXRO), which built and operates the XM-1, to achieve an extraordinary resolution of better than 15 nm, with the promise of even higher resolution in the near future.


DOE - Office of Legacy Management -- Project Gas Buggy Site - NM 14  

Office of Legacy Management (LM)

Gas Buggy Site - NM 14 Gas Buggy Site - NM 14 FUSRAP Considered Sites Site: Project Gas Buggy Site (NM.14 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: Also see Gasbuggy, New Mexico, Site Nevada Test Site History Documents Related to Project Gas Buggy Site Fact Sheet Gasbuggy, New Mexico The Gasbuggy Site is located in northwestern New Mexico in Rio Arriba County approximately 55 miles east of the city of Farmington and approximately 12 miles southwest of Dulce, New Mexico, in the Carson National Forest. Floodplains and Wetlands Survey Results for the Gasbuggy and Gnome-Coach Sites, New Mexico, December 1993.


DOI-BLM-NM-L000-2012-0218-DNA | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NM-L000-2012-0218-DNA DOI-BLM-NM-L000-2012-0218-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NM-L000-2012-0218-DNA DNA at Lightning Dock Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Lightning Dock Geothermal Inc Geothermal Area Lightning Dock Geothermal Area Project Location New Mexico Project Phase Geothermal/Exploration Techniques Well Testing Techniques Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office BLM Las Cruces District Office Managing Field Office none provided Funding Agencies none provided Surface Manager none provided Mineral Manager BLM


New Zone Plate for Soft X-Ray Microscopy at 15-nm Spatial Resolution  

NLE Websites -- All DOE Office Websites (Extended Search)

New Zone Plate for Soft X-Ray Microscopy at 15-nm Spatial Resolution Print New Zone Plate for Soft X-Ray Microscopy at 15-nm Spatial Resolution Print Analytical tools that combine spatial resolution with elemental and chemical identification at the nanometer scale along with large penetration depth are indispensable for the life and physical sciences. The XM-1 soft x-ray microscope at the ALS produces images that not only reveal structures but can identify their chemical elements and measure magnetic and other properties as well. Now a new method for creating optical devices with nanoscale accuracy has allowed researchers in Berkeley Lab's Center for X-Ray Optics (CXRO), which built and operates the XM-1, to achieve an extraordinary resolution of better than 15 nm, with the promise of even higher resolution in the near future.


DOI-BLM-NM-L000-2012-0200-DNA | Open Energy Information  

Open Energy Info (EERE)

DOI-BLM-NM-L000-2012-0200-DNA DOI-BLM-NM-L000-2012-0200-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NM-L000-2012-0200-DNA DNA at Lightning Dock Geothermal Area for Geothermal/Well Field, {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Lightning Dock Geothermal Inc Geothermal Area Lightning Dock Geothermal Area Project Location New Mexico Project Phase Geothermal/Well Field Techniques Drilling Techniques Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office BLM Las Cruces District Office Managing Field Office none provided Funding Agencies none provided Surface Manager none provided Mineral Manager BLM


A 4 to 0.1 nm FEL Based on the SLAC Linac  

Science Conference Proceedings (OSTI)

The author show that using existing electron gun technology and a high energy linac like the one at SLAC, it is possible to build a Free Electron Laser operating around the 4 nm water window. A modest improvement in the gun performance would further allow to extend the FEL to the 0.1 nm region. Such a system would produce radiation with a brightness many order of magnitude above that of any synchrotron radiation source, existing or under construction, with laser power in the multigawatt region and subpicosecond pulse length.

Pellegrini, C.; /UCLA



Analysis of electromigration induced early failures in Cu interconnects for 45nm node  

Science Conference Proceedings (OSTI)

Bi-directional current stressing was used for monitoring electromigration (EM) lifetime evolution in 45nm node interconnects. Experimental results show that an initial bimodal distribution of lifetimes can be modified into a more robust mono-modal distribution. ... Keywords: Bi-directional current, Cu interconnects, Electromigration, FEM modeling

L. Arnaud; F. Cacho; L. Doyen; F. Terrier; D. Galpin; C. Monget




Science Conference Proceedings (OSTI)

The principal objectives of the DM1200 melter tests were to determine the effects of feed rheology, feed solid content, and bubbler configuration on glass production rate and off-gas system performance while processing the HLW AZ-101 and C-106/AY-102 feed compositions; characterize melter off-gas emissions; characterize the performance of the prototypical off-gas system components, as well as their integrated performance; characterize the feed, glass product, and off-gas effluents; and perform pre- and post test inspections of system components. The specific objectives (including test success criteria) of this testing, along with how each objective was met, are outlined in a table. The data provided in this Final Report address the impacts of HLW melter feed rheology on melter throughput and validation of the simulated HLW melter feeds. The primary purpose of this testing is to further validate/verify the HLW melter simulants that have been used for previous melter testing and to support their continued use in developing melter and off-gas related processing information for the Project. The primary simulant property in question is rheology. Simulants and melter feeds used in all previous melter tests were produced by direct addition of chemicals; these feed tend to be less viscous than rheological the upper-bound feeds made from actual wastes. Data provided here compare melter processing for the melter feed used in all previous DM100 and DM1200 tests (nominal melter feed) with feed adjusted by the feed vendor (NOAH Technologies) to be more viscous, thereby simulating more closely the upperbounding feed produced from actual waste. This report provides results of tests that are described in the Test Plan for this work. The Test Plan is responsive to one of several test objectives covered in the WTP Test Specification for this work; consequently, only part of the scope described in the Test Specification was addressed in this particular Test Plan. For the purpose of comparison, the tests reported here were performed with AZ-102 and C-106/AY-102 HLW simulants and glass compositions that are essentially the same as those used for recent DM1200 tests. One exception was the use of an alternate, higher-waste-loading C-106/AY-102 glass composition that was used in previous DM100 tests to further evaluate the performance of the optimized bubbler configuration.




Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Supporting Solar Power in Renewables Portfolio Standards: Experience from the United States  

E-Print Network (OSTI)

NJ Credit Multipliers Specific Technology Solar Energy *:NJ, NM, NV, OH, OR, PA Specific Application Distributed Generation : AZ, CO, NM, NY Solar Energy :

Wiser, Ryan



DOE - Office of Legacy Management -- Blue Water AEC Ore Buying Station - NM  

NLE Websites -- All DOE Office Websites (Extended Search)

Blue Water AEC Ore Buying Station - Blue Water AEC Ore Buying Station - NM 0-02 FUSRAP Considered Sites Site: Blue Water AEC Ore Buying Station (NM.0-02 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: The history of domestic uranium procurement under U.S. Atomic Energy Commission (AEC) contracts identifies a number of ore buying stations (sampling and storage sites) that were operated during the period late-1949 through the mid-1960s. During this period the AEC established ore-buying stations in new uranium producing areas where it appeared that ore production would be sufficient to support a uranium milling operation. The


A InGaN/GaN quantum dot green ({lambda}=524 nm) laser  

SciTech Connect

The characteristics of self-organized InGaN/GaN quantum dot lasers are reported. The laser heterostructures were grown on c-plane GaN substrates by plasma-assisted molecular beam epitaxy and the laser facets were formed by focused ion beam etching with gallium. Emission above threshold is characterized by a peak at 524 nm (green) and linewidth of 0.7 nm. The lowest measured threshold current density is 1.2 kA/cm{sup 2} at 278 K. The slope and wall plug efficiencies are 0.74 W/A and {approx}1.1%, respectively, at 1.3 kA/cm{sup 2}. The value of T{sub 0}=233 K in the temperature range of 260-300 K.

Zhang Meng; Banerjee, Animesh; Lee, Chi-Sen; Hinckley, John M.; Bhattacharya, Pallab [Department of Electrical Engineering and Computer Science, Center for Nanoscale Photonics and Spintronics, University of Michigan, Ann Arbor, Michigan 48109-2122 (United States)



File:USDA-CE-Production-GIFmaps-NM.pdf | Open Energy Information  

Open Energy Info (EERE)

NM.pdf NM.pdf Jump to: navigation, search File File history File usage New Mexico Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 249 KB, MIME type: application/pdf) Description New Mexico Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States New Mexico External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:18, 27 December 2010 Thumbnail for version as of 16:18, 27 December 2010 1,650 × 1,275 (249 KB) MapBot (Talk | contribs) Automated bot upload

Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Radiation-induced transient attenuation of optical fibers at 800 and 1300 nm  

SciTech Connect

Radiation-induced absorption in optical fibers has been a subject of considerable interest throughout the world. As availability and applications of fibers have evolved from ''first window'' systems operating near 850 nm to ''second window'' systems near 1300 nm, interest in wavelength dependence of radiation effects in optical fibers has similarly evolved. The present work summarizes second-window, radiation-induced transient absorption measurements in optical fibers for times shorter than 5 ..mu..s. Comparisons to first window data for these fibers are also presented. Only high purity silica fibers with low-OH concentrations were used in the present study to avoid the large OH absorption band in this region. This paper also collects first window data on several high-OH optical fibers.

Looney, L.D.; Lyons, P.B.



Development of mirror manipulator for hard-x-ray nanofocusing at sub-50-nm level  

Science Conference Proceedings (OSTI)

X-ray focusing using Kirkpatrick-Baez (KB) mirrors is promising owing to their capability of highly efficient and energy-tunable focusing. We report the development of a mirror manipulator which enables KB mirror alignment with a high degree of accuracy. Mirror alignment tolerances were estimated using two types of simulators. On the basis of the simulation results, the mirror manipulator was developed to achieve an optimum KB mirror setup. As a result of focusing tests at BL29XUL of SPring-8, the beam size of 48x36 nm{sup 2} (VxH) was achieved in the full width at half maximum at an x-ray energy of 15 keV. Spatial resolution tests showed that a scanning x-ray microscope equipped with the KB focusing system could resolve line-and-space patterns of 80 nm linewidth in a high visibility of 60%.

Matsuyama, S.; Mimura, H.; Yumoto, H.; Hara, H.; Yamamura, K.; Sano, Y.; Endo, K.; Mori, Y.; Yabashi, M.; Nishino, Y.; Tamasaku, K.; Ishikawa, T.; Yamauchi, K. [Department of Precision Science and Technology, Graduate School of Engineering, Osaka University, 2-1 Yamada-oka, Suita, Osaka 565-0871 (Japan); Research Center for Ultra-Precision Science and Technology, Graduate School of Engineering, Osaka University, 2-1 Yamada-oka, Suita, Osaka 565-0871 (Japan); Department of Precision Science and Technology, Graduate School of Engineering, Osaka University, 2-1 Yamada-oka, Suita, Osaka 565-0871 (Japan); Research Center for Ultra-Precision Science and Technology, Graduate School of Engineering, Osaka University, 2-1 Yamada-oka, Suita, Osaka 565-0871 (Japan); SPring-8/Japan Synchrotron Radiation Research Institute (JASRI), 1-1-1 Kouto, Mikazuki, Hyogo 679-5148 (Japan); SPring-8/RIKEN, 1-1-1 Kouto, Mikazuki, Hyogo 679-5148 (Japan); Department of Precision Science and Technology, Graduate School of Engineering, Osaka University, 2-1 Yamada-oka, Suita, Osaka 565-0871 (Japan)



Effects of amines on formation of sub-3 nm particles and their subsequent growth  

SciTech Connect

Field observations and quantum chemical calculations suggest that amines can be important for formation of nanometer size particles. Amines and ammonia often have common atmospheric emission sources and the similar chemical and physical properties. While the effects of ammonia on aerosol nucleation have been previously investigated, laboratory studies of homogeneous nucleation involving amines are lacking. We have made kinetics studies of multicomponent nucleation (MCN) with sulfuric acid, water, ammonia and amines under conditions relevant to the atmosphere. Low concentrations of aerosol precursors were measured with chemical ionization mass spectrometers (CIMS) to provide constrained precursor concentrations needed for nucleation. Particle sizes larger than {approx}2 nm were measured with a nano-differential mobility analyzer (nano-DMA), and number concentrations of particles larger than {approx}1 nm were measured with a particle size magnifier (PSM). Our observations provide the laboratory evidence that amines indeed can participate in aerosol nucleation and growth at the molecular cluster level. The enhancement of particle number concentrations due to several atmospherically relevant amine compounds and ammonia were related to the basicity of these compounds, indicating that acid-base reactions may contribute to the formation of sub-3 nm particles.

Yu H.; McGraw R.; Lee S.-H.



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Xenon ion laser-induced fluorescence using a visible tunable diode laser near 680 nm  

SciTech Connect

Laser-induced fluorescence (LIF) measurements have been performed for the first time in a low temperature (T{sub e}{approx_equal}0.6 eV) Xe plasma using a tunable diode laser in the visible range of wavelengths. The transition in Xe II involved the ({sup 3}P{sub 1})5d[3]{sub 7/2} metastable state and the excitation wavelength was found to be 680.570{+-}0.001 nm (air). LIF measurements of I{sub 2} in a room temperature iodine gas cell were used to monitor the wavelength of the laser during the measurements.

Severn, Greg; Lee, Dongsoo; Hershkowitz, Noah [Department of Physics, University of San Diego, San Diego, California 92110 (United States); Department of Engineering Physics, University of Wisconsin at Madison, Madison, Wisconsin 53706 (United States)



Light trapping in a 30-nm organic photovoltaic cell for efficient carrier collection and light absorption  

E-Print Network (OSTI)

We describe surface patterning strategies that permit high photon-collection efficiency together with high carrier-collection efficiency in an ultra-thin planar heterojunction organic photovoltaic cell. Optimized designs reach up to 50% photon collection efficiency in a P3HT layer of only 30 nm, representing a 3- to 5-fold improvement over an unpatterned cell of the same thickness. We compare the enhancement of light confinement in the active layer with an ITO top layer for TE and TM polarized light, and demonstrate that the light absorption can increase by a factor of 2 due to a gap-plasmon mode in the active layer.

Tsai, Cheng-Chia; Banerjee, Ashish; Osgood, Richard M; Englund, Dirk



Direct Patterning of CdSe Quantum Dots into Sub-100 nm Structures  

SciTech Connect

Ordered, two-dimensional cadmium selenide (CdSe) arrays have been fabricated on indium-doped tin oxide (ITO) electrodes using the pattern replication in nonwetting templates (PRINT) process. CdSe quantum dots (QDs) with an average diameter of 2.7 nm and a pyridine surface ligand were used for patterning. The PRINT technique utilizes a perfluoropolyether (PFPE) elastomeric mold that is tolerant of most organic solvents, thus allowing solutions of CdSe QDs in 4-picoline to be used for patterning without significant deformation of the mold. Nanometer-scale diffraction gratings have been successfully replicated with CdSe QDs.

Hampton, Meredith J.; Templeton, Joseph L.; DeSimone, Joseph M.



ARR/18th SOFE Presentation, Albuquerque, NM, October 1999 SiC/SiC Composite for an  

E-Print Network (OSTI)

ARR/18th SOFE Presentation, Albuquerque, NM, October 1999 SiC/SiC Composite for an Advanced Fusion, Albuquerque, NM, October 1999 Background · The use of SiC/SiC composite as structural material in a fusion of a SiC/SiC based blanket for high performance blanket design - High temperature operation - Use latest

Raffray, A. René


Study on the oxidation and reduction of tungsten surface for sub-50 nm patterning process  

Science Conference Proceedings (OSTI)

The oxidation characteristics of tungsten line pattern during the carbon-based mask-layer removal process using oxygen plasmas have been investigated for sub-50 nm patterning processes, in addition to the reduction characteristics of the WO{sub x} layer formed on the tungsten line surface using hydrogen plasmas. The surface oxidation of tungsten lines during the mask layer removal process could be minimized by using low-temperature (300 K) plasma processing for the removal of the carbon-based material. Using this technique, the thickness of WO{sub x} on the tungsten line could be decreased to 25% compared to results from high-temperature processing. The WO{sub x} layer could also be completely removed at a low temperature of 300 K using a hydrogen plasma by supplying bias power to the tungsten substrate to provide a activation energy for the reduction. When this oxidation and reduction technique was applied to actual 40-nm-CD device processing, the complete removal of WO{sub x} formed on the sidewall of tungsten line could be observed.

Kim, Jong Kyu; Nam, Seok Woo; Cho, Sung Il; Jhon, Myung S.; Min, Kyung Suk; Kim, Chan Kyu; Jung, Ho Bum; Yeom, Geun Young [Memory Division Semiconductor Business, Samsung Electronics, San No. 16 Banwol-Ri, Taean-Eup, Hwasung-City, Gyeonggi-Do 449-711, South Korea and Department of Advanced Materials Science and Engineering, Sungkyunkwan University, Suwon, Gyeonggi-do 440-746 (Korea, Republic of); Memory Division Semiconductor Business, Samsung Electronics, San No. 16 Banwol-Ri, Taean-Eup, Hwasung-City, Gyeonggi-Do 449-711 (Korea, Republic of); Department of Chemical Engineering and Data Storage Systems Center, Carnegie Mellon University, Pittsburgh, Pennsylvania 15213 (United States); Department of Advanced Materials Science and Engineering, Sungkyunkwan University, Suwon, Gyeonggi-do 440-746 (Korea, Republic of)



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah




Science Conference Proceedings (OSTI)

This document provides the final report on data and results obtained from commissioning tests performed on the one-third scale DuraMelter{trademark} 1200 (DM 1200) HLW Pilot Melter system that has been installed at VSL with an integrated prototypical off-gas treatment system. That system has replaced the DM1000 system that was used for HLW throughput testing during Part BI [1]. Both melters have similar melt surface areas (1.2 m{sup 2}) but the DM1200 is prototypical of the present RPP-WTP HLW melter design whereas the DM1000 was not. These tests were performed under a corresponding RPP-WTP Test Specification and associated Test Plan. This report is a followup to the previously issued Preliminary Data Summary Report. The DM1200 system will be used for testing and confirmation of basic design, operability, flow sheet, and process control assumptions as well as for support of waste form qualification and permitting. This will include data on processing rates, off-gas treatment system performance, recycle stream compositions, as well as process operability and reliability. Consequently, this system is a key component of the overall HLW vitrification development strategy. The results presented in this report are from the initial series of short-duration tests that were conducted to support the start-up and commissioning of this system prior to conducting the main body of development tests that have been planned for this system. These tests were directed primarily at system 'debugging,' operator training, and procedure refinement. The AZ-101 waste simulant and glass composition that was used for previous testing was selected for these tests.




DOI-BLM-NM-L000-2012-0046-CX | Open Energy Information  

Open Energy Info (EERE)

6-CX 6-CX Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NM-L000-2012-0046-CX CX at Lightning Dock Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type CX Applicant Lightning Dock Geothermal Inc Geothermal Area Lightning Dock Geothermal Area Project Location New Mexico Project Phase Geothermal/Exploration Techniques Time Frame (days) Application Time 16 Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office BLM Las Cruces District Office Managing Field Office none provided Funding Agencies none provided Surface Manager none provided Mineral Manager BLM Selected Dates Application Date 1/4/2012


LOS ALAMOS, N.M., Oct. 31, 2013-Los Alamos National Laboratory scientist  

NLE Websites -- All DOE Office Websites (Extended Search)

Matter, antimatter and surviving the big Matter, antimatter and surviving the big bang is topic of Lab's next Frontiers in Science lecture October 31, 2013 Talk begins at 7 p.m. and open to public LOS ALAMOS, N.M., Oct. 31, 2013-Los Alamos National Laboratory scientist Vincenzo Cirigliano asks the question, How did we survive the big bang? in a series of Frontiers in Science lectures beginning Monday, Nov. 4, in the Duane Smith Auditorium at Los Alamos High School. "Particles and antiparticles were produced in equal numbers in the aftermath of the big bang," according to Cirigliano. "As the primordial soup cooled, they should have completely destroyed each other, leaving behind a universe with no matter. Instead, an - 2 - imbalance of matter over antimatter developed, eventually leading to galaxies and stars


LOS ALAMOS, N.M., Aug. 21, 2013-The High-Altitude Water Cherenkov (HAWC)  

NLE Websites -- All DOE Office Websites (Extended Search)

gamma-ray observatory begins gamma-ray observatory begins operations at Sierra Negra volcano in the state of Puebla, Mexico August 21, 2013 New site to observe supernovas and supermassive black holes LOS ALAMOS, N.M., Aug. 21, 2013-The High-Altitude Water Cherenkov (HAWC) Gamma Ray Observatory has begun formal operations at its site in Mexico. HAWC is designed to study the origin of very high-energy cosmic rays and observe the most energetic objects in the known universe. This extraordinary observatory, using a unique detection technique that differs from the classical astronomical design of mirrors, - 2 - lenses, and antennae, is a significant boost to international scientific and technical knowledge. "The HAWC observatory will search for signals from dark matter and to study some


DOI-BLM-NM-L000-2012-0020-DNA | Open Energy Information  

Open Energy Info (EERE)

20-DNA 20-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NM-L000-2012-0020-DNA DNA at Lightning Dock Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Energy Sector Geothermal energy Environmental Analysis Type DNA Applicant Lightning Dock Geothermal Inc Geothermal Area Lightning Dock Geothermal Area Project Location New Mexico Project Phase Geothermal/Exploration Techniques Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office BLM Las Cruces District Office Managing Field Office none provided Funding Agencies none provided Surface Manager none provided Mineral Manager BLM Selected Dates Application Document Type Sundry Notice


DOE Challenge Home Case Study, Palo Duro Homes, Inc., Albuquerque, NM, Production  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Palo Duro Palo Duro Homes, Inc. Albuquerque, NM BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.


LOS ALAMOS, N.M., January 15, 2013-Researchers from Los Alamos National  

NLE Websites -- All DOE Office Websites (Extended Search)

follows the 'Yellowknife follows the 'Yellowknife Road' to Martian wet area January 15, 2013 Instrument confirms presence of gypsum and related minerals LOS ALAMOS, N.M., January 15, 2013-Researchers from Los Alamos National Laboratory and the French Space Agency have tracked a trail of minerals that point to the prior presence of water at the Curiosity rover site on Mars. Researchers from the Mars Science Laboratory's ChemCam team today described how the laser instrument aboard the Curiosity Rover-an SUV-sized vehicle studying the surface of the Red Planet-has detected veins of gypsum running through an area known as Yellowknife Bay, located some 700 meters away from where the Curiosity Rover landed five months ago. - 2 - "These veins are composed mainly of hydrated calcium sulfate, such as bassanite


LOS ALAMOS, N.M., Nov. 19, 2013-Researchers at Los Alamos National Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

virus spread and evolution studied virus spread and evolution studied through computer modeling November 19, 2013 LOS ALAMOS, N.M., Nov. 19, 2013-Researchers at Los Alamos National Laboratory are investigating the complex relationships between the spread of the HIV virus in a population (epidemiology) and the actual, rapid evolution of the virus (phylogenetics) within each patient's body. "We have developed novel ways of estimating epidemics dynamics such as who infected whom, and the true population incidence of infection versus mere diagnoses dates," said Thomas Leitner, principal investigator. "Obviously, knowledge about these things is important for public health monitoring, decision making and intervention campaigns, and further to forensic investigations." The team models the uninfected population using traditional differential equations

Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOI-BLM-NM-L000-2012-0042-DNA | Open Energy Information  

Open Energy Info (EERE)

2-DNA 2-DNA Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home NEPA Document Collection for: DOI-BLM-NM-L000-2012-0042-DNA DNA at Lightning Dock Geothermal Area for Geothermal/Exploration {{{NEPA_Name}}} General NEPA Document Info Environmental Analysis Type DNA Applicant Lightning Dock Geothermal Inc Geothermal Area Lightning Dock Geothermal Area Project Location New Mexico Project Phase Geothermal/Exploration Techniques Time Frame (days) Participating Agencies Lead Agency BLM Funding Agency none provided Managing District Office BLM Las Cruces District Office Managing Field Office none provided Funding Agencies none provided Surface Manager none provided Mineral Manager BLM Selected Dates Application Document Type Sundry Notice Relevant Numbers Lead Agency


Dense wavelength multiplexing of 1550 nm QKD with strong classical channels in reconfigurable networking environments  

Science Conference Proceedings (OSTI)

To move beyond dedicated links and networks, quantum communications signals must be integrated into networks carrying classical optical channels at power levels many orders of magnitude higher than the quantum signals themselves. We demonstrate transmission of a 1550-nm quantum channel with up to two simultaneous 200-GHz spaced classical telecom channels, using ROADM (reconfigurable optical <1dd drop multiplexer) technology for multiplexing and routing quantum and classical signals. The quantum channel is used to perform quantum key distribution (QKD) in the presence of noise generated as a by-product of the co-propagation of classical channels. We demonstrate that the dominant noise mechanism can arise from either four-wave mixing or spontaneous Raman scattering, depending on the optical path characteristics as well <1S the classical channel parameters. We quantity these impairments and discuss mitigation strategies.

Rosenberg, Danna [Los Alamos National Laboratory; Peterson, Charles G [Los Alamos National Laboratory; Dallmann, Nicholas [Los Alamos National Laboratory; Hughes, Richard J [Los Alamos National Laboratory; Mccabe, Kevin P [Los Alamos National Laboratory; Nordholt, Jane E [Los Alamos National Laboratory; Tyagi, Hush T [Los Alamos National Laboratory; Peters, Nicholas A [TELCORDIA TECHNOLOGIES; Toliver, Paul [TELCORDIA TECHNOLOGIES; Chapman, Thomas E [TELCORDIA TECHNOLOGIES; Runser, Robert J [TELCORDIA TECHNOLOGIES; Mcnown, Scott R [TELCORDIA TECHNOLOGIES



The direct measurement of ablation pressure driven by 351-nm laser radiation  

Science Conference Proceedings (OSTI)

The instantaneous scaling of ablation pressure to laser intensity is directly inferred for ramp compression of diamond targets irradiated by 351-nm light. Continuously increasing pressure profiles from 100 to 970 GPa are produced by direct-drive laser ablation at intensities up to 7 x 10{sup 13} W/cm{sup 2}. The free-surface velocity on the rear of the target is used to directly infer the instantaneous ablation-pressure profile at the front of the target. The laser intensity on target is determined by laser power measurements and fully characterized laser spots. The ablation pressure is found to depend on the laser intensity as P(GPa)=42({+-}3)[I(TW/cm{sup 2})]{sup 0.71({+-}0.01)}.

Fratanduono, D. E. [Laboratory for Laser Energetics, University of Rochester, 250 East River Road, Rochester, New York 14623-1299 (United States); Department of Mechanical Engineering, University of Rochester, 250 East River Road, Rochester, New York 14623-1299 (United States); Lawrence Livermore National Laboratory, Livermore, California 94550 (United States); Boehly, T. R. [Laboratory for Laser Energetics, University of Rochester, 250 East River Road, Rochester, New York 14623-1299 (United States); Celliers, P. M.; Eggert, J. H.; Smith, R. F.; Hicks, D. G.; Collins, G. W. [Lawrence Livermore National Laboratory, Livermore, California 94550 (United States); Barrios, M. A. [Laboratory for Laser Energetics, University of Rochester, 250 East River Road, Rochester, New York 14623-1299 (United States); Department of Physics and Astronomy, University of Rochester, 250 East River Road, Rochester, New York 14623-1299 (United States); Meyerhofer, D. D. [Laboratory for Laser Energetics, University of Rochester, 250 East River Road, Rochester, New York 14623-1299 (United States); Department of Mechanical Engineering, University of Rochester, 250 East River Road, Rochester, New York 14623-1299 (United States); Department of Physics and Astronomy, University of Rochester, 250 East River Road, Rochester, New York 14623-1299 (United States)



Sub-0.1 nm-resolution quantitative scanning transmission electron microscopy without adjustable parameters  

Science Conference Proceedings (OSTI)

Atomic-resolution imaging in the scanning transmission electron microscope (STEM) constitutes a powerful tool for nanostructure characterization. Here, we demonstrate the quantitative interpretation of atomic-resolution high-angle annular dark-field (ADF) STEM images using an approach that does not rely on adjustable parameters. We measure independently the instrumental parameters that affect sub-0.1 nm-resolution ADF images, quantify their individual and collective contributions to the image intensity, and show that knowledge of these parameters enables a quantitative interpretation of the absolute intensity and contrast across all accessible spatial frequencies. The analysis also provides a method for the in-situ measurement of the STEM's effective source distribution.

Dwyer, C. [Monash Centre for Electron Microscopy, Monash University, Victoria 3800 (Australia); Department of Materials Engineering, Monash University, Victoria 3800 (Australia); ARC Centre of Excellence for Design in Light Metals, Monash University, Victoria 3800 (Australia); Maunders, C. [Department of Materials Engineering, Monash University, Victoria 3800 (Australia); Zheng, C. L. [Monash Centre for Electron Microscopy, Monash University, Victoria 3800 (Australia); Weyland, M.; Etheridge, J. [Monash Centre for Electron Microscopy, Monash University, Victoria 3800 (Australia); Department of Materials Engineering, Monash University, Victoria 3800 (Australia); Tiemeijer, P. C. [FEI Electron Optics, P.O. Box 80066, 5600 KA Eindhoven (Netherlands)



Pedestrian and traffic safety in parking lots at SNL/NM : audit background report.  

SciTech Connect

This report supplements audit 2008-E-0009, conducted by the ES&H, Quality, Safeguards & Security Audits Department, 12870, during fall and winter of FY 2008. The study evaluates slips, trips and falls, the leading cause of reportable injuries at Sandia. In 2007, almost half of over 100 of such incidents occurred in parking lots. During the course of the audit, over 5000 observations were collected in 10 parking lots across SNL/NM. Based on benchmarks and trends of pedestrian behavior, the report proposes pedestrian-friendly features and attributes to improve pedestrian safety in parking lots. Less safe pedestrian behavior is associated with older parking lots lacking pedestrian-friendly features and attributes, like those for buildings 823, 887 and 811. Conversely, safer pedestrian behavior is associated with newer parking lots that have designated walkways, intra-lot walkways and sidewalks. Observations also revealed that motorists are in widespread noncompliance with parking lot speed limits and stop signs and markers.

Sanchez, Paul Ernest



LOS ALAMOS, N.M., Feb. 14, 2013-Recently a Los Alamos National Laboratory  

NLE Websites -- All DOE Office Websites (Extended Search)

Quantum cryptography put to work for Quantum cryptography put to work for electric grid security February 14, 2013 LOS ALAMOS, N.M., Feb. 14, 2013-Recently a Los Alamos National Laboratory quantum cryptography (QC) team successfully completed the first-ever demonstration of securing control data for electric grids using quantum cryptography. The demonstration was performed in the electric grid test bed that is part of the Trustworthy Cyber Infrastructure for the Power Grid (TCIPG) project at the University of Illinois Urbana-Champaign (UIUC) that was set up under the Department of Energy's Cyber Security for Energy Delivery Systems program in the Office of Electricity Delivery and Energy Reliability. Novel methods for controlling the electric grid are needed to accommodate new energy sources such as renewables whose availability can fluctuate on short time scales. This


LOS ALAMOS, N.M., June 4, 2013-Los Alamos National Laboratory researchers  

NLE Websites -- All DOE Office Websites (Extended Search)

Using laser-driven neutrons to stop Using laser-driven neutrons to stop nuclear smugglers June 4, 2013 Los Alamos shows first nuclear material detection by single short-pulse-laser-driven neutron source LOS ALAMOS, N.M., June 4, 2013-Los Alamos National Laboratory researchers have successfully demonstrated for the first time that laser-generated neutrons can be enlisted as a useful tool in the War on Terror. The international research team in February used the short-pulse laser at Los Alamos's TRIDENT facility to generate a neutron beam with novel characteristics that interrogated a closed container to confirm the presence and quantity of nuclear material inside. The successful experiment paves the way for creation of a table-top-sized or truck-mounted - 2 - neutron generator that could be installed at strategic locations worldwide to thwart


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office


Near tubule and intertubular bovine detin mapped at the 250 nm level.  

Science Conference Proceedings (OSTI)

In this study, simultaneous diffraction and fluorescence mapping with a (250 nm){sup 2}, 10.1 keV synchrotron X-ray beam investigated the spatial distribution of carbonated apatite (cAp) mineral and elemental Ca (and other cations including Zn) around dentin tubules. In 1 {mu}m thick sections of near-pulp root dentin, where peritubular dentin (PTD) is newly forming, high concentrations of Zn, relative to those in intertubular dentin (ITD), were observed adjacent to and surrounding the tubule lumens. Some but not all tubules exhibited hypercalcified collars (high Ca signal relative to the surrounding ITD), and, when present, the zone of high Ca did not extend around the tubule. Diffraction rings from cAp 00.2 and 11.2 + 21.1 + 30.0 reflections were observed, and cAp was the only crystal phase detected. Profiles of Ca, Zn and cAp diffracted intensities showed the same transitions from solid to tubule lumen, indicating the same cAp content and organization in ITD far from the tubules and adjacent to them. Further, the matching Ca and diffraction profiles demonstrated that all of the Ca is in cAp or that any noncrystalline Ca was uniformly distributed throughout the dentin. Variation of 00.2 and 11.2 + 21.1 + 30.0 diffracted intensity was consistent with the expected biaxial crystallographic texture. Extension of X-ray mapping from near 1 {mu}m resolution to the 250 nm level, performed here for dentin and its tubules, will provide new understanding of other mineralized tissues.

Stock, S.R.; Veis, A.; Telser, A.; Cai, Z. (X-Ray Science Division); (Northwestern Univ.)



Absolute frequency measurement for the emission transitions of molecular iodine in the 982 - 985 nm range  

SciTech Connect

We report high-precision frequency measurements of the separate hyperfine structure (HFS) components of the emission B - X system transitions of {sup 127}I{sub 2} molecules in the 982 - 985 nm range. To resolve the HFS of the emission lines, advantage was taken of the method of three-level laser spectroscopy. The function of exciting radiation was fulfilled by the second harmonic of a cw Nd : YAG laser, and the probe radiation in the 968 - 998 nm range was generated by an external-cavity diode laser. The output Nd : YAG laser frequency was locked to an HFS component of the absorption transition and the probing laser radiation to the emission transition component. When both frequencies were locked to HFS components with a common upper level, the output diode laser frequency was precisely equal to the emission transition frequency. The output frequency of the thus stabilised diode laser was measured with the help of a femtosecond optical frequency synthesiser based on a Ti : sapphire laser. We present the results of the absolute frequency measurements of 20 HFS components belonging to six vibrational - rotational transitions of the B - X system of iodine [R56(32 - 48)a1, P58(32 - 48)a1, P85(33 - 48)a1, R87(33 - 48a1, R88(33 - 48)a10] and all 15 components of the R86(33 - 48) line. The relative measurement uncertainty is equal to 7 Multiplication-Sign 10{sup -10} and is determined by the frequency instability of the diode laser radiation.

Matyugin, Yu A; Ignatovich, S M; Kuznetsov, Sergei A; Nesterenko, M I; Okhapkin, M V; Pivtsov, V S; Skvortsov, Mikhail N; Bagaev, Sergei N [Institute of Laser Physics, Siberian Branch, Russian Academy of Sciences, Novosibirsk (Russian Federation)



The photodissociation of oxetane at 193 nm as the reverse of the Paterno-Buchi reaction  

SciTech Connect

We investigated the photodissociation of oxetane (1,3-trimethylene oxide) at 193.3 nm in a molecular-beam apparatus using photofragment-translational spectroscopy and selective photoionization. We measured time-of-flight (TOF) spectra and angular anisotropy parameters {beta}(t) as a function of flight time of products at m/z=26-30 u utilizing photoionization energies from 9.8 to 14.8 eV. The TOF distributions of the products alter greatly with the employed photon energy, whereas their {beta}(t) distributions are insensitive to the photon energy. Dissociation to H{sub 2}CO+C{sub 2}H{sub 4} is the major channel in the title reaction. Three distinct dissociation paths with branching ratios 0.923:0.058:0.019 are responsible for the three features observed in the distribution of kinetic energy released in the channel H{sub 2}CO+C{sub 2}H{sub 4}. The observation of H{sub 2} and H atoms, {approx}1% in branching, indicates that products H{sub 2}CO and C{sub 2}H{sub 4} spontaneously decompose to only a small extent. Most HCO, C{sub 2}H{sub 3}, and C{sub 2}H{sub 2} ions originate from dissociative photoionization of products H{sub 2}CO and C{sub 2}H{sub 4}. Except atomic H and H{sub 2}, the photoproducts have large angular anisotropies, {beta}{>=}-0.8, which reflects rapid dissociation of oxetane following optical excitation at 193.3 nm. The mechanisms of dissociation of oxetane are addressed. Our results confirm the quantum-chemical calculations of Palmer et al. and provide profound insight into the Paterno-Buchi reaction.

Lee, Shih-Huang [National Synchrotron Radiation Research Center (NSRRC), 101 Hsin-Ann Road, Hsinchu Science Park, Hsinchu 30076, Taiwan (China)



Spectroscopy and decay kinetics of Pr{sup 3+}-doped chloride crystals for 1300-nm optical amplifiers  

Science Conference Proceedings (OSTI)

Several Pr{sup 3+}-doped chloride crystals have been tested spectroscopically for suitability as 1300-nm optical amplifiers operating on the {sup 1}G{sub 4} - {sup 3}H{sub 5} transition. {sup 1}G{sub 4} lifetimes are much longer than in fluoride hosts, ranging up to 1300 {mu}sec and suggesting a near-unity luminescence quantum yield. Emission spectra are typically broad (FWHM {approximately} 70 nm) and include the 1310-nm zero-dispersion wavelength of standard telecommunications fiber.

Page, R.H.; Schaffers, K.I.; Wilke, G.D. [and others




Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural



Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration


Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.



Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost

Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."



Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of


45-nm silicon-on-insulator CMOS technology integrating embedded DRAM for high-performance server and ASIC applications  

Science Conference Proceedings (OSTI)

The 45-nm technology, called 12S and developed for IBM POWER7, is an extremely robust and versatile technology platform that allows for a rich set of features that include embedded dynamic random access memory (DRAM), performance and ...

S. S. Iyer; G. Freeman; C. Brodsky; A. I. Chou; D. Corliss; S. H. Jain; N. Lustig; V. McGahay; S. Narasimha; J. Norum; K. A. Nummy; P. Parries; S. Sankaran; C. D. Sheraw; P. R. Varanasi; G. Wang; M. E. Weybright; X. Yu; E. Crabbe; P. Agnello



Photon-controlled fabrication of amorphous superlattice structures using ArF (193 nm) excimer laser photolysis  

SciTech Connect

Pulsed ArF (193 nm) excimer laser photolysis of disilane, germane, and disilane-ammonia mixtures has been used to deposit amorphous superlattices containing silicon, germanium, and silicon nitride layers. Transmission electron microscope cross-section views demonstrate that structures having thin (5--25 nm) layers and sharp interlayer boundaries can be deposited at substrate temperatures below the pyrolytic threshold, entirely under laser photolytic control.

Lowndes, D.H.; Geohegan, D.B.; Eres, D.; Pennycook, S.J.; Mashburn, D.N.; Jellison G.E. Jr.



Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:


A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



Size and time-resolved growth rate measurements of 1 to 5 nm freshly formed atmospheric nuclei  

SciTech Connect

This study presents measurements of size and time-resolved particle diameter growth rates for freshly nucleated particles down to 1 nm geometric diameter. Novel data analysis methods were developed, de-coupling for the first time the size and time-dependence of particle growth rates by fitting the aerosol general dynamic equation to size distributions obtained at an instant in time. Size distributions of freshly nucleated total aerosol (neutral and charged) were measured during two intensive measurement campaigns in different environments (Atlanta, GA and Boulder, CO) using a recently developed electrical mobility spectrometer with a diethylene glycol-based ultrafine condensation particle counter as the particle detector. One new particle formation (NPF) event from each campaign was analyzed in detail. At a given instant in time during the NPF event, size-resolved growth rates were obtained directly from measured size distributions and were found to increase approximately linearly with particle size from {approx}1 to 3 nm geometric diameter, increasing from 5.5 {+-} 0.8 to 7.6 {+-} 0.6 nm h{sup -1} in Atlanta (13:00) and from 5.6 {+-} 2 to 27 {+-} 5 nm h{sup -1} in Boulder (13:00). The resulting growth rate enhancement {Lambda}, defined as the ratio of the observed growth rate to the growth rate due to the condensation of sulfuric acid only, was found to increase approximately linearly with size from {approx}1 to 3 nm geometric diameter. For the presented NPF events, values for {Lambda} had lower limits that approached {approx}1 at 1.2 nm geometric diameter in Atlanta and {approx}3 at 0.8 nm geometric diameter in Boulder, and had upper limits that reached 8.3 at 4.1 nm geometric diameter in Atlanta and 25 at 2.7 nm geometric diameter in Boulder. Nucleated particle survival probability calculations comparing the effects of constant and size-dependent growth indicate that neglecting the strong dependence of growth rate on size from 1 to 3 nm observed in this study could lead to a significant overestimation of CCN survival probability.

Kuang C.; Chen, M.; Zhao, J.; Smith, J.; McMurry, P. H.; Wang, J.



Zinc ion and neutral emission from single crystal zinc oxide during 193-nm excimer laser exposure  

SciTech Connect

Mass resolved time-of-flight measurements on neutral zinc atoms and zinc ions show energetic ions and neutrals during 193-nm irradiation of single crystals of semiconducting zinc oxide. Typical Zn+ kinetic energies are 3-5 eV. At fluences (energy per unit area per pulse) below 200 mJ/cm2, the ion intensities (per laser pulse) decrease monotonically to low values with laser pulse number. The depletion kinetics change from exponential to second order near 50 mJ/cm2. We attribute this change to the annihilation of defects yielding Zn+ emission when Zn+ or other surface defects become mobile. At fluences between 200 and 300 mJ/cm2, Zn+ emission becomes more sustained due to defects created by the laser. In this same fluence range, we observe the onset of detectable neutral atomic zinc emission. These neutral atoms display Maxwell-Boltzmann kinetic energy distributions w th effective surface temperatures that approach 5000 K as the fluence is raised to 350 mJ/cm2. These high surface temperatures are remarkable given the low etch rates observed at these fluences, suggesting that heated layer is extremely thin. We propose emission mechanisms and experiments to resolve outstanding questions.

Kahn, E. H. [Washington State University; Langford, S. C. [Washington State University; Boatner, Lynn A [ORNL; Dickinson, J. T. [Washington State University



Ultraviolet photodissociation of iodine monochloride (ICl) at 235, 250, and 265 nm  

SciTech Connect

ICl photolysis in the ultraviolet region of the spectrum (235-265 nm) is studied using the Slice Imaging technique. The Cl*({sup 2}P{sub 1/2})/Cl({sup 2}P{sub 3/2}) and the I*({sup 2}P{sub 1/2})/I({sup 2}P{sub 3/2}) branching ratio between the I({sup 2}P{sub 3/2}) + Cl({sup 2}P{sub 3/2})/Cl*({sup 2}P{sub 1/2}) and I*({sup 2}P{sub 1/2}) + Cl({sup 2}P{sub 3/2})/Cl*({sup 2}P{sub 1/2}) channels is extracted from the respective iodine and chlorine photofragment images. We find that ground state chlorine atoms (Cl({sup 2}P{sub 3/2})) are formed nearly exclusively with excited state iodine atoms (I*({sup 2}P{sub 1/2})), while excited spin-orbit chlorine atoms (Cl*({sup 2}P{sub 1/2})) are concurrently produced only with ground state iodine atoms (I({sup 2}P{sub 3/2})). We conclude that photolysis of ICl in this UV region is a relatively ''clean'' source of spin-orbit excited chlorine atoms that can be used in crossed molecular beam experiments.

Diamantopoulou, N.; Kitsopoulos, Theofanis N. [Institute of Electronic Structure and Laser, Foundation of Research and Technology Hellas, Iraklion 71110 (Greece); Department of Chemistry, University of Crete, Iraklion 71003 (Greece); Kartakoulis, A.; Glodic, P.; Samartzis, Peter C. [Institute of Electronic Structure and Laser, Foundation of Research and Technology Hellas, Iraklion 71110 (Greece)



Spectral irradiance model for tungsten halogen lamps in 340-850 nm wavelength range  

Science Conference Proceedings (OSTI)

We have developed a physical model for the spectral irradiance of 1 kW tungsten halogen incandescent lamps for the wavelength range 340-850 nm. The model consists of the Planck's radiation law, published values for the emissivity of tungsten, and a residual spectral correction function taking into account unknown factors of the lamp. The correction function was determined by measuring the spectra of a 1000 W, quartz-halogen, tungsten coiled filament (FEL) lamp at different temperatures. The new model was tested with lamps of types FEL and 1000 W, 120 V quartz halogen (DXW). Comparisons with measurements of two national standards laboratories indicate that the model can account for the spectral irradiance values of lamps with an agreement better than 1% throughout the spectral region studied. We further demonstrate that the spectral irradiance of a lamp can be predicted with an expanded uncertainty of 2.6% if the color temperature and illuminance values for the lamp are known with expanded uncertainties of 20 K and 2%, respectively. In addition, it is suggested that the spectral irradiance may be derived from resistance measurements of the filament with lamp on and off.

Ojanen, Maija; Kaerhae, Petri; Ikonen, Erkki



Effects of Pulse Duration on Bulk Laser Damage in 350-nm Raster-Scanned DKDP  

SciTech Connect

In this paper we present the results of bulk damage experiments done on Type-I1 DKDP triple harmonic generator crystals that were raster conditioned with 351-355 nm wavelengths and pulse durations of 4 and 23.2 ns. In the first phase of experiments 20 different scan protocols were rastered into a sample of rapid growth DKDP. The sample was then rastered at damage-causing fluences to determine the three most effective protocols. These three protocols were scanned into a 15-cm sample of conventional-growth DKDP and then exposed to single shots of a I-cm beam from LLNL's Optical Sciences Laser at fluences ranging from 0.5 - 1.5X of the 10% damage probability fluence and nominal pulse durations of 0.1,0.3,0.8,3.2,7.0 and 20 ns. The experiment showed that pulse durations in the 1-3 ns range were much more effective at conditioning than pulses in the 16.3 ns range and that the multiple pass 'peak fluence' scan was more effective than the single pass 'leading edge' scan for 23.2 ns XeF scans.

Runkel, M; Bruere, J; Sell, W; Weiland, T; Milam, D; Hahn, D E; Nostrand, M C



Electrical Mobility Spectrometer Using a Diethylene Glycol Condensation Particle Counter for Measurement of Aerosol Size Distributions Down to 1 nm  

Science Conference Proceedings (OSTI)

We report a new scanning mobility particle spectrometer (SMPS) for measuring number size distributions of particles down to {approx}1 nm mobility diameter. This SMPS includes an aerosol charger, a TSI 3085 nano differential mobility analyzer (nanoDMA), an ultrafine condensation particle counter (UCPC) using diethylene glycol (DEG) as the working fluid, and a conventional butanol CPC (the 'booster') to detect the small droplets leaving the DEG UCPC. The response of the DEG UCPC to negatively charged sodium chloride particles with mobility diameters ranging from 1-6 nm was measured. The sensitivity of the DEG UCPC to particle composition was also studied by comparing its response to positively charged 1.47 and 1.70 nm tetra-alkyl ammonium ions, sodium chloride, and silver particles. A high resolution differential mobility analyzer was used to generate the test particles. These results show that the response of this UCPC to sub-2 nm particles is sensitive to particle composition. The applicability of the new SMPS for atmospheric measurement was demonstrated during the Nucleation and Cloud Condensation Nuclei (NCCN) field campaign (Atlanta, Georgia, summer 2009). We operated the instrument at saturator and condenser temperatures that allowed the efficient detection of sodium chloride particles but not of air ions having the same mobility. We found that particles as small as 1 nm were detected during nucleation events but not at other times. Factors affecting size distribution measurements, including aerosol charging in the 1-10 nm size range, are discussed. For the charger used in this study, bipolar charging was found to be more effective for sub-2 nm particles than unipolar charging. No ion induced nucleation inside the charger was observed during the NCCN campaign.

Jiang, J.; Kuang, C.; Chen, M.; Attoui, M.; McMurry, P. H.




Science Conference Proceedings (OSTI)

This report provides data, analyses, and conclusions from a series of tests that were conducted at the Vitreous State Laboratory of The Catholic of America (VSL) to determine the processing rates that are achievable with AZ-101 HLW simulants and corresponding melter feeds on a DuraMelter 100 (DM100) vitrification system. One of the most critical pieces of information in determining the required size of the RPP-WTP HLW melter is the specific glass production rate in terms of the mass of glass that can be produced per unit area of melt surface per unit time. The specific glass production rate together with the waste loading (essentially, the ratio of waste-in to glass-out, which is determined from glass formulation activities) determines the melt area that is needed to achieve a given waste processing rate with due allowance for system availability. Tests conducted during Part B1 (VSL-00R2590-2) on the DM1000 vitrification system installed at the Vitreous State Laboratory of The Catholic University of America showed that, without the use of bubblers, glass production rates with AZ-101 and C-106/AY-102 simulants were significantly lower than the Project design basis rate of 0.4 MT/m{sup 2}/d. Conversely, three-fold increases over the design basis rate were demonstrated with the use of bubblers. Furthermore, an un-bubbled control test using a replica of the melter feed used in cold commissioning tests at West Valley reproduced the rates that were observed with that feed on the WVDP production melter. More recent tests conducted on the DM1200 system, which more closely represents the present RPP-WTP design, are in general agreement with these earlier results. Screening tests conducted on the DM10 system have provided good indications of the larger-scale processing rates with bubblers (for both HL W and LAW feeds) but significantly overestimated the DM1000 un-bubbled rate observed for C-106/AY-102 melter feeds. This behavior is believed to be a consequence of the role of heat transfer in rate attainment and the much greater role of wall effects in heat transfer when the melt pool is not agitated. The DM100 melter used for the present tests has a surface area of 0.108 m{sup 2}, which is approximately 5 times larger than that of the DM10 (0.021 m{sup 2}) and approximately 11 times smaller than that of the DM1000 (1.2 m{sup 2}) (the DM1000 has since been replaced by a pilot-scale prototypical HLW melter, designated the DM1200, which has the same surface area as the DM1000). Testing on smaller melters is the most economical method for obtaining data over a wide range of operating conditions (particularly at extremes) and for guiding the more expensive tests that are performed at pilot-scale. Thus, one objective of these tests was to determine whether the DM100 melters are sufficiently large to reproduce the un-bubbled melt rates observed at the DM1000 scale, or to determine the extent of any off-set. DM100-scale tests can then be used to screen feed chemistry variations that may serve to increase the un-bubbled production rates prior to confirmation at pilot scale. Finally, extensive characterization data obtained on simulated HLW melter feeds formed from various glass forming additives indicated that there may be advantages in terms of feed rheology and stability to the replacement of some of the hydroxides by carbonates. A further objective of the present tests was therefore to identify any deleterious processing effects of such a change before adopting the carbonate feed as the baseline. Data from the WVDP melter using acidified (nitrated) feeds, and without bubbling, showed productions rates that are higher than those observed with the alkaline RPP feeds at the VSL. Therefore, the effect of feed acidification on production rate also was investigated. This work was performed under Test Specification, 'TSP-W375-00-00019, Rev 0, 'HLW-DM10 and DM100 Melter Tests' dated November 13, 2000 and the corresponding Test Plan. It should be noted, however, that the RPP-WTP Project directed a series of changes to the Test Plan as the result





NLE Websites -- All DOE Office Websites (Extended Search)

POWGEN POWGEN E XPERIMENT Before y ou a rrive/Send y our s amples: 1. C onfirmation: The c onfirmation o f a ll r elevant i nformation f or y our b eamtime i s d one t hrough o ur I ntegrated Proposal T racking S ystem ( IPTS: h ttp://www.ornl.gov/sci/iums/ipts/). B efore a rriving f or b eamtime, you w ill n eed t o c onfirm 1 ) L ab n eeds, 2 ) S amples, 3 ) S ample E nvironment, 4 ) S afety a nd 4 ) Experiment t ime. This i s y our f inal c hance t o e nter t he c orrect s ample i nformation a nd a nything t hat i s n ot c onfirmed cannot b e m easured d uring y our b eamtime. A dding s imilar s amples a s s tated i n y our p roposal w ill most l ikely t rigger n o a dditional r eview. H owever, r emember i f y ou a re e ntering d rastically d ifferent samples f rom y our a pproved p roposal t hey w ill g o t hrough a f urther a pproval a nd


DIPLOMAMUNKA Az RkpK fehrje termeltetse  

E-Print Network (OSTI)

.................................................................................5 1.3.3. A nif és fix gének



SciTech Connect

The New Mexico Water and Infrastructure Data System (NM WAIDS) seeks to alleviate a number of produced water-related issues in southeast New Mexico. The project calls for the design and implementation of a Geographical Information System (GIS) and integral tools that will provide operators and regulators with necessary data and useful information to help them make management and regulatory decisions. The major components of this system are: (1) Databases on produced water quality, cultural and groundwater data, oil pipeline and infrastructure data, and corrosion information. (2) A web site capable of displaying produced water and infrastructure data in a GIS or accessing some of the data by text-based queries. (3) A fuzzy logic-based, site risk assessment tool that can be used to assess the seriousness of a spill of produced water. (4) A corrosion management toolkit that will provide operators with data and information on produced waters that will aid them in deciding how to address corrosion issues. The various parts of NM WAIDS will be integrated into a website with a user-friendly interface that will provide access to previously difficult-to-obtain data and information. Primary attention during the first six months of this project was focused on creating the water quality databases for produced water and surface water, along with collecting of corrosion information and building parts of the corrosion toolkit. Work on the project to date includes: (1) Creation of a water quality database for produced water analyses. The database was compiled from a variety of sources and currently has over 7000 entries for New Mexico. (2) Creation of a web-based data entry system for the water quality database. This system allows a user to view, enter, or edit data from a web page rather than having to directly access the database. (3) Creation of a semi-automated data capturing system for use with standard water quality analysis forms. This system improves the accuracy and speed of water quality data entry. (4) Acquisition of ground water data from the New Mexico State Engineer's office, including chloride content and TDS (Total Dissolved Solids) for over 30,000 data points in southeast New Mexico. (5) Creation of a web-based scale prediction tool, again with a web-based interface, that uses two common scaling indices to predict the likelihood of scaling. This prediction tool can either run from user input data, or the user can select samples from the water analysis database. (6) Creation of depth-to-groundwater maps for the study area. (7) Analysis of water quality data by formation. (8) Continuation of efforts to collect produced water quality information from operators in the southeast New Mexico area. (9) Qualitative assessment of produced water from various formations regarding corrosivity. (10) Efforts at corrosion education in the region through operator visits. Future work on this project will include: (1) Development of an integrated web and GIS interface for all the information collected in this effort. (2) Continued development of a fuzzy logic spill risk assessment tool that was initially developed prior to this project. Improvements will include addition of parameters found to be significant in determining the impact of a brine spill at a specific site. (3) Compilation of both hard copy and online corrosion toolkit material.

Martha Cather; Robert Lee; Ibrahim Gundiler; Andrew Sung



Use of a dynamic simulation model to understand nitrogen cycling in the middle Rio Grande, NM.  

Science Conference Proceedings (OSTI)

Water quality often limits the potential uses of scarce water resources in semiarid and arid regions. To best manage water quality one must understand the sources and sinks of both solutes and water to the river system. Nutrient concentration patterns can identify source and sink locations, but cannot always determine biotic processes that affect nutrient concentrations. Modeling tools can provide insight into these large-scale processes. To address questions about large-scale nitrogen removal in the Middle Rio Grande, NM, we created a system dynamics nitrate model using an existing integrated surface water--groundwater model of the region to evaluate our conceptual models of uptake and denitrification as potential nitrate removal mechanisms. We modeled denitrification in groundwater as a first-order process dependent only on concentration and used a 5% denitrification rate. Uptake was assumed to be proportional to transpiration and was modeled as a percentage of the evapotranspiration calculated within the model multiplied by the nitrate concentration in the water being transpired. We modeled riparian uptake as 90% and agricultural uptake as 50% of the respective evapotranspiration rates. Using these removal rates, our model results suggest that riparian uptake, agricultural uptake and denitrification in groundwater are all needed to produce the observed nitrate concentrations in the groundwater, conveyance channels, and river as well as the seasonal concentration patterns. The model results indicate that a total of 497 metric tons of nitrate-N are removed from the Middle Rio Grande annually. Where river nitrate concentrations are low and there are no large nitrate sources, nitrate behaves nearly conservatively and riparian and agricultural uptake are the most important removal mechanisms. Downstream of a large wastewater nitrate source, denitrification and agricultural uptake were responsible for approximately 90% of the nitrogen removal.

Meixner, Tom (University of Arizona, Tucson, AZ); Tidwell, Vincent Carroll; Oelsner, Gretchen (University of Arizona, Tucson, AZ); Brooks, Paul (University of Arizona, Tucson, AZ); Roach, Jesse D.


Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


EV Project Chevrolet Volt Vehicle Summary Report  

NLE Websites -- All DOE Office Websites (Extended Search)

events (mi) 25.8 Avg number of charging events per day when the vehicle was driven 1.4 EV Project Chevrolet Volt Vehicle Summary Report Region: Phoenix, AZ Metropolitan Area...


An AC phase measuring interferometer for measuring dn/dT of fused silica and calcium fluoride at 193 nm  

Science Conference Proceedings (OSTI)

A novel method for the measurement of the change in index of refraction vs. temperature (dn/dT) of fused silica and calcium fluoride at the 193 nm wavelength has been developed in support of thermal modeling efforts for the development of 193 nm-based photolithographic exposure tools. The method, based upon grating lateral shear interferometry, uses a transmissive linear grating to divide a 193 nm laser beam into several beam paths by diffraction which propagate through separate identical material samples. One diffracted order passing through one sample overlaps the undiffracted beam from a second sample and forms interference fringes dependent upon the optical path difference between the two samples. Optical phase delay due to an index change from heating one of the samples causes the interference fringes to change sinusoidally with phase. The interferometer also makes use of AC phase measurement techniques through lateral translation of the grating. Results for several samples of fused silica and calcium fluoride are demonstrated.

Shagam, R.N.



Modification of laminar flow ultrafine condensation particle counters for the enhanced detection of 1 nm condensation nuclei  

SciTech Connect

This paper describes simple modifications to thermally diffusive laminar flow ultrafine condensation particle counters (UCPCs) that allow detection of {approx}1 nm condensation nuclei with much higher efficiencies than have been previously reported. These nondestructive modifications were applied to a commercial butanol based UCPC (TSI 3025A) and to a diethylene glycol-based UCPC (UMN DEG-UCPC). Size and charge dependent detection efficiencies using the modified UCPCs (BNL 3025A and BNL DEGUCPC) were measured with high resolution mobility classified aerosols composed of NaCl, W, molecular ion standards of tetraalkyl ammonium bromide, and neutralizer-generated ions. With negatively charged NaCl aerosol, the BNL 3025A and BNL DEGUCPC achieved detection efficiencies of 37% (90x increase over TSI 3025A) at 1.68 nm mobility diameter (1.39 nm geometric diameter) and 23% (8x increase over UMN DEG-UCPC) at 1.19 nm mobility diameter (0.89 nm geometric diameter), respectively. Operating conditions for both UCPCs were identified that allowed negatively charged NaCl and W particles, but not negative ions of exactly the same mobility size, to be efficiently detected. This serendipitous material dependence, which is not fundamentally understood, suggests that vapor condensation might sometimes allow for the discrimination between air 'ions' and charged 'particles.' As a detector in a scanning mobility particle spectrometer (SMPS), a UCPC with this strong material dependence would allow for more accurate measurements of sub-2 nm aerosol size distributions due to the reduced interference from neutralizer-generated ions and atmospheric ions, and provide increased sensitivity for the determination of nucleation rates and initial particle growth rates.

Kuang, C.; Chen, M.; McMurry, P. H.; Wang, J.



Single-frequency hybrid laser with an output power up to 3 W at a wavelength of 1064 nm  

SciTech Connect

A high-power single-frequency laser with an output power of 2.5 W in the cw regime at a wavelength of 1064 nm has been developed using a hybrid scheme based on a master singlefrequency semiconductor laser (wavelength 1064 nm, lasing linewidth less than 3 MHz) and a two-cascade fibre amplifier pumped by high-power laser diodes. At pump powers of 4.8 W in the first cascade and 6.8 W in the second cascade the total gain is about 100.

Trikshev, A I; Kurkov, Andrei S; Tsvetkov, V B [A M Prokhorov General Physics Institute, Russian Academy of Sciences, Moscow (Russian Federation)



Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan



Evaluation of a PECVD advanced barrier (k=3.7) for 32nm CMOS technology and below  

Science Conference Proceedings (OSTI)

An advanced dielectric barrier proposed for sub-45nm CMOS technology nodes is firstly characterized on 300mm full sheet wafers. The barrier is a bi-layer deposited by PECVD. The copper diffusion barrier property is ensured by a depositing dense initiation ... Keywords: Dielectric barrier, Dual damascene, Electromigration, Etch stop layer, RC delay

L. L. Chapelon; E. Petitprez; P. Brun; A. Farcy; J. Torres



Approaching the theoretical limits of a mesh NoC with a 16-node chip prototype in 45nm SOI  

E-Print Network (OSTI)

In this paper, we present a case study of our chip prototype of a 16-node 4x4 mesh NoC fabricated in 45nm SOI CMOS that aims to simultaneously optimize energy-latency-throughput for unicasts, multicasts and broadcasts. We ...

Park, Sunghyun


Estimation of gate-to-channel tunneling current in ultra-thin oxide sub-50nm double gate devices  

Science Conference Proceedings (OSTI)

Double gate (DG) FETs have emerged as the most promising technology for sub-50nm transistor design. However, analysis and control of the gate tunneling leakage in DGFET is necessary to fully exploit their advantages. In this paper we have modeled (numerically ... Keywords: Direct tunneling, Double gate, Leakage, Quantum confinement

Saibal Mukhopadhyay; Keunwoo Kim; Jae-Joon Kim; Shih-Hsien Lo; Rajiv V. Joshi; Ching-Te Chuang; Kaushik Roy



A 65nm dual-mode baseband and multimedia application processor SoC with advanced power and memory management  

Science Conference Proceedings (OSTI)

A Dual-mode baseband (W-CDMA/HSDPA and GSM/GPRS/EDGE) and multimedia application processor SoC is described. The SoC fabricated in triple-Vth 65nm CMOS has 3 CPU cores and 20 separate power domains to achieve both high performance and low power. The ...

Tatsuya Kamei; Tetsuhiro Yamada; Takao Koike; Masayuki Ito; Takahiro Irita; Kenichi Nitta; Toshihiro Hattori; Shinichi Yoshioka




SciTech Connect

The change of spectral decomposition of the total radiative output on various timescales of solar magnetic activity is of large interest to terrestrial and solar-stellar atmosphere studies. Starting in 2002, SCIAMACHY was the first satellite instrument to observe daily solar spectral irradiance (SSI) continuously from 230 nm (UV) to 1750 nm (near-infrared; near-IR). In order to address the question of how much UV, visible (vis), and IR spectral regions change on 27 day and 11 year timescales, we parameterize short-term SSI variations in terms of faculae brightening (Mg II index) and sunspot darkening (photometric sunspot index) proxies. Although spectral variations above 300 nm are below 1% and, therefore, well below the accuracy of absolute radiometric calibration, relative accuracy for short-term changes is shown to be in the per mill range. This enables us to derive short-term spectral irradiance variations from the UV to the near-IR. During Halloween solar storm in 2003 with a record high sunspot area, we observe a reduction of 0.3% in the near-IR to 0.5% in the vis and near-UV. This is consistent with a 0.4% reduction in total solar irradiance (TSI). Over an entire 11 year solar cycle, SSI variability covering simultaneously the UV, vis, and IR spectral regions have not been directly observed so far. Using variations of solar proxies over solar cycle 23, solar cycle spectral variations have been estimated using scaling factors that best matched short-term variations of SCIAMACHY. In the 300-400 nm region, which strongly contributes to TSI solar cycle change, a contribution of 34% is derived from SCIAMACHY observations, which is lower than the reported values from SUSIM satellite data and the empirical SATIRE model. The total UV contribution (below 400 nm) to TSI solar cycle variations is estimated to be 55%.

Pagaran, J.; Weber, M.; Burrows, J. [Institute of Environmental Physics, University of Bremen, Otto-Hahn-Allee 1 D-28359 Bremen (Germany)], E-mail: pagaran@iup.physik.uni-bremen.de



EIS-0403: DOE and BLM Notice of Availability of the Final Programmatic...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Environmental Impact Statement Final Programmatic Environmental Impact Statement for Solar Energy Development in Six Southwestern States (AZ, CA, CO, NV, NM, and UT) The Bureau...


Environmental Impact Statements (EIS) | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Disposition July 24, 2012 EIS-0403: Final Programmatic Environmental Impact Statement Solar Energy Development in Six Southwestern States (AZ, CA, CO, NV, NM, and UT) May 31,...


EIS-0403: EPA Notice of Availability of the Final Programmatic...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Environmental Impact Statement Final Programmatic Environmental Impact Statement for Solar Energy Development in Six Southwestern States (AZ, CA, CO, NV, NM, and UT) The U.S....



Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming



Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana



E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


The formation of metallic nanoparticles in single crystal CaF{sub 2} under 157 nm excimer laser irradiation  

SciTech Connect

Single crystal calcium fluoride (CaF{sub 2}) is an important material for vacuum-ultraviolet optical components. Unfortunately, all metal halides tend to form defects when exposed to energetic particles and laser radiation, and these defects can degrade optical performance. Here we examine the consequences of exposing CaF{sub 2} to 157 nm excimer laser radiation and show that several tens of thousands of pulses at fluences near 1 J/cm{sup 2} can color the material. Absorption spectra of the exposed material confirm the formation of metallic calcium nanoparticles similar to those produced by other forms of energetic radiation. The rate of nanoparticle formation depends on the bulk temperature and displays a local maximum near 50 deg. C. Absorption measurements at 157 nm display a transient absorption component that grows during prolonged irradiation and disappears on time scales of several minutes after irradiation ceases. The implications of these effects in optical components are discussed.

Cramer, L.P.; Langford, S.C.; Dickinson, J.T. [Physics Department, Washington State University, Pullman, Washington 99164-2814 (United States)



Comparison of Mg-based multilayers for solar He II radiation at 30.4 nm wavelength  

Science Conference Proceedings (OSTI)

Mg-based multilayers, including SiC/Mg, Co/Mg, B4C/Mg, and Si/Mg, are investigated for solar imaging and a He II calibration lamp at a 30.4 nm wavelength. These multilayers were fabricated by a magnetron sputtering method and characterized by x-ray reflection. The reflectivities of these multilayers were measured by synchrotron radiation. Near-normal-incidence reflectivities of Co/Mg and SiC/Mg multilayer mirrors are as high as 40.3% and 44.6%, respectively, while those of B4C/Mg and Si/Mg mirrors are too low for application. The measured results suggest that SiC/Mg, Co/Mg multilayers are promising for a 30.4 nm wavelength.

Zhu Jingtao; Zhou Sika; Li Haochuan; Huang Qiushi; Wang Zhanshan; Le Guen, Karine; Hu, Min-Hui; Andre, Jean-Michel; Jonnard, Philippe



Homogeneous pinhole free 1 nm Al{sub 2}O{sub 3} tunnel barriers on graphene  

SciTech Connect

We report on the topographical and electrical characterisations of 1 nm thick Al{sub 2}O{sub 3} dielectric films on graphene. The Al{sub 2}O{sub 3} is grown by sputtering a 0.6 nm Al layer on graphene and subsequentially oxidizing it in an O{sub 2} atmosphere. The Al{sub 2}O{sub 3} layer presents no pinholes and is homogeneous enough to act as a tunnel barrier. A resistance-area product in the mega-ohm micrometer-square range is found. Comparatively, the growth of Al{sub 2}O{sub 3} by evaporation does not lead to well-wetted films on graphene. Application of this high quality sputtered tunnel barrier to efficient spin injection in graphene is discussed.

Dlubak, B.; Martin, M.-B.; Deranlot, C.; Bouzehouane, K.; Fusil, S.; Mattana, R.; Petroff, F.; Anane, A.; Seneor, P.; Fert, A. [Unite Mixte de Physique CNRS/Thales, 91767 Palaiseau (France) and University of Paris-Sud, 91405 Orsay (France)



Thickness effect on laser-induced-damage threshold of indium-tin oxide films at 1064 nm  

Science Conference Proceedings (OSTI)

Laser-induced-damage characteristics of commercial indium-tin oxide (ITO) films deposited by DC magnetron sputtering deposition on K9 glass substrates as a function of the film thickness have been studied at 1064 nm with a 10 ns laser pulse in the 1-on-1 mode, and the various mechanisms for thickness effect on laser-induced-damage threshold (LIDT) of the film have been discussed in detail. It is observed that laser-damage-resistance of ITO film shows dramatic thickness effect with the LIDT of the 50-nm ITO film 7.6 times as large as the value of 300 nm film, and the effect of depressed carrier density by decreasing the film thickness is demonstrated to be the primary reason. Our experiment findings indicate that searching transparent conductive oxide (TCO) film with low carrier density and high carrier mobility is an efficient technique to improve the laser-damage-resistance of TCO films based on maintaining their well electric conductivity.

Wang Haifeng; Huang Zhimeng; Zhang Dayong; Luo Fei; Huang Lixian; Li Yanglong; Luo Yongquan; Wang Weiping; Zhao Xiangjie [Institute of Fluid Physics, China Academy of Engineering Physics, Mianyang 621900 (China)


Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


High-energy kHz mid-IR tunable PPSLT-based OPO pumped at 1064 nm  

SciTech Connect

We report a single-frequency sub-nanosecond optical parametric oscillator (OPO) based on periodically poled stoichiometric lithium tantalate (PPSLT), pumped by a 1064-nm amplified microchip laser at a repetition rate of 0.5 kHz. Using a 11-mm-long PPSLT crystal polled with three different domain periods (30.2, 30.3, 30.4 {mu}m) and changing the temperature of the crystal from 20 Degree-Sign C to 265 Degree-Sign C, we have achieved wavelength tuning between 2990 nm and 3500 nm. The high nonlinearity of the used medium and the large aperture (2 mm) ensure the maximum idler output energy of {approx}0.5 mJ in the whole tuning range, corresponding to average {approx}10.5 % idler conversion efficiency and {approx}250 mW of average power. Sub-nanosecond pulse durations have been obtained for the idler at 0.88-ns pulse duration of the pump.

Gaydardzhiev, A; Chuchumishev, D; Draganov, D; Buchvarov, I [Department of Physics, Sofia University, 5 James Bourchier Blvd., BG-1164, Sofia (Bulgaria)



Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


eb surface alloying of magnesium alloys az31 b and az91 d  

Science Conference Proceedings (OSTI)

Jul 20, 2012 ... If the price of this product displays as $0.00 for your customer category, you may download it for free. You must, however, add it to your cart and...


Cryogenic ion implantation near amorphization threshold dose for halo/extension junction improvement in sub-30 nm device technologies  

SciTech Connect

We report on junction advantages of cryogenic ion implantation with medium current implanters. We propose a methodical approach on maximizing cryogenic effects on junction characteristics near the amorphization threshold doses that are typically used for halo implants for sub-30 nm technologies. BF{sub 2}{sup +} implant at a dose of 8 Multiplication-Sign 10{sup 13}cm{sup -2} does not amorphize silicon at room temperature. When implanted at -100 Degree-Sign C, it forms a 30 - 35 nm thick amorphous layer. The cryogenic BF{sub 2}{sup +} implant significantly reduces the depth of the boron distribution, both as-implanted and after anneals, which improves short channel rolloff characteristics. It also creates a shallower n{sup +}-p junction by steepening profiles of arsenic that is subsequently implanted in the surface region. We demonstrate effects of implant sequences, germanium preamorphization, indium and carbon co-implants for extension/halo process integration. When applied to sequences such as Ge+As+C+In+BF{sub 2}{sup +}, the cryogenic implants at -100 Degree-Sign C enable removal of Ge preamorphization, and form more active n{sup +}-p junctions and steeper B and In halo profiles than sequences at room temperature.

Park, Hugh; Todorov, Stan; Colombeau, Benjamin; Rodier, Dennis; Kouzminov, Dimitry; Zou Wei; Guo Baonian; Khasgiwale, Niranjan; Decker-Lucke, Kurt [Applied Materials, Varian Semiconductor Equipment, 35 Dory Road, Gloucester, Massachusetts 01930 (United States)



Sandia Corporation (Albuquerque, NM)  

DOE Patents (OSTI)

A method of designing a primary geometry, such as for a forming die, to be used in a powder pressing application by using a combination of axisymmetric geometric shapes, transition radii, and transition spaces to simulate the geometry where the shapes can be selected from a predetermined list or menu of axisymmetric shapes and then developing a finite element mesh to represent the geometry. This mesh, along with material properties of the component to be designed and powder, is input to a standard deformation finite element code to evaluate the deformation characteristics of the component being designed. The user can develop the geometry interactively with a computer interface in minutes and execute a complete analysis of the deformation characteristics of the simulated component geometry.

Ewsuk, Kevin G. (Albuquerque, NM); Arguello, Jr., Jose G. (Albuquerque, NM)



Sandia Corporation (Albuquerque, NM)  

DOE Patents (OSTI)

A Theoretical Overlay Photographic (TOP) alignment method uses the overlay of a theoretical projected image of a perfectly aligned concentrator on a photographic image of the concentrator to align the mirror facets of a parabolic trough solar concentrator. The alignment method is practical and straightforward, and inherently aligns the mirror facets to the receiver. When integrated with clinometer measurements for which gravity and mechanical drag effects have been accounted for and which are made in a manner and location consistent with the alignment method, all of the mirrors on a common drive can be aligned and optimized for any concentrator orientation.

Diver, Richard B. (Albuquerque, NM)



Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


Statistical Modeling of Pipeline Delay and Design of Pipeline under Process Variation to Enhance Yield in sub-100nm Technologies  

E-Print Network (OSTI)

Operating frequency of a pipelined circuit is determined by the delay of the slowest pipeline stage. However, under statistical delay variation in sub-100nm technology regime, the slowest stage is not readily identifiable and the estimation of the pipeline yield with respect to a target delay is a challenging problem. We have proposed analytical models to estimate yield for a pipelined design based on delay distributions of individual pipe stages. Using the proposed models, we have shown that change in logic depth and imbalance between the stage delays can improve the yield of a pipeline. A statistical methodology has been developed to optimally design a pipeline circuit for enhancing yield. Optimization results show that, proper imbalance among the stage delays in a pipeline improves design yield by 9% for the same area and performance (and area reduction by about 8.4% under a yield constraint) over a balanced design.

Datta, Animesh; Mukhopadhyay, Saibal; Banerjee, Nilanjan; Roy, Kaushik



Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects


Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012


Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.


Re-thinking highest and best use : implementing smart development in support of smart growth : a case study in Santa Fe, NM  

E-Print Network (OSTI)

This paper answers the questions "where to develop?", "for whom to develop?", and "what to develop?" from a double bottom line perspective of profit making and social benefit, using a 3-acre property in Santa Fe, NM as an ...

Balkcom, Jennifer K



Analysis of the efficiency of using 1265-nm cw laser radiation for initiating oxidative stress in the tissue of a solid malignant tumour  

SciTech Connect

The possibility of laser initiation of oxidative stress was studied by the example of the tumour tissue of cervix. The laser facility with the operating wavelength 1265 nm that falls within the region of resonance absorption of molecular oxygen was used for initiation. The source of radiation in the experiments was a fibre SRS laser with the repeated cascade conversion of radiation of a 1125-nm ytterbium laser. (optical fibres, lasers and amplifiers. properties and applications)

Gening, T P; Voronova, O S; Dolgova, D R; Abakumova, T V; Zolotovskii, Igor' O; Sholokhov, E M; Kurkov, Andrei S; Gening, S O



U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


Sub-10 nm Platinum Nanocrystals with Size and Shape Control: Catalytic Study for Ethylene and Pyrrole Hydrogenation  

SciTech Connect

Platinum nanocubes and nanopolyhedra with tunable size from 5 to 9 nm were synthesized by controlling the reducing rate of metal precursor ions in a one-pot polyol synthesis. A two-stage process is proposed for the simultaneous control of size and shape. In the first stage, the oxidation state of the metal ion precursors determined the nucleation rate and consequently the number of nuclei. The reaction temperature controlled the shape in the second stage by regulation of the growth kinetics. These well-defined nanocrystals were loaded into MCF-17 mesoporous silica for examination of catalytic properties. Pt loadings and dispersions of the supported catalysts were determined by elemental analysis (ICP-MS) and H2 chemisorption isotherms, respectively. Ethylene hydrogenation rates over the Pt nanocrystals were independent of both size and shape and comparable to Pt single crystals. For pyrrole hydrogenation, the nanocubes enhanced ring-opening ability and thus showed a higher selectivity to n-butylamine as compared to nanopolyhedra.

Tsung, Chia-Kuang; Kuhn, John N.; Huang, Wenyu; Aliaga, Cesar; Hung, Ling-I; Somorjai, Gabor A.; Yang, Peidong




Science Conference Proceedings (OSTI)

Understanding changes in the solar flux over geologic time is vital for understanding the evolution of planetary atmospheres because it affects atmospheric escape and chemistry, as well as climate. We describe a numerical parameterization for wavelength-dependent changes to the non-attenuated solar flux appropriate for most times and places in the solar system. We combine data from the Sun and solar analogs to estimate enhanced UV and X-ray fluxes for the young Sun and use standard solar models to estimate changing visible and infrared fluxes. The parameterization, a series of multipliers relative to the modern top of the atmosphere flux at Earth, is valid from 0.1 nm through the infrared, and from 0.6 Gyr through 6.7 Gyr, and is extended from the solar zero-age main sequence to 8.0 Gyr subject to additional uncertainties. The parameterization is applied to a representative modern day flux, providing quantitative estimates of the wavelength dependence of solar flux for paleodates relevant to the evolution of atmospheres in the solar system (or around other G-type stars). We validate the code by Monte Carlo analysis of uncertainties in stellar age and flux, and with comparisons to the solar proxies {kappa}{sup 1} Cet and EK Dra. The model is applied to the computation of photolysis rates on the Archean Earth.

Claire, Mark W. [School of Environmental Sciences, University of East Anglia, Norwich, UK NR4 7TJ (United Kingdom); Sheets, John; Meadows, Victoria S. [Virtual Planetary Laboratory and Department of Astronomy, University of Washington, Box 351580, Seattle, WA 98195 (United States); Cohen, Martin [Radio Astronomy Laboratory, University of California, Berkeley, CA 94720-3411 (United States); Ribas, Ignasi [Institut de Ciencies de l'Espai (CSIC-IEEC), Facultat de Ciencies, Torre C5 parell, 2a pl, Campus UAB, E-08193 Bellaterra (Spain); Catling, David C., E-mail: M.Claire@uea.ac.uk [Virtual Planetary Laboratory and Department of Earth and Space Sciences, University of Washington, Box 351310, Seattle, WA 98195 (United States)



On the Galactic chemical evolution of sulphur. Sulphur abundances from the [S i] 1082 nm line in giants  

E-Print Network (OSTI)

Context. The Galactic chemical evolution of sulphur is still under debate. At low metallicities some studies find no correlation between [S/Fe] and [Fe/H], others find [S/Fe] increasing towards lower metallicities, and still others find a combination of the two. Each scenario has different implications for the Galactic chemical evolution of sulphur. Aims. To contribute to the discussion on the Galactic chemical evolution of sulphur by deriving sulphur abundances from non-LTE insensitive spectral diagnostics in Disk and Halo stars with homogeneously determined stellar parameters. Methods. We derive Teff from photometric colours, logg from stellar isochrones and Bayesian estimation, and [Fe/H] and [S/Fe] from spectrum synthesis. We derive [S/Fe] from the [S i] 1082 nm line in 39 mostly cool and metal-poor giants, using 1D LTE MARCS model atmospheres to model our high-resolution NIR spectra obtained with the VLT, NOT and Gemini South telescopes. Results. We derive homogeneous stellar parameters for 29 stars. Our...

Matrozis, E; Dupree, A K



Development of tandem time-of-flight instrumentation for the examination of prompt photodissociation of peptides using 193-nm radiation  

E-Print Network (OSTI)

The design and incorporation of a decelerating/accelerating cell into a reflectron time-of-flight mass spectrometer is described for the examination of promptly-formed photodissociation products of peptide ions. The analytical utility of prompt 193-nm photodissociation was investigated for model peptides that resemble tryptic digest products, as well as for two sets of homologous peptides. The first of these sets include bradykinin, several bradykinin fragments, and two bradykinin mutants with substituted amino acids. Fragment ion spectra of [M + H]+, [M + Na]+, and [M + Cu]+ were collected for each of these peptides. The second set of homologous peptides has the sequence XVGVAZG, where variable amino acid X was either arginine, histidine, or lysine, and amino acid Z was either proline, serine, or glycine. Photofragment ion spectra obtained using the new mass spectrometer are compared to results of high energy collision induced dissociation (CID) acquired on a high performance commercial instrument. The advantages and disadvantages of prompt photodissociation relative to CID are discussed, as well as the advantages of photodissociation using the modified instrument geometry versus that of the post-source decay focusing method.

Morgan, Joseph William


Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


UV LED charge control of an electrically isolated proof mass in a Gravitational Reference Sensor configuration at 255 nm  

E-Print Network (OSTI)

Precise control over the potential of an electrically isolated proof mass is necessary for the operation of devices such as a Gravitational Reference Sensor (GRS) and satellite missions such as LISA. We show that AlGaN UV LEDs operating at 255 nm are an effective substitute for Mercury vapor lamps used in previous missions because of their ability to withstand space qualification levels of vibration and thermal cycling. After 27 thermal and thermal vacuum cycles and 9 minutes of 14.07 g RMS vibration, there is less than 3% change in current draw, less than 15% change in optical power, and no change in spectral peak or FWHM (full width at half maximum). We also demonstrate UV LED stimulated photoemission from a wide variety of thin film carbide proof mass coating candidates (SiC, Mo2C, TaC, TiC, ZrC) that were applied using electron beam evaporation on an Aluminum 6061-T6 substrate. All tested carbide films have measured quantum efficiencies of 3.8-6.8*10^-7 and reflectivities of 0.11-0.15, which compare favorably with the properties of previously used gold films. We demonstrate the ability to control proof mass potential on an 89 mm diameter spherical proof mass over a 20 mm gap in a GRS-like configuration. Proof mass potential was measured via a non-contact DC probe, which would allow control without introducing dynamic forcing of the spacecraft. Finally we provide a look ahead to an upcoming technology demonstration mission of UV LEDs and future applications toward charge control of electrically isolated proof masses.

Karthik Balakrishnan; Ke-Xun Sun; Abdul Alfauwaz; Ahmad Aljadaan; Mohammed Almajeed; Muflih Alrufaydah; Salman Althubiti; Homoud Aljabreen; Sasha Buchman; Robert L Byer; John Conklin; Daniel DeBra; John Hanson; Eric Hultgren; Turki Al Saud; Seiya Shimizu; Michael Soulage; Andreas Zoellner



Measurement of intensity-dependent rates of above-threshold ionization (ATI) of atomic hydrogen at 248 nm  

DOE Green Energy (OSTI)

Measured rates of multiphoton ionization (MPI) from the ground state of atomic hydrogen by a linearly polarized, subpicosecond KrF laser pulse at 248 nm wavelength are compared to predictions of lowest-order perturbation theory, Floquet theory, and Keldysh-Faisal-Reiss (KFR) theory with and without Coulomb correction for peak irradiance of 3 {times} 10{sup 12}W/cm{sup 2} to 2 {times} 10{sup 14}W/cm{sup 2}. The Coulomb-corrected Keldysh model falls closest to the measured rates, the others being much higher or much lower. At 5 {times} 10{sup 13}W/cm{sup 2}, the number of ATI electrons decreased by a factor of approximately 40 with each additional photon absorbed. ATI of the molecular hydrogen background and of atoms from photodissociation of the molecules were also observed. The experiment employed a crossed-beam technique at ultrahigh vacuum with an rf-discharge atomic hydrogen source and a magnetic-bottle type electron time-of-flight spectrometer to count the electrons in the different ATI channels separately. The apparatus was calibrated to allow comparison of absolute as well as relative ionization rates to the theoretical predictions. This calibration involved measuring the distribution of irradiance in a focal volume that moved randomly and changed its size from time to time. A data collection system under computer control divided the time-of-flight spectra into bins according to the energy of each laser pulse. This is the first measurement of absolute rates of ATI in atomic hydrogen, and the first measurement of absolute test of MPI in atomic hydrogen without a large factor to account for multiple modes in the laser field. As such, the results of this work are important to the development of ATI theories, which presently differ by orders of magnitude in their prediction of the ionization rates. They are also important to recent calculations of temperatures in laser-heated plasmas, many of which incorporate KFR theory.

Nichols, T.D.



A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



The relation of chlorophyll-a concentration with the reflectance peak near 700 nm in algae-dominated waters and sensitivity of fluorescence algorithms for detecting algal bloom  

Science Conference Proceedings (OSTI)

In order to investigate the relation of chlorophyll-a concentration with the reflectance peak near 700 nm, reflectance spectra of harmful algal bloom (HAB) species and non-HAB algae were obtained based on in situ measurements in the oceans and cultural ...

Dongzhi Zhao; Xiaogang Xing; Yuguang Liu; Jianhong Yang; Lin Wang



Renewable Energy Desalination: An Emerging Solution to Close MENA's Water Gap 56th Annual NM Water Conf., New Water New Energy: A Conference Linking Desalination and Renewable Energy  

E-Print Network (OSTI)

Renewable Energy Desalination: An Emerging Solution to Close MENA's Water Gap 56th Annual NM Water Conf., New Water New Energy: A Conference Linking Desalination and Renewable Energy 45 Renewable Energy and renewable energy to climate change impacts on water and agriculture sectors. Dr. Debele has published

Johnson, Eric E.


The effect of the operation modes of a gas discharge low-pressure amalgam lamp on the intensity of generation of 185 nm UV vacuum radiation  

SciTech Connect

The effect of the discharge current, mercury vapor pressure, and the inert gas pressure on the intensity and efficiency of the 185 nm line generation are considered. The spectra of the UV radiation (vacuum ultraviolet) transmission by protective coatings from the oxides of rare earth metals and aluminum are investigated.

Vasilyak, L. M., E-mail: vasilyak@ihed.ras.ru [Russian Academy of Sciences, Joint Institute of High Temperatures (Russian Federation); Drozdov, L. A., E-mail: lit@npo.lit.ru; Kostyuchenko, S. V.; Sokolov, D. V. [ZAO LIT (Russian Federation); Kudryavtsev, N. N.; Sobur, D. A., E-mail: soburda@gmail.com [Moscow Institute for Physics and Technology (Russian Federation)



Molecular beam deposition of LaAlO3 on silicon for sub-22nm CMOS technological nodes: Towards a perfect control of the oxide/silicon heterointerface  

Science Conference Proceedings (OSTI)

This work reports on the development of thin amorphous LaAlO"3 (LAO) layers on Si(001) for their integration as gate oxide in sub-22nm CMOS technologies. The crucial influence of the Si surface preparation is highlighted and an optimized surface preparation ... Keywords: Amorphous high-? dielectrics, Interfacial layer, LaAlO3, Molecular beam epitaxy, Surface preparation

S. Pelloquin; L. Becerra; G. Saint-Girons; C. Plossu; N. Baboux; D. Albertini; G. Grenet; G. Hollinger



Growths of staggered InGaN quantum wells light-emitting diodes emitting at 520525 nm employing graded growth-temperature profile  

E-Print Network (OSTI)

Growths of staggered InGaN quantum wells light-emitting diodes emitting at 520­525 nm employing current spreading and light extraction in GaN-based light emitting diodes Appl. Phys. Lett. 100, 061107 (2012) Electrically driven nanopyramid green light emitting diode Appl. Phys. Lett. 100, 061106 (2012

Gilchrist, James F.


Fabrication and characterization of sub-500nm channel organic field effect transistor using UV nanoimprint lithography with cheap Si-mold  

Science Conference Proceedings (OSTI)

P-type poly (3-hexylthiophene) (P3HT) organic field effect transistors (OFETs) with channel length down to 500nm were fabricated. The gold source and drain electrodes were patterned using UV-based nanoimprint lithography and a lift-off process. To reduce ... Keywords: Lift-off process, Opaque Si-mold, Organic transistor, Short channel effect, UV-nanoimprint lithography

Lichao Teng; Robert Kirchner; Matthias PlTner; Alexander TRke; Andreas Jahn; Jian He; Falk Hagemann; Wolf-Joachim Fischer



Promotion of Renewable Energies for Water Production through Desalination 56th Annual NM Water Conf., New Water New Energy: A Conference Linking Desalination and Renewable Energy  

E-Print Network (OSTI)

Promotion of Renewable Energies for Water Production through Desalination 56th Annual NM Water Conf., New Water New Energy: A Conference Linking Desalination and Renewable Energy 11 Promotion of Renewable with is ProDes (Promotion of Renewable Energy for Water production through Desalination), which brought

Johnson, Eric E.


Dependence of Gas-Phase Crotonaldehyde Hydrogenation Selectivity and Activity on the Size of Pt Nanoparticles (1.7-7.1 nm) Supported on SBA-15  

DOE Green Energy (OSTI)

The selectivity and activity for the hydrogenation of crotonaldehyde to crotyl alcohol and butyraldehyde was studied over a series of Pt nanoparticles (diameter of 1.7, 2.9, 3.6, and 7.1 nm). The nanoparticles were synthesized by the reduction of chloroplatinic acid by alcohol in the presence of poly(vinylpyrrolidone) (PVP), followed by encapsulation into mesoporous SBA-15 silica. The rate of crotonaldehyde hydrogenation and selectivity towards crotyl alcohol both increase with increasing particle size. The selectivity towards crotyl alcohol increased from 13.7 % to 33.9 % (8 Torr crotonaldehyde, 160 Torr H{sub 2} and 353 K), while the turnover frequency increases from 2.1 x 10{sup -2} s{sup -1} to 4.8 x 10{sup -2} s{sup -1} with an increase in the particle size from 1.7 nm to 7.1 nm. The decarbonylation pathway to form propene and CO is enhanced over the higher proportion of coordinatively unsaturated sites on the smaller nanoparticles. The apparent activation energy remains constant ({approx} 16 kcal mol{sup -1} for the formation of butyraldehyde and {approx} 8 kcal mol{sup -1} for the formation of crotyl alcohol) as a function of particle size. In the presence of 130-260 mTorr CO, the reaction rate decreases for all products with a CO reaction order of -0.9 for crotyl alcohol and butyraldehyde over 7.1 nm Pt particles; over 1.7 nm Pt particles, the order in CO is -1.4 and -0.9, respectively. Hydrogen reduction at 673 K after calcination in oxygen results in increased activity and selectivity relative to reduction at either higher or lower temperature; this is discussed with regards to the incomplete removal and/or change in morphology of the polymeric surface stabilizing agent, poly(vinylpyrrolidone) used for the synthesis of the Pt nanoparticles.

Grass, Michael; Rioux, Robert; Somorjai, Gabor A.



Optical modulation at around 1550 nm in a InGaAlAs optical waveguide containing a InGaAs/AlAs resonant tunnelling diode  

E-Print Network (OSTI)

We report electro-absorption modulation of light at around 1550 nm in a unipolar InGaAlAs optical waveguide containing a InGaAs/AlAs double-barrier resonant tunneling diode (DB-RTD). The RTD peak-to-valley transition increases the electric field across the waveguide, which shifts the core material absorption band-edge to longer wavelengths via the Franz-Keldysh effect, thus changing the light-guiding characteristics of the waveguide. Low-frequency characterisation of a device shows modulation up to 28 dB at 1565 nm. When dc biased close to the negative differential conductance (NDC) region, the RTD optical waveguide behaves as an electro-absorption modulator integrated with a wide bandwidth electrical amplifier, offering a potential advantage over conventional pn modulators.

Figueiredo, J M L; Stanley, C R; Ironside, C N; McMeekin, S G; Leite, A M P



Subpicosecond 41.8-nm X-ray laser in the plasma produced by femtosecond laser irradiation of a xenon cluster jet  

SciTech Connect

Model calculations are performed of the radiation gain for the 4d5d (J = 0) - 4d5p (J = 1) transition with a wavelength of 41.8 nm in Pd-like xenon ions in the plasma produced by femtosecond laser irradiation of a xenon cluster jet. Conditions for the excitation of an ultrashort-pulse ({approx}1 ps) X-ray laser are discussed. (lasers)

Ivanova, E P [Institute of Spectroscopy, Russian Academy of Sciences, Troitsk, Moscow region (Russian Federation)



Fabrication of nanoscale patterns in lithium fluoride crystal using a 13.5 nm Schwarzschild objective and a laser produced plasma source  

Science Conference Proceedings (OSTI)

Lithium fluoride (LiF) crystal is a radiation sensitive material widely used as EUV and soft x-ray detector. The LiF-based detector has high resolution, in principle limited by the point defect size, large field of view, and wide dynamic range. Using LiF crystal as an imaging detector, a resolution of 900 nm was achieved by a projection imaging of test meshes with a Schwarzschild objective operating at 13.5 nm. In addition, by imaging of a pinhole illuminated by the plasma, an EUV spot of 1.5 {mu}m diameter in the image plane of the objective was generated, which accomplished direct writing of color centers with resolution of 800 nm. In order to avoid sample damage and contamination due to the influence of huge debris flux produced by the plasma source, a spherical normal-incidence condenser was used to collect EUV radiation. Together with a description of experimental results, the development of the Schwarzschild objective, the influence of condenser on energy density and the alignment of the imaging system are also reported.

Wang Xin [Key Laboratory of Advanced Micro-structured Materials, MOE, Department of Physics, Institute of Precision Optical Engineering, Tongji University, Shanghai 200092 (China); School of Aerospace Engineering and Applied Mechanics, Tongji University, Shanghai 200092 (China); Mu Baozhong; Jiang Li; Zhu Jingtao; Yi Shengzhen; Wang Zhanshan [Key Laboratory of Advanced Micro-structured Materials, MOE, Department of Physics, Institute of Precision Optical Engineering, Tongji University, Shanghai 200092 (China); He Pengfei [School of Aerospace Engineering and Applied Mechanics, Tongji University, Shanghai 200092 (China)




Science Conference Proceedings (OSTI)

Jul 20, 2012 ... If the price of this product displays as $0.00 for your customer category, you may download it for free. You must, however, add it to your cart and...


Nogales, AZ Liquefied Natural Gas Exports to Mexico  

Gasoline and Diesel Fuel Update (EIA)

250 282 2006-2012 Pipeline Prices 6.79 7.88 4.04 4.86 4.47 3.31 2006-2012 Liquefied Natural Gas Volumes 16 0 0 0 0 34 1998-2012 Liquefied Natural Gas Prices 15.27 -- -- -- --...


Dynamic Response of Magnesium Alloy AZ31B and Aluminum ...  

Science Conference Proceedings (OSTI)

Symposium, Measurements and Modeling of Advanced Automotive and Structural Materials at Intermediate and High Strain Rates. Presentation Title, Dynamic...


132- Microstructure and Composition Modifications in a Mg AZ80 ...  

Science Conference Proceedings (OSTI)

086- Improvement in Gas Tightness of YSZ Coatings Produced by Atmospheric Plasma ... 145- The Synergy of XRD and XRF in a Shale and Slate Analysis.


SME Annual Meeting Feb. 28-Mar. 03, 2010, Phoenix, AZ  

E-Print Network (OSTI)

-066 DESIGNING AND MODELING WIRELESS MESH COMMUNICATIONS IN UNDERGROUND COAL MINES K. R. Griffin, Virginia Tech recent regulatory developments in underground coal communication systems, the implementation of these new technologies were limited. After several coal mining accidents in early 2006, the United States Congress


SME Annual Meeting Feb. 28-Mar. 03, 2010, Phoenix, AZ  

E-Print Network (OSTI)

-090 DECREASED CARBON FOOTPRINT THROUGH EFFECTIVE COAL DEGASIFICATION S. Keim, Virginia Tech, Blacksburg, VA K industry sector. Specifically, the combustion of one ton of coal produces between one and three tons of carbon dioxide, dependent upon the carbon content and heating value of the combusted coal. Additionally

Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Nogales, AZ Liquefied Natural Gas Exports to Mexico  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Exports by Point of Exit (Volumes in Million Cubic Ft., Prices in Dollars per Thousand Cubic Ft.)


DOE Research and Development Accomplishments Site Index (A-Z...  

Office of Scientific and Technical Information (OSTI)

A - Z Index A B C D E F G H I J K L M N O P Q R S T U V W X Y Z A Abrikosov, Alexei Abrikosov, Alexei: Publications activated complex theory of reaction rates adenosine...


Anemometer Data (Wind Speed, Direction) for Pascua Yaqui, AZ...  

Open Energy Info (EERE)

Powering America, a DOE Office of Energy Efficiency & Renewable Energy (EERE) program. A dynamic map displaying all available data from DOE anemometer loan programs...


Improving Melt Cleanliness and Mechanical Properties of AZ91E ...  

Science Conference Proceedings (OSTI)

Conference Tools for COM 2011 ... Presenter/Author Tools ... that has been linked to changing weather patterns and other extreme weather phenomenon.


Corrosion Mechanism of Anodized AZ91D and Its Biological ...  

Science Conference Proceedings (OSTI)

... Templates Facilitates Neural Stem Cell Adhesion, Proliferation and Differentiation ... Improving the Resistance of Ceramic Surfaces to Biofilm Formation ... Sol-Gel Synthesis of Bio-Active Nanoporous Sodium Zirconate Coated on 316L...


"1. Four Corners","Coal","Arizona Public Service Co",2100 "2. San Juan","Coal","Public Service Co of NM",1643  

U.S. Energy Information Administration (EIA) Indexed Site

Mexico" Mexico" "1. Four Corners","Coal","Arizona Public Service Co",2100 "2. San Juan","Coal","Public Service Co of NM",1643 "3. Luna Energy Facility","Gas","Public Service Co of NM",559 "4. Hobbs Generating Station","Gas","CAMS NM LLC",526 "5. Cunningham","Gas","Southwestern Public Service Co",480 "6. Escalante","Coal","Tri-State G & T Assn, Inc",247 "7. Rio Grande","Gas","El Paso Electric Co",236 "8. Afton Generating Station","Gas","Public Service Co of NM",236 "9. New Mexico Wind Energy Center","Other Renewables","FPL Energy New Mexico Wind LLC",204


Observation of coupled vortex gyrations by 70-ps-time and 20-nm-space- resolved full-field magnetic transmission soft x-ray microscopy  

SciTech Connect

We employed time-and space-resolved full-field magnetic transmission soft x-ray microscopy to observe vortex-core gyrations in a pair of dipolar-coupled vortex-state Permalloy (Ni{sub 80}Fe{sub 20}) disks. The 70 ps temporal and 20 nm spatial resolution of the microscope enabled us to simultaneously measure vortex gyrations in both disks and to resolve the phases and amplitudes of both vortex-core positions. We observed their correlation for a specific vortex-state configuration. This work provides a robust and direct method of studying vortex gyrations in dipolar-coupled vortex oscillators.

Jung, Hyunsung; Yu, Young-Sang; Lee, Ki-Suk; Im, Mi-Young; Fischer, Peter; Bocklage, Lars; Vogel, Andreas; Bolte, Markus; Meier, Guido; Kim, Sang-Koog



Radiation damage to amorphous carbon thin films irradiated by multiple 46.9 nm laser shots below the single-shot damage threshold  

SciTech Connect

High-surface-quality amorphous carbon (a-C) optical coatings with a thickness of 45 nm, deposited by magnetron sputtering on a silicon substrate, were irradiated by the focused beam of capillary-discharge Ne-like Ar extreme ultraviolet laser (CDL=capillary-discharge laser; XUV=extreme ultraviolet, i.e., wavelengths below 100 nm). The laser wavelength and pulse duration were 46.9 nm and 1.7 ns, respectively. The laser beam was focused onto the sample surface by a spherical Sc/Si multilayer mirror with a total reflectivity of about 30%. The laser pulse energy was varied from 0.4 to 40 muJ on the sample surface. The irradiation was carried out at five fluence levels between 0.1 and 10 J/cm{sup 2}, accumulating five different series of shots, i.e., 1, 5, 10, 20, and 40. The damage to the a-C thin layer was investigated by atomic force microscopy (AFM) and Nomarski differential interference contrast (DIC) optical microscopy. The dependence of the single-shot-damaged area on pulse energy makes it possible to determine a beam spot diameter in the focus. Its value was found to be equal to 23.3+-3.0 mum using AFM data, assuming the beam to have a Gaussian profile. Such a plot can also be used for a determination of single-shot damage threshold in a-C. A single-shot threshold value of 1.1 J/cm{sup 2} was found. Investigating the consequences of the multiple-shot exposure, it has been found that an accumulation of 10, 20, and 40 shots at a fluence of 0.5 J/cm{sup 2}, i.e., below the single-shot damage threshold, causes irreversible changes of thin a-C layers, which can be registered by both the AFM and the DIC microscopy. In the center of the damaged area, AFM shows a-C removal to a maximum depth of 0.3, 1.2, and 1.5 nm for 10-, 20- and 40-shot exposure, respectively. Raman microprobe analysis does not indicate any change in the structure of the remaining a-C material. The erosive behavior reported here contrasts with the material expansion observed earlier [L. Juha et al., Proc. SPIE 5917, 91 (2005)] on an a-C sample irradiated by a large number of femtosecond pulses of XUV high-order harmonics.

Juha, L.; Hajkova, V.; Vorlicek, V. [Institute of Physics, Academy of Sciences of the Czech Republic, Na Slovance 2, 182 21 Prague 8 (Czech Republic); Chalupsky, J. [Institute of Physics, Academy of Sciences of the Czech Republic, Na Slovance 2, 182 21 Prague 8 (Czech Republic); Faculty of Nuclear Sciences and Physical Engineering, Czech Technical University in Prague, Brehova 7, 115 19 Prague 1 (Czech Republic); Ritucci, A.; Reale, A.; Zuppella, P. [Department of Physics, University of L'Aquila, gc Laboratorio Nazionale del Gran Sasso (Istituto Nazionale di Fisica Nucleare-INFN), 67010 Coppito, L'Aquila (Italy); Stoermer, M. [GKSS Research Center, Max-Planck-Strasse 1, D-21502 Geesthacht (Germany)



Measurement of 100 nm and 60 nm Particle Standards by ...  

Science Conference Proceedings (OSTI)

... The voltage is increased, and the droplets are observed through the viewing win- dow illuminated by a light emitting diode. ...



Diffraction efficiency of 200-nm-period critical-angle transmission gratings in the soft x-ray and extreme ultraviolet wavelength bands  

SciTech Connect

We report on measurements of the diffraction efficiency of 200-nm-period freestanding blazed transmission gratings for wavelengths in the 0.96 to 19.4 nm range. These critical-angle transmission (CAT) gratings achieve highly efficient blazing over a broad band via total external reflection off the sidewalls of smooth, tens of nanometer thin ultrahigh aspect-ratio silicon grating bars and thus combine the advantages of blazed x-ray reflection gratings with those of more conventional x-ray transmission gratings. Prototype gratings with maximum depths of 3.2 and 6 {mu}m were investigated at two different blaze angles. In these initial CAT gratings the grating bars are monolithically connected to a cross support mesh that only leaves less than half of the grating area unobstructed. Because of our initial fabrication approach, the support mesh bars feature a strongly trapezoidal cross section that leads to varying CAT grating depths and partial absorption of diffracted orders. While theory predicts broadband absolute diffraction efficiencies as high as 60% for ideal CAT gratings without a support mesh, experimental results show efficiencies in the range of {approx}50-100% of theoretical predictions when taking the effects of the support mesh into account. Future minimization of the support mesh therefore promises broadband CAT grating absolute diffraction efficiencies of 50% or higher.

Heilmann, Ralf K.; Ahn, Minseung; Bruccoleri, Alex; Chang, Chih-Hao; Gullikson, Eric M.; Mukherjee, Pran; Schattenburg, Mark L.



"FERC423",2005,1,195,"Alabama Power Co",3,"Barry","AL","C",,...  

U.S. Energy Information Administration (EIA) Indexed Site

"Holcomb","KS","F",,"Gas","NG",,,,,,"AQUILLA",3006,0.993,0,0,585 "FERC423",2005,1,803,"Arizona Public Service Co",113,"Cholla","AZ","C",,"Coal","SUB",18,"NM","S","McKinley",31,"MCK...


2006 Alkaline Membrane Fuel Cell Workshop Final Report  

NLE Websites -- All DOE Office Websites (Extended Search)

AZ, USA Sponsored by Army Research Office (ARO) Principal Investigator Bryan Pivovar Fuel Cell Team Leader Los Alamos National Laboratory PO Box 1663, MS D429 Los Alamos, NM...


Sub-250 nm room-temperature optical gain from AlGaN/AlN multiple quantum wells with strong band-structure potential fluctuations  

Science Conference Proceedings (OSTI)

Deep-UV optical gain has been demonstrated in Al{sub 0.7}Ga{sub 0.3}N/AlN multiple quantum wells under femtosecond optical pumping. Samples were grown by molecular beam epitaxy under a growth mode that introduces band structure potential fluctuations and high-density nanocluster-like features within the AlGaN wells. A maximum net modal gain value of 118 {+-} 9 cm{sup -1} has been measured and the transparency threshold of 5 {+-} 1 {mu}J/cm{sup 2} was experimentally determined, corresponding to 1.4 x 10{sup 17} cm{sup -3} excited carriers. These findings pave the way for the demonstration of solid-state lasers with sub-250 nm emission at room temperature.

Francesco Pecora, Emanuele; Zhang Wei; Nikiforov, A.Yu.; Yin Jian; Paiella, Roberto; Dal Negro, Luca; Moustakas, T. D. [Department of Electrical and Computer Engineering and Photonics Center, Boston University, 8 Saint Mary's Street, Boston, Massachusetts 02215 (United States); Zhou Lin; Smith, David J. [Department of Physics, Arizona State University, Tempe, Arizona 85287 (United States)



A library of high resolution synthetic stellar spectra from 300nm to 1.8 micron with solar and alpha-enhanced composition  

E-Print Network (OSTI)

Libraries of stellar spectra are fundamental tools for the study of stellar populations and both empirical and synthetic libraries have been used for this purpose. In this paper, a new library of high resolution synthetic spectra is presented, ranging from the near-ultraviolet (300nm) to the near-infrared (1.8${\\rm \\mu}$m). The library spans all the stellar types that are relevant to the integrated light of old and intermediate-age stellar populations in the involved spectral region (spectral types F through M and all luminosity classes). The grid was computed for metallicities ranging from [Fe/H] = --2.5 to +0.5, including both solar and $\\alpha$-enhanced ([$\\alpha$/Fe] = 0.4) chemical compositions. The synthetic spectra are a good match to observations of stars throughout the stellar parameter space encompassed by the library and over the whole spectral region covered by the computations.

P. Coelho; B. Barbuy; J. Melendez; R. Schiavon; B. Castilho



Strain mapping with nm-scale resolution for the silicon-on-insulator generation of semiconductor devices by advanced electron microscopy  

SciTech Connect

Strain engineering in the conduction channel is a cost effective method of boosting the performance in state-of-the-art semiconductor devices. However, given the small dimensions of these devices, it is difficult to quantitatively measure the strain with the required spatial resolution. Three different transmission electron microscopy techniques, high-angle annular dark field scanning transmission electron microscopy, dark field electron holography, and nanobeam electron diffraction have been applied to measure the strain in simple bulk and SOI calibration specimens. These techniques are then applied to different gate length SiGe SOI pFET devices in order to measure the strain in the conduction channel. For these devices, improved spatial resolution is required, and strain maps with spatial resolutions as good as 1 nm have been achieved. Finally, we discuss the relative advantages and disadvantages of using these three different techniques when used for strain measurement.

Cooper, David; Denneulin, Thibaud; Barnes, Jean-Paul; Hartmann, Jean-Michel; Hutin, Louis; Le Royer, Cyrille [CEA, LETI France MINATEC Campus, 17 rue des Martyrs, 38054 Grenoble Cedex 9 (France); Beche, Armand [CEA, LETI, and FEI France MINATEC Campus, 17 rue des Martyrs, 38054 Grenoble Cedex 9 (France); Rouviere, Jean-Luc [CEA, INAC, MINATEC Campus, 17 rue des Martyrs, 38054 Grenoble Cedex 9 (France)



Atomic gas temperature in a nonequilibrium high-intensity discharge lamp determined from the red wing of the resonance mercury line 254 nm  

Science Conference Proceedings (OSTI)

For developing low-wattage high intensity discharge (HID) lamps, a better understanding of the relatively unexplored nonequilibrium phenomena is essential. This needs interpretation of diagnostic results by methods free from equilibrium assumptions. In this paper, the atomic temperature is determined from the simulation of a quasistatic broadened resonance line by distinguishing between atomic temperature and excitation temperature in the equation of radiative transfer. The proposed method is applied to the red wing of the resonance mercury line 254 nm emitted from a HID lamp working on ac. The experimental results show severe deviation from local thermodynamic equilibrium. More than one thousand degrees difference was obtained between atomic and electron temperatures at the maximum current phase.

Drakakis, E. [Technological Educational Institute, Department of Electrical Engineering, 71004 Heraklion (Greece); Karabourniotis, D. [Institute of Plasma Physics, Department of Physics, University of Crete, 71003 Heraklion (Greece)



Importance of energy efficiency in the design of the Process and Environmental Technology Laboratory (PETL) at Sandia National Laboratories, New Mexico (NM)  

Science Conference Proceedings (OSTI)

As part of the design of the Process and Environmental Technology Laboratory (PETL) in FY97, an energy conservation report (ECR) was completed. The original energy baseline for the building, established in Title 1 design, was 595,000 BTU/sq. ft./yr, site energy use. Following the input of several reviewers and the incorporation of the various recommendations into the Title 2 design, the projected energy consumption was reduced to 341,000 BTU/sq. ft./yr. Of this reduction, it is estimated that about 150,000 BTU/sq. ft./yr resulted from inclusion of more energy efficient options into the design. The remaining reductions resulted from better accounting of energy consumption between Title 1 ECR and the final ECR. The energy efficient features selected by the outcome of the ECR were: (1) Energy Recovery system, with evaporative cooling assist, for the Exhaust/Make-up Air System; (2) Chilled Water Thermal Storage system; (3) Premium efficiency motors for large, year-round applications; (4) Variable frequency drives for all air handling fan motors; (4) Premium efficiency multiple boiler system; and (5) Lighting control system. The annual energy cost savings due to these measures will be about $165,000. The estimated annual energy savings are two million kWhrs electric, and 168,000 therms natural gas, the total of which is equivalent to 23,000 million BTUs per year. Put into the perspective of a typical office/light lab at SNL/NM, the annual energy savings is equal the consumption of a 125,000 square foot building. The reduced air emissions are approximately 2,500 tons annually.

Wrons, R.



A 512kb 8T SRAM macro operating down to 0.57V with an AC-coupled sense amplifier and embedded data-retention-voltage sensor in 45nm SOI CMOS  

E-Print Network (OSTI)

An 8T SRAM fabricated in 45 nm SOI CMOS exhibits voltage scalable operation from 1.2 V down to 0.57 V with access times from 400 ps to 3.4 ns. Timing variation and the challenge of low-voltage operation are addressed with ...

Qazi, Masood


Obama Administration Announces Additional $63,817,400 for Local...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

AZ Mohave County 408,700 AZ Navajo County 473,900 AZ Pima County 3,981,900 AZ Pinal County 2,060,800 AZ Yavapai County 548,200 AZ Yuma County 427,700 In addition,...


Past Chairmen of the Conference  

Science Conference Proceedings (OSTI)

... 73rd 1988 Grand Rapids, MI D. Guensler, CA 74th 1989 Seattle, WA J. Bartfai, NY 75th 1990 Washington, DC F. Gerk, NM ...


Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


CRSP Customers  

NLE Websites -- All DOE Office Websites (Extended Search)

Colorado River Storage Project Management Center's Customer list Colorado River Storage Project Management Center's Customer list Use the filters above the customer list to refine your search. Click the "Clear" to reset the list. Western's full list of customers is available on the Western's Customer Web page. Customer Name Customer Type State Region Project Acoma Pueblo Native American Tribes NM CRSP SLIP Aggregated Energy Services Cooperatives AZ CRSP SLIP AK-Chin Indian Community Native American Tribes AZ CRSP SLIP Alamo Navajo Chapter Native American Tribes NM CRSP SLIP Albuquerque Operation-DOE Federal Agencies NM CRSP SLIP Arizona Electric Power Cooperative Cooperatives AZ CRSP/DSW SLIP/PD Aspen, City of Municipalities CO CRSP SLIP Aztec, City of Municipalities NM CRSP SLIP


Shortwave, Clear-sky Diffuse Irradiance in the 350 to 1050 nm Range: Comparison of Models with RSS Measurements at the Southern Great Plains ARM Site in September/October 2001  

NLE Websites -- All DOE Office Websites (Extended Search)

Shortwave, Clear-Sky Diffuse Irradiance in the Shortwave, Clear-Sky Diffuse Irradiance in the 350 to 1050 nm Range: Comparison of Models with RSS Measurements at the Southern Great Plains ARM Site in September/October 2001 J. J. Michalsky, P. W. Kiedron, Q.-L. Min, and L. C. Harrison Atmospheric Sciences Research Center State University of New York Albany, New York J. J. Michalsky Surface Radiation Research Branch Air Resources Laboratory National Oceanic and Atmospheric Administration Boulder, Colorado Abstract A rotating shadowband spectroradiometer (RSS) operating in the spectral range between 350 to 1050 nm obtained measurements of direct and diffuse components of spectral irradiance during the first diffuse irradiance IOP in the autumn of 2001. Independent measurements of the primary inputs to spectral


Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8



Gasoline and Diesel Fuel Update (EIA)

1 1 55 0 2 4 6 8 10 Residential Onsystem Commercial Onsystem Industrial Onsystem Vehicle Fuel Electric Utilities Dollars per Thousand Cubic Feet 0 30 60 90 120 150 180 210 240 270 300 330 Dollars per Thousand Cubic Meters 1997 1998 1999 2000 2001 25. Average Price of Natural Gas Delivered to Consumers in the United States, 1997-2001 Figure Note: Prices are calculated from onsystem sales. Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition" and Federal Energy Regulatory Commission (FERC), Form FERC- 423, "Monthly Report of Cost and Quality of Fuels for Electric Plants." Energy Information Administration / Natural Gas Annual 2001 56 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848



Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type


Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2008 (Million Cubic Feet) Norway Trinidad/ Tobago Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 45,772 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates.


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

,833 ,833 35 Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2009 (Million Cubic Feet) Norway Trinidad/ Tobago Trinidad/ Tobago Egypt Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 111,144 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates


AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 (Million Cubic Feet) Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 42,411 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2006 253,214 690,780 634,185 658,523 134,764 63,063 526,726 121,049 34,531 492,655 101,101 23,154 40,113 1,496,283 68,601


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value


DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256


Microsoft Word - figure_14.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 14. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2010 (Million Cubic Feet) Norway India Trinidad/ Tobago Egypt Yemen Japan Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 53,122 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada Gulf of Mexico Canada Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates based on historical data. Energy Information


Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FOA-0000028 FOA-0000028 Prime: Cascade Sierra Solutions EE DE-EE0002613 PMC/PVT 2011 John Jason Conley 07/2011 - 02/20/2014 Multiple sites, Multiple states Interstate Electrification Improvement (SUMMARY CX) Install truck stop electrification hardware at multiple (30) truck stops nationwide. Locations in UT, IA, NM, WY, AZ, MO, VA, MA, MI, TX, AL, WA, CA, NC, NY, MT, FL, KS. 08 17 2011 John Jason Conley Digitally signed by John Jason Conley DN: cn=John Jason Conley, o=DOE, ou=NETL, email=John.Conley@netl.doe.gov, c=US Date: 2011.08.17 13:25:08 -04'00' 10 18 2011 john ganz Digitally signed by john ganz DN: cn=john ganz, o=netl, ou=environmental compliance division, email=john.ganz@netl.doe.gov, c=US Date: 2011.10.18 13:52:43 -04'00' Sub: Shorepower Technologies. Funded by DE-FOA-0000028, "Recovery Act - Transportation


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)



Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use



Gasoline and Diesel Fuel Update (EIA)

18 18 Energy Information Administration / Natural Gas Annual 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 0 1 2 3 4 5 6 7 T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o A l a b a m a K a n s a s A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 1997 1998 1999 2000 2001 2001 16. Marketed Production of Natural Gas in Selected States, 1997-2001 Figure Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI

Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423


Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC



Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 (Million Cubic Feet) 24,891 2,895 Nigeria WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico Algeria C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada N i g e r i a O m a n Qatar Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Malaysia 2,986 Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2005 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 335,380 634,982 664,318 612,297 125,202 33,223 531,868 103,624


San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


SLM device for 193nm lithographic applications  

Science Conference Proceedings (OSTI)

The imaging capability of a new spatial light modulator, (SLM), a custom MEMS device is presented. Low k"1 factor aerial image measurements show the suitability of the SLM device for a variety of uses including optical maskless lithography (OML) applications. ... Keywords: Aerial image, Calibration, Design, Electro-mechanical, Electrode, Fabrication, Imaging, Integration, MEMS, Maskless, Micro-mirror, Mirror, OML, Optical maskless lithography, Packaging, Qualification, SLM, Spatial light modulator

John Lauria; Ronald Albright; Olga Vladimirsky; Maarten Hoeks; Roel Vanneer; Bert van Drieenhuizen; Luoqi Chen; Luc Haspeslagh; Ann Witvrouw



Colin Messer, NM Energy Conservation and Management  

E-Print Network (OSTI)

1 The following report is based on the contributions of the individuals and organizations listed below. The Team members were chosen for their breadth of knowledge and industry or policy experience. The group was assembled with the goal of having a wide scope of interests including industry, academia and environmental analysis. The group also worked towards consensus viewpoints on the critical issues impacting the development of Biodiesel as an alternative fuel. This consensus model helped to achieve a balanced perspective on the challenges and potential solutions to further commercial development of this alternative transportation fuel. Biodiesel and Renewable Diesel Team Members: Richard Nelson, Chair, Kansas State Univ.

Renewable Diesel; Conoco Phillips; Jeff Probst; Blue Sun Biodiesel; John Brenner; Natural Resources; Conservation Service



Transparent fluids for 157-nm immersion lithography  

E-Print Network (OSTI)

, the latter determined by the thickness of the spacer gaskets. Since the calcium fluoride windows were found that enables the fluid to be reused for many 100 expo- sure fields will be both necessary and possible

French, Roger H.


Polymer Crystallization in 25 nm Spheres  

E-Print Network (OSTI)

Crystallization within the discrete spheres of a block copolymer mesophase was studied by time-resolved x-ray scattering. The cubic packing of microdomains, established by self-assembly in the melt, is preserved throughout crystallization by strong interblock segregation even though the amorphous matrix block is well above its glass transition temperature. Homogeneous nucleation within each sphere yields isothermal crystallizations which follow first-order kinetics, contrasting with the sigmoidal kinetics normally exhibited in the quiescent crystallization of bulk polymers.

Yueh-Lin Loo; Richard A. Register; Anthony J. Ryan



NM, East Natural Gas Liquids Proved Reserves  

U.S. Energy Information Administration (EIA)

-No Data Reported; --= Not Applicable; NA = Not Available; W = Withheld to avoid disclosure of individual company data. Notes: Miscellaneous States ...


Notice of Availability of the Draft Environmental Impact Statement for the Proposed Chemistry and Metallurgy Research Building Replacement Project at Los Alamos National Laboratory, Los Alamos, NM (DOE/EIS-0350)(5/15/03)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

96 96 Federal Register / Vol. 68, No. 94 / Thursday, May 15, 2003 / Notices [FR Doc. 03-12161 Filed 5-14-03; 8:45 am] BILLING CODE 6450-01-P DEPARTMENT OF ENERGY National Nuclear Security Administration Notice of Availability of the Draft Environmental Impact Statement for the Proposed Chemistry and Metallurgy Research Building Replacement Project at Los Alamos National Laboratory, Los Alamos, NM AGENCY: U.S. Department of Energy, National Nuclear Security Administration. ACTION: Notice of availability and public hearings. SUMMARY: Pursuant to the National Environmental Policy Act (NEPA) of 1969, as amended (42 U.S.C. 4321 et seq.), and the DOE Regulations Implementing NEPA (10 CFR part 1021), the National Nuclear Security Administration (NNSA), an agency


Notice of Intent to Prepare an Environmental Impact Statement for the Operation of a Biosafety Level 3 Facility at Los Alamos National Laboratory, Los Alamos, NM (DOE/EIS-0388) (11/29/05)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

90 Federal Register 90 Federal Register / Vol. 70, No. 228 / Tuesday, November 29, 2005 / Notices DEPARTMENT OF ENERGY National Nuclear Security Administration Notice of Intent To Prepare an Environmental Impact Statement for the Operation of a Biosafety Level 3 Facility at Los Alamos National Laboratory, Los Alamos, NM AGENCY: Department of Energy, National Nuclear Security Administration. ACTION: Notice of intent. SUMMARY: The National Nuclear Security Administration (NNSA), an agency within the U.S. Department of Energy (DOE), announces its intent to prepare an Environmental Impact Statement (EIS) to evaluate the operation of a Biosafety Level 3 Facility (BSL-3 Facility) at the Los Alamos National Laboratory (LANL) in Los Alamos, New Mexico. This EIS is being prepared and considered in accordance


Extension of Comment Period on the Draft Site-Wide Environmental Impact Statement for Continued Operation of Los Alamos National Laboratory, Los Alamos, NM (DOE/EIS-0380) (08/31/06)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

10 Federal Register 10 Federal Register / Vol. 71, No. 169 / Thursday, August 31, 2006 / Notices Coordinator, at the address and phone number listed above. Issued at Washington, DC on August 24, 2006. Carol Matthews, Acting Advisory Committee Management Officer. [FR Doc. 06-7304 Filed 8-30-06; 8:45 am] BILLING CODE 6450-01-P DEPARTMENT OF ENERGY National Nuclear Security Administration Extension of Comment Period on the Draft Site-Wide Environmental Impact Statement for Continued Operation of Los Alamos National Laboratory, Los Alamos, NM AGENCY: U.S. Department of Energy (DOE), National Nuclear Security Administration (NNSA). ACTION: Notice of comment period extension. SUMMARY: On July 7, 2006, NNSA published a Notice of Availability for the Draft Site-wide Environmental

Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Determining the CH{sub 3}SO{sub 2}{yields}CH{sub 3}+SO{sub 2} barrier from methylsulfonyl chloride photodissociation at 193 nm using velocity map imaging  

Science Conference Proceedings (OSTI)

These imaging experiments study the formation of the methylsulfonyl radical, CH{sub 3}SO{sub 2}, from the photodissociation of CH{sub 3}SO{sub 2}Cl at 193 nm and determine the energetic barrier for the radical's subsequent dissociation to CH{sub 3}+SO{sub 2}. We first state-selectively detect the angular and recoil velocity distributions of the Cl({sup 2}P{sub 3/2}) and Cl({sup 2}P{sub 1/2}) atoms to further refine the distribution of internal energy partitioned to the momentum-matched CH{sub 3}SO{sub 2} radicals. The internal energy distribution of the radicals is bimodal, indicating that CH{sub 3}SO{sub 2} is formed in both the ground state and low-lying excited electronic states. All electronically excited CH{sub 3}SO{sub 2} radicals dissociate, while those formed in the ground electronic state have an internal energy distribution which spans the dissociation barrier to CH{sub 3}+SO{sub 2}. We detect the recoil velocities of the energetically stable methylsulfonyl radicals with 118 nm photoionization. Comparison of the total recoil translational energy distribution for all radicals to the distribution obtained from the detection of stable radicals yields an onset for dissociation at a translational energy of 70{+-}2 kcal/mol. This onset allows us to derive a CH{sub 3}SO{sub 2}{yields}CH{sub 3}+SO{sub 2} barrier height of 14{+-}2 kcal/mol; this determination relies on the S-Cl bond dissociation energy, taken here as the CCSD(T) predicted energy of 65.6 kcal/mol. With 118 nm photoionization, we also detect the velocity distribution of the CH{sub 3} radicals produced in this experiment. Using the velocity distributions of the SO{sub 2} products from the dissociation of CH{sub 3}SO{sub 2} to CH{sub 3}+SO{sub 2} presented in the following paper, we show that our fastest detected methyl radicals are not from these radical dissociation channels, but rather from a primary S-CH{sub 3} bond photofission channel in CH{sub 3}SO{sub 2}Cl. We also present critical points on the ground state potential energy surface of CH{sub 3}SO{sub 2} at the //CCSD(T)/aug-cc-pV(Q+d)ZCCSD(T)/6-311++G(2df,p) level. We include harmonic zero-point vibrational corrections as well as core-valence and scalar-relativistic corrections. The CCSD(T) predicted barrier of 14.6 kcal/mol for CH{sub 3}SO{sub 2}{yields}CH{sub 3}+SO{sub 2} agrees well with our experimental measurement. These results allow us to predict the unimolecular dissociation kinetics of CH{sub 3}SO{sub 2} radicals and critique the analysis of prior time-resolved photoionization studies on this system.

Ratliff, Britni J.; Tang Xiaonan; Butler, Laurie J. [Department of Chemistry and James Franck Institute, University of Chicago, Chicago, Illinois 60637 (United States); Szpunar, David E. [Department of Biological, Chemical, and Physical Sciences, Roosevelt University, Schaumburg, Illinois 60173 (United States); Lau, Kai-Chung [Department of Biology and Chemistry, City University of Hong Kong (Hong Kong)



dynamic characterization of az31b and zek100 magnesium alloy ...  

Science Conference Proceedings (OSTI)

Jul 20, 2012 ... If the price of this product displays as $0.00 for your customer category, you may download it for free. You must, however, add it to your cart and...


assessment of hot cracking susceptibility in az91e using the ...  

Science Conference Proceedings (OSTI)

Jul 20, 2012 ... If the price of this product displays as $0.00 for your customer category, you may download it for free. You must, however, add it to your cart and...


GRED III Final Report Clifton Hot Springs Geothermal Greenlee County, AZ  

SciTech Connect

Black & Veatch Corporation has prepared this report for Arizona Public Service Company, Salt River Project, and Tucson Electric Power Company (APS/SRP/TEP). The purpose of this report is to assess the prospects for significant renewable energy development in Arizona. The scope of the study is limited to Arizona projects that would export power to the grid (that is, not distributed energy projects). This study includes a review of the current status of renewable energy in Arizona, characterization of renewable power generation technologies, assessment of Arizona''s renewable resources, and an assessment of key risk factors. This section summarizes the key findings in these areas.

Brown, David E.



A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

What is the role of coal in the United States? ... Ancillary Services (Electricity) ... The EIA Glossary includes definitions of technical terms.


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Energy use in homes, commercial buildings, manufacturing, and transportation. ... Jobs (With the Energy Information Administration) Jordan Country ...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Air-Conditioning, Number of Households With; Air Pollution Abatement Equipment; Air Pollution Emissions Data (Leave EIA) Alabama Energy Profile; Alaska ...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

SPP: small power producer; SPR: ... VAWT: vertical-axis wind turbine; VLCC: very large crude carrier; VMT: vehicle miles traveled; VOC: volatile ...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Petroleum & Other Liquids. Crude oil, gasoline, heating oil, diesel, propane, and other liquids including biofuels and natural gas liquids. Natural Gas



E-Print Network (OSTI)

99 | Science/Nature Should the cold fusion dream die? 11 Sep 00 | Festival of science Arthur C Clarke demands cold fusion rethink Internet links: Nature Science Kenneth Suslick Oak Ridge National Laboratory Thursday, 25 July, 2002, 11:15 GMT 12:15 UK Fusion experiment disappoints The idea that we could build

Suslick, Kenneth S.



E-Print Network (OSTI)

. Paul, Jr. Art Kirk Willis History 1999 Noel Fallows Romance Languages (postponed until end of headship Geography Bernard Dauenhauer Philosophy & Religion Paul Edmonston Art Mary Legler Music William Free English Art Frank K. Gibson Political Science Richard Hill Chemistry Charles Patterson English Warren Spencer

California at Santa Cruz, University of


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Think of it like the index of a book. It is structured so that synonyms, acronyms, and cross-referencing provide multiple ways for you to access information.


The Effects of Nickel in Oxide Layers on the AZ91 Mg Alloys ...  

Science Conference Proceedings (OSTI)

Aerosol Route Synthesis of Copper Oxide Nanoparticles Using Copper Nitrate Solution AlGaAs-Based Optical ... Defect Energetics and Fission Product Transport in ZrC ... Enhancing Mineral Beneficiation by High Intensity Power Ultrasound.


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Energy Information Administration - EIA - Official Energy Statistics from the U.S. Government ... Alternative Fuels. Includes hydropower, solar, wind, geothermal, ...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Aluminum Industry Analysis Brief ; American Clean Energy and Security Act of 2009 - Analysis of Energy Market and Economic Impacts of H.R. 2454 ;


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

NERC (North American Electric Reliability Corporation; includes U.S. and Canada) Definition; Map; NERC Web Site (Leave EIA Site)


An A-Z of offshore oil and gas. Second ed  

Science Conference Proceedings (OSTI)

This is an illustrated international glossary and reference guide to the offshore oil and gas industries, and their technology. It contains more than 4,000 terms in current use, with 20 full-page maps and 200 line drawings, plus extensive appendices. The new edition has been considerably expanded, revised and updated. There are new features on subjects such as: new drilling rigs, fire and gas detection, gas dehydration, accommodation platforms, new articulated loading platforms, acoustic enclosures, and more. There are additional tables and maps as well as many more terms which have now come into practical use.

Whitehead, H.



Evaluation of Plug Power Gensys 5C Fuel Cell System in Mesa, AZ: Final Report  

Science Conference Proceedings (OSTI)

A pre-commercial Plug Power Gensys 5C fuel cell was installed at the Arizona State University - Photovoltaic Testing Laboratory (ASU-PTL). The proton exchange membrane (PEM) fuel cell is fueled with natural gas and exports up to 5 kW to the local electrical grid. The overall performance and maintenance history over 18 months of operation is chronicled. PEM fuel cells are being positioned by Plug Power and other vendors as residential power generators.



A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Biofuels: Ethanol & Biodiesel ... Wholesale Electricity (See Electric Sales for Resale) Wholesale Market Data (Electricity) Why are gasoline prices higher in some ...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

R. Rack Prices (Gasoline; includes U.S., PADD & State) Data; Definition; Rack Sales (Gasoline; includes U.S., PADD & State) Data; Definition; Railroad ...

Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Wahlfach II: ,,Ansthesie von A-Z Von der Prmedikation bis zur postoperativen Visite"  

E-Print Network (OSTI)

://www.bmbf.de/pub/begabtenfoerderungswerke.pdf Handbuch Promotion: Forschung - Förderung ­ Finanzierung Ansgar Nünning/Roy Sommer (Hrsg.) Verlag: Metzler

Manstein, Dietmar J.


C22 Twinning Behavior in AZ31-B Polycrystal Texture Subjected to ...  

Science Conference Proceedings (OSTI)

A37 Unconventional Method of Nitriding of 316l Austenitic Steel A38 Role of ..... I24 The Study of Cotton Finishing by Artemsia Argyi Oil Microcapsules.


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Major Coal Consumer (Manufacturers and Coke Plants) Major Coal Mines ... Miles Driven per Vehicle; Miles per Gallon; Minnesota Energy Profile ; ...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Commercial Buildings Energy Consumption Survey (CBECS ) (# of buildings, ... Consumption of Petroleum (Petroleum Products Supplied; includes U.S. & International)


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Alternative fuels survey forms; ... Availability and Price of Petroleum and Petroleum Products Produced in Countries Other Than Iran, The ; Average diesel fuel price


double-sided arc welding of az31b magnesium alloy sheet  

Science Conference Proceedings (OSTI)

Jul 20, 2012... tailor-welded blanks for forming automotive structural components. ... initial investigations suggest that visually acceptable symmetrical welds...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Energy Information Administration ... solar, wind, geothermal, biomass and ethanol. ... EIS: Environmental Impact Statement;


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Petroleum & Other Liquids. Crude oil, gasoline, heating oil, diesel, propane, and other liquids including biofuels and natural gas liquids. ...


Lattice Strain Evolution during In-situ Deformation of AZ31 Alloy ...  

Science Conference Proceedings (OSTI)

Based on the deviation of the lattice strain from its linear elastic trajectory, basal slip is identified in (10-12) and (10-13) grains at ~ 75 and 90 MPa respectively.


deformation behaviour of az80 subject to multi-axial tensile loading  

Science Conference Proceedings (OSTI)

Jul 20, 2012 ... If the price of this product displays as $0.00 for your customer category, you may download it for free. You must, however, add it to your cart and...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Copyright & Reuse Accessibility. Related Sites U.S. Department of Energy USA.gov FedStats. Stay Connected Facebook Twitter YouTube Email Updates RSS Feeds ...


Solidification Heat Transfer Analysis of AZ91D Cast Strip by Using a ...  

Science Conference Proceedings (OSTI)

The heat transfer coefficient between the molten magnesium ally and copper roll is important to cast magnesium strip. In the present study investigate the heat...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Electricity. Sales, revenue and prices, power plants, fuel use, stocks, ... Petroleum Cost to Electric Power Industry (U.S., Census Divsion & State) Annual;


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Analysis & Projections. Monthly and yearly energy forecasts, analysis of energy topics, financial analysis, Congressional reports. Markets & ...


SIAM Conference on Numerical Combustion Sedona, AZ May 9-12, 2004  

Science Conference Proceedings (OSTI)

The Society for Industrial and Applied Mathematics hosted the Tenth International Conference on Numerical Combustion held May 9-12, 2004 in Sedona, Arizona. This distinguished conference series began in 1985 in Sophia Antipolis, France and was followed by conferences in San Francisco, California (1987), Juan les Pins, France (1989), St. Petersburg Beach, Florida (1991), Garmisch, Germany (1993), New Orleans, Louisiana (1996), York, England (1998), Amelia Island, Florida (2000), and Sorrento, Italy (2002). SIAM is widely recognized as the originator and the U.S. anchor of this important meeting whose topics concerns the applied mathematics and computation associated with combustion and reactive flow. In particular, the International Numerical Combustion Symposiums have become one of the international major venues for research on direct simulation and modeling turbulent reacting flow. It is also one of the major international venues for theoretical work in reacting flows. This meeting drew approximately 200 participants from 30 countries whose research included the topics in turbulence, kinetics, detonation, flames, pollution, microgravity, micro-combustion, ignition, applications of parallel processing, tera-scale computation of combustion applications, material synthesis, droplets and sprays, heterogeneous combustion, energetic materials (propellants and explosives), engine and furnace combustion, fires, numerical methods and, software engineering for combustion applications.




Maintenance of Open Chromatin States by Histone H3 Eviction and H2A.Z  

E-Print Network (OSTI)

coregulator occupancy and chromatin modification. Proc Natlsuggested that 30-50% of chromatin-bound H3 undergoesa broad range of chromatin-based phenotypes, including

Lombardi, Laura



Ethanol Addition for Enhancing Denitrification at the Uranium Mill Tailing Site in Monument Valley, AZ  

Science Conference Proceedings (OSTI)

Uranium mining and processing near Monument Valley, Arizona resulted in the formation of a large nitrate plume in a shallow alluvial aquifer. The results of prior field characterization studies indicate that the nitrate plume is undergoing a slow rate of attenuation via denitrification, and the results of bench-scale studies suggest that denitrification rates can potentially be increased by an order of magnitude with the addition of ethanol as a carbon substrate. The objective of the study was to investigate the potential of ethanol amendment for enhancing the natural denitrification occurring in the alluvial aquifer. Pilot tests were conducted using the single well, push-pull method and a natural-gradient test. The results showed that the concentration of nitrate decreased, while the concentration of nitrous oxide (a product of denitrification) increased. In addition, changes in aqueous concentrations of sulfate, iron, and manganese indicate the ethanol amendment effected a change in prevailing redox conditions. The results of compound-specific stable isotope analysis for nitrogen indicated that the nitrate concentration reductions were biologically mediated. Continued monitoring after completion of the pilot tests has shown that nitrate concentrations in the injection zone have remained at levels three orders of magnitude lower than the initial values, indicating that the impacts of the pilot tests have been sustained for several months.

Borden, A. K.; Brusseau, M. L.; Carroll, Kenneth C.; McMillan, Andrew; Akyol, N. H.; Berkompas, J.; Miao, Z.; Jordan, F.; Tick, Geoff; Waugh, W. J.; Glenn, E. P.



Microsoft Word - WESTCARB AZ Pilot FactSheet--BKi 10-28.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

yet the area hosts one of the West's largest concentration of baseload coal-fired power plants, making it an ideal location for future CO 2 capture and storage projects....


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Exploration and reserves, storage, imports and exports, production, prices, sales ... State Energy Data System ... provide multiple ways for you to access ...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

The EIA Glossary includes definitions of technical terms. Please use the glossary to find the meanings of words. What items are included?

Note: This page contains sample records for the topic "mi az nm" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Smart Grid (Electrical System) Study; SO 2 Emissions (Electricity Industry) Solar Electricity Generation; Solar Energy Potential (map) Photovoltaic; Solar ...


A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Electric Power Grid; Electric Power Industry Maps; Electric Power Monthly (Report; ... Electrical System Smart Grid Study; Electricity (Main Electricity Web Page)


Photodissociation of van der Waals clusters of isoprene with oxygen, C{sub 5}H{sub 8}-O{sub 2}, in the wavelength range 213-277 nm  

SciTech Connect

The speed and angular distribution of O atoms arising from the photofragmentation of C{sub 5}H{sub 8}-O{sub 2}, the isoprene-oxygen van der Waals complex, in the wavelength region of 213-277 nm has been studied with the use of a two-color dissociation-probe method and the velocity map imaging technique. Dramatic enhancement in the O atoms photo-generation cross section in comparison with the photodissociation of individual O{sub 2} molecules has been observed. Velocity map images of these 'enhanced' O atoms consisted of five channels, different in their kinetic energy, angular distribution, and wavelength dependence. Three channels are deduced to be due to the one-quantum excitation of the C{sub 5}H{sub 8}-O{sub 2} complex into the perturbed Herzberg III state ({sup 3}{Delta}{sub u}) of O{sub 2}. This excitation results in the prompt dissociation of the complex giving rise to products C{sub 5}H{sub 8}+O+O when the energy of exciting quantum is higher than the complex photodissociation threshold, which is found to be 41740 {+-} 200 cm{sup -1} (239.6{+-}1.2 nm). This last threshold corresponds to the photodissociation giving rise to an unexcited isoprene molecule. The second channel, with threshold shifted to the blue by 1480 {+-} 280 cm{sup -1}, corresponds to dissociation with formation of rovibrationally excited isoprene. A third channel was observed at wavelengths up to 243 nm with excitation below the upper photodissociation threshold. This channel is attributed to dissociation with the formation of a bound O atom C{sub 5}H{sub 8}-O{sub 2}+hv{yields} C{sub 5}H{sub 8}-O{sub 2}({sup 3}{Delta}{sub u}) {yields} C{sub 5}H{sub 8}O + O and/or to dissociation of O{sub 2} with borrowing of the lacking energy from incompletely cooled complex internal degrees of freedom C{sub 5}H{sub 8}{sup *}-O{sub 2}+hv{yields} C{sub 5}H{sub 8}{sup *}-O{sub 2}({sup 3}{Delta}{sub u}) {yields} C{sub 5}H{sub 8}+ O + O. The kinetic energy of the O atoms arising in two other observed channels corresponds to O atoms produced by photodissociation of molecular oxygen in the excited a {sup 1}{Delta}{sub g} and b {sup 1}{Sigma}{sub g}{sup +} singlet states as the precursors. This indicates the formation of singlet oxygen O{sub 2}(a {sup 1}{Delta}{sub g}) and O{sub 2}(b {sup 1}{Sigma}{sub g}{sup +}) after excitation of the C{sub 5}H{sub 8}-O{sub 2} complex. Cooperative excitation of the complex with a simultaneous change of the spin of both partners {sup 1}X-{sup 3}O{sub 2}+h{nu}{yields}{sup 3}X-{sup 1}O{sub 2}{yields}{sup 3}X +{sup 1}O{sub 2} is suggested as a source of singlet oxygen O{sub 2}(a {sup 1}{Delta}{sub g}) and O{sub 2}(b {sup 1}{Sigma}{sub g}{sup +}). This cooperative excitation is in agreement with little or no vibrational excitation of O{sub 2}(a {sup 1}{Delta}{sub g}), produced from the C{sub 5}H{sub 8}-O{sub 2} complex as studied in the current paper as well as from the C{sub 3}H{sub 6}-O{sub 2} and CH{sub 3}I-O{sub 2} complexes reported in our previous paper [Baklanov et al., J. Chem. Phys. 126, 124316 (2007)]. The formation of O{sub 2}(a {sup 1}{Delta}{sub g}) from C{sub 5}H{sub 8}-O{sub 2} was observed at {lambda}{sub pump}= 213-277 nm with the yield going down towards the long wavelength edge of this interval. This spectral profile is interpreted as the red-side wing of the band of a cooperative transition {sup 1}X-{sup 3}O{sub 2}+h{nu}{yields}{sup 3}X(T{sub 2})-{sup 1}O{sub 2}(a {sup 1}{Delta}{sub g}) in the C{sub 5}H{sub 8}-O{sub 2} complex.

Vidma, Konstantin V.; Frederix, Pim W. J. M.; Parker, David H. [Institute for Molecules and Materials, Radboud University Nijmegen, Heyendaalseweg 135, 6525 ED Nijmegen (Netherlands); Baklanov, Alexey V. [Institute of Chemical Kinetics and Combustion, Institutskaja Street 3, Novosibirsk 630090 (Russian Federation) and Novosibirsk State University, Pirogova street 2, Novosibirsk 630090 (Russian Federation)



U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

1 Regional maps Figure F4. Oil and gas supply model regions Figure F4. Oil and Gas Supply Model Regions Atlantic WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA...


Managing Smart Grid Information in the Cloud: Opportunities, Model, and Applications  

E-Print Network (OSTI)

Managing Smart Grid Information in the Cloud: Opportunities, Model, and Applications Xi Fang, AZ, USA New Mexico State University, Las Cruces, NM, USA Abstract--Smart Grid (SG), regarded applications. 1. INTRODUCTION Smart Grid (SG), an enhancement of the 20th century electrical grid, is regarded

Misra, Satyajayant


Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management


Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","ng_prod_whv_a_epg0_vgm_mmcf_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/ng/ng_prod_whv_a_epg0_vgm_mmcf_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"12/19/2013 6:54:27 AM" "Back to Contents","Data 1: Natural Gas Marketed Production " "Sourcekey","N9050US2","N9050FX2","N9050AL2","N9050AK2","N9050AZ2","N9050AR2","N9050CA2","N9050CO2","N9050FL2","N9050IL2","N9050IN2","N9050KS2","N9050KY2","N9050LA2","N9050MD2","N9050MI2","N9050MS2","N9050MO2","N9050MT2","N9050NE2","N9050NV2","N9050NM2","N9050NY2","N9050ND2","N9050OH2","N9050OK2","N9050OR2","N9050PA2","N9050SD2","N9050TN2","N9050TX2","N9050UT2","N9050VA2","N9050WV2","N9050WY2"



Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly


Nanoparticles for targeting the infarcted heart  

E-Print Network (OSTI)

We report a nanoparticulate system capable of targeting the heart after myocardial infarction (MI). Targeting is based on overexpression of angiotensin II type 1 (AT1) receptor in the infarcted heart. Liposomes 142 nm in ...

Dvir, Tal


Figure 11. Shale gas proved reserves by selected states, wet after ...  

U.S. Energy Information Administration (EIA)

Figure 11 Shale_History_Summary state Alabama AL Arkansas AR CA Colorado CO Kentucky KY Louisiana LA Michigan MI Montana MT North Dakota ND NM Oklahoma OK Pennsylvania


Electron-Cloud Build-Up: Theory and Data  

E-Print Network (OSTI)

of Titanium Nitride Coating For SNS Ring Vac- uum Chambers,High-Current Proton Rings (SNS/LANL, Santa Fe, NM, 4-7 MarchSPS, APS, RHIC, Tevatron, MI, SNS, CESRTA, DA?NE and most

Furman, M. A.



Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...