Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Biology and Medicine Division annual report, 1981-1982. [Lead abstract  

SciTech Connect

Separate abstracts were prepared for the 61 research reports in the 1981-1982 annual report for the Biology and Medicine Division of the Lawrence Berkeley Laboratory. Programs reviewed include research medicine, Donner Pavilion, environmental physiology, radiation biophysics and structural biophysics. (KRM)



Anthracite coal supply for the 1981-1982 winter  

Science Conference Proceedings (OSTI)

This report contains a letter addressed to the Chairman of the Subcommittee on Energy and Mineral Resources in which findings on the potential for anthracite to become an effective component in meeting US energy needs are presented. Some of the problems facing the anthracite industry and consumers in the northeastern states, state and industry actions since the 1980 shortage, and the outlook for the winter of 1982 are addressed. Information was obtained on anthracite exports to foreign countries and to the DOD facilities in the Federal Republic of Germany. Development efforts to use anthracite in industrial boilers and the actions that the state of Pennsylvania has taken to encourage the use of anthracite in municipal buildings are also discussed. (DMC)

Peach, J.D.



Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


Computing Division two-year operational plan, FY 1981-1982  

Science Conference Proceedings (OSTI)

This report is a comprehensive planning guide for the Computing Division of the Los Alamos National Laboratory for fiscal years 1981 and 1982. Subjects discussed include critical issues, programmatic requiements, hardware plans, software projects, direct user services, research projects, and projections of future developments.

Euald, R.H.; Worlton, W.J.; McCormick, M.



Advanced methods development for LWR trsansient analysis, final report : 1981-1982  

E-Print Network (OSTI)

The initial development of TITAN, a three-dimensional coupled neutronics/thermal-hydraulics code for LWR safety analysis, has been completed. The transient neutronics code QUANDRY has been joined to the two-fluid ...

Griggs, D. P.



DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...

Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper


Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



Buildings Energy Data Book: 2.5 Residential Construction and Housing Market  

Buildings Energy Data Book (EERE)

1 1 Yearly Average Historic Mortgage Rates 30-Year Fixed 15-Year Fixed 1-Year ARM (1) 1973 1974 1975 1976 1977 1978 1979 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 Note(s): Source(s): 1) To calculate adjustable-rate mortgage (ARM) rates, Freddie Mac indexes the products to US Treasury yields and asks lenders for both the initial coupon rate as well as the margin on the ARM products. US Department of Housing and Urban Development, US Housing Market Conditions: 3rd Quarter 2011, November 2011, Exhibit 14. Mortgage Interest Rates, Average Commitment Rates, and Points: 1973-Present. 5.04 4.57 4.70 4.69 4.10 3.78 6.34 6.03 5.56 6.03 5.62 5.17 5.87 5.42 4.49 6.41 6.07 5.54 5.83 5.17 3.76 5.84 5.21 3.90 6.97 6.50


A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



International Energy Statistics - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Nuclear Electricity Net Generation (Billion Kilowatthours) Loading... Units Conversion Download Excel: 1980 1981 1982 1983 1984 ...


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


David Read  

Science Conference Proceedings (OSTI)

... NBS - National Research Council Postdoctoral Fellowship (1974-1975). NSF Summer Student Traineeship, University of Illinois at Urbana(1970). ...



miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Buildings Energy Data Book: 2.5 Residential Construction and Housing Market  

Buildings Energy Data Book (EERE)

9 9 Annual Sales of Existing Homes, by Region (thousands) North- Mid- east west South West 1970 1971 1972 1973 1974 1975 1976 1977 1978 1979 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 Source(s): HUD, US Housing Market Conditions: 3rd Quarter 2011, Nov. 2011, Exhibit 7: Existing Home Sales 1969-Present, p. 73. 868 1,163 1,914 1,211 5,156 817 1,076 1,860 1,154 4,907 1,006 1,327 2,235 1,084 5,652 849 1,129 1,865 1,070 4,913 1,169 1,588 2,702 1,617 7,076 1,086 1,483 2,563 1,346 6,478 1,019 1,468 2,283 1,405 6,175 1,113 1,550 2,540 1,575 6,778 912 1,271 1,967 1,184 5,334 952 1,346 2,064 1,269 5,631 910 1,246 1,850 1,177 5,183 911 1,222 1,866 1,174 5,173 812 1,088 1,474 997 4,371 898 1,228 1,724 1,115 4,965 717 1,010 1,315 810 3,852 772 1,060 1,394 941 4,167 709 1,027 1,262


Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)


Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


International Energy Statistics  

U.S. Energy Information Administration (EIA)

Unit: Total Oil Supply (Thousand Barrels Per Day) Loading... Units Conversion Download Excel: 1980 1981 1982 1983 ...


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



DC Resistivity Survey (Schlumberger Array) At Raft River Geothermal...  

Open Energy Info (EERE)

Community Login | Sign Up Search Page Edit History Facebook icon Twitter icon DC Resistivity Survey (Schlumberger Array) At Raft River Geothermal Area (1974-1975) Jump...


Board of Directors: Past Presidents  

Science Conference Proceedings (OSTI)

1957. 1958. 1959. 1960. 1961. 1962. 1963. 1964. 1965. 1966. 1967. 1968. 1969. 1970. 1971. 1972. 1973. 1974. 1975. 1976. 1977. 1978. 1979. 1980. 1981.


T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.


Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


Annual report, July 1981-June 1982  

DOE Green Energy (OSTI)

The report consists of brief progress reports describing thirty-five research projects conducted during FY 1981-1982 in the areas of geothermal energy, ocean thermal energy conversion, biomass, wind energy, solar energy, and hydrogen storage. (ACR)

Brown, N.E.



A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



DC Resistivity Survey (Schlumberger Array) At Raft River Geothermal Area  

Open Energy Info (EERE)

Area Area (1974-1975) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: DC Resistivity Survey (Schlumberger Array) At Raft River Geothermal Area (1974-1975) Exploration Activity Details Location Raft River Geothermal Area Exploration Technique DC Resistivity Survey (Schlumberger Array) Activity Date 1974 - 1975 Usefulness not indicated DOE-funding Unknown Exploration Basis Hydrogeologic study of the area Notes In 1975, the U.S. Geological Survey made 70 Schlumberger resistivity soundings in the Upper Raft River Valley and in parts of the Raft River Valley. These soundings complement the 79 soundings made previously in the Raft River Valley and bring the total number of soundings to 149. This work was done as part of a hydrogeologic study of the area. The location,


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


Survey of Artificial Production of Anadromous Salmonids in the Columbia River Basin, 1981-1985 Final Report.  

DOE Green Energy (OSTI)

The overall objective of this project is to collect, organize, and summarize data concerning anadromous fish culture stations of the Columbia River system for 1981, 1982, and 1983 and to create a data archive system with a means of making this information available to the public.

Washington, Percy M.



Los Alamos National Laboratory solar program  

DOE Green Energy (OSTI)

Progress is reported for passive solar tasks performed at the Los Alamos National Laboratory during FY 1982. Results on test cell experiments for the 1981-1982 winter are reported, as are Class A performance monitoring, passive cooling, both residential and commercial economic cooling assessments, and thermal effects of distributed mass in passive buildings.

Reisfeld, S.K.; Neeper, D.A.



Long-term variation of fiddler crab populations in North Carolina salt marshes  

SciTech Connect

As part of the environmental monitoring of possible effects of the Brunswick nuclear power plant fiddle crab populations were sampled in several salt marshes in the lower Cape Fear River estuary, North Carolina for five years. Total biomass of the fiddler crabs Uca Pugnax and U. minax in four Spartina marshes declined by 65 to 70% between the summers of 1974-1975 and 1976-1977 with no significant decrease in population density; there was evidence of a recovery in summer of 1978 to the 1974-1975 levels. The cause of these fluctuations is unknown, but such a degree of variability in intertidal populations emphasizes the need for caution in using one or two-year baseline studies to evalute potential environmental impacts. 1 figure, 2 table.

Cammen, L.M.; Seneca, E.D.; Stroud, L.M.



Georgia Natural Gas Summary  

Gasoline and Diesel Fuel Update (EIA)

Imports Imports 6.79 9.71 3.73 4.39 4.20 2.78 1999-2012 Pipeline and Distribution Use 1967-2005 Citygate 8.15 9.35 6.56 5.93 5.19 4.35 1984-2012 Residential 17.53 18.26 16.30 15.17 15.72 16.23 1967-2012 Commercial 13.21 14.30 11.70 10.95 10.51 9.74 1967-2012 Industrial 8.86 11.02 6.21 6.25 5.90 4.60 1997-2012 Vehicle Fuel 12.93 12.91 12.11 5.17 5.57 14.51 1993-2012 Electric Power 7.54 10.40 4.70 5.21 4.72 3.40 1997-2012 Imports and Exports (Million Cubic Feet) Imports 170,243 135,711 142,244 106,454 75,641 59,266 1999-2012 Underground Storage (Million Cubic Feet) Injections 1974-1975 Withdrawals 1974-1975 Net Withdrawals 1974-1975 Liquefied Natural Gas Storage (Million Cubic Feet) Additions 2,817 4,372 3,182 2,693 3,306 2,097 1980-2012


Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...

Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael




Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake



E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...

Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...


ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks


miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha



Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.



co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...


Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George


UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...


May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

May ________. A vistas la pornografa. Primera Hora, 22la medida contra la pornografa. El Nuevo Da, 13 Junecomunicacin contra la pornografa. El Nuevo Da, 16 May

Rivera, Petra Raquel



Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer


Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.



Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas



Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan


Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

Puertorriquea. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetn. Based on ethnographic and archival research in San Juan, Puerto Rico, (more)

Rivera, Petra Raquel



Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois


Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.


Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela


Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clment Jamin; Pierre-Marie Gandoin; Samir Akkouche



LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2013-10084P


Net Withdrawals of Natural Gas from Underground Storage - All Operators  

Gasoline and Diesel Fuel Update (EIA)

192,093 33,973 -348,719 -17,009 -347,562 -7,279 1967-2012 192,093 33,973 -348,719 -17,009 -347,562 -7,279 1967-2012 Alaska 1973-1975 Lower 48 States -347,562 -7,279 2011-2012 Alabama -140 -4,452 2,278 -6,286 -7,357 2,456 1968-2012 Arkansas -278 563 760 -304 -219 112 1967-2012 California 3,687 -22,721 -14,565 -23,157 -20,591 -48,077 1967-2012 Colorado -633 -2,140 -3,442 1,760 -3,128 -2,570 1967-2012 Connecticut 1973-1996 Delaware 1967-1975 Georgia 1974-1975 Idaho 1974-1975 Illinois 7,333 -506 -11,464 -2,323 -1,186 1,001 1967-2012 Indiana 2,419 37 -2,181 511 -2,401 1,097 1967-2012 Iowa 2,450 -2,274 -4,861 2,037 -4,244 10,517 1967-2012 Kansas 15,355 -14,613 3,685 8,484 -20,296 11,916 1967-2012 Kentucky 5,440 4,694 -4,938 2,159 -12,704 1,982 1967-2012 Louisiana 12,923 5,924 -46,527 -38,961 -37,124 12,820 1967-2012


Net Withdrawals of Natural Gas from Underground Storage - All Operators  

U.S. Energy Information Administration (EIA) Indexed Site

192,093 33,973 -348,719 -17,009 -347,562 -7,279 1967-2012 192,093 33,973 -348,719 -17,009 -347,562 -7,279 1967-2012 Alaska 1973-1975 Lower 48 States -347,562 -7,279 2011-2012 Alabama -140 -4,452 2,278 -6,286 -7,357 2,456 1968-2012 Arkansas -278 563 760 -304 -219 112 1967-2012 California 3,687 -22,721 -14,565 -23,157 -20,591 -48,077 1967-2012 Colorado -633 -2,140 -3,442 1,760 -3,128 -2,570 1967-2012 Connecticut 1973-1996 Delaware 1967-1975 Georgia 1974-1975 Idaho 1974-1975 Illinois 7,333 -506 -11,464 -2,323 -1,186 1,001 1967-2012 Indiana 2,419 37 -2,181 511 -2,401 1,097 1967-2012 Iowa 2,450 -2,274 -4,861 2,037 -4,244 10,517 1967-2012 Kansas 15,355 -14,613 3,685 8,484 -20,296 11,916 1967-2012 Kentucky 5,440 4,694 -4,938 2,159 -12,704 1,982 1967-2012 Louisiana 12,923 5,924 -46,527 -38,961 -37,124 12,820 1967-2012


Injections of Natural Gas into Underground Storage - All Operators  

Gasoline and Diesel Fuel Update (EIA)

3,132,920 3,340,365 3,314,990 3,291,395 3,421,813 2,825,427 3,132,920 3,340,365 3,314,990 3,291,395 3,421,813 2,825,427 1935-2012 Alaska 1973-1975 Lower 48 States 3,421,813 2,825,427 2011-2012 Alabama 20,009 31,208 21,020 23,026 22,766 21,195 1968-2012 Arkansas 5,695 5,023 4,108 4,672 4,628 2,848 1967-2012 California 214,469 237,364 199,763 226,810 263,067 218,663 1967-2012 Colorado 38,619 39,034 45,861 43,250 51,469 59,096 1967-2012 Connecticut 1973-1996 Delaware 1967-1975 Georgia 1974-1975 Idaho 1974-1975 Illinois 243,789 260,333 259,421 247,458 258,690 249,953 1967-2012 Indiana 22,686 22,874 24,399 21,943 23,864 19,878 1967-2012 Iowa 70,329 70,022 79,012 76,407 77,783 66,774 1967-2012 Kansas 113,399 115,669 102,406 113,253 119,823 93,460 1967-2012 Kentucky 70,682 77,503 71,972 85,167 77,526 64,483 1967-2012


Injections of Natural Gas into Underground Storage - All Operators  

U.S. Energy Information Administration (EIA) Indexed Site

3,132,920 3,340,365 3,314,990 3,291,395 3,421,813 2,825,427 3,132,920 3,340,365 3,314,990 3,291,395 3,421,813 2,825,427 1935-2012 Alaska 1973-1975 Lower 48 States 3,421,813 2,825,427 2011-2012 Alabama 20,009 31,208 21,020 23,026 22,766 21,195 1968-2012 Arkansas 5,695 5,023 4,108 4,672 4,628 2,848 1967-2012 California 214,469 237,364 199,763 226,810 263,067 218,663 1967-2012 Colorado 38,619 39,034 45,861 43,250 51,469 59,096 1967-2012 Connecticut 1973-1996 Delaware 1967-1975 Georgia 1974-1975 Idaho 1974-1975 Illinois 243,789 260,333 259,421 247,458 258,690 249,953 1967-2012 Indiana 22,686 22,874 24,399 21,943 23,864 19,878 1967-2012 Iowa 70,329 70,022 79,012 76,407 77,783 66,774 1967-2012 Kansas 113,399 115,669 102,406 113,253 119,823 93,460 1967-2012 Kentucky 70,682 77,503 71,972 85,167 77,526 64,483 1967-2012


Markets & Finance - Data - U.S. Energy Information Administration (EIA)  

Gasoline and Diesel Fuel Update (EIA)

Markets & Finance Markets & Finance Glossary › FAQS › Overview Data Market Prices and Uncertainty Charts Archive Analysis & Projections Most Requested Electricity Financial Markets Financial Reporting System Working Papers Market Prices and Uncertainty Report What Drives Crude Oil Prices All Reports ‹ See All Markets & Finance Reports Performance Profiles of Major Energy Producers 2009 Release Date: February 25, 2010 | Next Release Date: December 2011 | Report Number: DOE/EIA-0206(2009) Companies Reporting to the Financial Reporting System, 1974-2009 Company 1974 to 1981 1982 1983 to 1984 1985 to 1986 1987 1988 1989 to 1990 1991 1992 to 1993 1994 to 1996 1997 1998 1999 2000 2001 2002 2003 to 2006 2007 2008 2009 Alenco, Inc. X X X


Word Pro - Untitled1  

U.S. Energy Information Administration (EIA) Indexed Site

5 5 Table 2.6 Household End Uses: Fuel Types, Appliances, and Electronics, Selected Years, 1978-2009 Appliance Year Change 1978 1979 1980 1981 1982 1984 1987 1990 1993 1997 2001 2005 2009 1980 to 2009 Total Households (millions) .......... 77 78 82 83 84 86 91 94 97 101 107 111 114 32 Percent of Households Space Heating - Main Fuel 1 Natural Gas .................................... 55 55 55 56 57 55 55 55 53 52 55 52 50 -5 Electricity 2 ...................................... 16 17 18 17 16 17 20 23 26 29 29 30 35 17 Liquefied Petroleum Gases ............ 4 5 5 4 5 5 5 5 5 5 5 5 5 0 Distillate Fuel Oil 3 .......................... 20 17 15 14 13 12 12 11 11 9 7 7 6 -9 Wood .............................................. 2 4 6 6 7 7 6 4 3 2 2 3 2 -4


Degradation of EBR-II driver fuel during wet storage  

DOE Green Energy (OSTI)

Characterization data are reported for sodium bonded EBR-II reactor fuel which had been stored underwater in containers since the 1981--1982 timeframe. Ten stainless steel storage containers, which had leaked water during storage due to improper sealing, were retrieved from the ICPP-603 storage basin at the Idaho National Engineering and Environmental Laboratory (INEEL) in Idaho. In the container chosen for detailed destructive analysis, the stainless steel cladding on the uranium alloy fuel had ruptured and fuel oxide sludge filled the bottom of the container. Headspace gas sampling determined that greater than 99% hydrogen was present. Cesium 137, which had leached out of the fuel during the aqueous corrosion process, dominated the radionuclide source term of the water. The metallic sodium from the fuel element bond had reacted with the water, forming a concentrated caustic solution of NaOH.

Pahl, R. G.



Comparative performance of solar heating systems in the national solar data network  

Science Conference Proceedings (OSTI)

This paper presents an overview of the National Solar Data Network (NSDN). The NSDN consists of instrumented solar energy systems in buildings selected as part of the National Solar Heating and Demonstration Program. For the past five years data has been obtained on a 24-hour basis. The purpose of the NSDN is to assist in the development of solar technologies for buildings by providing data and information on the effectiveness of particular solar technologies and the areas of improvement. This paper presents the most recent composite results of analysis performed by Vitro Laboratories of solar space heating data for active sites in the National Solar Data Network (NSDN). The results presented have been developed on the basis of analysis of instrumented sites maintained through the 1981-1982 heating season.

Rossi, S.M.



Integration of Molecular Networks in the Shoot Apical Meristem that Controls Floral Specification in Arabidopsis thaliana  

E-Print Network (OSTI)

lycopersicum_miR156b Solanum_lycopersicum_miR156c Sorghum_bicolor_miR156a Sorghum_bicolor_miR156b Sorghum_bicolor_miR156c Sorghum_

Lal, Shruti



Atliekinio fosfogipso panaudojimas sunki?j? metal? immobilizacijai nuotek? dumble ir dumblo-dirvoemio miiniuose.  

E-Print Network (OSTI)

??Nuotek? dumble esan?i? sunki?j? metal? neigiam? poveik? aplinkai bei mogaus sveikatai galima sumainti apribojant metal? judrum? aplinkoje. Magistro darbe tiriamas sunki?j? metal? judrumas ir j? (more)

Puodi?nas,; Marius



Creative Reconstruction in the City: An Analysis of Art, Shrinking, and the Story of the American Dream in Detroit, MI.  

E-Print Network (OSTI)

??A right to the city is a human right that is overlooked in American cities. Cities reflect humanity in collective form, but are manipulated by (more)

Marotta, Stephen J.



1996 Department of Energy pre-freshman enrichment program at GMI Engineering and Management Institute, Flint, MI  

SciTech Connect

This document reports on a summer program to encourage students to pursue scientific or engineering professions. The topics of the report include a description of the recruitment program, selection criteria for participants, workshops, nine follow up activities, research projects and student`s presentation, and field trips. Course descriptions and schedule are included as appendices.



I Volume 5, Number 2 Spring 1992 A Ne\\izsletter for the RLE Community at MI'T  

E-Print Network (OSTI)

:l XI:~ri:l Ticchi. Inq~tiriesmay he ;~ddrcsscdto: RLE undercurrents Rescarcli Lahor:ltory of Electrc

Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Volume 2, Number 2 June 1989 A Nelr-sletter for the KL,t.: Communitv at MI'1'  

E-Print Network (OSTI)

Lahoratory of Electrc~nicsfor the RLE community at MIT. The following individuals contributed their time ancl


Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 2002 Place Time Name Group Group  

E-Print Network (OSTI)

37 192 19:28.7 John Wool 40-49 men 48 193 19:32.4 Jaimin Wan page 7 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS 1st


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 1996 Dummy first body page  

E-Print Network (OSTI)

-59 59 668 34:20.7 Seung-yu Rah 30-39 157 669 34:21.4 John Wool 40-49 120 670 34:25.6 Manny Gonzalez 30:42.8 Pete Valerio HISTORY OF LBL RUNAROUND WINNERS


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 14, 1990 Place Time Name Group Group  

E-Print Network (OSTI)

:56.4 John Wool 30­39 105 483 30:00.0 David O'Neill ) Group Time Name Overall Place Place 1 24:24.3 John Magee 373 2 25:41.9 Edward Lofgren 400 HISTORY OF LBL


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 22, 1995 Dummy first body page  

E-Print Network (OSTI)

198 16:04.7 Alan Meier 40-49 30 199 16:05.7 John Wool 40-49 31 200 16:07.5 Ginny Lackner 50-59F 1 201 Don Krieger Frances Mann Peter Morley Bob Shilling HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 10, 1997 Place Time Name Group  

E-Print Network (OSTI)

Larnon, Frank 50-59 13 156 15:17.4 157 15:18.0 Bartholomew, J 50-59 14 158 15:18.4 Wool, John 40-49 18 159 15 Time Name Group Group Place HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 15, 1989 Envel. Time Name Group Group  

E-Print Network (OSTI)

40-49 8 67 12:51.4 Desiderio Kovar Wool 30-39 20 69 12:56.7 Antoine Mensch Envelope Place Number 1 21:59.8 John L. Magee 354 2 26:14.8 Ed Lofgren 427 HISTORY OF LBL RUNAROUND WINNERS


LBL RUNAROUND RESULTS 2.95 km (1.84 mi) September 16, 1988 Envelope Time Name Group Group  

E-Print Network (OSTI)

120 14:08.2 Z. Mei 30-39 26 121 14:09.5 John Wool 30-39 27 122 14:10.3 Timothy Edberg 30-39 28 123 14 Time Name Envelope Place Number 1 30:14.0 Peter Endt 447 HISTORY OF LBL RUNAROUND WINNERS Year Distance


LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 11, 1992 Place Time Name Group Group  

E-Print Network (OSTI)

14:26.2 Barry Freifeld Wool 30-39 39 122 14:28.2 Ken Woolfe 40-49 18 123 14 Williams HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS


I Volume 7, Number 2 Spring 1994 A Newsleccer for the RLE Communitv at MI'I'  

E-Print Network (OSTI)

Robert J. Birgeneau, Dean of the School of Science and a principal investigator in RLE's Surfaces has his blue belt in karate. Seventh grader Amanda's bowl~ngteam competed in the state finals


Corrosion mechanisms of low level vitrified radioactive waste in a loamy soil M.I. Ojovan1  

E-Print Network (OSTI)

Topic: Briefings by environmental groups, industry groups, pub- lic policy groups, and state, is the central authority responsi- ble for evaluating and supervising the nuclear industry's research and 1.95 meters in diameter. It is fabricated from forged steel with a stainless steel coating. The cask

Sheffield, University of


Informa(on and Resources Prac&ces for Mi&ga&ng Urban Pes&cide Runoff  

E-Print Network (OSTI)

. Producers can then use these records to analyze the effectiveness of past pesticide applications a documentation system for determining crop replant, rotation and #12;Pesticide Recordkeeping 2 prePI-20 Pesticide Recordkeeping 1 Michael Aerts, O. Norman Nesheim, and Frederick M. Fishel2 1

Hammock, Bruce D.


Microsoft Word - Sample Abstract and Format Instructions.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Dearborn, MI 48128, Wayne State University 2 , Department of Physics and Astronomy, Detroit, MI 48202, Kettering University 3 , Flint, MI 48504, University of Paris-Sud 4 ,...


Language Assimilation Today: Bilingualism Persists More Than in the Past, But English Still Dominates  

E-Print Network (OSTI)

Somerset- Hunterdon, NJ Detroit, MI Table 2 Childrens homeSomerset- Hunterdon, NJ Detroit, MI Bergen-Passaic, NJSomerset- Hunterdon, NJ Detroit, MI Appendix Table 2

Alba, Richard



Former Worker Program - Defunct Beryllium Vendor Screening Program  

NLE Websites -- All DOE Office Websites (Extended Search)

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Wolverine Tube Division (Detroit, MI); National Beryllia (Haskell, NJ);...


Beryllium Vender Screening Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Speedring Systems, Inc. (Detroit, MI); Wolverine Tube Division...


--No Title--  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Michigan Total Sum City, County, and SEO Allocations All 76,601,500 MI Michigan State Energy Office 19,599,600 MI Ann Arbor City 1,243,400 MI Battle Creek City 545,100...


Evaluation of the solar building, Albuquerque, New Mexico. Final report, April 1974-September 1978  

DOE Green Energy (OSTI)

During portions of the 1974-1975 and 1975-1976 winter heating seasons, a field evaluation was made of a solar-assisted heat pump heating system in a small commercial office building in Albuquerque, N.M. The system was comprised of one main water-to-water heat pump and five small water-to-air heat pumps. The liquid-type solar collector array had an area equivalent to about 10% of the building floor area. Other than the ethylene glycol/water solution circulated through the solar collector array, water was used in all parts of the system, including three thermal energy storage tanks. Considerable information concerning this project has been disseminated through conferences, workshops, technical papers at professional society meetings, reports to the federal government and Master of Science theses, all of which are referenced in this report. The work done on this project over the period of the contract is summarized and pertinent information concerning the building, the solar-assisted heat pump system, data acquisition aspects, results, and conclusions are included.

Gilman, S.F.



Wisconsin Natural Gas Summary  

Gasoline and Diesel Fuel Update (EIA)

Pipeline and Distribution Use Pipeline and Distribution Use 1967-2005 Citygate 8.04 8.71 6.70 6.14 5.65 4.88 1984-2012 Residential 12.02 12.81 10.76 10.34 9.77 9.27 1967-2012 Commercial 10.36 11.18 8.95 8.53 8.03 7.34 1967-2012 Industrial 9.62 10.57 7.82 7.56 7.05 5.81 1997-2012 Vehicle Fuel 9.21 11.01 7.19 7.84 6.10 5.71 1989-2012 Electric Power 7.56 9.24 4.83 5.43 4.91 3.27 1997-2012 Underground Storage (Million Cubic Feet) Injections 1973-1973 Withdrawals 1974-1975 Net Withdrawals 1973-1975 Liquefied Natural Gas Storage (Million Cubic Feet) Additions 148 130 80 63 107 33 1980-2012 Withdrawals 70 79 98 92 87 100 1980-2012 Net Withdrawals 78 51 -18 -29 20 -67 1980-2012 Consumption (Million Cubic Feet) Total Consumption 398,370 409,377 387,066 372,898 393,734 402,657 1997-2012

Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Non-traumatic Shoulder Dislocation  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, MI Supervising SectionFord Hospital, 2799 W. Grand Blvd, Detroit, MI 48201. Email

Manteuffel, Jacob



Whither the Keiretsu, Japan's Business Networks? How Were They Structured? What Did They Do? Why Are They Gone?  

E-Print Network (OSTI)

Construction Nippon Flour Mills Kirin Brewery Oji PaperSa Textile NIPPON FLOUR MILLS Mi Food TORAY INDUSTRIES Mi

Lincoln, James R.; Shimotani, Masahiro



Epigenetic Alterations in High and Low LET Radiation Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the unstable clones. Among these, altered miRNA expression could be validated by qRT-PCR for mmu-miR-466g, hsa-miR-30a and hsa- miR-195. Hsa-miR-30a and hsa-miR-195 were...



Science Conference Proceedings (OSTI)

The principal objective of the study was to test a new analytical technique, Solid-Phase Microextraction (SPME), for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. This involved measuring the effectiveness of SPME to extract hydrocarbons under controlled conditions in the laboratory. As part of the study, a field demonstration was undertaken to assess the validity and usefulness of the laboratory results. Presented in this quarterly report is the condensed version of the Case History and Well Summary for the Bear Lake area in Manistee County, Michigan. The full version will be in the annual report. The condensed case history presents the important technical details regarding the geochemistry and horizontal lateral for Bear Lake, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan




SciTech Connect

The geochemical sampling team collected additional 148 samples at Vernon Field along 5 new traverses. Most of the locations were sampled for three types of analyses: microbial, iodine and enzyme leach; no results from the second batch of samples were available in time for this report. In addition to the sampling, a study was begun on the feasibility of collecting and analyzing hydrocarbon gases (C1-C8) directly. Although several companies offer these services, the cost ($200-300/sample w/o sampling fee) is high, on par with the cost of a 3D seismic survey, and may not include the raw data. However direct sampling of reservoir gases collecting in the soil appear to offer the best approach and should be included in this study. It would probably work well at Vernon Field. It may be possible to lower costs considerably; initial estimates of $20/sample for GCMS (Gas Chromatography--mass spectrometry) analysis are attractive and might induce to Michigan producers to include soil surveys in their routine field work-ups. A complete set of digital data was assembled for Vernon Field and nearby locations. The set consists of well locations, formation top picks, lithologies and scanned images of driller's reports and scout tickets. Well logs are still being located. The annual meeting for the Class Revisit work group is tentatively scheduled for the week of March 1-7 in Tampa, Fl. By that time all of the geochemical data will be available and final decisions regarding drilling can be made.

James R. Wood; T.J. Bornhorst; S.D. Chittichk; William B. Harrison; W. Quinlan




SciTech Connect

A principal goal of the Budget Period I was to demonstrate that surface geochemistry could be used to locate bypassed hydrocarbons in old fields. This part of the program was successful. A surface geochemical survey, employing 5 different techniques, was carried out in the Spring and Summer of 2000 and a demonstration well, the State Vernon & Smock 13-23 HD1 (permit number: PN 53945) was drilled in Vernon Township, Isabella County, Michigan in the late fall of 2000. A demonstration well was selected and drilled based on geologic considerations and surface geochemistry. Over 460 soil samples were collected and analyzed over the drill site. A good anomaly was detected near the proposed well site and the demonstration well, the Smock 13-23, was drilled to a depth of 3157 feet by November 17, 2000. Two laterals were drilled, and hydrocarbons were located in a zone approximately 175 feet in length. However, it was determined that the pay zone was too small and difficult reservoir conditions (water production) prevented putting the well in production. The Smock 13-23 was shut in and abandoned January 15, 2001. A post-mortem determined that the main reason the well was not economic was because the zone was nearly completely flushed by earlier recovery operations. The post mortem also revealed the presence of an unmapped shale plug crossing the first lateral. It appears that this shale was detected by the geochemical survey, but its significance was not appreciated at the time. It is possible that sections of the well were faulty, ''porposing'' up and down so as to create water blockages. We are continuing to use the Vernon Field and the demonstration well to calibrate the geochemical data. Eventually, this study may provide a standard site that can be used to test and calibrate geochemical anomalies, something that does not presently exist. A postmortem report on the well, including the geology and geochemistry used to site the well, is presented in Appendix I. Five geochemical techniques have been tested in Phase I. These include surface iodine, microbial, enzyme leaching, soil gas and subsurface iodine. We are most comfortable with the results of the microbial surveys but feel that direct measurement of soil gas is the best method if analytical difficulties can be overcome. The reason the microbial surveys are presently favored is because they provide a logical, consistent picture that is easy to interpret and easy to explain. This in turn is because the microbial anomaly is manifested as an ''apical'' as opposed to an ''edge'' or ''halo'' anomaly. Several lessons were learned during Phase I activities. The main one was that surface geochemistry could locate anomalies over old fields such as Vernon. We also learned that horizontal drilling has advantages and disadvantages in situations such as this. On the plus side, it does provide a means to probe for pockets of bypassed oil, but it is expensive relative to vertical (or slant wells?) and is difficult to control in a narrow pay zone. We tentatively conclude that horizontal wells do not provide a cost-effective solution in this setting and suggest that geochemical anomalies be investigated via a single vertical well or multiple vertical wells.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan; E. Taylor




Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. A major part of the remaining project will focus on using surface geochemistry to delineate prospects. A Niagaran reef field geochemical survey, the Bagley Prospect area in Otsego County, Michigan is scheduled to take place this summer. Previous wells drilled in Bagley Prospect area in the early 1970's and in place in late 2002 and early 2003 resulted in discoveries and numerous hydrocarbon shows in the Brown Niagaran reservoir interval. The Bagley region is still considered an area of interest by the industry and appears ripe for a geochemical survey. Our industry partner is interested in a possible test in the Bagley prospect because subsurface geophysical and geological interpretation indicates the presence of structures. Anomalous production and pressure data further suggest the region is not yet well understood and should not be considered mature. The most recent well, the Bagley 1-22A sidetrack, was unsuccessful at locating a new reef culmination to the south of the original vertical well and did not encounter hydrocarbon shows. The sidetrack and well were plugged and abandoned. The proposed geochemical survey will concentrate on areas away from the Bagley 1-22A to the north and west but will include the entire prospect so that the existing data can be used in interpretations. Bagley appears to offer a unique combination of potential and data for a geochemical study that focuses on looking for new oil in an area that has exhausted traditional geologic and geophysical methods. The Bear Lake pinnacle reef trend in Manistee County, Michigan, is also scheduled for further geochemical work this summer. Industry interest, mostly by small companies, is picking up in this area and it is also ripe for targeted geochemical surveys for the same reasons cited above.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

One of the main objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, several field demonstrations were undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The important observations from each of these field demonstrations are briefly reviewed in this annual report. These demonstrations have been successful in identifying the presence or lack of hydrocarbons in the subsurface and can be summarized as follows: (1) The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path of the State Springdale & O'Driscoll No.16-16 horizontal demonstration well in Manistee County, Michigan. The well was put on production in December 2003. To date, the well is flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which is a good well in Michigan. Reserves have not been established yet. Two successful follow-up horizontal wells have also been drilled in the Springdale area. Additional geochemistry data will be collected in the Springdale area in 2004. (2) The surface geochemistry sampling in the Bear Lake demonstration site in Manistee County, Michigan was updated after the prospect was confirmed and production begun; the original subsurface and seismic interpretation used to guide the location of the geochemical survey for the Charlich Fauble re-entry was different than the interpretation used by the operator who ultimately drilled the well. As expected, the anomaly appears to be diminishing as the positive (apical) microbial anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. (3) The geochemical sampling program over the Vernon Field, Isabella County, Michigan is now interpreted as a large negative anomaly associated with the entire field. The results of the State Smock horizontal well and the Bowers 4-25 well confirmed the lack of additional recoverable hydrocarbons in the Vernon Field. (4) The surface geochemistry data showed a strong anomaly in the Myrtle Beach, Burke County, North Dakota area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the geological and geophysical data; the microbial values here were the highest we have observed. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling, however, a pipeline has not yet been completed that would allow the wells to be placed into production. We also present in this annual report the results of recent efforts to map carbonate facies tracts in the middle Devonian Dundee and Rogers City Limestones using gamma ray, bulk density, and photoelectric effect geophysical well log amplitudes. This work was undertaken to identify fairways for exploration in the Dundee and Rogers City where surface geochemical techniques could then be used to screen potential leads.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

Two major accomplishments resulted from Phase I. One is the success of the surface geochemistry program, which collected over 800 samples from the site of the 1st demonstration well in Vernon Field and has pretty well provided us with the tools to delineate favorable ground from unfavorable. The second is the recent detailed mapping of the Central Michigan Basin that for the first time revealed the presence of at least two major faults that control the location of many of the reservoirs in the Michigan Basin. These faults were located from structure maps obtained by contouring the surface of the Dundee Formation using top picks from 9861 wells in 14 counties. Faults were inferred where the contour lines were most dense (''stacked'').

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan




SciTech Connect

The fault study continues to find more faults and develop new techniques to visualize them. Data from the Dundee Formation has been used to document 11 major faults in the Michigan Basin which have now been verified using data from other horizons. These faults control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new GC laboratory is now functional and has been fully staffed as of December. The annual project review was held March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer. A request was made to extend the scope of the project to include the Willison Basin. A demonstration well has been suggested in Burke County, N. Dakota, following a review of 2D seismic and surface geochem. A 3D seismic survey is scheduled for the prospect.

James R. Wood; T.J. Bornhorst; William B. Harrison; W. Quinlan




SciTech Connect

In this reporting period, we extended the fault study to include more faults and developed new techniques to visualize the faults. We now have used data from the Dundee Formation to document 11 major faults in the Michigan Basin and are in the process of reviewing data from other horizons. These faults appear to control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new laboratory is now functional and has been fully staffed as of December. The annual project review has been set for March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan



Role of microRNA?155 in dendritic cells and macrophages MiR?155 directly targets PU.1 and IL13R1.  

E-Print Network (OSTI)

??In search of genes differentially expressed between M1 (pro?Th1 or pro?inflammatory) and M2 (pro?Th2 or pro?tolerogenic) macrophages, BIC (microRNA 155 hosting gene) was found up (more)

Martinez?Nunez, Rocio Teresa



1. (P) M.I. Ojovan, W.E. Lee. New Developments in Glassy Nuclear Wasteforms. Nova Science Publishers, New York, 131p. (2007).  

E-Print Network (OSTI)

xxx Keywords: A. Intermetallics, miscellaneous B. Phase diagrams B. Thermodynamic and thermochemical in the Vienna ab-initio simulation package (VASP) [27]. We used the generalized gradient approximation (GGA, Lamoreaux RH. Molybdenum: physicochemical properties of its compounds and alloys. I. thermochemical

Ojovan, Michael


Summary of the EPRI Early Event Analysis of the Fukushima Daiichi Spent Fuel Pools Following the March 11, 2011 Earthquake and Tsuna mi in Japan  

Science Conference Proceedings (OSTI)

Damage to the Fukushima Daiichi Unit 4 reactor building observed on March 15, 2011, initially generated confusion and concern throughout the nuclear industry. The reactor had been defueled approximately 100 days prior to the March 11 earthquake and tsunami; therefore, any explosion in Unit 4 could not be linked to a recently operating reactor within that unit. With the full core in the spent fuel pool, suspicions immediately turned to hydrogen generated by oxidation of overheating spent fuel cladding fol...



Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

converting any H 2 gas produced to water) and measuring thefor the tritium produced in pore water of the fractured rockfor the tritium produced in pore water of the fractured rock



LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 16, 1994 Place Time Name GroupGroup Place Time Name GroupGroup  

E-Print Network (OSTI)

-49 8 30 11:56.7 Dan Gheng Wool 40-49 1 89 13 of the participants. The official number of finishers was 780, including babies in strollers page 7 #12;HISTORY OF LBL



SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The main news this reporting period is the confirmed discovery of producing hydrocarbons at the State Springdale & O'Driscoll No.16-16 demonstration well in Manistee County. This well was spudded in late November, tested and put on production in December 2003. To date it is flowing nearly 100 barrels of liquid hydrocarbons per day, which is a good well in Michigan. Reserves have not been established yet. The surface geochemistry sampling at the Springdale demonstration site will be repeated this spring after the well has been on production for several months to see if the anomaly pattern changes. We expect that the anomaly will diminish as the original positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. This is the behavior that we observed at the Bear lake demonstration well reported last quarter.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

In this reporting period two main accomplishments stand out. The Springdale task is in play in the northern Michigan Basin and the geochemical survey work over the Springdale prospect continued to progress. We still need to characterize the play in terms of the type of trap (basal reef diagenetic (?)) and its relation to the well documented pinnacle reef play. Also, we have become aware that Capac Field in the southern reef trend (Figure 1) is a possible analog to Springdale and so will be looking more closely at the literature on that field, particularly the work by Bowers (1987). Future work is directed toward further defining the Springdale project via more wells and examination and characterization of well cuttings. One to two more geochemical surveys are planned, one this spring and a final one in early fall. Based on current oil prices and Springdale production as of January 2005, an ROI, (defined as Total liquids revenue, $5.45m/DOE support, $1.45m) better than 3.75. This does not include gas revenues, which have not yet been calculated.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

Three horizontal wells have been completed (St. Springdale & Trezil 9-15 HD, St. Springdale 13-14 HD, St. Springdale & Stedronsky 10-15 HD) and three more wells were spudded (St. Springdale & CSX 2-22 HD, St. Springdale & Mann 9-21 HD and St. Springdale 7-22 HD) in the Springdale play this past reporting period. All are horizontal wells in the Brown Niagaran. This brings the total wells in the play to 12 with seven wells contributing to a total daily production exceeding 350 bbls/day. Data from these wells has been converted from drillers logs (footage calls) and converted to Michigan GeoRef coordinates and plotted. The Gamma Ray data along the well bore was available since it was used to steer the tool during drilling and this data was superimposed on the well trajectories in an effort to help distinguish pay zones from unproductive rock. One new geochemical survey was conducted over the projected surface path of the State Springdale & Stedronsky 14-15 HD and a final project survey was planned over one of the unsurveyed wells. This will bring the total surveyed wells to five and should provide enough data to determine if the idea of only sampling along the well bore is a sound strategy.

James R. Wood; A. Wylie; W. Quinlan




Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, plans were finalized for additional surface geochemical sampling in the new Springdale Prospect field demonstration in Manistee County, Michigan. Plans were also developed to acquire additional surface geochemical data in the vicinity of the Bagley Prospect area in Otsego County, Michigan. The main news this reporting period is the continued success in the Springdale demonstration area. The State Springdale & O'Driscoll No.16-16 and the State Springdale & Herban 12-16 horizontal demonstration wells in Manistee County, Michigan are both flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which are good wells in Michigan. Reserves have not been established yet. A third horizontal well, the State Springdale & Wilburn 1-21 HD has been drilled and is waiting on completion. Two more horizontal wells have been permitted in the Springdale area by our industry partner.

James R. Wood; A. Wylie; W. Quinlan


Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Springdale prospect area in Manistee County, Michigan. The samples were taken along the trace of the proposed horizontal wells. The samples are presently being analyzed and the results will be reported in the next quarterly report. The main news this reporting period is that the Springdale prospect area in Manistee County, Michigan, continues to see drilling activity. Our industry partner, Jordan Development Company, LLC, is permitting additional horizontal wells following their success in the prospect area.

James R. Wood; A. Wylie; W. Quinlan




SciTech Connect

Presented in this quarterly report is the Case History and Well Summary for the Vernon Field demonstration project in Isabella County, Michigan. This new case history and well summary format organizes and presents the technical and historical details of the Vernon Field demonstration, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion. Planning for the annual project meeting in Tampa, Florida has begun. This meeting will be held March 7-9, 2003 at the same site as the last three meetings. The goals of this project were to: (1) test the use of multi-lateral wells to recover bypassed hydrocarbons and (2) to access the potential of using surface geochemistry to reduce drilling risk. Two new demonstration wells, the State-Smock and the Bowers 4-25, were drilled to test the Dundee Formation at Vernon Field for bypassed oil. Neither well was commercial, although both produced hydrocarbon shows. An extensive geochemical survey in the vicinity of Vernon Field, covering much of Isabella County, has produced a base map for interpretation of anomalies in Michigan. Several potential new anomalies were discovered that could be further investigated.

James R. Wood; W. Quinlan




SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The surface geochemistry sampling at the original Bear Lake demonstration site was updated several months after the prospect was confirmed and production begun. As expected, the anomaly appears to be diminishing as the positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir.

James R. Wood; W. Quinlan



Functional miRNA regulation of metastatic genes promotes tumor cell dissemination in non-small cell and small cell lung carcinomas  

E-Print Network (OSTI)

Tumor progression, from initiation to advanced metastatic disease, requires the orchestration of a diverse group of cell-intrinsic and extrinsic factors. This multifactorial disease is promoted by an accumulation of genetic ...

Blat, Irene Catherine



Energetics of gas-driven limnic and volcanic eruptions Department of Geological Sciences, The University of Michigan, Ann Arbor, MI 48109-1063, USA  

E-Print Network (OSTI)

and when equilibrium is reached between the gas and liquid phases Natural silicate melts often contain two.3. Dynamics of reversible gas-driven eruptions through a fluid medium Because buoyancy plays an important roleEnergetics of gas-driven limnic and volcanic eruptions Y. Zhang* Department of Geological Sciences

Zhang, Youxue


Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

from three different sources (fractured rock, concrete, and+Rock Concentration, no Decay, Rock Source Concentration,Decay, Rock Source Mass Storage, no Decay, Rock Source Mass



50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale


Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

nontritium-bearing drilling fluid during the coring process,nontritium-bearing drilling fluid during the coring process,cores be drilled with drilling fluid spiked with a tracer.




SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, a field demonstration was undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a strong anomaly in the Myrtle Beach area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the 3D seismic data. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling. Presented in this quarterly report is the Case History and Well Summary for the Myrtle Beach area in Burke County, North Dakota. This case history presents the important technical details regarding the geochemistry and the two vertical wells that are part of this field demonstration, and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and is being used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan



AND FINANCIAL 2011 Edition | EConoMiC And FinAnCiAL PRoFiLE oF QUBEC  

E-Print Network (OSTI)

ENERGY AGENCY. SOURCE: HYDRO-QU?BEC, COMPARISON OF ELECTRICITY PRICES IN MAJOR NORTH AMERICAN CITIES renewable energy, hydro-electricity in particular. It supports the development of wind power through its Energy Strategy 2006-2015, Hydro-Québec is actively pursuing development of Québec's hydroelectric

Rosei, Federico



SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Trusty Steed prospect area in Grand Traverse County, Michigan. The samples were analyzed using the Microbial Oil Surveying Technique (MOST) technique and revealed only a local (1-point) anomaly. A decision to resample over that point is pending, but drilling has been postponed for the time being. The main news this reporting period is that in the Bear Lake area, northwest Michigan, Federated Oil & Gas Properties' Charlich-Fauble 2-9HD horizontal lateral, has cumulative production of more than 72,000 barrels of oil and is still producing 50 to 75 bopd from a Silurian Niagaran reef reservoir eighteen months after the well was completed. Surface geochemical surveys conducted in the demonstration area were consistent with production results although the ultimate decision to drill was based on interpretation of conventional subsurface and 2D seismic data. The surface geochemical techniques employed were Solid Phase MicroExtraction (SPME) and MOST. The geochemical results have been submitted to World Oil for publication. New geochemical surveys are planned for November in the Springdale quadrangle in Manistee County, Michigan. These surveys will concentrate on sampling over the trace of the proposed horizontal wells rather than a broad grid survey.

James R. Wood; A. Wylie; W. Quinlan



Recent Trends in Crude Oil Stock Levels  

Gasoline and Diesel Fuel Update (EIA)

J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J J 0 280 300 320 340 360 380 400 420 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 Average Range: 1993-1995 Recent Trends in Crude Oil Stock Levels by Aileen A. Bohn Energy Information Administration (EIA) data for March 1996 primary inventories of crude oil were the lowest recorded in almost 20 years. Crude oil inventories, which were generally on a downward trend since the beginning of 1995, fell below the average range in July 1995 and have yet to recover (Figure FE1). On September 27, 1996, crude oil stocks registered 303 million barrels, compared to a normal range of nearly 311 to 332 million barrels for September. 1 Low crude oil inventories can cause price volatility in crude oil markets. 2 When inventories are low, refiners resort to


Buildings Energy Data Book: 2.7 Industrialized Housing (IH)  

Buildings Energy Data Book (EERE)

6 6 1980-2009 Manufactured Home Shipments, Estimated Retail Sales and Average Sales Prices Year 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 Note(s): Source(s): Estimated Average Sales Price (2010$) Manufactured Home Retail Sales Shipments (2010$ Million) Single Section Multi-Section 238,808 9,396 $34,349 $56,715 295,079 11,905 $33,811 $58,592 221,091 10,146 $37,079 $66,046 240,313 10,133 $35,385 $61,872 244,660 9,635 $31,297 $54,154 232,598 9,420 $31,439 $55,360 294,993 11,742 $32,772 $56,287 283,489 11,106 $31,989 $54,093 188,172 8,017 $30,347 $56,095 170,713 7,000 $29,456 $54,619 218,429 9,057 $30,726 $55,505 198,254 8,585 $31,199 $56,827 303,932 13,220 $32,558 $58,189 339,601 15,302 $35,015 $60,530 210,787 8,655 $29,786 $53,787 254,276 10,971


Slide 1  

U.S. Energy Information Administration (EIA) Indexed Site

Investing in Oil and Natural Gas Investing in Oil and Natural Gas Opportunities and Barriers EIA Energy Conference April 8, 2009 Bruce Bawks Energy Information Administration Expenditures for Exploration, Development, and Production Tend to Follow Changes in Crude Oil Prices 0 20 40 60 80 100 120 140 160 180 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 Billion 2007 Dollars (bars) 0 10 20 30 40 50 60 70 80 2007 Dollars per Barrel (line) Crude Oil Price (right) Expenditures for Exploration, Development, and Production (left) 0 300 600 900 1200 1500 1800 3 / 2 1 / 0 8 4 / 2 1 / 0 8 5 / 2 1 / 0 8 6 / 2 1 / 0 8 7 / 2 1 / 0 8 8 / 2 1 / 0 8 9 / 2 1 / 0 8 1 0 / 2 1 / 0 8 1 1 / 2 1 / 0 8 1 2 / 2 1 / 0 8 1 / 2 1 / 0 9 2 / 2 1 / 0 9 3 / 2 1 / 0 9 Number of Rigs U.S. Rig Counts Have Declined Substantially in the Past Few Months Natural Gas Oil Source: Baker Hughes Inc.


Word Pro - Untitled1  

U.S. Energy Information Administration (EIA) Indexed Site

1 1 Table 2.4 Household 1 Energy Consumption by Census Region, Selected Years, 1978-2009 (Quadrillion Btu, Except as Noted) Census Region 2 1978 1979 1980 1981 1982 1984 1987 1990 1993 1997 2001 2005 2009 United States Total (does not include wood) ...... 10.56 9.74 9.32 9.29 8.58 9.04 9.13 9.22 10.01 10.25 9.86 10.55 10.18 Natural Gas ........................................................ 5.58 5.31 4.97 5.27 4.74 4.98 4.83 4.86 5.27 5.28 4.84 4.79 4.69 Electricity 3 .......................................................... 2.47 2.42 2.48 2.42 2.35 2.48 2.76 3.03 3.28 3.54 3.89 4.35 4.39 Distillate Fuel Oil and Kerosene ......................... 2.19 1.71 1.52 1.28 1.20 1.26 1.22 1.04 1.07 1.07 .75 .88 .61 Liquefied Petroleum Gases ................................ .33 .31 .35 .31 .29 .31 .32 .28


Natural Gas Processed  

U.S. Energy Information Administration (EIA) Indexed Site

Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011 2012 View History U.S. 15,663,381 15,316,804 15,904,517 16,267,757 16,566,883 17,538,026 1967-2012 Alabama 257,443 253,028 248,232 242,444 1969-2010 Alaska 2,965,956 2,901,760 2,830,034 2,731,803 2,721,396 2,788,997 1969-2012 Arkansas 11,532 6,531 2,352 9,599 5,611 6,872 1967-2012 California 206,239 195,272 198,213 204,327 180,648 169,203 1967-2012 Colorado 888,705 1,029,641 1,233,260 1,434,003 1967-2010 Florida 2,422 300 1967-2008 Illinois 235 233 164 5,393 15,727 0 1967-2012 Indiana 1981-1982 Kansas 391,022 397,587 370,670 341,778 1967-2010


Natural Gas Processed  

U.S. Energy Information Administration (EIA) Indexed Site

Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011 2012 View History U.S. 15,663,381 15,316,804 15,904,517 16,267,757 16,566,883 17,538,026 1967-2012 Alabama 257,443 253,028 248,232 242,444 1969-2010 Alaska 2,965,956 2,901,760 2,830,034 2,731,803 2,721,396 2,788,997 1969-2012 Arkansas 11,532 6,531 2,352 9,599 5,611 6,872 1967-2012 California 206,239 195,272 198,213 204,327 180,648 169,203 1967-2012 Colorado 888,705 1,029,641 1,233,260 1,434,003 1967-2010 Florida 2,422 300 1967-2008 Illinois 235 233 164 5,393 15,727 0 1967-2012 Indiana 1981-1982 Kansas 391,022 397,587 370,670 341,778 1967-2010


Epigenetic Alterations in High and Low LET Radiation Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the unstable clones. Among these, altered miRNA expression could be validated by qRT-PCR for mmu-miR-466g, hsa-miR-30a and hsamiR- 195. Hsa-miR-30a and hsa-miR-195 were...


,"Michigan Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050MI3","N3010MI3","N3020MI3","N3035MI3","N3045MI3" "Date","Natural Gas Citygate Price in Michigan (Dollars per Thousand Cubic Feet)","Michigan Price of...


Withdrawals of Natural Gas from Underground Storage - All Operators  

Gasoline and Diesel Fuel Update (EIA)

3,325,013 3,374,338 2,966,180 3,274,385 3,074,251 2,818,148 3,325,013 3,374,338 2,966,180 3,274,385 3,074,251 2,818,148 1944-2012 Lower 48 States 3,074,251 2,818,148 2011-2012 Alabama 19,868 26,756 23,298 16,740 15,408 23,651 1968-2012 Arkansas 5,417 5,585 4,868 4,368 4,409 2,960 1967-2012 California 218,155 214,643 185,198 203,653 242,477 170,586 1967-2012 Colorado 37,986 36,894 42,419 45,010 48,341 56,525 1967-2012 Connecticut 1973-1996 Delaware 1967-1975 Georgia 1974-1975 Illinois 251,122 259,827 247,957 245,135 257,504 250,955 1967-2012 Indiana 25,105 22,911 22,218 22,454 21,463 20,975 1967-2012 Iowa 72,779 67,748 74,151 78,444 73,538 77,291 1967-2012 Kansas 128,754 101,056 106,091 121,737 99,527 105,376 1967-2012 Kentucky 76,122 82,197 67,034 87,326 64,822 66,464 1967-2012

Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Withdrawals of Natural Gas from Underground Storage - All Operators  

U.S. Energy Information Administration (EIA) Indexed Site

3,325,013 3,374,338 2,966,180 3,274,385 3,074,251 2,818,148 3,325,013 3,374,338 2,966,180 3,274,385 3,074,251 2,818,148 1944-2012 Lower 48 States 3,074,251 2,818,148 2011-2012 Alabama 19,868 26,756 23,298 16,740 15,408 23,651 1968-2012 Arkansas 5,417 5,585 4,868 4,368 4,409 2,960 1967-2012 California 218,155 214,643 185,198 203,653 242,477 170,586 1967-2012 Colorado 37,986 36,894 42,419 45,010 48,341 56,525 1967-2012 Connecticut 1973-1996 Delaware 1967-1975 Georgia 1974-1975 Illinois 251,122 259,827 247,957 245,135 257,504 250,955 1967-2012 Indiana 25,105 22,911 22,218 22,454 21,463 20,975 1967-2012 Iowa 72,779 67,748 74,151 78,444 73,538 77,291 1967-2012 Kansas 128,754 101,056 106,091 121,737 99,527 105,376 1967-2012 Kentucky 76,122 82,197 67,034 87,326 64,822 66,464 1967-2012



Gasoline and Diesel Fuel Update (EIA)

1 1 Energy Information Administration / Historical Natural Gas Annual 1930 Through 2000 26. Average Price of Natural Gas Delivered to U.S. Residential Consumers by State, 1967-1994 (Dollars per Thousand Cubic Feet) Table State 1967 1968 1969 1970 1971 1972 1973 1974 1975 1976 Alabama.............. 1.13 1.10 1.09 1.13 1.19 1.27 1.37 1.55 1.57 1.99 Alaska ................. 1.51 1.52 1.52 1.52 1.53 1.55 1.57 1.58 1.63 1.65 Arizona................ 0.96 0.97 1.04 1.20 1.23 1.24 1.37 1.50 1.53 2.12 Arkansas ............. 0.72 0.70 0.71 0.75 0.79 0.83 0.87 1.06 1.12 1.23 California............. 0.93 0.93 0.93 0.99 1.03 1.08 1.16 1.38 1.57 1.77 Colorado ............. 0.66 0.68 0.69 0.72 0.75 0.78 0.83 1.00 1.16 1.27 Connecticut ......... 1.83 1.81 1.82 1.91 2.07 2.09 2.25 2.79 3.29 3.41 D.C...................... a a a a a a a a a a -- Delaware............. 1.60 1.59 1.50 1.58 1.63 1.71 1.85 2.11


Applications in the Nuclear Industry for Thermal Spray Amorphous Metal and Ceramic Coatings  

E-Print Network (OSTI)

Science & Technology 2007, Detroit, MI, Sept. 16 20, 2007,2007, Sept. 1620, 2007, Detroit, MI, American CeramicExhib. , Sept. 1620, 2007, Detroit, MI, American Ceramic

Blink, J.; Farmer, J.; Choi, J.; Saw, C.




NLE Websites -- All DOE Office Websites (Extended Search)

Vehicle Usage Number of trips 773,602 Total distance traveled (mi) 5,558,155 Avg trip distance (mi) 7.2 Avg distance traveled per day when the vehicle was driven (mi) 30.2 Avg...


Computational Enhancements in Low-Rank Semidefinite ...  

E-Print Network (OSTI)

Jul 12, 2004 ... curvature condition necessary for L-BFGS, to be more efficient than the WP linesearch if the ... The precise condition ..... (Mi D)Mi, Mi := AiR.


Tradeoffs between Costs and Greenhouse Gas Emissions in the Design of Urban Transit Systems  

E-Print Network (OSTI)

mi) Maintenance emissions (g/veh-mi) Total emissions (g/veh-mi) Total emissions (g/veh-km) Comments 15,300 Based onfrom Chester (2008); emissions from EIO-LCA (CMU 2012) 1,841

Griswold, Julia Baird



Energy Information Administration/Oil and Gas Field Code ...  

U.S. Energy Information Administration (EIA)

mississippi union 01-26n-9w grand traverse mi 055 003557 n 1969 union 02-26n-9w grand traverse mi 055 006252 n 1973 union 03-26n-9w grand traverse mi ...


Service/Product Provider  

NLE Websites -- All DOE Office Websites (Extended Search)

816 Maple St. 738 E. Gull Lake Dr. Three Rivers, MI 49093 Augusta, MI 49012 Business: Steam, air & hot water systems Business: Pharmaceutical manufacturing Tom Henry, Director of...


Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

experiments with approximately 25 hours and 51 minutes of luminosity - NuMI off due to power supply - MI transformer replaced Monday evening - Store established Tuesday morning...


Subsidized Housing and Neighborhood Change  

E-Print Network (OSTI)

97 Figure 3-6a Detroit, MI PMSA Neighborhood Quintile98 Figure 3-6b Detroit, MI PMSA Neighborhood Quintileinterviewing from the Detroit Area Study. Neighborhood

Wilson, Florence Louise



DOE - Office of Legacy Management -- General Motors Co - Flint...  

Office of Legacy Management (LM)

Motors Co - Flint - MI 07 FUSRAP Considered Sites Site: GENERAL MOTORS CO. (MI.07 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate...


E Pluribus...Separation: Deepening Double Segregation for More Students  

E-Print Network (OSTI)

TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-

Orfield, Gary; Kucsera, John; Siegel-Hawley, Genevieve



NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Clean Energy Coalition - Michigan Green Fleets This CX form is for installing propane refueling infrastructure at one site in MI. This CX is for project selected under...



Science Conference Proceedings (OSTI)

...Tim Webber, IPG Photonics, Oxford, MA Frank Brennan, Trumpf, Plymouth, MI Rainer Uhlig, ABB, Fort Collins, CO Jim Cann, Rofin Sinar, Plymouth, MI Urban Widén, Permanova, Mölndal, Sweden Robert Borgstrom, Precitec, New Hudson, MI Scott Green, LT Ultra, New Hudson, MI Mike...


Supporting Information Evolution of Dendritic Platinum Nanosheets  

E-Print Network (OSTI)

87131. 3 Toyota Technical Center, Toyota Motor Engineering & Manufacturing North America, Ann Arbor, MI

Shelnutt, John A.


Civil Works Fact Sheets  

E-Print Network (OSTI)

HAMILTON DAM, FLINT RIVER, FLINT, MI ............................................ LRD-19 HOLES CREEK, WEST

US Army Corps of Engineers


Microsoft Word - S03623_2007AnnRep_091007.doc  

Office of Legacy Management (LM)

Precipitation and Snowpack Data Precipitation and Snowpack Data This page intentionally left blank Page G-3 Table G-1. Precipitation in Inches; National Weather Service, Monticello Station Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec Calendar Year Total Calendar Year Water Year Water Year Total 1977 0.88 0.21 0.47 0.12 1.02 0.08 2.99 2.53 0.77 0.81 0.53 0.43 10.84 1977 1978 13 1978 3.73 2.22 1.91 1.38 0.84 0.13 0.38 0.2 0.44 1.04 4.32 4.79 21.38 1978 1979 24.32 1979 4.52 2.18 2.23 0.31 2.96 0.94 0.31 0.66 0.06 0.63 1.55 1.75 18.1 1979 1980 20.91 1980 6.25 3.07 1.33 1.42 1.57 0 0.6 0.69 2.05 1.28 0.49 0.32 19.07 1980 1981 15.71 1981 0.03 0.34 2.44 1.43 1.01 0.87 3.98 1.87 1.65 3.17 1.14 0.29 18.22 1981 1982 18.34 1982 1.76 0.52 1.66 0.08 0.88 0.08 0.84 4.26 3.66 1.55 3.66 2.49 21.44 1982 1983 23.06


Buildings Energy Data Book: 3.3 Commercial Sector Expenditures  

Buildings Energy Data Book (EERE)

3.3 Commercial Sector Expenditures 3.3 Commercial Sector Expenditures March 2012 3.3.3 Commercial Buildings Aggregate Energy Expenditures, by Year and Major Fuel Type ($2010 Billion) (1) Electricity Natural Gas Petroleum (2) Total 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 2021 2022 2023 2024 2025 2026 2027 2028 2029 148.6 37.0 17.0 202.6 148.9 37.2 17.1 203.2 145.9 36.2 16.7 198.9 147.5 36.8 16.9 201.2 143.8 35.1 16.4 195.2 145.0 35.5 16.6 197.0 141.1 34.0 16.0 191.1 142.5 34.6 16.2 193.3 136.9 32.1 15.7 184.8 139.1 33.0 15.9 188.0 133.5 31.0 15.4 179.9 135.0 31.6 15.6 182.2 131.0 29.7 15.1 175.8 131.9 30.3 15.3 177.5 128.1 28.7 14.5 171.3 130.0 29.3 15.0 174.4 129.4 29.7 15.4 174.5 127.7 29.2 13.8 170.7 134.8 29.9 14.5 179.2 134.5 28.5 16.9 180.0 141.1


Buildings Energy Data Book: 2.3 Residential Sector Expenditures  

Buildings Energy Data Book (EERE)

9 9 Average Annual Energy Expenditures per Household, by Year ($2010) Year 1980 1,991 1981 1,981 1982 2,058 1983 2,082 1984 2,067 1985 2,012 1986 1,898 1987 1,846 1988 1,849 1989 1,848 1990 1,785 1991 1,784 1992 1,729 1993 1,797 1994 1,772 1995 1,727 1996 1,800 1997 1,761 1998 1,676 1999 1,659 2000 1,824 2001 1,900 2002 1,830 2003 1,978 2004 2,018 2005 2,175 2006 2,184 2007 2,230 2008 2,347 2009 2,173 2010 2,201 2011 2,185 2012 2,123 2013 2,056 2014 2,032 2015 2,030 2016 2,007 2017 1,992 2018 1,982 2019 1,973 2020 1,963 2021 1,961 2022 1,964 2023 1,962 2024 1,959 2025 1,957 2026 1,959 2027 1,960 2028 1,953 2029 1,938 2030 1,932 2031 1,937 2032 1,946 2033 1,956 2034 1,967 2035 1,978 Source(s): Average Expenditure EIA, State Energy Data 2009: Prices and Expenditures, Jun. 2011 for 1980-2009; EIA, Annual Energy Outlook 2012 Early Release, Jan. 2012, Table A2, p. 3-


Low-cost energy conserving zip-up curtains  

Science Conference Proceedings (OSTI)

We originally estimated that sealed fabric curtains would be capable of saving 5% of the heat lost by windows. At the conclusion of our tests it was apparent that they were significantly more effective; and in fact, performed at a level more akin to double glazing by reducing window energy consumption by 20%. Zip-up curtains conserve energy by increasing the effective R-value of the windows they cover during the night while allowing beneficial solar gain during the day. According to the National Bureau of Standards, windows cause 5% of the Nation's energy losses. If zip-up curtains were adopted universally in the United States, they could save 20% of the the 5%, thereby reducing the Nation's energy losses 1%. The results of tests conducted on the zip-up curtains during the winter of 1981-1982 showed significant insulating value. In those tests, employment of the sealed fabric curtains showed an increase in window R-value to 1.77 from the 0.9 of single-glazed windows, nearly halving the energy loss. Many buildings have adopted double-glazing as a means of reducing energy use. When zip-up curtains are used on double-glazed windows, the R-value is increased by less than when they are used on single-glazed windows. The R-value for double glazed windows is 2.00 and when zip-up curtains are added, this is increased by 30% to 2.87 as compared to the almost 50% increase with single glazing. Therefore, it is necessary to take this into account in determining the national or regional impact of adoption of sealed-fabric curtains. 29 figures, 4 tables.

Wehrli, R.


Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


MicroRNA expression in canine mammary cancer  

E-Print Network (OSTI)

MicroRNAs (miRNAs) play a vital role in differentiation, proliferation and tumorigenesis by binding to messenger RNAs (mRNA) and inhibiting translation. To initiate an investigation into the identification of miRNAs in the domestic dog, an emerging model for human disease, a comparison of the human and canine genetic databases was conducted. The bioinformatics work revealed significant conservation of miRNA genes between the two species. Proof of principle experiments, including serial dilutions and sequencing, were performed to verify that primers made to amplify human mature miRNAs can be used to amplify canine miRNAs, providing that the mature sequences are conserved. TaqMan Real-time RT-PCR, a sensitive and specific method, was used to isolate the first miRNA mature products from canine tissues. The expression levels of miR-17-3p, miR-17-5p, miR-18, miR-19a, miR-19b, miR-20, and miR-92 were evaluated in five canine tissues (heart, lung, brain, kidney, and liver). Because miRNAs have been found to act as both tumor suppressors and oncogenes in several different cancers, expression patterns of ten miRNAs (miR-15a, miR-16, miR-17-5p, miR-21, miR-29b, miR-125b, miR-145, miR-155, miR-181b, let-7f) known to be associated with human breast cancer were compared between malignant canine mammary tumors (n=6) and normal canine mammary tissue (n=10). Resulting data revealed miR-29b and miR-21 to have a statistically significant (p<0.05) up-regulation in cancerous samples. Overall expression patterns showed nine of the ten miRNAs follow the same pattern of expression in the domestic dog as the human, while the miR-145 expression does not show a difference between the normal and cancerous samples.

Boggs, Rene' Michelle




NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Overall AC electrical energy consumption (AC Wh/mi)¹ 45 Overall DC electrical energy consumption (DC Wh/mi)² 22 Total number of trips 1,585 Total distance traveled (mi) 14,910 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 34 DC electrical energy consumption (DC Wh/mi) 49 Number of trips 883 Percent of trips city | highway 81% | 19% Distance traveled (mi) 4,778 Percent of total distance traveled 32%



NLE Websites -- All DOE Office Websites (Extended Search)

4 4 Overall AC electrical energy consumption (AC Wh/mi)¹ 64 Overall DC electrical energy consumption (DC Wh/mi)² 31 Total number of trips 831 Total distance traveled (mi) 7,559 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 35 DC electrical energy consumption (DC Wh/mi) 54 Number of trips 541 Percent of trips city | highway 79% | 21% Distance traveled (mi) 3,402 Percent of total distance traveled 45%


IL-1 beta and TNF-alpha upregulate angiotensin II type 1 (AT(1)) receptors on cardiac fibroblasts and are associated with increased AT(1) density in the post-MI heart  

E-Print Network (OSTI)

broblasts and the infarcted heart. Am J Physiol 1998;274:matrix remodeling in heart failure: a role for de novoin right and left heart after myocardial infarction. Mol

Gurantz, D; Cowling, R T; Varki, N; Frikovsky, E; Moore, C D; Greenberg, Barry H




E-Print Network (OSTI)

doxycycline make a difference? Maybe, but here was the catch: To slow IMHA's destruction of red blood cells- tion. How to get out of this catch-22? Start the doxycycline but "contin- ue to treat the IMHA because

Tufts University


A Kallikrein 15 (KLK15) single nucleotide polymorphism located close to a novel exon shows evidence of association with poor ovarian cancer survival  

E-Print Network (OSTI)

of the UTR and splice site SNPs. Analysis for putative microRNA (miRNA) sites was performed using miRBase Targets V4, Target scan, miRanda, PicTar and Patrocles. Cell culture, RT PCR and sequencing of KLK15 putative promoter region The normal ovarian cell... intronic SNPs located within 30 bp of exon- intron boundaries. We also predicted miRNA binding sites using three different software programs; Target Scan, miRanda and Patrocles. A maximum of 32 miRNA bind- ing sites scattered throughout the gene were...

Batra, Jyotsna; Nagle, Christina M; O'Mara, Tracy; Higgins, Melanie; Dong, Ying; Tan, Olivia L; Lose, Felicity; Skeie, Lene Marie; Srinivasan, Srilakshmi; Bolton, Kelly L; Song, Honglin; Ramus, Susan J; Gayther, Simon A; Pharoah, Paul D P; Kedda, Mary-Anne; Spurdle, Amanda B; Clements, Judith A




NLE Websites -- All DOE Office Websites (Extended Search)

74 74 Number of trips 399 Distance traveled (mi) 148 Percent of total distance traveled (%) 73% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 6.3 Average Stops per mile 35.5 Percent of Regen Braking Energy Recovery (%) 11% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 423 Number of trips 27 Distance traveled (mi) 54 Percent of total distance traveled (%) 27% Average Trip Distance (mi) 2.0 Average Driving Speed (mph) 20.7 Average Stops per mile 3.5 Percent of Regen Braking Energy Recovery (%) 15% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 0 Number of trips 0 Distance traveled (mi) 0 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.0 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

5 5 Overall AC electrical energy consumption (AC Wh/mi)¹ 111 Overall DC electrical energy consumption (DC Wh/mi)² 71 Overall DC electrical energy captured from regenerative braking (DC Wh/mi) 61 Total number of trips 1,135 Total distance traveled (mi) 4,408 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 22 DC electrical energy consumption (DC Wh/mi) 296 Number of trips 264 Percent of trips city | highway 100% | 0% Distance traveled (mi) 781 Percent of total distance traveled 18% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 19 DC electrical energy consumption (DC Wh/mi) 141 Number of trips 44 Percent of trips city | highway 96% | 4% Distance traveled CD | CS (mi) 333 | 389 Percent of total distance traveled CD | CS



NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 493 Distance traveled (mi) 189 Percent of total distance traveled (%) 38% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 4.9 Average Stops per mile 28.7 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 377 Number of trips 67 Distance traveled (mi) 275 Percent of total distance traveled (%) 56% Average Trip Distance (mi) 4.1 Average Driving Speed (mph) 17.9 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 438 Number of trips 1 Distance traveled (mi) 29 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 28.7 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

505 505 Number of trips 601 Distance traveled (mi) 245 Percent of total distance traveled (%) 62% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.4 Average Stops per mile 34.8 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 373 Number of trips 35 Distance traveled (mi) 124 Percent of total distance traveled (%) 31% Average Trip Distance (mi) 3.5 Average Driving Speed (mph) 23.0 Average Stops per mile 3.7 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 319 Number of trips 3 Distance traveled (mi) 25 Percent of total distance traveled (%) 6% Average Trip Distance (mi) 8.5 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

1 1 Overall AC electrical energy consumption (AC Wh/mi)¹ 93 Overall DC electrical energy consumption (DC Wh/mi)² 71 Overall DC electrical energy captured from regenerative braking (DC Wh/mi) 40 Total number of trips 11,047 Total distance traveled (mi) 119,879 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 25 DC electrical energy consumption (DC Wh/mi) 208 Number of trips 4,491 Percent of trips city | highway 92% | 8% Distance traveled (mi) 30,376 Percent of total distance traveled 25% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 22 DC electrical energy consumption (DC Wh/mi) 71 Number of trips 1,352 Percent of trips city | highway 69% | 31% Distance traveled CD | CS (mi) 12,772 | 20,001 Percent of total distance traveled CD | CS



NLE Websites -- All DOE Office Websites (Extended Search)

613 613 Number of trips 89 Distance traveled (mi) 9 Percent of total distance traveled (%) 30% Average Trip Distance (mi) 0.1 Average Driving Speed (mph) 7.0 Average Stops per mile 44.5 Percent of Regen Braking Energy Recovery (%) 9% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 8 Distance traveled (mi) 5 Percent of total distance traveled (%) 16% Average Trip Distance (mi) 0.6 Average Driving Speed (mph) 25.0 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 6% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 487 Number of trips 7 Distance traveled (mi) 16 Percent of total distance traveled (%) 54% Average Trip Distance (mi) 2.3 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Number of trips 1,610 Distance traveled (mi) 372 Percent of total distance traveled (%) 72% Average Trip Distance (mi) 0.2 Average Driving Speed (mph) 5.2 Average Stops per mile 32.1 Percent of Regen Braking Energy Recovery (%) 13% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 383 Number of trips 114 Distance traveled (mi) 144 Percent of total distance traveled (%) 28% Average Trip Distance (mi) 1.3 Average Driving Speed (mph) 18.3 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 16% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 549 Number of trips 5 Distance traveled (mi) 2 Percent of total distance traveled (%) 0% Average Trip Distance (mi) 0.4 Average Driving Speed (mph)



NLE Websites -- All DOE Office Websites (Extended Search)

530 530 Number of trips 1,308 Distance traveled (mi) 495 Percent of total distance traveled (%) 69% Average Trip Distance (mi) 0.4 Average Driving Speed (mph) 5.6 Average Stops per mile 31.4 Percent of Regen Braking Energy Recovery (%) 15% City Trips ( < 5 stops/mile & <37 mph avg) DC electrical energy consumption (DC Wh/mi) 471 Number of trips 91 Distance traveled (mi) 175 Percent of total distance traveled (%) 24% Average Trip Distance (mi) 1.9 Average Driving Speed (mph) 16.6 Average Stops per mile 3.8 Percent of Regen Braking Energy Recovery (%) 13% Highway Trips ( 37 mph avg) DC electrical energy consumption (DC Wh/mi) 357 Number of trips 2 Distance traveled (mi) 49 Percent of total distance traveled (%) 7% Average Trip Distance (mi) 24.7 Average Driving Speed (mph)


Computational and experimental analysis of plant microRNAs  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are small, endogenous, non-coding RNAs that mediate gene regulation in plants and animals. We demonstrated that Arabidopsis thaliana miRNAs are highly complementary (0-3 mispairs in an ungapped alignment) ...

Jones-Rhoades, Matthew W. (Matthew William)



Service/Product Provider  

NLE Websites -- All DOE Office Websites (Extended Search)

Johnson Controls, Inc. Ford Motor Company 2875 High Meadow Cir. 550 Town Center Dr., Ste 200 Auburn Hills, MI 48326-2773 Dearborn, MI 48126 Business: Building Automation, Facility...


Bang smad Villages New Year in 2011  

E-Print Network (OSTI)

and Mi Nyag Tibetan ??????? ??????????????????? Performer(s)'s first / native language Khams Tibetan and Mi Nyag Tibetan ??????? last updated by World Oral Literature Project staff on Wednesday, Tuesday, June 8, 2010 ??????????????????? Performer...

Bkar shis bzang po


Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","11292013" ,"Excel File Name:","n9050mi2a.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn9050mi2a.htm" ,"Source:","Energy Information...


C:\\DS\\08-2225 - Final with Errata Page.wpd  

NLE Websites -- All DOE Office Websites (Extended Search)

per liter MgO magnesium oxide mi milemiles mi 2 square miles mL millilitermilliliters MOU memorandum of understanding mph miles per hour mrem milliremmillirem MRL method...


Screening SNPs residing in the microRNA-binding sites of Hepatocellular Carcinoma related genes  

Science Conference Proceedings (OSTI)

Single nucleotide polymorphisms located at miRNA-binding sites are likely to affect the expression of the miRNA targets and may contribute to the susceptibility of humans to common diseases. Here we selected 289 candidate Hepatocellular Carcinoma ...

Jun Ding; Yuzhen Gao; Yan He; Yifeng Zhou; Moli Huang; Haiyan Liu


Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

with battery state of charge below 90% (for charging events with SOC reported) Vehicle Usage Number of trips 3,364 Total distance traveled (mi) 21,706 Avg trip distance (mi) 5.8...


Many families of Caenorhabditis elegans microRNAs are not essential for development or viability  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are approximately 23 nt regulatory RNAs that posttranscriptionally inhibit the functions of protein-coding mRNAs. We previously found that most C. elegans miRNAs are individually not essential for ...

Alvarez-Saavedra, Ezequiel


Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

Technical Publications website. The URA tracks the number of theses we produce each year. Power Outage News MI-65 October 25 Power will be off to the MI-65 service building and...


PLEASE SCROLL DOWN FOR ARTICLE This article was downloaded by: [Chow, T. Edwin  

E-Print Network (OSTI)

a ; Michael E. Hodgson b a Department of Earth and Resource Science, University of Michigan--Flint, Flint, MI*{ and MICHAEL E. HODGSON{ {Department of Earth and Resource Science, University of Michigan--Flint, Flint, MI

Chow, Tzeekiu Edwin


GTdemo (.mw) - CECM  

E-Print Network (OSTI)

Algorithm: Backtracking (Branch & Bound) MaximumIndependentSet(G); NygiIiMiIiQiIiYiIiciIigiIzc= MaximumClique(G); NyUiIiMiIikiIio= ChromaticNumber( G...


Species Revision and Generic Systematics of World Rileyinae (Hymenoptera: Eurytomidae)  

E-Print Network (OSTI)

Woolley (9F TAMU); 23 mi. S. Trona, 13.v.1980, J. Woolley,Gates (2m UCR); 23 mi. S. Trona, 13.v.1980, J. Woolley (1m

Gates, Michael William



PowerPoint Presentation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

law * Tech transfer and licensing Why do GIV and V2G make sense? Basic GIVV2G Math * US car used 1 hour day, parked 23 h d * Battery 100 mi, daily travel 30 mi, thus * Drive...


Modulation of Intestinal Micrornas by a Chemoprotective Diet  

E-Print Network (OSTI)

We have hypothesized that dietary modulation of intestinal miRNA expression may contribute to the chemoprotective effects of nutritional bioactives (fish oil and pectin). Using a rat colon carcinogen model, we determined miRNAs-let-7d, miR-15b, miR-107, miR-191 and miR-324-5p were modulated by fish oil + pectin. We also demonstrated that BACE1 and PTEN are targets of miR-107 and miR-21, respectively. To further elucidate the biological effects of diet and carcinogen on miRNAs, we integrated global miRNAs, total and polysomal gene expression datasets obtained from the above mentioned study and used four computational approaches. We demonstrated that polysomal profiling is tightly related to microRNA changes when compared with total mRNA profiling. In addition, diet and carcinogen exposure modulated a number of microRNAs and complementary gene expression analyses showed that oncogenic PTK2B, PDE4B, and TCF4 were suppressed by the chemoprotective diet at both the mRNA and protein levels. To determine the function of select diet and colon carcinogen modulated miRNAs and to validate their targets, we carried out a series of loss and gain of function experiments along with luciferase reporter assays. We verified that PDE4B and TCF4 are direct targets of miR-26b and miR-203, respectively. PTK2B was determined to be an indirect target of miR-19b. In addition, microRNA physiological function was assessed by examining effects on apoptosis and cell proliferation. To better understand how the colonic stem cell population responds to environmental factors such as diet and carcinogen, we investigated the chemoprotective effects of dietary agents on miRNAs in colonic stem cells obtained from Lgr5-EGFP-IRES-creERT2 knock in mice injected with AOM. We demonstrated that based on relative expression of miR-125a-5p, miR-190b and miR-191 in stem cells vs. daughter cells and differentiated cells, these miRNAs may be stem cell specific miRNAs. We also identified miR-21 to be significantly reduced in stem cells compared to differentiated cells and selectively modulated by these dietary agents in stem cells. In summary, our results indicate for the first time that fish oil plus pectin protect against colon tumorigenesis in part by modulating a subset of miRNAs and their target genes (mRNAs) implicated in the regulation of the colon stem cell niche and tumor development.

Shah, Manasvi 1984-



Semiconductor Landing  

Science Conference Proceedings (OSTI)

Title Goes Here. Lorem ipsum dolor sit amet, consectetur adipiscing elit. Sed malesuada accumsan mi, et adipiscing nunc varius quis. ...




E-Print Network (OSTI)

: Gole Mi" Myrtle Williomson. Deye Muey. Chris Moderl. led Row: Dr. Gron· yille Price. Deen Judd. Ed

O'Laughlin, Jay


Particulate matter chemistry and dynamics in the Twilight Zone at VERTIGO ALOHA and K2 Sites  

E-Print Network (OSTI)

Marine Chemistry 105, 208 Volk, T. , Hoffert, M.I. , 1985.Broecker and Peng, 1982; Volk and Hoffert, 1985; Armstrong

Bishop, James K.B.



The export of carbon mediated by mesopelagic fishes in the northeast Pacific Ocean  

E-Print Network (OSTI)

Chapman and Hall, New York. Volk, T. , Hoffert, M.I. , 1985.the biological pump (Volk and Hoffert, 1985). The

Davison, Peter Charles



I Cant Walk! Acute Thrombosis of Descending Aorta Causing Paraplegia  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, Michigan Supervising SectionWest Grand Boulevard, CFP-258, Detroit, MI 48202. Email:

Mitchell, Matthew Lee; Yucebey, Elif; Weaver, Mitchell R; Jaehne, A Kathrin; Rivers, Emanuel P



Observation of a Narrow Charm-Strange Meson D A.V. Evdokimov,8  

E-Print Network (OSTI)

University of Iowa, Iowa City, IA 52242, USA 17 University of Michigan-Flint, Flint, MI 48502, USA 18

Akgun, Ugur


Preserving the U.S. Underground and Alternative Press of the 1960s and '70s: History, Prospects, and Microform Sources  

E-Print Network (OSTI)

Reporter, Washington, DC, 1985- , UMI Navajo Times, WindowWashington, DC Native Sun, Detroit, MI Navajo Times, Window

Tsang, Daniel C



Materials Technology @ TMS  

Science Conference Proceedings (OSTI)

... MI; Elizabeth Holm, Carnegie Mellon University, Pittsburgh, PA; Peter Gumbsch, Fraunhofer Institute for Mechanics of Materials IWM, Freiburg, Germany.


2012 Proceedings of the Performance Metrics for Intelligent ...  

Science Conference Proceedings (OSTI)

Page 1. NIST Special Publication 1136 2012 Proceedings of the Performance Metrics for Intelligent Systems (PerMI '12) Workshop ...



The FASEB Journal Research Communication Structure-function analysis of human l-prostaglandin D  

E-Print Network (OSTI)

the commercially available PGD2-MOX ELISA kit (Cay- man Chemicals, Ann Arbor, MI, USA). One unit of enzyme activity

Zhijie, Liu



NLE Websites -- All DOE Office Websites (Extended Search)

Sciences STATE: MI PROJECT TITLE : Manufacturing Industrial Development for the Alternative Energy Systems Funding Opportunity Announcement Number Procurement Instrument...



Science Conference Proceedings (OSTI)

... the permission of GJ Ackland and MI Mendelev. These potentials are not designed for simulations of radiation damage. ...


Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Thermal Insulation Materials  

Science Conference Proceedings (OSTI)

... IN. Knauf Insulation Product Testing Laboratory, Shelbyville, IN [200883- 0] MI. Dow Chemical Building Solutions Product Perf. ...



Project Brief: Michigan Aerospace Corporation  

Science Conference Proceedings (OSTI)

... RECIPIENT: Michigan Aerospace Corporation, Ann Arbor, MI. Project duration: 3 Years; Total NIST Funding: $1,499,463. ...



Mark Iadicola  

Science Conference Proceedings (OSTI)

... 2002-2003 Postdoctoral Research Fellow University of Michigan, Ann Arbor, MI. 1996-2002 University of Michigan, Ann ...



California Cuckoo Wasps in the Family Chrysididae (Hymenoptera)  

E-Print Network (OSTI)

Panamint Springs; 13 mi. n Trona; Lone Pine; Death Valley;San Bernardino Co. : Trona. Map 89. California distribution

Kimsey, Lynn S.



Available Technologies: Long-term Growth of Finite Life ...  

APPLICATIONS OF TECHNOLOGY: Examine carcinogenesis, aging, expression of genes, proteins and miRNA, signaling pathways, epigenetics, and genomic ...


U.S. Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI : 140 : 2011-2013: Marysville, MI: 176 : 1,080: 14 : 2011-2013: St. Clair, MI: 1,562: 1,422: 2 : 26 : 2011-2013: Noyes, MN: 13,380: 14,460: 20,624: 33,889 ...


U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI: 3.80 : 4.50 : 2011-2013: Marysville, MI: 3.63: 3.65 : 4.57: 4.70 : 2011-2013: St. Clair, MI: 3.75: 3.67: 4.09: 4.41 : 4.35: 2011-2013: Noyes, MN: 3.74: 3 ...


U.S. Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA)

Detroit, MI: 22,904: 27,220: 43,980: 44,275: 43,690: 50,347: 1996-2011: Marysville, MI: 9,158: 8,756: 14,925: 22,198: 41,964: 42,866: 1996-2011: Sault Ste. Marie, MI ...


U.S. Price of Natural Gas Pipeline Imports by Point of Entry  

U.S. Energy Information Administration (EIA)

Detroit, MI: 8.28: 6.58: 4.53: 8.37: 5.17 : 1996-2011: Marysville, MI: 7.59: 8.59: 3.80: 4.44: 4.42: 2.99: 1996-2012: St. Clair, MI: 6.97: 10.03: 5.10: 4.97: 4.29: 2 ...


U.S. Price of Natural Gas Pipeline Exports by Point of Exit  

U.S. Energy Information Administration (EIA)

Detroit, MI: 6.88: 8.37: 4.01: 4.69: 4.26: 3.10: 1996-2012: Marysville, MI: 7.77: 7.48: 4.85: 4.87: 4.48: 3.18: 1996-2012: Sault Ste. Marie, MI: 7.13: 8.75: 5.04: 5 ...


Brief communication: Genome-wide computational identification of microRNAs and their targets in the deep-branching eukaryote Giardialamblia  

Science Conference Proceedings (OSTI)

Using a combined computational program, we identified 50 potential microRNAs (miRNAs) in Giardia lamblia, one of the most primitive unicellular eukaryotes. These miRNAs are unique to G. lamblia and no homologues have been found in other organisms; miRNAs, ... Keywords: CDS, Computational, EST, Gene regulation, Giardia lamblia, MicroRNA, UTR, VSPs

Yan-Qiong Zhang; Dong-Liang Chen; Hai-Feng Tian; Bao-Hong Zhang; Jian-Fan Wen



July 2009 NW Michigan Regional Fruit Grower Newsletter CALENDER OF EVENTS  

E-Print Network (OSTI)

Basket Sparta, MI 7/10 Grape IPM Update L. Mawby's Tasting Room 7/13 Canola Research 2009 Plot Days Central Lake, MI 7/14 Canola Research 2009 Plot Days Marion, MI 7/16 Backyard Chicken Production Workshop


Buildings Energy Data Book: 3.3 Commercial Sector Expenditures  

Buildings Energy Data Book (EERE)

2 2 Commercial Energy Prices, by Year and Fuel Type ($2010) Electricity Natural Gas Distillate Oil Residual Oil ($/gal) ($/gal) 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 2021 2022 2023 2024 2025 2026 2027 2028 9.39 104.50 2.79 3.78 9.35 104.74 2.81 3.81 9.47 101.25 2.73 3.69 9.40 103.22 2.76 3.75 9.54 99.28 2.67 3.60 9.51 100.49 2.70 3.64 9.52 94.53 2.66 3.52 9.55 97.45 2.64 3.55 9.46 90.92 2.61 3.46 9.48 92.13 2.63 3.49 9.49 87.65 2.54 3.41 9.47 89.48 2.58 3.42 9.58 85.91 2.41 3.28 9.54 86.36 2.49 3.34 9.57 87.02 2.07 2.97 9.52 84.58 2.26 3.14 10.09 86.14 2.34 3.55 9.76 87.22 2.37 3.57 10.27 97.87 1.49 2.03 10.14 90.95 1.66 2.86 10.04 114.33 1.51 2.47 10.56 121.16 2.01 3.34 9.59 121.45 1.24 2.07 10.13 124.31 1.39 2.32 9.44 94.94 0.93 1.23


Buildings Energy Data Book: 6.2 Electricity Generation, Transmission, and Distribution  

Buildings Energy Data Book (EERE)

6 6 Cost of an Electric Quad Used in the Buildings Sector ($2010 Billion) Residential Commercial Buildings Sector 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 2021 2022 2023 2024 2025 2026 2027 2028 2029 11.82 11.82 11.82 11.94 11.68 11.82 10.59 10.83 10.70 11.41 11.58 11.48 11.68 11.33 11.51 11.49 10.77 11.15 11.71 11.67 11.69 11.72 11.52 11.63 10.57 9.76 10.19 10.55 9.73 10.16 11.16 10.35 10.78 10.68 9.90 10.31 10.42 9.48 9.97 10.16 9.20 9.70 10.57 9.73 10.17 10.48 9.62 10.07 9.54 8.46 9.01 9.24 8.11 8.68 9.92 8.97 9.47 9.85 8.78 9.33 9.16 8.44 8.81 9.32 8.58 8.96 9.15 8.16 8.66 9.46 8.64 9.05 10.27 9.34 9.82 10.24 9.27 9.76 9.28 8.48 8.89 9.56 8.77 9.18 11.92 10.52 11.25 11.83 10.40 11.14 10.61 9.76 10.19 10.86 9.60 10.25 11.90 10.08


Buildings Energy Data Book: 3.3 Commercial Sector Expenditures  

Buildings Energy Data Book (EERE)

Commercial Energy Prices, by Year and Major Fuel Type ($2010 per Million Btu) Electricity Natural Gas Petroleum (1) Average 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 (2) 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 2021 2022 2023 2024 2025 2026 2027 2028 2029 27.39 10.47 27.48 21.15 27.10 10.45 27.73 21.01 27.56 10.32 27.04 21.10 27.52 10.45 27.28 21.18 27.86 10.05 26.41 21.06 27.74 10.12 26.73 21.07 28.00 9.75 25.85 20.90 27.96 9.93 26.16 21.01 27.78 9.21 25.46 20.46 27.90 9.45 25.69 20.67 27.76 8.95 24.95 20.23 27.72 9.09 25.24 20.32 27.96 8.64 24.34 20.11 27.81 8.77 24.80 20.14 27.91 8.46 23.15 19.90 28.07 8.59 24.07 20.11 28.61 8.72 23.94 20.36 28.05 8.70 22.00 19.99 29.73 9.10 20.28 20.99 29.57 8.61 24.24 21.03 30.95 12.12 23.75 23.21 30.09 9.79 15.83 21.13 29.70


Buildings Energy Data Book: 3.1 Commercial Sector Energy Consumption  

Buildings Energy Data Book (EERE)

2 2 Commercial Site Renewable Energy Consumption (Quadrillion Btu) (1) Growth Rate Wood (2) Solar Thermal (3) Solar PV (3) GHP Total 2010-Year 1980 1981 1982 1983 1984 1985 1986 1987 1988 1989 1990 1991 1992 1993 1994 1995 1996 1997 1998 1999 2000 2001 2002 2003 2004 2005 2006 2007 2008 2009 2010 2011 2012 2013 2014 2015 2016 2017 2018 2019 2020 2021 2022 2023 2024 2025 2026 2027 2028 2029 0.110 0.035 0.010 N.A. 0.155 0.4% 0.110 0.035 0.009 N.A. 0.154 0.4% 0.110 0.035 0.009 N.A. 0.153 0.4% 0.110 0.034 0.009 N.A. 0.153 0.4% 0.110 0.034 0.009 N.A. 0.152 0.4% 0.110 0.034 0.008 N.A. 0.152 0.4% 0.110 0.034 0.008 N.A. 0.151 0.4% 0.110 0.033 0.008 N.A. 0.151 0.4% 0.110 0.033 0.008 N.A. 0.150 0.4% 0.110 0.033 0.007 N.A. 0.150 0.4% 0.110 0.032 0.007 N.A. 0.149 0.4% 0.110 0.032 0.007 N.A. 0.149 0.4% 0.110 0.032 0.007 N.A. 0.149 0.5% 0.110 0.032 0.007 N.A. 0.149 0.5% 0.110 0.032 0.007 N.A. 0.148 0.6%



NLE Websites -- All DOE Office Websites (Extended Search)

Usage Usage Overall fuel economy (mpg) 139 Overall electrical energy consumption (AC Wh/mi) 293 Number of trips¹ 76,425 Total distance traveled (mi) 609,737 Avg trip distance (mi) 8.0 Avg distance traveled per day when the vehicle was driven (mi) 36.4 Avg number of trips between charging events 3.0 Avg distance traveled between charging events (mi) 24.1 Avg number of charging events per day when the vehicle was driven 1.5



NLE Websites -- All DOE Office Websites (Extended Search)

6 6 Overall AC electrical energy consumption (AC Wh/mi) 175 Average Trip Distance 12.2 Total distance traveled (mi) 272,366 Average Ambient Temperature (deg F) 54.1 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 368 Distance traveled (mi) 129,389 Percent of total distance traveled 47.5% Average driving style efficiency (distance weighted)¹ 75% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.0 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 142,977 Percent of total distance traveled 52.4% Average driving style efficiency (distance weighted)¹ 77% City³ Highway³ Percent of miles in EV operation (%) 65.1% 31.1% Percent Number of trips 85.5% 14.5% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

45 45 Overall DC electrical energy consumption (DC Wh/mi)² 29 Total number of trips 1,839 Total distance traveled (mi) 21,089 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 39 DC electrical energy consumption (DC Wh/mi) 61 Number of trips 654 Percent of trips city | highway 66% | 34% Distance traveled (mi) 5,717 Percent of total distance traveled 27% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 38 DC electrical energy consumption (DC Wh/mi) 57 Number of trips 117 Percent of trips city | highway 39% | 62% Distance traveled (mi) 3,683 Percent of total distance traveled 17% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 33 Number of trips 1,068 Percent of trips city | highway 71% | 30% Distance traveled (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

4.8 4.8 Overall AC electrical energy consumption (AC Wh/mi) 185 Average Trip Distance 13.1 Total distance traveled (mi) 208,165 Average Ambient Temperature (deg F) 77.6 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 369 Distance traveled (mi) 104,687 Percent of total distance traveled 50.3% Average driving style efficiency (distance weighted)¹ 87% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 37.2 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 103,478 Percent of total distance traveled 49.7% Average driving style efficiency (distance weighted)¹ 82% City³ Highway³ Percent of miles in EV operation (%) 69.8% 33.9% Percent Number of trips 85.0% 15.0% Average trip distance (mi)

Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft PowerPoint - Junior_ONR  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mi Mi it S i I tit ti (MSI ) Minority Serving Institutions (MSIs): Bridging the Gap between Federal g g p Agencies and MSIs Dr. Anthony Junior, Program Manager Naval Historically Black Colleges and University/Minority Institutions Program Office of Naval Research 874 North Randolph Street, Arlington, VA 22203 anthony.junior@navy.mil AVJ HBCU/MI SP Concepts V2 Agenda * The Requirement The Requirement * The Strategic Plan * HBCU/MI Full Engagement Model HBCU/MI Full Engagement Model * STEM Research Pipeline * HBCU/MI Accredited Engineering Schools * HBCU/MI Accredited Engineering Schools 2 10 USC 2362 Objective: Enhance defense-related research and education at HBCU/MIs to assist the Department in education at HBCU/MIs to assist the Department in defense-related research, development, testing, and



NLE Websites -- All DOE Office Websites (Extended Search)

2.5 2.5 Overall AC electrical energy consumption (AC Wh/mi) 166 Average Trip Distance 12.1 Total distance traveled (mi) 385,849 Average Ambient Temperature (deg F) 78.2 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 332 Distance traveled (mi) 193,336 Percent of total distance traveled 50.1% Average driving style efficiency (distance weighted)¹ 85% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.2 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 192,512 Percent of total distance traveled 49.9% Average driving style efficiency (distance weighted)¹ 79% City³ Highway³ Percent of miles in EV operation (%) 67.2% 31.5% Percent Number of trips 86.7% 13.3% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

36 36 Overall DC electrical energy consumption (DC Wh/mi)² 18 Total number of trips 1,290 Total distance traveled (mi) 13,023 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 39 DC electrical energy consumption (DC Wh/mi) 58 Number of trips 432 Percent of trips city | highway 75% | 25% Distance traveled (mi) 2,835 Percent of total distance traveled 22% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 41 DC electrical energy consumption (DC Wh/mi) 48 Number of trips 52 Percent of trips city | highway 31% | 69% Distance traveled (mi) 1,613 Percent of total distance traveled 12% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 34 Number of trips 806 Percent of trips city | highway 73% | 27% Distance traveled (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

7.8 7.8 Overall AC electrical energy consumption (AC Wh/mi) 180 Average Trip Distance 12.8 Total distance traveled (mi) 346,409 Average Ambient Temperature (deg F) 51.5 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 384 Distance traveled (mi) 161,982 Percent of total distance traveled 46.8% Average driving style efficiency (distance weighted)¹ 74% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.1 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 184,427 Percent of total distance traveled 53.2% Average driving style efficiency (distance weighted)¹ 76% City³ Highway³ Percent of miles in EV operation (%) 63.8% 28.4% Percent Number of trips 85.7% 14.3% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

49 49 Overall DC electrical energy consumption (DC Wh/mi)² 27 Total number of trips 927 Total distance traveled (mi) 9,301 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 39 DC electrical energy consumption (DC Wh/mi) 66 Number of trips 313 Percent of trips city | highway 68% | 32% Distance traveled (mi) 2,138 Percent of total distance traveled 23% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 41 DC electrical energy consumption (DC Wh/mi) 63 Number of trips 46 Percent of trips city | highway 30% | 70% Distance traveled (mi) 1,462 Percent of total distance traveled 16% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 34 Number of trips 568 Percent of trips city | highway 75% | 25% Distance traveled (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

8 8 Overall AC electrical energy consumption (AC Wh/mi)¹ 148 Overall DC electrical energy consumption (DC Wh/mi)² 104 Total number of trips 1,212 Total distance traveled (mi) 11,846 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 58 DC electrical energy consumption (DC Wh/mi) 160 Number of trips 823 Percent of trips city | highway 81% | 19% Distance traveled (mi) 5,559 Percent of total distance traveled 47% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 46 DC electrical energy consumption (DC Wh/mi) 85 Number of trips 195 Percent of trips city | highway 40% | 61% Distance traveled (mi) 4,217 Percent of total distance traveled 36% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 34 Number of trips



NLE Websites -- All DOE Office Websites (Extended Search)

0 0 Overall AC electrical energy consumption (AC Wh/mi) 174 Average Trip Distance 12.6 Total distance traveled (mi) 1,243,988 Average Ambient Temperature (deg F) 63.2 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 352 Distance traveled (mi) 615,161 Percent of total distance traveled 49.5% Average driving style efficiency (distance weighted)¹ 80% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.4 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 628,828 Percent of total distance traveled 50.5% Average driving style efficiency (distance weighted)¹ 78% City³ Highway³ Percent of miles in EV operation (%) 66.8% 31.7% Percent Number of trips 85.5% 14.5% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

50 50 Overall DC electrical energy consumption (DC Wh/mi)² 22 Total number of trips 730 Total distance traveled (mi) 9,164 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 40 DC electrical energy consumption (DC Wh/mi) 61 Number of trips 225 Percent of trips city | highway 68% | 32% Distance traveled (mi) 1,768 Percent of total distance traveled 19% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 36 DC electrical energy consumption (DC Wh/mi) 53 Number of trips 40 Percent of trips city | highway 23% | 78% Distance traveled (mi) 1,638 Percent of total distance traveled 18% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 35 Number of trips 465 Percent of trips city | highway 70% | 30% Distance traveled (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

71.0 71.0 Overall AC electrical energy consumption (AC Wh/mi) 169 Average Trip Distance 12.5 Total distance traveled (mi) 1,661,080 Average Ambient Temperature (deg F) 67.1 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 340 Distance traveled (mi) 826,775 Percent of total distance traveled 49.8% Average driving style efficiency (distance weighted)¹ 81% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.7 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 834,306 Percent of total distance traveled 50.2% Average driving style efficiency (distance weighted)¹ 78% City³ Highway³ Percent of miles in EV operation (%) 66.9% 31.6% Percent Number of trips 85.8% 14.2% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

5 5 Overall AC electrical energy consumption (AC Wh/mi) 170 Average Trip Distance 12.4 Total distance traveled (mi) 2,041,556 Average Ambient Temperature (deg F) 64.4 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 345 Distance traveled (mi) 1,002,495 Percent of total distance traveled 49.1% Average driving style efficiency (distance weighted)¹ 80% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.9 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 1,039,061 Percent of total distance traveled 50.9% Average driving style efficiency (distance weighted)¹ 78% City³ Highway³ Percent of miles in EV operation (%) 66.2% 31.0% Percent Number of trips 86.0% 14.0% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

1.1 1.1 Overall AC electrical energy consumption (AC Wh/mi) 182 Average Trip Distance 11.8 Total distance traveled (mi) 355,058 Average Ambient Temperature (deg F) 46.0 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 416 Distance traveled (mi) 155,080 Percent of total distance traveled 43.7% Average driving style efficiency (distance weighted)¹ 69% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 34.4 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 199,978 Percent of total distance traveled 56.3% Average driving style efficiency (distance weighted)¹ 74% City³ Highway³ Percent of miles in EV operation (%) 60.5% 27.0% Percent Number of trips 86.3% 13.7% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

53 53 Overall DC electrical energy consumption (DC Wh/mi)² 34 Total number of trips 1,515 Total distance traveled (mi) 15,617 Trips in Charge Depleting (CD) mode³ Gasoline fuel economy (mpg) 37 DC electrical energy consumption (DC Wh/mi) 65 Number of trips 739 Percent of trips city | highway 74% | 26% Distance traveled (mi) 4,915 Percent of total distance traveled 31% Trips in both Charge Depleting & Charge Sustaining (CD/CS) modes Gasoline fuel economy (mpg) 38 DC electrical energy consumption (DC Wh/mi) 58 Number of trips 93 Percent of trips city | highway 38% | 62% Distance traveled (mi) 2,842 Percent of total distance traveled 18% Trips in Charge Sustaining (CS) mode Gasoline fuel economy (mpg) 33 Number of trips 683 Percent of trips city | highway 72% | 28% Distance traveled (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

6.6 6.6 Overall AC electrical energy consumption (AC Wh/mi) 171 Average Trip Distance 11.9 Total distance traveled (mi) 370,316 Average Ambient Temperature (deg F) 53.8 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 371 Distance traveled (mi) 170,860 Percent of total distance traveled 46.1% Average driving style efficiency (distance weighted)¹ 75% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 35.9 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 199,456 Percent of total distance traveled 53.9% Average driving style efficiency (distance weighted)¹ 77% City³ Highway³ Percent of miles in EV operation (%) 63.2% 28.1% Percent Number of trips 86.7% 13.3% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

2 2 Overall AC electrical energy consumption (AC Wh/mi) 157 Average Trip Distance 12.3 Total distance traveled (mi) 407,245 Average Ambient Temperature (deg F) 67.9 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 338 Distance traveled (mi) 189,426 Percent of total distance traveled 46.5% Average driving style efficiency (distance weighted)¹ 82% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.5 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 217,819 Percent of total distance traveled 53.5% Average driving style efficiency (distance weighted)¹ 79% City³ Highway³ Percent of miles in EV operation (%) 65.2% 28.3% Percent Number of trips 86.5% 13.5% Average trip distance (mi)



NLE Websites -- All DOE Office Websites (Extended Search)

73.7 73.7 Overall AC electrical energy consumption (AC Wh/mi) 170 Average Trip Distance 12.6 Total distance traveled (mi) 370,987 Average Ambient Temperature (deg F) 71.0 Electric Vehicle mode operation (EV) Gasoline fuel economy (mpg) No Fuel Used AC electrical energy consumption (AC Wh/mi) 341 Distance traveled (mi) 185,282 Percent of total distance traveled 49.9% Average driving style efficiency (distance weighted)¹ 83% Extended Range mode operation (ERM) Gasoline fuel economy (mpg) 36.9 AC electrical energy consumption (AC Wh/mi) No Elec. Used Distance traveled (mi) 185,705 Percent of total distance traveled 50.1% Average driving style efficiency (distance weighted)¹ 79% City³ Highway³ Percent of miles in EV operation (%) 68.0% 32.4% Percent Number of trips 85.4% 14.6% Average trip distance (mi)


Revue dEtudes Tibtaines  

E-Print Network (OSTI)

. Moscou : Nauka. Zhang Yisun 1993. Bod rgya tshig mdzod chen mo, Pkin : Mi rigs dpe skrun khang LA ROCA BLANCA DE LHANG LHANG Un santuario en Nyag rong Oriol Aguilar En Tbet, el Pas de las Nieves, en el centro de... mi nyag pa en el Nyag rong, procedentes del norte. La predominancia del dialecto mi nyag habra cambiado el antiguo nombre del rea, que era Brag dmar, en Rag dmar8. Tambin facilita los nombres de los diversos centros religiosos desde tiempos...

Achard, Jean-Luc



microRNA: human disease and development  

Science Conference Proceedings (OSTI)

microRNAs or miRNAs are an abundant class of highly conversed, small non-coding RNAs that present an entirely new theme of post-transcriptional gene regulation. miRNAs play a key role in diverse biological systems, such as virology, embryogenesis, ... Keywords: bioinformatics, biomarkers, cancer, eukaryotes, gene regulation, immune system development, immune system response, immunity regulation, metabolic pathways, miRNAs, microRNA expression, stem cells, target predictions

Virendra S. Gomase; Akshay N. Parundekar




U.S. Energy Information Administration (EIA)

Pilgrim Nuclear Power Station Massachusetts Total MD Calvert Cliffs Nuclear Power Plant Maryland Total MI Fermi Donald C Cook Michigan Total MN Prairie Island ...


Materials Week '97: Wednesday AM Session  

Science Conference Proceedings (OSTI)

... MI 48104; Gordon Geiger, Qualitech Steel Corporation, 301 Merchant Bank .... hardness and impact energy are reported during austempering at 400, 375,...


CNST Group Seminars - 2008  

Science Conference Proceedings (OSTI)

... Joshua Hihath Arizona State University. ... electrostatic potential in high spatial and energy resolutions, and ... MI is a four-wave-mixing (FWM) process ...


Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Ecosystem dynamics of the Aleutian Islands.  

E-Print Network (OSTI)

??Located between Asia and America and extending over a 1,000 mi., the Aleutian Islands have commonly been studied in a partial or fragmented manner. This (more)

Ortiz, Ivonne



Molecular characterization of animal microRNAs : sequence, expression, and stability  

E-Print Network (OSTI)

(cont.) miRNAs. These cells lines may also be useful for other functional studies, such as validation of putative mRNA target genes.

Lau, Nelson C., 1978-



fcmlbig - Energy Information Administration  

U.S. Energy Information Administration (EIA)

256821 TX Freeman-Martin 256852 MI Freeman-Redding 256914 WV Freemansburg 256945 IL Freemanspur 256976 KS Freemeyer 257007 CA Fremont Landing 257038 OK Freeny


Service/Product Provider  

NLE Websites -- All DOE Office Websites (Extended Search)

Bay Controls, LLC Ford Motor Company 6528 Weatherfield Ct. 550 Town Center Dr., Ste 200 Maumee, OH 43537 Dearborn, MI 48126 Business: Air Compressor Controls Business: Automotive...


La Roca Blanca de Lhang lhang - Un santuario en Nyag rong  

E-Print Network (OSTI)

de Rag dmar, debido a la progresiva influencia a lo largo de los siglos de la emigracin de poblacin mi nyag pa en el Nyag rong, procedentes del norte. La predominancia del dialecto mi nyag habra cambiado el antiguo nombre del rea, que era Brag... mi nyag pa shar dang lho phyogs su phos mthus mi nyag log skad da ltaang lus yod pa de sa gnas dir rag dmar go zer ba ni brag dmar go zer ba yin/ La Roca Blanca de Lhang lhang 15 masculina(dbon brgyud) 9 . Muchos de estos centros religiosos...

Aguillar, Oriol



Past Chairmen of the Conference  

Science Conference Proceedings (OSTI)

... 73rd 1988 Grand Rapids, MI D. Guensler, CA 74th 1989 Seattle, WA J. Bartfai, NY 75th 1990 Washington, DC F. Gerk, NM ...



NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- 07312013 Midland, MI CONTRIBUTING TO NET ZERO BUILDING: HIGH ENERGY EFFICIENT EIFS WALL SYSTEMS Enhance exterior insulation and finishing system (EIFS) envelope systems to...


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Project Management Center 2010 Gary Sames 812010 - 7312013 Midland, MI Advanced Insulation for High-Performance, Cost-Effective Wall, Roof and Foundation Systems Develop...


VERTIGO (VERtical Transport In the Global Ocean): A study of particle sources and flux attenuation in the North Pacific  

E-Print Network (OSTI)

Research II, this volume. Volk, T. , Hoffert, M.I. , 1985.the oceans biological pump (Volk and Hoffert, 1985). This

Buesseler, K.O.



High Biomass Low Export Regimes in the Southern Ocean  

E-Print Network (OSTI)

Research-Oceans 106 (C12) Volk, T. , Hoffert, M.I. , 1985.in the atmosphere (Volk and Hoffert 1985), understanding the

Lam, Phoebe J.; Bishop, James K.B.



Quantifying the surface-subsurface biogeochemical coupling during the VERTIGO ALOHA and K2 studies  

E-Print Network (OSTI)

projects/vertigo.html Volk, T. , Hoffert, M.I. , 1985. Oceanto the oceans interior (Volk and Hoffert, 1985). The source

Boyd, P.W.



Chrysler RAM PHEV Fleet Results Report  

NLE Websites -- All DOE Office Websites (Extended Search)

istance (mi) 4 45 Trips in Charge Depleting (CD) mode City Highway Gasoline fuel economy (mpg) DC electrical energy consumption (DC Whmi) Percent of miles with internal combustion...


Michigan | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Assistance to Dow Kokam Mi, LLC To Manufacture Advanced Lithium Polymer Batteries for Hybrid and Electric Vehicles At Midland, Michigan March 1, 2010 EA-1721: Final...



NLE Websites -- All DOE Office Websites (Extended Search)

Braking Energy Recovery (%) 14% City Trips ( < 5 stopsmile & <37 mph avg) DC electrical energy consumption (DC Whmi) 380 Number of trips 106 Distance traveled (mi) 237 Percent...


EnergyCS Prius Altairnano 2009 Report.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

period: All trips combined Overall gasoline fuel economy (mpg) Overall DC electrical energy consumption (DC Whmi) 2 Total number of trips Total distance traveled (mi) Trips...



NLE Websites -- All DOE Office Websites (Extended Search)

Braking Energy Recovery (%) 15% City Trips ( < 5 stopsmile & <37 mph avg) DC electrical energy consumption (DC Whmi) 414 Number of trips 152 Distance traveled (mi) 131 Percent...


EnergyCS Prius Valence 2009 Report.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

period: All trips combined Overall gasoline fuel economy (mpg) Overall DC electrical energy consumption (DC Whmi) 2 Total number of trips Total distance traveled (mi) Trips...



NLE Websites -- All DOE Office Websites (Extended Search)

Braking Energy Recovery (%) 15% City Trips ( < 5 stopsmile & <37 mph avg) DC electrical energy consumption (DC Whmi) 410 Number of trips 94 Distance traveled (mi) 307 Percent of...


1 Introduction  

E-Print Network (OSTI)

1Department of Mathematics, Wayne State University, Detroit, MI 48202 (boris@ math.wayne.edu). Research of this author was partly supported by the National...


1 Introduction  

E-Print Network (OSTI)

2Department of Mathematics, Wayne State University, Detroit, MI 48202, USA; email: boris@math.wayne.edu. Research of this author was also partly supported ...

Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Approximate Maximum Principle for Discrete Approximations of ...  

E-Print Network (OSTI)

Detroit, MI 48202. Email: boris@math.wayne.edu. ILYA SHVARTSMAN. Department of Mathematics and Computer Science. Penn State University - Harrisburg.


Hlder Metric Subregularity with Applications to Proximal Point Method  

E-Print Network (OSTI)

Feb 2, 2012 ... Department of Mathematics, Wayne State University, Detroit, MI 48202, USA. Email: boris@math.wayne.edu. Research of this author was also...


1 Introduction  

E-Print Network (OSTI)

Strategic Reference Framework under grant PTDC/MAT/111809/2009. 3Doctoral Student, Department of Mathematics, Wayne State University, Detroit, MI 48202...



U.S. Energy Information Administration (EIA)

... , "Detroit, MI",, ,Coking,Steam 2000,61542,1142280 2005,177414,8456023 2010,160896,6187802 Jan-Aug 2011,9323,1227071 ,, "Mobile, AL", ...


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DTE Energy PMCPVT FY2012Appx. 11 months Rondle Harp Detroit, MI GM Battery Pack Assembly Plant - Electric Substation Upgrade General business actions to support the EDV battery...


1 Introduction  

E-Print Network (OSTI)

2Department of Mathematics, Wayne State University, Detroit, MI 48202, USA; email: boris@math.wayne.edu. Research of this author was also partially...



Science Conference Proceedings (OSTI)

Room: 330A. Session Chairperson: J.E. Benci, Wayne State University, Dept. of Materials Science and Engineering, Detroit, MI 48202...



U.S. Energy Information Administration (EIA)

... is through August, the latest data available",,,,, ,"Norfolk, VA","Baltimore, MD","Mobile, AL","New Orleans, LA","Detroit, MI","Seattle, ...


Girls Will Be Boys: Cross-Dressed Women and the Legitimation of American Silent Cinema  

E-Print Network (OSTI)

in American Film. Detroit: Wayne State University Press,159. Washington--The Prince and the Pauper. Detroit News.Detroit, MI, December 6, 1915. Waters, Sarah. A Girton

Horak, Laura



1 Introduction  

E-Print Network (OSTI)

2Department of Mathematics, Wayne State University, Detroit, MI 48202 (boris@ math.wayne.edu). Re- search of this author was also partly supported by the...


Transfac 2009: Home Page  

Science Conference Proceedings (OSTI)

TRANSFAC 2009 OCT. 31 - NOV. 3, 2009 DETROIT, MI USA ... and Materials (KIM), Metsoc Metallurgical Society of CIM, ASM International Detroit Chaper...


New Fractional Error Bounds for Nonconvex Polynomial Systems ...  

E-Print Network (OSTI)

Jan 7, 2013 ... Department of Mathematics, Wayne State University, Detroit, MI 48202, USA. Email: boris@math.wayne.edu. Re- search of this author was...


Evaluation of I-15 Devore (08-0A4224) Long-Life Pavement Rehabilitation Costs  

E-Print Network (OSTI)

Cost Indirect Costs Engineer's Estimate Category Amount2 lane-mi. Administrative Costs Engineer's Estimate CategoryMiles) Total (All Costs) Engineer's Estimate Amount Original

Fermo, Mary G; Santero, Nicholas J; Nokes, William; Harvey, John T



Journal of Research Volume 94  

Science Conference Proceedings (OSTI)

... L; Cabeza, MI; Rico, FR; Garciariquelme, O.; Kaufman, V. http://dx ... Database for XQQ instruments - A kinetics-based measurement protocol, p. 281 ...



NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- Clean Energy Coalition Michigan Green Fleets Improvements andor upgrades to existing CNG refueling station in Detroit, MI. This CX form is for one location in this project...



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

f a succcssfigyJI&&@ anETTPpropaty, W E T adW E signa MaMI.andumdUndct.9tanding (MOU), whichstatear thatallpartiesagreetothe objadivedaspccificpicetdpropatyfbtadctinnl...


Preserving research data  

E-Print Network (OSTI)

Consortium for Political and Social Research. Ann Arbor, MI;Access to Publicly Funded Research Data. The Public Domainof the products of scientific research. Meanwhile, research

Jacobs, James A; Humphrey, Charles



Altered microRNA expression patterns in irradiated hematopoietic tissues suggest a sex-specific protective mechanism  

Science Conference Proceedings (OSTI)

To investigate involvement of miRNAs in radiation responses we used microRNAome profiling to analyze the sex-specific response of radiation sensitive hematopoietic lymphoid tissues. We show that radiation exposure resulted in a significant and sex-specific deregulation of microRNA expression in murine spleen and thymus tissues. Among the regulated miRNAs, we found that changes in expression of miR-34a and miR-7 may be involved in important protective mechanisms counteracting radiation cytotoxicity. We observed a significant increase in the expression of tumor-suppressor miR-34a, paralleled by a decrease in the expression of its target oncogenes NOTCH1, MYC, E2F3 and cyclin D1. Additionally, we show that miR-7 targets the lymphoid-specific helicase LSH, a pivotal regulator of DNA methylation and genome stability. While miR-7 was significantly down-regulated LSH was significantly up-regulated. These cellular changes may constitute an attempt to counteract radiation-induced hypomethylation. Tissue specificity of miRNA responses and possible regulation of miRNA expression upon irradiation are discussed.

Ilnytskyy, Yaroslav; Zemp, Franz J.; Koturbash, Igor [Department of Biological Sciences, University of Lethbridge, 4401 University Drive, Lethbridge, Alta., T1K 3M4 (Canada); Kovalchuk, Olga [Department of Biological Sciences, University of Lethbridge, 4401 University Drive, Lethbridge, Alta., T1K 3M4 (Canada)], E-mail: olga.kovalchuk@uleth.ca




NLE Websites -- All DOE Office Websites (Extended Search)

through December 2012 Vehicle Usage Overall fuel economy (mpg) 126 Overall electrical energy consumption (AC Whmi) 229 Number of trips 369,118 Total distance traveled (mi)...



E-Print Network (OSTI)

Prog. , 21. (5), 67 (1977). Exxon Research & EngineeringMI 48640. 2. Present address: Exxon Research & Engineeringprocesses (Singer, et al, 1977; Exxon Research & Engineering

Greminger, Douglas C.


Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Vehma EE DE-EE0005574 PMCPVT 2011 Aaron Yocum 10012011 - 09302015 Troy, Oakland County, MI Demonstration of a Multi-Material Lightweight Prototype Vehicle Design, build, and...


Adaptive Materials Inc | Open Energy Information  

Open Energy Info (EERE)

Zip MI 48108 Product Adaptive Materials Inc (AMI) is a developer of portable fuel cell technology. References Adaptive Materials Inc1 LinkedIn Connections CrunchBase...


Development of a Damage Tolerant Heat Treatment for Cast + HIP ...  

Science Conference Proceedings (OSTI)

Supplier Institute - Dearborn, MI; 1986; pg 182. Acknowledgments ... A. Koren, et. al.; The Effect of Weld Energy Input Parameters on the Crack Sensitivity of...


Application of Optical Diagnostics for Fuel Spray Characterization  

NLE Websites -- All DOE Office Websites (Extended Search)

Optical Diagnostics for Fuel Spray Characterization Scott Parrish General Motors Global Research, 30500 Mound Road, Warren, MI 48090-9055 USA It is well known that fuel spray...


Author Biography Form  

Science Conference Proceedings (OSTI)

Author Biography Form. Title: ? Dr. ? Prof. ? Mr. ? Mrs. ? Ms. Gender: ? Male ? Female. Name: First. M.I.. Last. Current Status: Position: Company: Address:.


Individual Particle-Analysis of Ambient PM2.5 Using Advanced...  

NLE Websites -- All DOE Office Websites (Extended Search)

communities near southwestern Detroit, MI (close to multiple combustion sources including motor vehiclediesel, incinerators, and oil and coal combustion sources) and Steubenville,...


Economic Assessment of Electric-Drive Vehicle Operation in California and the United States  

E-Print Network (OSTI)

Seattle City Light XCEL Energy (If Applicable) Light) $2.77 Seattle ( WA) Colorado (XCEL CO) $2.50 Colorado Michigan (XCEL MI) $2.49 Michigan

Lidicker, Jeffrey R.; Lipman, Timothy E.; Shaheen, Susan A.



Exploration of Resource and Transmission Expansion Decisions in the Western Renewable Energy Zone Initiative  

E-Print Network (OSTI)

Capacity Factor ITC Availability Transmission Cost 500 kVwhere the availability of transmission-congestion managementxiv New Transmission Capacity (GW-mi) 16K availability of

Mills, Andrew



Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

turbine replaced - MI-50 Upper power supply brought back online - Pbar dry engine flywheel replaced Read the Current Accelerator Update Read the Early Bird Report View the...


Accelerator Update | Archive | 2008  

NLE Websites -- All DOE Office Websites (Extended Search)

turbine replaced - MI-50 Upper power supply brought back online - Pbar dry engine flywheel replaced October 17, 2008 - October 20, 2008 - four stores provided 61 hours and 15...


Materials for Transportation Applications: Selected Proceedings ...  

Science Conference Proceedings (OSTI)

Sep 16, 2007 ... A collection of papers from MS&T'07 held in Detroit, MI, September 16-20, 2007, covering topics related to Materials for Transportation...


Engineering microbial biofuel tolerance and export using ...  

Ramos JL, Duque E, Gallegos MT, Godoy P, Ramos-Gonzalez MI, Rojas A, Teran W, Segura A (2002) Mechanisms of solvent tolerance in gram-negative bacteria.


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Strategy to Accelerate US Transition to Electric Vehicles Demonstrate a plug-in hybrid vehicle, install charging systems. 07 20 2010 John Jason Conley Digitally signed by...


Finishing in the Future  

NLE Websites -- All DOE Office Websites (Extended Search)

The Genome Institute, Washington University Areas of emphasis at this meeting included: Genome Sequencing: New sequencing technologies (454, illumina, SOLiD, Ion Torrent, MiSeq,...


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2012 48 months Aaron Yocum Auburn Hills, MI Validation of Material Models for Automotive Carbon-Fiber Composite Structures via Physical and.... The project is the validation of...


A Sample Approximation Approach for Optimization with ...  

E-Print Network (OSTI)

... ? is a random vector with suport ? ? Rd, G : Rn Rd ? Rm is a given constraint mapping ...... The suppliers have limited capacity Mi for i ? I. There is a .


Thermal-Mechanical Fatigue Life Model for Coated Superalloy ...  

Science Conference Proceedings (OSTI)

in an aggressive combustion gas environment. Coating ..... M.I. Wood and G.F. Harrison, "Modeling The Deformation Of Coated. Superalloys Under Thermal...


Evaluating the Effectiveness of the Massachusetts Workforce Development System Using No-Shows as a Non-Experimental Comparison Group  

E-Print Network (OSTI)

the Effect of Training Programs, Review of Economics andGroup in Evaluating Training Programs, Kalamazoo, MI: W. E.ed. ) Evaluating Manpower Training Programs , JAI Press:

Raphael, Steve; Stoll, Michael A.



David Chamulak  

NLE Websites -- All DOE Office Websites (Extended Search)

Laboratory, USA 2009: Ph.D., Michigan State University, East Lansing, MI, USA. curriculum vitae Publications Asymmetry and the Nucleosynthetic Signature of Nearly Edge-Lit...


Ivan Brida  

NLE Websites -- All DOE Office Websites (Extended Search)

Laboratory, USA 2009: Ph.D., Michigan State University, East Lansing, MI, USA. curriculum vitae Publications I. Brida and F. M. Nunes, A microscopic hyper-spherical model:...

Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Event or Meeting Title  

Science Conference Proceedings (OSTI)

... Page 22. Representation Root Causes 22 Kilogram Kilogram per Sq Kilograms per D Kilograms per Cu Kilograms per Un Kilograms per Mi ...



NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PVTD 2009 S. Richardson 102009 - 122013 Detroit, MI Installation of Retail Biofuel Infrastructure Supporting I-75 Green Corridor Project Install retail biofuel fueling...


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PMCPVTD FY2009 102009 - 122013 S. Richardson Royal Oak, MI Installation of Retail Biofuel Infrastructure Supporting I-75 Green Corridor Project Install retail biodiesel...


NETL: Mercury Emissions Control Technologies - Pilot Testing...  

NLE Websites -- All DOE Office Websites (Extended Search)

Utilities, ND; Detroit Edison, MI; and SaskPower, Canada. Contacts: For further information on this project, contact NETL Project Manager, Barbara Carney or Alan Bland from WRI...


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Motors LLC OEPMPVTD FY14-15 100113 - 093015 Bruce Mixer Warren, MI High Energy Lithium Batteries for PHEV Applications Develop technology and demonstrate a lithium ion...


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Novi, MI Next Generation Ultra Lean Burn Powertrain Demonstrate 45% thermal efficiency on a light duty gasoline engine using MAHLE's Turbulent Jet Ignition System. Activities at...


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Pontiac, MI Lean Gasoline System Development for Fuel Efficient Small Cars This project accelerates development and synergistic integration of four cost competitive technologies to...


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Warren, MI Lean Gasoline System Development for Fuel Efficient Small Cars This project accelerates development and synergistic integration of four cost competitive technologies to...


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Milford, MI Lean Gasoline System Development for Fuel Efficient Small Cars This project accelerates development and synergistic integration of four cost competitive technologies to...


The use of pressurized bladders for stress control of superconducting magnets  

E-Print Network (OSTI)

separation as seen during the RTI test I o----c MiNd :weobolts as it was done in RTI. Further, a cantilever structure

Caspi, S.



Ceramics - TMS  

Science Conference Proceedings (OSTI)

"The Suspension Plasma Spraying of Bioceramics by Induction Plasma" ( Research Summary), E. Bouyer, F. Gitzhofer, and M.I. Boulos, February 1997, pp.


Surface Modification and Coatings  

Science Conference Proceedings (OSTI)

"The Suspension Plasma Spraying of Bioceramics by Induction Plasma" ( Research Summary), E. Bouyer, F. Gitzhofer, and M.I. Boulos, February 1997, pp.


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Holland, MI Distributed TE HVAC for Vehicle Applications Develop distributed thermoelectric HVAC components to supplement the central HVAC system in automotive applications and...


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Troy, MI Distributed TE HVAC for Vehicle Applications Develop distributed thermoelectric HVAC components to supplement the central HVAC system in automotive applications and...


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PMCPVT FY10-FY13 100109 - 073113 Carl Maronde Warren, MI Distributed TE HVAC for Vehicle Applications Develop distributed thermoelectric HVAC components to supplement the...


Ford Electric Battery Group | Open Energy Information  

Open Energy Info (EERE)

Ford Electric Battery Group Jump to: navigation, search Name Ford Electric Battery Group Place Dearborn, MI Information About Partnership with NREL Partnership with NREL Yes...


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

VT, and MI A Comprehensive Investigation of Unsteady Reciprocating Effects on Near-Wall Heat Transfer in Engines The objective of the proposed project is to use collaborative...


September 4, 2013 Selections for Vehicle Technologies Office...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

relative to current lithium-ion batteries. 999,778 Lubricant Formulations to Enhance Fuel Efficiency (Area of Interest 10) Ford Motor Company Dearborn, MI This project will...


1 Introduction  

E-Print Network (OSTI)

cal/bilevel structures, stochastic programming with applications to electricity spot market. 1Department of Mathematics, Wayne State University, Detroit, MI 48202...


Pulte/Del Webb | Open Energy Information  

Open Energy Info (EERE)

MI Information About Partnership with NREL Partnership with NREL Yes Partnership Type Test & Evaluation Partner Partnering Center within NREL Electricity Resources & Building...

Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Pulte | Open Energy Information  

Open Energy Info (EERE)

MI Information About Partnership with NREL Partnership with NREL Yes Partnership Type Test & Evaluation Partner Partnering Center within NREL Electricity Resources & Building...



Science Conference Proceedings (OSTI)

Apr 20, 2013 ... The authors of this articleand organizers of ICME 2013are Mei Li, Ford Motor Company, Dearborn, MI; Carelyn Campbell, NIST,...


jtechD1100195 1656..1671  

NLE Websites -- All DOE Office Websites (Extended Search)

bulence and volume-averaged vertical air motion within the radar sampling volume are the primary sources of uncertainty in retrieving cloud and precipitation mi- crophysical...


Universidad Collaboration  

E-Print Network (OSTI)

of Iowa, Iowa City, IA 52242, U.S.A. L.J. Dauwe University of Michigan­Flint, Flint, MI 48502, U.S.A. M

Fermi National Accelerator Laboratory


Double Charm Baryons at SELEX James S. Russ  

E-Print Network (OSTI)

of Michigan-Flint, Flint, MI 48502, U.S.A. M. Gaspero, M. Iori University of Rome "La Sapienza" and INFN, Rome

Fermi National Accelerator Laboratory


Doubly-charmed Discovered?  

E-Print Network (OSTI)

City , IA 52242, U.S.A. L.J. Dauwe University of Michigan-Flint, Flint, MI 48502, U.S.A. M. Gaspero, M

Fermi National Accelerator Laboratory


arXiv:0902.0355v1[hep-ex]2Feb2009 UASLPIF09001  

E-Print Network (OSTI)

University of Iowa, Iowa City, IA 52242, U.S.A. nUniversity of Michigan-Flint, Flint, MI 48502, U.S.A. o

Akgun, Ugur


Relocation Request Form The Ohio State University Page 1 of 1  

E-Print Network (OSTI)

____________________________________________ to ______________________________ , Ohio Expenses Mileage or For 1/1/12-12/31/12 _________ miles @ $ .23/mi = Gasoline For 1/1/13-12/31/13


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2217 General Motors Corporation EE PMCPVT FY2012 Appx. 11 months Rondle Harp Brownstown, MI GM Battery Pack Assembly Plant - Electric Substation Upgrade Addition of supplemental...



U.S. Energy Information Administration (EIA)

SEPT02MI 1. Monroe Coal Detroit Edison Co 2. Donald C Cook Nuclear Indiana Michigan Power Co 3. Ludington Pumped Storage Consumers Energy Co 4. ...


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

302014 Farmington Hills, MI Silicon-Nanowire-Based Lithium-Ion Batteries with Doubling Energy Density Materials research and testing to double energy density of lithium-ion...


DOE Joint Genome Institute 2008 Progress Report  

E-Print Network (OSTI)

proteins for biofuel production. Trends in Mi- crobiology,could help improve biofuel production. Diatom Genome Helpsa key target. Current biofuel production meth- ods, such as

Gilbert, David



NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Upgrade Compressed Natural Gas Facility at existing station located in Detroit, MI. This CX form is for one location in this project selected under Clean Cities FOA...


Microsoft Word - Grazing Factsheet.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

by either a Vario MACRO Elemental analyzer (Elementar Americas, Inc., Mt Laurel, NJ) or a Leco Tru Spec CN analyzer (Leco Corporation, Saint Joseph, MI). Inorganic carbon...


Previous Session - TMS  

Science Conference Proceedings (OSTI)

... University, Houghton, MI 49931; B.K. Cheong, W.M. Kim, S.G. Kim, Materials Design Laboratory, Korea Institute of Science and Technology, Seoul, Korea.


Other Participants 1992 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

, Sparks , NV Gateway High School , Monroeville , PA Grant High School, Portland , OR Hanford High School , Richland , WA Harrison High School , Farmington Hills , MI Henry M....


New Tools, New Science: Biology  

NLE Websites -- All DOE Office Websites (Extended Search)

transcriptomics, proteomics, and metabolomics analyses as well as high spatial resolution electron and fluorescence microscopy. MiCRoSCoPy Multi-photon fluorescence microscope:...


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EE EE0001814 PMC 2010 John Jason Conley 01012010-05012013 Livonia, MI Commercial EV Development and Manufacturing Program Battery pack development for the EV truck...


Task 1: Hydrate Code release, Maintenance and Support  

NLE Websites -- All DOE Office Websites (Extended Search)

in preparation include studies of methanotrophy in mi- crobial mats, Arctic lakes, the Gulf of Mexico and suboxic marine basins. Each of these manuscripts has been drafted and...


Black carbon aerosols and the third polar ice cap  

E-Print Network (OSTI)

estimations in global aerosol models, Atmos. Chem. Phys. ,Cloud mi- crophysics and aerosol indirect efefcts in theuncertainties in assessing aerosol effects on climate, Ann.

Menon, Surabi


Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tumor initiating but differentiated luminal-like breast cancer ...  

... Oslo, Norway; cCancer Stem Cell Innovation Center, Oslo ... the above explanation always must be ... Fold change analysis of the miRNA microarray ...


James Fekete  

Science Conference Proceedings (OSTI)

... Licensed Professional Engineer State of Michigan. ... Ph.D. Materials Science and Engineering, The University of Michigan, Ann Arbor, MI (1986). ...



Full Text  

E-Print Network (OSTI)

Department of Mathematics, Michigan State University, East Lansing, MI 48824- 1027, USA. Received June 29, 1999. Abstract. Stanley (Advances in Math. 111...


Abstract for Ivan Brida  

NLE Websites -- All DOE Office Websites (Extended Search)

Michigan State University, East Lansing, MI A microscopic hyperspherical model: from structure to reactions. Application to 6He. We have developed a microscopic cluster model for...


Middle Eastern Entrepreneurs: At Home In The Mission  

E-Print Network (OSTI)

Print. Sengstock, Mary C. Chaldeans in Michigan. East Lansing, MI: Michigan State University, 2005. Arab Americans in Michigan. East Lansing: Michigan

Khoshaba, Christy



Center for Tobacco Policy Research at Saint Louis University. Project LEAP. Michigan  

E-Print Network (OSTI)

I NTRODUCTION Michigan I T HIS REPORT PROVIDES AN OVERVIEWCTPR) partnered with Michigan and seven other states toParticipating Partners in Michigan's Network MI Dept of

Jenine Harris



On feasibility based bounds tightening0  

E-Print Network (OSTI)

Jan 24, 2012 ... 3 Ind. and Op. Eng. Dept., University of Michigan, Ann Arbor MI, USA. Email: jonxlee@umich.edu. 4 LIX, Ecole Polytechnique, F-91128...


Validation Workshop  

Science Conference Proceedings (OSTI)

... Lewis Publishers: Chelsea, MI HY Aboul-Enein, et al. ... I've trusted system manufacturers to handle this. Should I have? ...




Science Conference Proceedings (OSTI)

... Measurements. Lewis Publishers: Chelsea, MI, p. 193 Page 8. ... hands. I've trusted system manufacturers to handle this. Should I have? ...




Science Conference Proceedings (OSTI)

... 5.8 Handling of test and calibration items ... JK Taylor, Quality Assurance of Chemical Measurements, Lewis Publishers, Chelsea, MI, 1987. ...




Science Conference Proceedings (OSTI)

... Measurements. Lewis Publishers: Chelsea, MI, p. 193 Page 15. ... hands. I've trusted system manufacturers to handle this. Should I have? ...



MFR PAPER 995 Millions are spent annually  

E-Print Network (OSTI)

. During Colu mbu 's time, bottoms of ships were covered with a mi xture of tallow and pitch in hope o f



NLE Websites -- All DOE Office Websites (Extended Search)

(mi) 7.2 43.8 Average driving style efficiency (distance weighted) 76% 80% Chevrolet Volt Vehicle Demonstration Fleet Summary Report Reporting period: May 2011 through March...


Other Participants 1999 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

MI Shawnee Mission South High School , Shawnee Mission , KS Skyline High School , Idaho Falls, ID Smoky Hill High School, Aurora, CO St. James High School , Montgomery , AL...


WSU foUndation/2006-2007 2006-2007 annUaL REPoRt  

E-Print Network (OSTI)

, Loïc, Manu, Marie-Jo, Chantale, Mi chèle, Anastasia, Patrick, Pierre, Anne, Ilizabethe, Eléa, Boris

Collins, Gary S.


On two relaxations of quadratically-constrained cardinality ...  

E-Print Network (OSTI)

Oct 18, 2012 ... Department of Electrical Engineering and Computer Science, University of Michigan, 1301 Beal Avenue,. Ann Arbor, MI 48109, USA. E-mail:...


SP58: Hydrogels for Stem Cell-Based Heart Muscle Regeneration  

Science Conference Proceedings (OSTI)

MI leads to chronic heart failure due to insufficient cardiomyocyte regeneration. The goal of this project is to design injectable, pH- and temperature-sensitive...


A Continuous Measure of Gross Primary Production for the Conterminous U.S. Derived from MODIS and AmeriFlux Data  

E-Print Network (OSTI)

Oklahoma (ARM) Metolius intermediate aged ponderosa pine (MI) Metolius new young pine (MN) Brookings (Bro) Freeman Ranch Mesquite Juniper (FRM) Wind

Xia, Jingfeng



Interatomic Potentials Repository Project  

Science Conference Proceedings (OSTI)

... EAM/FS setfl, Ti.eam.fs, This conversion was performed from GJ Ackland's parameters by MI Mendelev (Ames National Laboratory). ...



Functional profiling of microRNAs in stallions  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short non-coding RNAs that act as post-transcriptional regulators of gene expression in eukaryotic genomes and are thought to be critically involved in many biological processes. While the functions of sperm miRNAs in equine biology are yet to be determined, studies in mouse and humans suggest that sperm miRNAs regulate gene expression in the zygote and can indicate the status of male fertility. The aim of this study was to characterize the expression profiles of selected sperm miRNA in equine tissues and compare their expression levels in the sperm and testes of fertile/sexually mature and subfertile/sexually immature stallions. From sperm RNA-seq data, we selected 6 highly expressed miRNAs: miR-34b, -34c, -191, -223, -1248 and -1905c. Total RNA enriched with miRNAs was extracted from 10 adult tissues, sperm of 3 fertile and 3 subfertile stallions, and testes of five 1-year old and five 3-year old stallions. The RNA was polyadenylated, reverse transcribed into srcDNA, and examined through RT-PCR and qRT-PCR. Reverse transcriptase PCR on a panel of adult male tissues revealed ubiquitous expression of the 6 miRNAs, whereas transcription of miR-34c, -223, and -1905c was elevated in testes and sperm. Additionally, we showed that stallion sperm and testes contain transcripts of mature sperm-enriched tRNA-derived 2 small RNAs (mse-tsRNAs), which is a novel finding for the horse. A pilot study was conducted to quantify the expression of miR-34c and miR-1905c in the sperm of fertile and subfertile stallions. While the expression levels varied between individuals and the two fertility phenotypes, a significantly (p=0.04) elevated expression of miR-34c was observed in the subfertile group. Finally, due to the overall high expression of miR-1905c in sperm, its expression was qualified and quantified in the testes of 1-year old and 3-year old stallions. miR-1905c was expressed in all testes samples and no significant differences in expression level were observed between immature and maturing testes. Because the number of stallions was limited, the current results remain preliminary and further experimentation will be required. Nevertheless, the discovery of miRNAs in stallion sperm might lead to a new direction in the search of biomarkers for stallion fertility.

Wang, Aaron Stephen


Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Energy Efficiency and Conservation Block Grant Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U.S. Department of Energy Categorical Exclusion Determination Form Program or Field Office: Energy Efficiency and Conservation Block Grant Program Project Title MI-County-St. Clair Location: County St. Clair MI American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Develop County's Long Term Energy Efficiency and Conservation Strategy, 2) technical consultant


Cliff Hagan Baseball Stadium  

E-Print Network (OSTI)

DIY DIY DIYS Limestone Nicholasville S Upper Ave of Cham pions Euclid Ave University Dr CooperDr Alumni Dr VirginiaAve Huguelet Dr M axwell Dr WallerAve University Ct W oodland Ave E High St Rose St DIY (3.5 mi) Proposed Shared Use Trail (0.4 mi) !(l Bicycle Rack DIY Bicycle Repair Station 0 1

Hayes, Jane E.


A framework to enrich student interaction via cross-institutional microblogging  

Science Conference Proceedings (OSTI)

This paper introduces a framework for collaborative microblogging that we believe is useful in enriching student interaction, both in-class and outside of contact hours. The framework is called Microblogging for Community of Inquiry (MiCoI). MiCoI is ... Keywords: community of inquiry, microblogging, tertiary institution, twitter

Suku Sinnappan; Samar Zutshi



Fuzzy Hopfield neural network clustering for single-trial motor imagery EEG classification  

Science Conference Proceedings (OSTI)

An electroencephalogram (EEG) analysis system for single-trial classification of motor imagery (MI) data is proposed in this study. Unsupervised fuzzy Hopfield neural network (FHNN) clustering, together with active segment selection and multiresolution ... Keywords: Brain-computer interface (BCI), Electroencephalogram (EEG), Fractal dimension (FD), Fuzzy Hopfield neural network (FHNN), Motor imagery (MI), Wavelet transform

Wei-Yen Hsu



Paper Number: 01-2263 An ASAE Meeting Presentation  

E-Print Network (OSTI)

at hq@asae.org or 616-429-0300 (2950 Niles Road, St. Joseph, MI 49085-9659 USA). #12;per cow, and manure presentation, please contact ASAE at hq@asae.org or 616-429-0300 (2950 Niles Road, St. Joseph, MI 49085. Manure applications increase soil organic matter, improve soil tilth, and increase water holding capacity

Tennessee, University of


MicroRNA expression profiling of human breast cancer identifies new markers of tumour subtype  

E-Print Network (OSTI)

Abstract Background MicroRNAs (miRNAs), a class of short non-coding RNAs found in many plants and animals, often act post-transcriptionally to inhibit gene expression. Results Here we report the analysis of miRNA expression in 93 primary human...

Blenkiron, Cherie; Goldstein, Leonard D; Thorne, Natalie P; Spiteri, Inmaculada; Chin, Suet-Feung; Dunning, Mark J; Barbosa-Morais, Nuno L; Teschendorff, Andrew E; Green, Andrew R; Ellis, Ian O; Tavare, Simon; Caldas, Carlos; Miska, Eric A



Molecular titration by MicroRNAs and target mimic inhibitors  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short, highly conserved non-coding RNA molecules that repress gene expression in a sequence-dependent manner. Each miRNA is predicted to target hundreds of genes, and a majority of protein-coding ...

Ebert, Margaret S. (Margaret Sarah)



Commissioning Of The MINER{nu}A Tracking Prototype  

Science Conference Proceedings (OSTI)

MINER{nu}A is a neutrino scattering experiment that uses the NuMI beamline at Fermilab. A Tracking Prototype was assembled, commissioned and tested at Fermilab before moving it into the NuMI beamline. A description of some of the main commissioning activities is presented here.

Castorena, J.; Felix, J.; Higuera, A.; Urrutia, Z. [Universidad De Guanajuato, Division De Ciencias E Ingenierias, Leon, Guanajuato (Mexico); Zavala, G. [Universidad De Guanajuato, DCEA, Guanajuato, Guanajuato (Mexico)



U.S. Natural Gas Pipeline Exports by Point of Exit  

Annual Energy Outlook 2012 (EIA)

Eastport, ID 0 252 113 12 10 1998-2011 Calais, ME 0 0 2,131 452 1,028 6,952 2007-2011 Detroit, MI 22,904 27,220 43,980 44,275 43,690 50,347 1996-2011 Marysville, MI 9,158 8,756...


U.S. Natural Gas Pipeline Exports by Point of Exit  

Annual Energy Outlook 2012 (EIA)

1973-2013 Eastport, ID 2011-2011 Calais, ME 1,824 1,853 2,021 1,528 433 652 2011-2011 Detroit, MI 4,331 4,801 3,571 4,430 3,769 3,933 2011-2011 Marysville, MI 4,807 5,273 2,983...


MicroRNA targeting in mus musculus and Caenorhabditis elegans  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are small, approximately 22 nucleotide RNAs that regulate gene expression post-transcriptionally by base-pairing to complementary sites in the target mRNA. The first miRNA, lin-4, was discovered in 1993 ...

Lafkas, Ginamarie N



Exploring essential attributes for detecting MicroRNA precursors from background sequences  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) have been shown to play important roles in post-transcriptional gene regulation. The hairpin structure is a key characteristic of the microRNAs precursors (pre-miRNAs). How to encode their hairpin structures is a critical step to correctly ...

Yun Zheng; Wynne Hsu; Mong Li Lee; Limsoon Wong



Brief Communication: Computational identification of 48 potato microRNAs and their targets  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) are a new family of small RNA molecules known in animals and plants, whose conservation among species suggests that they bear conserved biological functions. So far, little is known about miRNA in Solanum tuberosum species. Using previously ... Keywords: Computational analyses, MicroRNA, Solanum tuberosum, Transcription factor

Wenwei Zhang; Yuping Luo; Xi Gong; Wenhong Zeng; Siguang Li



IEEE TRANSACTIONS ON VEHICULAR TECHNOLOGY 1 Efficient Message Composition and Coding for  

E-Print Network (OSTI)

describe a deployment in several vehicles at the Toyota Technical Center in Ann Arbor, MI. Then, using data. This work has been supported by a Toyota research contract at the University of Illinois at Urbana Champaign. Laberteaux are at the Toyota Technical Center in Ann Arbor, MI. email lorenzo.caminiti--derek.caveney--ken.laberteaux@tema.toyota


Microsoft Word - S07409_2010_SER  

Office of Legacy Management (LM)

meters (m) m 3.281 ft miles (mi) 1.609 kilometers (km) km 0.6214 mi pounds (lb) 0.454 kilograms (kg) kg 2.205 lb gallons 3.785 liters (L) L 0.2642 gallons square feet (ft 2 )...


Most mammalian mRNAs are conserved targets of microRNAs  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are small endogenous RNAs that pair to sites in mRNAs to direct post-transcriptional repression. Many sites that match the miRNA seed (nucleotides 27), particularly those in 3? untranslated regions ...

Friedman, Robin Carl


Genome-wide identification of Ago2 binding sites from mouse embryonic stem cells with and without mature microRNAs  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are 1922-nucleotide noncoding RNAs that post-transcriptionally regulate mRNA targets. We have identified endogenous miRNA binding sites in mouse embryonic stem cells (mESCs), by performing photo-cross-linking ...

Leung, Anthony K. L.


Identification of many microRNAs that copurify with polyribosomes in mammalian neurons  

E-Print Network (OSTI)

, Wellman 8, 50 Blossom Street, Massachusetts General Hospital, Boston, MA 02114. E-mail: ruvkun, the miRNAs displayed a bimodal distribution with peak miRNA abundance in the light fraction containing m for helpful discussions and comments on the manuscript. This research was supported by a Department of Energy

Church, George M.


Biophysical Journal Volume 66 May 1994 1726-1732 Cooperative Action between Band 3 and Glycophorin A in Human  

E-Print Network (OSTI)

. Further, immobilization and rigidification did not occur when antibodies were bound to Miltenberger V in Miltenberger V (MiV) red cells in which a variant of gly- cophorin A lacks most of its cytoplasmic domain with antibody (100 ,ug/ml) 8 ± 1 * MiV, Miltenberger V. physical proximity of glycophorin A and band 3

Knowles, David William


Examination of mammalian microRNAs by high-throughput sequencing  

E-Print Network (OSTI)

Small non-coding RNAs play an important role in a wide range of cellular events. MicroRNAs (miRNAs) are an abundant class of small RNAs that post-transcriptionally repress expression of their target genes. Since miRNA ...

Chiang, HyoJin Rosaria


Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Acute liver injury upregulates microRNA-491-5p in mice, and its overexpression sensitizes Hep G2 cells for tumour necrosis factor-alpha-induced apoptosis.  

E-Print Network (OSTI)

expression of AFP, hsp-90 and NF-kB. Acknowledgements This90; miRNA, microRNA; NF-kB, nuclear factor-k B; siRNA, short90) and nuclear factor-kB (NF-kB). Overexpression of miRNA-

Wu, Jian; Zern, M A



MicroRNAs Modulate the Dynamics of the NF-kB Signaling Pathway  

E-Print Network (OSTI)

Background: NF-kB, a major transcription factor involved in mammalian inflammatory signaling, is primarily involved in regulation of response to inflammatory cytokines and pathogens. Its levels are tightly regulated since uncontrolled inflammatory response can cause serious diseases. Mathematical models have been useful in revealing the underlying mechanisms, the dynamics, and other aspects of regulation in NF-kB signaling. The recognition that miRNAs are important regulators of gene expression, and that a number of miRNAs target different components of the NF-kB network, motivate the incorporation of miRNA regulated steps in existing mathematical models to help understand the quantitative aspects of miRNA mediated regulation. Methodology/Principal findings: In this study, two separate scenarios of miRNA regulation within an existing model are considered. In the first, miRNAs target adaptor proteins involved in the synthesis of IKK that serves as the NF-kB activator. In the second, miRNAs target different isoforms of IkB that act as NF-kB inhibitors. Simulations are carried out under two different conditions: when all three isoforms of IkB are present (wild type), and when only one isoform (IkBa) is present (knockout type). In both scenarios, oscillations in the NF-kB levels are observed and are found to be dependent on the levels of miRNAs. Conclusions/Significance: Computational modeling can provide fresh insights into intricate regulatory processes. The

Ida Vaz; Arvind Singh Mer; Alok Bhattacharya; Ramakrishna Ramaswamy



Project Award Spreadsheets 2010 12 21 1232.xlsx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

200,000 Delray Beach FL FL-022 64,092 130,000 Durango CO CO-003 16,416 58,500 Flint MI MI-005 112,900 199,814 Fort Wayne IN IN-003 251,591 195,700 Hailey ID ID-002...


Bidirectional search in a string with wavelet trees  

Science Conference Proceedings (OSTI)

Searching for genes encoding microRNAs (miRNAs) is an important task in genome analysis. Because the secondary structure of miRNA (but not the sequence) is highly conserved, the genes encoding it can be determined by finding regions in a genomic DNA ...

Thomas Schnattinger; Enno Ohlebusch; Simon Gog



Bidirectional search in a string with wavelet trees and bidirectional matching statistics  

Science Conference Proceedings (OSTI)

Searching for genes encoding microRNAs (miRNAs) is an important task in genome analysis. Because the secondary structure of miRNA (but not the sequence) is highly conserved, the genes encoding it can be determined by finding regions in a genomic DNA ... Keywords: Bidirectional search, Matching statistics, String matching

Thomas Schnattinger; Enno Ohlebusch; Simon Gog



PoS(Nufact08)096 Copyright owned by the author(s) under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike Licence. http://pos.sissa.it  

E-Print Network (OSTI)

MI The two NuMI horns are designed for remote handling and exchange. A shielded and equipped work cell exists for remote handling and exchange. Special effort is put into the optimisation of dedicated tooling and in to ensure a high uptime of the neutrino beam line. Remote horn handling and remote horn exchange have

McDonald, Kirk


Melt index prediction using optimized least squares support vector machines based on hybrid particle swarm optimization algorithm  

Science Conference Proceedings (OSTI)

Melt index (MI) is considered as one of the most important variables of the quality, which determines the product specifications. Thus, a reliable estimation of MI is crucial in the quality control of the practical processes in the propylene polymerization ... Keywords: Ant colony optimization, Immune clone particle swarm optimization, Industrial polypropylene manufacture, Least squares support vector machines, Melt index prediction

Huaqin Jiang, Zhengbing Yan, Xinggao Liu



Neutrinos from Stored Muons STORM Target Station Conceptualg p  

E-Print Network (OSTI)

) systems · Work cell for hot handling and failed component repair/replacementWork cell for hot handling and failed component repair/replacement · Remote handling fixtures and camera system · Hot component storageDesign Approach · Utilize NuMI style target chase and positioning modules · Utilize NuMI style hot handling

McDonald, Kirk



NLE Websites -- All DOE Office Websites (Extended Search)

François Rémi Carrié [Clear All Filters] François Rémi Carrié [Clear All Filters] 2013 Wargocki, Pawel, Max H. Sherman, Willem de Gids, Peter Wouters, Francis Allard, François Rémi Carrié, Paolo Carrer, and Stylianos Kephalopolous. Proposed Research Agenda for Achieving Indoor Air Quality Supporting Health and Comfort in Highly Energy Efficient Buildings., 2013. 2002 Carrié, François Rémi, Ronnen M. Levinson, Tengfang T. Xu, Darryl J. Dickerhoff, William J. Fisk, Jennifer A. McWilliams, Mark P. Modera, and Duo Wang. "Laboratory and field testing of an aerosol-based duct-sealing technology for large commercial buildings." ASHRAE Transactions (2002). Xu, Tengfang T., François Rémi Carrié, Darryl J. Dickerhoff, William J. Fisk, Jennifer A. McWilliams, Duo Wang, and Mark P. Modera. "Performance of


Distribution of Mutual Information  

E-Print Network (OSTI)

In the analysis of time series from nonlinear sources, mutual information (MI) is used as a nonlinear statistical criterion for the selection of an appropriate time delay in time delay reconstruction of the state space. MI is a statistic over the sets of sequences associated with the dynamical source, and we examine here the distribution of MI, thus going beyond the familiar analysis of its average alone. We give for the first time the distribution of MI for a standard, classical communications channel with Gaussian, additive white noise. For time series analysis of a dynamical system, we show how to determine the distribution of MI and discuss the implications for the use of average mutual information (AMI) in selecting time delays in phase space reconstruction.

Henry D. I. Abarbanel; Naoki Masuda; M. I. Rabinovich; Evren Tumer



U.S. Department of Energy National Environmental Policy Act categorical exclusion determination  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Farmington Hills MI-City-Farmington Hills Location: City Farmington Hills MI American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Establish regional energy office; 2) provide grants to conduct comprehensive energy audits for commercial and residential buildings; 3) financial incentive program; 4) building retrofits to include: 4a) lighting retrofits, occupancy sensors, building management controls, and ice controls in two buildings and installation of solar hot water heater, 4b) green roof, solar hot water heater, and sky lights and solar tubes at City Hall, and 4c) Mayor's Youth Council Program to purchase a foreclosed home and renovate to


U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-County-Livingston MI-County-Livingston Location: County Livingston MI American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Development of an energy efficiency and conservation strategy (CX-8/14/09); 2) retrofit of boiler systems for the Administration Building, Courthouse, and County Jail; 3) retrofit of heating, ventilating, and air conditioning (HVAC) control systems for the Administration Building, Courthouse, Animal Shelter, Law Center, Judicial Center, and County Jail; 4) provision of project management services for EECBG-funded projects, 5) retrofit of the HVAC systems for the Jail and Animal Shelter, 6) installation of lighting controls


U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Shelby, Charter Township of MI-City-Shelby, Charter Township of Location: City Shelby, Charter MI Township of American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Acquisition of technical services for development of an energy efficiency and conservation strategy and to conduct energy audits on all Township buildings (completed), 2) conduct energy efficiency building retrofits on the Shelby Township Municipal Building envelope (window replacement project), 3) conduct energy efficiency building retrofits to the Township Municipal Building (heating, ventilating, and air conditioning upgrades), 4) conduct energy efficiency building retrofits on township municipal buildings (lighting upgrades-Municipal Building, Detective Building, Parks & Recreation Gas Pump, Nature Center


U.S. Department of Energy National Environmental Policy Act Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-City-Warren MI-City-Warren Location: City Warren MI American Recovery and Reinvestment Act: Proposed Action or Project Description: 1) Conduct energy audits of several municipal buildings; 2) install green roof on Police Headquarters, 3) install green roof on Sanitation Building, 4) conduct a biomass feasibility study; and 5) conduct building retrofits based on audit recommendations in municipal buildings (Police Headquarters, Judicial Building, Water Garage, Sanitation Building, six identified Fire Stations, DPW Garage, Stilwell Manor, Ice Rink, Owen Jax, and Community Center): replacement of boilers; replacement of HVAC units; and installation of energy efficiency lighting, exit lights, and parking lot lights; and replace exit lights and install occupancy


Revue dEtudes Tibtaines  

E-Print Network (OSTI)

nouvelles classifications : gshin rje, ma mo, srin po, gnod sbyin, mi' am ci, sa bdag, btsan, bdud ; et lha, btsan, bdud, gza', dmu, srin po, rgyal po, ma mo4. Questionn sur les recoupements, mais aussi les diver- gences que prsentent ces trois listes, il... citant les an- ciens voquent la possibilit pour les klu dapparatre sous la forme dtres surnaturels mi-humains mi-serpents. Les anciens disent que dans la mer vivent des klu et des klu mo ou klu femelles tte et torse d'homme ou de femme et ...

Achard, Jean-Luc



Efficient Repeated Implementation  

E-Print Network (OSTI)

is an outcome function such that ?g(m) ? A for any message profile m = (m1, . . . ,mI) ?M g. Let G be the set of all feasible mechanisms. Given a mechanism g = (M g, ?g), we denote by Ng(?) ?M g the set of Nash equilibria of the game induced by g in state ?. We... and satisfies no veto power. The Maskin mechanism,M = (M,?), for f is defined as follows: Mi = ? A Z+ (where Z+ is the set of non-negative integers) for all i and ? satisfies 1. if mi = (?, f(?), 0) for all i, ?(m) = f(?); 2. if there exists some i...

Lee, J; Sabourian, Hamid


Pour servir a la numerisation des manuscrits tibetains de Dunhuang conserves a la Bibliotheque Nationale : II. Un fichier de Marcelle Lalou  

E-Print Network (OSTI)

'i mdo. 129, INV. 116 (quinzimedes textes mentionns la suite du texte 5). = Otani 810 ? rnam par mi rtog par 'jug pa zhes bya ba'igzungs. ! Avikalpapravesha.- rnam par snang mdzad chos kyi rje. 257, INV. 2 (dbut du texte 2).- rnam spyan drang ba smon... texte 4).- mi rtog pa'i bsam gtan la 'jug pa dam pa'i chos kyi mdo sde (las). 068,INV. 829 (dbut du texte, qui donne "myi rtog pa" et non "mi rtog pa".- moksa'i bshas pa rdzogs sho //. 0618, INV. 910 (fin du f. 22, l'orthographede la fiche est...

Chayet, Anne



Modulational instability of ion acoustic waves in e-p-i plasmas with electrons and positrons following a q-nonextensive distribution  

Science Conference Proceedings (OSTI)

The propagation of ion acoustic waves (IAWs) in plasmas composed of ions and nonextensive electrons and positrons is investigated. By means of the reduction perturbation technique, a nonlinear Schroedinger equation is derived and the modulation instability (MI) of ion acoustic waves is analyzed in detail. The effects of different ranges of the nonextensive parameter q on the MI are studied. The growth rate of the MI is also given for different values of the q parameter. It is also found that the ratio of the electron temperature to positron temperature and the ratio of the positron density to electron density modify the nature of IAWs instability and the solitary structures.

Eslami, Parvin [Department of Physics, Ferdowsi University of Mashhad, Mashhad (Iran, Islamic Republic of); Mottaghizadeh, Marzieh [Department of Physics, Mashhad Branch, Islamic Azad University, Mashhad (Iran, Islamic Republic of); Pakzad, Hamid Reza [Department of Physics, Bojnourd Branch, Islamic Azad University, Bojnourd (Iran, Islamic Republic of)



Multi-batch slip stacking in the Main Injector at Fermilab  

SciTech Connect

The Main Injector (MI) at Fermilab is planning to use multi-batch slip stacking scheme in order to increase the proton intensity at the NuMI target by about a factor of 1.5.[1] [2] By using multi-batch slip stacking, a total of 11 Booster batches are merged into 6, 5 double ones and one single. We have successfully demonstrated the multibatch slip stacking in MI and accelerated a record intensity of 4.6E13 particle per cycle to 120 GeV. The technical issues and beam loss mechanisms for multibatch slip stacking scheme are discussed.

Seiya, K.; Berenc, T.; Chase, B.; Dey, J.; Joireman, P.; Kourbanis, I.; Reid, J.; /Fermilab



Revista Iguanazul, Number 2  

E-Print Network (OSTI)

- queo pero sabas hacer dibujos. Cmo has crecido mucho y cambiado bastante! Te acuerdas? Me pregunt sonriendo. Si usted no me lo recuerda, yo...para nada. Le con- test. Me qued observando el dibujo que hizo recordar mi in- fancia y mis sueos... nuestra madre. La voz de la vieja rompi mi breve silencio y continu. Te voy a traer algo. De algn lugar vi que sac algo como una cuerdita. Era un collar parecido al que yo traa en el cuello. Se parece a este que dej mi mam. Le coment. S...

Santopietro, Judith


Note: This page contains sample records for the topic "mi 1974-1975 1981-1982" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


well | OpenEI  

Open Energy Info (EERE)

43 43 Varnish cache server Browse Upload data GDR 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load) Guru Meditation: XID: 2142280543 Varnish cache server well Dataset Summary Description The California Division of Oil, Gas, and Geothermal Resources contains oil, gas, and geothermal data for the state of California. Source California Division of Oil, Gas, and Geothermal Resources Date Released February 01st, 2011 (3 years ago) Date Updated Unknown Keywords California data gas geothermal oil well Data application/vnd.ms-excel icon California district 1 wells (xls, 10.1 MiB) application/vnd.ms-excel icon California district 2 wells (xls, 4 MiB) application/vnd.ms-excel icon California district 3 wells (xls, 3.8 MiB) application/zip icon California district 4 wells (zip, 11.2 MiB)


Property:Volume | Open Energy Information  

Open Energy Info (EERE)

Volume Volume Jump to: navigation, search Property Name Volume Property Type Quantity Description Any unit of volume. For example, the mean estimated reservoir volume at location based on the USGS 2008 Geothermal Resource Assessment if the United States. Use this type to express a quantity of three-dimensional space. The default unit is the cubic meter (m³). Acceptable units (and their conversions) are: Cubic Meters - 1 m³,m3,m^3,cubic meter,cubic meters,Cubic Meter,Cubic Meters,CUBIC METERS Cubic Kilometers - 0.000000001 km³,km3,km^3,cubic kilometer,cubic kilometers,cubic km,Cubic Kilometers,CUBIC KILOMETERS Cubic Miles - 0.000000000239912759 mi³,mi3,mi^3,mile³,cubic mile,cubic miles,cubic mi,Cubic Miles,CUBIC MILES Cubic Feet - 35.314666721 ft³,ft3,ft^3,cubic feet,cubic


Annual Energy Outlook 2013 Early Release Reference Case  

U.S. Energy Information Administration (EIA) Indexed Site

Vehicle Choice Modeling and Vehicle Choice Modeling and Projections for the Annual Energy Outlook John Maples Office of Energy Analysis, Energy Efficiency and End Use January 25, 2013 | Detroit, MI Outline John Maples, Vehicle Choice Models and Markets Detroit, MI, January 25, 2013 2 * Overview of model structure and inputs * Battery electric vehicles and current state of the market * Projections of battery electric vehicles in the Annual Energy Outlook 2013 * High Battery Technology case in the Annual Energy Outlook 2012 Overview of model structure and inputs 3 John Maples, Vehicle Choice Models and Markets Detroit, MI, January 25, 2013 Light duty vehicle technology market penetration John Maples, Vehicle Choice Models and Markets Detroit, MI, January 25, 2013 4 * Technologies affecting light-duty vehicle fuel economy are


Report Notes  

NLE Websites -- All DOE Office Websites (Extended Search)

Notes Notes 1 "Overall AC electrical energy consumption (AC Wh/mi)" is based on AC electricity consumed during charging events which began during the reporting period and distance driven during all trips in the reporting period. 2 "Overall DC electrical energy consumption (DC Wh/mi)" is based on net DC electricity discharged from or charged to the plug-in battery pack and distance driven during all trips in the reporting period. DC Wh/mi may not be comparable to AC Wh/mi if AC electricity charged prior to the reporting period was discharged during driving within the reporting period, or if AC electricity charged during the reporting period was not discharged during driving within the reporting period. 3 Trips when the plug-in battery pack charge was depleted to propel the vehicle throughout


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5661 5661 USAMP EE Ford, Chrysler, GM PMC/PVT 2012/ 48 months Aaron Yocum Three sites in MI, one in Canada Validation of Material Models for Automotive Carbon-Fiber Composite Structures via Physical and... SUMMARY CX - Computer design, analysis and validation for lightweight front bumper and crush can systems. Adrienne Riggi Digitally signed by Adrienne Riggi DN: cn=Adrienne Riggi, o=NETL, ou=Vehicles, email=Adrienne.Riggi@NETL.DOE.GOV, c=US Date: 2012.02.13 18:08:52 -05'00' 02 13 2012 john ganz Digitally signed by john ganz DN: cn=john ganz, o=netl, ou=environmental compliance division, email=john.ganz@netl.doe.gov, c=US Date: 2012.04.05 13:16:26 -04'00' 4 5 2012 Warren, MI; Dearborn, MI; Southfield, MI; West Ontario, Canada are the four CX(A) locations for this project.


U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-NOTTAWASEPPI HURON BAND OF THE POTAWATOMI MI-TRIBE-NOTTAWASEPPI HURON BAND OF THE POTAWATOMI Location: Tribe MI-TRIBE- NOTTAWASEPPI HURON BAND OF THE POTAWATOMI MI American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Funds for incremental costs associated with building three LEED certified homes on the Pine Creek Reservation and acquiring technical services for project management services for their construction (incremental costs are for purchasing materials for foundation walls, lumber [sealants and energy heel truss], additional framing required, geothermal heat pump, plumbing, insulation, landscaping, LEED supervision and general conditions) Conditions: None Categorical Exclusion(s) Applied: A9, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21


DOE Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-MATCH-E-BE-NASH-SHE-WISH BAND OF POTTAWATOMI MI-TRIBE-MATCH-E-BE-NASH-SHE-WISH BAND OF POTTAWATOMI INDIANS Location: Tribe MI-TRIBE-MATCH- E-BE-NASH-SHE- WISH BAND OF POTTAWATOMI INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Match-E-Be-Nash-She-Wish Tribe of Pottawatomi Indians of Michigan proposes to conduct energy audits and life cycle cost analyses for several Tribal homes (approximately 25). The proposed actions would involve planning and conducting energy audits, which may include environmental monitoring to determine building energy efficiency, for residential and Tribal buildings. Electricity and fuel consumption and associated costs would be determined. The audits are intended to identify potential energy savings. Conditions: None


GHG emissions | OpenEI  

Open Energy Info (EERE)

GHG emissions GHG emissions Dataset Summary Description These datasets include GHG and CO2 emissions statistics for the European Union (EU). The statistics are available from the European Commission. Source European Commission Date Released Unknown Date Updated Unknown Keywords Biofuels CO2 emissions EU GHG emissions Data application/vnd.ms-excel icon Total GHG and CO2 Emissions for EU (xls, 853.5 KiB) application/vnd.ms-excel icon GHG Emissions by Sector, all member countries (xls, 2 MiB) application/vnd.ms-excel icon GHG Emissions from Transport, all member countries (xls, 1.3 MiB) application/vnd.ms-excel icon CO2 emissions by sector, all member countries (xls, 2.1 MiB) application/vnd.ms-excel icon CO2 emissions by transport, all member countries (xls, 1.5 MiB)


U.S. Department of Energy Office of Energy Efficiency and Renewable Energy NEPA Categorical Exclusion Determination  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-SAULT STE. MARIE TRIBE OF CHIPPEWA INDIANS OF MI-TRIBE-SAULT STE. MARIE TRIBE OF CHIPPEWA INDIANS OF MICHIGAN Location: Tribe MI-TRIBE-SAULT STE. MARIE TRIBE OF CHIPPEWA INDIANS OF MICHIGAN MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Sault Ste. Marie Tribe of Chippewa Indians proposes to perform energy efficiency lighting retrofits at several Tribal-owned facilities. Retrofit activities include installing ballasts, light sockets, lamps, and motion sensors. Conditions: Historic preservation clause applies to this application (Tribal Administration Building I located @ 523 Ashmun St [1949], Chippewa Service Building [1955], and Northern Hospitality Building [1955]) Categorical Exclusion(s) Applied: B2.5, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21


Ford Escape Advanced Research Vehicle Report Notes  

NLE Websites -- All DOE Office Websites (Extended Search)

Advanced Research Vehicle Advanced Research Vehicle Report Notes 1 "Overall AC electrical energy consumption (AC Wh/mi)" is based on AC electricity consumed during charging events which began during the reporting period and distance driven during all trips in the reporting period. 2 "Overall DC electrical energy consumption (DC Wh/mi)" is based on net DC electricity discharged from or charged to the plug-in battery pack and distance driven during all trips in the reporting period. DC Wh/mi may not be comparable to AC Wh/mi if AC electricity charged prior to the reporting period was discharged during driving within the reporting period, or if AC electricity charged during the reporting period was not discharged during driving within the reporting period.


A Cryptographically Secure Random Number G enerator for ... - CECM  

E-Print Network (OSTI)

*The work was supported by the MI T ACS NCE o f C a n ada . 1. Page 2. 1 Introduction. Definition 1.1 A pseudo random number generator, PRNG for short, is a.


DIY CHECKLIST FOR RENTERS Check your lease carefully. Make a very detailed inspection report before signing lease, include photos. Develop a good  

E-Print Network (OSTI)

DIY CHECKLIST FOR RENTERS Check your lease carefully. Make a very detailed inspection report before. Carpetdyeingforpaleandstainedcarpet. Re-caulkingandre-groutingofkitchenandbathrooms. Tileandbathresurfacingpaint. DIY FOR RENTERS;12DOM_MI089 DIY CHECKLIST FOR RENTERS WALLS Low-adhesivetapeorhookstohangartwork(neveruse Blu

Peters, Richard


The Combined Sensor Program: An AirSea Science Mission in the Central and Western Pacific Ocean  

Science Conference Proceedings (OSTI)

Twelve national research organizations joined forces on a 30-day, 6800 n mi survey of the Central and Tropical Western Pacific on NOAA's Research Vessel Discoverer. The Combined Sensor Program (CSP), which began in American Samoa on 14 March 1996,...

Madison J. Post; Christopher W. Fairall; Jack B. Snider; Yong Han; Allen B. White; Warner L. Ecklund; Klaus M. Weickmann; Patricia K. Quinn; Daniel I. Cooper; Steven M. Sekelsky; Robert E. McIntosh; Peter Minnett; Robert O. Knuteson



NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ingham Regional Medical Center EE CDP Tracking 80.10 BETD 2010 Nicholas D'Amico July 2010 to September 2010 Lansing, MI Energy Conservation Upgrades; Ingham Regional Medical...



E-Print Network (OSTI)

), Stockholm Intl Peace Research Inst, Oxford University Oress 337 p., 1997. Arkin, WM and J Handler, Naval Geochemistry (eds. AC Sigleo and A Hattori), Lewis Publishers, Inc., Chelsea, MI, 97-119, 1985. Brungot, AL


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI (Chester 2 reef) Midwest Regional Carbon Sequestration Partnership - Subtask 1.7 SOPO Subtask 1.7 - Collect dipole sonic data from a new lateral well in Chester 2 reef...


ASAE EP558 FEB04 Load Tests for Metal-Clad, Wood-Frame Diaphragms  

E-Print Network (OSTI)

Engineers ASAE is a professional and technical organization, of members worldwide, who are dedicated 2950 Niles Rd., St. Joseph, MI 49085-9659, USA ph. 269-429-0300, fax 269-429-3852, hq@asae.org #12;ASAE

Bohnhoff, David


ANSI/ASAE EP486.1 OCT00 Shallow Post Foundation Design  

E-Print Network (OSTI)

ASAE is a professional and technical organization, of members worldwide, who are dedicated 2950 Niles Rd., St. Joseph, MI 49085-9659, USA ph. 269-429-0300, fax 269-429-3852, hq@asae.org #12;ANSI

Bohnhoff, David


ANSI/ASAE EP559 FEB03 Design Requirements and Bending Properties for Mechanically Laminated  

E-Print Network (OSTI)

American Society of Agricultural Engineers ASAE is a professional and technical organization, of members, and biological systems 2950 Niles Rd., St. Joseph, MI 49085-9659, USA ph. 269-429-0300, fax 269-429-3852, hq

Bohnhoff, David


ANSI/ASAE EP484.2 FEB03 Diaphragm Design of Metal-Clad, Wood-Frame Rectangular Buildings  

E-Print Network (OSTI)

Society of Agricultural Engineers ASAE is a professional and technical organization, of members worldwide, and biological systems 2950 Niles Rd., St. Joseph, MI 49085-9659, USA ph. 269-429-0300, fax 269-429-3852, hq

Bohnhoff, David