Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


J.D. Power | Open Energy Information  

Open Energy Info (EERE)

D. Power D. Power Jump to: navigation, search Name J.D. Power Address 2625 Townsgate Road Westlake Village, CA 91361 Place Westlake Village, CA Zip 91361 Year founded 1968 Website http://www.jdpower.com Coordinates 34.158915°, -118.832738° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":34.158915,"lon":-118.832738,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Numerical Modeling of Acoustic Timescale Detonation J.D. Regele  

E-Print Network (OSTI)

Numerical Modeling of Acoustic Timescale Detonation Initiation J.D. Regele , D.R. Kassoy and O to perform one and two-dimensional simulations of acoustic timescale detonation initiation using thermal overdriven detonation wave that decays to a steady-state CJ wave. A 1-D parametric study of acoustic

Vasilyev, Oleg V.


Thermal behavior simulation of Ni/MH battery  

Science Journals Connector (OSTI)

Thermal behavior of overcharged Ni/MH battery is studied with microcalorimeter. The battery is installed in a special device in ... Quantity of heat and heat capacity of the battery charged at different state of ...

DaHe Li; Kai Yang; Shi Chen; Feng Wu



JD Wind 10 Wind Farm | Open Energy Information  

Open Energy Info (EERE)

10 Wind Farm 10 Wind Farm Jump to: navigation, search Name JD Wind 10 Wind Farm Facility JD Wind 10 Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner DWS/John Deere Wind Developer DWS/John Deere Wind Energy Purchaser Southwestern Public Service Location TX Coordinates 35.808304°, -101.994807° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.808304,"lon":-101.994807,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


JD Wind 4 Wind Farm | Open Energy Information  

Open Energy Info (EERE)

4 Wind Farm 4 Wind Farm Jump to: navigation, search Name JD Wind 4 Wind Farm Facility JD Wind 4 Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner John Deere Wind Developer DWS/John Deere Wind Energy Purchaser Xcel Energy Location Hansford County TX Coordinates 36.398384°, -101.376997° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.398384,"lon":-101.376997,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


JD Wind 8 Wind Farm | Open Energy Information  

Open Energy Info (EERE)

8 Wind Farm 8 Wind Farm Facility JD Wind 8 Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner DWS/John Deere Wind Developer DWS/John Deere Wind Energy Purchaser Southwestern Public Service Location TX Coordinates 35.808304°, -101.994807° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.808304,"lon":-101.994807,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


JD Wind 1 Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Wind Farm Wind Farm Facility JD Wind 1 Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner DWS/John Deere Wind Developer DWS/John Deere Wind Energy Purchaser Xcel Energy Location Hansford County TX Coordinates 36.398384°, -101.376997° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.398384,"lon":-101.376997,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


JD Wind 11 Wind Farm | Open Energy Information  

Open Energy Info (EERE)

1 Wind Farm 1 Wind Farm Facility JD Wind 11 Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner DWS/John Deere Wind Developer DWS/John Deere Wind Energy Purchaser Southwestern Public Service Location TX Coordinates 35.808304°, -101.994807° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.808304,"lon":-101.994807,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


JD Wind 2 Wind Farm | Open Energy Information  

Open Energy Info (EERE)

2 Wind Farm 2 Wind Farm Facility JD Wind 2 Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner DWS/John Deere Wind Developer DWS/John Deere Wind Energy Purchaser Xcel Energy Location TX/OK panhandle TX Coordinates 36.398384°, -101.376997° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.398384,"lon":-101.376997,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


JD Wind 3 Wind Farm | Open Energy Information  

Open Energy Info (EERE)

3 Wind Farm 3 Wind Farm Facility JD Wind 3 Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner DWS/John Deere Wind Developer DWS/John Deere Wind Energy Purchaser Xcel Energy Location TX/OK panhandle TX Coordinates 36.398384°, -101.376997° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.398384,"lon":-101.376997,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


JD Wind 7 Wind Farm | Open Energy Information  

Open Energy Info (EERE)

7 Wind Farm 7 Wind Farm Facility JD Wind 7 Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner John Deere Wind Developer DWS/John Deere Wind Energy Purchaser Xcel Energy Location TX Coordinates 35.808304°, -101.994807° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.808304,"lon":-101.994807,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


JD Wind 9 Wind Farm | Open Energy Information  

Open Energy Info (EERE)

9 Wind Farm 9 Wind Farm Facility JD Wind 9 Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner DWS/John Deere Wind Developer DWS/John Deere Wind Energy Purchaser Southwestern Public Service Location TX Coordinates 35.808304°, -101.994807° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":35.808304,"lon":-101.994807,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


JD Wind 5 Wind Farm | Open Energy Information  

Open Energy Info (EERE)

5 Wind Farm 5 Wind Farm Facility JD Wind 5 Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner John Deere Wind Developer DWS/John Deere Wind Energy Purchaser Xcel Location Sherman County TX Coordinates 36.466801°, -101.813446° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.466801,"lon":-101.813446,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


JD Wind 6 Wind Farm | Open Energy Information  

Open Energy Info (EERE)

6 Wind Farm 6 Wind Farm Facility JD Wind 6 Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner John Deere Wind Developer DWS/John Deere Wind Energy Purchaser Xcel Energy Location Sherman County TX Coordinates 36.466801°, -101.813446° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":36.466801,"lon":-101.813446,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Electric Automobile Ni-MH Battery Investigation in Diverse Situations  

Science Journals Connector (OSTI)

Abstract The electronic differential system ensures the robust control of the vehicle comportment on the road. This paper focuses Ni-MH Battery controlled by Buck Boost DC-DC converter power supply for EV. Sliding mode control based on space vector modulation (SVM-SMC) is proposed to achieve the tow rear driving wheel control. The performances of the proposed strategy controller give a satisfactory simulation results. The proposed control law increases the utility EV autonomous under several speed variations. Moreover, the future industrial's vehicle must take into considerations the battery material choice into design steps. The battery material model choice is a crucial item, and thanks to an increasing emphasis on vehicle range and performance, the Ni-MH battery could become a viable candidate that's our proposal battery model in the present work, in this way the present paper show a novel strategy of electric automobile (EA) power electronics studies when the current battery take into account the impact of the sliding mode control based onspace vector machine technique in the several speed variations using the primitive battery SOC of 60% state.

Brahim Mebarki; Belkacem Draoui; Lakhdar Rahmani; Boumedine Allaoua



Thermal analysis of nickel/metal (Ni/MH) hydride battery during charge cycle  

Science Journals Connector (OSTI)

A three-dimensional mathematical model containing temporal and spatial coordinates is presented for analyzing the thermal behavior and obtaining the internal temperature profile of cylindrical Ni/MH battery. This model is performed to investigate the ... Keywords: Ni/MH battery, charge, heat transfer coefficient, thermal analysis

Nabi Jahantigh; Ebrahim Afsharia



MEMORANDUM FOR SWG-2007-1623 Subject: Jurisdictional Determination (JD) for SWG-2007-1623 on Interdunal Wetlands  

E-Print Network (OSTI)

-1623 on Interdunal Wetlands Adjacent to Traditional Navigable Waters (TNWs) Summary The U.S. Environmental Protection wetlands for JD SWG-2007- 1623. This determination is based on our finding that these wetlands are adjacent interdunal wetlands for JD SWG-2007-1623. First, we provide a baseline assessment (in Section II

US Army Corps of Engineers


From Spider Robots to Half Disk Robots J-D. Boissonnat O. Devillers S. Lazard  

E-Print Network (OSTI)

From Spider Robots to Half Disk Robots J-D. Boissonnat O. Devillers S. Lazard INRIA, BP 93 06902 robot. The body of this robot is a single point and the legs are line segments attached to the body. The robot can only put its feet on some regions, called the foothold regions. Moreover, the robot is subject

Paris-Sud XI, Université de


Cem Kaner, Ph.D., J.D. Pat Bond, Ph.D.  

E-Print Network (OSTI)

Cem Kaner, Ph.D., J.D. Professor Director Pat Bond, Ph.D. Associate Professor Scott Tilley, Ph.D. Associate Professor Mike Andrews, Ph.D. Assistant Professor James Whittaker, Ph.D. Professor MISSION Create is active investigation of a product by an outsider who is more focused on the acceptability of the product


An Undergraduate Curriculum for Software Testing Cem Kaner, J.D., Ph.D.  

E-Print Network (OSTI)

1 An Undergraduate Curriculum for Software Testing Cem Kaner, J.D., Ph.D. February, 2001 Draft .3 an infinitely large expenditure on the testing of any nontrivial product. Cost/benefit tradeoffs lie: · Computer science · Epistemology · Human factors · Quality control · Engineering economics · Safety

Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


mHealth and global mental health: still waiting for the mH2 wedding?  

Science Journals Connector (OSTI)

The conjunction of high levels of mental illness and high levels of mobile phone usage in poorer countries highlights the potential for mH2 interventions i.e. mHealth (mobile technology-based) mental health i...

Conor Farrington; Angela Aristidou; Kai Ruggeri



Cem Kaner, J.D., Ph.D. Professor: Computer Science  

E-Print Network (OSTI)

Cem Kaner, J.D., Ph.D. Professor: Computer Science Florida Institute of Technology Measuring've discovered 593 bugs.Results ? We've run 80% of the test cases.Plan ? We've tested 80% of the lines of code.Product. We should be at that percentage on this product too. History across projects ? Beta testers have


RPS JDC Inc formerly JD Consulting L P | Open Energy Information  

Open Energy Info (EERE)

RPS JDC Inc formerly JD Consulting L P RPS JDC Inc formerly JD Consulting L P Jump to: navigation, search Name RPS JDC, Inc. (formerly JD Consulting L.P.) Place Austin, Texas Zip 78746 Product Austin-based consultancy for the engineering and environmental sectors, serving clients in Texas and along the Gulf Coast. Coordinates 30.267605°, -97.742984° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":30.267605,"lon":-97.742984,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


DeMartini et al 2012 In Press.pdf  

NLE Websites -- All DOE Office Websites (Extended Search)

Accepted Manuscript, which has been through the RSC Publishing peer review process and has been accepted for publication. Accepted Manuscripts are published online shortly after acceptance, which is prior to technical editing, formatting and proof reading. This free service from RSC Publishing allows authors to make their results available to the community, in citable form, before publication of the edited article. This Accepted Manuscript will be replaced by the edited and formatted Advance Article as soon as this is available. To cite this manuscript please use its permanent Digital Object Identifier (DOI®), which is identical for all formats of publication. More information about Accepted Manuscripts can be found in the Information for Authors.


Photothermal Response in Dual-Gated Bilayer Graphene M.-H. Kim,1  

E-Print Network (OSTI)

Photothermal Response in Dual-Gated Bilayer Graphene M.-H. Kim,1 J. Yan,1,2 R. J. Suess,3 T. E photoresponse in gapped bilayer graphene was investigated by optical and transport measurements. A pulse There is growing recognition that graphene has excep- tional potential as a new optoelectronic material, which has

Murphy, Thomas E.



E-Print Network (OSTI)

THE MODULUS OF CONTINUITY FOR 0(m)\\H SEMI-CLASSICAL LIMITS SCOTT A. WOLPERT Abstract. We study [13]. In [29] the author found that the microlocal lift to SL(2; R) S (H)1/2 of automorphic eigen result is equivalent to a limit-sum formula combining the Riemann zeta values (1 + it) and the elemen

Wolpert, Scott A.


Cotton Tolerance and Weed Management with Sharpen J.D. Reed, J.W. Keeling, and D.M. Petty  

E-Print Network (OSTI)

Cotton Tolerance and Weed Management with Sharpen J.D. Reed, J.W. Keeling, and D.M. Petty Texas (PPO) inhibitor herbicide that was registered in 2009 for use in corn, soybeans, sorghum and cotton. Field studies were conducted to evaluate cotton tolerance and preplant and in-season weed control

Mukhtar, Saqib


Water as Property Sandra B. Zellmer, Professor UNL College of Law and Jessica Harder, J.D., Water  

E-Print Network (OSTI)

be characterized as property under the law raises considerable controversy. In the western United States, water that jurisdictions that recognize private property rights in water, as in the western United States, haveWater as Property Sandra B. Zellmer, Professor UNL College of Law and Jessica Harder, J.D., Water

Nebraska-Lincoln, University of


Complete genome sequence of Hippea maritima type strain (MH2T)  

SciTech Connect

Hippea maritima (Miroshnichenko et al. 1999) is the type species of the genus Hippea, which belongs to the family Desulfurellaceae within the class Deltaproteobacteria. The anaerobic, moderately thermophilic marine sulfur-reducer was first isolated from shallow-water hot vents in Matipur Harbor, Papua New Guinea. H. maritima was of interest for genome se- quencing because of its isolated phylogenetic location, as a distant next neighbor of the ge- nus Desulfurella. Strain MH2T is the first type strain from the order Desulfurellales with a com- pletely sequenced genome. The 1,694,430 bp long linear genome with its 1,723 protein- coding and 57 RNA genes consists of one circular chromosome and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

Huntemann, Marcel [U.S. Department of Energy, Joint Genome Institute; Lu, Megan [Los Alamos National Laboratory (LANL); Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Hammon, Nancy [U.S. Department of Energy, Joint Genome Institute; Deshpande, Shweta [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Spring, Stefan [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute




SciTech Connect

We report four years of radio and X-ray monitoring of the Type IIn supernova SN 2006jd at radio wavelengths with the Very Large Array, Giant Metrewave Radio Telescope, and Expanded Very Large Array; at X-ray wavelengths with Chandra, XMM-Newton, and Swift-XRT. We assume that the radio and X-ray emitting particles are produced by shock interaction with a dense circumstellar medium. The radio emission shows an initial rise that can be attributed to free-free absorption by cool gas mixed into the nonthermal emitting region; external free-free absorption is disfavored because of the shape of the rising light curves and the low gas column density inferred along the line of sight to the emission region. The X-ray luminosity implies a preshock circumstellar density {approx}10{sup 6} cm{sup -3} at a radius r {approx} 2 Multiplication-Sign 10{sup 16} cm, but the column density inferred from the photoabsorption of X-rays along the line of sight suggests a significantly lower density. The implication may be an asymmetry in the interaction. The X-ray spectrum shows Fe line emission at 6.9 keV that is stronger than is expected for the conditions in the X-ray emitting gas. We suggest that cool gas mixed into the hot gas plays a role in the line emission. Our radio and X-ray data both suggest the density profile is flatter than r{sup -2} because of the slow evolution of the unabsorbed emission.

Chandra, Poonam [Department of Physics, Royal Military College of Canada, Kingston, ON K7K 7B4 (Canada); Chevalier, Roger A.; Irwin, Christopher M. [Department of Astronomy, University of Virginia, P.O. Box 400325, Charlottesville, VA 22904-4325 (United States); Chugai, Nikolai [Institute of Astronomy of Russian Academy of Sciences, Pyatnitskaya Street 48, 109017 Moscow (Russian Federation); Fransson, Claes [Department of Astronomy, Stockholm University, AlbaNova, SE-106 91 Stockholm (Sweden); Soderberg, Alicia M. [Smithsonian Astrophysical Observatory, 60 Garden Street, MS-20, Cambridge, MA 02138 (United States); Chakraborti, Sayan [Department of Astronomy and Astrophysics, Tata Institute of Fundamental Research, 1 Homi Bhabha Road, Colaba, Mumbai 400005 (India); Immler, Stefan, E-mail: Poonam.Chandra@rmc.ca [Astrophysics Science Division, NASA Goddard Space Flight Center, Greenbelt, MD 20771 (United States)



An experimental and modeling study of isothermal charge/discharge behavior of commercial NiMH cells  

E-Print Network (OSTI)

is used to predict and compare various charge algorithms so as to provide guidelines for application and hybrid-electric vehicles. For clean transportation, Ni­MH battery is presently the most promising battery evolution reaction was coupled with main electro- chemical reactions on both electrodes. A sensitivity


C. Rdiger, J.P. Walker, J.D. Kalma, G.R. Willgoose, and P.R. Houser (2004), Streamflow data assimilation: A study on nested catchments,  

E-Print Network (OSTI)

assimilation: A study on nested catchments, in Proceedings of the 2nd international CAHMDA workshop on: The Ter.P. Walker1, J.D. Kalma2, G.R. Willgoose3, and P.R. Houser4 1Dept. of Civil and Environmental Engineering "observations" and the evaluation data. The initial conditions and land surface forcing data are then degraded

Walker, Jeff


Jordan Canonical Form Given d N and K, the Jordan block Jd() is the upper-triangular (d d)-matrix  

E-Print Network (OSTI)

Jordan Canonical Form Given d N and K, the Jordan block Jd() is the upper-triangular (d ? d. Observations/Facts. (a) The number m of Jordan blocks (counting multiple occurrences of the same block. (c) The number of Jordan blocks corresponding to a given eigenvalue is the geometric multi- plicity

Smith, Gregory G.


The citation for this paper is: Spitler, J.D., X. Liu, S.J. Rees, C. Yavuzturk. 2005. Simulation and Optimization of Ground Source Heat  

E-Print Network (OSTI)

are potentially more efficient than conventional air-to-air systems. In practice, ground-source heat pump systems and Optimization of Ground Source Heat Pump Systems. 8th International Energy Agency Heat Pump Conference. Las Vegas. May 30-June 2. 1 #12;SIMULATION AND OPTIMIZATION OF GROUND SOURCE HEAT PUMP SYSTEMS J.D. Spitler


Evaluation of Zr(Ni, Mn){sub 2} Laves phase alloys as negative active material for Ni-MH electric vehicle batteries  

SciTech Connect

Laves phase alloys of compositions (Zr, Ti)(Ni, Mn, M){sub x} where M = Cr, V, Co, Al, and 1.9 < x < 2.1 with hexagonal C14 or cubic C15 structure have been studied in order to select the most suitable AB{sub 2} alloys as an active material for nickel-metal hydride (Ni-MH) batteries. With the selected alloy, feasibility of MH negative electrodes using industrial technology and containing more than 97% of the alloy powder has been demonstrated. 22 Ah Ni-MH batteries for electric vehicle application have been assembled, and 600 cycles have been achieved at steady C/3 charge and discharge rates and 80% depth of discharge.

Knosp, B. [Alcatel Alsthom Recherche, Marcoussis (France); Jordy, C.; Blanchard, P. [SAFT Research Dept., Marcoussis (France); Berlureau, T. [SAFT Advanced and Industrial Battery Div., Bordeaux (France)



Bilayer Graphene Photon Detector J. Y. Yan, M.-H. Kim, J. A. Elle, A. B. Sushkov, G. S. Jenkins, H. M. Milchberg  

E-Print Network (OSTI)

Bilayer Graphene Photon Detector J. Y. Yan, M.-H. Kim, J. A. Elle, A. B. Sushkov, G. S. Jenkins, H in graphene suggests that "hot electrons" created by incident light can provide the basis for a fast graphene in a "dual-gated" structure. This new "bolometer" has ultralow noise, besting existing detectors

Shapiro, Benjamin


Klymak, J.M., S. Legg, M.H. Alford, M. Buijsman, R. Pinkel, and J.D. Nash. 2012. The direct breaking of internal waves at steep topography. Oceanography 25(2):150159, http://dx.doi.org/10.5670/  

E-Print Network (OSTI)

of internal tide generation, computation of how much energy they trap and turn into turbulence. This approach waves forced by wind and by tides (Munk and Wunsch, 1998). Tracking the energy pathways of internal the energy balance of tides. Though simpler than wind-driven waves, the energy balance of internal tides



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MASON & HANGER CORPORATION MASON & HANGER CORPORATION February 10, 1998 U. S. Department of Energy Office of General Counsel, GC-52 1000 Independence Ave. SW. Washington, DC 20585 Subject: Reply comments to notice of inquiry concerning preparation of report to Congress on the Price-Anderson Act Dear Sir or Madam: Mason & Hanger Corporation has reviewed the Federal Register Notice published December 31, 1997. It is our intent to offer the attached replies to the listed questions contained in the Notice. Thank you for the opportunity to provide input to the report preparation process. Please contact myself or Alan G. Wagner, Esq. at (806) 477-7233 if you have any questions. Very truly yours,



NLE Websites -- All DOE Office Websites (Extended Search)

this work: David Randall, Kuanman Xu, Steve Ghan, Chris Doran, Steve Krueger, and James Hack. This research is supported by the U.S. Department of Energy (DOE) ARM Program under...


Prepared By Lon Hatamiya, MBA, JD  

E-Print Network (OSTI)

of Miami's Annual Employment and Expenditures are a Major Economic Engine In FY 2011, the University & THE ECONOMIC IMPACT OF THE More than 6 Billion Dollars annually in Positive Economic Contributions to the Local Communities, the Region and the State of Florida #12;1 The Economic Impact of the University of Miami

Shyu, Mei-Ling

Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


メタンハイドレート資源開発研究コンソーシアム 平成23年度事業報告 平成24年度事業計画 (概要) MH21プロジェクトリーダー 増田 昌敬  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

First Offshore MH Production Test First Offshore MH Production Test Takami Kawamoto JOGMEC June 7, 2013 1 機密性○ To conduct studies to establish the technological platform for commercialization of methane hydrate *Preparatory study for commercial production *Feasibility *Environmental Impacts *Overall evaluation of the total Program etc. Offshore Production Tests * 1 st Production Test - FY2012 * 2 nd Production Test - FY2014 Technological Studies * Designing and Manufacturing Systems for Flow Test * Studying Production Methods * Assessing Environmental Impacts * Resource Assessments Onshore Production Tests ・1 st Production Test 2002 ・ 2 nd Production Test in 2008 Resource Assessment in Eastern Nankai Trough ・Seismic


MH4D Development Plasma Science and Innovation Center  

E-Print Network (OSTI)

-parallel periodic boundaries ­ Operator matrix b.c. · Atomic physics development ­ Spheromak simulations · Other Development Phase II 16 · Spheromak t


`.h -WJR-94-3MH? Submitted k  

E-Print Network (OSTI)

demand for new cost-efficient drilling in geothermal environments, a three year rock melting program. CORT JOEN c. ROWLEY KENNETHWOLHLETZ I WORLDGEOTEERMM CONGRESS 1995 INTERNATIONAL GEOTHERMAL ASSOCIATIONOrSt@d by the UnlVOr81tyof Calttorma for the u,S, oe~flrnent of Energy under contract W. 7405. ENG.3& Etyacceptance


Microsoft Word - 150121_NPR3_Programmatic_Agreement_AG_MH  

NLE Websites -- All DOE Office Websites (Extended Search)

appropriate web hosting site. 3. The audio file will be an audio recording of the website material. 4. The smart phone application will be the development of material appropriate...


Plant Physiol. (1992) 99, 1381-1387 0032-0889/92/99/1 381/07/$01 .00/0  

E-Print Network (OSTI)

, Universite du Quebec a Montreal, C.P. 8888, Succ. "A", Montreal, Quebec, H3C 3P8 Canada (M.H., J.D., E.R., F.S.); Department of Biology, McGill University, 1205 Avenue Docteur Penfield, Montreal, Quebec, H3A IBI Canada (R.S.D.); and Departement de virologie, Institut Armand-Frappier, 531 Boul. des Prairies, Laval des Rapides, Quebec, H7V 1B7

Sarhan, Fathey


SOP077_r1_9_Safety Manual.doc 1 / 42 03/18/11 Harvard University  

E-Print Network (OSTI)

................................................................................... 5-1290 JD Deng ­ Cleanroom

Gunawardena, Jeremy


Mailed January 11, 1934January 18, 1934 7 WHY THE 'JdATHdR ? ----I___---  

E-Print Network (OSTI)

1 have traveled a great deal -.- i n Concordll found mni- fold wonders i n the snow and ice saw a more Elysian blus than my shadow. Persian from my cap to my boots, such as no mortal can produce forms; the ghosts Ice flowers (beautiful hoarfrost crystals like bunches of ferns found on a sheet


Unsteady effects in dense, high speed, particle laden flows J.D. Regele a,  

E-Print Network (OSTI)

t Dense high speed non-compacted multiphase flows exist in variable phase turbines, explosions, and ejec multiphase flows can be found in a variety of practical applications such as variable phase turbines

Dabiri, John O.


CEM KANER, J.D., Ph.D. Department of Computer Sciences  

E-Print Network (OSTI)

contains several protections for consumers and "mass-market" customers. Larger customers (or transactions UCITA creates a new category of transaction, the "mass-market" transaction but small business and these types of transactions are not mass-market. · Software that is almost in any way customized


Martin T. Meehan, J.D., M.P.A. University of Massachusetts Lowell  

E-Print Network (OSTI)

activities that sustain the economic, environmental and social health of the region. Under my leadership buildings, increased student housing, enhanced campus life and strengthened alumni relations. As a result colleges or universities in the nation to offer students a 30-year ROI of more than $1 million. My

Massachusetts at Lowell, University of


Microsoft PowerPoint - 2nd Qtr 2010 Presentation _compressed tt mh.ppt [Compatibility Mode]  

Office of Legacy Management (LM)

Second Quarter 2010 Second Quarter 2010 Surveillance and Maintenance Report for the LM Rocky Flats Site 2 Surface Water Monitoring and Operations Second Quarter 2010 3 Pond Operations - Second Quarter 2010 Terminal Pond Discharges: * Pond A-4: May 1 through May 19, 2010, 32.4 MG * Pond B-5: April 23 through May 16, 2010, 20.8 MG Transfers: * A-3 to A-4: intermittently during the quarter; total of 24.2 MG Pond Levels: * As of June 1, 2010, Ponds A-3, A-4, B-5, and C-2 and the Landfill Pond were holding approximately 19.6 MG (19.8 percent of capacity) November 1, 2010, Pond Levels * Landfill (20.5 percent) * A-3 (0.4 percent) * A-4 (23.4 percent) * B-5 (21.7 percent) * C-2 (2.4 percent) 4 Hydrologic Data - Second Quarter 2010 Precipitation * 6.65 inches total precipitation * 122 percent of WY 1993-2009 average


M(^/H\\ Ris-R-437 ^\\\\j) P a r t  

E-Print Network (OSTI)

as to their vulnerability to a given radioactive contamination. The variability of the concentrations of a radionuclide variability with time is a useful way to assess the route of contamination of the sample and the local variability is ^ measure of environmental inhomogenity with respect to radioac- tive contamination


he U.S. Coast Guard expects all of its Sikorsky Aircraft MH-60T  

E-Print Network (OSTI)

to have an Aircraft Diagnostic Vibration Management System (ADVMS) installed by 2018. It chose Honeywell also save Vol. 59, No. 3 1 The U.S.Coast Guard selected Honeywell late last year to supply the Aircraft

Almor, Amit



E-Print Network (OSTI)

, to make comparisons and eventually for the simulations there is a need for a proper battery model and MEMS actuators use mobile power supplies to ensure energy for their operation. These are mostly and lower power consumption. Today even software developers have to take also the battery-aware system

Paris-Sud XI, Université de


Mining Configurable Enterprise Information M.H. Jansen-Vullers a  

E-Print Network (OSTI)

. Rosemann b aDepartment of Technology Management, Eindhoven University of Technology, P.O. Box 513, NL-5600 MB, Eindhoven, The Netherlands bFaculty of Information Technology, Queensland University of Technology, 126 Margaret Street Brisbane Qld 4000, Australia Abstract Process mining is the extraction

van der Aalst, Wil


LaNi{sub 5}-based metal hydride electrode in Ni-MH rechargeable cells  

DOE Patents (OSTI)

An at least ternary metal alloy of the formula AB{sub (Z-Y)}X{sub (Y)} is disclosed. In this formula, A is selected from the rare earth elements, B is selected from the elements of Groups 8, 9, and 10 of the Periodic Table of the Elements, and X includes at least one of the following: antimony, arsenic, germanium, tin or bismuth. Z is greater than or equal to 4.8 and less than or equal to 6.0. Y is greater than 0 and less than 1. Ternary or higher-order substitutions to the base AB{sub 5} alloys that form strong kinetic interactions with the predominant metals in the base metal hydride are used to form metal alloys with high structural integrity after multiple cycles of hydrogen sorption. 16 figs.

Bugga, R.V.; Fultz, B.; Bowman, R.; Surampudi, S.R.; Witham, C.K.; Hightower, A.




E-Print Network (OSTI)

, slope angles, flood-lines and boulder positions were also measured. The geometry of the channel both contains a range of coarse- sized materials with boulders up to 10 m on a side, some of which are from and boulders down to clay and silt. Based on measurements on an air photo the main deposit L (d3 to d4) is 311

Bourke, Mary C.


Irma E Abu-Jumah Amy L Adams Termotto  

E-Print Network (OSTI)

Timothy Shaun Curtis Colleen A D'angelo Susan W Darby Patricia K Davis Ann M Delario Shaun K Demartinis Kearney Elizabeth A Keirstead Roselie P Kelemen Tracy A Kenney Kathryn L Keymel

Mahon, Bradford Z.


A Measurement of Time-Averaged Aerosol Optical Depth using Air-Showers Observed in Stereo by HiRes  

E-Print Network (OSTI)

.F. Hanlon,1 C.M. Hoffman,2 M.H. Holzscheiter,2 G.A. Hughes,6 P. H¨untemeyer,1 C.C.H. Jui,1 M.A. Kirn,3 BZvi,5 D.R. Bergman,6 J.H. Boyer,4 C.T. Cannon,1 Z. Cao,1 B.M. Connolly,5 Y. Fedorova,1 C.B. Finley,5 W K. Reil,1 M.D. Roberts,8 S.R. Schnetzer,6 M. Seman,4 G. Sinnis,2 J.D. Smith,1 P. Sokolsky,1 C. Song


CEM KANER, J.D., Ph.D. Law Office of Cem Kaner kaner@kaner.com  

E-Print Network (OSTI)

THE WAYS! Copyright © Cem Kaner, 1998. All rights reserved. In press, Software QA Magazine.1 I'm not a Y2K of $1 trillion in legal costs are common, though I pointed out in my last article in Software QA on Y2K to implement a full-fledged strategy to become year 2000 compliant, and only 24 percent have a detailed plan

Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Stimuli materials from Roediger, H.L., & Karpicke, J.D. (2006b). Test-enhanced learning: Taking memory tests  

E-Print Network (OSTI)

dwarf star. It is fueled by thermonuclear reactions near its center that convert hydrogen to helium temperature will fall. The higher temperature of the center will increase the rate of thermonuclear reactions to exist. Once the Sun has used up its thermonuclear energy as a red giant, it will begin to shrink. After


MODELING OF LOWER LIMBS FOR VIBROTACTILE COMPENSATION Martin J.-D. Otis, Guillaume Millet, Stephane Beniak, and Jeremy R. Cooperstock  

E-Print Network (OSTI)

. A real-time algorithm is developed, based on an FFT filter-bank and a rheological limb model, which-synthesis filter-bank and rheological modeling of lower limbs. A previous study demonstrated that we could compensate for the structural properties of the tile, obtaining a flat response in the desired frequency

Cooperstock, Jeremy R.


J.F. Bruno C.E. Siddon J.D. Witman P.L. Colin M.A. Toscano  

E-Print Network (OSTI)

bleaching in Palau, Western Caroline Islands Received: 3 January 2000 / Accepted: 8 January 2001 / Published% were partially bleached. Overall, the results indicate that the 1998 coral bleaching episode in Palau Disturbance á El Nin? o á Palau á Sea surface temperature Introduction Coral reefs throughout the world

Bruno, John F.



E-Print Network (OSTI)

of the solar cells. According to recent publications, the trigger of electric arcs involves the creation. They proposed a numerical model for the mechanism of the electric arc formation. The simulation, which are based 31062 Toulouse cedex 4 31077 Toulouse cedex 4 Abstract -- We study the primary discharge of a solar cell

Vignal, Marie-Hélène


Artificial Neural Networks ICANN'97, Lecture Notes in Computer Science, vol. 1327, W. Gerstner, A. Germond, M. Hasler and J.D. Nicaud (Eds.),  

E-Print Network (OSTI)

feedback inhibition. Keywords: Barrel Cortex, Plasticity, Experience, BCM Modification Threshold Plasticity in Rat Barrel Cortex Induced by One Spared Whisker Lubica BenusŸková Slovak Technical University, Department of Computer Science and Engineering, 81219 Bratislava, Slovakia, e-mail: benus

Benuskova, Luba


CDC/Division of Birth Defects and Developmental Disabilities Jurczyk P, Lu JJ, Li X, Cragan JD, Correa A. A fine-  

E-Print Network (OSTI)

Asthma Using California Health Inter- view Survey, Traffic and Outdoor Air Pollution Da- ta. Environ, Marcus M, Tolbert PE. Ambient air pollution and cardiovascular mal- formations in Atlanta, Georgia, 1986 M, Tolbert PE. The Issue of Con- founding in Epidemiological Studies of Ambient Air Pollution


Status of resistance of Helicoverpa armigera (Lepidoptera: Noctuidae) and Diparopsis castanea (Lepidoptera: Noctuidae) to Bt cotton in South Africa / Pretorius J.D.  

E-Print Network (OSTI)

??Genetically modified (GM) cotton expressing Cry1Ac proteins was released in South Africa in 1997 for control of the bollworm complex on this crop. No reports (more)

Pretorius, Johannes Diederik



Jeff Martin (U. Winnipeg) Collaborators: J.D. Bowman, J. Birchall, L. Buchmann, L. Clarke, C. Davis, B.W. Filippone,  

E-Print Network (OSTI)

, B. Plaster, I. Tanihata, W.T.H. van Oers, Y. Watanabe, S. Yamashita, T. Yoshioka (Winnipeg, Manitoba.D. Bowman, B. Filippone, T. Ito, B. Plaster #12;UCN Quantum States in Gravity Quantized energy leve

Martin, Jeff


PEER-REVIEWED PUBLICATIONS Vitek, N.S, Vinther, J., Schiffbauer, J.D., Briggs, D., and Prum, R. Accepted. Exceptional three-  

E-Print Network (OSTI)

the Middle Eocene Messel Oil Shale. Paläontologische Zeitschrift. Danilov, I.G., and Vitek, N.S. 2012. Soft

Yang, Zong-Liang


J.D. Brown -Quantifying Surgeon Grasping Mechanics in Laparoscopy Studies in Health Technology and Informatics -Medicine Meets Virtual Reality, Newport Beach, CA, January 2004  

E-Print Network (OSTI)

tasks. Grasping force (as applied to the tool handles) and handle angle for each tool were the signals applied by the surgeons during two common laparoscopic procedures.[1, 2] The Blue DRAGON was used to track the forces/torques applied to surgical tools, as well as their kinematics, during live procedures.[3, 4

Rosen, Jacob


UCC Article 2B March 1996 Copyright Cem Kaner, All rights reserved. 1 Cem Kaner, Ph.D., J.D. 1060 Highland Court #4  

E-Print Network (OSTI)

UCC Article 2B ­ March 1996 Copyright © Cem Kaner, All rights reserved. 1 Cem Kaner, Ph.D., J, the Human Factors and Ergonomics Society, the Institute for Electrical and Electronic Engineers, Consumers organization that represents customers, consumers, programmers, testers, writers, or other product development


Development and Interfacial Characterization of Co/Mg Periodic Multilayers for the EUV K. Le Guen,* M.-H. Hu, J.-M. Andre, and P. Jonnard  

E-Print Network (OSTI)

and the formation of compounds at the metal-metal interfaces, we consider the introduction of boron carbide at one over a period of time of three months. The introduction of thin boron carbide interfacial layers proves


2130 Fulton Street MH 113 San Francisco, CA 94117 somundergrad@usfca.edu www.usfca.edu/management Bachelor of Science in Management  

E-Print Network (OSTI)

) Foundations of Communication (8 credits) ___ A1. Public Speaking (4 credits) ___ A2. Rhetoric and Composition and Performing Arts (4 credits) ___ F. Visual & Performing Arts (4 credits) ___ Cultural Diversity (fulfilled 2013 may submit ISA essay on or before the August 15, 2014 5:00 PM deadline. General Electives (to

Galles, David


ABSTRACT : To 1992 o Borcherds eis gage mia na kathgora algbrwn Lie mh peperasmnhc distashc, tic genikeumnec lgebrec Kac-Moody. Autc oi lgebrec qoun pollc omoithtec  

E-Print Network (OSTI)

, tic genikeumènec lgebrec Kac-Moody. Autèc oi lgebrec èqoun pollèc omoiìthtec me tic lgebrec Kac

Beligiannis, Apostolos


The genetic basis of Streptolysin S (Beta-hemolysin) production in Group A Streptococcus and its role as virulence factor in invasive infection  

E-Print Network (OSTI)

63: 3539 Fuller, J.D. , Camus, A. , Duncan, C.L. , Nizet,Fuller, J. D. , A . C. Camus, et al. (2002). "Identification3-12. 8. Fuller, J.D. , Camus, A . C . , Duncan, C.L. ,

Datta, Vivekanand



uw-!i/(asfe/s) trllhJd-rrt. it,4t-U)t1..6(.R t4r~~ I{!~d b!Rc+~cfbl/'Vl SySte;Ud. (:J()of)  

E-Print Network (OSTI)

the photovoltaic (PV) industry today. In the 1950s there were several attempts to commercialize PVs, but their cost is said to be photovoltaic. A photon with short enough wavelength and high enough energy can cause an electron in a photovoltaic material to break free of the atom that holds it. If a nearby electric field

Kammen, Daniel M.


Merritt, J.W., Auton, C.A., Connell, E.R., Hall, A.M. and Peacock, J.D. Cainozoic Geology and Landscape Evolution of north-east Scotland.:  

Science Journals Connector (OSTI)

...Mineralogical Society Book Review Book Reviews Merritt, J.W., Auton, C.A., Connell...igneous or crystalline basement rocks. Nick Petford's excellent paper examines the...be properly understood. G. M. GADD Merritt, J.W., Auton, C.A., Connell...

S. Hillier


Tiengwe, C., Marcello, L., Farr, H., Gadelha, C., Burchmore, R., Barry, J.D., Bell, S.D., and McCulloch, R. (2012) Identification of ORC1/CDC6-  

E-Print Network (OSTI)

Culloch, R. (2012) Identification of ORC1/CDC6- interacting factors in trypanosoma brucei reveals critical publications by members of the University of Glasgow http://eprints.gla.ac.uk #12;Identification of ORC1/CDC6 Complex (ORC), Cdc6 and the MCM replicative helicase in conjunction with Cdt1. Eukaryotic ORC

Azzopardi, Leif


Indicators for Soil and Water Conservation on Rangelands M.G. "SHERM" KARL, D.A. PYKE, P.T. TUELLER, J.D. STEDNICK, S.J. BORCHARD, AND W.  

E-Print Network (OSTI)

Specialist, National Wildlife Refuge System, U.S. Fish & Wildlife Service, U.S. Department of the Interior by the Soil and Water Resources Criterion Group. Soil erosion from water and wind, soil organic matter, soil

Wyoming, University of


In S.J. Hanson, J.D. Cowan, & C.L. Giles, Eds., Advances in Neural Information Processing Systems, 5. San Mateo, CA: Morgan Kaufmann Publishers, 1993, pp. 417--424.  

E-Print Network (OSTI)

of Computer Science, CB 3175, Sitterson Hall University of North Carolina, Chapel Hill, NC 27599­3175, U; Ts'o, Gilbert, & Wiesel, 1986). 2 VISUAL UNSMEARING Human visual systems summate signals over a period of approximately 120 ms in daylight (Burr 1980; Ross & Hogben, 1974). This slow summation

North Carolina at Chapel Hill, University of

Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Computers M~h. Applic. Vol. 21, No. 10, pp. 39-52, 1991 0097-4943/91 $3.00 + 0.00 Printed in Great Britain. All rights reserved Copyright(~ 1991 Pergamon Press plc  

E-Print Network (OSTI)

Britain. All rights reserved Copyright(~ 1991 Pergamon Press plc SYMMETRY IN ATOMIC AND MOLECULAR SYSTEMS

Berry, R. Stephen


Electro-Refractive Low Loss MMI-Coupled Ring M.H. Kwakernaak,A.N. Lepore, H. Mohseni, H. An, Z.A. Shellenbarger,J.H. Abeles  

E-Print Network (OSTI)

.C. Connolly,M. King "Low-threshold InGaAsP ring lasers fabricated using bi-level dry etching", IEEE Photon in active discs using electro-absorption[2]. We report the first demonstrationof electro

Rommel, Sean


Estimates of Embodied Global Energy and Air-Emission Intensities of Japanese Products for Building a Japanese InputOutput Life Cycle Assessment Database with a Global System Boundary  

Science Journals Connector (OSTI)

To build a life cycle assessment (LCA) database of Japanese products embracing their global supply chains in a manner requiring lower time and labor burdens, this study estimates the intensity of embodied global environmental burden for commodities produced in Japan. ... This sector is followed by several food- and agriculture-related sectors such as seeds and seedlings (JD11) (?57%), flour and other grain mill products (JD47) (?52%), timber (JD90) (?52%), and Feeds (JD72) (?51%). ...

Keisuke Nansai; Yasushi Kondo; Shigemi Kagawa; Sangwon Suh; Kenichi Nakajima; Rokuta Inaba; Susumu Tohno



IWW's strategic plan at maturity was to be considered a technical resource by state and federal agencies. IWW was strategically positioned to  

E-Print Network (OSTI)

micro-hydro research through OSU Foundation to fund first joint UO JD/ OSU MS water student. #12;Metric

Escher, Christine


Fair-weather clouds hold dirty secret | EMSL  

NLE Websites -- All DOE Office Websites (Extended Search)

the PNNL Fundamental & Computational Sciences Directorate. Reference: Shrivastava M, LK Berg, JD Fast, R Easter, A Laskin, E Chapman, WI Gustafson Jr, Y Liu, and CM Berkowitz....


E-Print Network 3.0 - alimentos para idade Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

DIFFUSIONANDDISTRIBUTION CentrodeInformaoemAlimentos... de Alimentos -ITAL Av. Brasil, 2880 - Caixa Postal 139 - Jd. Brasil 13073-001 Campinas, SP Brazil... cultivares de...


Polar Infromation: An International Approach  

E-Print Network (OSTI)

B.G. Gardiner, and J.D. Shanklin. 1985 "Large losses ofFarman, Gardiner & Shanklin 1985), and the understanding

West, Sharon M.; McCarthy, Paul H.



Oak Ridge National Laboratory - Global Security Directorate  

NLE Websites -- All DOE Office Websites (Extended Search)

Intelligence Point of Contact: JD Stauffer Intelligence Oak Ridge National Laboratory Post Office Box 2008, MS-6242 Oak Ridge, Tennessee 37831-6242 Telephone: (865) 241-6580...


Fruit and Vegetable Consumption by Low-Income Americans  

E-Print Network (OSTI)

ML, Schillo BA. 5 A Day fruit and vegetable interventionof perceived barriers to fruit and vegetable consumptionKA, Potter JD. Vegetables, fruit, and cancer prevention: a

Sisson, Aimee



E-Print Network 3.0 - alpha7-nicotinic acetylcholine receptor...  

NLE Websites -- All DOE Office Websites (Extended Search)

lpyridazine-3-yloctahydropyrrolo3,4-c 11CA-582941 Summary: .B. Mikkelsen J.D. Cognitive improvement by activation of alpha7 nicotinic acetylcholine receptors: from...


E-Print Network 3.0 - ann ojarand enno Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Modelling the hydrodynamic Schafer, K.V.R., R. Oren, and J.D. Tenhunen. 2000 Source: Stiller, Volker - Department of Biological Sciences, Southeastern Louisiana University...


Clinical Recommendations: Lichen Sclerosus Bercaw J, Boardman L, Simms-Cendan. Journal of Pediatric Adolescent Gynecology, April 2014 Vol 27(2) p111-116.  

E-Print Network (OSTI)

does it affect Cytopathologists? Cytopathology Help Desk invited column. Cancer (Cancer Cytopathol for oral presentation] Kibble JD, Cramer N. Development of a novel assessment tool for higher order

Wu, Shin-Tson


Yakama Power  

NLE Websites -- All DOE Office Websites (Extended Search)

Power Administration FROM: J.D. Williams Attorney RE: Initial Comments on Draft Load Following Regional Dialogue Contract Template Dear Mark, Please allow these comments...


E-Print Network 3.0 - ancestral susceptible genetic Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

from gene trees such as the time to the most Source: Biggins, J.D.- Department of Probability and Statistics, University of Sheffield Collection: Mathematics 10 The...


Impact of a Health Information Exchange on Resource Use and Medicare-Allowable Reimbursements at 11 Emergency Departments in a Midsized City  

E-Print Network (OSTI)

EC, et al. Health information exchange reduces repeatedal. Primer in health information Res. 2013;2(1):21. exchange12. Halamka JD. Health information exchange for emergency

Saef, Steven H.; Melvin, Cathy L.; Carr, Christine M.




NLE Websites -- All DOE Office Websites (Extended Search)

Challenge: Increase Tank Farm Operational Readiness Solutions: - Improve Conduct of Operations - Retrieval transition JD said approximately 140 million of the ARRA funding...


E-Print Network 3.0 - allotetraploid soybean glycine Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Evidence for Allopolyploidy in Soybean1OA Summary: University, Ithaca, New York 14853 (J.D.) Recent studies have documented that the soybean (Glycine max... in Glycine...


The California rangeland decisionmaking survey provides important insights into defining sustainability on working landscapes. First, there is considerable heterogeneity  

E-Print Network (OSTI)

in mainstreaming conservation initiatives. L.M. Roche1, T.K. Schohr1, M.N. Lubell1, J.D. Derner2, L. Huntsinger3

Tate, Kenneth


Seasonal variation of carbon monoxide in northern Japan: Fourier transform IR measurements and source-labeled model calculations  

E-Print Network (OSTI)

doi:10.1029/2002JD003093. Stricker, N. C. M. , A. Hahne, D.satellite measurements [ Stricker et al . , 1995] are shown



EIS-0285-SA-56: Supplement Analysis | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

in the Ross District: Cape Horn, North Bonneville, Stevenson, Carson, Underwood, Troutdale, Cascade Locks, Acton Ross 345 kilovolts and J.D., Alcoa, Sifton, St. Johns,...

Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - Cover Sheet.doc  

National Nuclear Security Administration (NNSA)

... D-33 Figure D-10 Annual Average Wind Rose for the J.D. Smith DAQEM Site at 1301 East Tonopah Road, 2004-2008 ......


West Virginia University 1 WVU law students have a passion for justice, an interest in how our legal system contributes to society, and a desire to learn a discipline that is both  

E-Print Network (OSTI)

University Law Center) William J. Maier, Jr. Dean and Thomas R. Goodwin Professor of Law Associate Deans) Bowles, Rice, McDavid, Graff, and Love Professor of Law · Charles R. DiSalvo - J.D. (University · Gregory W. Bowman - J.D. (Northwestern University) Associate Dean of Academic Affairs, Professor of Law

Mohaghegh, Shahab


West Virginia University 1 WVU Law students have a passion for justice, an interest in how our legal system contributes to society, and a desire to learn a discipline that is both  

E-Print Network (OSTI)

University Law Center) William J. Maier, Jr. Dean and Thomas R. Goodwin Professor of Law Associate Deans · Gregory W. Bowman - J.D. (Northwestern University) Associate Dean for Academic Affairs, Professor of Law · Janet Long Armistead - M.A. (West Virginia University) Student Affairs · Amber Brugnoli - J.D. (West

Mohaghegh, Shahab


Onion-skin method (OSM) analysis of DIIID edge measurements P.C. Stangeby,a J.G. Watkins,b G.D. Porter,c J.D. Elder,a S. Lisgo,a D. Reiter,d W.P. West,e  

E-Print Network (OSTI)

codes -- both for hydrogen neutrals, e.g. EIRENE [1], and impurity neutral+ion, production1 Onion-skin method (OSM) analysis of DIII­D edge measurements P.C. Stangeby,a J.G. Watkins,b G Diego, California Abstract OSM analysis provides, in principle, a method for establishing the 2-D edge

Stangeby, P. C.


Whittecar, G.R., Daniels, W.L., and Carter, C.H.III, 2007, Developing a Beneficial Use for Dredged Sediments at Shirley Plantation: Hydrostratigraphy, Groundwater Flow Patterns, and Water Quality Studies In: Bailey, C.M. and Lamoreaux, M.H.  

E-Print Network (OSTI)

and Old Dominion University have drilled several dozen boreholes and constructed and monitored groundwater spoils were reconfigured into compacted dikes to form a large L-shape basin, one with moderately

Darby, Dennis


Engineering of a high-throughput screening system to identify cellulosic biomass, pretreatments, and enzyme formulations that enhance sugar release  

NLE Websites -- All DOE Office Websites (Extended Search)

Engineering Engineering of a High-Throughput Screening System to Identify Cellulosic Biomass, Pretreatments, and Enzyme Formulations That Enhance Sugar Release Michael H. Studer, Jaclyn D. DeMartini, Simone Brethauer, Heather L. McKenzie, Charles E. Wyman Chemical and Environmental Engineering Department, Center for Environmental Research and Technology, Bourns College of Engineering, University of California Riverside, 1084 Columbia Avenue, Riverside, California 92507; telephone: þ951-781-5791; fax: þ951-781-5790; e-mail: charles.wyman@ucr.edu Received 7 April 2009; revision received 21 August 2009; accepted 31 August 2009 Published online 3 September 2009 in Wiley InterScience (www.interscience.wiley.com). DOI 10.1002/bit.22527 ABSTRACT: The recalcitrance of cellulosic biomass, the only abundant, sustainable feedstock for making liquid fuels, is a primary



NLE Websites -- All DOE Office Websites (Extended Search)

ARTICLE Copyright © 2010 American Scientific Publishers All rights reserved Printed in the United States of America Journal of Biobased Materials and Bioenergy Vol. 4, 1-6, 2010 Near Infrared Spectroscopy as a Screening Tool for Sugar Release and Chemical Composition of Wheat Straw J. Lindedam 1 2 ∗ , S. Bruun 1 , J. DeMartini 3 , H. Jørgensen 2 , C. Felby 2 , B. Yang 3 4 , C. E. Wyman 3 , and J. Magid 1 1 Plant and Soil Science Laboratory, Department of Agriculture and Ecology, Faculty of Life Sciences, University of Copenhagen, DK-1871 Frederiksberg C, Denmark 2 Wood and Biomass Science, Forest and Landscape, Faculty of Life Sciences, University of Copenhagen, DK-1871 Frederiksberg C, Denmark 3 Center for Environmental Research and Technology, Bourns College of Engineering, University of California Riverside, 1084 Columbia Avenue, Riverside CA 92507, USA 4 Now at Center for Bioproducts


Cultivar variation and selection potential relevant to the production of cellulosic ethanol from wheat straw  

NLE Websites -- All DOE Office Websites (Extended Search)

Cultivar Cultivar variation and selection potential relevant to the production of cellulosic ethanol from wheat straw J. Lindedam a, *, S.B. Andersen b , J. DeMartini c , S. Bruun b , H. Jørgensen a , C. Felby a , J. Magid b , B. Yang d , C.E. Wyman c a Forestry and Wood Products, Forest & Landscape, Faculty of Life Sciences, University of Copenhagen, Rolighedsvej 23, DK-1958 Frederiksberg C, Denmark b Plant and Soil Science Laboratory, Department of Agriculture and Ecology, Faculty of Life Sciences, University of Copenhagen, Thorvaldsensvej 40, DK-1871 Frederiksberg C, Denmark c Center for Environmental Research and Technology, Bourns College of Engineering, University of California Riverside, 1084 Columbia Avenue, Riverside, CA 92507, USA d Center for Bioproducts and Bioenergy, Washington State University, 2710 University Drive, Richland, WA 99354, USA a r t i c l e i n f o Article history:


pnas201009252 1..6  

NLE Websites -- All DOE Office Websites (Extended Search)

Lignin Lignin content in natural Populus variants affects sugar release Michael H. Studer a,b,1 , Jaclyn D. DeMartini a,b , Mark F. Davis b,c , Robert W. Sykes b,c , Brian Davison b,d , Martin Keller b,d , Gerald A. Tuskan b,e , and Charles E. Wyman a,b,2 a University of California, Bourns College of Engineering, Center for Environmental Research and Technology, Riverside, CA 92507; b BESC BioEnergy Science Center, Oak Ridge National Laboratory, Oak Ridge, TN 37831-6422; c National Bioenergy Center, National Renewable Energy Laboratory, Golden, CO 80401- 3305; d Energy and Environmental Sciences, Oak Ridge National Laboratory, Oak Ridge, TN 37831-6422; and e Plant Systems Biology Group, BioSciences Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831-6422 Edited* by Ronald R. Sederoff, North Carolina State University, Raleigh, NC, and approved March 3, 2011 (received for review


Changes in composition and sugar release across the annual rings of Populus wood and implications on recalcitrance  

NLE Websites -- All DOE Office Websites (Extended Search)

composition composition and sugar release across the annual rings of Populus wood and implications on recalcitrance Jaclyn D. DeMartini, Charles E. Wyman ⇑ Center for Environmental Research and Technology, Bourns College of Engineering, University of California Riverside, 1084 Columbia Avenue, Riverside, CA 92507, United States a r t i c l e i n f o Article history: Received 9 July 2010 Received in revised form 30 August 2010 Accepted 31 August 2010 Available online xxxx Keywords: Pretreatment Enzymatic hydrolysis Biomass recalcitrance Age effects Populus wood a b s t r a c t Understanding structural characteristics that are responsible for biomass recalcitrance by identifying why it is more difficult for some plants, or portions of plants, to release their sugars would be extremely valuable in overcoming this barrier. With this in mind, this study investigated the recalcitrance of wood


High-Throughput Pretreatment and Hydrolysis Systems for Screening Biomass Species in Aqueous Pretreatment of Plant Biomass  

NLE Websites -- All DOE Office Websites (Extended Search)

High-throughput High-throughput Pretreatment and Hydrolysis Systems for Screening Biomass Species in Aqueous Pretreatment of Plant Biomass Jaclyn D. DeMartini 1,2,3,Ã and Charles E. Wyman 1,2,3 1 Department of Chemical and Environmental Engineering, University of California, Riverside, USA 2 Center for Environmental Research and Technology, University of California, Riverside, USA 3 BioEnergy Science Center, Oak Ridge, USA 22.1 Introduction: The Need for High-throughput Technologies The primary barrier to low-cost biological conversion of lignocellulosic biomass to renewable fuels and chemicals is plant recalcitrance, that is to say, resistance of cell walls to deconstruction by enzymes or microbes [1,2]. However, the discovery and use of biomass species with reduced recalcitrance, when com- bined with optimized pretreatment processes and enzyme mixtures, could potentially


Smallscale and automatable highthroughput compositional analysis of biomass  

NLE Websites -- All DOE Office Websites (Extended Search)

Small-Scale Small-Scale and Automatable High-Throughput Compositional Analysis of Biomass Jaclyn D. DeMartini, Michael H. Studer, Charles E. Wyman Center for Environmental Research and Technology, Bourns College of Engineering, University of California Riverside, 1084 Columbia Avenue, Riverside, California 92507; telephone: 951-781-5703; fax: 951-781-5790; e-mail: charles.wyman@ucr.edu Received 26 May 2010; revision received 26 August 2010; accepted 3 September 2010 Published online 9 September 2010 in Wiley Online Library (wileyonlinelibrary.com). DOI 10.1002/bit.22937 ABSTRACT: Conventional wet chemistry methods to deter- mine biomass composition are labor- and time-intensive and require larger amounts of biomass (300 mg) than is often available. To overcome these limitations and to sup- port a high-throughput pretreatment and hydrolysis (HTPH) screening system,


Determination of porosity of lignocellulosic biomass before and after pretreatment by using Simons⠒ stain and NMR techniques  

NLE Websites -- All DOE Office Websites (Extended Search)

porosity porosity of lignocellulosic biomass before and after pretreatment by using Simons' stain and NMR techniques Xianzhi Meng a , Marcus Foston a,1 , Johannes Leisen b , Jaclyn DeMartini c , Charles E. Wyman c , Arthur J. Ragauskas a,⇑ a BioEnergy Science Center, School of Chemistry and Biochemistry, Institute of Paper Science and Technology, Georgia Institute of Technology, 500 10th Street, Atlanta, GA 30332, USA b School of Chemistry and Biochemistry, Georgia Institute of Technology, Atlanta, GA 30332, USA c Department of Chemical & Environmental Engineering, Center for Environmental Research and Technology, University of California, Riverside, BioEnergy Science Center, Riverside, CA 92507, USA h i g h l i g h t s  Cellulose accessibility was tested by Simons' stain and multiple NMR techniques.  Pretreatment increases the pore size and overall surface area of the


c1ee02112e 1..8  

NLE Websites -- All DOE Office Websites (Extended Search)

monoclonal monoclonal antibodies to investigate plant cell wall deconstruction for biofuels production† Jaclyn D. DeMartini, abe Sivakumar Pattathil, ce Utku Avci, ce Kaitlyn Szekalski, c Koushik Mazumder, ce Michael G. Hahn cde and Charles E. Wyman * abe Received 10th July 2011, Accepted 17th August 2011 DOI: 10.1039/c1ee02112e To better understand how hydrothermal pretreatment reduces plant cell wall recalcitrance, we applied a high throughput approach (''glycome profiling'') using a comprehensive suite of plant glycan-directed monoclonal antibodies to monitor structural/extractability changes in Populus biomass. The results of glycome profiling studies were verified by immunolabeling using selected antibodies from the same toolkit. The array of monoclonal antibodies employed in these studies is large enough to monitor changes occurring in most plant cell wall polysaccharides.


Optimal Planning and Operation of Smart Grids with Electric Vehicle Interconnection  

E-Print Network (OSTI)

costs, EV battery degradation costs, and sales. min C ?????electricity sales, $ Electricity exchange with EVs D EV m,h

Stadler, Michael



Is it Labors Turn to Globalize? Twenty-?rst Century Opportunities and Strategic Responses  

E-Print Network (OSTI)

Stanford University Press. Fairbrother, M.H. (2007) 'Makingsegments of capital. See Fairbrothers (2006, 2007) analysis

Evans, Peter



DOE Uranium Leasing Program - Lease Tract Metrics  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Uranium Leasing Program -- Lease Tract Metrics Uranium Leasing Program -- Lease Tract Metrics Lease Tract Lessee Lease Date Bid (%) Reclamation Bond a Total Acres Acres Excluded b Comment C-JD-5 Gold Eagle Mining, Inc. 04/30/08 12.00 37,000 150.71 C-JD-5A Golden Eagle Uranium, LLC 06/27/08 20.10 5,000 24.54 C-JD-6 Cotter Corporation 04/30/08 14.20 19,000 530.08 C-JD-7 c Cotter Corporation 04/30/08 27.30 1,206,000 493.01 C-JD-8 Cotter Corporation 04/30/08 36.20 4,000 954.62 C-JD-8A No bids received - remains inactive N/A N/A N/A 77.91 C-JD-9 Cotter Corporation 04/30/08 24.30 72,000 1,036.50 C-SR-10 Golden Eagle Uranium, LLC 06/27/08 13.10 5,000 637.64 C-SR-11 Cotter Corporation 04/30/08 11.67 43,000 1,303.22 200.25 Summit Canyon area excluded from lease tract C-SR-11A Golden Eagle Uranium, LLC 06/27/08 14.30 5,000 1,296.81 C-SR-12 Colorado Plateau Partners 06/27/08


"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Change","Daily Volume MWh","Number of Trades","Number of Companies"  

U.S. Energy Information Administration (EIA) Indexed Site

Nepool MH Da Lmp ",39815,39818,39818,65.55,65,65.44,-5.89,12000,15,9 Nepool MH Da Lmp ",39815,39818,39818,65.55,65,65.44,-5.89,12000,15,9 "Nepool MH Da Lmp",39818,39819,39819,67,65,66.22,0.78,39200,46,22 "Nepool MH Da Lmp ",39819,39820,39820,65,63.25,63.83,-2.39,20000,24,18 "Nepool MH Da Lmp ",39820,39821,39821,67.5,65.75,66.47,2.64,28000,33,16 "Nepool MH Da Lmp ",39821,39822,39822,78.5,76,77.31,10.84,21600,27,16 "Nepool MH Da Lmp ",39822,39825,39825,100,90,94.19,16.88,28800,35,19 "Nepool MH Da Lmp ",39825,39826,39826,81,72.75,74.76,-19.43,36000,44,24 "Nepool MH Da Lmp ",39826,39827,39827,101,98,99.83,25.07,16000,20,18 "Nepool MH Da Lmp",39827,39828,39828,130,117,120.32,20.49,40000,50,27 "Nepool MH Da Lmp ",39828,39829,39829,120,106,109.76,-10.56,72800,91,35


"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Daily Volume MWh","Number of Trades","Number of Companies"  

U.S. Energy Information Administration (EIA) Indexed Site

7988,37991,37991,62,62,62,800,1,2 7988,37991,37991,62,62,62,800,1,2 "NEPOOL MH DA LMP",37991,37992,37992,70,69,69.5,1600,2,2 "NEPOOL MH DA LMP",37992,37993,37993,75.25,72,73.81,3200,4,6 "NEPOOL MH DA LMP",37993,37994,37994,81,76,78.3,8000,10,11 "NEPOOL MH DA LMP",37994,37995,37995,85.75,81.5,84.24,12800,16,12 "NEPOOL MH DA LMP",37998,37999,37999,77,72.5,74.12,6400,8,9 "NEPOOL MH DA LMP",37999,38000,38000,120,92,104.81,16800,21,11 "NEPOOL MH DA LMP",38000,38001,38001,375,270,311.75,6400,8,8 "NEPOOL MH DA LMP",38001,38002,38002,175,170,171,4000,5,5 "NEPOOL MH DA LMP",38005,38006,38006,90,84,86.78,7200,9,7 "NEPOOL MH DA LMP",38006,38007,38007,94,81.5,87.42,10400,13,13 "NEPOOL MH DA LMP",38007,38008,38008,76,72,74.69,6400,8,8


Microsoft PowerPoint - 2-04_Vienna Glass Models Draft (11-15-10) v2.pptx  

NLE Websites -- All DOE Office Websites (Extended Search)

D. J.D. Vienna D. J.D. Vienna Vienna Pacific Northwest National Laboratory, Richland, WA J.D. Belsher, P.A. Empey, and F.L. Meinert J.D. Belsher, P.A. Empey, and F.L. Meinert Washington River Protection Solutions, Richland, WA Property Models for High Waste Property Models for High Waste Loaded Hanford HLW Glasses Loaded Hanford HLW Glasses Print Close 2  Waste loading improvements in Hanford HLW glasses  Glass property models  Systems studies with dynamic flowsheet model  waste glass predictions for Hanford  influential components  glass testing priorities  Status of the testing/modeling task  Summary and conclusions  Acknowledgements Outline Print Close Waste Loading Improvements in Hanford HLW Glass  Hanford HLW covers a broad range of compositions -

Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


ARM - 2013 AGU Presentations Featuring ARM Data  

NLE Websites -- All DOE Office Websites (Extended Search)

of Aerosol in the Marine Environment: Tales from the Two-Column Aerosol Project LK Berg, JD Fast, J Barnard, D Chand, EG Chapman, JM Comstock, RA Ferrare, CJ Flynn, JW Hair,...


ARM - 2012 AGU Presentations Featuring ARM Data  

NLE Websites -- All DOE Office Websites (Extended Search)

MD Obland, AJ Scarino, B Cairns, PB Russell, J Redemann, Y Shinozuka, B Schmid, LK Berg, JD Fast, CJ Flynn 1:40 pm, M-South Poster A13A-0339. Combining Passive Polarimetric...


Research Highlight  

NLE Websites -- All DOE Office Websites (Extended Search)

Reference: Scarino AJ, MD Obland, JD Fast, SP Burton, RA Ferrare, CA Hostetler, LK Berg, B Lefer, C Haman, JW Hair, RR Rogers, C Butler, AL Cook, and DB Harper. 2014....


Modelling chromosome dynamics in mitosis: a historical perspective on models of metaphase and anaphase in eukaryotic cells  

Science Journals Connector (OSTI)

...nsmb896 ) 46 McIntosh, JR , 2008 Fibrils connect...Grishchuk, EL, McIntosh, JR, Ataullakhanov, FI...Mogilner, A , Wollman, R, Civelekoglu-Scholey...1110412108 ) 56 Loughlin, R , Wilbur, JD, McNally, FJ, Nedelec, FJ, Heald...



Removal of pertechnetate from simulated nuclear waste streams using supported zerovalent iron  

E-Print Network (OSTI)

3. ?? TM/JD 2. Westinghouse Hanford Co. , Report WHC-SD-WM-Department of Energys Hanford Site: (1) the direct removaltypical of those found in Hanford tank waste; and (2) the

Darab, John



HIV-1 Envelope Glycan Moieties Modulate HIV-1 Transmission  

Science Journals Connector (OSTI)

...1 cloned directly from uncultured human brain tissue: identification of replication-competent...Dangond, MF McLane, M Essex, and JD Brain. 2007. Noninfectious entry of HIV-1 into peripheral and brain macrophages mediated by the mannose receptor...

Ruizhong Shen; Milan Raska; Diane Bimczok; Jan Novak; Phillip D. Smith



Immunogenicity of a Vaccine Regimen Composed of Simian Immunodeficiency Virus DNA, rMVA, and Viral Particles Administered to Female Rhesus Macaques via Four Different Mucosal Routes  

Science Journals Connector (OSTI)

...MW Carroll, LS Wyatt, JR Bennink, VM Hirsch, S Goldstein, WR Elkins, TR Fuerst, JD Lifson, M Piatak, NP Restifo, W Overwijk, R Chamberlain, SA Rosenberg, and G Sutter. 1996. Host range restricted, non-replicating vaccinia virus vectors as...

Mariana Manrique; Pamela A. Kozlowski; Antonio Cobo-Molinos; Shainn-Wei Wang; Robert L. Wilson; David C. Montefiori; Angela Carville; Anna Aldovini



SUSANA MARTINEZ Governor JOHN A. SANCHEZ Lieutenant Governor  

NLE Websites -- All DOE Office Websites (Extended Search)



Trends in template/fragment-free protein structure prediction  

E-Print Network (OSTI)

1998) Pathways to a protein folding intermediate observed instudy of all-atom protein folding and structure predic-JD, Dill KA (2007) Protein folding by zipping and assembly.

Zhou, Yaoqi; Duan, Yong; Yang, Yuedong; Faraggi, Eshel; Lei, Hongxing



Precipitation response to land subsurface hydrologic processes in atmospheric general circulation model simulations  

E-Print Network (OSTI)

doi:10.1029/2001JD000392. Hack, J. J. , J. M. Caron, S. G.by several studies [e.g. , Hack et al. , 2006; Wang et al. ,

Lo, Min-Hui; Famiglietti, James S



Combinatorial Mathematicians based in  

E-Print Network (OSTI)

. Keith J. Dundee Essam, Prof. John W. Royal Holloway Evans, Dr. David M. East Anglia Evans, Dr. Edward A Holloway Hirschfeld, Prof. James W.P. Sussex Hobbs, J.D. Open Hoffman, Michael Leicester Hoggar, Dr. Stuart


Response times from ensembles of accumulators  

Science Journals Connector (OSTI)

...Center for Computing for Research and Education. We manipulated three key parameters...Advanced Computing Center for Research and Education, and Robin and Richard Patton through...Logan GD, Palmeri TJ, Schall JD, Poster Presented at Computational and Systems...

Bram Zandbelt; Braden A. Purcell; Thomas J. Palmeri; Gordon D. Logan; Jeffrey D. Schall



Response times from ensembles of accumulators  

Science Journals Connector (OSTI)

...Computing Center for Research and Education, and Robin and Richard Patton...coding of movement direction. Science 233(4771):1416 ZZQQhy1419...of detail and abstraction. Science 314(5796):80...Palmeri TJ, Schall JD, Poster Presented at Computational...

Bram Zandbelt; Braden A. Purcell; Thomas J. Palmeri; Gordon D. Logan; Jeffrey D. Schall



Discovery of the millisecond pulsar PSR J2043+1711 in a Fermi source with the Nanay Radio Telescope  

Science Journals Connector (OSTI)

......Italy, the Ministry of Education, Culture, Sports, Science and Technology (MEXT...agreement with the National Science Foundation. The Green...facility of the National Science Foundation operated...Coherent Dedispersor (poster JD02-44). Cognard......

L. Guillemot; P. C. C. Freire; I. Cognard; T. J. Johnson; Y. Takahashi; J. Kataoka; G. Desvignes; F. Camilo; E. C. Ferrara; A. K. Harding; G. H. Janssen; M. Keith; M. Kerr; M. Kramer; D. Parent; S. M. Ransom; P. S. Ray; P. M. Saz Parkinson; D. A. Smith; B. W. Stappers; G. Theureau



70 proud moments in BPA's 70 years  

NLE Websites -- All DOE Office Websites (Extended Search)

from Bonneville Dam to St. Johns Substation at Portland, via Vancouver (now J.D. Ross) Substation. 5. Dec. 20, 1939 - BPA signs its fi rst power sales contract with an...


Slide01 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Science-Forums.net Communities for Science Colleagues Tweet Comments or Questions: @LVowell @LynnJD GL13ScienceForums GL13conf Lance Vowell Program Manager Contractor to DOE...


Slide20 | OSTI, US Dept of Energy, Office of Scientific and Technical...  

Office of Scientific and Technical Information (OSTI)

Science-Forums.net Communities for Science Colleagues Tweet Comments or Questions: @LVowell @LynnJD GL13ScienceForums GL13conf Lance Vowell Program Manager Contractor to DOE...


Microsoft Word - EMSSABChairs.conferencecall.january312008.FINAL...  

Office of Environmental Management (EM)

Lisa Aldrich, John Bolliger, William Flanery, R.D. Maynard Nevada Rosemary Rehfeldt, Kelly Snyder, Walt Wegst NNM Fran Berting, J.D. Campbell, Menice Santistevan Oak Ridge Steve...


E-Print Network 3.0 - artificial aluminium silicate Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

Collection: Mathematics 26 Theme 5 Outputs: 1. Publications Summary: .J.D MacKenzie, M.E. Smith, T.F. Kemp, and D. Voll, Crystalline Aluminium Borates with the Mullite... Calcium...


Seed Germination of GA-Insensitive sleepy1 Mutants Does Not Require RGL2 Protein Disappearance in Arabidopsis  

Science Journals Connector (OSTI)

...signaling gene SLEEPY1 are rescued by overexpression of its homologue, SNEEZY. Proc. Natl. Acad. Sci. USA 101: 12771-12776. Sundaresan, V., Springer, P., Volpe, T., Haward, S., Jones, J.D., Dean, C., Ma, H., and Martienssen...

Tohru Ariizumi; Camille M. Steber


Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


E-Print Network 3.0 - asme international mechanical Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

1990. Denton, J.D. Loss mechanisms... and mechanical performance of a high pressure turbine stage in a transient wind tunnel. ASME Paper No. 90-GT-353... loss mechanisms in a...


New consumers: The influence of affluence on the environment  

Science Journals Connector (OSTI)

...cleanedge.com) Manandhar, S. 1997. Solar Electricity...Consumption. MIT Press, Cambridge, Massachusetts. Prugh, T., R. Costanza...HIID, Harvard University, Cambridge, Massachusetts. Sachs, J.D. and A. M...

Norman Myers; Jennifer Kent



Glass Formulation and Testing for U.S. High-Level Tank Wastes?Project...  

NLE Websites -- All DOE Office Websites (Extended Search)

Formulation and Testing for U.S. High-Level Tank Wastes-Project 17210 JD Vienna, Pacific Northwest National Laboratory, Richland, WA, USA AA Kruger, U.S. Department of Energy,...


An experimental investigation of nitrogen gas produced during...  

NLE Websites -- All DOE Office Websites (Extended Search)

AD Peacock, M Oostrom, and TW Wietsma.2007."An experimental investigation of nitrogen gas produced during denitrification."Ground Water 45(4):461-467. Authors: JD Istok MM Park AD...


E-Print Network 3.0 - aortic repair pushing Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

for: aortic repair pushing Page: << < 1 2 3 4 5 > >> 1 Mechanobiology of the Aortic Heart Valve Jonathan T. Butcher1 Summary: ;13:798-803 18. Deck JD, Thubrikar MJ, Schneider...


REFERENCES Baines, W. D.  

Office of Scientific and Technical Information (OSTI)

was performed at Sandia National Laboratories, supported by the U. S. Department of Energy under contract number DE-AC04-76DP00789. REFERENCES Baines, W. D. a, Jd Peterson,...


Meeting Report. Assessing Human Germ-Cell Mutagenesis in the Post-Genome Era: A Celebration of the Legacy of William Lawson (Bill) Russell  

E-Print Network (OSTI)

and 20 years after Chernobyl. Boice JD Jr, Tawn EJ, Winther2006. Cancer risk among Chernobyl cleanup workers in EstoniaDNA Germ-Cell Mutagenesis in Chernobyl, Japanese, and Animal



Enhanced killing of pancreatic cancer cells by expression of fusogenic membrane glycoproteins in combination with chemotherapy  

Science Journals Connector (OSTI)

...and Medical Virology, Institute of Microbiology and Hygiene, Ruhr-University Bochum...Freytag SO, Rogulski KR, Paielli DL, Gilbert JD, Kim JH. A novel three-pronged...and Medical Virology, Institute of Microbiology and Hygiene, Ruhr-University Bochum...

Dennis Hoffmann and Oliver Wildner



Correlation of physical surfaces, bentonites, and biozones in the Cretaceous Colorado Group from the Alberta Foothills to southwest Saskatchewan, and a revision of the Belle Fourche - Second White Specks formational boundary  

Science Journals Connector (OSTI)

...Powell J.D. 1977. Stratigraphic, paleontologic, and paleoenvironmental analysis of the Upper Cretaceous rocks of Cimmaron county, northwestern Oklahoma. Geological Society of America, Memoir 149, 150 p. a Einsele G., Werner R., Seilacher...

Aditya Tyagi; A. Guy Plint; David H. McNeil


Solar absorption by Mie resonances in cloud droplets  

E-Print Network (OSTI)

on the enhancement factor for absorption of light by carbonKlett JD. Black carbon and absorption of solar radiation bySize parameter; Particle absorption; Water clouds; Aerosols

Zender, Charles S; Talamantes, Jorge



Microsoft Word - 2011_11_0203_NovemberHAB_Summary_Final.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

for the Central Plateau. J.D. said DOE-RL is striving for stability after American Recovery and Reinvestment Act (ARRA) funding ceased and there were layoffs on site. DOE is...


Continental-scale net radiation and evapotranspiration estimated using MODIS satellite observations  

E-Print Network (OSTI)

et al. (2008) J. Munger J. Hadley D. Hollinger K. Davis T.doi:10.1029/2006JD007161. Hadley, J. L. , Kuzeja, P. S. ,Desai Urbanski et al. (2007) Hadley et al. (2008) Hollinger

Jin, Yufang; Randerson, James T.; Goulden, Michael L.



Measured Black Carbon Deposition on the Sierra Nevada Snow Pack and Implication for Snow Pack Retreat  

E-Print Network (OSTI)

8010.1029/2000JC000414, 2002. Hadley, O. L. , Ramanathan,05310.01029/02006JD007632, 2007. Hadley, O. L. , Corrigan,Author List 1. ) Odelle L. Hadley Lawrence Berkeley National

Hadley, O.L.



Black carbon transport and deposition to the California mountain snow pack  

E-Print Network (OSTI)

doi:10.1029/2003JD004406. Hadley, O. L. , V. Ramanathan, G.32. Roberts, G. , G. Mauger, O. Hadley, and V. Ramanathan (8010.1029/2000JC000414. Hadley, O. L. , V. Ramanathan, G. R.

Hadley, Odelle L.



E-Print Network 3.0 - african american men Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Summary: .E.D. to J.D., M.D., or Ph.D.: EXPOSING AFRICAN AMERICANBLACK AND LATINOHISPANIC STUDENTS TO GRADUATE... Morning Panel Discussions Current Enrollment Trends of...


A Measuring  

Office of Scientific and Technical Information (OSTI)

clozapine. Relation to extrapyramidal side ffects. Arch Gen Psychiatry 1992; 49538-544. Smith M, Wolf AP, Brodie JD, et. al. Serial '*F-N- methylspiroperidol PET studies to measure...



NLE Websites -- All DOE Office Websites (Extended Search)

SA-84872 1 Glass Formulation and Testing for U.S. High-Level Tank Wastes Project 17210 Year 1 Status Report: October 15, 2014 JD Vienna, DS Kim, MJ Schweiger, GF Piepel, JO Kroll,...


Microsoft PowerPoint - CIMTEC Talk Final (6-17-14) [Read-Only...  

NLE Websites -- All DOE Office Websites (Extended Search)

Developments in the HLW Glass Formulation for the Hanford Tank Waste Treatment and Immobilization Plant and their Impacts on its Mission JD VIENNA 1 , DS KIM 1 , AA KRUGER 2 , AND...


Biographical Sketch Marlos Goes  

E-Print Network (OSTI)

of instrumental observations and an Earth System model, J. Geophys. Res., 117, D04103, doi:10.1029/2011JD016620-induced ocean mixing in an Earth system model of intermediate complexity, J. Geophys. Res.-Oceans, doi:10


Plant Molecular Biology 41: 637644, 1999. 1999 Kluwer Academic Publishers. Printed in the Netherlands.  

E-Print Network (OSTI)

in the Netherlands. 637 Test of the combinatorial model of intron recognition in a native maize gene Maita J- 5020, USA; present addresses: 3Stadhouderslaan 47, 3583 JD Utrecht, Netherlands; 4Department of Zoology

Brendel, Volker

Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

- - - - - - - Agenda 12:30 p.m. Welcome Sharon Braswell, Facilitator (Mission Support Alliance) 12:40 p.m. DOE-Richland Operations Office JD Dowell , Assistant Manager for the...


Improving Door-to-balloon Time by Decreasing Door-to-ECG time for Walk-in STEMI Patients  

E-Print Network (OSTI)

JD, Lindsell CJ, et al. Door-to-ECG time in patients QualTime by Decreasing Door-to-ECG time for Walk-in STEMIto-electrocardiography (ECG) times for patients with ST-



One approach to artificial photosynthesis  

NLE Websites -- All DOE Office Websites (Extended Search)

One approach to artificial photosynthesis Authors: Llansola-Portols, M.J., Palacios, R.E., Kodis, G., Megiatto, J.D., Moore, A.L., Moore, T. A., and Gust, D. Title: One approach...


Requirements for the Effective Use of the Water Resources Scientific Information Center (WRSIC) -- Determined by Field Evaluation  

E-Print Network (OSTI)

TR- 23 Vol II 1969 Requirements for Effective Use of the Water Resources Scientific Information Center (WRSIC) ? Determined by Field Evaluation E.B. Smith J.B. Herbich J.D. Benson Texas...TR- 23 Vol II 1969 Requirements for Effective Use of the Water Resources Scientific Information Center (WRSIC) ? Determined by Field Evaluation E.B. Smith J.B. Herbich J.D. Benson Texas...

Herbich, J. B.; Smith, E. B.; Benson, J. D.



Contract No.: DE-AC02-09CH11466 ATTACHMENT J.4  

E-Print Network (OSTI)

Contract No.: DE-AC02-09CH11466 Section J Appendix D J-D-1 ATTACHMENT J.4 APPENDIX D BUDGET PROGRAM Applicable to the Operation of PPPL Contract No. DE-AC02-09CH11466 #12;Contract No.: DE-AC02-09CH11466 Section J Appendix D J-D-2 BUDGET PROGRAM This Appendix implements the clause of this contract entitled

Princeton Plasma Physics Laboratory


"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Daily Volume MWh","Number of Trades","Number of Companies"  

U.S. Energy Information Administration (EIA) Indexed Site

449,39450,39450,180,158,161.65,26400,33,22 449,39450,39450,180,158,161.65,26400,33,22 "NEPOOL MH DA LMP",39450,39451,39451,123,108,114.27,36800,46,28 "NEPOOL MH DA LMP",39451,39454,39454,77,75.5,76.31,21600,26,17 "NEPOOL MH DA LMP",39454,39455,39455,68.25,66,67.1,41600,51,26 "NEPOOL MH DA LMP",39455,39456,39456,69.5,68,68.71,21600,27,18 "NEPOOL MH DA LMP",39456,39457,39457,81,74,75.75,30400,35,17 "NEPOOL MH DA LMP",39457,39458,39458,75,69.75,71.18,24800,31,19 "NEPOOL MH DA LMP",39458,39461,39461,80.5,77,79.38,17600,19,17 "NEPOOL MH DA LMP",39461,39462,39462,102,95,98.76,52000,64,24 "NEPOOL MH DA LMP",39462,39463,39463,90.5,87.5,88.59,34400,43,25 "NEPOOL MH DA LMP",39463,39464,39464,85,83.5,84.21,20800,26,14


"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Daily Volume MWh","Number of Trades","Number of Companies"  

U.S. Energy Information Administration (EIA) Indexed Site

084,39085,39085,62,55,55.98,10400,13,10 084,39085,39085,62,55,55.98,10400,13,10 "NEPOOL MH DA LMP",39085,39086,39086,54.75,52.75,53.53,30400,38,20 "NEPOOL MH DA LMP",39086,39087,39087,56,55,55.35,24800,31,19 "NEPOOL MH DA LMP",39087,39090,39090,58,56.5,57.08,8000,10,12 "NEPOOL MH DA LMP",39090,39091,39091,58.75,57.25,57.86,34400,41,19 "NEPOOL MH DA LMP",39091,39092,39092,60.5,59,59.8,20800,25,19 "NEPOOL MH DA LMP",39092,39093,39093,65,63.5,64.04,13600,16,15 "NEPOOL MH DA LMP",39093,39094,39094,61.25,59.75,60.82,15200,19,14 "NEPOOL MH DA LMP",39094,39097,39097,62,59,60.95,16800,21,16 "NEPOOL MH DA LMP",39097,39098,39098,69.25,67,68.25,22400,28,15 "NEPOOL MH DA LMP",39098,39099,39099,89,84.5,86.33,34400,43,26


"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Daily Volume MWh","Number of Trades","Number of Companies"  

U.S. Energy Information Administration (EIA) Indexed Site

355,38356,38356,56.85,56.25,56.7,6400,7,7 355,38356,38356,56.85,56.25,56.7,6400,7,7 "NEPOOL MH DA LMP",38356,38357,38357,55.25,55,55.0833,2400,3,3 "NEPOOL MH DA LMP",38357,38358,38358,59,59,59,800,1,2 "NEPOOL MH DA LMP",38358,38359,38359,57.5,57,57.25,2400,3,5 "NEPOOL MH DA LMP",38359,38362,38362,55.5,55.5,55.5,3200,4,6 "NEPOOL MH DA LMP",38362,38363,38363,58.75,58,58.575,9600,11,10 "NEPOOL MH DA LMP",38363,38364,38364,57.75,57.5,57.625,1600,2,4 "NEPOOL MH DA LMP",38364,38365,38365,55.75,55.25,55.4688,12800,15,11 "NEPOOL MH DA LMP",38365,38366,38366,58.5,58.25,58.4583,4800,5,6 "NEPOOL MH DA LMP",38366,38369,38369,92,85,88.7143,5600,7,8 "NEPOOL MH DA LMP",38369,38370,38370,97.5,97,97.1667,2400,3,5


Southwest Rural Elec Assn Inc | Open Energy Information  

Open Energy Info (EERE)

Oklahoma Oklahoma Utility Id 17681 Utility Location Yes Ownership C NERC Location SPP Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 1-10 175 Watts Commercial 100 Watt HPS, No Energy Lighting 100 Watt HPS, Unmetered Lighting 1000 Watt HPS or MH, No Energy Lighting 1000 Watt HPS or MH, Unmetered Lighting 11-50 175 Watts Commercial 175 Watt MVL, No Energy Lighting 175 Watt MVL, Unmetered Lighting 250 Watt HPS or MH, No Energy Lighting 250 Watt HPS or MH, Unmetered Lighting 400 Watt HPS or MH, No Energy Lighting 400 Watt HPS or MH, Unmetered Lighting


City of Frankfort, Kentucky (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Frankfort City of Frankfort City of Place Kentucky Utility Id 6708 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes Activity Transmission Yes Activity Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Area Lighting- (1000W MH With 35' Metal Pole) Lighting Area Lighting- (1000W MH With 35' Wood Pole) Lighting Area Lighting- (1000W MH With 45' Metal Pole) Lighting Area Lighting- (250W MH With 35' Metal Pole) Lighting Area Lighting- (250W MH With 35' Wood Pole) Lighting Area Lighting- (320W MH With 35' Metal Pole) Lighting


"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Change","Daily Volume MWh","Number of Trades","Number of Companies"  

U.S. Energy Information Administration (EIA) Indexed Site

546,40547,40547,55.25,54,54.67,7.01,27200,29,18 546,40547,40547,55.25,54,54.67,7.01,27200,29,18 "Nepool MH DA LMP",40547,40548,40548,50,48.75,49.39,-5.28,14400,16,14 "Nepool MH DA LMP",40548,40549,40549,54.25,53,53.44,4.05,24800,31,23 "Nepool MH DA LMP",40549,40550,40550,55.5,53.25,54.05,0.61,84800,80,24 "Nepool MH DA LMP",40550,40553,40553,65.5,64.75,65.01,10.96,21600,25,18 "Nepool MH DA LMP",40553,40554,40554,71,68.5,69.33,4.32,15200,18,17 "Nepool MH DA LMP",40554,40555,40555,79,72,77.51,8.18,68800,85,29 "Nepool MH DA LMP",40555,40556,40556,100.5,88,94.96,17.45,40000,49,23 "Nepool MH DA LMP",40556,40557,40557,92.25,87,87.7,-7.26,25600,31,23 "Nepool MH DA LMP",40557,40560,40560,66,63.5,65.03,-22.67,28000,30,17


"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Change","Daily Volume MWh","Number of Trades","Number of Companies"  

U.S. Energy Information Administration (EIA) Indexed Site

182,40183,40183,100.5,95,97,19.88,33600,42,27 182,40183,40183,100.5,95,97,19.88,33600,42,27 "Nepool MH DA LMP",40183,40184,40184,95,90,92.96,-4.04,39200,49,25 "Nepool MH DA LMP",40184,40185,40185,94,83,86.45,-6.51,33600,42,30 "Nepool MH DA LMP",40185,40186,40186,90,81.5,83.19,-3.26,47200,53,27 "Nepool MH DA LMP",40186,40189,40189,91,88.75,89.88,6.69,42400,53,30 "Nepool MH DA LMP",40189,40190,40190,71,67.75,68.95,-20.93,78400,95,30 "Nepool MH DA LMP",40190,40191,40191,61.25,58.75,59.99,-8.96,52800,64,31 "Nepool MH DA LMP",40191,40192,40192,56.25,54.75,55.33,-4.66,71200,82,32 "Nepool MH DA LMP",40192,40193,40193,53.75,53,53.36,-1.97,44000,55,25 "Nepool MH DA LMP",40193,40196,40196,55.75,54.75,55.64,2.28,21600,25,12


Sanyo Electric Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Sector: Solar, Vehicles Product: Japanese electric appliance manufacturer; manufactures solar panels, domestic fuel cell system, and NiMH batteries for hybrid vehicles....


Mechanism-Based Inactivation of Cytochrome P450 3A4 by L-754,394  

Science Journals Connector (OSTI)

The theoretical average mass for the other peptides which could produce [M+H]+ ions nearest the value observed in the MADLI mass spectrum are 4600.2 ...

Luke Koenigs Lightning; Jeffrey P. Jones; Thomas Friedberg; Michael P. Pritchard; Magang Shou; Thomas H. Rushmore; William F. Trager



E-Print Network 3.0 - assertiveness Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

Logic Programs Michael Hanus Institut f... ur Informatik, CAU Kiel, D-24098 Kiel, Germany mh@informatik.uni-kiel.de Abstract. Assertions or contracts... are an important...



E-Print Network (OSTI)

the potential use of geothermal energy for power generation47. Boldizsar, T. , 1970, "Geothermal energy production fromCoast Geopressure Geothermal Energy Conference, M.H. Dorfman

Narasimhan, T.N.



Data:155cf4f1-f386-4f37-9f0a-0f6fde30a317 | Open Energy Information  

Open Energy Info (EERE)

Next >> Basic Information Utility name: Nebraska Public Power District Effective date: 20130101 End date if known: Rate name: Directional Lighting MH 250 W Unmetered 835 Sector:...


Ovonic Battery Company Inc | Open Energy Information  

Open Energy Info (EERE)

Ovonic Battery Company Inc Place: Michigan Zip: 48309 Sector: Hydro, Hydrogen Product: Focused on commercializing its patented and proprietary NiMH battery technology through...



E-Print Network (OSTI)

the potential use of geothermal energy for power generationCoast Geopressure Geothermal Energy Conference, M.H. Dorfmanand Otte, C. , 1976, Geothermal energy-resources production,

Narasimhan, T.N.



Ferromagnetic Semiconductor Nanoclusters: Co-doped Cu2O. | EMSL  

NLE Websites -- All DOE Office Websites (Extended Search)

D Meyer DE McCready MH Engelhard Capabilities: Spectroscopy and Diffraction NMR and EPR Facility: Radiochemistry Annex Science Theme: Energy Materials & Processes Biosystem...

Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Change","Daily Volume MWh","Number of Trades","Number of Counterparties"  

U.S. Energy Information Administration (EIA) Indexed Site

Da LMP Peak",41246,41247,41247,48,45.75,47.16,-7.85,40000,48,21 Da LMP Peak",41246,41247,41247,48,45.75,47.16,-7.85,40000,48,21 "Nepool MH Da LMP Peak",41247,41248,41248,58.5,55,57.81,10.65,26400,32,21 "Nepool MH Da LMP Peak",41248,41249,41249,79.75,75,76.49,18.68,32800,39,18 "Nepool MH Da LMP Peak",41249,41250,41250,65,50.5,51.47,-25.02,35200,42,23 "Nepool MH Da LMP Peak",41250,41253,41253,47,45.5,46.48,-4.99,12800,16,14 "Nepool MH Da LMP Peak",41253,41254,41254,50,46,47.3,0.82,38400,44,22 "Nepool MH Da LMP Peak",41254,41255,41255,70,57,59.54,12.24,39200,49,19 "Nepool MH Da LMP Peak",41255,41256,41256,50,48.25,48.97,-10.57,53600,59,29 "Nepool MH Da LMP Peak",41256,41257,41257,39.25,38.5,38.98,-9.99,11200,14,10 "Nepool MH Da LMP Peak",41257,41260,41260,45,45,45,6.02,3200,4,6


"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Change","Daily Volume MWh","Number of Trades","Number of Counterparties"  

U.S. Energy Information Administration (EIA) Indexed Site

DA LMP",40911,40912,40912,92,84.75,87.16,-14.07,46400,56,29 DA LMP",40911,40912,40912,92,84.75,87.16,-14.07,46400,56,29 "Nepool MH DA LMP",40912,40913,40913,49,46,47.55,-39.61,78400,77,24 "Nepool MH DA LMP",40913,40914,40914,39.75,39.25,39.57,-7.98,12000,15,10 "Nepool MH DA LMP",40914,40917,40917,39,38,38.39,-1.18,8800,11,9 "Nepool MH DA LMP",40917,40918,40918,38.25,38,38.14,-0.25,8000,9,11 "Nepool MH DA LMP",40918,40919,40919,41.5,39.9,40.88,2.74,70400,83,25 "Nepool MH DA LMP",40919,40920,40920,37.25,36.75,36.83,-4.05,20000,23,16 "Nepool MH DA LMP",40920,40921,40921,44,43.5,43.73,6.9,11200,11,12 "Nepool MH DA LMP",40921,40924,40924,67,65.5,66.35,22.62,16800,21,15 "Nepool MH DA LMP",40924,40925,40925,50.75,50,50.24,-16.11,11200,14,12


Kayo Battery Industries Group | Open Energy Information  

Open Energy Info (EERE)

Vehicles Product: Shenzhen-based company, started by Hong Kong Highpower Technology and Japan Kayo Group, active in producing Lithium and NiMH batteries for various applications...


MP-Boost: A Multiple-Pivot Boosting Algorithm and Its Application to Text  

E-Print Network (OSTI)

for building multi-label (aka n-of-m) text classifiers. AdaBoost.MH be- longs to the family of "boostingBoost.MH [1] is a popular supervised learning algorithm for building multi-label text classifiers. Ada" algorithms, and works by iteratively building a committee of "decision stump" classifiers, where each

Sebastiani, Fabrizio


Computational Studies on the Mechanical Inhomogeneity of Tropomyosin, and the Directed and Cooperative Motility of the Ncd Motor  

E-Print Network (OSTI)

the coiled-coil neck-stalks of longitudinal neighbors drive synchrony among a group of Ncds on a single protofilament. Across lateral dimers, surface loop L2 of the motor-head (MH) that is not bound to the MT (unbound-MH) in a pre-stroke dimer, is seen...

Lakkaraju, Sirish



Subpicosecond oxygen trapping in the heme pocket of the oxygen sensor FixL observed by time-resolved resonance Raman spectroscopy  

Science Journals Connector (OSTI)

...11241 11242 . 7 Liebl U Bouzhir-Sima L Negrerie M Martin J-L Vos MH ( 2002 ) Proc Natl Acad Sci USA 99 : 12771 12776 . 8 Balland V Bouzhir-Sima L Kiger L Marden MC Vos MH Liebl U Mattioli TA ( 2005 ) J Biol Chem 280 : 15279 15288 . 9 Jasaitis...

Sergei G. Kruglik; Audrius Jasaitis; Klara Hola; Taku Yamashita; Ursula Liebl; Jean-Louis Martin; Marten H. Vos



Pollution Ecology: ERSC 355 page 1/4 POLLUTION ECOLOGY: ERSC 355  

E-Print Network (OSTI)

of pollutants, food chain effects, as well as the effects of mining and smelting activities, transportation on Aquatic Ecosystems MH 4 Oct 1 Acid Rain effects on Terrestrial Ecosystems & Air Pollution in the Kawartha's TH 5 Oct 8 Case Study: Smoking Hills MH/TH 6 Oct 15 Air Pollution Indicators & Sentinels TH Reading

Fox, Michael


Verification of the SAP Reference Models using EPC Reduction, State Space Analysis,  

E-Print Network (OSTI)

B.F. van Dongen , M.H. Jansen-Vullers, H.M.W. Verbeek , W.M.P. van der Aalst Department ), m.h.jansen-vullers@tm.tue.nl ( M.H. Jansen-Vullers), h.m.w.verbeek@tm.tue.nl (H.M.W. Verbeek ), w

van der Aalst, Wil


Lipoprotein subclass analysis by immunospecific density  

E-Print Network (OSTI)

fingerprinting method as previously reported. The light source used was a Fiber-Lite MH ?100 Illuminator (MH100A, Edmund Industrial Optics). The camera used was a digital color microscope camera (S99808, Optronics, Goleta, CA). The camera and the light source...

Lester, Sandy Marie



Austerity in MCMC Land: Cutting the Metropolis-Hastings Budget Anoop Korattikara AKORATTI@UCI.EDU  

E-Print Network (OSTI)

above. Researchers have made some progress in terms of making Proceedings of the 31st International-Hastings (MH) test to reach a single binary decision is computationally inefficient. We introduce an ap- proximate MH rule based on a sequential hypoth- esis test that allows us to accept or reject samples

Welling, Max


Vehicle Manufacturing Futures in Transportation Life-cycle Assessment  

E-Print Network (OSTI)

Lead Acid, Ni-Mh, and Li-ion battery manufacturing isMh battery, HEV Page 4 of 10 with a Li-ion battery, PHEV20with a Li-ion battery, PHEV60 with a Li-ion battery, and

Chester, Mikhail; Horvath, Arpad



PE2-7 Small animal PET imaging Michael A. Miller and Gary D. Hutchins (Indianapolis, USA)  

E-Print Network (OSTI)

27 PE2-7 Small animal PET imaging Michael A. Miller and Gary D. Hutchins (Indianapolis, USA) May 21, USA) May 23 8:30-10:00 RoomA+B, 10/F Meet the history Chair: Koji Abe (Okayama, Japan), James Mc Michael A. Moskowitz (Boston, USA) MH-7 Takaaki Kirino (Tokyo, Japan) MH-8 Nicolas G. Bazan (New Orleans


Induction of endoplasmic reticulum stress response by TZD18, a novel dual ligand for peroxisome proliferator-activated receptor ?/?, in human breast cancer cells  

Science Journals Connector (OSTI)

...cancer cells. Breast Cancer Res Treat 2002;74:155-65. 8 Fenner MH , Elstner E. Peroxisome proliferator-activated receptor-gamma...MDA-MB-231. Mol Carcinog 2002;34:165-71. 12 Liu H , Zang C, Fenner MH, et al. Growth inhibition and apoptosis in human Philadelphia...

Chuanbing Zang; Hongyu Liu; Janina Bertz; Kurt Possinger; H. Phillip Koeffler; Elena Elstner; Jan Eucker



PPAR? Agonists Target Aromatase Via Both PGE2 and BRCA1  

Science Journals Connector (OSTI)

...desmoplastic reaction.Cancer Res 2001;61:2250-5. 12. Fenner MH , Elstner E.Peroxisome proliferator-activated receptor-gamma...Acad Sci U S A 1998;95:8806-11. 20. Liu H , Zang C, Fenner MH, Possinger K, Elstner E.PPARgamma ligands and ATRA inhibit...

Ofer Margalit; Dingzhi Wang; Raymond N. DuBois



JGR-Atmospheres Papers from the RADAGAST Research Team  

NLE Websites -- All DOE Office Websites (Extended Search)

JGR-Atmospheres Papers from the RADAGAST Research Team JGR-Atmospheres Papers from the RADAGAST Research Team Bharmal, N.A., A. Slingo, G.J. Robinson, and J.J. Settle, 2009: Simulation of surface and top of atmosphere thermal fluxes and radiances from the RADAGAST experiment. Journal of Geophysical Research-Atmospheres, 114, doi:10.1029/2008JD010504, in press. Kollias, P., M.A. Miller, K.L. Johnson, M.P. Jensen, and D.T. Troyan, 2009: Cloud, thermodynamic, and precipitation observations in West Africa during 2006. Journal of Geophysical Research- Atmospheres, 114, doi: 10.1029/2008JD010641, in press. McFarlane, S.A., E.I. Kassianov, J. Barnard, C. Flynn, and T. Ackerman, 2009: Surface shortwave aerosol forcing during the ARM Mobile Facility deployment in Niamey, Niger. Journal of Geophysical Research-Atmospheres, 114, doi: 10.1029/2008JD010491, 17 pages.


City of Rocky Mount, North Carolina (Utility Company) | Open Energy  

Open Energy Info (EERE)

Mount, North Carolina (Utility Company) Mount, North Carolina (Utility Company) Jump to: navigation, search Name City of Rocky Mount Place North Carolina Utility Id 16226 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes ISO Other Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Area Lighting - 1000W MH Lighting Area Lighting - 1000W MV Lighting Area Lighting - 100W MH Lighting Area Lighting - 100W MH (SE) Lighting Area Lighting - 100W SV Lighting Area Lighting - 100W SV (SE) Lighting Area Lighting - 1500W MH Lighting Area Lighting - 150W SV Lighting Area Lighting - 175W MH Lighting


Characterization of gentamicin resistance plasmids: a comparison of plasmids isolated from the enteric flora of commercial turkeys to plasmids of human origin  

E-Print Network (OSTI)

and plasmid DNA content of gentamicin resistant stra1ns . 26 45 50 68 Characterization of plasmid DNA content of gentami c1n res1stant trans conjugants 87 LIST OF FIGURES Fi gure Agarose gel electrophoresis of partially purified DNA from strains... of gentamicin resistant E. col1 1solated from commercial turkeys. $a) JD 125, 25 ul of part1ally purified DNA . Agarose gel electrophores1s of part1ally purified DNA from gentamicin resistant bacterial strains isolated from commercial turkeys. (a) JD 010...

Dubel, Jacqueline Roberta



The INTERVAL Trial to determine whether intervals between blood donations can be safely and acceptably decreased to optimise blood supply: study protocol for a randomised controlled trial  

E-Print Network (OSTI)

, and reproducibility). J Orthop Sci 2011, 16:713. 20. Hirsch JD, Lee SJ, Terkeltaub R, Khanna D, Singh J, Sarkin A, Harvey J, Kavanaugh A: Evaluation of an instrument assessing influence of gout on health-related quality of life. J Rheumatol 2008, 35:24062414. 21... Sci 2011, 16:713. 20. Hirsch JD, Lee SJ, Terkeltaub R, Khanna D, Singh J, Sarkin A, Harvey J, Kavanaugh A: Evaluation of an instrument assessing influence of gout on health-related quality of life. J Rheumatol 2008, 35...

Moore, Carmel; Sambrook, Jennifer; Walker, Matthew; Tolkien, Zoe; Kaptoge, Stephen; Allen, David; Mehenny, Susan; Mant, Jonathan; Di Angelantonio, Emanuele; Thompson, Simon G.; Ouwehand, Willem; Roberts, David J.; Danesh, John



L^p Bernstein Inequalities and Radial Basis Function Approximation  

E-Print Network (OSTI)

on scattered data This dissertation follows the style of the Journal of Approximation Theory. 2 sites. F.J. Narcowich and J.D. Ward have made signi cant contributions to this eld studying approximation on compact manifolds where the data sites are allowed... on scattered data This dissertation follows the style of the Journal of Approximation Theory. 2 sites. F.J. Narcowich and J.D. Ward have made signi cant contributions to this eld studying approximation on compact manifolds where the data sites are allowed...

Ward, John P.



Spontaneous CP violation in the supersymmetric Higgs sector  

Science Journals Connector (OSTI)

Spontaneous CP violation in the minimal supersymmetric standard model with a gauge singlet and a cubic superpotential is examined. Although the tree-level Higgs potential conserves CP, it is shown that with the inclusion of the one-loop top-quark radiative effects CP may be broken spontaneously. The CP-violating minimum requires two neutral (h1,h2) and one charged (H) Higgs boson to be relatively light with mh1+mh2?100 GeV and mH?110 GeV. The electric dipole moment of the electron is in the observable range of (1/3 to 3)10-27e cm.

K. S. Babu and S. M. Barr


Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Identification and initial characterization of circadian clock mutants in Neurospora crassa  

E-Print Network (OSTI)

strains . . . . . . . . . . . . . . . . . . . . . 19 4. The mtr selection. 20 5. Plasmid construction. . 26 6. Genetic analysis of strain 96-9 shows that it is mtr and trp 31 7. Genetic analysis of strain 106-20 shows that it is mtr, trp..., and hygromycin resistant. . 33 8. Southern analysis and pC1M restriction map. . . . . . 34 9. Genetic analysis of strain 4MH2 (bdtmtrttrp-2;frq IpCI M) 36 10. Genetic analysis of strain 7MH7 (bd; mtr; trptpC I M). . . . . 37 11. Reconstruction of strain 4MH2...

March, Irene Jennifer




NLE Websites -- All DOE Office Websites (Extended Search)

McKeown, N.A. Roberts, J.D. Fowlkes, T.B. LaGrange, B.W. Reed, G.H. Campbell, and P.D. Rack. "Real-time observation of nanosecond liquid-phase assembly of nickel nanoparticles via...


Four Postmortem Case Reports with Quantitative Detection of the Synthetic Cannabinoid, 5F-PB-22  

Science Journals Connector (OSTI)

......gas stations and the Internet (1-5). Many of these...past history of alcohol abuse or dependence was denied...decedents in all cases were young males; three teenage...Tofighi B. , Lee J.D. Internet highs-seizures after...2012) 6:240-241. 7 Young A.C. , Schwarz E......

George Behonick; Kevin G. Shanks; Dennis J. Firchau; Gagan Mathur; Charles F. Lynch; Marcus Nashelsky; David J. Jaskierny; Chady Meroueh



Four Postmortem Case Reports with Quantitative Detection of the Synthetic Cannabinoid, 5F-PB-22  

Science Journals Connector (OSTI)

......via smoke shops, gas stations and the Internet (1-5). Many of these substances are...A current or past history of alcohol abuse or dependence was denied by the patient...27-46. 6 Tofighi B. , Lee J.D. Internet highs-seizures after consumption of......

George Behonick; Kevin G. Shanks; Dennis J. Firchau; Gagan Mathur; Charles F. Lynch; Marcus Nashelsky; David J. Jaskierny; Chady Meroueh



Is low pathogenic avian influenza virus virulent for wild waterbirds?  

Science Journals Connector (OSTI)

...JD , DE Stallknecht, JR Beck, DL Suarez, and...Bestebroer, WE Beyer, R van Lavieren, AD Osterhaus...Bewick's swans. Proc. R. Soc. B 279, 529-534...settings. Chicago, IL: Rand McNally College Publishing. 52...or vice versa? Proc. R. Soc. B 276, 2345-2346...



Aurora at the pole and equator: overlapping functions of Aurora kinases in the mitotic spindle  

Science Journals Connector (OSTI)

...200901036 ) 97 Loughlin, R , JD Wilbur, FJ McNally, FJ Nedelec, and R Heald. 2011 Katanin contributes...111 Roll-Mecak, A , and FJ McNally. 2010 Microtubule-severing...jcb.200612011 ) 113 Brown, JR , KK Koretke, ML Birkeland...



January 2012 PUBLICATIONS AND PAPERS-Clare E. Reimers  

E-Print Network (OSTI)

, conference proceedings, etc. 1. Reimers, C.E., ?zkan-Haller, H.T., Berg, P., Devol, A., McCann-Grosvenor, K energy from deep ocean cold seeps. Energy and Environmental Science 1, 584-593. 8. Nelson, J.D., Boehme, L., White, H.K., and Girguis, P.R. (2007) Substrate degradation kinetics, microbial diversity

Wright, Dawn Jeannine


Occupational Trichloroethylene Exposure and Renal Carcinoma Risk: Evidence of Genetic Susceptibility by Reductive Metabolism Gene Variants  

Science Journals Connector (OSTI)

...coded for organic/chlorinated solvent and TCE exposure (ever/never...studies have implicated the solvent trichloroethylene (TCE) as...occupational exposure to organic solvents: a case referent approach...35 Sherratt PJ , Manson MM, Green T Hayes JD. Increased activation...

Lee E. Moore; Paolo Boffetta; Sara Karami; Paul Brennan; Patricia S. Stewart; Rayjean Hung; David Zaridze; Vsevolod Matveev; Vladimir Janout; Helena Kollarova; Vladimir Bencko; Marie Navratilova; Neonila Szeszenia-Dabrowska; Dana Mates; Jan Gromiec; Ivana Holcatova; Maria Merino; Stephen Chanock; Wong-Ho Chow; and Nathaniel Rothman



An assessment of the progression adjustment factor using TRANSYT- 7F  

E-Print Network (OSTI)

, p~, pr)dydT J JD =ff -'w(-j))[-( ? )"f'( )'J d(dr where the notation P = and Pr= . One can find that the functional also ap ap ' ay ' aT' contains a exponential term similar to the solution of a series of harmonic waves indicating that these two...

Lan, Chang-Jen



1 Managed by UT-Battelle for the U.S. Department of Energy  

E-Print Network (OSTI)

, S.D., C.C. Gilmour, A.M. Kucken, J.D. Wall, D.A. Elias, C.C. Brandt, M. Podar, O. Chertkov, B. Held, D.C. Bruce, J.C. Detter, R. Tapia, C.S. Han, L.A. Goodwin, J.-F. Cheng, S. Pitluck, T. Woyke, N


Turbulent effects on the microphysics and initiation of warm rain in deep convective clouds: 2-D simulations  

E-Print Network (OSTI)

and theoretical investigations are required to quantify the turbulent effects. Citation: Benmoshe, N., M. Pinsky. Res., 117, D06220, doi:10.1029/2011JD016603. 1. Introduction [2] Several factors affect formation there are specific effects of turbulent mixing on the shape of droplet size distribution [e.g., Jensen and Baker

Mark, Pinsky


Simultaneous Targeting of Tumor Antigens and the Tumor Vasculature Using T Lymphocyte Transfer Synergize to Induce Regression of Established Tumors in Mice  

Science Journals Connector (OSTI)

...Engl J Med 2003;349:427-34. 18. Overwijk WW , Theoret MR, Finkelstein SE, Surman...3953-68. 21. Abad JD , Wrzensinski C, Overwijk W, de Witte MA, Jorritsma A, Hsu C...Immunother 2009;32:129-39. 24. Overwijk WW , Lee DS, Surman DR, Irvine KR...

Dhanalakshmi Chinnasamy; Eric Tran; Zhiya Yu; Richard A. Morgan; Nicholas P. Restifo; Steven A. Rosenberg



Granite Recrystallization The Key to an Alternative Strategy for HLW Disposal? Fergus G.F. Gibb  

E-Print Network (OSTI)

JD, U.K. ABSTRACT An alternative strategy is proposed for the disposal of spent nuclear fuel (SNF HLWs, such as spent reactor fuel, to `cool' for a period (usually a few decades) prior to disposal potentially damaging temperature rises. Secondly, the waste contains sufficient quantities of very long lived

Sheffield, University of


Cross-Clade Ultrasensitive PCR-Based Assays To Measure HIV Persistence in Large-Cohort Studies  

Science Journals Connector (OSTI)

...3516-3526. doi: 10.1128/JVI.03331-13 . 26. Han, Y , M Wind-Rotolo, HC Yang, JD Siliciano, and RF Siliciano. 2007...431-438. 37. Sonza, S , A Maerz, N Deacon, J Meanger, J Mills, and S Crowe. 1996. Human immunodeficiency virus type 1 replication...

Claire Vandergeeten; Rmi Fromentin; Esther Merlini; Mariam B. Lawani; Sandrina DaFonseca; Wendy Bakeman; Amanda McNulty; Moti Ramgopal; Nelson Michael; Jerome H. Kim; Jintanat Ananworanich; Nicolas Chomont



LINE-1 Retrotransposable Element DNA Accumulates in HIV-1-Infected Cells  

Science Journals Connector (OSTI)

...this article. Type 1 long-interspersed nuclear elements (L1s) are autonomous retrotransposable...L1-ORF1 (E), and Alu (F). In each graph, DNA quantifications for NL4-3-infected...J. Mol. Biol. 304 :11-20. 18. Cost, GJ , Q Feng, A Jacquier, and JD Boeke...

R. Brad Jones; Haihan Song; Yang Xu; Keith E. Garrison; Anton A. Buzdin; Naveed Anwar; Diana V. Hunter; Shariq Mujib; Vesna Mihajlovic; Eric Martin; Erika Lee; Monika Kuciak; Rui Andr Saraiva Raposo; Ardalan Bozorgzad; Duncan A. Meiklejohn; Lishomwa C. Ndhlovu; Douglas F. Nixon; Mario A. Ostrowski



Defining groundwater remediation objectives with cost-1 benefit analysis: does it work?2  

E-Print Network (OSTI)

/or decontamination are related to direct50 groundwater use. Benefits are often considered as avoided costs1 Defining groundwater remediation objectives with cost-1 benefit analysis: does it work?2 3 J.7 *Corresponding author (E-mail: jd.rinaudo@brgm.fr)8 9 Abstract10 The use of cost-benefit analysis

Paris-Sud XI, Université de


This article was published in an Elsevier journal. The attached copy is furnished to the author for non-commercial research and  

E-Print Network (OSTI)

reserved. Keywords: ICMEs; Solar wind; Heliosphere; Solar cycle 1. Introduction The solar wind was first://www.elsevier.com/copyright #12;Author's personal copy Journal of Atmospheric and Solar-Terrestrial Physics 70 (2008) 219­225 Solar cycle variations of solar wind dynamics and structures J.D. Richardsona,b,?, J.C. Kaspera a Kavli

Richardson, John


Functional Genomics with a Comprehensive Library of Transposon Mutants for the Sulfate-Reducing Bacterium Desulfovibrio alaskensis G20  

Science Journals Connector (OSTI)

...not included in the average. In this paper...and Ng TK. 1988. Effect of phosphate on the...Rapp-Giles BJ, Price MN, Lin M, Bruce...ED, Jorgens D, Price MN, Witkowska HE...Wall JD. 2010. Effect of the deletion of...1160446 . 34. Price MN , Deutschbauer...

Jennifer V. Kuehl; Morgan N. Price; Jayashree Ray; Kelly M. Wetmore; Zuelma Esquivel; Alexey E. Kazakov; Michelle Nguyen; Raquel Kuehn; Ronald W. Davis; Terry C. Hazen; Adam P. Arkin; Adam Deutschbauer



Biomedical Application of Apatites  

Science Journals Connector (OSTI)

...Barralet JE, Best SM, Bonfield W (2000...161-173 Best SM, Sim B, Kayser...Bifano SL, Waldrop TC (1998) Hydroxylapatite...S, Boyd RD, Sun TC, Blaha JD, Lane...particles: Potential radiopharmaceuticals for radiation synovectomy...Planell JA, Best SM (1999) Precipitation...

Karlis A. Gross; Christopher C. Berndt


Cloning of the Arabidopsis RSF1 Gene by Using a Mapping Strategy Based on High-Density DNA Arrays and Denaturing High-Performance Liquid Chromatography  

Science Journals Connector (OSTI)

...Alto, California 94304 Howard Hughes Medical Institute, La Jolla, California 92037...Associate Investigator of the Howard Hughes Medical Institute. Aarts M.G.M. Corzaan...genomics Nagatani A. Plant biology. Lighting up the nucleus Neff M.M. Neff J.D...

Jamie I. Spiegelman; Michael N. Mindrinos; Christian Fankhauser; Daniel Richards; Jason Lutes; Joanne Chory; Peter J. Oefner

Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

COTTON TOLERANCE AND WEED MANAGEMENT WITH SHARPEN J.D. Reed Texas AgriLife Research Lubbock, TX J that was registered in 2009 for use in corn, soybeans, sorghum and cotton. Field studies were conducted in 2009 to 1 and perennial weeds, 2) evaluate Sharpen applied postemergence for volunteer glyphosate-resistant cotton

Mukhtar, Saqib


Glioblastoma Stem Cells Are Regulated by Interleukin-8 Signaling in a Tumoral Perivascular Niche  

Science Journals Connector (OSTI)

...polymeric scaffolds were fabricated using a gas-foaming, particulate leaching method...high-pressure (800 psi) CO2 and releasing gas quickly using a pressure vessel (Parr Instruments...Lathia JD , Li M, Hall PE, Gallagher J, Hale JS, Wu Q, et alLaminin alpha 2 enables...

David W. Infanger; YouJin Cho; Brina S. Lopez; Sunish Mohanan; S. Chris Liu; Demirkan Gursel; John A. Boockvar; and Claudia Fischbach



Existing and emerging high impact invasive species are characterized by higher functional responses than natives  

Science Journals Connector (OSTI)

...research was funded by the DST-NRF Centre of Excellence for Invasion Biology. D.M.R. received support from...issuing research permits. J.D. acknowledges support from the...native (c) Cape kurper and (d) river goby towards tadpole prey...



Control of reproductive dominance by the thelytoky gene in honeybees  

Science Journals Connector (OSTI)

...kinases cell cycle similar to CG2862 D. mel. protein kinase C nucleotide...F.A.M., R.M.C.), D.F.G. (R.F.A.M.), NRF (R.M.C.) and EU-BABE network...1007/BF00405650 Evans, J.D , and D.E Wheeler2000Expression...



Combinatorial Mathematicians  

E-Print Network (OSTI)

. LSE, London Arhin, Mr. J. QMUL Arrowsmith, Prof. David K. QMUL, London Ashton, James Royal Holloway Essam, Prof. John W. Royal Holloway Evans, Dr. David M. East Anglia Evans, Dr. Edward A. St.Mary's U. C.W. Reading Hines, P. Royal Holloway Hirschfeld, Prof. James W.P. Sussex Hobbs, J.D. Open Hoffman, M



E-Print Network (OSTI)

MAGNETIC FIELDS IN THE NIGHTSIDE VENUS IONOSPHERE AND NEAR WAKE J,G. Luhmann.R.C. Elphic,C.T. Russelland were convected remnants of ionospheric fields induced on the dayside by the solar wind interaction 90024 J.D. Mihalov NASAAmesResearchCenter,MoffettField,California94035 Abstract. Pioneer Orbiter

California at Berkeley, University of


Curriculum vitae-Bilal Rashid Malik Curriculum vitae  

E-Print Network (OSTI)

Curriculum vitae- Bilal Rashid Malik 1 Curriculum vitae Contact Name: Bilal Rashid Malik Room 2;Curriculum vitae- Bilal Rashid Malik 2 Skills Molecular Biology, Immunology, Biochemistry and Cell biology. #12;Curriculum vitae- Bilal Rashid Malik 3 Malik BR, Grant SGN, Armstrong JD (2006). Components

Edinburgh, University of



E-Print Network (OSTI)

.A. Callahan-Miller, J.F. Latkowski, B.G. Logan, J.D. Lindl Lawrence Livermore National Laboratory P.O. Box 808 Livermore, California 94551 (925) 422-8536 P.F. Peterson Department of Nuclear Engineering University will be the demonstration of indirect-drive ignition and gain on the National Ignition Facility (NIF), to confirm capsule


Preplant Burndown and In-Season Sharpen Use in Cotton J.W. Keeling  

E-Print Network (OSTI)

Preplant Burndown and In-Season Sharpen Use in Cotton J.W. Keeling J.D. Reed J.L. Spradley W as a preplant burndown treatment prior to cotton planting and during the fallow period following harvest amaranth (Amaranthus palmeri), morningglory (Ipomoea spp.), and volunteer cotton (Gossypium hirsutum) when

Mukhtar, Saqib


Control of Palmer amaranth in GlytolTM + LibertyLink Cotton J.W. Keeling  

E-Print Network (OSTI)

Control of Palmer amaranth in GlytolTM + LibertyLink® Cotton J.D. Reed J.W. Keeling Texas Agri Lubbock, TX Abstract Palmer amaranth (Amaranthus palmeri) remains the most common weed in cotton fields such that weeds that are difficult to control with glyphosate are becoming more common in fields. Cotton varieties

Mukhtar, Saqib


Palmer amaranth (Amaranthus palmeri S. Wats.) Management in Glytol + LibertyLink Cotton Texas AgriLife Research  

E-Print Network (OSTI)

Palmer amaranth (Amaranthus palmeri S. Wats.) Management in Glytol® + LibertyLink® Cotton J.D. Reed in cotton fields on the Texas High Plains is Palmer amaranth (Amaranthus palmeri). Weeds that are difficult. Cotton varieties containing both GlyTol® and LibertyLink® traits will be commercialized as Gly

Mukhtar, Saqib


Genotypic Diversity and Virulence Characteristics of Clinical and Environmental Vibrio vulnificus Isolates from the Baltic Sea Region  

Science Journals Connector (OSTI)

...intracontinental sea and a low-salinity marine ecosystem. At the same time it shows an...The evolution of genetic structure in the marine pathogen, Vibrio vulnificus. Infect...14 :457-459. 54. Oliver, JD , JE Wear, MB Thomas, M Warner and K Linder. 1986...

Nadja Bier; Silke Bechlars; Susanne Diescher; Florian Klein; Gerhard Hauk; Oliver Duty; Eckhard Strauch; Ralf Dieckmann



Vibrio vulnificus Bacteriophage SSP002 as a Possible Biocontrol Agent  

Science Journals Connector (OSTI)

...Vibrio vulnificus and other marine bacteria. Epidemiol. Infect...90206-7 . 6. Oliver, JD , JE Wear, MB Thomas, M Warner and K...into ecology and evolution of marine siphoviruses. Environ. Microbiol...Complete genome sequence of a novel marine siphovirus, pVp-1, infecting...

Hyun Sung Lee; Slae Choi; Hakdong Shin; Ju-Hoon Lee; Sang Ho Choi




E-Print Network (OSTI)

Packaging, October 2009) A.A. Shapiro, C. Tudryn, D. Schatzel, S. Tseng. 18. "Computational Evolutionary. Shapiro, J. C. Earthman, J-D. M. Saphores and O. A. Ogunseitan. IEEE Transactions on Electronics PackagingAndrew A. Shapiro, Ph.D. ACADEMIC PUBLICATIONS 20. "Renovating the Electronics Revolution: From e

Mease, Kenneth D.


-./012&3)45&%$6'&78 -.//$9$).:);$573/)<$(&=&5$  

E-Print Network (OSTI)

Cardiovascular Disease (heart trouble, heart attack, angina, coronary insufficiency, coronary occlusion, FIC/derrame cerebral Heart Attack Ataque al corazón FIC)JC&K DL)JD.K If yes, when? Si es así, ¿cuando padecido alguna vez de alguna de las siguientes enfermedades o problemas? Damaged heart valves

Grishok, Alla


An implicit staggered-grid finite-difference method for seismic modelling  

Science Journals Connector (OSTI)

......for Geophysics, John A. and Katherine G. Jackson School of Geosciences...Galerkin (e.g. Riviere Wheeler 2003; Kaser Dumbser 2006...Basabe J.D. , Sen M.K., Wheeler M.F., 2008. The interior...1032-1056. Riviere B. , Wheeler M., 2003. Discontinuous......

Yang Liu; Mrinal K. Sen



=Campus =Distance Learning through IIT Online DoctoralDegree  

E-Print Network (OSTI)

Master'sDegreeCertificate Non-Degree Undergraduate ENGINEERING Architectural Engineering Architectural Engineering.D.)/Business Administration (M.B.A.) Dual Degree Juris Doctor (J.D.)/ Environmental Management and Sustainability Dual Management and Markets Doctor of the Science of Law (J.S.D.) ARCHITECTURE Architecture Architecture (M

Heller, Barbara


Optimized regional and interannual variability of lightning in a global chemical transport model constrained  

E-Print Network (OSTI)

to remove their diurnal sampling bias, we construct a monthly time series of lightning flash rates for 1998, D20307, doi:10.1029/2012JD017934. 1. Introduction [2] The extreme heat in a lightning flash channelOptimized regional and interannual variability of lightning in a global chemical transport model

Jacob, Daniel J.


Dan Dorsa, PhD Vice President, Research  

E-Print Network (OSTI)

Melinda Allie, BA, CIP Wendy Doggett, BA Stacie Fujisaki, CIP Kelly Kidner, CIP Trish Lindstrom, BA Triana Nagel, BS Kaija Maggard, BA, CIP Hilde Wette, PhD COI Analyst Sarah Byers, PhD Leta Guptill, BA IBC, JD, CIP Regulatory Specialist Click here for OIO Org Chart / Integrity Office Staff Nikki Bishop, BA

Chapman, Michael S.


The Effect of Compound Structure on the Elemental Responses in Gas Chromatography-Microwave Induced Plasma Atomic Emission Spectrometry  

Science Journals Connector (OSTI)

......Since microwave induced plasma atomic emission spectrometry...pro totype Model SG-2 atmospheric pressure GC-MIP which...The flow of the He plasma supporting gas was maintained...output frequency: 2450 30 MHz output power: 0-200...by J&D Instruments Plasma discharge tube length......

Huang Yieru; Ou Qingyu; Yu Weile


Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Manuscript for Geoscience Data Journal 1 The Egg Model -A Geological Ensemble for Reservoir  

E-Print Network (OSTI)

Simulation J.D. Jansen , R.M. Fonseca , S. Kahrobaei , M.M. Siraj§ , G.M. Van Essen , and P.M.J. Van den Hof relatively small three-dimensional realizations of a channelized oil reservoir produced under water flooding to demonstrate a variety of aspects related to computer-assisted flooding optimization and history matching

Van den Hof, Paul


A global single-sensor analysis of 20022011 tropospheric nitrogen dioxide trends observed from space  

E-Print Network (OSTI)

A global single-sensor analysis of 2002­2011 tropospheric nitrogen dioxide trends observed from nitrogen dioxide trends observed from space, J. Geophys. Res., 117, D16309, doi:10.1029/2012JD017571. 1. Introduction [2] Nitrogen dioxide (NO2) is one of most prominent air pollutants and is emitted primarily

Haak, Hein


Revised Manuscript  

NLE Websites -- All DOE Office Websites (Extended Search)

AIP Conf. Proc. 79 (1982) 155 1982LE23 M. LeMere, Y. Fujiwara, Y.C. Tang and Q.K.K. Liu, Phys. Rev. C26 (1982) 1847 1982LEZY M. Leitch, H.W. Baer, R. Bolton, J.D. Bowman,...


Khesbn no. 61-62 - Autumn - Winter 1970-1971 - Journal  

E-Print Network (OSTI)

StJ't lyl! )t rrtvj s I'N lgh r'ltNT J.r," ltJt' srs N ,-t:l t? illt D ''ly rrs;t /l1"lgh,, rtfty'l .rJD]t: 1y,'1 IrR

Admin, LAYCC



Seasonal variations of semidiurnal tidal perturbations in mesopause region temperature and zonal and meridional winds above  

E-Print Network (OSTI)

.1029/2007JD009687. 1. Introduction [2] Solar thermal tides are global-scale waves that dom- inate to conserve wave energy. When propagating into the MLT region, the horizontal wind tidal amplitude can reach with fluorescence lidar's advantages of high temporal and spatial resolution and the capability of full diurnal


Towards breaking temperature equilibrium in multi-component Eulerian schemes  

SciTech Connect

We investigate the effects ofthermal equilibrium on hydrodynamic flows and describe models for breaking the assumption ofa single temperature for a mixture of components in a cell. A computational study comparing pressure-temperature equilibrium simulations of two dimensional implosions with explicit front tracking is described as well as implementation and J-D calculations for non-equilibrium temperature methods.

Grove, John W [Los Alamos National Laboratory; Masser, Thomas [Los Alamos National Laboratory



Strecker 1 of 7 Ph.D., Biology. Queen's University, Kingston, Ontario, 2007.  

E-Print Network (OSTI)

-2011 Project title: "Conservation of desert fishes." Supervisors: Drs. J. Olden (University of Washington of alpine ponds." Supervisor: Dr. R. Vinebrooke PUBLICATIONS 1. Pool, T.K., A.L. Strecker, and J.D. Olden. Lafrenz, V. Shandas, H. Moradkhani, A. Yeakley, Y. Pan, R. Bean, G. Johnson, and M. Psaris. 2012. Water

Strecker, Angela L.


Antibiotic Consumption in Children Prior to Diagnosis of Asthma  

E-Print Network (OSTI)

2005, 331:301-2. 27. Spiro DM, Tay KY, Arnold DH, Dziura JD, Baker MD, Shapiro ED: Wait-and- see prescription for the treatment of acute otitis media: A randomized controlled trial. JAMA 2006, 296:1235-41. 28. Little P, Gould C, Williamson I, Moore M...

Marra, Fawziah; Marra, Carlo A; Richardson, Kathryn J; Lynd, Larry D; Fitzgerald, J Mark



Antimicrobial Resistance in Neisseria gonorrhoeae in the 21st Century: Past, Evolution, and Future  

Science Journals Connector (OSTI)

...summarized in Fig. 1. FIG 1 History of discovered and recommended...ESCs that can increase the energy for activating the formation...1994. The scars of Venus: a history of venereology. Springer-Verlag...Martin, JE, Jr , A Lester, EV Price, and JD Schmale. 1970. Comparative...

Magnus Unemo; William M. Shafer



Ensemble-based multi-objective production optimization of smart wells  

E-Print Network (OSTI)

of Technology, Eindhoven, The Netherlands p.m.j.vandenhof@tue.nl J.D. Jansen Delft University of Technology, Stevinweg 1, 2628 CN Delft, The Netherlands j.d.jansen@tudelft.nl Abstract In a recent study two with the aid of an adjoint formulation; see e.g. Brouwer and Jansen (2004), Sarma et al. (2005, 2006) or Jansen

Van den Hof, Paul


Journal of Coastal Research 21 2 307322 West Palm Beach, Florida March 2005 Concepts in Sediment Budgets  

E-Print Network (OSTI)

Journal of Coastal Research 21 2 307­322 West Palm Beach, Florida March 2005 Concepts in Sediment and Hydraulics Laboratory Vicksburg, MS 39180-6199, U.S.A. ABSTRACT ROSATI, J.D., 2005, Concepts in sediment-0208. The sediment budget is fundamental in coastal science and engineering. Budgets allow estimates to be made

US Army Corps of Engineers


Bioaccumulation of perfluoroalkyl compounds in midge (Chironomus riparius) larvae exposed to sediment  

E-Print Network (OSTI)

to sediment Delphine Bertin1* , Benoît J.D. Ferrari1,4 , Pierre Labadie2 , Alexandre Sapin1 , Jeanne Garric1 exposed to sediments from a deposition2 sampled at a site along the Rhône River (France) downstream of an industrial site3 releasing various perfluorinated chemicals. This sediment is characterized by high4


Nondestructive indices of trace element exposure in squamate reptiles  

E-Print Network (OSTI)

a , J.W. Snodgrass c , B.P. Jackson a , D.E Kling a , C.L. Rowe d , J.D. Congdon a a Savannah River Ecology Laboratory, University of Georgia, Aiken, SC 29802, USA b Department of Biological Sciences, snakes were either fed ®sh from a coal ash-contaminated site or uncontaminated food from a reference site

Hopkins, William A.


CHUIA VISTA Development Services Department Building Division  

E-Print Network (OSTI)

the diminution of energy consumption levels permitted by the 2008 Building Energy Efficiency Standards. Reduction of total and peak energy use, as a result of incremental energy conservation measures required Commissioner Arthur H. Rosenfeld Ph.D. Commissioner Julia Levin, J.D. California Energy Commission 1516 Ninth


Web %"%W%j%1!%7%g%s3+H/$N$9$9$a :4 F# K' y, ,  

E-Print Network (OSTI)

¡0;T¿l$,3+$$$F$$ $k;~4VBS$K$O¿pJs$,IQHK$K99?7$5$l$k$?$a%-%c%C%7%e $,L5BL$K$J$k$7, JD$C$F$$$k;~4VBS

Chiba, Shigeru


Fiscal Year 2004 Cont. #: 2730  

E-Print Network (OSTI)

carbon and assessment of instrument performance. J. Geophys. Res., 109(D23), D23S24, doi: 10.1029/2003JD.H. Langmuir (2004): Hydrothermal venting in magma deserts: The ultraslow-spreading Gakkel and South West (2003): Submarine hydrothermal venting on the southern Kermadec volcanic arc front (offshore New Zealand


Photochemically Induced Ionic Reactions of Cycloalkenes  

Science Journals Connector (OSTI)


James A. Marshall



Disparate Roles for the Regulatory A Subunit Isoforms in Arabidopsis Protein Phosphatase 2A  

Science Journals Connector (OSTI)

...J.D. (2003). Enhanced ethylene responsiveness in the Arabidopsis...Arabidopsis eer1 mutant has enhanced ethylene responses in the hypocotyl...Plant Cell 3, 677-684. Price, N.E., and Mumby, M...Weterings, K. (2003). Ethylene regulates the timing of anther...

Hong-Wei Zhou; Cindy Nussbaumer; Yvonne Chao; Alison DeLong



Comparative Mapping of the Brassica S Locus Region and Its Homeolog in Arabidopsis: Implications for the Evolution of Mating Systems in the Brassicaceae  

Science Journals Connector (OSTI)

...A.B. Meyerowitz E.M. Arabidopsis ethylene-response gene ETR1 Similarity of product...receptor-like kinase gene in Brassica oleracea. Price, R.A., Palmer, J.D., and Al-Shehbaz...chromosome 1 in the immediate vicinity of the ethylene response gene ETR1. A total of 26 genomic...

Joann A. Conner; Patrick Conner; Mikhail E. Nasrallah; June B. Nasrallah


Alumni Council Membership List (June 1, 2012 May 31, 2013)  

E-Print Network (OSTI)

Babilonia Hermann, M.B.A. '08 Amy Gretenstein, B.S.C. '06 Matt Roberts, M.M. '97 Elena Mulvaney, B.B.A. '04 Larry King, Jr., A.B. '83, M.B.A. '93 Donald Wine, J.D. '07 Representatives Phyllis E. Tyler, B.B.A. '80 Sports Hall of Fame: Public Health Alumni Association: #12;

Shyu, Mei-Ling

Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


HPLC Separation of Tetracycline Analogues: Comparison Study of Laser-Based Polarimetric Detection with UV Detection  

Science Journals Connector (OSTI)

......A.R. Naylor, P.R.F. Bell, and M.M. Thompson. Simple and reliable method...30510 (1992). 19. J.D. Ingle, Jr. and S.R. Crouch. Spectrochemical Analysis, 1st ed. Prentice Hall, Englewood Cliffs, NJ, 1998, p. 41......

Karno Ng; Sean W. Linder



Activation of the NOTCH Pathway in Head and Neck Cancer  

Science Journals Connector (OSTI)

...biology of Notch.J Endocrinol 2007;194:459-74. 37. Dang TP , Gazdar AF, Virmani AK, Sepetavec T, Hande KR, Minna JD...cell carcinoma.Clin Cancer Res 2010;16:2022-35. 47. Iso T , Kedes L Hamamori Y.HES and HERP families: multiple effectors...

Wenyue Sun; Daria A. Gaykalova; Michael F. Ochs; Elizabeth Mambo; Demetri Arnaoutakis; Yan Liu; Myriam Loyo; Nishant Agrawal; Jason Howard; Ryan Li; Sun Ahn; Elana Fertig; David Sidransky; Jeffery Houghton; Kalyan Buddavarapu; Tiffany Sanford; Ashish Choudhary; Will Darden; Alex Adai; Gary Latham; Justin Bishop; Rajni Sharma; William H. Westra; Patrick Hennessey; Christine H. Chung; and Joseph A. Califano




E-Print Network (OSTI)


Viglas, Anastasios


Annual Report and Accounts  

E-Print Network (OSTI)

Resources and Accounts Act 2000 Ordered by the House of Commons to be printed 15 July 2010 Forest Research's Stationery Office. FR(JD-JP)/CG-350 JUL/10 Printed on paper containing 75% recycled fibre content minimum . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 10 Centre for Forest Resources and Management


Economic demand predicts addiction-like behavior and therapeutic efficacy of oxytocin in the rat  

Science Journals Connector (OSTI)

...continue to make rational price-dependent choices...Lilje TC Kassel JD de Wit H ( 2012 ) Quantifying reinforcement value and...consumption and maximal price paid . Psychopharmacology...Shaham Y Shalev U Lu L De Wit H Stewart J ( 2003 ) The reinstatement...duration, raising the price of cocaine (responses...

Brandon S. Bentzley; Thomas C. Jhou; Gary Aston-Jones



Intangibility in intertemporal choice  

Science Journals Connector (OSTI)

...rather implicitly captured by prices, participants appear to rely...brains scanned, and replacing price with nutritional information...triple dollar sign indicates the price period; a triple question mark...D.E, Flory, J.D, de Wit, H, Manuck, S.B2006Preference...



Novel H7N9 Influenza Virus Shows Low Infectious Dose, High Growth Rate, and Efficient Contact Transmission in the Guinea Pig Model  

Science Journals Connector (OSTI)

...Soboleski, MR , JD Gabbard, GE Price, JA Misplon, CY Lo, DR Perez...Riel, D , VJ Munster, E de Wit, GF Rimmelzwaan, RA Fouchier...Chutinimitkul, VJ Munster, E de Wit, GF Rimmelzwaan, RA Fouchier...Riel, D , VJ Munster, E de Wit, GF Rimmelzwaan, RA Fouchier...

Jon D. Gabbard; Daniel Dlugolenski; Debby Van Riel; Nicolle Marshall; Summer E. Galloway; Elizabeth W. Howerth; Patricia J. Campbell; Cheryl Jones; Scott Johnson; Lauren Byrd-Leotis; David A. Steinhauer; Thijs Kuiken; S. Mark Tompkins; Ralph Tripp; Anice C. Lowen; John Steel



The integrity of oil and gas wells  

Science Journals Connector (OSTI)

...collected ?$225 million in impact fees. What Pennsylvania...Pennsylvania. Most of the impact fees that Pennsylvania...Yoxtheimer D Abad JD ( 2013 ) Impact of shale gas development on regional...environmental costs and benefits of fracking. Annu Rev Environ Resour...

Robert B. Jackson



Global Patterns of Groundwater Table Depth  

Science Journals Connector (OSTI)

...2012JD017539 3 Fan Y. Miguez-Macho G. , A simple hydrologic framework for simulating wetlands in climate and earth system models . Clim. Dyn. 37 , 253 ( 2011 ). 10.1007/s00382-010-0829-8 4 Miguez-Macho G. Fan Y. , The role...

Y. Fan; H. Li; G. Miguez-Macho



Process-model simulations of cloud albedo enhancement by aerosols in the Arctic  

Science Journals Connector (OSTI)

...Timmreck. 2013 Sea-salt injections into the low-latitude marine boundary layer: the transient response in three Earth system models. J. Geophys. Res. 118, 12195-12206. ( doi:10.1002/2013JD020432 ) 62 Jenkins, AKL , and PM Forster...



Exhumation of the southern Sierra Nevadaeastern Tehachapi Mountains constrained by low-temperature thermochronology: Implications for the initiation of the Garlock fault  

Science Journals Connector (OSTI)

...E. , Grove, M., Vucic, A., Pedrick, J.N., and Ebert, K.A., 2007, Exhumation of the Orocopia schist and associated...10.1029/94JB02127. McGill, S.F. , Wells, S.G., Fortner, S.K., Kuzma, H.A., and McGill, J.D., 2009...

A.E. Blythe; N. Longinotti


Genetic Bases of Estrogen-Induced Tumorigenesis in the Rat: Mapping of Loci Controlling Susceptibility to Mammary Cancer in a Brown Norway ACI Intercross  

Science Journals Connector (OSTI)

...E2-induced pyometritis in the Brown Norway rat, to RNO5. Mamm Genome...McComb RD, Shull JD. Dietary energy restriction inhibits estrogen-induced...to mammary cancer in a Brown Norway x ACI intercross. | Exposure...strain and the unrelated Brown Norway (BN) rat strain. Whereas...

Beverly S. Schaffer; Cynthia M. Lachel; Karen L. Pennington; Clare R. Murrin; Tracy E. Strecker; Martin Tochacek; Karen A. Gould; Jane L. Meza; Rodney D. McComb; and James D. Shull



Geologic and physiographic controls on bed-material yield, transport, and channel morphology for alluvial and bedrock rivers, western Oregon  

Science Journals Connector (OSTI)

...2. Howard, A.D. , 1980, Thresholds in river regimes, in Coates D.R., Vitek J.D., eds., Thresholds...1982, The Composition of Recent Alluvial Gravels in Alberta River Beds: Alberta Research Council Bulletin 41, 151 p. Sklar, L...

Jim E. OConnor; Joseph F. Mangano; Scott W. Anderson; J. Rose Wallick; Krista L. Jones; Mackenzie K. Keith



E-Print Network (OSTI)

Fee Hall harding3@msu.edu jonesd72@msu.edu Pediatrics* Joel Greenberg, DO, Chairperson Nancy Marsh 353@msu.edu grover@msu.edu Radiology Thomas G. Cooper, JD, MBA, Acting Chairperson Carol Yatchak 355-0120 432-2849 184 Radiology Building jim.potchen@rad.msu.edu carol.yatchak@radiology.msu.edu ext 234 Sports Medicine


Can desert dust explain the outgoing longwave radiation anomaly over the Sahara during July 2003?  

E-Print Network (OSTI)

of the Met Office Unified Model. A significant difference is found over desert regions of northern Africa:10.1029/2004JD005232. 1. Introduction [2] The top of the atmosphere radiative energy balance between net incoming solar radiation and outgoing long- wave radiation (OLR) is crucial in determining

Allan, Richard P.


Accumulation mode aerosol, pockets of open cells, and particle nucleation in the remote subtropical Pacific marine boundary layer  

E-Print Network (OSTI)

Accumulation mode aerosol, pockets of open cells, and particle nucleation in the remote subtropical in the remote subtropical Pacific marine boundary layer, J. Geophys. Res., 111, D02206, doi:10.1029/2004JD005694 the boundary layer via its action on the budgets of heat and water substance. A plausible consequence may

Russell, Lynn


Thirty-year history of glacier melting in the Nepal Himalayas Koji Fujita,1  

E-Print Network (OSTI)

Thirty-year history of glacier melting in the Nepal Himalayas Koji Fujita,1 Lonnie G. Thompson,2 of glacier melting in the Nepal Himalayas, J. Geophys. Res., 111, D03109, doi:10.1029/2005JD005894. 1. Introduction [2] Rapid shrinkage of glaciers in the Nepal Himalayas has been observed during recent decades [e

Howat, Ian M.


SDSU General Catalog 2014-2015 515 ARTS AND LETTERS  

E-Print Network (OSTI)

and Comparative Literature Brown, Christopher, Dean's Office Carr, David, Ph.D., Geography Catanzarite, Lisa, Ph and Asian/Middle Eastern Languages Chu, Crystal, M.A., Dean's Office Clarke, Keith, Ph.D., Geography Colston Wang, Yandong, Ph.D., Geography White, Christopher, M.A., Anthropology Xie, Tianchang, J.D., Sociology

Gallo, Linda C.


Molecular Pathways: Interleukin-15 Signaling in Health and in Cancer  

Science Journals Connector (OSTI)

...Blood 1996;87:2632-40. 4. Kennedy MK , Glaccum M, Brown SN, Butz EA, Viney...84. Wolchok JD , Kluger H, Callahan MK, Postow MA, Rizvi NA, Lesokhin AM, et...Bernstein ZP, et alA phase I study of ultra low dose interleukin-2 and stem cell factor...

Anjali Mishra; Laura Sullivan; and Michael A. Caligiuri



Tumor-Reactive CD8+ T Cells in Metastatic Gastrointestinal Cancer Refractory to Chemotherapy  

Science Journals Connector (OSTI)

...cells were plated in multiple 25-cm2 ultra-low attachment and standard treated canted...culturing of tumor cell suspensions in ultra-low attachment flasks in addition to...18. Wolchok JD , Kluger H, Callahan MK, Postow MA, Rizvi NA, Lesokhin AM...

Simon Turcotte; Alena Gros; Eric Tran; Chyi-Chia R. Lee; John R. Wunderlich; Paul F. Robbins; and Steven A. Rosenberg


Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Journal of Atmospheric and Solar-Terrestrial Physics 70 (2008) 10461055 The response in the Pacific to the sun's decadal peaks and  

E-Print Network (OSTI)

. Coupled air­sea response to solar forcing in the Pacific region during northern winter. Journal of Geophysical Research 112, D02108, doi:10.1029/2006JD007378] showed that the Pacific Ocean in northern winter thus appears as a strengthening of the climatological mean regional precipitation maxima

Meehl, Gerald A.


The Cochliobolus carbonum SNF1 Gene Is Required for Cell Wall??Degrading Enzyme Expression and Virulence on Maize  

Science Journals Connector (OSTI)

...Cotty P.J. Cleveland T.E. Dean R.A. Molecular genetic evidence for the involvement of a specific polygalacturonase, P2c, in the invasion and spread of Aspergillus flavus in cotton bolls Sposato J.P. Ahn J.-H. Walton J.D. Characterization...

Nyerhovwo J. Tonukari; John S. Scott-Craig; Jonathan D. Waltonb


Polygamous particles  

Science Journals Connector (OSTI)

...New York ), pp 1 23 . 36 Watson JD Crick FHC ( 1953 ) Molecular...useEq. S4 of our model for the Watson ZZQQhyCrick system to...triangle effect as fABC 1 3 fAB fBC fAC ; [S10] where fAB, fBC, and fAC are determined from...

Kun-Ta Wu; Lang Feng; Ruojie Sha; Rmi Dreyfus; Alexander Y. Grosberg; Nadrian C. Seeman; Paul M. Chaikin



DEBRA ANNE ROACH, M.S. Assistant Dean  

E-Print Network (OSTI)

#12;DEBRA ANNE ROACH, M.S. Assistant Dean Director Graduate Enrollment SEAN-MICHAEL GREEN, J.D., LL effective communication plans Planning and hosting well-attended events #12;GRADUATE STUDENTS' INTERESTS with Decision Makers #12;INQUIRY APPS ACCEPTS ENROLLED RETAIN MARKET COMMUNICATION PLAN #12;WORD OF MOUTH

Navara, Kristen


Automatic calibration of an ensemble for uncertainty estimation and probabilistic forecast: Application to air quality  

E-Print Network (OSTI)

: Application to air quality D. Garaud1 and V. Mallet2 Received 8 February 2011; revised 25 May 2011; accepted: Application to air quality, J. Geophys. Res., 116, D19304, doi:10.1029/2011JD015780. 1. Introduction [2] Air concentrations measures the simulations uncertainties. This approach has been applied for air quality simulations

Paris-Sud XI, Université de


University of Virginia School of Medicine PO Box 800761  

E-Print Network (OSTI)

for Health Care Reform (Now that the Supreme Court and the Voters Have Weighed In)? Timothy S. Jost JD-presented with the Generalist Scholars Program in observance at UVA of Primary Care Week 26 September 2012 History of the Health Issues and Center for Biomedical Ethics and Humanities, UVA Co-presented with the History of the Health

Acton, Scott


Robust increases in severe thunderstorm environments in response to greenhouse forcing  

Science Journals Connector (OSTI)

...688 . 12 Mahoney K Alexander MA Thompson G Barsugli JJ Scott JD ( 2012 ) Changes in hail and flood risk in high-resolution simulations over Colorado's mountains . Nature Climate Change 2 ( 2 ): 125 131 . 13 Gao Y Fu JS Drake JB Liu Y Lamarque...

Noah S. Diffenbaugh; Martin Scherer; Robert J. Trapp



Regional transport and dilution during high-pollution episodes in southern France: Summary of findings from the Field  

E-Print Network (OSTI)

of findings from the Field Experiment to Constraint Models of Atmospheric Pollution and Emissions Transport transport and dilution of pollutants within the Field Experiment to Constraint Models of Atmospheric of Atmospheric Pollution and Emissions Transport (ESCOMPTE), J. Geophys. Res., 112, D13105, doi:10.1029/2006JD

Ribes, Aurélien


Correction to Hyperspectral Aerosol Optical Depths from TCAP Flights  

SciTech Connect

In the paper Hyperspectral aerosol optical depths from TCAP flights by Y. Shinozuka et al. (Journal of Geophysical Research: Atmospheres, 118, doi:10.1002/2013JD020596, 2013), Tables 1 and 2 were published with the column heads out of order. Tables 1 and 2 are published correctly here. The publisher regrets the error.

Shinozuka, Yohei; Johnson, Roy R.; Flynn, Connor J.; Russell, P. B.; Schmid, Beat; Redemann, Jens; Dunagan, Stephen; Kluzek, Celine D.; Hubbe, John M.; Segal-Rosenheimer, Michal; Livingston, J. M.; Eck, T.; Wagener, Richard; Gregory, L.; Chand, Duli; Berg, Larry K.; Rogers, Ray; Ferrare, R. A.; Hair, John; Hostetler, Chris A.; Burton, S. P.



Jocelyn L. Sy Education & Training  

E-Print Network (OSTI)

. Pratte, M., Sy, J.L., Swisher, J.D., & Tong, F. (in prep). Orientation decoding in V1. Published Articles-perceptual selection during the attentional blink. Journal of Cognitive Neuroscience, 19(12), 2005-2018. Giesbrecht, B applied to EEG and fMRI data. Journal of the Optical Society of America A: Optics, image science

Tong, Frank


A missense mutation in the 3-ketodihydrosphingosine reductase FVT1 as candidate causal mutation for bovine spinal muscular atrophy  

Science Journals Connector (OSTI)

...with our available computing power. Instead, we used an alternative...enzymatic assay or by partial restoration of enzymatic function in vivo...development of the nervous system, and several neurodegenerative diseases are described...Terwilliger JD Ott J ( 1994 ) Handbook of Human Genetic Linkage...

Stefan Krebs; Ivica Medugorac; Susanne Rther; Katja Strsser; Martin Frster



World Wide Wood Network, Ltd. 2001-2002 Forest Products e-Commerce  

E-Print Network (OSTI)

World Wide Wood Network, Ltd. © 2001-2002 Forest Products e-Commerce An Oxymoron or Wave of the Future Presented by: Thomas J. Westbrook, JD President & CEO World Wide Wood Network, Ltd. http Collapsing time and space Communication World Wide Wood Network, Ltd. © 2001-2002 The Promise of the Internet


On-Road Measurement of Gas and Particle Phase Pollutant Emission Factors  

NLE Websites -- All DOE Office Websites (Extended Search)

On-Road Measurement of Gas and Particle Phase Pollutant Emission Factors On-Road Measurement of Gas and Particle Phase Pollutant Emission Factors for Individual Heavy-Duty Diesel Trucks Title On-Road Measurement of Gas and Particle Phase Pollutant Emission Factors for Individual Heavy-Duty Diesel Trucks Publication Type Journal Article Year of Publication 2012 Authors Dallmann, Timothy R., Steven J. DeMartini, Thomas W. Kirchstetter, Scott C. Herndon, Timothy B. Onasch, Ezra C. Wood, and Robert A. Harley Journal Environmental Science and Technology Volume 46 Issue 15 Pagination 8511-8518 Abstract Pollutant concentrations in the exhaust plumes of individual diesel trucks were measured at high time resolution in a highway tunnel in Oakland, CA, during July 2010. Emission factors for individual trucks were calculated using a carbon balance method, in which pollutants measured in each exhaust plume were normalized to measured concentrations of carbon dioxide. Pollutants considered here include nitric oxide, nitrogen dioxide (NO2), carbon monoxide, formaldehyde, ethene, and black carbon (BC), as well as optical properties of emitted particles. Fleet-average emission factors for oxides of nitrogen (NOx) and BC respectively decreased 30 ± 6 and 37 ± 10% relative to levels measured at the same location in 2006, whereas a 34 ± 18% increase in the average NO2 emission factor was observed. Emissions distributions for all species were skewed with a small fraction of trucks contributing disproportionately to total emissions. For example, the dirtiest 10% of trucks emitted half of total NO2 and BC emissions. Emission rates for NO2 were found to be anticorrelated with all other species considered here, likely due to the use of catalyzed diesel particle filters to help control exhaust emissions. Absorption and scattering cross-section emission factors were used to calculate the aerosol single scattering albedo (SSA, at 532 nm) for individual truck exhaust plumes, which averaged 0.14 ± 0.03.


Little Ocmulgee El Member Corp | Open Energy Information  

Open Energy Info (EERE)

Ocmulgee El Member Corp Ocmulgee El Member Corp Jump to: navigation, search Name Little Ocmulgee El Member Corp Place Georgia Utility Id 26218 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes ISO Other Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 100 watt HPS - open bottom, Metered Lighting 100 watt HPS - open bottom, Non-Metered Lighting 1000 watt HPS, MV, MH - Directional, Metered Lighting 1000 watt HPS, MV, MH - Directional, Non-Metered Lighting 1000 watt MH - Shoebox, Metered Lighting 1000 watt MH - Shoebox, Non-Metered Lighting


Colquitt Electric Membership Corp | Open Energy Information  

Open Energy Info (EERE)

Electric Membership Corp Electric Membership Corp Jump to: navigation, search Name Colquitt Electric Membership Corp Place Georgia Utility Id 40212 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 1000W Existing MH-Flood, OVERHEAD WIRING, Metal or Fiberglass Pole Lighting 1000W Existing MH-Flood, OVERHEAD WIRING, Wood Pole Lighting 1000W Existing MH-Flood, UNDERGROUND WIRING, Metal or Fiberglass Pole Lighting 1000W Existing MH-Flood, UNDERGROUND WIRING, Wood Pole Lighting 100W Existing HPS-Open, OVERHEAD WIRING, Metal or Fiberglass Pole Lighting


Monitoring the excavation damaged zone by three-dimensional reconstruction of electrical resistivity  

Science Journals Connector (OSTI)

......R.E., Worthington M.H. Anisotropic resistivity tomography. Geophys...acoustic investigation of a damaged anisotropic shale at the Mont Terri Underground...M.H., de Oliveira C.R. Anisotropic resistivity inversion. Inverse......

Nolwenn Lesparre; Dominique Gibert; Florence Nicollin; Christophe Nussbaum; Andy Adler



Magmatic subsidence of the East Pacific Rise (EPR) at S revealed through fault restoration of ridge crest  

E-Print Network (OSTI)

and John Sinton Department of Geology and Geophysics, University of Hawaii, 2525 Correa Road Honolulu. Ryan, W. Jin, M.-H. Cormier, E. Bergmanis, J. Sinton, and S. White, Magmatic subsidence of the East

Carbotte, Suzanne


Design and control of a passively stabilized multimodal hopping robot  

E-Print Network (OSTI)

the spin rotor assembly, the batteries selected changed fromfactor 9 volt Lithium Polymer batteries to a matched pair ofof six 1.2 V subC NiMH batteries. These were placed along

Pantel, Erica



Shida Battery Technology Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Co, Ltd Place: China Product: Shida is a China-based maker of NiMH and Li-Poly batteries with applications that include e-bikes. References: Shida Battery Technology Co,...


Acceptance of repeat population-based voluntary counseling and testing for HIV in rural Malawi  

E-Print Network (OSTI)

Calverton, Maryland, USA: ORC Macro, 2006. 5. Bateganya MH,Office (NSO) [Malawi] and ORC Macro. Malawi Demographic andCalverton, Maryland: NSO and ORC Macro, 2005. 17. Boerma JT,


Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


E-Print Network 3.0 - actinoid metal-transition metal-boron Sample...  

NLE Websites -- All DOE Office Websites (Extended Search)

3 , T.V.Shymchuk , I.V.Stasyuk, T.S.Mysakovych Summary: is absent actinoide ions in water solu- tions are present as complexes (M(H2O)n)z+ where z is a cation......


E-Print Network 3.0 - academy sailing squadron Sample Search...  

NLE Websites -- All DOE Office Websites (Extended Search)

SCHOOL Monterey, California Summary: ) SQUADRONS by Cory L. Culver March 2002 Thesis Advisor: Gerald Brown Second Reader: Kevin Wood 12;THIS PAGE... of the MH-60S Helicopter and...


Hemoglobin-derived porphyrins preserved in a Middle Eocene blood-engorged mosquito  

Science Journals Connector (OSTI)

...5519 5521 . 28 Bauder C Ocampo R Callot HJ Albrecht P ( 1990 ) Structural evidence for heme fossils in Messel oil shale (FRG) Naturwissenschaften 77 ( 8 ): 378 379 . 29 Suo Z Avci R Schweitzer MH Deliorman M ( 2007 ) Porphyrin as an...

Dale E. Greenwalt; Yulia S. Goreva; Sandra M. Siljestrm; Tim Rose; Ralph E. Harbach




NLE Websites -- All DOE Office Websites (Extended Search)

Zhang, MH, WY Lin,SA Klein, JT Bacmeister, S Bony, RT Cederwall, AD Del Genio, JJ Hack, NG Loeb, U Lohmann, P Minnis, I Musat, R Pincus, P Stier, MJ Suarez, MJ Webb, JB Wu,...


Evolutionary relationships of ATP-Binding Cassette (ABC) uptake porters  

E-Print Network (OSTI)

Evolutionary relationships of ATP-Binding Cassette (ABC)MH Jr: Membrane porters of ATP-binding cassette transportand exporters in the evolution of ATP-binding cassette (ABC)

Zheng, Wei Hao; Vstermark, ke; Shlykov, Maksim A; Reddy, Vamsee; Sun, Eric I; Saier, Milton H



Miltefosine Increases Lipid and Protein Dynamics in Leishmania amazonensis Membranes at Concentrations Similar to Those Needed for Cytotoxicity Activity  

Science Journals Connector (OSTI)

...CAPES, FUNAPE, and FAPEG. Rodrigo Alves Moreira, Sebastiao Antonio...0113 . 14. Alonso, A , WP dos Santos, SJ Leonor, JG dos Santos, and M Tabak. 2001. Stratum...CM d'Avila-Levy, ALS dos Santos, and MH Branquinha. 2011...

Rodrigo Alves Moreira; Sebastio Antonio Mendanha; Kelly Souza Fernandes; Grazzielle Guimaraes Matos; Lais Alonso; Miriam Leandro Dorta; Antonio Alonso




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to be in the best interest of the United States and the general public to grant a Class Waiver to certain identified inventions made under the Prime Contract to M&H and a Class...


Integrated, Low Voltage, DynamicallyIntegrated, Low Voltage, Dynamically Adaptive BuckAdaptive Buck--Boost ConverterBoost Converter  

E-Print Network (OSTI)

Improvement in battery life Low voltage Single cell operation (Li-ion/NiCd/NiMH/Fuel Cell) Integrated Linearity degradation #12;55Georgia Tech Analog Consortium Biranchinath Sahu School of Electrical

Rincon-Mora, Gabriel A.


The search for the Higgs boson in tauon pairs at the ATLAS experiment.  

E-Print Network (OSTI)

??The combined results have excluded most Higgs masses between 110 and 500 GeV. The only region that is not excluded is at mH = 126 (more)

Shao, Qi Tao



HEV Fleet Testing - Summary Fact Sheet for 2010 Ford Fusion  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ford Fusion VIN 3FADP0L32AR194699 Vehicle Specifications Engine: 2.5 L 4-cylinder Electric Motor: 60 kW Battery: NiMH Seatbelt Positions: Five Payload: 850 lbs Features:...


HEV Fleet Testing - Summary Fact Sheet for 2010 Honda Insight  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

courts, law offices, and medical facilities on city streets and urban freeways. Vehicle Specifications Engine: 1.3 L 4-cylinder Electric Motor: 10 kW Battery: NiMH Seatbelt...


HEV Fleet Testing - Summary Fact Sheet for 2010 Toyota Prius  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

courts, law offices, and medical facilities on city streets and urban freeways. Vehicle Specifications Engine: 1.8 L 4-cylinder Electric Motor: 60 kW Battery: NiMH Seatbelt...


HEV Fleet Testing - Summary Fact Sheet 2010 Toyota Prius  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Toyota Prius VIN JTDKN3DU2A5010462 Vehicle Specifications Engine: 1.8 L 4-cylinder Electric Motor: 60 kW Battery: NiMH Seatbelt Positions: Five Payload: 885 lbs Features:...


Zasidranost pregovorov v besedis?c?u govorcev slovenskega jezika  

E-Print Network (OSTI)

#17; 6PHK#3;MH#3;SRO#3;]GUDYMD#17; 5DQD#3;XUD#15;#3;]ODWD#3;XUD#17; =LKHU#3;MH#3;]LKHU#17; 2EOMXED#3;GHOD#3;GROJ#17; .DNUHQ#3;RH#15;#3;WDNHQ#3;VLQ#17; 9LGH]#3;YDUD#17; 8SDQMH#3;XPUH#3;]DGQMH#17; 2EOHND#3;QDUHGL#3;ORYHND#17; 1LNROL#3;QH#3;UHFL#3... SUDJRP#17; 6PHK#3;MH#3;SRO#3;]GUDYMD#17; 5DQD#3;XUD#15;#3;]ODWD#3;XUD#17; =LKHU#3;MH#3;]LKHU#17; -DERONR#3;QH#3;SDGH#3;GDOH#3;RG#3; GUHYHVD#17; 9LGH]#3;YDUD#17; 1LNROL#3;QH#3;UHFL#3;QLNROL#17; 9DMD#3;GHOD#3;PRMVWUD#17; .GRU#3;DND#15;#3;GRDND#17; Vsak...

Lipavic Otir, Alja; Vasiljevi?, Anja; Koletnik, Mihaela



VBA-0060- In the Matter of Robert Burd  

Energy.gov (U.S. Department of Energy (DOE))

On November 16, 2001, BWXT Pantex, as successor to Mason & Hanger Corporation (M&H) (collectively referred to as the contractor), filed an appeal of an Initial Agency Decision (IAD)...


E-Print Network 3.0 - anne kuusksalu merike Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

: To 1992 o Borcherds eis gage mia na kathgora algbrwn Lie mh peperasmnhc distashc, tic genikeumnec lgebrec Kac-Moody. Autc oi lgebrec qoun pollc omoithtec Summary: merik c...


E-Print Network 3.0 - arvo leola merike Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

: To 1992 o Borcherds eis gage mia na kathgora algbrwn Lie mh peperasmnhc distashc, tic genikeumnec lgebrec Kac-Moody. Autc oi lgebrec qoun pollc omoithtec Summary: merik c...


Abstract--This paper outlines the design of an autonomous flying vehicle (AFV) for use in researching formation  

E-Print Network (OSTI)

with a full suite of integrated peripherals. Today, Nickel- Metal Hydride (NiMH) batteries can source more predators and efficiently forage for food [6]. Both the Air Force and NASA have identified autonomous

Sukhatme, Gaurav S.


E-Print Network 3.0 - aids entre homens Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

entre sexos (M-H) (p.p.) populao desempregada - nvel... com emprego por sexo variao (%) -0,6 -0,2 0,2 0,6 1,0 total homens mulheres fonte: INE, Inqurito ao......


A double-blind, randomized, multicenter phase 2 study of prasugrel versus placebo in adult patients with sickle cell disease  

E-Print Network (OSTI)

in adult patients with sickle cell disease. Journal of1. Steinberg MH: Management of sickle cell disease. N Engl Jadherence to endothelium in sickle-cell anemia. A possible


Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


NOAAlNMFS Developments U.S. and South Pacific Island  

E-Print Network (OSTI)

Islands, Nauru, New Zealand, Niue, Palau, Papua New Guinea, the Solomon Is lands, Tuvalu, Vanuatu Marianas .. Philippines G\\ '; . uam . ~.~ ..·F·il·~;~~~';;::;:;' ....c;:. ;M'''h'''','''''' . : . Palau


Thermal behavior of nickel/metal hydride battery during charging and discharging  

Science Journals Connector (OSTI)

This work discusses thermal behavior of Ni/MH battery with experimental methods. The present work not ... new way to get more exactly parameters and thermal model, but also concentrates on thermal behavior in dis...

K. Yang; D. H. Li; S. Chen; F. Wu



Thermal behavior analysis of nickel/metal hydride battery during overcharging  

Science Journals Connector (OSTI)

To analyze the thermal behavior of the cylinder Ni/MH battery during overcharging, a two-dimensional thermal model is provided in this work. More ... reliable data is provided to create the precise thermal model....

Kai Yang; JinJing An; Shi Chen



Thermal behavior of nickelmetal hydride battery during charging at a wide range of ambient temperatures  

Science Journals Connector (OSTI)

The thermal behavior of D-type NiMH battery during charging was investigated at a wide ... this work. The temperature measurement of the battery was conducted by using a thermal infrared imager put in a highlow...

Kai Zheng Fang; Dao Bin Mu; Shi Chen



VBX-0060- In the Matter of Robert Burd  

Energy.gov (U.S. Department of Energy (DOE))

On November 16, 2001, BWXT Pantex, as successor to Mason & Hanger Corporation (M&H) (collectively referred to as the contractor), filed an appeal of an Initial Agency Decision (IAD)...



E-Print Network (OSTI)

diffraction des rayons X, - Du côté du DMSC : M-H. Ritti, pour la dilatométrie et l'AFM, merci pour tout ce

Paris-Sud XI, Université de


Feasibility of Wholesale Electricity Competition in a Developing Country: Insights from Simulating a Market in Maharashtra State, India  

E-Print Network (OSTI)

I assume that private firms in the MH electricity market actand private firms will play important roles in the electricityand private firms operate in the sector at the same time) on wholesale electricity

Phadke, Amol



Electronic structure of alkaline metal hydrides according to MO LCAO-SCF-CNDO cluster calculations  

Science Journals Connector (OSTI)

This paper presents the results of a quantum chemical study of compounds MH (M = Li, Na, K, Rb, and Cs) in a cluster approximation. The calculations were performed by the MO LCAO-SCF- ... model systems of high-te...

E. A. Zharikova; A. I. Ermakov; R. P. Ozerov


Temperature, thermal-conductivity, and heat-flux data,Raft River...  

Open Energy Info (EERE)

conductivity; United States; USGS Authors Urban, T.C.; Diment, W.H.; Nathenson, M.; Smith, E.P.; Ziagos, J.P.; Shaeffer and M.H. Published Open-File Report - U. S. Geological...


Microsoft Word - REPRINTS.DOC  

NLE Websites -- All DOE Office Websites (Extended Search)

and a twelve-year abandoned field. Oikos 15:185-199. 0114 Bunnell, B.N. and M.H. Smith. 1966. Septal lesions and aggressiveness in the cotton rat, Sigmodon hispidus....


E-Print Network 3.0 - advanced home care Sample Search Results  

NLE Websites -- All DOE Office Websites (Extended Search)

4 Scope, objective and setting 1.1 Scope and objective Summary: home in the Dutch health care system. Int Psychogeriatr 1993; 5: 213-22. 28 Beers MH, Ouslander JG... for...


Are batteries ready for plug-in hybrid buyers?  

E-Print Network (OSTI)

Of the battery chemistries discussed, only Li-ion shows the2008) battery researchers continue to develop Li-ionbattery chemistries: nickel-metal hydride (NiMH) and lithium-ion (Li-

Axsen, Jonn; Kurani, Kenneth S.; Burke, Andrew



Are Batteries Ready for Plug-in Hybrid Buyers?  

E-Print Network (OSTI)

Of the battery chemistries discussed, only Li-ion shows the2008) battery researchers continue to develop Li-ionbattery chemistries: nickel- metal hydride (NiMH) and lithium-ion (Li-

Axsen, Jonn; Burke, Andy; Kurani, Kenneth S



Are Batteries Ready for Plug-in Hybrid Buyers?  

E-Print Network (OSTI)

Of the battery chemistries discussed, only Li-ion shows the2008) battery researchers continue to develop Li-ionbattery chemistries: nickel-metal hydride (NiMH) and lithium-ion (Li-

Axsen, Jonn; Kurani, Kenneth S; Burke, Andy



Pontotoc Electric Power Assn | Open Energy Information  

Open Energy Info (EERE)

Pontotoc Electric Power Assn Pontotoc Electric Power Assn Jump to: navigation, search Name Pontotoc Electric Power Assn Place Mississippi Utility Id 15211 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Flood Light MH 400 W Lighting Flood Light MH 400 W 30' pole Lighting Flood Light MH 400 W 35' pole Lighting Flood Light MH 400 W 40' pole Lighting General Power Service GSA (1001 kW - 5000 kW) Industrial General Power Service GSA (51 kW -1000 kW) Multi-Phase Commercial General Power Service GSA (51 kW -1000 kW) Single-Phase Commercial


Commercializing Light-Duty Plug-In/Plug-Out Hydrogen-Fuel-Cell Vehicles:Mobile Electricity Technologies, Early California Household Markets, and Innovation Management  

E-Print Network (OSTI)

battery Type Capacity (kWh) Saft Li- Ion Valence LiIon LiIonOvonic NiMH A-hr, 336V) Saft Li-Ion Valence LiIon EEEI

Williams, Brett D



Commercializing light-duty plug-in/plug-out hydrogen-fuel-cell vehicles: Mobile Electricity technologies and opportunities  

E-Print Network (OSTI)

battery Type Capacity (kWh) Saft Li- Ion Valence LiIon LiIonOvonic NiMH A-hr, 336V) Saft Li-Ion Valence LiIon EEEI

Williams, Brett D; Kurani, Kenneth S



Technological assessment and evaluation of high power batteries and their commercial values  

E-Print Network (OSTI)

Lithium Ion (Li-ion) battery technology has the potential to compete with the more matured Nickel Metal Hydride (NiMH) battery technology in the Hybrid Electric Vehicle (HEV) energy storage market as it has higher specific ...

Teo, Seh Kiat



Edinburgh Research Explorer Citation for published version  

E-Print Network (OSTI)

, Gohlke, BO, Preissner, SC, Hoffmann, MF, Bauer, JMJ, Armstrong, D, Schaefer, MH, Andrade-Navarro, MA, Le. Andrade-Navarro3 , Nicolas Le Novere4 , Michael D. R. Croning5 , Seth G. N. Grant5 , Pim van Nierop6

Millar, Andrew J.


Chromatin stretch enhancer states drive cell-specific gene regulation and harbor human disease risk variants  

Science Journals Connector (OSTI)

...2004) GO::TermFinder--open source software for accessing Gene...5.0 7.5 10.0 Islets G M 12878 H 1 ESH epG 2H M ECH SM MH U VECK562 N H EKN H...2.66 4 5 6 7 8 9 Islets G M 12878 H 1 ESH epG 2H M ECH SM MH U VECK562 N H EK N H...

Stephen C. J. Parker; Michael L. Stitzel; D. Leland Taylor; Jose Miguel Orozco; Michael R. Erdos; Jennifer A. Akiyama; Kelly Lammerts van Bueren; Peter S. Chines; Narisu Narisu; NISC Comparative Sequencing Program; Brian L. Black; Axel Visel; Len A. Pennacchio; Francis S. Collins


Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DNA fingerprinting in anthropological genetics: past, present, future  

E-Print Network (OSTI)

polymorphisms, and direct sequencing not only to identi of markers (or prints) of entire populations. In the field o to reconstruct evolutionary history and answer questions the effects of admixture and adaptation to different envir 2013 Crawford and Beaty..., Deka R, Young K, Crawford MH: Genetic architecture of a small, recently aggregated Aleut population: Bering Island. Hum Biol 2010, 82(506):719736. 30. Crawford MH, Rubicz RC, Zlojutro M: Origins of Aleuts and the genetic structure of populations...

Crawford, Michael H.; Beaty, Kristine Gatchalian



Model Year 2006: Alternative Fuel and Advanced Technology Vehicles  

Alternative Fuels and Advanced Vehicles Data Center (EERE)

06: Alternative Fuel and Advanced Technology Vehicles 06: Alternative Fuel and Advanced Technology Vehicles Fuel Type EPAct Compliant? Model Vehicle Type Emission Class Powertrain Fuel Capacity Range American Honda Motor Corporation 888-CCHONDA www.honda.com CNG Dedicated EPAct Yes Civic GX Compact Sedan SULEV Tier 2 Bin II 1.7L, 4-cylinder 8 GGE 200 mi HEV (NiMH) EPAct No Accord Hybrid Sedan ULEV 3.0L V6 144 volt NiMH + 17.1 Gal Gasoline TBD HEV (NiMH) EPAct No Civic Hybrid Sedan CA ULEV 1.3L, 4-cylinder 144 volt NiMH + 13.2 Gal Gasoline TBD HEV (NiMH) EPAct No Insight Two-seater SULEV (CVT model) ULEV (MT model) 1.0L, 3-cylinder 144 volt NiMH + 10.6 Gal Gasoline 636 mi DaimlerChrysler 800-999-FLEET www.fleet.chrysler.com E85 FFV EPAct Yes Dodge Ram Pickup 1500 Series 1 Pickup Tier 2 Bin 10A 4.7L V8 26 Gal 416 mi E85 FFV


Encouraging and sustaining integration of child mental health into primary care: interviews with primary care providers participating in Project TEACH (CAPES and CAP PC) in NY  

Science Journals Connector (OSTI)

AbstractObjective Project Training and Education for the Advancement of Children's Health (TEACH) provides training, consultation and referral support to build child and adolescent mental health (MH) expertise among primary care providers (PCPs). This study describes how TEACH engages PCP, how program components lead to changes in practice and how contextual factors influence sustainability. Method Thirty \\{PCPs\\} randomly selected from 139 trained \\{PCPs\\} and 10 \\{PCPs\\} from 143 registered with TEACH but not yet trained completed semistructured interviews. PCP selection utilized purposeful sampling for region, rurality and specialty. Interviews were recorded, transcribed and analyzed using grounded theory. Results PCP participation was facilitated by perceived patient needs, lack of financial and logistic barriers and continuity of PCPprogram relationships from training to ongoing consultation. Trained \\{PCPs\\} reported more confidence interacting with families about MH, assessing severity, prescribing medication and developing treatment plans. They were encouraged by satisfying interactions with MH specialists and positive feedback from families. Barriers included difficulties implementing screening, time constraints, competing demands, guarded expectations for patient outcomes and negative impressions of the MH system overall. Conclusions Programs like TEACH can increase PCP confidence in MH care and promote increased MH treatment in primary care and through collaboration with specialists. Sustainability may depend on the PCP practice context and implementation support.

Anne M. Gadomski; Lawrence S. Wissow; Lawrence Palinkas; Kimberly E. Hoagwood; Jeffrey M. Daly; David L. Kaye



CX-002920: Categorical Exclusion Determination | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

20: Categorical Exclusion Determination 20: Categorical Exclusion Determination CX-002920: Categorical Exclusion Determination Reclamation Projects in Jo Dandy Lease Tract C-JD-7, Uranium Leasing Program CX(s) Applied: B1.28, B1.3 Date: 06/25/2010 Location(s): Naturita, Colorado Office(s): Legacy Management The United States Department of Energy (DOE) Office of Legacy Management (LM) proposes to close a mine portal and the related vent located on the Aztec Claim on Lease Tract C-JD-7. Independent contractors associated with Cotter Corporation, the leaseholder, would complete all work within an expected 2 days. The abandoned mine features, which DOE inherited when lease tract boundaries were reconfigured in 2007, are a public safety concern. The lease tract is in the Paradox Valley in western Montrose


Ventilation Systems for Cooling | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ventilation Systems for Cooling Ventilation Systems for Cooling Ventilation Systems for Cooling May 30, 2012 - 6:19pm Addthis Proper ventilation helps you save energy and money. | Photo courtesy of JD Hancock. Proper ventilation helps you save energy and money. | Photo courtesy of JD Hancock. Ventilation is the least expensive and most energy-efficient way to cool buildings. Ventilation works best when combined with methods to avoid heat buildup in your home. In some cases, natural ventilation will suffice for cooling, although it usually needs to be supplemented with spot ventilation, ceiling fans, and window fans. For large homes, homeowners might want to investigate whole house fans. Interior ventilation is ineffective in hot, humid climates where


Soluble Substances and Evaporation  

NLE Websites -- All DOE Office Websites (Extended Search)

Soluble Substances and Evaporation Soluble Substances and Evaporation Name: JD Status: student Grade: 9-12 Location: FL Country: New Zealand Date: Winter 2011-2012 Question: Do soluble substances evaporate with the water? Replies: JD, As a general rule, no. If the soluble substance is a solid, then its boiling point is well above that of water, so it cannot possibly boil off. If the substance is a liquid, it may have a boiling point that is below that of water and will boil off at a lower temperature than water. If the boiling point is higher than that of water, than it will boil off after the water has evaporated. Some substances, like ethanol for example, form an "azeotrope" with water. The combination of ethanol and water form a tight intermolecular connection that makes the two substances boil off at the same time.


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

RE Mahan & JD Fluckiger RE Mahan & JD Fluckiger Pacific Northwest National Laboratory Secure Data Transfer Summary Slide: Secure Data Transfer  Outcomes: Best practices guidance for technical staff on the implementation of secure data transmission technology in the SCADA environment.  Roadmap Challenge: Primary focus is on development and integration of protective measures.  Major Successes: Produced a unified view of significant security issues and developed in-depth guideline for addressing security issues in client/server applications.  Schedule: Guidance for developers by 9/30/2010  Level of Effort: 1.25 fte  Funds Remaining: $174K  Performers: PNNL  Partners: N/A Technical Approach and Feasibility * Approach - Identify & document deficiencies/issues


Research Highlight  

NLE Websites -- All DOE Office Websites (Extended Search)

Cloud Susceptibility Measures Potential Cloud Sensitivity to First Aerosol Cloud Susceptibility Measures Potential Cloud Sensitivity to First Aerosol Indirect Effect Download a printable PDF Submitter: Oreopoulos, L., NASA Platnick, S., NASA - Goddard Space Flight Center Area of Research: Cloud Distributions/Characterizations Working Group(s): Radiative Processes Journal Reference: Platnick, S, and L Oreopoulos. 2008. "Radiative susceptibility of cloudy atmospheres to droplet number perturbations: 1. Theoretical analysis and examples from MODIS." Journal of Geophysical Research doi:10.1029/2007JD009654, in press. Oreopoulos, L., and S. Platnick. 2008. Radiative susceptibility of cloudy atmospheres to droplet number perturbations: 2. Global analysis from MODIS, J. Geophys. Res., doi:10.1029/2007JD009655, in press. Theoretical calculations with a shortwave broadband radiative transfer


Ventilation Systems for Cooling | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ventilation Systems for Cooling Ventilation Systems for Cooling Ventilation Systems for Cooling May 30, 2012 - 6:19pm Addthis Proper ventilation helps you save energy and money. | Photo courtesy of JD Hancock. Proper ventilation helps you save energy and money. | Photo courtesy of JD Hancock. Ventilation is the least expensive and most energy-efficient way to cool buildings. Ventilation works best when combined with methods to avoid heat buildup in your home. In some cases, natural ventilation will suffice for cooling, although it usually needs to be supplemented with spot ventilation, ceiling fans, and window fans. For large homes, homeowners might want to investigate whole house fans. Interior ventilation is ineffective in hot, humid climates where


Ancient Lava Flows Trap CO2 for Long-Term Storage in Big Sky Injection |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ancient Lava Flows Trap CO2 for Long-Term Storage in Big Sky Ancient Lava Flows Trap CO2 for Long-Term Storage in Big Sky Injection Ancient Lava Flows Trap CO2 for Long-Term Storage in Big Sky Injection August 13, 2013 - 1:59pm Addthis Photo by J.D. Griggs, courtesy of U.S.Geological Survey Photo by J.D. Griggs, courtesy of U.S.Geological Survey For Additional Information To learn more about the carbon storage projects in which NETL is involved, please visit the NETL Carbon Storage website How can a prehistoric volcanic eruption help us reduce the amount of CO2 released into the atmosphere today? The answer is found in the basalt formations created by the lava - formations that can be used as sites for injecting carbon dioxide (CO2) captured from industrial sources in a process called carbon capture and storage (CCS).


T-537: Oracle Critical Patch Update Advisory - January 2011 | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

7:11am 7:11am Addthis PROBLEM: Oracle Critical Patch Update Advisory - January 2011. PLATFORM: Oracle Database, Oracle Fusion Middleware, Oracle Enterprise Manager Grid Control, Oracle E-Business Suite Applications, JD Edwards EnterpriseOne, JD Edwards OneWorld Tools, PeopleSoft Enterprise Portal Applications, PeopleSoft Enterprise PeopleTools, Siebel Enterprise, Oracle Industry Applications and Oracle VM patches. ABSTRACT: A Critical Patch Update is a collection of patches for multiple security vulnerabilities. It also includes non-security fixes that are required because of interdependencies by those security patches. Critical Patch Updates are cumulative. reference LINKS: Oracle Critical Patch SecurityTracker Alert ID: 1024979 CVE-2010-3594 Oracle Appendix Critical Patch Updates and Security Alerts


T-537: Oracle Critical Patch Update Advisory - January 2011 | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2:30pm 2:30pm Addthis PROBLEM: Oracle Critical Patch Update Advisory - January 2011. PLATFORM: Oracle Database, Oracle Fusion Middleware, Oracle Enterprise Manager Grid Control, Oracle E-Business Suite Applications, JD Edwards EnterpriseOne, JD Edwards OneWorld Tools, PeopleSoft Enterprise Portal Applications, PeopleSoft Enterprise PeopleTools, Siebel Enterprise, Oracle Industry Applications and Oracle VM patches. ABSTRACT: A Critical Patch Update is a collection of patches for multiple security vulnerabilities. It also includes non-security fixes that are required because of interdependencies by those security patches. Critical Patch Updates are cumulative. reference LINKS: Oracle Critical Patch SecurityTracker Alert ID: 1024979 CVE-2010-3594 Oracle Appendix Critical Patch Updates and Security Alerts



NLE Websites -- All DOE Office Websites (Extended Search)

3, 2013 3, 2013 Ancient Lava Flows Trap CO2 for Long-Term Storage in Big Sky Injection Photo by J.D. Griggs, courtesy of U.S.Geological Survey Photo by J.D. Griggs, courtesy of U.S.Geological Survey How can a prehistoric volcanic eruption help us reduce the amount of CO2 released into the atmosphere today? The answer is found in the basalt formations created by the lava - formations that can be used as sites for injecting carbon dioxide (CO2) captured from industrial sources in a process called carbon capture and storage (CCS). The Big Sky Carbon Sequestration Partnership , one of seven Department of Energy (DOE) regional partnerships conducting carbon storage research with funding from the National Energy Technology Laboratory (NETL) and industrial partners, recently injected 1,000 metric tons of CO2 into the


Microsoft Outlook - Memo Style  

Gasoline and Diesel Fuel Update (EIA)

Draves, J.D. Draves, J.D. <Jdraves@HomerElectric.com> Sent: Monday, May 13, 2013 9:01 PM To: ERS2014 Subject: Homer Electric Association, Inc. Comments on Proposed Balancing Authority Operating Statistics Homer Electric Association, Inc., (HEA), a member owned electric cooperative serving the majority of Alaska's Kenai Peninsula, submits the following comments regarding the proposed Form EIA-930. (a) Whether the proposed collection of information is necessary for the proper performance of the functions of the agency, including whether the information shall [sic] have practical utility HEA at the present time is not a Balancing Authority (or control areas as they are referred to in Alaska). It receives its


Electrical Conductivity of Soils and Rocks | Open Energy Information  

Open Energy Info (EERE)

form form View source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon » Electrical Conductivity of Soils and Rocks Jump to: navigation, search OpenEI Reference LibraryAdd to library Report: Electrical Conductivity of Soils and Rocks Author J.D. McNeill Organization Geonics Limited Published Geonics Limited, 1980 Report Number TN-5 DOI Not Provided Check for DOI availability: http://crossref.org Online Internet link for Electrical Conductivity of Soils and Rocks Citation J.D. McNeill (Geonics Limited). 1980. Electrical Conductivity of Soils and Rocks. TN-5 Edition. ?: Geonics Limited. Report No.: TN-5. Retrieved from "http://en.openei.org/w/index.php?title=Electrical_Conductivity_of_Soils_and_Rocks&oldid=695344"


Ancient Lava Flows Trap CO2 for Long-Term Storage in Big Sky Injection |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ancient Lava Flows Trap CO2 for Long-Term Storage in Big Sky Ancient Lava Flows Trap CO2 for Long-Term Storage in Big Sky Injection Ancient Lava Flows Trap CO2 for Long-Term Storage in Big Sky Injection August 13, 2013 - 1:59pm Addthis Photo by J.D. Griggs, courtesy of U.S.Geological Survey Photo by J.D. Griggs, courtesy of U.S.Geological Survey For Additional Information To learn more about the carbon storage projects in which NETL is involved, please visit the NETL Carbon Storage website How can a prehistoric volcanic eruption help us reduce the amount of CO2 released into the atmosphere today? The answer is found in the basalt formations created by the lava - formations that can be used as sites for injecting carbon dioxide (CO2) captured from industrial sources in a process called carbon capture and storage (CCS).


U-150: Oracle Critical Patch Update Advisory - April 2012 | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U-150: Oracle Critical Patch Update Advisory - April 2012 U-150: Oracle Critical Patch Update Advisory - April 2012 U-150: Oracle Critical Patch Update Advisory - April 2012 April 18, 2012 - 8:43am Addthis PROBLEM: Cumulative security patches for Oracle products has been released for April 17, 2012 PLATFORM: The Oracle Database, Oracle Fusion Middleware Oracle Enterprise Manager Grid Control, Oracle E-Business Suite Applications JD Edwards EnterpriseOne, JD Edwards OneWorld Tools PeopleSoft Enterprise Portal Applications, PeopleSoft Enterprise PeopleTools Siebel Enterprise, Industry Applications FLEXCUBE, Primavera and Oracle VM ABSTRACT: Critical Patch Updates are the primary means of releasing security fixes for Oracle products to customers with valid support contracts. They are released on the Tuesday closest to the 17th day of January, April, July and


Microsoft Word - B4E846CE.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

12-1 12-1 12. LIST OF PREPARERS U.S. Department of Energy Mark McKoy - DOE NEPA Document Manager J.D., Law M.S., Geology B.S., Geology 20+ years of experience in environmental sciences, geology, natural gas reservoir simulation, and geotechnical engineering; Registered Professional Geologist. Thomas A. Sarkus - FutureGen Project Director J.D., Law M.S., Earth Sciences B.S., Geology B.S., Chemistry 25 years of experience with clean coal technologies, including air pollution control technologies and advanced power generation technologies. Jeffrey Hoffmann - DOE Project Engineer B.S.E., Chemical Engineering B.S., Biological Sciences Provided technical direction and oversight on surface and subsurface facility design, facility emissions, and project goals.


Microsoft Word - SAFARI 2000_special_ed_refs_20040804.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

SAFARI 2000-Southern African Regional Science Initiative JOURNAL OF GEOPHYSICAL RESEARCH VOL. 108, NO. D13, 2003 Anyamba, A., Justice, C. O., Tucker, C. J., Mahoney, Robert, Seasonal to interannual variability of vegetation and fires at SAFARI 2000 sites inferred from advanced very high resolution radiometer time series data, J. Geophys. Res., 108(D13), 8507, doi:10.1029/2002JD002464, 2003. Bergstrom, R. W., P. Pilewskie, B. Schmid, and P. B. Russell, Estimates of the spectral aerosol single scattering albedo and aerosol radiative effects during SAFARI 2000, J. Geophys. Res., 108(D13), 8474, doi:10.1029/2002JD002435, 2003. Bertschi, I., R. J. Yokelson, D. E. Ward, R. E. Babbitt, R. A. Susott, J. G. Goode, and W. M. Hao, Trace gas and particle emissions from fires in large diameter and belowground biomass


On the Present and Future of Pulsar Astronomy  

E-Print Network (OSTI)

To face recent observational results obtained in multi-wavelength studies from neutron stars and pulsars with the various theoretical models and to discuss on future perspectives on neutron star astronomy we organized a Joined Discussion (JD02) during the XXVI IAU General Assembly which took place in 2006 August in Prague. More than 150 scientists took actively part in this Joint Discussion. Fourteen invited review talks were presented to view the present and future of pulsar astronomy. Fifty three poster contributions displayed new and exciting results. In this summary we give an overview of the invited review talks and contributed posters. The review talks are subject of review articles which will be published elsewhere. More information on this will be available at http://www.mpe.mpg.de/IAU_JD02 in the near future.

W. Becker; J. Gil; B. Rudak


Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Measurement of a magnetic-dipole transition probability in Xe32+ using an electron-beam ion trap  

E-Print Network (OSTI)

D2 5D3 M1 transition of interest at 413.94 nm Measurement of a magnetic-dipol using an electron-bea F. G. Serpa,* C. A. Morgan, E Atomic Physics Division, National Institute of Standard E. Tr Experimentalphysik III, Ruhr-Universit D. A.... Sugar, J. Opt. Soc. Am. B 8, 3 ~1991!. @8# C.A. Morgan, F.G. Serpa, E. Taka?cs, E.S. Meyer, J.D. Gillaspy, J. Sugar, J.R. Roberts, C.M. Brown, and U. Feldman, Phys. Rev. Lett. 74, 1716 ~1995!. @9# F.G. Serpa, E.S. Meyer, C.A. Morgan, J.D. Gillaspy...

Serpa, F. G.; Morgan, C. A.; Meyer, E. S.; Gillaspy, J. D.; Trabert, E.; Church, David A.; Takacs, E.



Characterization of Economic Requirements for a Carbon-Debt-Free Country  

Science Journals Connector (OSTI)

Assuming that the amounts of GHGs emitted directly and indirectly within and outside Japan in order to meet domestic final demand for domestic products and imports is QglobalJP and assuming that the amount of direct GHG emissions accompanying household and nonhousehold consumption expenditure is HdirectJP, then the amount of Japans consumption-based emission, UcomsJP, can be derived from eq 1. ... (32) Here, fJD and fJI were broken down into five categories, fJD[s] and fJI[s] (s = 1 households, 2 government, 3 public fixed capital, 4 private fixed capital, and 5 others), with the respective values being inferred from JIOT. ...

Keisuke Nansai; Shigemi Kagawa; Yasushi Kondo; Sangwon Suh; Kenichi Nakajima; Rokuta Inaba; Yuko Oshita; Takashi Morimoto; Kazumasa Kawashima; Takuji Terakawa; Susumu Tohno



T-605: Oracle Critical Patch Update Advisory - April 2011 | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5: Oracle Critical Patch Update Advisory - April 2011 5: Oracle Critical Patch Update Advisory - April 2011 T-605: Oracle Critical Patch Update Advisory - April 2011 April 19, 2011 - 4:13am Addthis PROBLEM: Oracle Critical Patch Update Advisory - April 19 2011. PLATFORM: Oracle Database, Oracle Fusion Middleware, Oracle Enterprise Manager Grid Control, Oracle E-Business Suite Applications, JD Edwards EnterpriseOne, JD Edwards OneWorld Tools, PeopleSoft Enterprise Portal Applications, PeopleSoft Enterprise PeopleTools, Siebel Enterprise, Oracle Industry Applications and Oracle VM patches. ABSTRACT: A Critical Patch Update is a collection of patches for multiple security vulnerabilities. It also includes non-security fixes that are required because of interdependencies by those security patches. Critical Patch Updates are cumulative.


Modeling & Simulation publications  

NLE Websites -- All DOE Office Websites (Extended Search)

Modeling & Simulation » Modeling & Simulation » Modeling & Simulation Publications Modeling & Simulation publications Research into alternative forms of energy, especially energy security, is one of the major national security imperatives of this century. Get Expertise David Harradine Physical Chemistry and Applied Spectroscopy Email Josh Smith Chemistry Email The inherent knowledge of transformation has beguiled sorcerers and scientists alike. D.A. Horner, F. Lambert, J.D. Kress, and L.A. Collins, "Transport properties of lithium hydride from quantum molecular dynamics and orbital-free molecular dynamics," Physical Review B - Condensed Matter and Materials Physics 80(2) (2009). J.D. Kress, D.A. Horner, and L.A. Collins, "Mixing rules for optical and transport properties of warm, dense matter," AIP Conference Proceedings 1195, 931-934 (2009).


Methodology for Developing the REScheck Software through Version 4.4.3  

NLE Websites -- All DOE Office Websites (Extended Search)

20797 20797 Prepared for the U.S. Department of Energy under Contract DE-AC05-76RL01830 Methodology for Developing the REScheck TM Software through Version 4.4.3 R Bartlett RW Schultz LM Connell ZT Taylor K Gowri JD Wiberg RG Lucas September 2012 PNNL-20797 Methodology for Developing the REScheck TM Software through Version 4.4.3 R Bartlett RW Schultz LM Connell ZT Taylor K Gowri JD Wiberg RG Lucas September 2012 Prepared for the U.S. Department of Energy under Contract DE-AC05-76RL01830 Pacific Northwest National Laboratory Richland, Washington 99352 iii Summary The Energy Policy Act of 1992 (EPAct, Public Law 102-486) establishes the 1992 Model Energy Code (MEC), published by the Council of American Building Officials (CABO), as the target for several



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SECTION 4 SECTION 4 REFERENCES 4-1 SECTION 4 REFERENCES Anderson, J.D., 1996, The History of the 200 Area Burial Ground Facilities, WHC-EP-0912, Westinghouse Hanford Company, Richland, Washington, September. Anderson, J.D., and D.L. Hagel, 1996, Summary of Radioactive Solid Waste Received in the 200 Areas During Calendar Year 1995, WHC-EP-0125-8, Westinghouse Hanford Company, Richland, Washington, June. Atkinson, A., and J.A. Hearne, 1984, An Assessment of the Long-Term Durability of Concrete in Radioactive Waste Repositories, AERE-R11465, United Kingdom Atomic Energy Authority, Harwell, England, October. Barnett, D.B., R.M. Smith, C.J. Chou, and J.P. McDonald, 2005, Groundwater Monitoring Plan for the Hanford Site 216-B-3 Pond RCRA Facility, PNNL-15479, Pacific Northwest National Laboratory, Richland,



NLE Websites -- All DOE Office Websites (Extended Search)

830E 830E Hot Water Draw Patterns in Single-Family Houses: Findings from Field Studies J.D. Lutz, Renaldi, A. Lekov, Y. Qin, and M. Melody Environmental Energy Technologies Division Lawrence Berkeley National Laboratory Berkeley, CA 94720 May 2011 This work was supported by the Assistant Secretary for Energy Efficiency and Renewable Energy, Office of Building Technology, State, and Community Programs, of the U.S.


Paracanthogalea egyptensis n. gen., n. sp.(Digenea:Lepocreadiidae) from the grunter Terapon jarbua (Perciformes:Terapontidae) from the Red Sea  

E-Print Network (OSTI)

& Nagibina. 1974 Gus sev?1973 Gupta & Gupta, 1971 Kalyankar, 1971 Madhavi, 2000 Abdou, 2001 The ropon Jd rbua 1947) Helicometrina indtca (Lmton, 1910) Andhra Pradesh, Bay of Bengal, India Dhanumku mari , 1999 Therapon theraps Telorhynchus..., Ancyrocephalinae). Parazitologiia 8: 473-483. 15 Dhanumkumari, C. 1999. On a new trematode of the genus Decemtestis (Yamaguti 1934) from brackish water fishes of Visakhapatnam, India. Rivista di ~Pi1 1 1 16: 141-146. Dhanumkumari, C. 1999. On a new species...

Gray, Elizabeth Anne



Increased Blood Glucose is Related to Disturbed Cerebrovascular Pressure Reactivity After Traumatic Brain Injury  

E-Print Network (OSTI)

Joseph Donnelly Division of Neurosurgery, Department of Clinical Neurosciences, Box 167, Cambridge Biomedical Campus, Cambridge, CB2 0QQ, United Kingdom. United Kingdom Email: jd634@cam.ac.uk Phone: +44 (0) 1223 336946 0DQXVFULSW &OLFN#3... glucose concentration impairs endothelial, and smooth muscle cell responses both in the cerebral and peripheral vasculature. Clearly, further investigation on the link between glucose and pressure reactivity in the TBI population is warranted...

Donnelly, Joseph; Sudhan, Nazneen; Varsos, Georgios V.; Nasr, Nathalie; Jalloh, Ibrahim; Liu, Xiuyun; Dias, Celeste; Sekhon, Mypinder; Carpenter, Keri L. H.; Menon, David K.; Hutchinson, Peter J.; Smielewski, Peter; Czosnyka, Marek



PMMA quantum dots composites fabricated via use of pre-polymerization  

E-Print Network (OSTI)

.V.Vaitkus, "Optical properties of CdS nanocrystallites embedded in (Si0.2Ti0.8)O2 sol-gel waveguide," Opt. Comm. 148 efficiencies in light emitting diodes made with CdSe(CdS) core/shell type nanocrystals and a semiconducting, 242-248 (1998). 10. A. Martucci, P. Innocenzi, J. Fick, J.D. Mackenzie, "Zirconia-ormosil flms doped

Fainman, Yeshaiahu


Regional Public Coordination Transportation Plan Texoma Region #22  

E-Print Network (OSTI)

Goodwill Industries J.D. Hall Fannin County Judge Bob Rhoden Texoma Workforce Kathy Roberts Texas Department of Health and Human Services James Powell NCTCOG Michelle Bloomer NCTCOG Tim McGraw Grayson County Judge Tom Parker Red River Regional...: Transportation Research Board, National Research Council Federal Highway Administration and Federal Transit Administration. Statewide metropolitan transportation planning. Federal Register 65:02, pp. 33922-33958 21 Appendix D ? Survey Form...

Texoma Council of Governments



Pulse trains that are characteristic of preliminary breakdown in cloud-to-ground lightning but are not followed by return stroke pulses  

E-Print Network (OSTI)

but are not followed by return stroke pulses Amitabh Nag1 and Vladimir A. Rakov1 Received 1 February 2007; revised 26-to-ground discharges but are not followed by return stroke waveforms. We assume that such trains are manifestations-to-ground lightning but are not followed by return stroke pulses, J. Geophys. Res., 113, D01102, doi:10.1029/2007JD

Florida, University of



E-Print Network (OSTI)

BAYESIAN ESTIMATION OF FUEL ECONOMY POTENTIAL DUE TO TECHNOLOGY IMPROVEMENTS by Richard W. Andrews in the engineering assessment phase of this project: N.T. Barnes, B. Beeson, R.C. Belaire, W.C. Follmer, R.J. Genik, R.C. Heathfield, T.E. Kenney, D.L. Kulp, J.G. LaFond, J.D. Medrick, N.M. Novelli, G. Pietron, N

Berger, Jim


)": t-Il )\\JA\\A-~' i{~ j30 )-1b1)". \\1 1VI-J\\J'-Y ~ (.3'-1  

E-Print Network (OSTI)

. ,j(;1 3 Ill!. I ~ mi. 1';- Ill!. #12;T· 55 11V" 5l.i!s"" \\-\\1JD : 10 Iv..,'" $"4/5 1 ~HV17: L!1 Mf. ~S mi. Vis. mi. Vis. 2.[mi. #12;T_y:) J . "I....,'.~ ()A,.H{)(). '"6l t'\\MI Y; .., ~ I 35'/ ?> b loo (J ~(I).'). 0 f f'{lv~: o· 10"\\ l pC/V;,' 0.6" #12

Thompson, Anne


DDiiggiilleenntt CCeerreebboott PPlluussTMTM BBooaarrdd RReeffeerreennccee MMaannuuaall  

E-Print Network (OSTI)

devices. Digilent peripheral modules include H-bridges, analog-to-digital and digital-to-analog converters, SPI, &TWI ports 3.3V regulator JB Mem Addr JC Mem Ctl UART JD SPI TWI UART JE H-bridge JF H-bridge JG H-bridge & LEDs Various power connectors 8 8 8 8 8 4 8 Eight servo connectors JH H-bridge UART 8 8

Zachmann, Gabriel


Alumni Council Membership List (June 1, 2011 May 31, 2012)  

E-Print Network (OSTI)

Amy Gretenstein, B.S.C. '06 Roger Reynolds, B.M. '91, M.M. '96 Elena Mulvaney, B.B.A. '04 Melissa.B.A. '95 John Clough, J.D. '99 TBD Kelly Sciba, B.S.C. '92 Larry King, Jr., A.B. '83, M.B.A. '93 Michael B: Tampa: Washington, D.C.: Special Interest Groups Black Alumni Society: Band of the Hour: UM Sports Hall

Miami, University of


"Branches of a Tree" 31 October 2009 Edwards (Ted) Atwood, Ph.D., 1976  

E-Print Network (OSTI)

"Branches of a Tree" ­ 31 October 2009 #12;#12; Edwards (Ted) Atwood, Ph.D., 1976 Kumar Bhushan, PD, 2003-2005 Alex Bonner, Ph.D., 1975 Ting Chen, PD, 2001-2003 Kyung-Hee (Kay) Choi, Ph.D., 1998 Hann--Bin Chuang, Ph.D., 1986 Gejing Deng, Ph.D., 1997 Daniel DeOliveira, Ph.D., 1998 J.D. Dixon, Ph

Spence, Harlan Ernest


Further Taxonomic Studies on Straight to Flexuous Streptomycetes  

Science Journals Connector (OSTI)

...oX: as~niouID + + ++ + + + + + + + + + + _ oIOIUOOuoqJevoN I I I 9khP!UasotOJ4JD + + + + + + ++ + to ,,c2u + + + + + +++ + WES ~ ~ s ss sS S S I 15 5S0 cd 0i) m M M p ;M P PprM4 Cd 0 . c)r. C1._1 U) -o C- ._ 0- CM CD...

Thomas G. Pridham; Allister J. Lyons



Meteorological conditions associated with the full-span galloping oscillations of overhead transmission lines  

E-Print Network (OSTI)

transmission lines J. C.R. Hunt, M.A., Ph.D., A.F.I.M.A., and M.D. Rowbottom,B.Sc., PhJD., A.F.I.M.A. Indexing transmission lines over a 7-year period have been correlated in the form of histograms of number of faults-span galloping oscillations of ice-accreted bundled overhead transmission lines. The main assumption made

Hunt, Julian


The international status of intelligence-collecting reconnaissance satellites  

E-Print Network (OSTI)

May 1972 Major Subject: Political Science THE INTERNATIONAL STATUS OF INTELLIGENCE- COLLECTING RECONNAISSANCE SATELLITES A Thesis by BRENT ALLEN GATES Approved as to style and content by: (Chairman of Commit e) 09JD ' J 'd (Head of Department... and legal issues surrounding aerial reconnaissance are examined. It is shown that the rapid technological evolution of spaceborne reconnaissance systems which is taking place in the absence of international agreements governing these systems is a...

Gates, Brent Allen


Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Design of stand-alone brackish water desalination wind energy system for Jordan  

SciTech Connect

More than 100 underground water wells drilled in Jordan are known to have brackish water with total desolved solids (TDS) over 1500 ppm but not greater than 4000 ppm. The world standard for potable water limits the TDS count to 500 ppm in addition to being free from live microorganisms or dangerous mineral and organic substances. A reverse osmosis desalination scheme powered by a stand-alone wind energy converter (WEC) is proposed to produce fresh water water from wells located in potentially high-wind sites. The purpose of this study if to present the main design parameters and economic estimates of a wind-assisted RO system using a diesel engine as the baseline energy source and an electric wind turbine for the wind energy source. It is found that brackish water pumping and desalinating using WECs costs 0.67 to 1.16 JD/m[sup 3] (JD = Jordanian Dinar, 1US$ = 0.68 JD), which is less than using conventional diesel engines especially in remote areas. In addition, the wind-reverse osmosis system becomes more economically feasible for higher annual production rates or in good wind regimes.

Habali, S.M.; Saleh, I.A.



Search for Higgs boson production in oppositely charged dilepton and missing energy final states in 9.7??fb-1 of pp collisions at s=1.96??TeV  

Science Journals Connector (OSTI)

We present a search for the Higgs boson in final states with two oppositely charged leptons and large missing transverse energy as expected in H?WW??????? decays. The events are selected from the full Run II data sample of 9.7??fb-1 of pp collisions collected with the D0 detector at the Fermilab Tevatron Collider at s=1.96??TeV. To validate our search methodology, we measure the nonresonant WW production cross section and find ?WW=11.60.7??pb, in agreement with the standard model prediction. In the Higgs boson search, no significant excess above the background expectation is observed. Upper limits at the 95%confidence level on the Higgs boson production cross section are therefore derived. Within the standard model, the Higgs boson mass range 159<MH<176??GeV is excluded while the expected exclusion sensitivity is 156<MH<172??GeV. For a mass hypothesis of MH=125??GeV, we exclude Higgs boson production cross sections 4.1times larger than the standard model expectation, which is compatible with the presence of a Higgs boson at this mass. Within a theoretical framework with a fourth generation of fermions, the mass range 125<MH<218??GeV is excluded. The search results are also interpreted in the context of fermiophobic Higgs boson couplings, which yields an exclusion of fermiophobic Higgs boson production cross sections 3.1times larger than the expectation for MH=125??GeV.

V. M. Abazov et al. (D0 Collaboration)



Medina Electric Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Medina Electric Coop, Inc Medina Electric Coop, Inc Place Texas Utility Id 12268 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes ISO Ercot Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png City of Laredo Street Lighting- 150W HPS Lighting City of Laredo Street Lighting- 150W MH Lighting City of Laredo Street Lighting-250 W HPS Lighting City of Laredo Street Lighting-250 W MH Lighting City of Laredo Street Lighting-400 W HPS Lighting City of Laredo Street Lighting-400 W MH Lighting Commercial General Service (Primary Metered & Primary Voltage) Commercial


Leavenworth-Jefferson E C, Inc | Open Energy Information  

Open Energy Info (EERE)

Leavenworth-Jefferson E C, Inc Leavenworth-Jefferson E C, Inc Jump to: navigation, search Name Leavenworth-Jefferson E C, Inc Place Kansas Utility Id 10801 Utility Location Yes Ownership C NERC Location SPP Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Outdoor Area Lighting Service (HPS 100 W) Lighting Outdoor Area Lighting Service (HPS 250 W) Lighting Outdoor Area Lighting Service (HPS 400 W) Lighting Outdoor Area Lighting Service (MH 100 W) Lighting Outdoor Area Lighting Service (MH 250 W) Lighting Outdoor Area Lighting Service (MH 400 W) Lighting Outdoor Area Lighting Service (MV 175 W) Lighting


Central Alabama Electric Coop | Open Energy Information  

Open Energy Info (EERE)

Central Alabama Electric Coop Central Alabama Electric Coop Place Alabama Utility Id 3222 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Residential Service Residential Security Lights Service: 100 W/HPS with 1 pole set Lighting Security Lights Service: 100 W/HPS with 2 poles set Lighting Security Lights Service: 1000 W/MH Lighting Security Lights Service: 1000 W/MH with 1 pole set Lighting Security Lights Service: 1000 W/MH with 2 poles set Lighting Security Lights Service: 100W/HPS (on existing pole) Lighting


Metal chelates of N,N'-dihydroxyethyl-N,N'-ethylenediaminedisuccinic acid and selected metal ions  

E-Print Network (OSTI)

constants . Thus K~gi L is the formation con- H n stant of 5%nL by combination of 1% 1L and H+, The reactions taking place during the addition of four males of base per mole of ligand are those involving 18 formation of the three MHL(m 3) + ML(m-4...) Mm+ + postulated metal chelate species KH MH2L 1, @ L(m-2)+ 2 KH MHL(m-3) + ~ L KM L4" ML ML(m-4) + The mass balance expressions for metal and ligand species are: T M [Mm+] + [yg (m-4)+] + MHL(m-3)+ MH L(m-2)+ (1) 2 [ML ?+] [MHL m +] [MH...

Hampton, Joan Martiner



Magnetic nanoparticles: study of magnetic heating and adsorption/desorption for biomedical and environmental applications  

Science Journals Connector (OSTI)

This paper presents a summary of research on magnetic nanoparticles (MNPs) carried out recently at the Institute of Materials Science. Three families of oxide MNPs namely magnetite, manganite and spinel ferrite materials were prepared by several methods: co-precipitation, sol-gel and high-energy mechanical milling. Magnetite nanoparticles were encapsulated by two natural polymers, starch and chitosan. The structure of the prepared nanosystems was characterised by XRD, SEM, TEM techniques while their magnetisation was measured by VSM and PPMS. The magnetic heating (MH) of both naked and polymer-coated MNPs was studied. We also present two examples of researched applications that can be derived from this effect, namely the use of MH of magnetite NPs coated with starch to kill cancer cells, and the MH-assisted desorption of VOC from SBA/ferrite nanocomposite. Other research application examples include the use of magnetite MNPs to remove heavy toxic metals, such as arsenic, lead and nickel from contaminated water.

Pham Hoai Linh; Do Hung Manh; Tran Dai Lam; Le Van Hong; Nguyen Xuan Phuc; Nguyen Anh Tuan; Nguyen Thanh Ngoc; Vu Anh Tuan



Inclusive Search for Standard Model Higgs Boson Production in the WW Decay Channel using the CDF II Detector  

E-Print Network (OSTI)

We present a search for standard model (SM) Higgs boson production using ppbar collision data at sqrt(s) = 1.96 TeV, collected with the CDF II detector and corresponding to an integrated luminosity of 4.8 fb-1. We search for Higgs bosons produced in all processes with a significant production rate and decaying to two W bosons. We find no evidence for SM Higgs boson production and place upper limits at the 95% confidence level on the SM production cross section (sigma(H)) for values of the Higgs boson mass (m_H) in the range from 110 to 200 GeV. These limits are the most stringent for m_H > 130 GeV and are 1.29 above the predicted value of sigma(H) for mH = 165 GeV.

The CDF Collaboration; T. Aaltonen



City of La Grange, Georgia (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Georgia (Utility Company) Georgia (Utility Company) Jump to: navigation, search Name City of La Grange Place Georgia Utility Id 10585 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png COMMERCIAL ELECTRIC SERVICE Commercial GENERAL ELECTRIC SERVICE Commercial HPS Acorn, 100 Lighting HPS Acorn, 250 Lighting HPS Open Bottom, 100 Lighting HPS Post Top, 100 Lighting HPS Post Top, 150 Lighting HPS or MH - Flood or Shoebox, 150 Lighting HPS or MH - Flood or Shoebox, 250 Lighting HPS or MH - Flood or Shoebox, 400 Lighting


City of Siloam Springs, Arkansas (Utility Company) | Open Energy  

Open Energy Info (EERE)

Arkansas (Utility Company) Arkansas (Utility Company) Jump to: navigation, search Name City of Siloam Springs Place Arkansas Utility Id 17184 Utility Location Yes Ownership M NERC Location SPP NERC SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Commercial Commercial - All Electric Rate Commercial Large Power Industrial Large Power Transformer Discount Industrial Residential Residential Residential - All Electric Residential Security Lighting 1000 W MH Lighting Security Lighting 150-175 W MH Lighting Security Lighting 400 W MH Lighting Small Power Industrial


Character of Z-pole data constraints on standard model parameters  

Science Journals Connector (OSTI)

Despite the impressive precision of the Z-pole measurements made at the e+e- colliders at CERN (LEP) and SLAC (SLC), the allowed region for the principal standard model parameters responsible for radiative corrections [mH, mt, and ?(mZ2)] is still large enough to encompass significant nonlinearities. The nature of the experimental constraints therefore depends in an interesting way on the accidental relationships among the various measurements. In particular, the fact that the Z-pole measurements favor values of mH excluded by direct searches leads us to examine the effects of external Higgsstrahlung, a process ignored by the usual precision electroweak calculations.

T. Kawamoto and R. G. Kellogg



Status of Higgs boson searches at the beginning of the LHC era  

Science Journals Connector (OSTI)

In recent years the Tevatron Run-II collaborations have extended the search for Higgs bosons which was pioneered during the LEP accelerator operation between 1989 and 2000. This review concisely discusses the experimental constraints set by the CDF and D collaborations with the complete dataset taken up to September 2011. Model-independent and model-dependent limits on Higgs boson masses and couplings have been set and interpretations are discussed both in the context of the Standard Model and in extended models. In spring 2012 the Tevatron extended the excluded SM Higgs boson mass range to 147 mH mH

A Sopczak



The effect of maleic hydrazide and 2,4-dichlorophenoxyacetic acid on the carbohydrate content and leaf and stem rust response of wheat  

E-Print Network (OSTI)

respiration (13, 38) . Possibly the change in carbohydrate metabolism is the effect and not the cause, although it may be an indication of what is happening. 37 The MH and 2, 4-D treatments did not seem to have any consistant effects on the starch... respiration (13, 38) . Possibly the change in carbohydrate metabolism is the effect and not the cause, although it may be an indication of what is happening. 37 The MH and 2, 4-D treatments did not seem to have any consistant effects on the starch...

Lyles, William Earl



Promising process to distinguish supersymmetric models with large tan ? from the standard model: B?Xs?+?-  

Science Journals Connector (OSTI)

It is shown that in supersymmetric models the large supersymmetric contributions to B?Xs?+?- come from the Feynman diagrams which consist of exchanging neutral Higgs boson loops and are proportional to mbm?tan3?/mh2 when tan ? is large and the mass of the lightest neutral Higgs boson mh is not too large (say, less than 150 GeV). Numerical results show that the branching ratios of B?Xs?+?- can be enhanced by more than 100% compared to the standard model (SM) and the backward-forward asymmetry of the lepton is significantly different from that in the SM when tan ??30.

Chao-Shang Huang, Wei Liao, and Qi-Shu Yan



Fluorometric sedimentation equilibrium for lipoprotein sub-class analysis.  

E-Print Network (OSTI)

was obtained and analyzed using a digital Optronics Microfire Camera (S99808, Goleta, CA) with a Fiber-Lite MH- 100 Illuminator, (MH100A, Edmund Industrial Optics). The light source described here is a metal halide continuous light source. The camera is a... digital color microscope camera (S99808, Optronics, Goleta, CA). The camera and light source were placed orthogonally to each other on an optical bench to illuminate the sample suspended in a post holder. Two filters matching the excitation and emission...

Henriquez, Ronald Rene



Restriction fragment length polymorphisms of chromosome 10S in maize (Zea mays L.) linked to resistance to Southern rust (Puccinia polysora)  

E-Print Network (OSTI)

. ~Mh~d 1 Inoculation was accomplished by removing spores from an infection pustule on a Tx5855 rust maintenance plant, in the evening, with a flat wooden toothpick and placing them deep in the whorl of the host plant to be tested. To obtain a humid... environment for spore germination, 1- 2 ml of distilled water was added to the whorl and the entire plant sprayed with a fine mist of distilled water. ~Mh~d 2 Innoculum was prepared by thawing one or two ampules of liquid nitrogen frozen innoculum...

Blakey, Cynthia Ann



Experimental Study of the Richtmyer-Meshkov Instability on Inclined Interface  

E-Print Network (OSTI)

Laboratory, Report UCRL-LR-110500, in final preparation. (2003). [8] Anderson, M.H., Puranik, B.P., Oakley, J.G., Brooks, P.W., Bonazza, R.: Shock tube investigation of hydrodynamic issues related to inertial confinement fusion. Shock Waves. 10, 377... Laboratory, Report UCRL-LR-110500, in final preparation. (2003). [8] Anderson, M.H., Puranik, B.P., Oakley, J.G., Brooks, P.W., Bonazza, R.: Shock tube investigation of hydrodynamic issues related to inertial confinement fusion. Shock Waves. 10, 377...

McDonald, Christopher Michael



Re-Commissioning of a VAV Air-Distribution System  

E-Print Network (OSTI)

P_setpoint=cte Supply circuit Fresh air circuit Extraction Group Atrium Bs1 south 3100 m?/h Return circuit BLOC B BLOC C VAV box 250 to 450 Pa 32 m fire cut-off valve silencer V& : air flow rate - m?/h Mechanized register regulation valve grille PAF Legend Figure 2... box manufacturer, this minimum pressure is around 250 Pa. The calculation, which is presented by Figure 4, shows that, with such a value, the pressure is acceptable in all rooms connected to this AHU. The same calculation shows that the connection...

Andre, P.; Silva, C. A.; Fonseca, N.; Hannay, J.; Lebrun, J.; Lacote, P.



Ramifications of Discrete R Symmetries USC, October 2012  

E-Print Network (OSTI)

in nature which appears extremely tuned: the cosmological constant (dark energy). We have no good ideas Symmetries #12;The Higgs Discovery July 4 2012: ATLAS/CMS/CERN announcement of candidate Higgs discovery Discovery for Supersymmetry Higgs at 125 GeV poses two challenges: 1 In MSSM, mh MZ . Radiative corrections

California at Santa Cruz, University of


Herausgeber: Deutsche Forschungsgemeinschaft http://www.dfg.de  

E-Print Network (OSTI)

#12;Herausgeber: Deutsche Forschungsgemeinschaft http://www.dfg.de ?berreicht durch: Den. Christopher H. Baum Forschungsdekan der MHH #12;http://www.mh-hannover.de/forschung.html Deutsche 'Selbstkontrolle in der Wissenschaft' (Deutsch) #12;Empfehlungen der Kommission "Selbstkontrolle in der

Manstein, Dietmar J.

Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Improvement of output coupling efficiency of organic light-emitting diodes by backside substrate modification  

E-Print Network (OSTI)

modification C. F. Madigan, M.-H. Lu, and J. C. Sturma) Center for Photonics and Optoelectronic Materials, Department of Electrical Engineering, Princeton University, Princeton, New Jersey 08544 Received 8 November and at least triple it when high-index plastic substrates are used. The work is accompa- nied by modeling


Interactions between turbidity currents and topography in aggrading sinuous submarine channels: A laboratory study  

Science Journals Connector (OSTI)

...and thickness of the currents as the channel-form evolved. Aerial video was collected throughout the duration of each current...1365-3091.2003.00551.x. Parker, G., Garcia, M.H., Fukushima, Y., and Yu, W., 1987, Experiments on turbidity currents...

Kyle M. Straub; David Mohrig; Brandon McElroy; James Buttles; Carlos Pirmez



E-Print Network (OSTI)

ENVIRONMENTAL EFFECTS IN GALAXIES: MOLECULAR GAS AND NUCLEAR ACTIVITY DUILIA DE MELLO and TOMMY;ENVIRONMENTAL EFFECTS IN GALAXIES 69 a. log(MH2 /LB) versus Morphology b. Kolmogorov-Smirnov Statistic Figure 2 in dense envir- onments and in the field and to study whether there is any correlation between nuclear

Maia, Marcio Antonio Geimba


Psychotherapie in der Medizin Modul-Code: MSE_WP 534  

E-Print Network (OSTI)

Dr. Burkard Jäger Dr. Stefanie Jasper (Lehrbeauftragte) PD Dr. Dr. Astrid Müller Dr. Michael Stephan Jasper (jasper.stefanie@mh-hannover.de) melden 1. Woche: Beginn Montag ab 7.50 Uhr, Werktägliche zugesandte Einführungsliteratur. Dazu bitte auch an Fr. Dr. Stefanie Jasper wenden (jasper

Manstein, Dietmar J.


Mobile Networks and Applications 9, 481490, 2004 2004 Kluwer Academic Publishers. Manufactured in The Netherlands.  

E-Print Network (OSTI)

to physical hazards, but also suffer from limited battery life, reduced storage capacity, and a relatively low. Introduction Thanks to the relentless advances in semiconductors, the number of users with mobile computers (we to save battery life or communication dollars; while such a MH is disconnected, it has not failed

Madiraju, Praveen


Non-Aqueous Solvation of n-Octanol and Ethanol: Spectroscopic and Computational Lori M. Levering, Carrigan J. Hayes, Karen M. Callahan, Christopher M. Hadad,* and  

E-Print Network (OSTI)

Non-Aqueous Solvation of n-Octanol and Ethanol: Spectroscopic and Computational Studies Lori M-H bonds in n-octanol and ethanol with the organic solvents carbon tetrachloride (CCl4), cyclohexane populations of each ethanol complex and are consistent with the experimental results. Additional spectra were


Cancer Epidemiology in the 21st Century: Knowledge Integration in Cancer: Current Landscape and Future Prospects  

Science Journals Connector (OSTI)

...Deposition of raw datasets in public: documentation, access...Optimization of multiconsortial space, competition, and communication...Information, National Library of Medicine. [cited...Al-Mallah MH, Ioannidis JP.Public availability of published...future directions.Am J Public Health 2012;102:1274-81...

John P.A. Ioannidis; Sheri D. Schully; Tram Kim Lam; and Muin J. Khoury



The West/African Americans/The Long Nineteenth Century UW-Madison, Department of History  

E-Print Network (OSTI)

The West/African Americans/The Long Nineteenth Century Jesse Gant UW-Madison, Department of History, Ohio: Ohio University Press, 2006. Baptist, Edward E, and Stephanie M.H. Camp. New Studies, 2003. #12;_____. Many Thousands Gone: The First Two Centuries of Slavery in North America. Cambridge

Wisconsin at Madison, University of


Evidence of magnetic isotope effects during thermochemical sulfate reduction  

Science Journals Connector (OSTI)

...4). The acid/water would come from...nitrogen flow. Water lost to evaporation...mL of Milli-Q water through a septum...in ref. 38). Recovery was incomplete because...through radical condensation reactions. 1 Farquhar...Thiemens MH ( 2000 ) Atmospheric influence of Earths earliest...

Harry Oduro; Brian Harms; Herman O. Sintim; Alan J. Kaufman; George Cody; James Farquhar



Development of a Rapid Normal-Phase LC-Positive Ion APCI-MS Method for Simultaneous Detection and Quantitation of Cholesterol, Androst-4-ene-3,17-dione, and Androsta-1,4-diene-3,17-dione  

Science Journals Connector (OSTI)

......chromatography (LC)positive ion atmospheric pressure chemical ionization...nitrogen from a nitrogen generator was used as the carrier...369 after the loss of water moiety from the molecule...protonated ions after loss of water [MH2O+H]+ at m...cholesterol after the loss of water fragments. The LCAPCIMS......

Ravi K. Khajuria; Vikram Bhardwaj; Rajinder K. Gupta; Preeti Sharma; Priti Somal; Pradeep Mehta; Ghulam N. Qazi



Coherent photoproduction of -mesons off 3 He -search for -mesic nuclei  

E-Print Network (OSTI)

.N. Prakhov k , J. Robinson c , G. Rosner c , T. Rostomyan a,h , S. Schumann b , M.H. Sikora i , D.I. Sober p, pointing to the existence of a resonant state. The search for further evidence of this state

Krusche, Bernd


Quasifree Photoproduction of Mesons off Protons and Neutrons D. Werthmuller1  

E-Print Network (OSTI)

, G. Rosner3 , T. Rostomyan1 , S. Schumann2,5 , M.H. Sikora8 , D. Sober18 , A. Starostin10 , I. Supek, agree with the known neutron-to-proton cross-section ratio in the peak of the S11(1535) resonance

Krusche, Bernd


EPJ AHadrons and Nuclei your physics journal  

E-Print Network (OSTI)

. Rosner3 , M. Rost2 , T. Rostomyan1 , S. Schumann2,5 , M.H. Sikora8 , D. Sober18 , A. Starostin10 , I nuclear Fermi motion. In the S11(1535) resonance peak, the data agree with the neutron/proton cross

Krusche, Bernd


HEP/123-qed Photoproduction of 0  

E-Print Network (OSTI)

HEP/123-qed Photoproduction of 0 -mesons off neutrons in the nucleon resonance region M. Dieterle1. Robinson3 , G. Rosner3 , T. Rostomyan1 , S. Schumann2,5 , M.H. Sikora8 , D. Sober18 , A. Starostin10 , I of nucleon resonances. How- ever, with the recent progress in the numerical meth- ods of lattice gauge

Krusche, Bernd


Leliaert et al. 2011 Tda: Chlorophyceae  

E-Print Network (OSTI)

Solazyme's 100% algal-derived jet fuel, Solajet(R) HRJ-5, in an MH-60S Seahawk helicopter test flight in a 50/50 blend with petroleum-derived jet fuel. This is the first defense aircraft in history to fly on algae fuel. United Airlines 737 made the first U.S. commercial flight running on a biofuel blend, a 60


Adaptive Reliability Analysis of Excavation Problems  

E-Print Network (OSTI)

........................................................................... 26 2.5.3 Structure of ?z ............................................................................. 28 2.6 Solution Strategies ................................................................................ 29 2.6.1 Markov Chain Monte Carlo... simulation Metropolis-Hastings (MH) algorithm ........................................................................... 30 viii Page 2.6.2 Delayed Rejection Adaptive Metropolis (DRAM) method ........ 32 2.7 Application...

Park, Jun Kyung



IEEE Computer Society 1986 , 1988  

E-Print Network (OSTI)

Society Golden Core Member 226 NEDO NEDO , IT , , JSTJSPSJAXA ES,, , ES2 , IEEE,, ACM Conf.PC, 191 Year Total Cores Rmax Rpeak Effecie ncy (%) Power Mflops /Watt Proc. Proc. MH z OS Core s Sequoia BlueGene/Q, Power BQC 16C 1.60 GHz, Custom DOE/ NNSA /LLN L IBM 2011 1572864 16324751 20132659 81.09 7890 2069

Kasahara, Hironori


Nucleotide sequence of the iucD gene of the pColV-K30 aerobactin operon and topology of its product studied with phoA and lacZ gene fusions.  

Science Journals Connector (OSTI)

...Pro Lou Ile Thr Rot His Asp Lys Asn Thr Phe Lys Val Arg Asp LCA GOT TAC CGT TCT GCG TTG CCA CM ATA CTT CCC TCA CTG ATG CCC...CRCR-1-1633 from the National Science Foundation and Department of Agriculture, respectively. M.H. was a Postdoctoral Fellow from the...

M Herrero; V de Lorenzo; J B Neilands



Effect of Scaling Transfer between Evapotranspiration Maps Derived from LandSat 7 and MODIS Images  

E-Print Network (OSTI)

Sung-ho Hong, Jan M.H. Hendrickx and Brian Borchers New Mexico Tech, 801 Leroy place, Socorro, NM 87801 of the spatial distribution of ET over a range of space and time scales is needed for sustainable management coarse resolution images like MODIS provide very useful opportunities to monitor the energy balance

Borchers, Brian


Oxygen tolerance of an in silico-designed bioinspired hydrogen-evolving catalyst in water  

Science Journals Connector (OSTI)

...32 Zipoli F Car R Cohen MH...A ( 2009 ) Hydrogen production...reduction at a fuel-cell cathode . J Phys...current for hydrogen evolution...Reduction at a Fuel-Cell cathode...Current for Hydrogen Evolution...Zipoli, F., Car, R., Cohen...

Patrick H.-L. Sit; Roberto Car; Morrel H. Cohen; Annabella Selloni


Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


SOLAR BATTERY CHARGERS FOR NIMH BATTERIES1 Abstract -This paper proposes new solar battery  

E-Print Network (OSTI)

SOLAR BATTERY CHARGERS FOR NIMH BATTERIES1 Abstract - This paper proposes new solar battery chargers for NiMH batteries. Used with portable solar panels, existing charge control methods are shown of consumer portable solar arrays. These new arrays are lightweight, durable, and flexible and have been

Lehman, Brad


CURRICULUM VITAE James A. Bednar, Ph.D.  

E-Print Network (OSTI)

for Adaptive and Neural Computation School of Informatics College of Science and Engineering University, Department of Computer Sciences, University of Texas at Austin, 2002-2004. · Principal research grants Institute of Mental Health (Human Brain Project) grant #1R01-MH66991, Computational Modeling of Cortical

Bednar, Jim


16. D. S. Scheirer and K. C. Macdonald, ibid. 98, 7871 17. MBAs are calculated by subtracting from the free-air  

E-Print Network (OSTI)

16. D. S. Scheirer and K. C. Macdonald, ibid. 98, 7871 (1993). 17. MBAs are calculated. J. R. Cochran, Geophys. J. R. Astron. Soc. 87, 421 (1986). 24. M.-H. Cormier, K. C. Macdonald, D. S, K. C. Macdonald, D. W. Forsyth, Y. Shen, Mar. Geophys. Res. 18, 13 (1996). 32. Y. Shen, D. W

Toomey, Doug


Table of Contents Faculty Conf. 1  

E-Print Network (OSTI)

Baxter -- as did every bridge group leader. Each bridge group met and got (continued on page two) "A year to become a dentist and the importance of professionalism and scholarship. Denice Stewart, D.D.S., M.H under sunny skies. Each bridge group was charged with creating a hands-on exhibit for a hypothetical

Chapman, Michael S.


KaushikRajashekara TheUniversityofTexasatDallas  

E-Print Network (OSTI)

rpm Brushless DC * Fuel consumption (City/Highway): 42/43 MPG with CVT NissanLEAF­ Product Range extender Series Hybrid Parallel Fuel Cell Series Mild HybridMild Hybrid GeneratorEngine Fuel Cell * Engine: 1.3 liter, 4 cylinder * Battery: 100.8V DC (NiMH battery), 5.75 Ah * Motor/Generator: 13 KW @1500

California at Davis, University of


Copyright 2001 Psychonomic Society, Inc. 330 Cognitive, Affective, & Behavioral Neuroscience  

E-Print Network (OSTI)

that may well be related to body and limb position up- dating (Bonda,Petrides, Frey, & Evans, 1995;Sirigu Grant 97-17 to J.W.P. and by NIH Grant RO1 MH54246to M.B. The authorsthank John Jonides and two of locations during whole-body rotations in patients with hemispatial neglect JOHN W. PHILBECK George

Loomis, Jack M.


Magnetic Patterning of Permanent-Magnet Rotors for Microscale Motor/Generators  

E-Print Network (OSTI)

offers three advantages. First, eliminating the integrated winding permits simpler MH design element modeling 1. INTRODUCTION High power-density, microscale, axial-flux, PM machines [1-3] typically (Thickness = 0.5 mm, OD=9.5 mm) encased in a Ti adaptor used for microscale power generator [1]; (b


Microbiological and Physicochemical Characterization of Small-Scale Cocoa Fermentations and Screening of Yeast and Bacterial Strains To Develop a Defined Starter Culture  

Science Journals Connector (OSTI)

...subsequently centrifuged at 100 g and 4C for 10 min to remove large particles. The supernatant was further centrifuged at 8,000 g and...MH Zwietering. 2011. Theobroma cacao L., the food of the gods: quality determinants of commercial cocoa beans, with particular...

Gilberto Vincius de Melo Pereira; Maria Gabriela da Cruz Pedrozo Miguel; Cntia Lacerda Ramos; Rosane Freitas Schwan



MT3DMS, A Modular Three-Dimensional Multispecies Transport Model User Guide to the  

E-Print Network (OSTI)

.M. Cozzarelli, M.H. Lahvis, and B.A. Bekins. 1998. Ground water contamination by crude oil near Bemidji (LNAPL) contaminant through the unsaturated zone and the formation of an oil lens on the water table ................................................................................................................. 18 #12;1 1. INTRODUCTION Leaks of fuels that release contaminants such as BTEX, MTBE and other fuel

Zheng, Chunmiao


Development of a large format direct detection device for three dimensional transmission electron microscopy  

E-Print Network (OSTI)

F. Duttweiler, J.C. Bouwer, S.T. Peltier, M.H. Ellisman, andDuttweiler, J.C. Bouwer, S.T. Peltier, M. Ellisman, and N.H.Duttweiler, J.C. Bouwer, S.T. Peltier, A.C. Milazzo, and M.

Milazzo, Anna-Clare



Contributed Paper Using Changes in Agricultural Utility to Quantify  

E-Print Network (OSTI)

Contributed Paper Using Changes in Agricultural Utility to Quantify Future Climate-Induced Risk to Conservation LYNDON D. ESTES, LYDIE-LINE PAROZ, BETHANY A. BRADLEY,§ JONATHAN M.H. GREEN, DAVID G. HOLE to be mediated through changes in the agricultural utility of land. As farmers adapt their practices to changing

Bradley, Bethany


Zero-Emission Vehicle Scenario Cost Analysis Using A Fuzzy Set-Based Framework  

E-Print Network (OSTI)

a small percentage of EV sales with the ZEV mandate). WithNow, a portion of the 10% EV sales mandate can be composedSales - High Produciton Volume Scenario Subcompact Vehicle Chassis Manufacturing Costs GM Ovonics Projection of Selling Prices of NiMH EV

Lipman, Timothy E.




E-Print Network (OSTI)

Next, let us consider the approximation of a function u 2 H2(I) by continuous,. piecewise-linear functions. Let ...... (1.7.10). Note that the recursion could have begun at any level of di erentiation. By the argu- ...... fv 2Mh : v j@= ghg: The Galerkin...



E-Print Network (OSTI)

... text/html; charset="iso-8859-1" Content-Transfer-Encoding: quoted-printable ...... /tP+u9rbGFyiMh750+0r7f49Tm7I3o1wtOGM1pRQuUy9oceKRvmQYp3LAgg


Insights from Sequencing Fungal and Oomycete Genomes: What Can We Learn about Plant Disease and the Evolution of Pathogenicity?  

Science Journals Connector (OSTI)

...number of projects is in progress, and the dramatic fall in the price of DNA sequencing, coupled with the new high-throughput sequencing...Harrison, S.J., Joosten, M.H., Vervoort, J., and de Wit, P.J. (2006). Cladosporium fulvum Avr4 protects fungal...

Darren M. Soanes; Thomas A. Richards; Nicholas J. Talbot



Toward Prediction of Efficacy of Chemotherapy: A Proof of Concept Study in Lung Cancer Patients Using [11C]docetaxel and Positron Emission Tomography  

Science Journals Connector (OSTI)

...Engels FK, De Bruijn P, Lam MH, De Wit R, et alPitfalls of the application of...Rosso L , Brock CS, Gallo JM, Saleem A, Price PM, Turkheimer FE, et alA new model for...Res 2001;61:3369-72. 31. Saleem A Price PM.Early tumor drug pharmacokinetics...

Astrid A.M. van der Veldt; Mark Lubberink; Ron H.J. Mathijssen; Walter J. Loos; Gerarda J.M. Herder; Henri N. Greuter; Emile F.I. Comans; Hugo B. Rutten; Jonas Eriksson; Albert D. Windhorst; N. Harry Hendrikse; Pieter E. Postmus; Egbert F. Smit; and Adriaan A. Lammertsma



Obesity as a Barrier to the Transition from Welfare to Work John Cawley  

E-Print Network (OSTI)

for Child Health and Development, and the National Institute of Mental Health (R24-MH51363). We thank George from Welfare to Work John Cawley and Sheldon Danziger Abstract In 1996, welfare reform created individual cases from these requirements. As a result of welfare reform, expansions of the Earned Income Tax

Shyy, Wei


Work after Welfare Reform and the Well-being of Children* Rucker C. Johnson  

E-Print Network (OSTI)

Work after Welfare Reform and the Well-being of Children* Rucker C. Johnson Goldman School Policy Research Program of the Robert Wood Johnson Foundation, the National Institute of Mental Health (R24- MH51363), the National Institute of Child Health and Human Development (P50-HD38986

Shyy, Wei


Gerald R. Ford School Of Public Policy, University Of Michigan National Poverty Center Working Paper Series  

E-Print Network (OSTI)

at the Conference "From Welfare to Child Care: What Happens to Infants and Toddlers When Single Mothers Exchange, and the National Institute of Mental Health (R24-MH51363). The authors wish to thank Sheldon Danziger, Deborah costs but not parenting stress or problems with care. It predicts earnings and work duration net

Shyy, Wei


Possibilistic clustering approach to trackless ring Pattern Recognition in RICH counters  

Science Journals Connector (OSTI)

The pattern recognition problem in Ring Imaging CHerenkov (RICH) counters concerns the identification of an unknown number of rings whose centers and radii are assumed to be unknown. In this paper we present an algorithm based on the possibilistic approach ... Keywords: 07.05.Mh, 29.40.Ka, 29.85.+c, Pattern recognition, Possibilistic clustering, RICH counters

A. M. Massone; L. Studer; F. Masulli


Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Analytical assessment of the thermal behavior of nickelemetal hydride batteries during fast charging  

E-Print Network (OSTI)

Analytical assessment of the thermal behavior of nickelemetal hydride batteries during fast to investigate transient thermal behavior of NiMH batteries. The thermal model uses integral transformation 2013 Available online 25 June 2013 Keywords: Battery thermal management Battery thermal model Fast

Bahrami, Majid


Influence of additives on the thermal behavior of nickel/metal hydride battery  

Science Journals Connector (OSTI)

This study discusses the thermal behavior of the 6.5 Ah cylinder Ni/MH hydride battery with 0.5wt% ytterbium oxide (...2O3...) in nickel electrode and 1.0wt% super absorbent polymer (SAP) in hydrogen-storage al...

Kai Yang; Jin Jing An; Shi Chen



The effect of football helmet energy absorption mechanisms on the mitigation of cervical spinal injuries: a mathematical model  

E-Print Network (OSTI)

. The variables which are used for the mathematical model are as follows: head Head acceleration [ft/sec ] 2 x totso Torso acceleration [ft/sec ] 2 head Head velocity [ft/sec] x torso Torso velocity [ft/sec] Xl?, d Head displacement [ft] mh?d Head mass [ibm...

Yung, Adelino



A Chemical Screen for Biological Small Molecule-RNA Conjugates Reveals CoA-Modified RNA  

E-Print Network (OSTI)

purification system using Flash+ silica gel columns. The 1 H and 13 C NMR spectra were recorded on a Varian addition of n-butylamine to the C4H4O3 unknown and the loss of two molecules of water (observed [M+H]+ m and were used without further purification. Flash column chromatography was carried out on a Biotage SP4

Liu, David R.


Optimization Neuroimaging'',  

E-Print Network (OSTI)

Canonical Ridge Analysis with Ridge Parameter Optimization F. ?. Nielsen, L. K. Hansen and S. C - PLS 1 = k 0 = k optimal k k = optimal k k £ £ 0 #12; Canonical Ridge Analysis with Ridge Parameter Optimization F. ?. Nielsen, L. K. Hansen and S. C. Strother The Human Brain Project, P20 MH57180 ``Spatial

Nielsen, Finn ?rup


Stable isotope geochemistry of sulfur bearing minerals and clay mineralogy of some soils and sediments in Loot Desert, central Iran  

E-Print Network (OSTI)

and sediments in Loot Desert, central Iran M.H. Farpoor a, , H.R. Krouse b a Soil Sci. Dept., Faculty of Agriculture, Shahid Bahonar Univ. of Kerman, Kerman, Iran b Department of Physics and Astronomy, the Univ technique and clay mineralogy were studied in different landforms in Loot Desert, central Iran. Four

Ahmad, Sajjad


Mid-to Late Holocene climate change: an overview Heinz Wanner a,*, Ju rg Beer b  

E-Print Network (OSTI)

from the Mid-Holocene (MH) to pre-industrial time. The redistribution of solar energy, due to orbital by a pronounced weakening of the monsoon systems in Africa and Asia and increasing dryness and desertification of the last millennium. On decadal to multi-century timescales, a worldwide coincidence between solar

Stocker, Thomas


Mid-to Late Holocene climate change: an overview Heinz Wanner a,*, Ju rg Beer b  

E-Print Network (OSTI)

forclimate changes from the Mid-Holocene (MH) to pre-industrial time. The redistribution of solar energy, due by a pronounced weakening of the monsoon systems in Africa and Asia and increasing dryness and desertification of the last millennium. On decadal to multi-century timescales, a worldwide coincidence between solar

Fortunat, Joos


Implications of near-term coal power plant retirement for SO2 and NOX, and life cycle GHG emissions  

E-Print Network (OSTI)

prices of electricity production Plant type Unit Price Nuclear ($/MWh) 16.51 Wind ($/MWh) 201 Hydro Top SO2 100 430 95 440 100 430 Top NOX 105 350 100 380 105 345 Small, inefficient 125 410 125 405 125) Manitoba Hydro Manitoba Hydro Undertaking # 57 http://www.pub.gov.mb.ca/exhibits/mh-83.pdf. (5) Sotkiewicz

Jaramillo, Paulina


Dynamic modeling of nitrogen losses in river networks unravels the coupled effects of hydrological  

E-Print Network (OSTI)

prices of electricity production Plant type Unit Price Nuclear ($/MWh) 16.51 Wind ($/MWh) 201 Hydro Top SO2 100 430 95 440 100 430 Top NOX 105 350 100 380 105 345 Small, inefficient 125 410 125 405 125) Manitoba Hydro Manitoba Hydro Undertaking # 57 http://www.pub.gov.mb.ca/exhibits/mh-83.pdf. (5) Sotkiewicz

David, Mark B.


arXiv:hep-ph/0102297v32Mar2001 Preprint typeset in JHEP style. -HYPER VERSION SCIPP-01/10  

E-Print Network (OSTI)

USA E-mail: haber@scipp.ucsc.edu Abstract: A light CP-even Higgs boson with mh 10 GeV could explain Higgs boson limit: cos( - ) = 0 8 3. CESR and LEP constraints on a light Higgs boson 8 4. Final Results

California at Santa Cruz, University of


Maternal work behavior under welfare reform: How does the transition from welfare to work affect child development?  

E-Print Network (OSTI)

welfare to work affect child development? Abstract Using data from a longitudinal sample of formerMaternal work behavior under welfare reform: How does the transition from welfare to work affect of Mental Health (R24-MH51363) to the Social Work Research Development Center on Poverty, Risk, and Mental

Shyy, Wei


Operon for Biosynthesis of Lipstatin, the Beta-Lactone Inhibitor of Human Pancreatic Lipase  

Science Journals Connector (OSTI)

...S0076-6879(09)04808-3 . 38. Rottig, M , MH Medema, K Blin, T Weber, C Rausch and O Kohlbacher. 2011. NRPSpredictor2-a Web server for predicting NRPS adenylation domain specificity. Nucleic Acids Res. 39 :W362-W367. doi: 10.1093/nar/gkr323...

Tingli Bai; Daozhong Zhang; Shuangjun Lin; Qingshan Long; Yemin Wang; Hongyu Ou; Qianjin Kang; Zixin Deng; Wen Liu; Meifeng Tao



Floodwater Chemistry in the Yolo Bypass during Winter and Spring 1998  

E-Print Network (OSTI)

Floodwater Chemistry in the Yolo Bypass during Winter and Spring 1998 Open-File Report 2007­1025 U.S. Department of the Interior U.S. Geological Survey #12;Floodwater Chemistry in the Yolo Bypass during Winter-USGS Suggested citation: Schemel, L.E., Cox, M.H., 2007, Floodwater Chemistry in the Yolo Bypass during Winter


Extremal shot noises, heavy tails and maxstable random fields.  

E-Print Network (OSTI)

Extremal shot noises, heavy tails and max­stable random fields. Clément Dombry # May 31, 2010 Abstract We consider the extremal shot noise defined by M(y) = sup{mh(y - x); (x, m) # #}, where function. Extremal shot noises naturally appear in extreme value theory as a model for spatial extremes

Recanati, Catherine


Extremal shot noises, heavy tails and max-stable random fields.  

E-Print Network (OSTI)

Extremal shot noises, heavy tails and max-stable random fields. Cl´ement Dombry May 31, 2010 Abstract We consider the extremal shot noise defined by M(y) = sup{mh(y - x); (x, m) }, where. Extremal shot noises naturally appear in extreme value theory as a model for spatial extremes and serve

Paris-Sud XI, Université de


Composite metal-hydrogen electrodes for metal-hydrogen batteries. Final report, October 1, 1993--April 15, 1997  

SciTech Connect

The purpose of this project is to develop and conduct a feasibility study of metallic thin films (multilayered and alloy composition) produced by advanced sputtering techniques for use as anodes in Ni-metal hydrogen batteries that would be deposited as distinct anode, electrolyte and cathode layers in thin film devices. The materials could also be incorporated in secondary consumer batteries (i.e. type AF(4/3 or 4/5)) which use electrodes in the form of tapes. The project was based on pioneering studies of hydrogen uptake by ultra-thin Pd-capped Nb films, these studies suggested that materials with metal-hydrogen ratios exceeding those of commercially available metal hydride materials and fast hydrogen charging and discharging kinetics could be produced. The project initially concentrated on gas phase and electrochemical studies of Pd-capped niobium films in laboratory-scale NiMH cells. This extended the pioneering work to the wet electrochemical environment of NiMH batteries and exploited advanced synchrotron radiation techniques not available during the earlier work to conduct in-situ studies of such materials during hydrogen charging and discharging. Although batteries with fast charging kinetics and hydrogen-metal ratios approaching unity could be fabricated, it was found that oxidation, cracking and corrosion in aqueous solutions made pure Nb films and multilayers poor candidates for battery application. The project emphasis shifted to alloy films based on known elemental materials used for NiMH batteries. Although commercial NiMH anode materials contain many metals, it was found that 0.24 {mu}m thick sputtered Zr-Ni films cycled at least 50 times with charging efficiencies exceeding 95% and [H]/[M] ratios of 0.7-1.0. Multilayered or thicker Zr-Ni films could be candidates for a thin film NiMH battery that may have practical applications as an integrated power source for modern electronic devices.

Ruckman, M.W.; Strongin, M.; Weismann, H. [and others



High-efficiency cross-beam magnetic electron-impact source for improved miniature Mattauch-Herzog mass spectrometer performance  

SciTech Connect

We describe a newly designed cross-beam magnetic electron-impact ion source (CBM-EI). We demonstrate its superiority in comparison with a conventional source (CB-EI) when used with a commercial miniature sector-field-type, non-scanning mass spectrometer featuring Mattauch-Herzog geometry (MH-MS) and a permanent sector-field magnet. This paper clearly shows the value of the CBM-EI for enhancing MH-MS sensitivity. Unlike secondary electron-multiplier type detectors, the pixelated detector (IonCCD Trade-Mark-Sign ) used in the commercial MH-MS has no gain. The MH-MS/IonCCD system is therefore challenged to compete with time-of-flight and quadrupole MS systems due to their higher ion transmissions and detector gains. Using the new CBM-EI, we demonstrate an instrument sensitivity increase of 20-fold to 100-fold relative to the CB-EI-equipped instrument. This remarkable signal increase by the simple addition of the magnet assembly arises from the magnet-induced gyromotion of the thermionic electrons, which vastly increases the effective path length of the electrons through the ionization region, and the collimated nature of the electron flux, which optimizes the ion transmission through the 100-{mu}m object slit of the MH-MS. Some or all of the realized sensitivity increase may be exchanged for an increase in resolution and/or mass range through the use of a narrower object slit, or for a reduction in ion-source pressure to limit quenching. The CBM-EI should facilitate development of a differentially pumped ion source to extend the lifetime of the filament, especially in otherwise intractable applications associated with oxidizing and corrosive samples.

Hadjar, O.; Fowler, W. K. [OI Analytical/CMS Field Products, 2148 Pelham Parkway, Bldg. 400, Pelham, Alabama 35124 (United States)



NA Standards | Valence Geometries | Nitrog. Bases Table 1  

NLE Websites -- All DOE Office Websites (Extended Search)

Table 1: References for Nitrogenous Base Structures Table 1: References for Nitrogenous Base Structures used in Lester Clowney, Shri C. Jain, A. R. Srinivasan, John Westbrook, Wilma K. Olson, and Helen M. Berman. "Geometric Parameters in Nucleic Acids: Nitrogenous Bases. (1996) J. Am. Chem. Soc. 118, 519-529. Cytosine -------------------------------------------------------------------------- CSD ID Compound Reference -------------------------------------------------------------------------- acytid alpha-cytidine Post, M.L., et al. Biochim. Biophys. Acta, 1977, 479, 133 bivvil 2',3'-O-(tetraisopropyl-1,3-disiloxanediyl)-cytidine Hoogendorp J.D and Romers, C Acta Cryst., 1982, B38, 2738 bofwoi 2'-deoxy-2'-fluorocytidine dihydrate Marck, C., et al. J. Mol. Struct., 1982, 82, 77



Office of Legacy Management (LM)

s72 :· j~~~~: :i--..IY.::·q: i?,. - s72 :· j~~~~: :i--..IY.::·q: i?,. - K. .71 , r~~~~~tu, : 8~~~~~~~11: ~~~~~~~ c~~~~--· ·. ;~~~w~-. Sit'V · 4 : . ~'~'.;,.~_...: .... r ;'~.; .'-. ·'4V ~ ~ ~ ~ ~ ~ ~ ~ . q,:.~ _~: :i : /,., ~'' . ~::?'';,'',,~ .. ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~: , :..: ... ;~~~~~~~~~~~~~~~~~. ~ .. % 5. .. I , ,~~ . 74K, Sl ~n v.--, 7~~~~~~~~~~~~~~~~~~~~~~~~~. :·Jd~~~~~Jil - Alvii·Pi·:ii-it -ff to.~~~ ~ fj; Apn,~~~~~~~~~;·~ ~r:: kL~~ ~~; ?.: n. W ·. ,~lT~i; ''-:L ~ Ar , i l i : I~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~'hl -A - - ~~~~~~~~~~~~~~~~~~~~~~~~~ '* , "' '~~ ,-* ' ~;' > ... -. ' ~ j· :, · 4 ?*, t ~ -*,* A m- .1... - ;:· ~ ~ ~ ~ ~ ~ ~ ~ : n; '.I; ::· ·. ;'. - ~ ;L $, ' -'~ '- , - *~~~~~~~~~~~~~~~~4~~~~~~~ f'- - ,- k-< ,''" . . . ~ '. -. '~' , -~e, '

Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

D-1 D-1 SECTION J APPENDIX D KEY PERSONNEL Name Position Doug Cooper General Manager John Donnell Repository Licensing Lead Al Ebner, PE, PhD Repository Design Lead Steve Piccolo Deputy General Manager Steve White Quality & Performance Assurance Lead George Clare Project Management & Integration Lead Mike Hitchler Preclosure Safety Analysis Lead Contract No.: DE-RW0000005 QA:QA J-D-2 POSITION DESCRIPTIONS OCRWM SPECIFIED KEY PERSONNEL 1. General Manager: Requires 10 years experience as a Senior Manager, responsible for the licensing and/or design and/or operation of a large complex nuclear facility. Must have experience as a


Corporate Board Meeting Minutes  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

th th Environmental Management Quality Assurance Corporate Board Meeting Minutes February 16, 2011 - Oak Ridge, TN Page 1 of 17 Voting Board Members in Attendance (general attendance sheet for the meeting is attached): *Greg Hayward - Idaho Robert Brown - Oak Ridge Ray Corey - Richland *Bill Rowland - Savannah River Bud Danielson -Chief of Nuclear Safety T.J. Jackson - EMCBC Ken Picha (chair) - Headquarters Acting EM-20 Russell McCallister - Portsmouth/Paducah Bob Murray (vice-chair) - Headquarters EM-23 No Voting Member Present - Carlsbad Jonathan (JD) Dowell - River Protection *Note: The by-laws require the voting member to be the Site Manager or assistant/deputy manager. The noted


Asymptotic normalization coefficients for N-14 C-13+p from C-13(He-3,d)N-14  

E-Print Network (OSTI)

-93ER40773 and by the Robert A. Welch Foundation. @1# A.M. Mukhamedzhanov, H.L. Clark, C.A. Gagliardi, Y.-W. Lui, L. Trache, R.E. Tribble, H.M. Xu, X.G. Zhou, V. Burjan, J. Cejpek, V. Kroha, and F. Carstoiu, Phys. Rev. C 56, 1302 ~1997...!, and references therein. @2# C.A. Gagliardi, R.E. Tribble, A. Azhari, H.L. Clark, Y.-W. Lui, A.M. Mukhamedzhanov, A. Sattarov, L. Trache, V. Bur- jan, J. Cejpek, V. Kroha, S? . Piskor, and J. Vincour, Phys. Rev. lished!. @8# W.W. Daehnick, J.D. Childs, and Z...

Bem, P.; Burjan, V.; Kroha, V.; Novak, J.; Piskor, S.; Simeckova, E.; Vincour, J.; Gagliardi, Carl A.; Mukhamedzhanov, AM; Tribble, Robert E.



Diagenesis of the Terry sandstone member of the Pierre Shale, Spindle field, Weld County, Colorado  

E-Print Network (OSTI)

DIAGENESIS OF THE TERRY SANDSTONE MEMBER OF THE PIERRE SHALE, SPINDLE FIELD, WELD COUNTY, COLORADO A Thesis PHILLIP DEAN HAYS Submitted to the Gradute College of Texas A&M University in partial fulfillment of the requirements for the degree... of MASTER OF SCIENCE August 1986 Major Subject: Geology DIAGNESIS OF THE TERRY SANDSTONE MEMBER OF THE PIERRE SHALE ~ SP INDLE F I ELD ~ WELD COUNTY ~ COLORADO A Thesis by PHILLIP DEAN HAYS Approved as to style and content by: -, ~jD Thomas T...

Hays, Phillip Dean



Heat transfer and pressure drop in square duct with two opposite repeated rib-roughened walls  

E-Print Network (OSTI)

HEAT TRANSFER AND PRESSURE DROP IN SQUARE DUCT WITH TWO OPPOSITE REPEATED RIB-ROUGHENED WALLS A Thesis CHIANG-KUO LEI Submitted to the Graduate College of Texas ARM University in partial fulfillment of the requirement for the degree of MASTER... OF SCIENCE December 1983 Major Subject: Mechanical Engineering HEAT TRANSFER AND PRESSURE DROP IN SQUARE DUCT WITH TWO OPPOSITE REPEATED RIB-ROUGHENED WALLS A Thesis by CHIANG-KUO LEI Approved as to style and content by: , ~p= jd~. = e-C in Han...

Lei, Chiang-Kuo



The association between community environment and cognitive function: a systematic review  

E-Print Network (OSTI)

-54. doi: 10.1093/eurpub/ckm076 23. Boardman JD, Barnes LL, Wilson RS, Evans DA, & Mendes de Leon CF (2012) Social disorder, APOE-E4 genotype, and change in cognitive function among older adults living in Chicago. Soc Sci Med 74: 1584-1590. 24. Clarke... from the English Longitudinal Study of Ageing. J Am Geriatr Soc 56: 191-198. 28. Lee BK, Glass TA, James BD, Bandeen-Roche K, & Schwartz BS (2011) Neighborhood psychosocial environment, apolipoprotein E genotype, and cognitive function in older...

Wu, Yu-Tzu; Prina, A. Matthew; Brayne, Carol



"Technical Observations on the Sculptures from the Temple of Zeus at Olympia"  

E-Print Network (OSTI)

, and 1996. 7. See, e.g., the spirited discussion in JdI 6: Furtwngler 1891; Sauer 1891a, 1891b; Treu 1891a, 1891b, 1891c. john g. younger and paul rehak44 Phases of Temple Construction The process of building a Greek temple is well known mainly from ob...dining in the sanctuary of demeter and kore 1 Volume 78 2009 Hesperia Th e J o u r na l of t h e A m e r i c a n S c ho ol of Classical Studies at Athens This article is The American School of Classical Studies at Athens...

Younger, John G.; Rehak, Paul



Morphological and Functional Stasis in Mycorrhizal Root Nodules as Exhibited by a Triassic Conifer  

E-Print Network (OSTI)

Telemachus: Evidence from the Triassic of Antarctica. Int J Plant Sci 171:560573. 22. Bergersen FJ, Costin B (1964) Root nodules of Podocarpus lawrencei and their eco- logical significance. Aust J Biol Sci 17:4448. Schwendemann et al. PNAS | August 16, 2011... evolution: analysis of nuclear 18S rRNA sequences. Mol Biol Evol 14:5668. 33. Chaw S-M, Parkinson CL, Cheng Y, Vincent TM, Palmer JD (2000) Seed plant phy- logeny inferred from all three plant genomes: Monophyly of extant gymnosperms and origin of Gnetales...

Schwendemann, Andrew Benjamin; Decombeix, Anne-Laure; Taylor, Thomas N.; Taylor, Edith L.; Krings, Michael



Effect of Model and Operating Parameters on Air Gasification of Char  

Science Journals Connector (OSTI)

Sheffield University Waste Incineration Centre (SUWIC), Department of Chemical and Process Engineering, Sheffield University, Mappin Street, Sheffield S1 3JD, United Kingdom ... It produces gaseous species such as CO, H2, and CH4 which can either be burned in a separated chamber with ultralow pollutant emissions or further synthesized into materials for the chemical industry. ... The effect on the gasification rate is very small, though, no more than 3%, and the case for ? = 0 results in a slightly higher gasifying rate than ? = 1. ...

Yao Bin Yang; ChangKook Ryu; Vida N. Sharifi; Jim Swithenbank



Diversity within Unity: Import Laws of Islamic Countries on Haram (Forbidden) Products  

E-Print Network (OSTI)

, Lawrence, KS 66045-7577 U.S.A. Tel. 785-864-9224. Fax. 785-864-5054. http://www.law.ku.edu. J.D., Harvard (1989); M.Sc., Oxford (1986); M.Sc., London School of Economics (1985); A.B., Duke (1984). Marshall Scholar (198486). Member, American Bar... of the significance of that duty.85 There was only one such country, Malaysia.86 It uses a specific duty denominated in local currency.87 Third, how should a country be treated if it has bound MFN tariffs on .Haram products at different levels, depending...

Bhala, Raj; Keating, Shannon



An ecological study of an oyster population, including selected associated organisms in West Bay, Galveston, Texas  

E-Print Network (OSTI)

11 tel Number Length mm Width mm Condition Month Measured Range Average Range Average Index 1967 June July November December 1968 January February March April May June 62 52 57 23 67 45 61 55 63 34 25-105 58 30-75 53 23-62 34... Jd e w C o IJ IU C H o O 1967 June June June June July July July July November November November December December 1 2&4 29 14 10 9 20 13 8 11 20 21 16 13 10 35-97 40-80 25-105 40-71 32-75 30-65 40-75 40...

Gillard, Robert Moore



An instrumentation package for monitoring tractor performance  

E-Print Network (OSTI)

-wheel drive JD 4440 diesel tractor was provided by Deere L Company for the duration of the TpM project. Sensors used for measuring left and right rear axle torques and d'fferential speed were installed by Deere S Company personnel. A load cell used... for measuring drawbar pull and an eight-channel Campbell digital recorder were also furnished by Deere 6 Company. In the early stages of planning instrumentation for the tractor, the TPM project received a commercially available tractor performance...

Green, Malcolm Kirk




NLE Websites -- All DOE Office Websites (Extended Search)

Expat's Expat's Guide to U.S. Taxes Hands-On Help for Americans Overseas by JANE A. BRUNO, J.D. Published by Jane A. Bruno, J.D. Palm Beach Gardens, Florida, U.S.A. N E W f o r 2 0 0 8 / 2 0 0 9 ! I n c l u d e s T h e L a t e s t T a x C h a n g e s ! Copyright 2009 Jane A. Bruno. Printed and bound in the United States of America. All rights reserved. No part of this book may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or by information storage and retrieval system - except by a reviewer who may quote brief passages in a review to be printed in a magazine or newspaper - without permission in writing from the publisher. For information, please contact Jane Bruno at janebruno1@gmail.com. First printing, 1998. Publisher's Note: This book was written in an effort to clarify and simplify the federal tax rules


Combining NASA/JPL One-Way Optical-Fiber Light-Speed Data with Spacecraft Earth-Flyby Doppler-Shift Data to Characterise 3-Space Flow  

E-Print Network (OSTI)

We combine data from two high precision NASA/JPL experiments: (i) the one-way speed of light experiment using optical fibers: Krisher T.P., Maleki L., Lutes G.F., Primas L.E., Logan R.T., Anderson J.D. and Will C.M., Phys. Rev. D, vol 42, 731-734, 1990, and (ii) the spacecraft earth-flyby doppler shift data: Anderson J.D., Campbell J.K., Ekelund J.E., Ellis J. and Jordan J.F., Phys. Rev. Lett., vol 100, 091102, 2008, to give the solar-system galactic 3-space average speed of 486km/s in the direction RA=4.29hrs, Dec=-75.0deg. Turbulence effects (gravitational waves) are also evident. Data also reveals the 30km/s orbital speed of the earth and the sun inflow component at 1AU of 42km/s and also 615km/s near the sun, and for the first time, experimental measurement of the 3-space 11.2km/s inflow of the earth. The NASA/JPL data is in remarkable agreement with that determined in other light speed anisotropy experiments, such as Michelson-Morley (1887), Miller (1933), Torr and Kolen (1981), DeWitte (1991), Cahill (2006), Munera (2007), Cahill and Stokes (2008) and Cahill (2009).

Reginald T Cahill



Stainless steel submerged arc weld fusion line toughness  

SciTech Connect

This effort evaluated the fracture toughness of austenitic steel submerged-arc weld (SAW) fusion lines. The incentive was to explain why cracks grow into the fusion line in many pipe tests conducted with cracks initially centered in SAWS. The concern was that the fusion line may have a lower toughness than the SAW. It was found that the fusion line, Ji. was greater than the SAW toughness but much less than the base metal. Of greater importance may be that the crack growth resistance (JD-R) of the fusion line appeared to reach a steady-state value, while the SAW had a continually increasing JD-R curve. This explains why the cracks eventually turn to the fusion line in the pipe experiments. A method of incorporating these results would be to use the weld metal J-R curve up to the fusion-line steady-state J value. These results may be more important to LBB analyses than the ASME flaw evaluation procedures, since there is more crack growth with through-wall cracks in LBB analyses than for surface cracks in pipe flaw evaluations.

Rosenfield, A.R.; Held, P.R.; Wilkowski, G.M. [Battelle, Columbus, OH (United States)



LaCreek Electric Assn, Inc | Open Energy Information  

Open Energy Info (EERE)

0558 0558 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes ISO Other Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Large Power Industrial Large Power Heating Industrial Outdoor Lighting HPS 100W Metered Lighting Outdoor Lighting HPS 175W Metered Lighting Outdoor Lighting Lucalox Lighting Outdoor Lighting MH 400W Lighting Outdoor Lighting MH 400W Metered Lighting Outdoor Lighting MV 100W Metered Lighting Outdoor Lighting MV 175W Lighting Outdoor Lighting MV 175W Metered Lighting Outdoor Lighting MV 400W Lighting


Amicalola Electric Member Corp | Open Energy Information  

Open Energy Info (EERE)

Amicalola Electric Member Corp Amicalola Electric Member Corp Jump to: navigation, search Name Amicalola Electric Member Corp Place Georgia Utility Id 562 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Security Lights Acorn 100 W Lighting Security Lights Acorn 150 W Lighting Security Lights Cobra 100 W Lighting Security Lights Cobra 150 W Lighting Security Lights Cobra 250 W Lighting Security Lights Cobra 400 W Lighting Security Lights Cobra MH 250 W Lighting Security Lights Cobra MH 400 W Lighting Security Lights Flood 250 W Lighting


Data:564a3135-a0a4-42c8-93cf-ca55dbcbf90c | Open Energy Information  

Open Energy Info (EERE)

a0a4-42c8-93cf-ca55dbcbf90c a0a4-42c8-93cf-ca55dbcbf90c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Algoma Utility Comm Effective date: 2008/05/28 End date if known: Rate name: Street Lighting Service - Option B - 100 W MH Sector: Lighting Description: Application: This schedule will be applied to municipal street lighting. Option B: Customer Owned and Utility Maintained. Power Cost Adjustment Clause: Charge per all kWh varies monthly. See schedule PCAC. Note: HPS = High Pressure Sodium MH = Metal Halide Source or reference: http://www.algomautilities.com/media/Electric_Rate_Tariff_Sheets.pdf


City of Hope, Arkansas (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

City of Hope City of Hope Place Arkansas Utility Id 8840 Utility Location Yes Ownership M NERC Location SPP NERC SPP Yes RTO SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Area Lighting 1000 W HPS Lighting Area Lighting 1000 W MH Lighting Area Lighting 1000 W MV Lighting Area Lighting 150 W HPS Lighting Area Lighting 175 W MV Lighting Area Lighting 250 W HPS Lighting Area Lighting 400 W HPS Lighting Area Lighting 400 W MH Lighting Area Lighting 400 W MV Lighting Large General Service (w/Demand Meter) Commercial Large Light and Power Primary Service Commercial


Data:Ac07146b-8d32-45e7-9042-85f065e602d6 | Open Energy Information  

Open Energy Info (EERE)

Ac07146b-8d32-45e7-9042-85f065e602d6 Ac07146b-8d32-45e7-9042-85f065e602d6 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Algoma Utility Comm Effective date: 2008/05/28 End date if known: Rate name: Street Lighting Service - Option A - 175 W MH Sector: Lighting Description: Application: This schedule will be applied to municipal street lighting. Option A: Utility Owned and Maintained. Power Cost Adjustment Clause: Charge per all kWh varies monthly. See schedule PCAC. Note: HPS = High Pressure Sodium MH = Metal Halide Source or reference: http://www.algomautilities.com/media/Electric_Rate_Tariff_Sheets.pdf

Note: This page contains sample records for the topic "mh demartini jd" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tri-County Elec Member Corp (Kentucky) | Open Energy Information  

Open Energy Info (EERE)

Corp (Kentucky) Corp (Kentucky) Jump to: navigation, search Name Tri-County Elec Member Corp Place Kentucky Utility Id 19162 References EIA Form EIA-861 Final Data File for 2010 - File2_2010[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 100 Watt HPS Lighting 100 Watt Induction Lighting 1000 Watt MH Lighting 103 Watt LED Lighting 175 Watt MV Lighting 200 Watt HPS Lighting 250 Watt HPS Lighting 400 Watt HPS Lighting 400 Watt MH Lighting 400 Watt MV Lighting 51 Watt LED Lighting 85 Watt Induction Lighting GSA-Part 1 Commercial GSA-Part 2 Commercial GSA-Part 3 Industrial Residential Residential Average Rates Residential: $0.0941/kWh Commercial: $0.1050/kWh


Data:Da8c4406-ba6e-4564-aa77-7003d74bee60 | Open Energy Information  

Open Energy Info (EERE)

06-ba6e-4564-aa77-7003d74bee60 06-ba6e-4564-aa77-7003d74bee60 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jefferson Electric Member Corp Effective date: 2010/11/01 End date if known: Rate name: STREET LIGHTING SERVICE ( 1000W MH - Shoebox ) Sector: Lighting Description: Additional fees for poles and transformers may apply Source or reference: ISU Documentation Source Parent: Comments Applicable only to outdoor lighting by ballast operated vapor lamp fixtures, either high pressure sodium (HPS) or metal halide (MH), and poles conforming to Cooperative specifications. Applicability Demand (kW)


RAV4 Fleet Report-Final Version.PDF  

NLE Websites -- All DOE Office Websites (Extended Search)

0-00866 0-00866 June 2000 Field Operations Program Toyota RAV4 (NiMH) Fleet Evaluation Final Report J. Francfort B. Sanchez J. Argueta J. Phung M. Wehrey INEEL/EXT-2000-00866 Field Operations Program Toyota RAV4 (NiMH) Fleet Evaluation Final Report J. Francfort 1 B. Sanchez 2 J. Argueta 2 J. Phung 2 M. Wehrey 2 Published June 2000 Idaho National Engineering and Environmental Laboratory Automotive Systems and Technology Department Idaho Falls, Idaho 83415 Prepared for the U.S. Department of Energy Assistant Secretary for Energy Efficiency and Renewable Energy Under DOE Idaho Operations Office Contract No. DE-AC07-99ID13727 1 INEEL/Bechtel BWXT Idaho, LLC. 2 Southern California Edison 1 EXECUTIVE SUMMARY The U.S. Department of Energy's Field Operations Program evaluates electric and


Data:B86ebcf3-870c-4233-9e75-a0471a221774 | Open Energy Information  

Open Energy Info (EERE)

-870c-4233-9e75-a0471a221774 -870c-4233-9e75-a0471a221774 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jefferson Electric Member Corp Effective date: 2010/11/01 End date if known: Rate name: STREET LIGHTING SERVICE ( 400W MH - Shoebox ) Sector: Lighting Description: Additional fees for poles and transformers may apply Source or reference: ISU Documentation Source Parent: Comments Applicable only to outdoor lighting by ballast operated vapor lamp fixtures, either high pressure sodium (HPS) or metal halide (MH), and poles conforming to Cooperative specifications. Applicability Demand (kW)


Data:B37ad405-1bd7-40e7-9478-baf3c053a57e | Open Energy Information  

Open Energy Info (EERE)

05-1bd7-40e7-9478-baf3c053a57e 05-1bd7-40e7-9478-baf3c053a57e No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Algoma Utility Comm Effective date: 2008/05/28 End date if known: Rate name: Street Lighting Service - Option A - 100 W MH Sector: Lighting Description: Application: This schedule will be applied to municipal street lighting. Option A: Utility Owned and Maintained. Power Cost Adjustment Clause: Charge per all kWh varies monthly. See schedule PCAC. Note: HPS = High Pressure Sodium MH = Metal Halide Source or reference: http://www.algomautilities.com/media/Electric_Rate_Tariff_Sheets.pdf


PowerPoint Presentation  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Bipolar Nickel Metal Hydride Battery Bipolar Nickel Metal Hydride Battery Development and Testing DOE ENERGY STORAGE SYSTEMS RESEARCH PROGRAM ANNUAL PEER REVIEW November 2 - 3, 2006, Washington, D.C. James Landi jlandi@electroenergyinc.com 203-797-2699 Program Objectives and Benefits  The objective of this program is to further develop the bipolar NiMH battery design to be used in high-energy and high-power energy storage applications. - Build and demonstrate large-format batteries - Demonstrate these batteries in present and future applications  The bipolar NiMH battery could provide the following benefits: - Improve efficiencies by reducing transmission peaking losses and shifting peak demands. - Reduce power and voltage sag to users. - Provide an efficient method to distribute backup energy/power


City of Duncan, Oklahoma (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Duncan, Oklahoma (Utility Company) Duncan, Oklahoma (Utility Company) Jump to: navigation, search Name City of Duncan Place Oklahoma Utility Id 5429 Utility Location Yes Ownership M NERC Location SPP NERC SPP Yes Activity Generation Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service Secondary Commercial Limited Usage General Service Secondary Commercial Power and Light Secondary Industrial Residential Service Secondary Residential Security Lighting- (1000W MH Directional Flood Lighting on existing DPUA utility Pole) Lighting Security Lighting- (1000W MH Directional Flood Lighting on existing 50 ft.


Tri-County Elec Member Corp (Tennessee) | Open Energy Information  

Open Energy Info (EERE)

Tri-County Elec Member Corp Tri-County Elec Member Corp Place Tennessee Utility Id 19162 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 100 Watt HPS Lighting 100 Watt Induction Lighting 1000 Watt MH Lighting 103 Watt LED Lighting 175 Watt MV Lighting 200 Watt HPS Lighting 250 Watt HPS Lighting 400 Watt HPS Lighting 400 Watt MH Lighting 400 Watt MV Lighting 51 Watt LED Lighting 85 Watt Induction Lighting GSA-Part 1 Commercial GSA-Part 2 Commercial GSA-Part 3 Industrial Residential Residential Average Rates


City of Lawrenceville, Georgia (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Lawrenceville Lawrenceville Place Georgia Utility Id 10800 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Retail Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png COMMERCIAL NON DEMAND Commercial LARGE POWER Commercial MEDIUM POWER Commercial RESIDENTIAL Residential SECURITY LIGHTING, HPS 100W Lighting SECURITY LIGHTING, HPS 150W Lighting SECURITY LIGHTING, HPS 250W Lighting SECURITY LIGHTING, HPS 400W Lighting SECURITY LIGHTING, MH 1000W Lighting SECURITY LIGHTING, MH 400W Lighting SECURITY LIGHTING, MV 175W Lighting SMALL POWER Commercial


City of Livingston, Texas (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Texas (Utility Company) Texas (Utility Company) Jump to: navigation, search Name City of Livingston Place Texas Utility Id 11097 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Industrial Rate Industrial Large Light and Power Commercial Large School and Government Commercial Monthly Security Light Charge Lighting Residential Residential Security Lights- 1000W MH Lighting Security Lights- 1000W MV Lighting Security Lights- 100W HPS Lighting Security Lights- 175W MV Lighting Security Lights- 400W MH Lighting


York Electric Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Electric Coop Inc Electric Coop Inc Jump to: navigation, search Name York Electric Coop Inc Place South Carolina Utility Id 21002 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Outdoor Lighting Backyard Lighting Outdoor Lighting Baxter Lighting Outdoor Lighting Shoebox 1 Light Lighting Outdoor Lighting Shoebox 2 Lights Lighting Outdoor Lighting Traditional Lighting Outdoor Lighting Ultra-Flood HPS/ MH 400 W 2 Lights Wood Pole Lighting Outdoor Lighting Ultra-Flood HPS/MH 1000 W Fiberglass Pole Lighting


City of Monroe, Georgia (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Georgia Georgia Utility Id 12800 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png COMMERCIAL DEMAND RATE Commercial COMMERCIAL NON DEMAND RATE Commercial Church Service Commercial City Electric Service Commercial Industrial Service Industrial RESIDENTIAL RATE Residential SECURITY LIGHT - 1000 Watt MH Lighting SECURITY LIGHT - 400 Watt HPS Lighting SECURITY LIGHT - 400 Watt MH Lighting SECURITY LIGHT - 150 Watt HPS Lighting SECURITY LIGHT - 150 Watt HPS (ornamental) Lighting SECURITY LIGHT - 175 Watt MV Lighting


Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

and Qualification of the Methane and Qualification of the Methane Hydrate Resource Potential Associated with the Barrow Gas Fields Kick-off Meeting Morgantown, WV January 9, 2007 Tom Walsh Presentation Outline Overview Team Project Objectives Scope of Work Schedule,Milestones, Deliverables Overview * Last Comprehensive Reservoir Study in 1991-Glenn and Allen * Postulated Presence of Methane Hydrate * Material Balance Models for East Barrow and Walakpa Fields Lend Support to Possible MH Recharge * Potential Significant Impact on Local Resource * Excellent Laboratory for MH Research Location of Study Barrow Gas Fields Participants DOE-NETL NSB PRA UAF Advisory Committee Tim Collett, Chet Paris, Bob Hunter, Bob Swenson, Shirish Patil, Richard Glenn DOE/NETL COR Robert Vagnetti NSB Project Manager Kent Grinage PRA Principal Investigator


Kenergy Corp | Open Energy Information  

Open Energy Info (EERE)

Kenergy Corp Kenergy Corp Jump to: navigation, search Name Kenergy Corp Place Kentucky Utility Id 9964 Utility Location Yes Ownership C NERC RFC Yes NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Environmental Surcharge Rider Fuel Adjustment Rider High Pressure Sodium - 200/250 Watts Lighting High Pressure Sodium - Flood Light 400 Watts Lighting LED NEMA Head - 60 Watt Lighting Light - 100 watt HPS Lighting Light - 100 watt HPS - Acorn Globe Lighting Light - 100 watt MH Lighting Light - 100 watt MH - Acorn Lighting


Altamaha Electric Member Corp | Open Energy Information  

Open Energy Info (EERE)

Altamaha Electric Member Corp Altamaha Electric Member Corp Jump to: navigation, search Name Altamaha Electric Member Corp Place Georgia Utility Id 407 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Industrial Service Industrial Irrigation Service- IRGS-8 Commercial Large Power Service- LPS Commercial Net Metering Service- NMS-8 Commercial Outdoor Security Lighting Service- SL-9 (1000W HPS-Flood) Lighting Outdoor Security Lighting Service- SL-9 (1000W MH-Flood) Lighting Outdoor Security Lighting Service- SL-9 (1000W MH-Flood) Lighting


Data:13c51b15-5cae-49e3-9ee6-400f38d52613 | Open Energy Information  

Open Energy Info (EERE)

-5cae-49e3-9ee6-400f38d52613 -5cae-49e3-9ee6-400f38d52613 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jefferson Electric Member Corp Effective date: 2010/11/01 End date if known: Rate name: STREET LIGHTING SERVICE ( 175W MH - Torch ) Sector: Lighting Description: Additional fees for poles and transformers may apply Source or reference: ISU Documentation Source Parent: Comments Applicable only to outdoor lighting by ballast operated vapor lamp fixtures, either high pressure sodium (HPS) or metal halide (MH), and poles conforming to Cooperative specifications. Applicability Demand (kW)


Data:080a0f72-aa5e-4884-8060-e7999ce0b409 | Open Energy Information  

Open Energy Info (EERE)

a0f72-aa5e-4884-8060-e7999ce0b409 a0f72-aa5e-4884-8060-e7999ce0b409 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Leavenworth-Jefferson E C, Inc Effective date: 2010/05/01 End date if known: Rate name: Street Light Rate (MH 250 W) Sector: Lighting Description: Available for municipal outdoor lighting service on public thoroughfares, city housing development, and in public parks where service can be supplied from a breaker box installed by the cooperative on existing facilities of the cooperative. Street Light Rate (MH 250 W) Source or reference: Rate Binder #7 (Illinois State University)


Village of Churchville, New York (Utility Company) | Open Energy  

Open Energy Info (EERE)

Churchville, New York (Utility Company) Churchville, New York (Utility Company) Jump to: navigation, search Name Village of Churchville Place New York Utility Id 3525 Utility Location Yes Ownership M NERC Location NPCC NERC NPCC Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial 2 Commercial Commercial wDemand 3 Commercial Outdoor Lighting 1000W MH Lighting Outdoor Lighting 150W HPS Lighting Outdoor Lighting 250W HPS Lighting Outdoor Lighting 400W MH Lighting Outdoor Lighting 400W MV Lighting Outdoor Lighting Wood Pole Rental Lighting


City of Hogansville, Georgia (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Hogansville, Georgia (Utility Company) Hogansville, Georgia (Utility Company) Jump to: navigation, search Name Hogansville City of Place Georgia Utility Id 8698 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Residential Residential Security Lights, HPS 100 Lighting Security Lights, HPS 250 Lighting Security Lights, HPS 400 Lighting Security Lights, HPS Flood 250 Lighting Security Lights, HPS Flood 400 Lighting Security Lights, MH 1000 Lighting Security Lights, MH 400 Lighting Security Lights, MV 175 Lighting



E-Print Network (OSTI)

;TCGTTTCCCTTCAGTCGCTG#7;#7;CBU2012 forward#7;CGAAGAACTGGATAGCGAAAG#7;#7; Beta-Galactosidase Assay C loned plasmids were electroporated into either BN4020 pMH15 or BN4020 pNP104 electrocompetent cells to form two plasmid heterolo ssay was performed...;#7;pMH15#7;pACYC184 with E. coli fur#7;#7;#7;pBlue TOPO#7;TA cloning vector, promoter trap#7;Invitrogen#7;#7;pNP104#7;pACYC184 with complete C. burnetii fur#7;This work#7;#7;BN4020#7;E. coli fur deletion strain#7;This work#7;#7; Table 2. List of all...

Wilson, Mary J
