Powered by Deep Web Technologies
Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Thermal behavior simulation of Ni/MH battery  

Science Journals Connector (OSTI)

Thermal behavior of overcharged Ni/MH battery is studied with microcalorimeter. The battery is installed in a special device in ... Quantity of heat and heat capacity of the battery charged at different state of ...

DaHe Li; Kai Yang; Shi Chen; Feng Wu

2009-05-01T23:59:59.000Z

2

Electric Automobile Ni-MH Battery Investigation in Diverse Situations  

Science Journals Connector (OSTI)

Abstract The electronic differential system ensures the robust control of the vehicle comportment on the road. This paper focuses Ni-MH Battery controlled by Buck Boost DC-DC converter power supply for EV. Sliding mode control based on space vector modulation (SVM-SMC) is proposed to achieve the tow rear driving wheel control. The performances of the proposed strategy controller give a satisfactory simulation results. The proposed control law increases the utility EV autonomous under several speed variations. Moreover, the future industrial's vehicle must take into considerations the battery material choice into design steps. The battery material model choice is a crucial item, and thanks to an increasing emphasis on vehicle range and performance, the Ni-MH battery could become a viable candidate that's our proposal battery model in the present work, in this way the present paper show a novel strategy of electric automobile (EA) power electronics studies when the current battery take into account the impact of the sliding mode control based onspace vector machine technique in the several speed variations using the primitive battery SOC of 60% state.

Brahim Mebarki; Belkacem Draoui; Lakhdar Rahmani; Boumedine Allaoua

2013-01-01T23:59:59.000Z

3

Thermal analysis of nickel/metal (Ni/MH) hydride battery during charge cycle  

Science Journals Connector (OSTI)

A three-dimensional mathematical model containing temporal and spatial coordinates is presented for analyzing the thermal behavior and obtaining the internal temperature profile of cylindrical Ni/MH battery. This model is performed to investigate the ... Keywords: Ni/MH battery, charge, heat transfer coefficient, thermal analysis

Nabi Jahantigh; Ebrahim Afsharia

2008-02-01T23:59:59.000Z

4

mHealth and global mental health: still waiting for the mH2 wedding?  

Science Journals Connector (OSTI)

The conjunction of high levels of mental illness and high levels of mobile phone usage in poorer countries highlights the potential for mH2 interventions i.e. mHealth (mobile technology-based) mental health i...

Conor Farrington; Angela Aristidou; Kai Ruggeri

2014-03-01T23:59:59.000Z

5

Photothermal Response in Dual-Gated Bilayer Graphene M.-H. Kim,1  

E-Print Network [OSTI]

Photothermal Response in Dual-Gated Bilayer Graphene M.-H. Kim,1 J. Yan,1,2 R. J. Suess,3 T. E photoresponse in gapped bilayer graphene was investigated by optical and transport measurements. A pulse There is growing recognition that graphene has excep- tional potential as a new optoelectronic material, which has

Murphy, Thomas E.

6

THE MODULUS OF CONTINUITY FOR 0(m)\\H SEMI-CLASSICAL LIMITS  

E-Print Network [OSTI]

THE MODULUS OF CONTINUITY FOR 0(m)\\H SEMI-CLASSICAL LIMITS SCOTT A. WOLPERT Abstract. We study [13]. In [29] the author found that the microlocal lift to SL(2; R) S (H)1/2 of automorphic eigen result is equivalent to a limit-sum formula combining the Riemann zeta values (1 + it) and the elemen

Wolpert, Scott A.

7

Complete genome sequence of Hippea maritima type strain (MH2T)  

SciTech Connect (OSTI)

Hippea maritima (Miroshnichenko et al. 1999) is the type species of the genus Hippea, which belongs to the family Desulfurellaceae within the class Deltaproteobacteria. The anaerobic, moderately thermophilic marine sulfur-reducer was first isolated from shallow-water hot vents in Matipur Harbor, Papua New Guinea. H. maritima was of interest for genome se- quencing because of its isolated phylogenetic location, as a distant next neighbor of the ge- nus Desulfurella. Strain MH2T is the first type strain from the order Desulfurellales with a com- pletely sequenced genome. The 1,694,430 bp long linear genome with its 1,723 protein- coding and 57 RNA genes consists of one circular chromosome and is a part of the Genomic Encyclopedia of Bacteria and Archaea project.

Huntemann, Marcel [U.S. Department of Energy, Joint Genome Institute; Lu, Megan [Los Alamos National Laboratory (LANL); Nolan, Matt [U.S. Department of Energy, Joint Genome Institute; Lapidus, Alla L. [U.S. Department of Energy, Joint Genome Institute; Lucas, Susan [U.S. Department of Energy, Joint Genome Institute; Hammon, Nancy [U.S. Department of Energy, Joint Genome Institute; Deshpande, Shweta [U.S. Department of Energy, Joint Genome Institute; Cheng, Jan-Fang [U.S. Department of Energy, Joint Genome Institute; Tapia, Roxanne [Los Alamos National Laboratory (LANL); Han, Cliff [Los Alamos National Laboratory (LANL); Goodwin, Lynne A. [Los Alamos National Laboratory (LANL); Pitluck, Sam [U.S. Department of Energy, Joint Genome Institute; Liolios, Konstantinos [U.S. Department of Energy, Joint Genome Institute; Pagani, Ioanna [U.S. Department of Energy, Joint Genome Institute; Ivanova, N [U.S. Department of Energy, Joint Genome Institute; Ovchinnikova, Galina [U.S. Department of Energy, Joint Genome Institute; Pati, Amrita [U.S. Department of Energy, Joint Genome Institute; Chen, Amy [U.S. Department of Energy, Joint Genome Institute; Palaniappan, Krishna [U.S. Department of Energy, Joint Genome Institute; Land, Miriam L [ORNL; Hauser, Loren John [ORNL; Jeffries, Cynthia [Oak Ridge National Laboratory (ORNL); Detter, J. Chris [U.S. Department of Energy, Joint Genome Institute; Brambilla, Evelyne-Marie [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Rohde, Manfred [HZI - Helmholtz Centre for Infection Research, Braunschweig, Germany; Spring, Stefan [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Goker, Markus [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Woyke, Tanja [U.S. Department of Energy, Joint Genome Institute; Bristow, James [U.S. Department of Energy, Joint Genome Institute; Eisen, Jonathan [U.S. Department of Energy, Joint Genome Institute; Markowitz, Victor [U.S. Department of Energy, Joint Genome Institute; Hugenholtz, Philip [U.S. Department of Energy, Joint Genome Institute; Kyrpides, Nikos C [U.S. Department of Energy, Joint Genome Institute; Klenk, Hans-Peter [DSMZ - German Collection of Microorganisms and Cell Cultures GmbH, Braunschweig, Germany; Mavromatis, K [U.S. Department of Energy, Joint Genome Institute

2011-01-01T23:59:59.000Z

8

An experimental and modeling study of isothermal charge/discharge behavior of commercial NiMH cells  

E-Print Network [OSTI]

is used to predict and compare various charge algorithms so as to provide guidelines for application and hybrid-electric vehicles. For clean transportation, Ni­MH battery is presently the most promising battery evolution reaction was coupled with main electro- chemical reactions on both electrodes. A sensitivity

9

Evaluation of Zr(Ni, Mn){sub 2} Laves phase alloys as negative active material for Ni-MH electric vehicle batteries  

SciTech Connect (OSTI)

Laves phase alloys of compositions (Zr, Ti)(Ni, Mn, M){sub x} where M = Cr, V, Co, Al, and 1.9 < x < 2.1 with hexagonal C14 or cubic C15 structure have been studied in order to select the most suitable AB{sub 2} alloys as an active material for nickel-metal hydride (Ni-MH) batteries. With the selected alloy, feasibility of MH negative electrodes using industrial technology and containing more than 97% of the alloy powder has been demonstrated. 22 Ah Ni-MH batteries for electric vehicle application have been assembled, and 600 cycles have been achieved at steady C/3 charge and discharge rates and 80% depth of discharge.

Knosp, B. [Alcatel Alsthom Recherche, Marcoussis (France); Jordy, C.; Blanchard, P. [SAFT Research Dept., Marcoussis (France); Berlureau, T. [SAFT Advanced and Industrial Battery Div., Bordeaux (France)

1998-05-01T23:59:59.000Z

10

Bilayer Graphene Photon Detector J. Y. Yan, M.-H. Kim, J. A. Elle, A. B. Sushkov, G. S. Jenkins, H. M. Milchberg  

E-Print Network [OSTI]

Bilayer Graphene Photon Detector J. Y. Yan, M.-H. Kim, J. A. Elle, A. B. Sushkov, G. S. Jenkins, H in graphene suggests that "hot electrons" created by incident light can provide the basis for a fast graphene in a "dual-gated" structure. This new "bolometer" has ultralow noise, besting existing detectors

Shapiro, Benjamin

11

HANGER\MH  

Broader source: Energy.gov (indexed) [DOE]

MASON & HANGER CORPORATION MASON & HANGER CORPORATION February 10, 1998 U. S. Department of Energy Office of General Counsel, GC-52 1000 Independence Ave. SW. Washington, DC 20585 Subject: Reply comments to notice of inquiry concerning preparation of report to Congress on the Price-Anderson Act Dear Sir or Madam: Mason & Hanger Corporation has reviewed the Federal Register Notice published December 31, 1997. It is our intent to offer the attached replies to the listed questions contained in the Notice. Thank you for the opportunity to provide input to the report preparation process. Please contact myself or Alan G. Wagner, Esq. at (806) 477-7233 if you have any questions. Very truly yours,

12

zhang-mh-99.PDF  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

this work: David Randall, Kuanman Xu, Steve Ghan, Chris Doran, Steve Krueger, and James Hack. This research is supported by the U.S. Department of Energy (DOE) ARM Program under...

13

メタンハイドレート資源開発研究コンソーシアム 平成23年度事業報告 平成24年度事業計画 (概要) MH21プロジェクトリーダー 増田 昌敬  

Broader source: Energy.gov (indexed) [DOE]

First Offshore MH Production Test First Offshore MH Production Test Takami Kawamoto JOGMEC June 7, 2013 1 機密性○ To conduct studies to establish the technological platform for commercialization of methane hydrate *Preparatory study for commercial production *Feasibility *Environmental Impacts *Overall evaluation of the total Program etc. Offshore Production Tests * 1 st Production Test - FY2012 * 2 nd Production Test - FY2014 Technological Studies * Designing and Manufacturing Systems for Flow Test * Studying Production Methods * Assessing Environmental Impacts * Resource Assessments Onshore Production Tests ・1 st Production Test 2002 ・ 2 nd Production Test in 2008 Resource Assessment in Eastern Nankai Trough ・Seismic

14

MH4D Development Plasma Science and Innovation Center  

E-Print Network [OSTI]

-parallel periodic boundaries ­ Operator matrix b.c. · Atomic physics development ­ Spheromak simulations · Other Development Phase II 16 · Spheromak t

15

`.h -WJR-94-3MH? Submitted k  

E-Print Network [OSTI]

demand for new cost-efficient drilling in geothermal environments, a three year rock melting program. CORT JOEN c. ROWLEY KENNETHWOLHLETZ I WORLDGEOTEERMM CONGRESS 1995 INTERNATIONAL GEOTHERMAL ASSOCIATIONOrSt@d by the UnlVOr81tyof Calttorma for the u,S, oe~flrnent of Energy under contract W. 7405. ENG.3& Etyacceptance

16

Microsoft Word - 150121_NPR3_Programmatic_Agreement_AG_MH  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

appropriate web hosting site. 3. The audio file will be an audio recording of the website material. 4. The smart phone application will be the development of material appropriate...

17

Microsoft PowerPoint - 2nd Qtr 2010 Presentation _compressed tt mh.ppt [Compatibility Mode]  

Office of Legacy Management (LM)

Second Quarter 2010 Second Quarter 2010 Surveillance and Maintenance Report for the LM Rocky Flats Site 2 Surface Water Monitoring and Operations Second Quarter 2010 3 Pond Operations - Second Quarter 2010 Terminal Pond Discharges: * Pond A-4: May 1 through May 19, 2010, 32.4 MG * Pond B-5: April 23 through May 16, 2010, 20.8 MG Transfers: * A-3 to A-4: intermittently during the quarter; total of 24.2 MG Pond Levels: * As of June 1, 2010, Ponds A-3, A-4, B-5, and C-2 and the Landfill Pond were holding approximately 19.6 MG (19.8 percent of capacity) November 1, 2010, Pond Levels * Landfill (20.5 percent) * A-3 (0.4 percent) * A-4 (23.4 percent) * B-5 (21.7 percent) * C-2 (2.4 percent) 4 Hydrologic Data - Second Quarter 2010 Precipitation * 6.65 inches total precipitation * 122 percent of WY 1993-2009 average

18

M(^/H\\ Ris-R-437 ^\\\\j) P a r t  

E-Print Network [OSTI]

as to their vulnerability to a given radioactive contamination. The variability of the concentrations of a radionuclide variability with time is a useful way to assess the route of contamination of the sample and the local variability is ^ measure of environmental inhomogenity with respect to radioac- tive contamination

19

he U.S. Coast Guard expects all of its Sikorsky Aircraft MH-60T  

E-Print Network [OSTI]

to have an Aircraft Diagnostic Vibration Management System (ADVMS) installed by 2018. It chose Honeywell also save Vol. 59, No. 3 1 The U.S.Coast Guard selected Honeywell late last year to supply the Aircraft

Almor, Amit

20

Stresa, Italy, 25-27 April 2007 NI-MH BATTERY MODELLING FOR AMBIENT INTELLIGENCE APPLICATIONS  

E-Print Network [OSTI]

, to make comparisons and eventually for the simulations there is a need for a proper battery model and MEMS actuators use mobile power supplies to ensure energy for their operation. These are mostly and lower power consumption. Today even software developers have to take also the battery-aware system

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Mining Configurable Enterprise Information M.H. Jansen-Vullers a  

E-Print Network [OSTI]

. Rosemann b aDepartment of Technology Management, Eindhoven University of Technology, P.O. Box 513, NL-5600 MB, Eindhoven, The Netherlands bFaculty of Information Technology, Queensland University of Technology, 126 Margaret Street Brisbane Qld 4000, Australia Abstract Process mining is the extraction

van der Aalst, Wil

22

LaNi{sub 5}-based metal hydride electrode in Ni-MH rechargeable cells  

DOE Patents [OSTI]

An at least ternary metal alloy of the formula AB{sub (Z-Y)}X{sub (Y)} is disclosed. In this formula, A is selected from the rare earth elements, B is selected from the elements of Groups 8, 9, and 10 of the Periodic Table of the Elements, and X includes at least one of the following: antimony, arsenic, germanium, tin or bismuth. Z is greater than or equal to 4.8 and less than or equal to 6.0. Y is greater than 0 and less than 1. Ternary or higher-order substitutions to the base AB{sub 5} alloys that form strong kinetic interactions with the predominant metals in the base metal hydride are used to form metal alloys with high structural integrity after multiple cycles of hydrogen sorption. 16 figs.

Bugga, R.V.; Fultz, B.; Bowman, R.; Surampudi, S.R.; Witham, C.K.; Hightower, A.

1999-03-30T23:59:59.000Z

23

TOPOGRAPHIC DATA FOR DEBRIS FLOWS -IMPLICATIONS FOR PLANETARY MODELING Bulmer, M.H., 2  

E-Print Network [OSTI]

, slope angles, flood-lines and boulder positions were also measured. The geometry of the channel both contains a range of coarse- sized materials with boulders up to 10 m on a side, some of which are from and boulders down to clay and silt. Based on measurements on an air photo the main deposit L (d3 to d4) is 311

Bourke, Mary C.

24

ELECTRON TRANSPORT AND SECONDARY EMISSION IN A SURFACE OF SOLAR CELL P. Degond, R. Talaalout, M.-H. Vignal  

E-Print Network [OSTI]

of the solar cells. According to recent publications, the trigger of electric arcs involves the creation. They proposed a numerical model for the mechanism of the electric arc formation. The simulation, which are based 31062 Toulouse cedex 4 31077 Toulouse cedex 4 Abstract -- We study the primary discharge of a solar cell

Vignal, Marie-Hélène

25

City of Rocky Mount, North Carolina (Utility Company) | Open Energy  

Open Energy Info (EERE)

Mount, North Carolina (Utility Company) Mount, North Carolina (Utility Company) Jump to: navigation, search Name City of Rocky Mount Place North Carolina Utility Id 16226 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes ISO Other Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Area Lighting - 1000W MH Lighting Area Lighting - 1000W MV Lighting Area Lighting - 100W MH Lighting Area Lighting - 100W MH (SE) Lighting Area Lighting - 100W SV Lighting Area Lighting - 100W SV (SE) Lighting Area Lighting - 1500W MH Lighting Area Lighting - 150W SV Lighting Area Lighting - 175W MH Lighting

26

LaCreek Electric Assn, Inc | Open Energy Information  

Open Energy Info (EERE)

0558 0558 Utility Location Yes Ownership C NERC Location MRO NERC MRO Yes ISO Other Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Large Power Industrial Large Power Heating Industrial Outdoor Lighting HPS 100W Metered Lighting Outdoor Lighting HPS 175W Metered Lighting Outdoor Lighting Lucalox Lighting Outdoor Lighting MH 400W Lighting Outdoor Lighting MH 400W Metered Lighting Outdoor Lighting MV 100W Metered Lighting Outdoor Lighting MV 175W Lighting Outdoor Lighting MV 175W Metered Lighting Outdoor Lighting MV 400W Lighting

27

Development and Interfacial Characterization of Co/Mg Periodic Multilayers for the EUV K. Le Guen,* M.-H. Hu, J.-M. Andre, and P. Jonnard  

E-Print Network [OSTI]

and the formation of compounds at the metal-metal interfaces, we consider the introduction of boron carbide at one over a period of time of three months. The introduction of thin boron carbide interfacial layers proves

28

2130 Fulton Street MH 113 San Francisco, CA 94117 somundergrad@usfca.edu www.usfca.edu/management Bachelor of Science in Management  

E-Print Network [OSTI]

) Foundations of Communication (8 credits) ___ A1. Public Speaking (4 credits) ___ A2. Rhetoric and Composition and Performing Arts (4 credits) ___ F. Visual & Performing Arts (4 credits) ___ Cultural Diversity (fulfilled 2013 may submit ISA essay on or before the August 15, 2014 5:00 PM deadline. General Electives (to

Galles, David

29

ABSTRACT : To 1992 o Borcherds eis gage mia na kathgora algbrwn Lie mh peperasmnhc distashc, tic genikeumnec lgebrec Kac-Moody. Autc oi lgebrec qoun pollc omoithtec  

E-Print Network [OSTI]

, tic genikeumènec lgebrec Kac-Moody. Autèc oi lgebrec èqoun pollèc omoiìthtec me tic lgebrec Kac

Beligiannis, Apostolos

30

Leavenworth-Jefferson E C, Inc | Open Energy Information  

Open Energy Info (EERE)

Leavenworth-Jefferson E C, Inc Leavenworth-Jefferson E C, Inc Jump to: navigation, search Name Leavenworth-Jefferson E C, Inc Place Kansas Utility Id 10801 Utility Location Yes Ownership C NERC Location SPP Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Outdoor Area Lighting Service (HPS 100 W) Lighting Outdoor Area Lighting Service (HPS 250 W) Lighting Outdoor Area Lighting Service (HPS 400 W) Lighting Outdoor Area Lighting Service (MH 100 W) Lighting Outdoor Area Lighting Service (MH 250 W) Lighting Outdoor Area Lighting Service (MH 400 W) Lighting Outdoor Area Lighting Service (MV 175 W) Lighting

31

City of Siloam Springs, Arkansas (Utility Company) | Open Energy  

Open Energy Info (EERE)

Arkansas (Utility Company) Arkansas (Utility Company) Jump to: navigation, search Name City of Siloam Springs Place Arkansas Utility Id 17184 Utility Location Yes Ownership M NERC Location SPP NERC SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Commercial Commercial - All Electric Rate Commercial Large Power Industrial Large Power Transformer Discount Industrial Residential Residential Residential - All Electric Residential Security Lighting 1000 W MH Lighting Security Lighting 150-175 W MH Lighting Security Lighting 400 W MH Lighting Small Power Industrial

32

City of Hope, Arkansas (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

City of Hope City of Hope Place Arkansas Utility Id 8840 Utility Location Yes Ownership M NERC Location SPP NERC SPP Yes RTO SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Area Lighting 1000 W HPS Lighting Area Lighting 1000 W MH Lighting Area Lighting 1000 W MV Lighting Area Lighting 150 W HPS Lighting Area Lighting 175 W MV Lighting Area Lighting 250 W HPS Lighting Area Lighting 400 W HPS Lighting Area Lighting 400 W MH Lighting Area Lighting 400 W MV Lighting Large General Service (w/Demand Meter) Commercial Large Light and Power Primary Service Commercial

33

Data:Ac07146b-8d32-45e7-9042-85f065e602d6 | Open Energy Information  

Open Energy Info (EERE)

Ac07146b-8d32-45e7-9042-85f065e602d6 Ac07146b-8d32-45e7-9042-85f065e602d6 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Algoma Utility Comm Effective date: 2008/05/28 End date if known: Rate name: Street Lighting Service - Option A - 175 W MH Sector: Lighting Description: Application: This schedule will be applied to municipal street lighting. Option A: Utility Owned and Maintained. Power Cost Adjustment Clause: Charge per all kWh varies monthly. See schedule PCAC. Note: HPS = High Pressure Sodium MH = Metal Halide Source or reference: http://www.algomautilities.com/media/Electric_Rate_Tariff_Sheets.pdf

34

City of Lawrenceville, Georgia (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Lawrenceville Lawrenceville Place Georgia Utility Id 10800 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Retail Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png COMMERCIAL NON DEMAND Commercial LARGE POWER Commercial MEDIUM POWER Commercial RESIDENTIAL Residential SECURITY LIGHTING, HPS 100W Lighting SECURITY LIGHTING, HPS 150W Lighting SECURITY LIGHTING, HPS 250W Lighting SECURITY LIGHTING, HPS 400W Lighting SECURITY LIGHTING, MH 1000W Lighting SECURITY LIGHTING, MH 400W Lighting SECURITY LIGHTING, MV 175W Lighting SMALL POWER Commercial

35

City of Livingston, Texas (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Texas (Utility Company) Texas (Utility Company) Jump to: navigation, search Name City of Livingston Place Texas Utility Id 11097 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Industrial Rate Industrial Large Light and Power Commercial Large School and Government Commercial Monthly Security Light Charge Lighting Residential Residential Security Lights- 1000W MH Lighting Security Lights- 1000W MV Lighting Security Lights- 100W HPS Lighting Security Lights- 175W MV Lighting Security Lights- 400W MH Lighting

36

Data:13c51b15-5cae-49e3-9ee6-400f38d52613 | Open Energy Information  

Open Energy Info (EERE)

-5cae-49e3-9ee6-400f38d52613 -5cae-49e3-9ee6-400f38d52613 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jefferson Electric Member Corp Effective date: 2010/11/01 End date if known: Rate name: STREET LIGHTING SERVICE ( 175W MH - Torch ) Sector: Lighting Description: Additional fees for poles and transformers may apply Source or reference: ISU Documentation Source Parent: Comments Applicable only to outdoor lighting by ballast operated vapor lamp fixtures, either high pressure sodium (HPS) or metal halide (MH), and poles conforming to Cooperative specifications. Applicability Demand (kW)

37

Cullman Power Board | Open Energy Information  

Open Energy Info (EERE)

Board Board Jump to: navigation, search Name Cullman Power Board Place Alabama Utility Id 4617 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Outdoor Lights 100 W HPS Lighting Outdoor Lights 175 W MV Lighting Outdoor Lights 400 W MV Lighting Residential Residential Security Light Service 1000 W MH Lighting Security Light Service 250 W HPS Flood Lighting Security Light Service 250 W MH Lighting Security Light Service 400 W HPS Lighting Security Light Service 400 W HPS Flood Lighting

38

Town of Forest City, North Carolina (Utility Company) | Open Energy  

Open Energy Info (EERE)

North Carolina (Utility Company) North Carolina (Utility Company) Jump to: navigation, search Name Town of Forest City Place North Carolina Utility Id 6580 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Operates Generating Plant Yes Activity Generation Yes Activity Buying Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 1000W DIRECTIONAL MH SECURITY LIGHT RATE - 105 Lighting 100W HPS SECURITY LIGHT RATE - 87 Lighting 175 W MV SECURITY LIGHT RATE - 81 Lighting 250W HPS SECURITY LIGHT RATE - 92 Lighting 400W DIRECTIONAL MH SECURITY LIGHT RATE - 104 Lighting

39

Diverse Power Incorporated | Open Energy Information  

Open Energy Info (EERE)

Diverse Power Incorporated Diverse Power Incorporated Jump to: navigation, search Name Diverse Power Incorporated Place Georgia Utility Id 19219 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Electric Service Commercial General Electric Service* Commercial Outdoor Lighting HPS 100 W Lighting Outdoor Lighting HPS 150 W Lighting Outdoor Lighting HPS 250 W Lighting Outdoor Lighting HPS 400 W Lighting Outdoor Lighting MH 1000 W Lighting Outdoor Lighting MH 400 W Lighting Outdoor Lighting MV 175 W Lighting

40

Data:8528a9dd-9b7c-4f63-bc00-065e48d37e29 | Open Energy Information  

Open Energy Info (EERE)

dd-9b7c-4f63-bc00-065e48d37e29 dd-9b7c-4f63-bc00-065e48d37e29 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Algoma Utility Comm Effective date: 2008/05/28 End date if known: Rate name: Street Lighting Service - Option B - 175 W MH Sector: Lighting Description: Application: This schedule will be applied to municipal street lighting. Option B: Customer Owned and Utility Maintained. Power Cost Adjustment Clause: Charge per all kWh varies monthly. See schedule PCAC. Note: HPS = High Pressure Sodium MH = Metal Halide Source or reference: http://www.algomautilities.com/media/Electric_Rate_Tariff_Sheets.pdf

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Computers M~h. Applic. Vol. 21, No. 10, pp. 39-52, 1991 0097-4943/91 $3.00 + 0.00 Printed in Great Britain. All rights reserved Copyright(~ 1991 Pergamon Press plc  

E-Print Network [OSTI]

Britain. All rights reserved Copyright(~ 1991 Pergamon Press plc SYMMETRY IN ATOMIC AND MOLECULAR SYSTEMS

Berry, R. Stephen

42

Electro-Refractive Low Loss MMI-Coupled Ring M.H. Kwakernaak,A.N. Lepore, H. Mohseni, H. An, Z.A. Shellenbarger,J.H. Abeles  

E-Print Network [OSTI]

.C. Connolly,M. King "Low-threshold InGaAsP ring lasers fabricated using bi-level dry etching", IEEE Photon in active discs using electro-absorption[2]. We report the first demonstrationof electro

Rommel, Sean

43

City of Fairhope, Alabama (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Fairhope, Alabama (Utility Company) Fairhope, Alabama (Utility Company) Jump to: navigation, search Name Fairhope City of Place Alabama Utility Id 6145 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Commercial Eleemosynary M2 Commercial Eleemosynary M2I Commercial Eleemosynary M3: City Use Commercial Industrial Industrial Residential Residential Schools Commercial Security Light 100 W HPS Lighting Security Light 150 W HPS Lighting Security Light 175 W MH or MV Lighting

44

Data:9e7233f6-730f-4c26-bdfb-365e4b1f8c14 | Open Energy Information  

Open Energy Info (EERE)

f6-730f-4c26-bdfb-365e4b1f8c14 f6-730f-4c26-bdfb-365e4b1f8c14 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jackson Electric Member Corp Effective date: End date if known: Rate name: Outdoor Lighting Decashield MH 175 W Non Wood Pole Sector: Lighting Description: Source or reference: http://www.jacksonemc.com/business-manage-my-account-commercial-rates-options/schedules/outdoor-lighting-service Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service

45

Data:0a12114f-2370-4281-9fd8-391c2c81d860 | Open Energy Information  

Open Energy Info (EERE)

2114f-2370-4281-9fd8-391c2c81d860 2114f-2370-4281-9fd8-391c2c81d860 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Woodruff Electric Coop Corp Effective date: 2012/10/24 End date if known: Rate name: Outdoor lighting - Street Lights 175 W MH Sector: Lighting Description: To unmetered automatically controlled outdoor lighting service burning all night. Source or reference: Illinois State University Archive Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V):

46

Data:Dea75df5-1338-4a6f-af26-0cfb847da8ba | Open Energy Information  

Open Energy Info (EERE)

Dea75df5-1338-4a6f-af26-0cfb847da8ba Dea75df5-1338-4a6f-af26-0cfb847da8ba No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Woodruff Electric Coop Corp Effective date: 2012/10/24 End date if known: Rate name: Outdoor lighting - Security Lamps 175 W MH Sector: Lighting Description: To unmetered automatically controlled outdoor lighting service burning all night. Source or reference: Illinois State University Archive Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V):

47

Data:9db3c007-c0aa-491b-ae00-bfdd08bc40cd | Open Energy Information  

Open Energy Info (EERE)

7-c0aa-491b-ae00-bfdd08bc40cd 7-c0aa-491b-ae00-bfdd08bc40cd No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Lee County Electric Coop, Inc Effective date: 2008/07/01 End date if known: Rate name: Public Street and Highway Lighting Service- Cooperative Owned Decorative Fixture (175W MH) Sector: Lighting Description: Applicable to customers, under the qualification Street Light Districts and governmental agencies for automatically controlled dusk-to-dawn outdoor lighting where existing overhead secondary circuits are located. Source or reference: https://www.lcec.net/pdf/EntireRateTariff.pdf#page=18

48

Data:A15976ec-b4bf-4b04-ae8e-581bf4eac88f | Open Energy Information  

Open Energy Info (EERE)

ec-b4bf-4b04-ae8e-581bf4eac88f ec-b4bf-4b04-ae8e-581bf4eac88f No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Lee County Electric Coop, Inc Effective date: 2008/07/01 End date if known: Rate name: Private Area Lighting- Decorative Fixture (175W MH) Sector: Lighting Description: Applicable to customers, other than Street Light Districts, for automatically controlled dusk-to-dawn outdoor lighting where existing overhead secondary circuits are located. Source or reference: https://www.lcec.net/pdf/EntireRateTariff.pdf#page=18 Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW):

49

City of Palmetto, Georgia (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Georgia (Utility Company) Georgia (Utility Company) Jump to: navigation, search Name City of Palmetto Place Georgia Utility Id 14396 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Large Commercial Commercial Residential Electric Rates Residential Security Lighting Service 100 W HPSV Lighting Security Lighting Service 250 W HPSV Lighting Security Lighting Service 400W HPSV Lighting Security Lighting Service 400W MV Lighting Security Lighting Service- 1000 W MH Lighting Security Lighting Service- 175W MV Lighting

50

Ozark Electric Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Ozark Electric Coop Inc Ozark Electric Coop Inc Place Missouri Utility Id 14288 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Multi-Phase (Less Than 125 kW) Commercial Commercial Single-Phase Commercial Large Power (Industrial) Industrial Outdoor Lighting HPS 100 W Lighting Outdoor Lighting HPS 1000 W Lighting Outdoor Lighting MH 400 W Lighting Outdoor Lighting MV 175 W Lighting Residential Single Phase (Planned Subdivision) Residential Residential Single Phase (Under 75 kW) Residential

51

Tahlequah Public Works Auth | Open Energy Information  

Open Energy Info (EERE)

Tahlequah Public Works Auth Tahlequah Public Works Auth Jump to: navigation, search Name Tahlequah Public Works Auth Place Oklahoma Utility Id 18433 Utility Location Yes Ownership M NERC Location SPP NERC SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Academic Commercial City Services Commercial Large Commercial LC-1 Commercial Large Commercial LC-2 Commercial Large Commercial LC-3 Commercial Northeastern State University Commercial Outdoor Lighting MH 400 W Lighting Outdoor Lighting MV 175 W Lighting Outdoor Lighting MV 250 W Lighting Residential Residential

52

Escambia River Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Escambia River Elec Coop, Inc Escambia River Elec Coop, Inc Jump to: navigation, search Name Escambia River Elec Coop, Inc Place Florida Utility Id 5964 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Athletic Field Lighting- AL Commercial General Service Demand- GSD Commercial General Service Time of Use- GS TOU Commercial General Service- GS Commercial Outdoor Lighting- LS (100 W HPS) Lighting Outdoor Lighting- LS (175 W MH/MV) Lighting Outdoor Lighting- LS (250 W HPS-CH) Lighting Outdoor Lighting- LS (250 W HPS-Dir) Lighting

53

Data:3066feb1-297c-4bd3-afb8-f604b961bcfb | Open Energy Information  

Open Energy Info (EERE)

feb1-297c-4bd3-afb8-f604b961bcfb feb1-297c-4bd3-afb8-f604b961bcfb No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Springfield, Oregon (Utility Company) Effective date: 2013/05/01 End date if known: Rate name: Street Lighting 175 W MH Opt. 1 L-1 Sector: Lighting Description: Option 1 refers to a Customer owned and installed fixture. The fixed monthly charge covers energy, operation and fixture maintenance fees. Possible Additional Fees include: Transfer of a street light, mast arm, overhead conductor, and conductor support to a new pole, and make necessary electrical connection: $175 each.

54

Data:71ed6bbb-bcbc-4c99-97b4-33d24ddc5f27 | Open Energy Information  

Open Energy Info (EERE)

bbb-bcbc-4c99-97b4-33d24ddc5f27 bbb-bcbc-4c99-97b4-33d24ddc5f27 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Two Rivers Water & Light Effective date: 2011/01/01 End date if known: Rate name: Security Lighting- 175W MH Sector: Lighting Description: This schedule will be applied to municipal street lighting. The utility will furnish, install, and maintain street lighting units. The lighting pole charge applies if the lamp is on a dedicated pole that is not used to support the utility distribution system. Pole Charge: $3.00 per pole, per month. The Power Cost Adjustment Clause applies to this rate.

55

Data:E0ce00a1-7347-4651-9656-bc1e4705451c | Open Energy Information  

Open Energy Info (EERE)

0a1-7347-4651-9656-bc1e4705451c 0a1-7347-4651-9656-bc1e4705451c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Coast Electric Power Assn Effective date: 2011/04/01 End date if known: Rate name: Light Service MH 175 W - Urban Sector: Lighting Description: *Fixed monthly charge is the sum of fixture charge, energy charge, and pole charge. Adjustment includes power cost adjustment rider and tax expense adjustment rider Source or reference: http://www.coastepa.com/myHome/rateSchedules/lightservice.aspx Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months):

56

Data:Ce257723-a06c-4647-a520-102fafcf2c22 | Open Energy Information  

Open Energy Info (EERE)

Ce257723-a06c-4647-a520-102fafcf2c22 Ce257723-a06c-4647-a520-102fafcf2c22 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Crisp County Power Comm Effective date: 2012/01/01 End date if known: Rate name: Rental Light Service-Post Top Fixtures- (Traditional MH 150/175W) Sector: Lighting Description: Applicable only to outdoor lighting by ballast operated vapor lamp fixtures, either Mercury Vapor, Pressure Sodium, or Metal Halide. Source or reference: ISU Documentation Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh):

57

City of Newton, Texas (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Texas Texas Utility Id 13603 Utility Location Yes Ownership M NERC Location SERC NERC SPP Yes Activity Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Lighting Service Commercial Large Light And Power Commercial Municipal Street Lighting - 175 Watt MV Lighting Municipal Street Lighting - 400 Watt MV Lighting Residental Service Commercial Security Lights 175W Lighting Security Lights 400W HPS Lighting Security Lights 400W MH Lighting Average Rates Residential: $0.0993/kWh Commercial: $0.0874/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a"

58

Data:4e6c54d3-26a6-4919-8400-7d7b12e79780 | Open Energy Information  

Open Energy Info (EERE)

d3-26a6-4919-8400-7d7b12e79780 d3-26a6-4919-8400-7d7b12e79780 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Frankfort, Kentucky (Utility Company) Effective date: 2012/07/01 End date if known: Rate name: Rate S1- Security Lights- (175W MH) Sector: Lighting Description: Source or reference: ISU Documentation Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous

59

Alcorn County Elec Power Assn | Open Energy Information  

Open Energy Info (EERE)

Power Assn Power Assn Jump to: navigation, search Name Alcorn County Elec Power Assn Place Mississippi Utility Id 276 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service (1001 kW-5000 kW) Industrial General Service (50 kW and Under) Commercial General Service (51 kW-1000 kW) Industrial Outdoor Lighting HPS 100 W Lighting Outdoor Lighting HPS 250 W Lighting Outdoor Lighting MH 400 W Lighting Outdoor Lighting MV 175 W Lighting Residential Residential Average Rates Residential: $0.0959/kWh

60

Magic Valley Electric Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Valley Electric Coop Inc Valley Electric Coop Inc Jump to: navigation, search Name Magic Valley Electric Coop Inc Place Texas Utility Id 11501 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes ISO Ercot Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Area 100 W HPS Lighting Commercial Area 150 W HPS Lighting Commercial Area 175 W MV Lighting Commercial Area 250 W HPS Lighting Commercial Area 400 W HPS Lighting Commercial Area 400 W MV Lighting Commercial Flood 1000 W HPS Lighting Commercial Flood 1000 W MH Lighting Commercial Flood 250 W HPS Lighting

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Data:Ab279419-79a1-4410-af5b-0c56114c33ea | Open Energy Information  

Open Energy Info (EERE)

9419-79a1-4410-af5b-0c56114c33ea 9419-79a1-4410-af5b-0c56114c33ea No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Sumter Electric Member Corp Effective date: 2012/01/01 End date if known: Rate name: Outdoor Lighting Underground MH Acorn 175 W w/ Aid Sector: Lighting Description: * Fixed Monthly Charge does not include monthly pole rate charges Source or reference: http://www.sumteremc.com/pdfs/OL-9.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service

62

Data:A69444d6-0ec2-458a-816f-7076f7caacaf | Open Energy Information  

Open Energy Info (EERE)

0ec2-458a-816f-7076f7caacaf 0ec2-458a-816f-7076f7caacaf No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Excelsior Electric Member Corp Effective date: 2009/01/01 End date if known: Rate name: Outdoor Lighting Service- 175W MH Sector: Lighting Description: Applicable only to outdoor lighting by means of ballast operated lamp fixtures that do not require a dedicated transformer and street lighting service by means of ballast operated lamp fixtures, subject to the established rules and regulations of the Cooperative. Source or reference: ISU Documentation Source Parent: Comments Applicability

63

Sheffield Utilities | Open Energy Information  

Open Energy Info (EERE)

Utilities Utilities Jump to: navigation, search Name Sheffield Utilities Place Alabama Utility Id 17033 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Security Light 100 W HPS Openbottom Lighting Security Light 150 W HPS Cobrahead Lighting Security Light 150 W HPS Decorative Light Lighting Security Light 1500 W MH Floodlight Lighting Security Light 175 W MV Openbottom Lighting Security Light 250 W HPS Cobrahead Lighting Security Light 250 W HPS Decorative Light Lighting Security Light 250 W HPS Floodlight Lighting

64

Data:8f295db5-b375-443a-86b2-d2030722bc0c | Open Energy Information  

Open Energy Info (EERE)

5db5-b375-443a-86b2-d2030722bc0c 5db5-b375-443a-86b2-d2030722bc0c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Woodruff Electric Coop Corp Effective date: 2012/10/24 End date if known: Rate name: Outdoor lighting - Street Lights 175 W MH, Metal pole Sector: Lighting Description: To unmetered automatically controlled outdoor lighting service burning all night. Source or reference: Illinois State University Archive Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V):

65

Data:5fe7f9c0-2b65-4b72-953c-8353d8b91407 | Open Energy Information  

Open Energy Info (EERE)

-2b65-4b72-953c-8353d8b91407 -2b65-4b72-953c-8353d8b91407 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jackson Electric Member Corp Effective date: End date if known: Rate name: Outdoor Lighting Decashield MH 175 W Wood Pole Sector: Lighting Description: Source or reference: http://www.jacksonemc.com/business-manage-my-account-commercial-rates-options/schedules/outdoor-lighting-service Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service

66

City of Grantville, Georgia (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Grantville, Georgia (Utility Company) Grantville, Georgia (Utility Company) Jump to: navigation, search Name City of Grantville Place Georgia Utility Id 7515 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Large/Industrial -Monthly Industrial Commercial Small-Monthly Commercial Municipal- Monthly Commercial Residential-Monthly Residential School-Monthly Commercial Security /Street-Monthly-After Meter- 100 W HPSV Lighting Security /Street-Monthly-After Meter- 1000 W MH Lighting Security /Street-Monthly-After Meter- 175 W MV Lighting

67

Klymak, J.M., S. Legg, M.H. Alford, M. Buijsman, R. Pinkel, and J.D. Nash. 2012. The direct breaking of internal waves at steep topography. Oceanography 25(2):150159, http://dx.doi.org/10.5670/  

E-Print Network [OSTI]

of internal tide generation, computation of how much energy they trap and turn into turbulence. This approach waves forced by wind and by tides (Munk and Wunsch, 1998). Tracking the energy pathways of internal the energy balance of tides. Though simpler than wind-driven waves, the energy balance of internal tides

68

Whittecar, G.R., Daniels, W.L., and Carter, C.H.III, 2007, Developing a Beneficial Use for Dredged Sediments at Shirley Plantation: Hydrostratigraphy, Groundwater Flow Patterns, and Water Quality Studies In: Bailey, C.M. and Lamoreaux, M.H.  

E-Print Network [OSTI]

and Old Dominion University have drilled several dozen boreholes and constructed and monitored groundwater spoils were reconfigured into compacted dikes to form a large L-shape basin, one with moderately

Darby, Dennis

69

Optimal Planning and Operation of Smart Grids with Electric Vehicle Interconnection  

E-Print Network [OSTI]

costs, EV battery degradation costs, and sales. min C ?????electricity sales, $ Electricity exchange with EVs D EV m,h

Stadler, Michael

2012-01-01T23:59:59.000Z

70

Is it Labors Turn to Globalize? Twenty-?rst Century Opportunities and Strategic Responses  

E-Print Network [OSTI]

Stanford University Press. Fairbrother, M.H. (2007) 'Makingsegments of capital. See Fairbrothers (2006, 2007) analysis

Evans, Peter

2010-01-01T23:59:59.000Z

71

"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Change","Daily Volume MWh","Number of Trades","Number of Companies"  

U.S. Energy Information Administration (EIA) Indexed Site

Nepool MH Da Lmp ",39815,39818,39818,65.55,65,65.44,-5.89,12000,15,9 Nepool MH Da Lmp ",39815,39818,39818,65.55,65,65.44,-5.89,12000,15,9 "Nepool MH Da Lmp",39818,39819,39819,67,65,66.22,0.78,39200,46,22 "Nepool MH Da Lmp ",39819,39820,39820,65,63.25,63.83,-2.39,20000,24,18 "Nepool MH Da Lmp ",39820,39821,39821,67.5,65.75,66.47,2.64,28000,33,16 "Nepool MH Da Lmp ",39821,39822,39822,78.5,76,77.31,10.84,21600,27,16 "Nepool MH Da Lmp ",39822,39825,39825,100,90,94.19,16.88,28800,35,19 "Nepool MH Da Lmp ",39825,39826,39826,81,72.75,74.76,-19.43,36000,44,24 "Nepool MH Da Lmp ",39826,39827,39827,101,98,99.83,25.07,16000,20,18 "Nepool MH Da Lmp",39827,39828,39828,130,117,120.32,20.49,40000,50,27 "Nepool MH Da Lmp ",39828,39829,39829,120,106,109.76,-10.56,72800,91,35

72

"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Daily Volume MWh","Number of Trades","Number of Companies"  

U.S. Energy Information Administration (EIA) Indexed Site

7988,37991,37991,62,62,62,800,1,2 7988,37991,37991,62,62,62,800,1,2 "NEPOOL MH DA LMP",37991,37992,37992,70,69,69.5,1600,2,2 "NEPOOL MH DA LMP",37992,37993,37993,75.25,72,73.81,3200,4,6 "NEPOOL MH DA LMP",37993,37994,37994,81,76,78.3,8000,10,11 "NEPOOL MH DA LMP",37994,37995,37995,85.75,81.5,84.24,12800,16,12 "NEPOOL MH DA LMP",37998,37999,37999,77,72.5,74.12,6400,8,9 "NEPOOL MH DA LMP",37999,38000,38000,120,92,104.81,16800,21,11 "NEPOOL MH DA LMP",38000,38001,38001,375,270,311.75,6400,8,8 "NEPOOL MH DA LMP",38001,38002,38002,175,170,171,4000,5,5 "NEPOOL MH DA LMP",38005,38006,38006,90,84,86.78,7200,9,7 "NEPOOL MH DA LMP",38006,38007,38007,94,81.5,87.42,10400,13,13 "NEPOOL MH DA LMP",38007,38008,38008,76,72,74.69,6400,8,8

73

"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Daily Volume MWh","Number of Trades","Number of Companies"  

U.S. Energy Information Administration (EIA) Indexed Site

449,39450,39450,180,158,161.65,26400,33,22 449,39450,39450,180,158,161.65,26400,33,22 "NEPOOL MH DA LMP",39450,39451,39451,123,108,114.27,36800,46,28 "NEPOOL MH DA LMP",39451,39454,39454,77,75.5,76.31,21600,26,17 "NEPOOL MH DA LMP",39454,39455,39455,68.25,66,67.1,41600,51,26 "NEPOOL MH DA LMP",39455,39456,39456,69.5,68,68.71,21600,27,18 "NEPOOL MH DA LMP",39456,39457,39457,81,74,75.75,30400,35,17 "NEPOOL MH DA LMP",39457,39458,39458,75,69.75,71.18,24800,31,19 "NEPOOL MH DA LMP",39458,39461,39461,80.5,77,79.38,17600,19,17 "NEPOOL MH DA LMP",39461,39462,39462,102,95,98.76,52000,64,24 "NEPOOL MH DA LMP",39462,39463,39463,90.5,87.5,88.59,34400,43,25 "NEPOOL MH DA LMP",39463,39464,39464,85,83.5,84.21,20800,26,14

74

"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Daily Volume MWh","Number of Trades","Number of Companies"  

U.S. Energy Information Administration (EIA) Indexed Site

084,39085,39085,62,55,55.98,10400,13,10 084,39085,39085,62,55,55.98,10400,13,10 "NEPOOL MH DA LMP",39085,39086,39086,54.75,52.75,53.53,30400,38,20 "NEPOOL MH DA LMP",39086,39087,39087,56,55,55.35,24800,31,19 "NEPOOL MH DA LMP",39087,39090,39090,58,56.5,57.08,8000,10,12 "NEPOOL MH DA LMP",39090,39091,39091,58.75,57.25,57.86,34400,41,19 "NEPOOL MH DA LMP",39091,39092,39092,60.5,59,59.8,20800,25,19 "NEPOOL MH DA LMP",39092,39093,39093,65,63.5,64.04,13600,16,15 "NEPOOL MH DA LMP",39093,39094,39094,61.25,59.75,60.82,15200,19,14 "NEPOOL MH DA LMP",39094,39097,39097,62,59,60.95,16800,21,16 "NEPOOL MH DA LMP",39097,39098,39098,69.25,67,68.25,22400,28,15 "NEPOOL MH DA LMP",39098,39099,39099,89,84.5,86.33,34400,43,26

75

"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Daily Volume MWh","Number of Trades","Number of Companies"  

U.S. Energy Information Administration (EIA) Indexed Site

355,38356,38356,56.85,56.25,56.7,6400,7,7 355,38356,38356,56.85,56.25,56.7,6400,7,7 "NEPOOL MH DA LMP",38356,38357,38357,55.25,55,55.0833,2400,3,3 "NEPOOL MH DA LMP",38357,38358,38358,59,59,59,800,1,2 "NEPOOL MH DA LMP",38358,38359,38359,57.5,57,57.25,2400,3,5 "NEPOOL MH DA LMP",38359,38362,38362,55.5,55.5,55.5,3200,4,6 "NEPOOL MH DA LMP",38362,38363,38363,58.75,58,58.575,9600,11,10 "NEPOOL MH DA LMP",38363,38364,38364,57.75,57.5,57.625,1600,2,4 "NEPOOL MH DA LMP",38364,38365,38365,55.75,55.25,55.4688,12800,15,11 "NEPOOL MH DA LMP",38365,38366,38366,58.5,58.25,58.4583,4800,5,6 "NEPOOL MH DA LMP",38366,38369,38369,92,85,88.7143,5600,7,8 "NEPOOL MH DA LMP",38369,38370,38370,97.5,97,97.1667,2400,3,5

76

Data:8c3161bd-0e75-4937-8088-f3ad6feb8c22 | Open Energy Information  

Open Energy Info (EERE)

61bd-0e75-4937-8088-f3ad6feb8c22 61bd-0e75-4937-8088-f3ad6feb8c22 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: CenterPoint Energy Effective date: 2013/01/25 End date if known: Rate name: Flood/Directional Lighting (MH 175w, Muni Discount) Sector: Lighting Description: The lighting fixtures served under this rate schedule will be served at standard secondary voltages as determined by Company. This tariff is applicable to any Retail Customer receiving un-metered service for one or more Company approved lighting fixtures which operate automatically every night from dusk to dawn and can be either: (1.) a Customer Owned Fixture or (2.) a Company Owned Fixture. The Company will install, make electrical connection(s), and maintain the lighting fixture(s).

77

Data:164154d9-ecb3-48dd-b443-cf682d0cc2a6 | Open Energy Information  

Open Energy Info (EERE)

4d9-ecb3-48dd-b443-cf682d0cc2a6 4d9-ecb3-48dd-b443-cf682d0cc2a6 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Sumter Electric Member Corp Effective date: 2012/01/01 End date if known: Rate name: Outdoor Lighting Underground MH Traditional 175 W w/ Aid Sector: Lighting Description: * Fixed Monthly Charge does not include monthly pole rate charges Source or reference: http://www.sumteremc.com/pdfs/OL-9.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V):

78

Data:5f350e5e-3052-4d69-8665-c8756bce60a9 | Open Energy Information  

Open Energy Info (EERE)

e5e-3052-4d69-8665-c8756bce60a9 e5e-3052-4d69-8665-c8756bce60a9 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: CenterPoint Energy Effective date: 2013/01/25 End date if known: Rate name: Flood/Directional Lighting (MH 175w) Sector: Commercial Description: The lighting fixtures served under this rate schedule will be served at standard secondary voltages as determined by Company. This tariff is applicable to any Retail Customer receiving un-metered service for one or more Company approved lighting fixtures which operate automatically every night from dusk to dawn and can be either: (1.) a Customer Owned Fixture or (2.) a Company Owned Fixture. The Company will install, make electrical connection(s), and maintain the lighting fixture(s).

79

Data:B751405f-c662-411a-aef7-e2840c6158ca | Open Energy Information  

Open Energy Info (EERE)

51405f-c662-411a-aef7-e2840c6158ca 51405f-c662-411a-aef7-e2840c6158ca No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Cobb Electric Membership Corp Effective date: 2006/01/01 End date if known: Rate name: Outdoor Lighting Acorn MH 175 W Pole Contribution Paid Fiberglass Sector: Lighting Description: Pole Contribution Wood 30' $246.00 Wood 35' $297.00 Wood 40' $382.00 Wood 45' $424.00 Fiberglass with Traditional 20' $490.00 Fiberglass with Acorn 20' $490.00 Fiberglass with Roadway 30' $532.00 Fiberglass with Roadway 35' $569.00 Fiberglass with Roadway 39' $772.00 Fiberglass with Decorative 30' $562.00

80

Data:5de2ae17-b167-4eb0-8e9b-1909b901720f | Open Energy Information  

Open Energy Info (EERE)

ae17-b167-4eb0-8e9b-1909b901720f ae17-b167-4eb0-8e9b-1909b901720f No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Cobb Electric Membership Corp Effective date: 2006/01/01 End date if known: Rate name: Outdoor Lighting Acorn MH 175 W Pole Contribution Not Paid Concrete Sector: Lighting Description: Pole Contribution Wood 30' $246.00 Wood 35' $297.00 Wood 40' $382.00 Wood 45' $424.00 Fiberglass with Traditional 20' $490.00 Fiberglass with Acorn 20' $490.00 Fiberglass with Roadway 30' $532.00 Fiberglass with Roadway 35' $569.00 Fiberglass with Roadway 39' $772.00 Fiberglass with Decorative 30' $562.00

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Data:1d8afd61-3f26-4513-8aba-6aa223835703 | Open Energy Information  

Open Energy Info (EERE)

afd61-3f26-4513-8aba-6aa223835703 afd61-3f26-4513-8aba-6aa223835703 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Springfield, Oregon (Utility Company) Effective date: 2013/05/01 End date if known: Rate name: Street Lighting 175 W MH Opt. 2 L-1 Sector: Lighting Description: Option 2 is a Utility (SUB) owned and installed fixtures. in addition to charges in Option 2, there is a charge of .333% per month for return on investment (plant original cost). Source or reference: http://www.subutil.com/files/static_page_files/A6CFDCA3-94A4-7DCF-40A67DECC1D04974/201204SUBElec.pdf Source Parent:

82

Data:C6eb28a2-d266-48f6-88b8-3f0c94ce73d5 | Open Energy Information  

Open Energy Info (EERE)

8a2-d266-48f6-88b8-3f0c94ce73d5 8a2-d266-48f6-88b8-3f0c94ce73d5 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Cobb Electric Membership Corp Effective date: 2006/01/01 End date if known: Rate name: Outdoor Lighting Acorn MH 175 W Pole Contribution Paid Concrete Sector: Lighting Description: Pole Contribution Wood 30' $246.00 Wood 35' $297.00 Wood 40' $382.00 Wood 45' $424.00 Fiberglass with Traditional 20' $490.00 Fiberglass with Acorn 20' $490.00 Fiberglass with Roadway 30' $532.00 Fiberglass with Roadway 35' $569.00 Fiberglass with Roadway 39' $772.00 Fiberglass with Decorative 30' $562.00 Fiberglass with Decorative 35' $596.00

83

Data:0d5a4bb9-e52f-4e19-ba91-10142fcfb74c | Open Energy Information  

Open Energy Info (EERE)

a4bb9-e52f-4e19-ba91-10142fcfb74c a4bb9-e52f-4e19-ba91-10142fcfb74c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Springfield, Oregon (Utility Company) Effective date: 2013/05/01 End date if known: Rate name: Private Lighting 175 W MH L-3 Sector: Lighting Description: New Lighting systems shall be overhead construction consisting of wood poles, aerial circuits, and conventional street lighting luminaries with mast arms not longer than ten feet, or floodlighting luminaries with no mast arms. The installed luminaries shall use low-pressure sodium lamps. All equipment used to provide service under this schedule will be furnished, owned, operated and maintained by the Springfield Utility Board.

84

Data:85e41446-67c9-4eef-9c61-f3991cf9978f | Open Energy Information  

Open Energy Info (EERE)

1446-67c9-4eef-9c61-f3991cf9978f 1446-67c9-4eef-9c61-f3991cf9978f No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Cobb Electric Membership Corp Effective date: 2006/01/01 End date if known: Rate name: Outdoor Lighting Acorn MH 175 W Pole Contribution Not Paid Fiberglass Sector: Lighting Description: Pole Contribution Wood 30' $246.00 Wood 35' $297.00 Wood 40' $382.00 Wood 45' $424.00 Fiberglass with Traditional 20' $490.00 Fiberglass with Acorn 20' $490.00 Fiberglass with Roadway 30' $532.00 Fiberglass with Roadway 35' $569.00 Fiberglass with Roadway 39' $772.00 Fiberglass with Decorative 30' $562.00

85

Data:F3acd424-7d4f-49cb-9b08-e5fca2679772 | Open Energy Information  

Open Energy Info (EERE)

acd424-7d4f-49cb-9b08-e5fca2679772 acd424-7d4f-49cb-9b08-e5fca2679772 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Cobb Electric Membership Corp Effective date: 2006/01/01 End date if known: Rate name: Outdoor Lighting Traditional MH 175 W Pole Contribution Paid Fiberglass Sector: Lighting Description: Pole Contribution Wood 30' $246.00 Wood 35' $297.00 Wood 40' $382.00 Wood 45' $424.00 Fiberglass with Traditional 20' $490.00 Fiberglass with Acorn 20' $490.00 Fiberglass with Roadway 30' $532.00 Fiberglass with Roadway 35' $569.00 Fiberglass with Roadway 39' $772.00 Fiberglass with Decorative 30' $562.00

86

Data:E8cdc47b-0b38-4f48-900c-9c533e173d35 | Open Energy Information  

Open Energy Info (EERE)

cdc47b-0b38-4f48-900c-9c533e173d35 cdc47b-0b38-4f48-900c-9c533e173d35 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Sumter Electric Member Corp Effective date: 2012/01/01 End date if known: Rate name: Outdoor Lighting Underground MH Acorn 175 W Sector: Lighting Description: * Fixed Monthly Charge does not include monthly pole rate charges Source or reference: http://www.sumteremc.com/pdfs/OL-9.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service

87

Data:6bf97a4f-74e1-40f7-9c67-e5909ec35995 | Open Energy Information  

Open Energy Info (EERE)

a4f-74e1-40f7-9c67-e5909ec35995 a4f-74e1-40f7-9c67-e5909ec35995 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Cobb Electric Membership Corp Effective date: 2006/01/01 End date if known: Rate name: Outdoor Lighting Traditional MH 175 W Pole Contribution Paid Concrete Sector: Lighting Description: Pole Contribution Wood 30' $246.00 Wood 35' $297.00 Wood 40' $382.00 Wood 45' $424.00 Fiberglass with Traditional 20' $490.00 Fiberglass with Acorn 20' $490.00 Fiberglass with Roadway 30' $532.00 Fiberglass with Roadway 35' $569.00 Fiberglass with Roadway 39' $772.00 Fiberglass with Decorative 30' $562.00

88

Data:5617d6dd-ae54-4308-8e25-7c9cdc3bc1fa | Open Energy Information  

Open Energy Info (EERE)

d6dd-ae54-4308-8e25-7c9cdc3bc1fa d6dd-ae54-4308-8e25-7c9cdc3bc1fa No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Cobb Electric Membership Corp Effective date: 2006/01/01 End date if known: Rate name: Outdoor Lighting Traditional MH 175 W Pole Contribution Not Paid Concrete Sector: Lighting Description: Pole Contribution Wood 30' $246.00 Wood 35' $297.00 Wood 40' $382.00 Wood 45' $424.00 Fiberglass with Traditional 20' $490.00 Fiberglass with Acorn 20' $490.00 Fiberglass with Roadway 30' $532.00 Fiberglass with Roadway 35' $569.00 Fiberglass with Roadway 39' $772.00 Fiberglass with Decorative 30' $562.00

89

Data:70543032-9536-41f0-93c3-b72e4d1ad779 | Open Energy Information  

Open Energy Info (EERE)

2-9536-41f0-93c3-b72e4d1ad779 2-9536-41f0-93c3-b72e4d1ad779 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Kiel, Wisconsin (Utility Company) Effective date: 2011/05/06 End date if known: Rate name: Ms-1 Street Lighting Service Ornamental 175 W MH Sector: Lighting Description: Power Cost Adjustment Clause - All metered rates shall be subject to a positive or negative power cost adjustment charge equivalent to the amount by which the current cost of power (per kilowatt-hour of sales) is greater or lesser than the base cost of power purchased (per kilowatt-hour of sales). The base cost of power (U) is $0.0754 per kilowatt-hour.

90

Data:D9157b31-4e5c-45e0-999a-de2fa3a76a44 | Open Energy Information  

Open Energy Info (EERE)

7b31-4e5c-45e0-999a-de2fa3a76a44 7b31-4e5c-45e0-999a-de2fa3a76a44 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Sawnee Electric Membership Corporation Effective date: 2012/06/01 End date if known: Rate name: Outdoor Lighting Cobrahead/Ornamental MH 175 W Sector: Lighting Description: *Wood Poles a. Prior to construction, the requesting party will be required to pay a one-time, non-refundable, contribution-in-aid of construction (CIAC) as outlined below; i. $600 per 30 foot wood pole, ii. $625 per 35 foot wood pole, Standard Ornamental Fixtures and Standard Ornamental Poles a. Prior to construction, the requesting party will be required to pay a one-time, non-refundable, contribution-in-aid of construction (CIAC) as outlined below; i. $ 525 per 22 foot fiberglass pole; ii. $1,450 per 35 foot fiberglass pole;

91

Data:D0e84398-1a36-4b59-925a-e8c34fea01f2 | Open Energy Information  

Open Energy Info (EERE)

e84398-1a36-4b59-925a-e8c34fea01f2 e84398-1a36-4b59-925a-e8c34fea01f2 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Sumter Electric Member Corp Effective date: 2012/01/01 End date if known: Rate name: Outdoor Lighting Underground MH Traditional 175 W Sector: Lighting Description: * Fixed Monthly Charge does not include monthly pole rate charges Source or reference: http://www.sumteremc.com/pdfs/OL-9.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V):

92

Data:2e47217e-aee9-4fe0-bb2c-49a06af100f0 | Open Energy Information  

Open Energy Info (EERE)

7217e-aee9-4fe0-bb2c-49a06af100f0 7217e-aee9-4fe0-bb2c-49a06af100f0 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Cobb Electric Membership Corp Effective date: 2006/01/01 End date if known: Rate name: Outdoor Lighting Traditional MH 175 W Pole Contribution Not Paid Fiberglass Sector: Lighting Description: Pole Contribution Wood 30' $246.00 Wood 35' $297.00 Wood 40' $382.00 Wood 45' $424.00 Fiberglass with Traditional 20' $490.00 Fiberglass with Acorn 20' $490.00 Fiberglass with Roadway 30' $532.00 Fiberglass with Roadway 35' $569.00 Fiberglass with Roadway 39' $772.00 Fiberglass with Decorative 30' $562.00

93

Ocmulgee Electric Member Corp | Open Energy Information  

Open Energy Info (EERE)

Ocmulgee Electric Member Corp Ocmulgee Electric Member Corp Place Georgia Utility Id 13934 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 1000W Type -'MH-Flood', kWh-500 Lighting 100W Type -'Decorative HPS', kWh-40 Lighting 100W Type -'HPS-Open', kWh-40 Lighting 100W Type -'HPS-Open', kWh-Metered Lighting 150W Type -'HPS-Sidelite', kWh-60 Lighting 175W Type -'MV-Open', kWh-70 Lighting 250W Type -'HPS-Flood', kWh-100 Lighting 250W Type -'HPS-Flood', kWh-Metered Lighting 250W Type -'HPS-Open/Cobra', kWh-100 Lighting

94

Data:Fa014190-210f-49f0-81fa-a3e0aee9f840 | Open Energy Information  

Open Energy Info (EERE)

Fa014190-210f-49f0-81fa-a3e0aee9f840 Fa014190-210f-49f0-81fa-a3e0aee9f840 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Tri-County Elec Member Corp Effective date: 2008/10/01 End date if known: Rate name: Outdoor Lighting MH Decorative 175 W Sector: Lighting Description: Assuming Existing Pole Source or reference: http://www.tri-countyemc.com/skins/userfiles/file/Outdoor_lighting_1_2_3.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service

95

Data:5cd55dba-e42d-4839-a42e-d318eb83d364 | Open Energy Information  

Open Energy Info (EERE)

cd55dba-e42d-4839-a42e-d318eb83d364 cd55dba-e42d-4839-a42e-d318eb83d364 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Groton Dept of Utilities Effective date: 2008/10/01 End date if known: Rate name: Street and Area Lighting Service(175 W MH)-Underground Sector: Commercial Description: pplicable to public or private customers for standard street and area lighting installations provided and maintained by the Department to render 4,000 annual hours of lighting. Overhead installation is a light fixture attached to an existing overhead distribution system pole. Underground installation is a light fixture attached to a new pole served from an existing underground distribution system.

96

Southwest Rural Elec Assn Inc | Open Energy Information  

Open Energy Info (EERE)

Oklahoma Oklahoma Utility Id 17681 Utility Location Yes Ownership C NERC Location SPP Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 1-10 175 Watts Commercial 100 Watt HPS, No Energy Lighting 100 Watt HPS, Unmetered Lighting 1000 Watt HPS or MH, No Energy Lighting 1000 Watt HPS or MH, Unmetered Lighting 11-50 175 Watts Commercial 175 Watt MVL, No Energy Lighting 175 Watt MVL, Unmetered Lighting 250 Watt HPS or MH, No Energy Lighting 250 Watt HPS or MH, Unmetered Lighting 400 Watt HPS or MH, No Energy Lighting 400 Watt HPS or MH, Unmetered Lighting

97

City of Frankfort, Kentucky (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Frankfort City of Frankfort City of Place Kentucky Utility Id 6708 Utility Location Yes Ownership M NERC Location RFC NERC RFC Yes Activity Transmission Yes Activity Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Area Lighting- (1000W MH With 35' Metal Pole) Lighting Area Lighting- (1000W MH With 35' Wood Pole) Lighting Area Lighting- (1000W MH With 45' Metal Pole) Lighting Area Lighting- (250W MH With 35' Metal Pole) Lighting Area Lighting- (250W MH With 35' Wood Pole) Lighting Area Lighting- (320W MH With 35' Metal Pole) Lighting

98

"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Change","Daily Volume MWh","Number of Trades","Number of Companies"  

U.S. Energy Information Administration (EIA) Indexed Site

546,40547,40547,55.25,54,54.67,7.01,27200,29,18 546,40547,40547,55.25,54,54.67,7.01,27200,29,18 "Nepool MH DA LMP",40547,40548,40548,50,48.75,49.39,-5.28,14400,16,14 "Nepool MH DA LMP",40548,40549,40549,54.25,53,53.44,4.05,24800,31,23 "Nepool MH DA LMP",40549,40550,40550,55.5,53.25,54.05,0.61,84800,80,24 "Nepool MH DA LMP",40550,40553,40553,65.5,64.75,65.01,10.96,21600,25,18 "Nepool MH DA LMP",40553,40554,40554,71,68.5,69.33,4.32,15200,18,17 "Nepool MH DA LMP",40554,40555,40555,79,72,77.51,8.18,68800,85,29 "Nepool MH DA LMP",40555,40556,40556,100.5,88,94.96,17.45,40000,49,23 "Nepool MH DA LMP",40556,40557,40557,92.25,87,87.7,-7.26,25600,31,23 "Nepool MH DA LMP",40557,40560,40560,66,63.5,65.03,-22.67,28000,30,17

99

"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Change","Daily Volume MWh","Number of Trades","Number of Companies"  

U.S. Energy Information Administration (EIA) Indexed Site

182,40183,40183,100.5,95,97,19.88,33600,42,27 182,40183,40183,100.5,95,97,19.88,33600,42,27 "Nepool MH DA LMP",40183,40184,40184,95,90,92.96,-4.04,39200,49,25 "Nepool MH DA LMP",40184,40185,40185,94,83,86.45,-6.51,33600,42,30 "Nepool MH DA LMP",40185,40186,40186,90,81.5,83.19,-3.26,47200,53,27 "Nepool MH DA LMP",40186,40189,40189,91,88.75,89.88,6.69,42400,53,30 "Nepool MH DA LMP",40189,40190,40190,71,67.75,68.95,-20.93,78400,95,30 "Nepool MH DA LMP",40190,40191,40191,61.25,58.75,59.99,-8.96,52800,64,31 "Nepool MH DA LMP",40191,40192,40192,56.25,54.75,55.33,-4.66,71200,82,32 "Nepool MH DA LMP",40192,40193,40193,53.75,53,53.36,-1.97,44000,55,25 "Nepool MH DA LMP",40193,40196,40196,55.75,54.75,55.64,2.28,21600,25,12

100

Sanyo Electric Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Sector: Solar, Vehicles Product: Japanese electric appliance manufacturer; manufactures solar panels, domestic fuel cell system, and NiMH batteries for hybrid vehicles....

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Mechanism-Based Inactivation of Cytochrome P450 3A4 by L-754,394  

Science Journals Connector (OSTI)

The theoretical average mass for the other peptides which could produce [M+H]+ ions nearest the value observed in the MADLI mass spectrum are 4600.2 ...

Luke Koenigs Lightning; Jeffrey P. Jones; Thomas Friedberg; Michael P. Pritchard; Magang Shou; Thomas H. Rushmore; William F. Trager

2000-03-16T23:59:59.000Z

102

E-Print Network 3.0 - assertiveness Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Logic Programs Michael Hanus Institut f... ur Informatik, CAU Kiel, D-24098 Kiel, Germany mh@informatik.uni-kiel.de Abstract. Assertions or contracts... are an important...

103

SUBSIDENCE DUE TO GEOTHERMAL FLUID WITHDRAWAL  

E-Print Network [OSTI]

the potential use of geothermal energy for power generation47. Boldizsar, T. , 1970, "Geothermal energy production fromCoast Geopressure Geothermal Energy Conference, M.H. Dorfman

Narasimhan, T.N.

2013-01-01T23:59:59.000Z

104

Data:155cf4f1-f386-4f37-9f0a-0f6fde30a317 | Open Energy Information  

Open Energy Info (EERE)

Next >> Basic Information Utility name: Nebraska Public Power District Effective date: 20130101 End date if known: Rate name: Directional Lighting MH 250 W Unmetered 835 Sector:...

105

Ovonic Battery Company Inc | Open Energy Information  

Open Energy Info (EERE)

Ovonic Battery Company Inc Place: Michigan Zip: 48309 Sector: Hydro, Hydrogen Product: Focused on commercializing its patented and proprietary NiMH battery technology through...

106

SUBSIDENCE DUE TO GEOTHERMAL FLUID WITHDRAWAL  

E-Print Network [OSTI]

the potential use of geothermal energy for power generationCoast Geopressure Geothermal Energy Conference, M.H. Dorfmanand Otte, C. , 1976, Geothermal energy-resources production,

Narasimhan, T.N.

2013-01-01T23:59:59.000Z

107

Ferromagnetic Semiconductor Nanoclusters: Co-doped Cu2O. | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

D Meyer DE McCready MH Engelhard Capabilities: Spectroscopy and Diffraction NMR and EPR Facility: Radiochemistry Annex Science Theme: Energy Materials & Processes Biosystem...

108

"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Change","Daily Volume MWh","Number of Trades","Number of Counterparties"  

U.S. Energy Information Administration (EIA) Indexed Site

Da LMP Peak",41246,41247,41247,48,45.75,47.16,-7.85,40000,48,21 Da LMP Peak",41246,41247,41247,48,45.75,47.16,-7.85,40000,48,21 "Nepool MH Da LMP Peak",41247,41248,41248,58.5,55,57.81,10.65,26400,32,21 "Nepool MH Da LMP Peak",41248,41249,41249,79.75,75,76.49,18.68,32800,39,18 "Nepool MH Da LMP Peak",41249,41250,41250,65,50.5,51.47,-25.02,35200,42,23 "Nepool MH Da LMP Peak",41250,41253,41253,47,45.5,46.48,-4.99,12800,16,14 "Nepool MH Da LMP Peak",41253,41254,41254,50,46,47.3,0.82,38400,44,22 "Nepool MH Da LMP Peak",41254,41255,41255,70,57,59.54,12.24,39200,49,19 "Nepool MH Da LMP Peak",41255,41256,41256,50,48.25,48.97,-10.57,53600,59,29 "Nepool MH Da LMP Peak",41256,41257,41257,39.25,38.5,38.98,-9.99,11200,14,10 "Nepool MH Da LMP Peak",41257,41260,41260,45,45,45,6.02,3200,4,6

109

"Price Hub","Trade Date","Delivery Start Date","Delivery End Date","High Price $/MWh","Low Price $/MWh","Wtd Avg Price $/MWh","Change","Daily Volume MWh","Number of Trades","Number of Counterparties"  

U.S. Energy Information Administration (EIA) Indexed Site

DA LMP",40911,40912,40912,92,84.75,87.16,-14.07,46400,56,29 DA LMP",40911,40912,40912,92,84.75,87.16,-14.07,46400,56,29 "Nepool MH DA LMP",40912,40913,40913,49,46,47.55,-39.61,78400,77,24 "Nepool MH DA LMP",40913,40914,40914,39.75,39.25,39.57,-7.98,12000,15,10 "Nepool MH DA LMP",40914,40917,40917,39,38,38.39,-1.18,8800,11,9 "Nepool MH DA LMP",40917,40918,40918,38.25,38,38.14,-0.25,8000,9,11 "Nepool MH DA LMP",40918,40919,40919,41.5,39.9,40.88,2.74,70400,83,25 "Nepool MH DA LMP",40919,40920,40920,37.25,36.75,36.83,-4.05,20000,23,16 "Nepool MH DA LMP",40920,40921,40921,44,43.5,43.73,6.9,11200,11,12 "Nepool MH DA LMP",40921,40924,40924,67,65.5,66.35,22.62,16800,21,15 "Nepool MH DA LMP",40924,40925,40925,50.75,50,50.24,-16.11,11200,14,12

110

Kayo Battery Industries Group | Open Energy Information  

Open Energy Info (EERE)

Vehicles Product: Shenzhen-based company, started by Hong Kong Highpower Technology and Japan Kayo Group, active in producing Lithium and NiMH batteries for various applications...

111

MP-Boost: A Multiple-Pivot Boosting Algorithm and Its Application to Text  

E-Print Network [OSTI]

for building multi-label (aka n-of-m) text classifiers. AdaBoost.MH be- longs to the family of "boostingBoost.MH [1] is a popular supervised learning algorithm for building multi-label text classifiers. Ada" algorithms, and works by iteratively building a committee of "decision stump" classifiers, where each

Sebastiani, Fabrizio

112

Computational Studies on the Mechanical Inhomogeneity of Tropomyosin, and the Directed and Cooperative Motility of the Ncd Motor  

E-Print Network [OSTI]

the coiled-coil neck-stalks of longitudinal neighbors drive synchrony among a group of Ncds on a single protofilament. Across lateral dimers, surface loop L2 of the motor-head (MH) that is not bound to the MT (unbound-MH) in a pre-stroke dimer, is seen...

Lakkaraju, Sirish

2012-02-14T23:59:59.000Z

113

Subpicosecond oxygen trapping in the heme pocket of the oxygen sensor FixL observed by time-resolved resonance Raman spectroscopy  

Science Journals Connector (OSTI)

...11241 11242 . 7 Liebl U Bouzhir-Sima L Negrerie M Martin J-L Vos MH ( 2002 ) Proc Natl Acad Sci USA 99 : 12771 12776 . 8 Balland V Bouzhir-Sima L Kiger L Marden MC Vos MH Liebl U Mattioli TA ( 2005 ) J Biol Chem 280 : 15279 15288 . 9 Jasaitis...

Sergei G. Kruglik; Audrius Jasaitis; Klara Hola; Taku Yamashita; Ursula Liebl; Jean-Louis Martin; Marten H. Vos

2007-01-01T23:59:59.000Z

114

Pollution Ecology: ERSC 355 page 1/4 POLLUTION ECOLOGY: ERSC 355  

E-Print Network [OSTI]

of pollutants, food chain effects, as well as the effects of mining and smelting activities, transportation on Aquatic Ecosystems MH 4 Oct 1 Acid Rain effects on Terrestrial Ecosystems & Air Pollution in the Kawartha's TH 5 Oct 8 Case Study: Smoking Hills MH/TH 6 Oct 15 Air Pollution Indicators & Sentinels TH Reading

Fox, Michael

115

Verification of the SAP Reference Models using EPC Reduction, State Space Analysis,  

E-Print Network [OSTI]

B.F. van Dongen , M.H. Jansen-Vullers, H.M.W. Verbeek , W.M.P. van der Aalst Department ), m.h.jansen-vullers@tm.tue.nl ( M.H. Jansen-Vullers), h.m.w.verbeek@tm.tue.nl (H.M.W. Verbeek ), w

van der Aalst, Wil

116

Lipoprotein subclass analysis by immunospecific density  

E-Print Network [OSTI]

fingerprinting method as previously reported. The light source used was a Fiber-Lite MH ?100 Illuminator (MH100A, Edmund Industrial Optics). The camera used was a digital color microscope camera (S99808, Optronics, Goleta, CA). The camera and the light source...

Lester, Sandy Marie

2009-05-15T23:59:59.000Z

117

Austerity in MCMC Land: Cutting the Metropolis-Hastings Budget Anoop Korattikara AKORATTI@UCI.EDU  

E-Print Network [OSTI]

above. Researchers have made some progress in terms of making Proceedings of the 31st International-Hastings (MH) test to reach a single binary decision is computationally inefficient. We introduce an ap- proximate MH rule based on a sequential hypoth- esis test that allows us to accept or reject samples

Welling, Max

118

Vehicle Manufacturing Futures in Transportation Life-cycle Assessment  

E-Print Network [OSTI]

Lead Acid, Ni-Mh, and Li-ion battery manufacturing isMh battery, HEV Page 4 of 10 with a Li-ion battery, PHEV20with a Li-ion battery, PHEV60 with a Li-ion battery, and

Chester, Mikhail; Horvath, Arpad

2011-01-01T23:59:59.000Z

119

PE2-7 Small animal PET imaging Michael A. Miller and Gary D. Hutchins (Indianapolis, USA)  

E-Print Network [OSTI]

27 PE2-7 Small animal PET imaging Michael A. Miller and Gary D. Hutchins (Indianapolis, USA) May 21, USA) May 23 8:30-10:00 RoomA+B, 10/F Meet the history Chair: Koji Abe (Okayama, Japan), James Mc Michael A. Moskowitz (Boston, USA) MH-7 Takaaki Kirino (Tokyo, Japan) MH-8 Nicolas G. Bazan (New Orleans

120

Induction of endoplasmic reticulum stress response by TZD18, a novel dual ligand for peroxisome proliferator-activated receptor ?/?, in human breast cancer cells  

Science Journals Connector (OSTI)

...cancer cells. Breast Cancer Res Treat 2002;74:155-65. 8 Fenner MH , Elstner E. Peroxisome proliferator-activated receptor-gamma...MDA-MB-231. Mol Carcinog 2002;34:165-71. 12 Liu H , Zang C, Fenner MH, et al. Growth inhibition and apoptosis in human Philadelphia...

Chuanbing Zang; Hongyu Liu; Janina Bertz; Kurt Possinger; H. Phillip Koeffler; Elena Elstner; Jan Eucker

2009-08-01T23:59:59.000Z

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

PPAR? Agonists Target Aromatase Via Both PGE2 and BRCA1  

Science Journals Connector (OSTI)

...desmoplastic reaction.Cancer Res 2001;61:2250-5. 12. Fenner MH , Elstner E.Peroxisome proliferator-activated receptor-gamma...Acad Sci U S A 1998;95:8806-11. 20. Liu H , Zang C, Fenner MH, Possinger K, Elstner E.PPARgamma ligands and ATRA inhibit...

Ofer Margalit; Dingzhi Wang; Raymond N. DuBois

2012-10-01T23:59:59.000Z

122

Spontaneous CP violation in the supersymmetric Higgs sector  

Science Journals Connector (OSTI)

Spontaneous CP violation in the minimal supersymmetric standard model with a gauge singlet and a cubic superpotential is examined. Although the tree-level Higgs potential conserves CP, it is shown that with the inclusion of the one-loop top-quark radiative effects CP may be broken spontaneously. The CP-violating minimum requires two neutral (h1,h2) and one charged (H) Higgs boson to be relatively light with mh1+mh2?100 GeV and mH?110 GeV. The electric dipole moment of the electron is in the observable range of (1/3 to 3)10-27e cm.

K. S. Babu and S. M. Barr

1994-03-01T23:59:59.000Z

123

Identification and initial characterization of circadian clock mutants in Neurospora crassa  

E-Print Network [OSTI]

strains . . . . . . . . . . . . . . . . . . . . . 19 4. The mtr selection. 20 5. Plasmid construction. . 26 6. Genetic analysis of strain 96-9 shows that it is mtr and trp 31 7. Genetic analysis of strain 106-20 shows that it is mtr, trp..., and hygromycin resistant. . 33 8. Southern analysis and pC1M restriction map. . . . . . 34 9. Genetic analysis of strain 4MH2 (bdtmtrttrp-2;frq IpCI M) 36 10. Genetic analysis of strain 7MH7 (bd; mtr; trptpC I M). . . . . 37 11. Reconstruction of strain 4MH2...

March, Irene Jennifer

2012-06-07T23:59:59.000Z

124

Little Ocmulgee El Member Corp | Open Energy Information  

Open Energy Info (EERE)

Ocmulgee El Member Corp Ocmulgee El Member Corp Jump to: navigation, search Name Little Ocmulgee El Member Corp Place Georgia Utility Id 26218 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes ISO Other Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 100 watt HPS - open bottom, Metered Lighting 100 watt HPS - open bottom, Non-Metered Lighting 1000 watt HPS, MV, MH - Directional, Metered Lighting 1000 watt HPS, MV, MH - Directional, Non-Metered Lighting 1000 watt MH - Shoebox, Metered Lighting 1000 watt MH - Shoebox, Non-Metered Lighting

125

Colquitt Electric Membership Corp | Open Energy Information  

Open Energy Info (EERE)

Electric Membership Corp Electric Membership Corp Jump to: navigation, search Name Colquitt Electric Membership Corp Place Georgia Utility Id 40212 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 1000W Existing MH-Flood, OVERHEAD WIRING, Metal or Fiberglass Pole Lighting 1000W Existing MH-Flood, OVERHEAD WIRING, Wood Pole Lighting 1000W Existing MH-Flood, UNDERGROUND WIRING, Metal or Fiberglass Pole Lighting 1000W Existing MH-Flood, UNDERGROUND WIRING, Wood Pole Lighting 100W Existing HPS-Open, OVERHEAD WIRING, Metal or Fiberglass Pole Lighting

126

Monitoring the excavation damaged zone by three-dimensional reconstruction of electrical resistivity  

Science Journals Connector (OSTI)

......R.E., Worthington M.H. Anisotropic resistivity tomography. Geophys...acoustic investigation of a damaged anisotropic shale at the Mont Terri Underground...M.H., de Oliveira C.R. Anisotropic resistivity inversion. Inverse......

Nolwenn Lesparre; Dominique Gibert; Florence Nicollin; Christophe Nussbaum; Andy Adler

2013-01-01T23:59:59.000Z

127

Magmatic subsidence of the East Pacific Rise (EPR) at S revealed through fault restoration of ridge crest  

E-Print Network [OSTI]

and John Sinton Department of Geology and Geophysics, University of Hawaii, 2525 Correa Road Honolulu. Ryan, W. Jin, M.-H. Cormier, E. Bergmanis, J. Sinton, and S. White, Magmatic subsidence of the East

Carbotte, Suzanne

128

Design and control of a passively stabilized multimodal hopping robot  

E-Print Network [OSTI]

the spin rotor assembly, the batteries selected changed fromfactor 9 volt Lithium Polymer batteries to a matched pair ofof six 1.2 V subC NiMH batteries. These were placed along

Pantel, Erica

2010-01-01T23:59:59.000Z

129

Shida Battery Technology Co Ltd | Open Energy Information  

Open Energy Info (EERE)

Co, Ltd Place: China Product: Shida is a China-based maker of NiMH and Li-Poly batteries with applications that include e-bikes. References: Shida Battery Technology Co,...

130

Acceptance of repeat population-based voluntary counseling and testing for HIV in rural Malawi  

E-Print Network [OSTI]

Calverton, Maryland, USA: ORC Macro, 2006. 5. Bateganya MH,Office (NSO) [Malawi] and ORC Macro. Malawi Demographic andCalverton, Maryland: NSO and ORC Macro, 2005. 17. Boerma JT,

2008-01-01T23:59:59.000Z

131

E-Print Network 3.0 - actinoid metal-transition metal-boron Sample...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

3 , T.V.Shymchuk , I.V.Stasyuk, T.S.Mysakovych Summary: is absent actinoide ions in water solu- tions are present as complexes (M(H2O)n)z+ where z is a cation......

132

E-Print Network 3.0 - academy sailing squadron Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

SCHOOL Monterey, California Summary: ) SQUADRONS by Cory L. Culver March 2002 Thesis Advisor: Gerald Brown Second Reader: Kevin Wood 12;THIS PAGE... of the MH-60S Helicopter and...

133

Hemoglobin-derived porphyrins preserved in a Middle Eocene blood-engorged mosquito  

Science Journals Connector (OSTI)

...5519 5521 . 28 Bauder C Ocampo R Callot HJ Albrecht P ( 1990 ) Structural evidence for heme fossils in Messel oil shale (FRG) Naturwissenschaften 77 ( 8 ): 378 379 . 29 Suo Z Avci R Schweitzer MH Deliorman M ( 2007 ) Porphyrin as an...

Dale E. Greenwalt; Yulia S. Goreva; Sandra M. Siljestrm; Tim Rose; Ralph E. Harbach

2013-01-01T23:59:59.000Z

134

1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Zhang, MH, WY Lin,SA Klein, JT Bacmeister, S Bony, RT Cederwall, AD Del Genio, JJ Hack, NG Loeb, U Lohmann, P Minnis, I Musat, R Pincus, P Stier, MJ Suarez, MJ Webb, JB Wu,...

135

Evolutionary relationships of ATP-Binding Cassette (ABC) uptake porters  

E-Print Network [OSTI]

Evolutionary relationships of ATP-Binding Cassette (ABC)MH Jr: Membrane porters of ATP-binding cassette transportand exporters in the evolution of ATP-binding cassette (ABC)

Zheng, Wei Hao; Vstermark, ke; Shlykov, Maksim A; Reddy, Vamsee; Sun, Eric I; Saier, Milton H

2013-01-01T23:59:59.000Z

136

Miltefosine Increases Lipid and Protein Dynamics in Leishmania amazonensis Membranes at Concentrations Similar to Those Needed for Cytotoxicity Activity  

Science Journals Connector (OSTI)

...CAPES, FUNAPE, and FAPEG. Rodrigo Alves Moreira, Sebastiao Antonio...0113 . 14. Alonso, A , WP dos Santos, SJ Leonor, JG dos Santos, and M Tabak. 2001. Stratum...CM d'Avila-Levy, ALS dos Santos, and MH Branquinha. 2011...

Rodrigo Alves Moreira; Sebastio Antonio Mendanha; Kelly Souza Fernandes; Grazzielle Guimaraes Matos; Lais Alonso; Miriam Leandro Dorta; Antonio Alonso

2014-03-10T23:59:59.000Z

137

STATEMENT OF CONSIDERATIONS CLASS WAIVER OF THE GOVERNMENT'S...  

Broader source: Energy.gov (indexed) [DOE]

to be in the best interest of the United States and the general public to grant a Class Waiver to certain identified inventions made under the Prime Contract to M&H and a Class...

138

Integrated, Low Voltage, DynamicallyIntegrated, Low Voltage, Dynamically Adaptive BuckAdaptive Buck--Boost ConverterBoost Converter  

E-Print Network [OSTI]

Improvement in battery life Low voltage Single cell operation (Li-ion/NiCd/NiMH/Fuel Cell) Integrated Linearity degradation #12;55Georgia Tech Analog Consortium Biranchinath Sahu School of Electrical

Rincon-Mora, Gabriel A.

139

The search for the Higgs boson in tauon pairs at the ATLAS experiment.  

E-Print Network [OSTI]

??The combined results have excluded most Higgs masses between 110 and 500 GeV. The only region that is not excluded is at mH = 126 (more)

Shao, Qi Tao

2013-01-01T23:59:59.000Z

140

HEV Fleet Testing - Summary Fact Sheet for 2010 Ford Fusion  

Broader source: Energy.gov (indexed) [DOE]

Ford Fusion VIN 3FADP0L32AR194699 Vehicle Specifications Engine: 2.5 L 4-cylinder Electric Motor: 60 kW Battery: NiMH Seatbelt Positions: Five Payload: 850 lbs Features:...

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

HEV Fleet Testing - Summary Fact Sheet for 2010 Honda Insight  

Broader source: Energy.gov (indexed) [DOE]

courts, law offices, and medical facilities on city streets and urban freeways. Vehicle Specifications Engine: 1.3 L 4-cylinder Electric Motor: 10 kW Battery: NiMH Seatbelt...

142

HEV Fleet Testing - Summary Fact Sheet for 2010 Toyota Prius  

Broader source: Energy.gov (indexed) [DOE]

courts, law offices, and medical facilities on city streets and urban freeways. Vehicle Specifications Engine: 1.8 L 4-cylinder Electric Motor: 60 kW Battery: NiMH Seatbelt...

143

HEV Fleet Testing - Summary Fact Sheet 2010 Toyota Prius  

Broader source: Energy.gov (indexed) [DOE]

Toyota Prius VIN JTDKN3DU2A5010462 Vehicle Specifications Engine: 1.8 L 4-cylinder Electric Motor: 60 kW Battery: NiMH Seatbelt Positions: Five Payload: 885 lbs Features:...

144

Zasidranost pregovorov v besedis?c?u govorcev slovenskega jezika  

E-Print Network [OSTI]

#17; 6PHK#3;MH#3;SRO#3;]GUDYMD#17; 5DQD#3;XUD#15;#3;]ODWD#3;XUD#17; =LKHU#3;MH#3;]LKHU#17; 2EOMXED#3;GHOD#3;GROJ#17; .DNUHQ#3;RH#15;#3;WDNHQ#3;VLQ#17; 9LGH]#3;YDUD#17; 8SDQMH#3;XPUH#3;]DGQMH#17; 2EOHND#3;QDUHGL#3;ORYHND#17; 1LNROL#3;QH#3;UHFL#3... SUDJRP#17; 6PHK#3;MH#3;SRO#3;]GUDYMD#17; 5DQD#3;XUD#15;#3;]ODWD#3;XUD#17; =LKHU#3;MH#3;]LKHU#17; -DERONR#3;QH#3;SDGH#3;GDOH#3;RG#3; GUHYHVD#17; 9LGH]#3;YDUD#17; 1LNROL#3;QH#3;UHFL#3;QLNROL#17; 9DMD#3;GHOD#3;PRMVWUD#17; .GRU#3;DND#15;#3;GRDND#17; Vsak...

Lipavic Otir, Alja; Vasiljevi?, Anja; Koletnik, Mihaela

2014-06-25T23:59:59.000Z

145

VBA-0060- In the Matter of Robert Burd  

Broader source: Energy.gov [DOE]

On November 16, 2001, BWXT Pantex, as successor to Mason & Hanger Corporation (M&H) (collectively referred to as the contractor), filed an appeal of an Initial Agency Decision (IAD)...

146

E-Print Network 3.0 - anne kuusksalu merike Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

: To 1992 o Borcherds eis gage mia na kathgora algbrwn Lie mh peperasmnhc distashc, tic genikeumnec lgebrec Kac-Moody. Autc oi lgebrec qoun pollc omoithtec Summary: merik c...

147

E-Print Network 3.0 - arvo leola merike Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

: To 1992 o Borcherds eis gage mia na kathgora algbrwn Lie mh peperasmnhc distashc, tic genikeumnec lgebrec Kac-Moody. Autc oi lgebrec qoun pollc omoithtec Summary: merik c...

148

Abstract--This paper outlines the design of an autonomous flying vehicle (AFV) for use in researching formation  

E-Print Network [OSTI]

with a full suite of integrated peripherals. Today, Nickel- Metal Hydride (NiMH) batteries can source more predators and efficiently forage for food [6]. Both the Air Force and NASA have identified autonomous

Sukhatme, Gaurav S.

149

E-Print Network 3.0 - aids entre homens Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

entre sexos (M-H) (p.p.) populao desempregada - nvel... com emprego por sexo variao (%) -0,6 -0,2 0,2 0,6 1,0 total homens mulheres fonte: INE, Inqurito ao......

150

A double-blind, randomized, multicenter phase 2 study of prasugrel versus placebo in adult patients with sickle cell disease  

E-Print Network [OSTI]

in adult patients with sickle cell disease. Journal of1. Steinberg MH: Management of sickle cell disease. N Engl Jadherence to endothelium in sickle-cell anemia. A possible

2013-01-01T23:59:59.000Z

151

NOAAlNMFS Developments U.S. and South Pacific Island  

E-Print Network [OSTI]

Islands, Nauru, New Zealand, Niue, Palau, Papua New Guinea, the Solomon Is lands, Tuvalu, Vanuatu Marianas .. Philippines G\\ '; . uam . ~.~ ..·F·il·~;~~~';;::;:;' ....c;:. ;M'''h'''','''''' . : . Palau

152

Thermal behavior of nickel/metal hydride battery during charging and discharging  

Science Journals Connector (OSTI)

This work discusses thermal behavior of Ni/MH battery with experimental methods. The present work not ... new way to get more exactly parameters and thermal model, but also concentrates on thermal behavior in dis...

K. Yang; D. H. Li; S. Chen; F. Wu

2009-02-01T23:59:59.000Z

153

Thermal behavior analysis of nickel/metal hydride battery during overcharging  

Science Journals Connector (OSTI)

To analyze the thermal behavior of the cylinder Ni/MH battery during overcharging, a two-dimensional thermal model is provided in this work. More ... reliable data is provided to create the precise thermal model....

Kai Yang; JinJing An; Shi Chen

2010-05-01T23:59:59.000Z

154

Thermal behavior of nickelmetal hydride battery during charging at a wide range of ambient temperatures  

Science Journals Connector (OSTI)

The thermal behavior of D-type NiMH battery during charging was investigated at a wide ... this work. The temperature measurement of the battery was conducted by using a thermal infrared imager put in a highlow...

Kai Zheng Fang; Dao Bin Mu; Shi Chen

2011-07-01T23:59:59.000Z

155

VBX-0060- In the Matter of Robert Burd  

Broader source: Energy.gov [DOE]

On November 16, 2001, BWXT Pantex, as successor to Mason & Hanger Corporation (M&H) (collectively referred to as the contractor), filed an appeal of an Initial Agency Decision (IAD)...

156

THESE DE DOCTORAT DE L'UNIVERSITE PARIS VI PIERRE ET MARIE CURIE  

E-Print Network [OSTI]

diffraction des rayons X, - Du côté du DMSC : M-H. Ritti, pour la dilatométrie et l'AFM, merci pour tout ce

Paris-Sud XI, Université de

157

Feasibility of Wholesale Electricity Competition in a Developing Country: Insights from Simulating a Market in Maharashtra State, India  

E-Print Network [OSTI]

I assume that private firms in the MH electricity market actand private firms will play important roles in the electricityand private firms operate in the sector at the same time) on wholesale electricity

Phadke, Amol

2007-01-01T23:59:59.000Z

158

Electronic structure of alkaline metal hydrides according to MO LCAO-SCF-CNDO cluster calculations  

Science Journals Connector (OSTI)

This paper presents the results of a quantum chemical study of compounds MH (M = Li, Na, K, Rb, and Cs) in a cluster approximation. The calculations were performed by the MO LCAO-SCF- ... model systems of high-te...

E. A. Zharikova; A. I. Ermakov; R. P. Ozerov

159

Temperature, thermal-conductivity, and heat-flux data,Raft River...  

Open Energy Info (EERE)

conductivity; United States; USGS Authors Urban, T.C.; Diment, W.H.; Nathenson, M.; Smith, E.P.; Ziagos, J.P.; Shaeffer and M.H. Published Open-File Report - U. S. Geological...

160

Microsoft Word - REPRINTS.DOC  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and a twelve-year abandoned field. Oikos 15:185-199. 0114 Bunnell, B.N. and M.H. Smith. 1966. Septal lesions and aggressiveness in the cotton rat, Sigmodon hispidus....

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

E-Print Network 3.0 - advanced home care Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

4 Scope, objective and setting 1.1 Scope and objective Summary: home in the Dutch health care system. Int Psychogeriatr 1993; 5: 213-22. 28 Beers MH, Ouslander JG... for...

162

Are batteries ready for plug-in hybrid buyers?  

E-Print Network [OSTI]

Of the battery chemistries discussed, only Li-ion shows the2008) battery researchers continue to develop Li-ionbattery chemistries: nickel-metal hydride (NiMH) and lithium-ion (Li-

Axsen, Jonn; Kurani, Kenneth S.; Burke, Andrew

2008-01-01T23:59:59.000Z

163

Are Batteries Ready for Plug-in Hybrid Buyers?  

E-Print Network [OSTI]

Of the battery chemistries discussed, only Li-ion shows the2008) battery researchers continue to develop Li-ionbattery chemistries: nickel- metal hydride (NiMH) and lithium-ion (Li-

Axsen, Jonn; Burke, Andy; Kurani, Kenneth S

2010-01-01T23:59:59.000Z

164

Are Batteries Ready for Plug-in Hybrid Buyers?  

E-Print Network [OSTI]

Of the battery chemistries discussed, only Li-ion shows the2008) battery researchers continue to develop Li-ionbattery chemistries: nickel-metal hydride (NiMH) and lithium-ion (Li-

Axsen, Jonn; Kurani, Kenneth S; Burke, Andy

2009-01-01T23:59:59.000Z

165

Pontotoc Electric Power Assn | Open Energy Information  

Open Energy Info (EERE)

Pontotoc Electric Power Assn Pontotoc Electric Power Assn Jump to: navigation, search Name Pontotoc Electric Power Assn Place Mississippi Utility Id 15211 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Flood Light MH 400 W Lighting Flood Light MH 400 W 30' pole Lighting Flood Light MH 400 W 35' pole Lighting Flood Light MH 400 W 40' pole Lighting General Power Service GSA (1001 kW - 5000 kW) Industrial General Power Service GSA (51 kW -1000 kW) Multi-Phase Commercial General Power Service GSA (51 kW -1000 kW) Single-Phase Commercial

166

Commercializing Light-Duty Plug-In/Plug-Out Hydrogen-Fuel-Cell Vehicles:Mobile Electricity Technologies, Early California Household Markets, and Innovation Management  

E-Print Network [OSTI]

battery Type Capacity (kWh) Saft Li- Ion Valence LiIon LiIonOvonic NiMH A-hr, 336V) Saft Li-Ion Valence LiIon EEEI

Williams, Brett D

2007-01-01T23:59:59.000Z

167

Commercializing light-duty plug-in/plug-out hydrogen-fuel-cell vehicles: Mobile Electricity technologies and opportunities  

E-Print Network [OSTI]

battery Type Capacity (kWh) Saft Li- Ion Valence LiIon LiIonOvonic NiMH A-hr, 336V) Saft Li-Ion Valence LiIon EEEI

Williams, Brett D; Kurani, Kenneth S

2007-01-01T23:59:59.000Z

168

Technological assessment and evaluation of high power batteries and their commercial values  

E-Print Network [OSTI]

Lithium Ion (Li-ion) battery technology has the potential to compete with the more matured Nickel Metal Hydride (NiMH) battery technology in the Hybrid Electric Vehicle (HEV) energy storage market as it has higher specific ...

Teo, Seh Kiat

2006-01-01T23:59:59.000Z

169

Edinburgh Research Explorer Citation for published version  

E-Print Network [OSTI]

, Gohlke, BO, Preissner, SC, Hoffmann, MF, Bauer, JMJ, Armstrong, D, Schaefer, MH, Andrade-Navarro, MA, Le. Andrade-Navarro3 , Nicolas Le Novere4 , Michael D. R. Croning5 , Seth G. N. Grant5 , Pim van Nierop6

Millar, Andrew J.

170

Chromatin stretch enhancer states drive cell-specific gene regulation and harbor human disease risk variants  

Science Journals Connector (OSTI)

...2004) GO::TermFinder--open source software for accessing Gene...5.0 7.5 10.0 Islets G M 12878 H 1 ESH epG 2H M ECH SM MH U VECK562 N H EKN H...2.66 4 5 6 7 8 9 Islets G M 12878 H 1 ESH epG 2H M ECH SM MH U VECK562 N H EK N H...

Stephen C. J. Parker; Michael L. Stitzel; D. Leland Taylor; Jose Miguel Orozco; Michael R. Erdos; Jennifer A. Akiyama; Kelly Lammerts van Bueren; Peter S. Chines; Narisu Narisu; NISC Comparative Sequencing Program; Brian L. Black; Axel Visel; Len A. Pennacchio; Francis S. Collins

2013-01-01T23:59:59.000Z

171

DNA fingerprinting in anthropological genetics: past, present, future  

E-Print Network [OSTI]

polymorphisms, and direct sequencing not only to identi of markers (or prints) of entire populations. In the field o to reconstruct evolutionary history and answer questions the effects of admixture and adaptation to different envir 2013 Crawford and Beaty..., Deka R, Young K, Crawford MH: Genetic architecture of a small, recently aggregated Aleut population: Bering Island. Hum Biol 2010, 82(506):719736. 30. Crawford MH, Rubicz RC, Zlojutro M: Origins of Aleuts and the genetic structure of populations...

Crawford, Michael H.; Beaty, Kristine Gatchalian

2013-11-18T23:59:59.000Z

172

Model Year 2006: Alternative Fuel and Advanced Technology Vehicles  

Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

06: Alternative Fuel and Advanced Technology Vehicles 06: Alternative Fuel and Advanced Technology Vehicles Fuel Type EPAct Compliant? Model Vehicle Type Emission Class Powertrain Fuel Capacity Range American Honda Motor Corporation 888-CCHONDA www.honda.com CNG Dedicated EPAct Yes Civic GX Compact Sedan SULEV Tier 2 Bin II 1.7L, 4-cylinder 8 GGE 200 mi HEV (NiMH) EPAct No Accord Hybrid Sedan ULEV 3.0L V6 144 volt NiMH + 17.1 Gal Gasoline TBD HEV (NiMH) EPAct No Civic Hybrid Sedan CA ULEV 1.3L, 4-cylinder 144 volt NiMH + 13.2 Gal Gasoline TBD HEV (NiMH) EPAct No Insight Two-seater SULEV (CVT model) ULEV (MT model) 1.0L, 3-cylinder 144 volt NiMH + 10.6 Gal Gasoline 636 mi DaimlerChrysler 800-999-FLEET www.fleet.chrysler.com E85 FFV EPAct Yes Dodge Ram Pickup 1500 Series 1 Pickup Tier 2 Bin 10A 4.7L V8 26 Gal 416 mi E85 FFV

173

Encouraging and sustaining integration of child mental health into primary care: interviews with primary care providers participating in Project TEACH (CAPES and CAP PC) in NY  

Science Journals Connector (OSTI)

AbstractObjective Project Training and Education for the Advancement of Children's Health (TEACH) provides training, consultation and referral support to build child and adolescent mental health (MH) expertise among primary care providers (PCPs). This study describes how TEACH engages PCP, how program components lead to changes in practice and how contextual factors influence sustainability. Method Thirty \\{PCPs\\} randomly selected from 139 trained \\{PCPs\\} and 10 \\{PCPs\\} from 143 registered with TEACH but not yet trained completed semistructured interviews. PCP selection utilized purposeful sampling for region, rurality and specialty. Interviews were recorded, transcribed and analyzed using grounded theory. Results PCP participation was facilitated by perceived patient needs, lack of financial and logistic barriers and continuity of PCPprogram relationships from training to ongoing consultation. Trained \\{PCPs\\} reported more confidence interacting with families about MH, assessing severity, prescribing medication and developing treatment plans. They were encouraged by satisfying interactions with MH specialists and positive feedback from families. Barriers included difficulties implementing screening, time constraints, competing demands, guarded expectations for patient outcomes and negative impressions of the MH system overall. Conclusions Programs like TEACH can increase PCP confidence in MH care and promote increased MH treatment in primary care and through collaboration with specialists. Sustainability may depend on the PCP practice context and implementation support.

Anne M. Gadomski; Lawrence S. Wissow; Lawrence Palinkas; Kimberly E. Hoagwood; Jeffrey M. Daly; David L. Kaye

2014-01-01T23:59:59.000Z

174

Data:485fd878-ca09-4ebe-bce1-0f719e919704 | Open Energy Information  

Open Energy Info (EERE)

fd878-ca09-4ebe-bce1-0f719e919704 fd878-ca09-4ebe-bce1-0f719e919704 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Oncor Electric Delivery Company LLC Effective date: 2012/01/01 End date if known: Rate name: Street Lighting Service, MH - 175W - Schedule C and D Sector: Lighting Description: Applicable to Competitive Retailer for street lighting, pedestrian walkway lighting, and overhead sign lighting service to governmental entities in areas served by Company. Overhead sign lighting is available only under the provisions of Schedule D of the Monthly Rate - Unmetered Facilities or the Monthly Rate - Metered Facilities - Non-Company-Owned provisions or the appropriate Secondary Service or Primary Service Rate Schedule. Street lights installed for the use of Retail Customer by Retail Customer or by a governmental subdivision. All equipment replacement and maintenance is performed by Retail Customer or the governmental subdivision. Company provides lamp replacement service only which includes lamp and labor (unless otherwise requested in writing by Retail Customer). Company owned street lights mounted on steel or other ornamental poles of a type not normally used by Company, and Retail Customer has contributed to Company an amount equivalent to the entire construction cost of the street lighting facilities including luminaires and circuits. Company operates all street lights under Schedule C (must be of a type suitable for use with the lamp sizes provided for herein) and makes all normal lamp replacements which includes lamp and labor at its expense. All other maintenance will be billed to Retail Customer on the basis of actual costs including appropriate overhead expenses. Retail Customer operated and maintained street lights and overhead sign lights or where such lights are installed by a governmental subdivision for the use of Retail Customer, and Company supplies distribution service to Retail Customer for the operation of the street lights or overhead sign lights

175

Data:0485f0ae-57b5-42d9-bfaf-e3d433280acd | Open Energy Information  

Open Energy Info (EERE)

f0ae-57b5-42d9-bfaf-e3d433280acd f0ae-57b5-42d9-bfaf-e3d433280acd No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Oncor Electric Delivery Company LLC Effective date: 2012/01/01 End date if known: Rate name: Street Lighting Service, MH - 175W - Schedule B Sector: Lighting Description: Applicable to Competitive Retailer for street lighting, pedestrian walkway lighting, and overhead sign lighting service to governmental entities in areas served by Company. Overhead sign lighting is available only under the provisions of Schedule D of the Monthly Rate - Unmetered Facilities or the Monthly Rate - Metered Facilities - Non-Company-Owned provisions or the appropriate Secondary Service or Primary Service Rate Schedule. Company installed, owned, operated, and maintained street lights mounted on steel or other ornamental poles of a type normally used by Company and served overhead. If the number of steel and/or other ornamental poles exceeds the number of such poles on which lights are mounted, there will be an additional charge of $5.34 per month for each such excess pole. Where two street lights with lamps of the same size are mounted on the same steel and/or other ornamental pole, Schedule B applies to one of the lights and Schedule A to the other. Company installed, owned, operated, and maintained street lights mounted on steel or other ornamental poles of a type normally used by Company and served underground, and Retail Customer has contributed to Company an amount equivalent to the difference between the total installed cost of the underground circuits serving the street lights and the total installed cost of overhead circuits. Where two street lights with lamps of the same size are mounted on the same steel and/or other ornamental pole, Schedule B applies to one of the lights and Schedule A to the other.

176

Search for Higgs boson production in oppositely charged dilepton and missing energy final states in 9.7??fb-1 of pp collisions at s=1.96??TeV  

Science Journals Connector (OSTI)

We present a search for the Higgs boson in final states with two oppositely charged leptons and large missing transverse energy as expected in H?WW??????? decays. The events are selected from the full Run II data sample of 9.7??fb-1 of pp collisions collected with the D0 detector at the Fermilab Tevatron Collider at s=1.96??TeV. To validate our search methodology, we measure the nonresonant WW production cross section and find ?WW=11.60.7??pb, in agreement with the standard model prediction. In the Higgs boson search, no significant excess above the background expectation is observed. Upper limits at the 95%confidence level on the Higgs boson production cross section are therefore derived. Within the standard model, the Higgs boson mass range 159<MH<176??GeV is excluded while the expected exclusion sensitivity is 156<MH<172??GeV. For a mass hypothesis of MH=125??GeV, we exclude Higgs boson production cross sections 4.1times larger than the standard model expectation, which is compatible with the presence of a Higgs boson at this mass. Within a theoretical framework with a fourth generation of fermions, the mass range 125<MH<218??GeV is excluded. The search results are also interpreted in the context of fermiophobic Higgs boson couplings, which yields an exclusion of fermiophobic Higgs boson production cross sections 3.1times larger than the expectation for MH=125??GeV.

V. M. Abazov et al. (D0 Collaboration)

2013-09-17T23:59:59.000Z

177

Medina Electric Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Medina Electric Coop, Inc Medina Electric Coop, Inc Place Texas Utility Id 12268 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes ISO Ercot Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png City of Laredo Street Lighting- 150W HPS Lighting City of Laredo Street Lighting- 150W MH Lighting City of Laredo Street Lighting-250 W HPS Lighting City of Laredo Street Lighting-250 W MH Lighting City of Laredo Street Lighting-400 W HPS Lighting City of Laredo Street Lighting-400 W MH Lighting Commercial General Service (Primary Metered & Primary Voltage) Commercial

178

Central Alabama Electric Coop | Open Energy Information  

Open Energy Info (EERE)

Central Alabama Electric Coop Central Alabama Electric Coop Place Alabama Utility Id 3222 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Residential Service Residential Security Lights Service: 100 W/HPS with 1 pole set Lighting Security Lights Service: 100 W/HPS with 2 poles set Lighting Security Lights Service: 1000 W/MH Lighting Security Lights Service: 1000 W/MH with 1 pole set Lighting Security Lights Service: 1000 W/MH with 2 poles set Lighting Security Lights Service: 100W/HPS (on existing pole) Lighting

179

Metal chelates of N,N'-dihydroxyethyl-N,N'-ethylenediaminedisuccinic acid and selected metal ions  

E-Print Network [OSTI]

constants . Thus K~gi L is the formation con- H n stant of 5%nL by combination of 1% 1L and H+, The reactions taking place during the addition of four males of base per mole of ligand are those involving 18 formation of the three MHL(m 3) + ML(m-4...) Mm+ + postulated metal chelate species KH MH2L 1, @ L(m-2)+ 2 KH MHL(m-3) + ~ L KM L4" ML ML(m-4) + The mass balance expressions for metal and ligand species are: T M [Mm+] + [yg (m-4)+] + MHL(m-3)+ MH L(m-2)+ (1) 2 [ML ?+] [MHL m +] [MH...

Hampton, Joan Martiner

2012-06-07T23:59:59.000Z

180

Magnetic nanoparticles: study of magnetic heating and adsorption/desorption for biomedical and environmental applications  

Science Journals Connector (OSTI)

This paper presents a summary of research on magnetic nanoparticles (MNPs) carried out recently at the Institute of Materials Science. Three families of oxide MNPs namely magnetite, manganite and spinel ferrite materials were prepared by several methods: co-precipitation, sol-gel and high-energy mechanical milling. Magnetite nanoparticles were encapsulated by two natural polymers, starch and chitosan. The structure of the prepared nanosystems was characterised by XRD, SEM, TEM techniques while their magnetisation was measured by VSM and PPMS. The magnetic heating (MH) of both naked and polymer-coated MNPs was studied. We also present two examples of researched applications that can be derived from this effect, namely the use of MH of magnetite NPs coated with starch to kill cancer cells, and the MH-assisted desorption of VOC from SBA/ferrite nanocomposite. Other research application examples include the use of magnetite MNPs to remove heavy toxic metals, such as arsenic, lead and nickel from contaminated water.

Pham Hoai Linh; Do Hung Manh; Tran Dai Lam; Le Van Hong; Nguyen Xuan Phuc; Nguyen Anh Tuan; Nguyen Thanh Ngoc; Vu Anh Tuan

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Inclusive Search for Standard Model Higgs Boson Production in the WW Decay Channel using the CDF II Detector  

E-Print Network [OSTI]

We present a search for standard model (SM) Higgs boson production using ppbar collision data at sqrt(s) = 1.96 TeV, collected with the CDF II detector and corresponding to an integrated luminosity of 4.8 fb-1. We search for Higgs bosons produced in all processes with a significant production rate and decaying to two W bosons. We find no evidence for SM Higgs boson production and place upper limits at the 95% confidence level on the SM production cross section (sigma(H)) for values of the Higgs boson mass (m_H) in the range from 110 to 200 GeV. These limits are the most stringent for m_H > 130 GeV and are 1.29 above the predicted value of sigma(H) for mH = 165 GeV.

The CDF Collaboration; T. Aaltonen

2010-02-17T23:59:59.000Z

182

City of La Grange, Georgia (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Georgia (Utility Company) Georgia (Utility Company) Jump to: navigation, search Name City of La Grange Place Georgia Utility Id 10585 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png COMMERCIAL ELECTRIC SERVICE Commercial GENERAL ELECTRIC SERVICE Commercial HPS Acorn, 100 Lighting HPS Acorn, 250 Lighting HPS Open Bottom, 100 Lighting HPS Post Top, 100 Lighting HPS Post Top, 150 Lighting HPS or MH - Flood or Shoebox, 150 Lighting HPS or MH - Flood or Shoebox, 250 Lighting HPS or MH - Flood or Shoebox, 400 Lighting

183

Character of Z-pole data constraints on standard model parameters  

Science Journals Connector (OSTI)

Despite the impressive precision of the Z-pole measurements made at the e+e- colliders at CERN (LEP) and SLAC (SLC), the allowed region for the principal standard model parameters responsible for radiative corrections [mH, mt, and ?(mZ2)] is still large enough to encompass significant nonlinearities. The nature of the experimental constraints therefore depends in an interesting way on the accidental relationships among the various measurements. In particular, the fact that the Z-pole measurements favor values of mH excluded by direct searches leads us to examine the effects of external Higgsstrahlung, a process ignored by the usual precision electroweak calculations.

T. Kawamoto and R. G. Kellogg

2004-06-29T23:59:59.000Z

184

Status of Higgs boson searches at the beginning of the LHC era  

Science Journals Connector (OSTI)

In recent years the Tevatron Run-II collaborations have extended the search for Higgs bosons which was pioneered during the LEP accelerator operation between 1989 and 2000. This review concisely discusses the experimental constraints set by the CDF and D collaborations with the complete dataset taken up to September 2011. Model-independent and model-dependent limits on Higgs boson masses and couplings have been set and interpretations are discussed both in the context of the Standard Model and in extended models. In spring 2012 the Tevatron extended the excluded SM Higgs boson mass range to 147 mH mH

A Sopczak

2012-01-01T23:59:59.000Z

185

The effect of maleic hydrazide and 2,4-dichlorophenoxyacetic acid on the carbohydrate content and leaf and stem rust response of wheat  

E-Print Network [OSTI]

respiration (13, 38) . Possibly the change in carbohydrate metabolism is the effect and not the cause, although it may be an indication of what is happening. 37 The MH and 2, 4-D treatments did not seem to have any consistant effects on the starch... respiration (13, 38) . Possibly the change in carbohydrate metabolism is the effect and not the cause, although it may be an indication of what is happening. 37 The MH and 2, 4-D treatments did not seem to have any consistant effects on the starch...

Lyles, William Earl

2012-06-07T23:59:59.000Z

186

Promising process to distinguish supersymmetric models with large tan ? from the standard model: B?Xs?+?-  

Science Journals Connector (OSTI)

It is shown that in supersymmetric models the large supersymmetric contributions to B?Xs?+?- come from the Feynman diagrams which consist of exchanging neutral Higgs boson loops and are proportional to mbm?tan3?/mh2 when tan ? is large and the mass of the lightest neutral Higgs boson mh is not too large (say, less than 150 GeV). Numerical results show that the branching ratios of B?Xs?+?- can be enhanced by more than 100% compared to the standard model (SM) and the backward-forward asymmetry of the lepton is significantly different from that in the SM when tan ??30.

Chao-Shang Huang, Wei Liao, and Qi-Shu Yan

1998-11-17T23:59:59.000Z

187

Fluorometric sedimentation equilibrium for lipoprotein sub-class analysis.  

E-Print Network [OSTI]

was obtained and analyzed using a digital Optronics Microfire Camera (S99808, Goleta, CA) with a Fiber-Lite MH- 100 Illuminator, (MH100A, Edmund Industrial Optics). The light source described here is a metal halide continuous light source. The camera is a... digital color microscope camera (S99808, Optronics, Goleta, CA). The camera and light source were placed orthogonally to each other on an optical bench to illuminate the sample suspended in a post holder. Two filters matching the excitation and emission...

Henriquez, Ronald Rene

2009-05-15T23:59:59.000Z

188

Restriction fragment length polymorphisms of chromosome 10S in maize (Zea mays L.) linked to resistance to Southern rust (Puccinia polysora)  

E-Print Network [OSTI]

. ~Mh~d 1 Inoculation was accomplished by removing spores from an infection pustule on a Tx5855 rust maintenance plant, in the evening, with a flat wooden toothpick and placing them deep in the whorl of the host plant to be tested. To obtain a humid... environment for spore germination, 1- 2 ml of distilled water was added to the whorl and the entire plant sprayed with a fine mist of distilled water. ~Mh~d 2 Innoculum was prepared by thawing one or two ampules of liquid nitrogen frozen innoculum...

Blakey, Cynthia Ann

1989-01-01T23:59:59.000Z

189

Experimental Study of the Richtmyer-Meshkov Instability on Inclined Interface  

E-Print Network [OSTI]

Laboratory, Report UCRL-LR-110500, in final preparation. (2003). [8] Anderson, M.H., Puranik, B.P., Oakley, J.G., Brooks, P.W., Bonazza, R.: Shock tube investigation of hydrodynamic issues related to inertial confinement fusion. Shock Waves. 10, 377... Laboratory, Report UCRL-LR-110500, in final preparation. (2003). [8] Anderson, M.H., Puranik, B.P., Oakley, J.G., Brooks, P.W., Bonazza, R.: Shock tube investigation of hydrodynamic issues related to inertial confinement fusion. Shock Waves. 10, 377...

McDonald, Christopher Michael

2013-02-06T23:59:59.000Z

190

Re-Commissioning of a VAV Air-Distribution System  

E-Print Network [OSTI]

P_setpoint=cte Supply circuit Fresh air circuit Extraction Group Atrium Bs1 south 3100 m?/h Return circuit BLOC B BLOC C VAV box 250 to 450 Pa 32 m fire cut-off valve silencer V& : air flow rate - m?/h Mechanized register regulation valve grille PAF Legend Figure 2... box manufacturer, this minimum pressure is around 250 Pa. The calculation, which is presented by Figure 4, shows that, with such a value, the pressure is acceptable in all rooms connected to this AHU. The same calculation shows that the connection...

Andre, P.; Silva, C. A.; Fonseca, N.; Hannay, J.; Lebrun, J.; Lacote, P.

2004-01-01T23:59:59.000Z

191

Ramifications of Discrete R Symmetries USC, October 2012  

E-Print Network [OSTI]

in nature which appears extremely tuned: the cosmological constant (dark energy). We have no good ideas Symmetries #12;The Higgs Discovery July 4 2012: ATLAS/CMS/CERN announcement of candidate Higgs discovery Discovery for Supersymmetry Higgs at 125 GeV poses two challenges: 1 In MSSM, mh MZ . Radiative corrections

California at Santa Cruz, University of

192

Herausgeber: Deutsche Forschungsgemeinschaft http://www.dfg.de  

E-Print Network [OSTI]

#12;Herausgeber: Deutsche Forschungsgemeinschaft http://www.dfg.de ?berreicht durch: Den. Christopher H. Baum Forschungsdekan der MHH #12;http://www.mh-hannover.de/forschung.html Deutsche 'Selbstkontrolle in der Wissenschaft' (Deutsch) #12;Empfehlungen der Kommission "Selbstkontrolle in der

Manstein, Dietmar J.

193

Improvement of output coupling efficiency of organic light-emitting diodes by backside substrate modification  

E-Print Network [OSTI]

modification C. F. Madigan, M.-H. Lu, and J. C. Sturma) Center for Photonics and Optoelectronic Materials, Department of Electrical Engineering, Princeton University, Princeton, New Jersey 08544 Received 8 November and at least triple it when high-index plastic substrates are used. The work is accompa- nied by modeling

194

Interactions between turbidity currents and topography in aggrading sinuous submarine channels: A laboratory study  

Science Journals Connector (OSTI)

...and thickness of the currents as the channel-form evolved. Aerial video was collected throughout the duration of each current...1365-3091.2003.00551.x. Parker, G., Garcia, M.H., Fukushima, Y., and Yu, W., 1987, Experiments on turbidity currents...

Kyle M. Straub; David Mohrig; Brandon McElroy; James Buttles; Carlos Pirmez

195

ENVIRONMENTAL EFFECTS IN GALAXIES: MOLECULAR GAS AND NUCLEAR ACTIVITY  

E-Print Network [OSTI]

ENVIRONMENTAL EFFECTS IN GALAXIES: MOLECULAR GAS AND NUCLEAR ACTIVITY DUILIA DE MELLO and TOMMY;ENVIRONMENTAL EFFECTS IN GALAXIES 69 a. log(MH2 /LB) versus Morphology b. Kolmogorov-Smirnov Statistic Figure 2 in dense envir- onments and in the field and to study whether there is any correlation between nuclear

Maia, Marcio Antonio Geimba

196

Psychotherapie in der Medizin Modul-Code: MSE_WP 534  

E-Print Network [OSTI]

Dr. Burkard Jäger Dr. Stefanie Jasper (Lehrbeauftragte) PD Dr. Dr. Astrid Müller Dr. Michael Stephan Jasper (jasper.stefanie@mh-hannover.de) melden 1. Woche: Beginn Montag ab 7.50 Uhr, Werktägliche zugesandte Einführungsliteratur. Dazu bitte auch an Fr. Dr. Stefanie Jasper wenden (jasper

Manstein, Dietmar J.

197

Mobile Networks and Applications 9, 481490, 2004 2004 Kluwer Academic Publishers. Manufactured in The Netherlands.  

E-Print Network [OSTI]

to physical hazards, but also suffer from limited battery life, reduced storage capacity, and a relatively low. Introduction Thanks to the relentless advances in semiconductors, the number of users with mobile computers (we to save battery life or communication dollars; while such a MH is disconnected, it has not failed

Madiraju, Praveen

198

Non-Aqueous Solvation of n-Octanol and Ethanol: Spectroscopic and Computational Lori M. Levering, Carrigan J. Hayes, Karen M. Callahan, Christopher M. Hadad,* and  

E-Print Network [OSTI]

Non-Aqueous Solvation of n-Octanol and Ethanol: Spectroscopic and Computational Studies Lori M-H bonds in n-octanol and ethanol with the organic solvents carbon tetrachloride (CCl4), cyclohexane populations of each ethanol complex and are consistent with the experimental results. Additional spectra were

199

Cancer Epidemiology in the 21st Century: Knowledge Integration in Cancer: Current Landscape and Future Prospects  

Science Journals Connector (OSTI)

...Deposition of raw datasets in public: documentation, access...Optimization of multiconsortial space, competition, and communication...Information, National Library of Medicine. [cited...Al-Mallah MH, Ioannidis JP.Public availability of published...future directions.Am J Public Health 2012;102:1274-81...

John P.A. Ioannidis; Sheri D. Schully; Tram Kim Lam; and Muin J. Khoury

2013-01-01T23:59:59.000Z

200

The West/African Americans/The Long Nineteenth Century UW-Madison, Department of History  

E-Print Network [OSTI]

The West/African Americans/The Long Nineteenth Century Jesse Gant UW-Madison, Department of History, Ohio: Ohio University Press, 2006. Baptist, Edward E, and Stephanie M.H. Camp. New Studies, 2003. #12;_____. Many Thousands Gone: The First Two Centuries of Slavery in North America. Cambridge

Wisconsin at Madison, University of

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Evidence of magnetic isotope effects during thermochemical sulfate reduction  

Science Journals Connector (OSTI)

...4). The acid/water would come from...nitrogen flow. Water lost to evaporation...mL of Milli-Q water through a septum...in ref. 38). Recovery was incomplete because...through radical condensation reactions. 1 Farquhar...Thiemens MH ( 2000 ) Atmospheric influence of Earths earliest...

Harry Oduro; Brian Harms; Herman O. Sintim; Alan J. Kaufman; George Cody; James Farquhar

2011-01-01T23:59:59.000Z

202

Development of a Rapid Normal-Phase LC-Positive Ion APCI-MS Method for Simultaneous Detection and Quantitation of Cholesterol, Androst-4-ene-3,17-dione, and Androsta-1,4-diene-3,17-dione  

Science Journals Connector (OSTI)

......chromatography (LC)positive ion atmospheric pressure chemical ionization...nitrogen from a nitrogen generator was used as the carrier...369 after the loss of water moiety from the molecule...protonated ions after loss of water [MH2O+H]+ at m...cholesterol after the loss of water fragments. The LCAPCIMS......

Ravi K. Khajuria; Vikram Bhardwaj; Rajinder K. Gupta; Preeti Sharma; Priti Somal; Pradeep Mehta; Ghulam N. Qazi

2007-09-01T23:59:59.000Z

203

Coherent photoproduction of -mesons off 3 He -search for -mesic nuclei  

E-Print Network [OSTI]

.N. Prakhov k , J. Robinson c , G. Rosner c , T. Rostomyan a,h , S. Schumann b , M.H. Sikora i , D.I. Sober p, pointing to the existence of a resonant state. The search for further evidence of this state

Krusche, Bernd

204

Quasifree Photoproduction of Mesons off Protons and Neutrons D. Werthmuller1  

E-Print Network [OSTI]

, G. Rosner3 , T. Rostomyan1 , S. Schumann2,5 , M.H. Sikora8 , D. Sober18 , A. Starostin10 , I. Supek, agree with the known neutron-to-proton cross-section ratio in the peak of the S11(1535) resonance

Krusche, Bernd

205

EPJ AHadrons and Nuclei your physics journal  

E-Print Network [OSTI]

. Rosner3 , M. Rost2 , T. Rostomyan1 , S. Schumann2,5 , M.H. Sikora8 , D. Sober18 , A. Starostin10 , I nuclear Fermi motion. In the S11(1535) resonance peak, the data agree with the neutron/proton cross

Krusche, Bernd

206

HEP/123-qed Photoproduction of 0  

E-Print Network [OSTI]

HEP/123-qed Photoproduction of 0 -mesons off neutrons in the nucleon resonance region M. Dieterle1. Robinson3 , G. Rosner3 , T. Rostomyan1 , S. Schumann2,5 , M.H. Sikora8 , D. Sober18 , A. Starostin10 , I of nucleon resonances. How- ever, with the recent progress in the numerical meth- ods of lattice gauge

Krusche, Bernd

207

Leliaert et al. 2011 Tda: Chlorophyceae  

E-Print Network [OSTI]

Solazyme's 100% algal-derived jet fuel, Solajet(R) HRJ-5, in an MH-60S Seahawk helicopter test flight in a 50/50 blend with petroleum-derived jet fuel. This is the first defense aircraft in history to fly on algae fuel. United Airlines 737 made the first U.S. commercial flight running on a biofuel blend, a 60

208

Adaptive Reliability Analysis of Excavation Problems  

E-Print Network [OSTI]

........................................................................... 26 2.5.3 Structure of ?z ............................................................................. 28 2.6 Solution Strategies ................................................................................ 29 2.6.1 Markov Chain Monte Carlo... simulation Metropolis-Hastings (MH) algorithm ........................................................................... 30 viii Page 2.6.2 Delayed Rejection Adaptive Metropolis (DRAM) method ........ 32 2.7 Application...

Park, Jun Kyung

2012-10-19T23:59:59.000Z

209

IEEE Computer Society 1986 , 1988  

E-Print Network [OSTI]

Society Golden Core Member 226 NEDO NEDO , IT , , JSTJSPSJAXA ES,, , ES2 , IEEE,, ACM Conf.PC, 191 Year Total Cores Rmax Rpeak Effecie ncy (%) Power Mflops /Watt Proc. Proc. MH z OS Core s Sequoia BlueGene/Q, Power BQC 16C 1.60 GHz, Custom DOE/ NNSA /LLN L IBM 2011 1572864 16324751 20132659 81.09 7890 2069

Kasahara, Hironori

210

Nucleotide sequence of the iucD gene of the pColV-K30 aerobactin operon and topology of its product studied with phoA and lacZ gene fusions.  

Science Journals Connector (OSTI)

...Pro Lou Ile Thr Rot His Asp Lys Asn Thr Phe Lys Val Arg Asp LCA GOT TAC CGT TCT GCG TTG CCA CM ATA CTT CCC TCA CTG ATG CCC...CRCR-1-1633 from the National Science Foundation and Department of Agriculture, respectively. M.H. was a Postdoctoral Fellow from the...

M Herrero; V de Lorenzo; J B Neilands

1988-01-01T23:59:59.000Z

211

Effect of Scaling Transfer between Evapotranspiration Maps Derived from LandSat 7 and MODIS Images  

E-Print Network [OSTI]

Sung-ho Hong, Jan M.H. Hendrickx and Brian Borchers New Mexico Tech, 801 Leroy place, Socorro, NM 87801 of the spatial distribution of ET over a range of space and time scales is needed for sustainable management coarse resolution images like MODIS provide very useful opportunities to monitor the energy balance

Borchers, Brian

212

Oxygen tolerance of an in silico-designed bioinspired hydrogen-evolving catalyst in water  

Science Journals Connector (OSTI)

...32 Zipoli F Car R Cohen MH...A ( 2009 ) Hydrogen production...reduction at a fuel-cell cathode . J Phys...current for hydrogen evolution...Reduction at a Fuel-Cell cathode...Current for Hydrogen Evolution...Zipoli, F., Car, R., Cohen...

Patrick H.-L. Sit; Roberto Car; Morrel H. Cohen; Annabella Selloni

2013-01-01T23:59:59.000Z

213

SOLAR BATTERY CHARGERS FOR NIMH BATTERIES1 Abstract -This paper proposes new solar battery  

E-Print Network [OSTI]

SOLAR BATTERY CHARGERS FOR NIMH BATTERIES1 Abstract - This paper proposes new solar battery chargers for NiMH batteries. Used with portable solar panels, existing charge control methods are shown of consumer portable solar arrays. These new arrays are lightweight, durable, and flexible and have been

Lehman, Brad

214

CURRICULUM VITAE James A. Bednar, Ph.D.  

E-Print Network [OSTI]

for Adaptive and Neural Computation School of Informatics College of Science and Engineering University, Department of Computer Sciences, University of Texas at Austin, 2002-2004. · Principal research grants Institute of Mental Health (Human Brain Project) grant #1R01-MH66991, Computational Modeling of Cortical

Bednar, Jim

215

16. D. S. Scheirer and K. C. Macdonald, ibid. 98, 7871 17. MBAs are calculated by subtracting from the free-air  

E-Print Network [OSTI]

16. D. S. Scheirer and K. C. Macdonald, ibid. 98, 7871 (1993). 17. MBAs are calculated. J. R. Cochran, Geophys. J. R. Astron. Soc. 87, 421 (1986). 24. M.-H. Cormier, K. C. Macdonald, D. S, K. C. Macdonald, D. W. Forsyth, Y. Shen, Mar. Geophys. Res. 18, 13 (1996). 32. Y. Shen, D. W

Toomey, Doug

216

Table of Contents Faculty Conf. 1  

E-Print Network [OSTI]

Baxter -- as did every bridge group leader. Each bridge group met and got (continued on page two) "A year to become a dentist and the importance of professionalism and scholarship. Denice Stewart, D.D.S., M.H under sunny skies. Each bridge group was charged with creating a hands-on exhibit for a hypothetical

Chapman, Michael S.

217

KaushikRajashekara TheUniversityofTexasatDallas  

E-Print Network [OSTI]

rpm Brushless DC * Fuel consumption (City/Highway): 42/43 MPG with CVT NissanLEAF­ Product Range extender Series Hybrid Parallel Fuel Cell Series Mild HybridMild Hybrid GeneratorEngine Fuel Cell * Engine: 1.3 liter, 4 cylinder * Battery: 100.8V DC (NiMH battery), 5.75 Ah * Motor/Generator: 13 KW @1500

California at Davis, University of

218

Copyright 2001 Psychonomic Society, Inc. 330 Cognitive, Affective, & Behavioral Neuroscience  

E-Print Network [OSTI]

that may well be related to body and limb position up- dating (Bonda,Petrides, Frey, & Evans, 1995;Sirigu Grant 97-17 to J.W.P. and by NIH Grant RO1 MH54246to M.B. The authorsthank John Jonides and two of locations during whole-body rotations in patients with hemispatial neglect JOHN W. PHILBECK George

Loomis, Jack M.

219

Magnetic Patterning of Permanent-Magnet Rotors for Microscale Motor/Generators  

E-Print Network [OSTI]

offers three advantages. First, eliminating the integrated winding permits simpler MH design element modeling 1. INTRODUCTION High power-density, microscale, axial-flux, PM machines [1-3] typically (Thickness = 0.5 mm, OD=9.5 mm) encased in a Ti adaptor used for microscale power generator [1]; (b

220

Microbiological and Physicochemical Characterization of Small-Scale Cocoa Fermentations and Screening of Yeast and Bacterial Strains To Develop a Defined Starter Culture  

Science Journals Connector (OSTI)

...subsequently centrifuged at 100 g and 4C for 10 min to remove large particles. The supernatant was further centrifuged at 8,000 g and...MH Zwietering. 2011. Theobroma cacao L., the food of the gods: quality determinants of commercial cocoa beans, with particular...

Gilberto Vincius de Melo Pereira; Maria Gabriela da Cruz Pedrozo Miguel; Cntia Lacerda Ramos; Rosane Freitas Schwan

2012-05-25T23:59:59.000Z

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

MT3DMS, A Modular Three-Dimensional Multispecies Transport Model User Guide to the  

E-Print Network [OSTI]

.M. Cozzarelli, M.H. Lahvis, and B.A. Bekins. 1998. Ground water contamination by crude oil near Bemidji (LNAPL) contaminant through the unsaturated zone and the formation of an oil lens on the water table ................................................................................................................. 18 #12;1 1. INTRODUCTION Leaks of fuels that release contaminants such as BTEX, MTBE and other fuel

Zheng, Chunmiao

222

Development of a large format direct detection device for three dimensional transmission electron microscopy  

E-Print Network [OSTI]

F. Duttweiler, J.C. Bouwer, S.T. Peltier, M.H. Ellisman, andDuttweiler, J.C. Bouwer, S.T. Peltier, M. Ellisman, and N.H.Duttweiler, J.C. Bouwer, S.T. Peltier, A.C. Milazzo, and M.

Milazzo, Anna-Clare

2009-01-01T23:59:59.000Z

223

Contributed Paper Using Changes in Agricultural Utility to Quantify  

E-Print Network [OSTI]

Contributed Paper Using Changes in Agricultural Utility to Quantify Future Climate-Induced Risk to Conservation LYNDON D. ESTES, LYDIE-LINE PAROZ, BETHANY A. BRADLEY,§ JONATHAN M.H. GREEN, DAVID G. HOLE to be mediated through changes in the agricultural utility of land. As farmers adapt their practices to changing

Bradley, Bethany

224

Zero-Emission Vehicle Scenario Cost Analysis Using A Fuzzy Set-Based Framework  

E-Print Network [OSTI]

a small percentage of EV sales with the ZEV mandate). WithNow, a portion of the 10% EV sales mandate can be composedSales - High Produciton Volume Scenario Subcompact Vehicle Chassis Manufacturing Costs GM Ovonics Projection of Selling Prices of NiMH EV

Lipman, Timothy E.

1999-01-01T23:59:59.000Z

225

notes.ps  

E-Print Network [OSTI]

Next, let us consider the approximation of a function u 2 H2(I) by continuous,. piecewise-linear functions. Let ...... (1.7.10). Note that the recursion could have begun at any level of di erentiation. By the argu- ...... fv 2Mh : v j@= ghg: The Galerkin...

226

mht  

E-Print Network [OSTI]

... text/html; charset="iso-8859-1" Content-Transfer-Encoding: quoted-printable ...... /tP+u9rbGFyiMh750+0r7f49Tm7I3o1wtOGM1pRQuUy9oceKRvmQYp3LAgg

227

Insights from Sequencing Fungal and Oomycete Genomes: What Can We Learn about Plant Disease and the Evolution of Pathogenicity?  

Science Journals Connector (OSTI)

...number of projects is in progress, and the dramatic fall in the price of DNA sequencing, coupled with the new high-throughput sequencing...Harrison, S.J., Joosten, M.H., Vervoort, J., and de Wit, P.J. (2006). Cladosporium fulvum Avr4 protects fungal...

Darren M. Soanes; Thomas A. Richards; Nicholas J. Talbot

2007-11-16T23:59:59.000Z

228

Toward Prediction of Efficacy of Chemotherapy: A Proof of Concept Study in Lung Cancer Patients Using [11C]docetaxel and Positron Emission Tomography  

Science Journals Connector (OSTI)

...Engels FK, De Bruijn P, Lam MH, De Wit R, et alPitfalls of the application of...Rosso L , Brock CS, Gallo JM, Saleem A, Price PM, Turkheimer FE, et alA new model for...Res 2001;61:3369-72. 31. Saleem A Price PM.Early tumor drug pharmacokinetics...

Astrid A.M. van der Veldt; Mark Lubberink; Ron H.J. Mathijssen; Walter J. Loos; Gerarda J.M. Herder; Henri N. Greuter; Emile F.I. Comans; Hugo B. Rutten; Jonas Eriksson; Albert D. Windhorst; N. Harry Hendrikse; Pieter E. Postmus; Egbert F. Smit; and Adriaan A. Lammertsma

2013-08-01T23:59:59.000Z

229

Obesity as a Barrier to the Transition from Welfare to Work John Cawley  

E-Print Network [OSTI]

for Child Health and Development, and the National Institute of Mental Health (R24-MH51363). We thank George from Welfare to Work John Cawley and Sheldon Danziger Abstract In 1996, welfare reform created individual cases from these requirements. As a result of welfare reform, expansions of the Earned Income Tax

Shyy, Wei

230

Work after Welfare Reform and the Well-being of Children* Rucker C. Johnson  

E-Print Network [OSTI]

Work after Welfare Reform and the Well-being of Children* Rucker C. Johnson Goldman School Policy Research Program of the Robert Wood Johnson Foundation, the National Institute of Mental Health (R24- MH51363), the National Institute of Child Health and Human Development (P50-HD38986

Shyy, Wei

231

Gerald R. Ford School Of Public Policy, University Of Michigan National Poverty Center Working Paper Series  

E-Print Network [OSTI]

at the Conference "From Welfare to Child Care: What Happens to Infants and Toddlers When Single Mothers Exchange, and the National Institute of Mental Health (R24-MH51363). The authors wish to thank Sheldon Danziger, Deborah costs but not parenting stress or problems with care. It predicts earnings and work duration net

Shyy, Wei

232

Possibilistic clustering approach to trackless ring Pattern Recognition in RICH counters  

Science Journals Connector (OSTI)

The pattern recognition problem in Ring Imaging CHerenkov (RICH) counters concerns the identification of an unknown number of rings whose centers and radii are assumed to be unknown. In this paper we present an algorithm based on the possibilistic approach ... Keywords: 07.05.Mh, 29.40.Ka, 29.85.+c, Pattern recognition, Possibilistic clustering, RICH counters

A. M. Massone; L. Studer; F. Masulli

2006-02-01T23:59:59.000Z

233

Analytical assessment of the thermal behavior of nickelemetal hydride batteries during fast charging  

E-Print Network [OSTI]

Analytical assessment of the thermal behavior of nickelemetal hydride batteries during fast to investigate transient thermal behavior of NiMH batteries. The thermal model uses integral transformation 2013 Available online 25 June 2013 Keywords: Battery thermal management Battery thermal model Fast

Bahrami, Majid

234

Influence of additives on the thermal behavior of nickel/metal hydride battery  

Science Journals Connector (OSTI)

This study discusses the thermal behavior of the 6.5 Ah cylinder Ni/MH hydride battery with 0.5wt% ytterbium oxide (...2O3...) in nickel electrode and 1.0wt% super absorbent polymer (SAP) in hydrogen-storage al...

Kai Yang; Jin Jing An; Shi Chen

2010-12-01T23:59:59.000Z

235

The effect of football helmet energy absorption mechanisms on the mitigation of cervical spinal injuries: a mathematical model  

E-Print Network [OSTI]

. The variables which are used for the mathematical model are as follows: head Head acceleration [ft/sec ] 2 x totso Torso acceleration [ft/sec ] 2 head Head velocity [ft/sec] x torso Torso velocity [ft/sec] Xl?, d Head displacement [ft] mh?d Head mass [ibm...

Yung, Adelino

1995-01-01T23:59:59.000Z

236

A Chemical Screen for Biological Small Molecule-RNA Conjugates Reveals CoA-Modified RNA  

E-Print Network [OSTI]

purification system using Flash+ silica gel columns. The 1 H and 13 C NMR spectra were recorded on a Varian addition of n-butylamine to the C4H4O3 unknown and the loss of two molecules of water (observed [M+H]+ m and were used without further purification. Flash column chromatography was carried out on a Biotage SP4

Liu, David R.

237

Optimization Neuroimaging'',  

E-Print Network [OSTI]

Canonical Ridge Analysis with Ridge Parameter Optimization F. ?. Nielsen, L. K. Hansen and S. C - PLS 1 = k 0 = k optimal k k = optimal k k £ £ 0 #12; Canonical Ridge Analysis with Ridge Parameter Optimization F. ?. Nielsen, L. K. Hansen and S. C. Strother The Human Brain Project, P20 MH57180 ``Spatial

Nielsen, Finn ?rup

238

Stable isotope geochemistry of sulfur bearing minerals and clay mineralogy of some soils and sediments in Loot Desert, central Iran  

E-Print Network [OSTI]

and sediments in Loot Desert, central Iran M.H. Farpoor a, , H.R. Krouse b a Soil Sci. Dept., Faculty of Agriculture, Shahid Bahonar Univ. of Kerman, Kerman, Iran b Department of Physics and Astronomy, the Univ technique and clay mineralogy were studied in different landforms in Loot Desert, central Iran. Four

Ahmad, Sajjad

239

Mid-to Late Holocene climate change: an overview Heinz Wanner a,*, Ju rg Beer b  

E-Print Network [OSTI]

from the Mid-Holocene (MH) to pre-industrial time. The redistribution of solar energy, due to orbital by a pronounced weakening of the monsoon systems in Africa and Asia and increasing dryness and desertification of the last millennium. On decadal to multi-century timescales, a worldwide coincidence between solar

Stocker, Thomas

240

Mid-to Late Holocene climate change: an overview Heinz Wanner a,*, Ju rg Beer b  

E-Print Network [OSTI]

forclimate changes from the Mid-Holocene (MH) to pre-industrial time. The redistribution of solar energy, due by a pronounced weakening of the monsoon systems in Africa and Asia and increasing dryness and desertification of the last millennium. On decadal to multi-century timescales, a worldwide coincidence between solar

Fortunat, Joos

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Implications of near-term coal power plant retirement for SO2 and NOX, and life cycle GHG emissions  

E-Print Network [OSTI]

prices of electricity production Plant type Unit Price Nuclear ($/MWh) 16.51 Wind ($/MWh) 201 Hydro Top SO2 100 430 95 440 100 430 Top NOX 105 350 100 380 105 345 Small, inefficient 125 410 125 405 125) Manitoba Hydro Manitoba Hydro Undertaking # 57 http://www.pub.gov.mb.ca/exhibits/mh-83.pdf. (5) Sotkiewicz

Jaramillo, Paulina

242

Dynamic modeling of nitrogen losses in river networks unravels the coupled effects of hydrological  

E-Print Network [OSTI]

prices of electricity production Plant type Unit Price Nuclear ($/MWh) 16.51 Wind ($/MWh) 201 Hydro Top SO2 100 430 95 440 100 430 Top NOX 105 350 100 380 105 345 Small, inefficient 125 410 125 405 125) Manitoba Hydro Manitoba Hydro Undertaking # 57 http://www.pub.gov.mb.ca/exhibits/mh-83.pdf. (5) Sotkiewicz

David, Mark B.

243

arXiv:hep-ph/0102297v32Mar2001 Preprint typeset in JHEP style. -HYPER VERSION SCIPP-01/10  

E-Print Network [OSTI]

USA E-mail: haber@scipp.ucsc.edu Abstract: A light CP-even Higgs boson with mh 10 GeV could explain Higgs boson limit: cos( - ) = 0 8 3. CESR and LEP constraints on a light Higgs boson 8 4. Final Results

California at Santa Cruz, University of

244

Maternal work behavior under welfare reform: How does the transition from welfare to work affect child development?  

E-Print Network [OSTI]

welfare to work affect child development? Abstract Using data from a longitudinal sample of formerMaternal work behavior under welfare reform: How does the transition from welfare to work affect of Mental Health (R24-MH51363) to the Social Work Research Development Center on Poverty, Risk, and Mental

Shyy, Wei

245

Operon for Biosynthesis of Lipstatin, the Beta-Lactone Inhibitor of Human Pancreatic Lipase  

Science Journals Connector (OSTI)

...S0076-6879(09)04808-3 . 38. Rottig, M , MH Medema, K Blin, T Weber, C Rausch and O Kohlbacher. 2011. NRPSpredictor2-a Web server for predicting NRPS adenylation domain specificity. Nucleic Acids Res. 39 :W362-W367. doi: 10.1093/nar/gkr323...

Tingli Bai; Daozhong Zhang; Shuangjun Lin; Qingshan Long; Yemin Wang; Hongyu Ou; Qianjin Kang; Zixin Deng; Wen Liu; Meifeng Tao

2014-09-19T23:59:59.000Z

246

Floodwater Chemistry in the Yolo Bypass during Winter and Spring 1998  

E-Print Network [OSTI]

Floodwater Chemistry in the Yolo Bypass during Winter and Spring 1998 Open-File Report 2007­1025 U.S. Department of the Interior U.S. Geological Survey #12;Floodwater Chemistry in the Yolo Bypass during Winter-USGS Suggested citation: Schemel, L.E., Cox, M.H., 2007, Floodwater Chemistry in the Yolo Bypass during Winter

247

Extremal shot noises, heavy tails and maxstable random fields.  

E-Print Network [OSTI]

Extremal shot noises, heavy tails and max­stable random fields. Clément Dombry # May 31, 2010 Abstract We consider the extremal shot noise defined by M(y) = sup{mh(y - x); (x, m) # #}, where function. Extremal shot noises naturally appear in extreme value theory as a model for spatial extremes

Recanati, Catherine

248

Extremal shot noises, heavy tails and max-stable random fields.  

E-Print Network [OSTI]

Extremal shot noises, heavy tails and max-stable random fields. Cl´ement Dombry May 31, 2010 Abstract We consider the extremal shot noise defined by M(y) = sup{mh(y - x); (x, m) }, where. Extremal shot noises naturally appear in extreme value theory as a model for spatial extremes and serve

Paris-Sud XI, Université de

249

Composite metal-hydrogen electrodes for metal-hydrogen batteries. Final report, October 1, 1993--April 15, 1997  

SciTech Connect (OSTI)

The purpose of this project is to develop and conduct a feasibility study of metallic thin films (multilayered and alloy composition) produced by advanced sputtering techniques for use as anodes in Ni-metal hydrogen batteries that would be deposited as distinct anode, electrolyte and cathode layers in thin film devices. The materials could also be incorporated in secondary consumer batteries (i.e. type AF(4/3 or 4/5)) which use electrodes in the form of tapes. The project was based on pioneering studies of hydrogen uptake by ultra-thin Pd-capped Nb films, these studies suggested that materials with metal-hydrogen ratios exceeding those of commercially available metal hydride materials and fast hydrogen charging and discharging kinetics could be produced. The project initially concentrated on gas phase and electrochemical studies of Pd-capped niobium films in laboratory-scale NiMH cells. This extended the pioneering work to the wet electrochemical environment of NiMH batteries and exploited advanced synchrotron radiation techniques not available during the earlier work to conduct in-situ studies of such materials during hydrogen charging and discharging. Although batteries with fast charging kinetics and hydrogen-metal ratios approaching unity could be fabricated, it was found that oxidation, cracking and corrosion in aqueous solutions made pure Nb films and multilayers poor candidates for battery application. The project emphasis shifted to alloy films based on known elemental materials used for NiMH batteries. Although commercial NiMH anode materials contain many metals, it was found that 0.24 {mu}m thick sputtered Zr-Ni films cycled at least 50 times with charging efficiencies exceeding 95% and [H]/[M] ratios of 0.7-1.0. Multilayered or thicker Zr-Ni films could be candidates for a thin film NiMH battery that may have practical applications as an integrated power source for modern electronic devices.

Ruckman, M.W.; Strongin, M.; Weismann, H. [and others

1997-04-01T23:59:59.000Z

250

High-efficiency cross-beam magnetic electron-impact source for improved miniature Mattauch-Herzog mass spectrometer performance  

SciTech Connect (OSTI)

We describe a newly designed cross-beam magnetic electron-impact ion source (CBM-EI). We demonstrate its superiority in comparison with a conventional source (CB-EI) when used with a commercial miniature sector-field-type, non-scanning mass spectrometer featuring Mattauch-Herzog geometry (MH-MS) and a permanent sector-field magnet. This paper clearly shows the value of the CBM-EI for enhancing MH-MS sensitivity. Unlike secondary electron-multiplier type detectors, the pixelated detector (IonCCD Trade-Mark-Sign ) used in the commercial MH-MS has no gain. The MH-MS/IonCCD system is therefore challenged to compete with time-of-flight and quadrupole MS systems due to their higher ion transmissions and detector gains. Using the new CBM-EI, we demonstrate an instrument sensitivity increase of 20-fold to 100-fold relative to the CB-EI-equipped instrument. This remarkable signal increase by the simple addition of the magnet assembly arises from the magnet-induced gyromotion of the thermionic electrons, which vastly increases the effective path length of the electrons through the ionization region, and the collimated nature of the electron flux, which optimizes the ion transmission through the 100-{mu}m object slit of the MH-MS. Some or all of the realized sensitivity increase may be exchanged for an increase in resolution and/or mass range through the use of a narrower object slit, or for a reduction in ion-source pressure to limit quenching. The CBM-EI should facilitate development of a differentially pumped ion source to extend the lifetime of the filament, especially in otherwise intractable applications associated with oxidizing and corrosive samples.

Hadjar, O.; Fowler, W. K. [OI Analytical/CMS Field Products, 2148 Pelham Parkway, Bldg. 400, Pelham, Alabama 35124 (United States)

2012-06-15T23:59:59.000Z

251

Amicalola Electric Member Corp | Open Energy Information  

Open Energy Info (EERE)

Amicalola Electric Member Corp Amicalola Electric Member Corp Jump to: navigation, search Name Amicalola Electric Member Corp Place Georgia Utility Id 562 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Security Lights Acorn 100 W Lighting Security Lights Acorn 150 W Lighting Security Lights Cobra 100 W Lighting Security Lights Cobra 150 W Lighting Security Lights Cobra 250 W Lighting Security Lights Cobra 400 W Lighting Security Lights Cobra MH 250 W Lighting Security Lights Cobra MH 400 W Lighting Security Lights Flood 250 W Lighting

252

Data:564a3135-a0a4-42c8-93cf-ca55dbcbf90c | Open Energy Information  

Open Energy Info (EERE)

a0a4-42c8-93cf-ca55dbcbf90c a0a4-42c8-93cf-ca55dbcbf90c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Algoma Utility Comm Effective date: 2008/05/28 End date if known: Rate name: Street Lighting Service - Option B - 100 W MH Sector: Lighting Description: Application: This schedule will be applied to municipal street lighting. Option B: Customer Owned and Utility Maintained. Power Cost Adjustment Clause: Charge per all kWh varies monthly. See schedule PCAC. Note: HPS = High Pressure Sodium MH = Metal Halide Source or reference: http://www.algomautilities.com/media/Electric_Rate_Tariff_Sheets.pdf

253

Tri-County Elec Member Corp (Kentucky) | Open Energy Information  

Open Energy Info (EERE)

Corp (Kentucky) Corp (Kentucky) Jump to: navigation, search Name Tri-County Elec Member Corp Place Kentucky Utility Id 19162 References EIA Form EIA-861 Final Data File for 2010 - File2_2010[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 100 Watt HPS Lighting 100 Watt Induction Lighting 1000 Watt MH Lighting 103 Watt LED Lighting 175 Watt MV Lighting 200 Watt HPS Lighting 250 Watt HPS Lighting 400 Watt HPS Lighting 400 Watt MH Lighting 400 Watt MV Lighting 51 Watt LED Lighting 85 Watt Induction Lighting GSA-Part 1 Commercial GSA-Part 2 Commercial GSA-Part 3 Industrial Residential Residential Average Rates Residential: $0.0941/kWh Commercial: $0.1050/kWh

254

Data:Da8c4406-ba6e-4564-aa77-7003d74bee60 | Open Energy Information  

Open Energy Info (EERE)

06-ba6e-4564-aa77-7003d74bee60 06-ba6e-4564-aa77-7003d74bee60 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jefferson Electric Member Corp Effective date: 2010/11/01 End date if known: Rate name: STREET LIGHTING SERVICE ( 1000W MH - Shoebox ) Sector: Lighting Description: Additional fees for poles and transformers may apply Source or reference: ISU Documentation Source Parent: Comments Applicable only to outdoor lighting by ballast operated vapor lamp fixtures, either high pressure sodium (HPS) or metal halide (MH), and poles conforming to Cooperative specifications. Applicability Demand (kW)

255

RAV4 Fleet Report-Final Version.PDF  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

0-00866 0-00866 June 2000 Field Operations Program Toyota RAV4 (NiMH) Fleet Evaluation Final Report J. Francfort B. Sanchez J. Argueta J. Phung M. Wehrey INEEL/EXT-2000-00866 Field Operations Program Toyota RAV4 (NiMH) Fleet Evaluation Final Report J. Francfort 1 B. Sanchez 2 J. Argueta 2 J. Phung 2 M. Wehrey 2 Published June 2000 Idaho National Engineering and Environmental Laboratory Automotive Systems and Technology Department Idaho Falls, Idaho 83415 Prepared for the U.S. Department of Energy Assistant Secretary for Energy Efficiency and Renewable Energy Under DOE Idaho Operations Office Contract No. DE-AC07-99ID13727 1 INEEL/Bechtel BWXT Idaho, LLC. 2 Southern California Edison 1 EXECUTIVE SUMMARY The U.S. Department of Energy's Field Operations Program evaluates electric and

256

Data:B86ebcf3-870c-4233-9e75-a0471a221774 | Open Energy Information  

Open Energy Info (EERE)

-870c-4233-9e75-a0471a221774 -870c-4233-9e75-a0471a221774 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jefferson Electric Member Corp Effective date: 2010/11/01 End date if known: Rate name: STREET LIGHTING SERVICE ( 400W MH - Shoebox ) Sector: Lighting Description: Additional fees for poles and transformers may apply Source or reference: ISU Documentation Source Parent: Comments Applicable only to outdoor lighting by ballast operated vapor lamp fixtures, either high pressure sodium (HPS) or metal halide (MH), and poles conforming to Cooperative specifications. Applicability Demand (kW)

257

Data:B37ad405-1bd7-40e7-9478-baf3c053a57e | Open Energy Information  

Open Energy Info (EERE)

05-1bd7-40e7-9478-baf3c053a57e 05-1bd7-40e7-9478-baf3c053a57e No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Algoma Utility Comm Effective date: 2008/05/28 End date if known: Rate name: Street Lighting Service - Option A - 100 W MH Sector: Lighting Description: Application: This schedule will be applied to municipal street lighting. Option A: Utility Owned and Maintained. Power Cost Adjustment Clause: Charge per all kWh varies monthly. See schedule PCAC. Note: HPS = High Pressure Sodium MH = Metal Halide Source or reference: http://www.algomautilities.com/media/Electric_Rate_Tariff_Sheets.pdf

258

PowerPoint Presentation  

Broader source: Energy.gov (indexed) [DOE]

Bipolar Nickel Metal Hydride Battery Bipolar Nickel Metal Hydride Battery Development and Testing DOE ENERGY STORAGE SYSTEMS RESEARCH PROGRAM ANNUAL PEER REVIEW November 2 - 3, 2006, Washington, D.C. James Landi jlandi@electroenergyinc.com 203-797-2699 Program Objectives and Benefits  The objective of this program is to further develop the bipolar NiMH battery design to be used in high-energy and high-power energy storage applications. - Build and demonstrate large-format batteries - Demonstrate these batteries in present and future applications  The bipolar NiMH battery could provide the following benefits: - Improve efficiencies by reducing transmission peaking losses and shifting peak demands. - Reduce power and voltage sag to users. - Provide an efficient method to distribute backup energy/power

259

City of Duncan, Oklahoma (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Duncan, Oklahoma (Utility Company) Duncan, Oklahoma (Utility Company) Jump to: navigation, search Name City of Duncan Place Oklahoma Utility Id 5429 Utility Location Yes Ownership M NERC Location SPP NERC SPP Yes Activity Generation Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Service Secondary Commercial Limited Usage General Service Secondary Commercial Power and Light Secondary Industrial Residential Service Secondary Residential Security Lighting- (1000W MH Directional Flood Lighting on existing DPUA utility Pole) Lighting Security Lighting- (1000W MH Directional Flood Lighting on existing 50 ft.

260

Tri-County Elec Member Corp (Tennessee) | Open Energy Information  

Open Energy Info (EERE)

Tri-County Elec Member Corp Tri-County Elec Member Corp Place Tennessee Utility Id 19162 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 100 Watt HPS Lighting 100 Watt Induction Lighting 1000 Watt MH Lighting 103 Watt LED Lighting 175 Watt MV Lighting 200 Watt HPS Lighting 250 Watt HPS Lighting 400 Watt HPS Lighting 400 Watt MH Lighting 400 Watt MV Lighting 51 Watt LED Lighting 85 Watt Induction Lighting GSA-Part 1 Commercial GSA-Part 2 Commercial GSA-Part 3 Industrial Residential Residential Average Rates

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

York Electric Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Electric Coop Inc Electric Coop Inc Jump to: navigation, search Name York Electric Coop Inc Place South Carolina Utility Id 21002 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Outdoor Lighting Backyard Lighting Outdoor Lighting Baxter Lighting Outdoor Lighting Shoebox 1 Light Lighting Outdoor Lighting Shoebox 2 Lights Lighting Outdoor Lighting Traditional Lighting Outdoor Lighting Ultra-Flood HPS/ MH 400 W 2 Lights Wood Pole Lighting Outdoor Lighting Ultra-Flood HPS/MH 1000 W Fiberglass Pole Lighting

262

City of Monroe, Georgia (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Georgia Georgia Utility Id 12800 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png COMMERCIAL DEMAND RATE Commercial COMMERCIAL NON DEMAND RATE Commercial Church Service Commercial City Electric Service Commercial Industrial Service Industrial RESIDENTIAL RATE Residential SECURITY LIGHT - 1000 Watt MH Lighting SECURITY LIGHT - 400 Watt HPS Lighting SECURITY LIGHT - 400 Watt MH Lighting SECURITY LIGHT - 150 Watt HPS Lighting SECURITY LIGHT - 150 Watt HPS (ornamental) Lighting SECURITY LIGHT - 175 Watt MV Lighting

263

Slide 1  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Qualification of the Methane and Qualification of the Methane Hydrate Resource Potential Associated with the Barrow Gas Fields Kick-off Meeting Morgantown, WV January 9, 2007 Tom Walsh Presentation Outline Overview Team Project Objectives Scope of Work Schedule,Milestones, Deliverables Overview * Last Comprehensive Reservoir Study in 1991-Glenn and Allen * Postulated Presence of Methane Hydrate * Material Balance Models for East Barrow and Walakpa Fields Lend Support to Possible MH Recharge * Potential Significant Impact on Local Resource * Excellent Laboratory for MH Research Location of Study Barrow Gas Fields Participants DOE-NETL NSB PRA UAF Advisory Committee Tim Collett, Chet Paris, Bob Hunter, Bob Swenson, Shirish Patil, Richard Glenn DOE/NETL COR Robert Vagnetti NSB Project Manager Kent Grinage PRA Principal Investigator

264

Kenergy Corp | Open Energy Information  

Open Energy Info (EERE)

Kenergy Corp Kenergy Corp Jump to: navigation, search Name Kenergy Corp Place Kentucky Utility Id 9964 Utility Location Yes Ownership C NERC RFC Yes NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Environmental Surcharge Rider Fuel Adjustment Rider High Pressure Sodium - 200/250 Watts Lighting High Pressure Sodium - Flood Light 400 Watts Lighting LED NEMA Head - 60 Watt Lighting Light - 100 watt HPS Lighting Light - 100 watt HPS - Acorn Globe Lighting Light - 100 watt MH Lighting Light - 100 watt MH - Acorn Lighting

265

Altamaha Electric Member Corp | Open Energy Information  

Open Energy Info (EERE)

Altamaha Electric Member Corp Altamaha Electric Member Corp Jump to: navigation, search Name Altamaha Electric Member Corp Place Georgia Utility Id 407 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Industrial Service Industrial Irrigation Service- IRGS-8 Commercial Large Power Service- LPS Commercial Net Metering Service- NMS-8 Commercial Outdoor Security Lighting Service- SL-9 (1000W HPS-Flood) Lighting Outdoor Security Lighting Service- SL-9 (1000W MH-Flood) Lighting Outdoor Security Lighting Service- SL-9 (1000W MH-Flood) Lighting

266

Data:080a0f72-aa5e-4884-8060-e7999ce0b409 | Open Energy Information  

Open Energy Info (EERE)

a0f72-aa5e-4884-8060-e7999ce0b409 a0f72-aa5e-4884-8060-e7999ce0b409 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Leavenworth-Jefferson E C, Inc Effective date: 2010/05/01 End date if known: Rate name: Street Light Rate (MH 250 W) Sector: Lighting Description: Available for municipal outdoor lighting service on public thoroughfares, city housing development, and in public parks where service can be supplied from a breaker box installed by the cooperative on existing facilities of the cooperative. Street Light Rate (MH 250 W) Source or reference: Rate Binder #7 (Illinois State University)

267

Village of Churchville, New York (Utility Company) | Open Energy  

Open Energy Info (EERE)

Churchville, New York (Utility Company) Churchville, New York (Utility Company) Jump to: navigation, search Name Village of Churchville Place New York Utility Id 3525 Utility Location Yes Ownership M NERC Location NPCC NERC NPCC Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial 2 Commercial Commercial wDemand 3 Commercial Outdoor Lighting 1000W MH Lighting Outdoor Lighting 150W HPS Lighting Outdoor Lighting 250W HPS Lighting Outdoor Lighting 400W MH Lighting Outdoor Lighting 400W MV Lighting Outdoor Lighting Wood Pole Rental Lighting

268

City of Hogansville, Georgia (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Hogansville, Georgia (Utility Company) Hogansville, Georgia (Utility Company) Jump to: navigation, search Name Hogansville City of Place Georgia Utility Id 8698 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Distribution Yes Activity Bundled Services Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Residential Residential Security Lights, HPS 100 Lighting Security Lights, HPS 250 Lighting Security Lights, HPS 400 Lighting Security Lights, HPS Flood 250 Lighting Security Lights, HPS Flood 400 Lighting Security Lights, MH 1000 Lighting Security Lights, MH 400 Lighting Security Lights, MV 175 Lighting

269

THE ROLE OF FERRIC IRON UPTAKE REGULATOR (FUR) PROTEIN ON IRON REGULATION IN COXIELLA BURNETII  

E-Print Network [OSTI]

;TCGTTTCCCTTCAGTCGCTG#7;#7;CBU2012 forward#7;CGAAGAACTGGATAGCGAAAG#7;#7; Beta-Galactosidase Assay C loned plasmids were electroporated into either BN4020 pMH15 or BN4020 pNP104 electrocompetent cells to form two plasmid heterolo ssay was performed...;#7;pMH15#7;pACYC184 with E. coli fur#7;#7;#7;pBlue TOPO#7;TA cloning vector, promoter trap#7;Invitrogen#7;#7;pNP104#7;pACYC184 with complete C. burnetii fur#7;This work#7;#7;BN4020#7;E. coli fur deletion strain#7;This work#7;#7; Table 2. List of all...

Wilson, Mary J

2006-08-16T23:59:59.000Z

270

Investigation of Metalloproteins Utilizing High Resolution Mass Spectrometry  

E-Print Network [OSTI]

.............................................................. 79 30 Fragment ion spectra of the [M+H]+ ions (a) Ac- Y(AEAAKA)2F-NH2 (-OCH3), (b) Ac-Y(AEAAKA)2F-NH2 (- 2OCH3) and (c) Ac-Y(AEAAKA)2F-NH2 (-3CH3)................. 82 31 Arrival time distribution (ATD) of the [M+H]+ ions of (a) Ac- Y...(AEAAKA)2F-NH2 (3OCH3) (FWHM:14), (b) Ac- Y(AEAAKA)2F-NH2 (2OCH3) (FWHM:25), (c) Ac- Y(AEAAKA)2F-NH2 (OCH3) (FWHM:21) and (d) Ac- Y(AEAAKA)2F-NH2 (FWHM:31)......................................... 85 32 Arrival time distribution (ATD) of the [M...

Wu, Zhaoxiang

2011-08-08T23:59:59.000Z

271

Complete one-loop electroweak corrections to ZZZ production at the ILC  

Science Journals Connector (OSTI)

We study the complete O(?ew) electroweak (EW) corrections to the production of three Z0 bosons in the framework of the standard model (SM) at the ILC. The leading-order and the EW next-to-leading-order corrected cross sections are presented, and their dependence on the colliding energy s and Higgs-boson mass mH is analyzed. We investigate also the LO and one-loop EW corrected distributions of the transverse momentum of the final Z0 boson, and the invariant mass of the Z0Z0 pair. Our numerical results show that the EW one-loop correction generally suppresses the tree-level cross section, and the relative correction with mH=120??GeV(150??GeV) varies between -15.8%(-13.9%) and -7.5%(-6.2%) when s goes up from 350GeV to 1TeV.

Su Ji-Juan; Ma Wen-Gan; Zhang Ren-You; Wang Shao-Ming; Guo Lei

2008-07-31T23:59:59.000Z

272

Linear depressions and collapse features in the Northwest Hueco Basin, West Texas  

E-Print Network [OSTI]

, Cartel?, CI y mm Sa d, S X, Cahetm CI y j5' 402 U&eformedFmeS d. Stlt, C I, h, CI y 401 E 4DD 399 398 m S d, mh, Cahche, Clay I Ec x S d Ecoan e 3 &It tl 397 3960 395 3940 393 0 200 4DO 600 SOD IDDD 1200 1400 1600 1800 20DO Dnt e..., Cartel?, CI y mm Sa d, S X, Cahetm CI y j5' 402 U&eformedFmeS d. Stlt, C I, h, CI y 401 E 4DD 399 398 m S d, mh, Cahche, Clay I Ec x S d Ecoan e 3 &It tl 397 3960 395 3940 393 0 200 4DO 600 SOD IDDD 1200 1400 1600 1800 20DO Dnt e...

Henderson, Scott D

2012-06-07T23:59:59.000Z

273

Search for the Standard Model Higgs Boson in ZH??+?-bb Production with the D0 Detector in 9.7??fb-1 of pp Collisions at s=1.96??TeV  

Science Journals Connector (OSTI)

We present a search for the standard model (SM) Higgs boson produced in association with a Z boson in 9.7??fb-1 of pp collisions collected with the D0 detector at the Fermilab Tevatron Collider at s=1.96??TeV. Selected events contain one reconstructed Z?e+e- or Z??+?- candidate and at least two jets, including at least one jet identified as likely to contain a b quark. To validate the search procedure, we also measure the cross section for ZZ production in the same final state. It is found to be consistent with its SM prediction. We set upper limits on the ZH production cross section times branching ratio for H?bb at the 95% C.L. for Higgs boson masses 90?MH?150??GeV. The observed (expected) limit for MH=125??GeV is 7.1 (5.1) times the SM cross section.

V. M. Abazov et al. (D0 Collaboration)

2012-09-20T23:59:59.000Z

274

Search for ZH??+?-bb production in 9.7??fb-1 of pp collisions with the D0 detector  

Science Journals Connector (OSTI)

We present a search for the standard model Higgs boson produced in association with a Z boson in 9.7??fb-1 of pp collisions collected with the D0 detector at the Fermilab Tevatron Collider at s=1.96??TeV. Selected events contain one reconstructed Z?e+e- or Z??+?- candidate and at least two jets, including at least one jet likely to contain a b quark. To validate the search procedure, we also measure the cross section for ZZ production and find that it is consistent with the standard model expectation. We set upper limits at the 95%C.L. on the product of the ZH production cross section and branching ratio B(H?bb) for Higgs boson masses 90?MH?150??GeV. The observed (expected) limit for MH=125??GeV is a factor of 7.1 (5.1) larger than the standard model prediction.

V. M. Abazov et al. (D0 Collaboration)

2013-09-17T23:59:59.000Z

275

Light Higgsino Dark Matter in a Realistic String CMSSM  

E-Print Network [OSTI]

When supersymmetry breaking is dominated by the complex structure moduli and the universal dilaton, a subset of the supersymmetry parameter space in a realistic MSSM constructed from intersecting/magnetized D-branes is equivalent to the mSUGRA/CMSSM parameter space with the trilinear term fixed to be minus the gaugino mass, A_0=-m_{1/2}. More generally, the scalar mass-squared terms for sfermions are split about the Higgs mass-squared terms, m_{Q_L,L_L}^2=m_H^2 - \\Delta m^2$ and m_{Q_R,L_R}^2=m_H^2 + \\Delta m^2, for generic values of the Kahler moduli. The hyberbolic branch/focus point (HB/FP) regions of this parameter space are present for both \\Delta m^2 = 0 and \\Delta m^2 \

Mayes, Van E

2014-01-01T23:59:59.000Z

276

Process for production of a metal hydride  

DOE Patents [OSTI]

A process for production of a metal hydride compound MH.sub.x, wherein x is one or two and M is an alkali metal, Be or Mg. The process comprises combining a compound of formula (R.sup.1O).sub.xM with aluminum, hydrogen and at least one metal selected from among titanium, zirconium, hafnium, niobium, vanadium, tantalum and iron to produce a compound of formula MH.sub.x. R.sup.1 is phenyl or phenyl substituted by at least one alkyl or alkoxy group. A mole ratio of aluminum to (R.sup.1O).sub.xM is from 0.1:1 to 1:1. The catalyst is present at a level of at least 200 ppm based on weight of aluminum.

Allen, Nathan Tait; Butterick, III, Robert; Chin, Arthur Achhing; Millar, Dean Michael; Molzahn, David Craig

2014-08-12T23:59:59.000Z

277

Light Higgsino Dark Matter in a Realistic String CMSSM  

E-Print Network [OSTI]

When supersymmetry breaking is dominated by the complex structure moduli and the universal dilaton, a subset of the supersymmetry parameter space in a realistic MSSM constructed from intersecting/magnetized D-branes is equivalent to the mSUGRA/CMSSM parameter space with the trilinear term fixed to be minus the gaugino mass, A_0=-m_{1/2}. More generally, the scalar mass-squared terms for sfermions are split about the Higgs mass-squared terms, m_{Q_L,L_L}^2=m_H^2 - \\Delta m^2$ and m_{Q_R,L_R}^2=m_H^2 + \\Delta m^2, for generic values of the Kahler moduli. The hyberbolic branch/focus point (HB/FP) regions of this parameter space are present for both \\Delta m^2 = 0 and \\Delta m^2 \

Van E. Mayes; Andrew W. Lutz

2014-12-03T23:59:59.000Z

278

Invisible Higgs boson decay in the littlest Higgs model with T-parity  

E-Print Network [OSTI]

We study the invisible decay of the Higgs boson into a pair of stable, heavy photons, H -> A_H A_H, in the littlest Higgs model with T-parity. For a symmetry breaking scale of f = 450 GeV, the branching ratio H -> A_H A_H can be as high as 93% for Higgs masses below 150 GeV. For f = 500 GeV, the invisible branching ratio is about 75% in the Higgs mass range 135 - 150 GeV and 10 (5.5)% for m_H = 200 (600) GeV. It drops to a few percent for f larger than 600 GeV. We have found regions in parameter space, allowed by the electroweak precision data, with such low values of f for 115 GeV < m_H < 650 GeV.

Raghavendra Srikanth Hundi; Biswarup Mukhopadhyaya; Andreas Nyffeler

2006-11-09T23:59:59.000Z

279

Review: Avgust Pavel: Prekmurska Slovenska Slovnica. Vend Nyelvtan  

E-Print Network [OSTI]

#28;#24; 2FHQH#15;#3;]DSLVNL#15;#3;SRURLOD#3;#3;5HYLHZV#15;#3;1RWHV#15;#3;5HSRUWV $9*867#3;3$9(/#29; PREKMURSKA SLOVENSKA SLOVNICA. VEND NYELVTAN#17;#3;0DULERU#29;#3;)LOR]RIVND#3;ID- NXOWHWD#15;#3;0HGQDURGQD#3;]DORED#3;2GGHOND#3; ]D...#3;VORYDQVNH#3;MH]LNH#3;LQ#3;NQMLHYQRVWL#3; #11;=RUD#30;#3;#20;#19;#19;#12;#17;#3;#23;#26;#23;#3;VWU#17; .RQHF#3;OHWD#3;#21;#19;#20;#22;#3;MH#3;Y#3;PHGQDURGQL#3;NQML- QL#3; ]ELUNL#3; =RUD#3; #11;=RUD#3; #20;#19;#19;#15;#3; XUHGQLN#3; 0DUNR#3...

ek Mertü k, Polonca

2014-06-25T23:59:59.000Z

280

Alma Karlin svojevrstna pisateljska osebnost  

E-Print Network [OSTI]

86 $OPD#3;.DUOLQ#3;#3;VYRMHYUVWQD#3; SLVDWHOMVND#3;RVHEQRVW SILVIJA BOROVNIK 8QLYHU]D#3;Y#3;0DULERUX#15;#3;)LOR]RIVND#3;IDNXOWHWD#15;#3;.RURND#3;FHVWD#3;#20;#25;#19;#15;#3; SI 2000 Maribor, VLOYLMD#17;ERURYQLN#XP#17;VL ODQHN#3;VH...#3;XNYDUMD#3;V#3;VYRMHYUVWQR#3;SLVDWHOMVNR#3;RVHEQRVWMR#3;$OPR#3;0#17;#3;.DUOLQ#15;#3; URMHQR#3;Y#3;&HOMX#15;#3;NL#3; MH#3;ELOD#3;SROLJORWND#3;LQ#3;DYWRULFD#3;WHYLOQLK#3;SRWRSLVRY#3;WHU#3; GUXJLK#3;OLWHUDUQLK#3;GHO#17;#3;7D#3;GHOD#3;MH#15;#3;HSUDY#3...

Borovnik, Silvija

2014-06-25T23:59:59.000Z

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Data:37dd1c0b-67c5-46f0-9ede-17cb1ab0c120 | Open Energy Information  

Open Energy Info (EERE)

c0b-67c5-46f0-9ede-17cb1ab0c120 c0b-67c5-46f0-9ede-17cb1ab0c120 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Leavenworth-Jefferson E C, Inc Effective date: 2010/05/01 End date if known: Rate name: Street Light Rate (MH 100 W) Sector: Lighting Description: Available for municipal outdoor lighting service on public thoroughfares, city housing development, and in public parks where service can be supplied from a breaker box installed by the cooperative on existing facilities of the cooperative. Street Light Rate (MH 100 W) Source or reference: Rate Binder #7 (Illinois State University)

282

Data:0d384f23-35e4-45c3-a908-f8b49349f5dc | Open Energy Information  

Open Energy Info (EERE)

3-35e4-45c3-a908-f8b49349f5dc 3-35e4-45c3-a908-f8b49349f5dc No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Leavenworth-Jefferson E C, Inc Effective date: 2010/05/01 End date if known: Rate name: Outdoor Area Lighting Service (MH 100 W) Sector: Lighting Description: Available for outdoor lighting service to individual consumers where service can be supplied from existing facility of the cooperative. Outdoor Area Lighting Service (MH 100 W) Source or reference: Rate Binder #7 (Illinois State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months):

283

Data:71d6b6fd-5996-4692-8470-e8e9fd2cea39 | Open Energy Information  

Open Energy Info (EERE)

fd-5996-4692-8470-e8e9fd2cea39 fd-5996-4692-8470-e8e9fd2cea39 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jefferson Electric Member Corp Effective date: 2010/11/01 End date if known: Rate name: STREET LIGHTING SERVICE ( 250W MH - Shoebox ) Sector: Lighting Description: Additional fees for poles and transformers may apply Source or reference: ISU Documentation Source Parent: Comments Applicable only to outdoor lighting by ballast operated vapor lamp fixtures, either high pressure sodium (HPS) or metal halide (MH), and poles conforming to Cooperative specifications. Applicability Demand (kW)

284

Slash Pine Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Slash Pine Elec Member Corp Slash Pine Elec Member Corp Jump to: navigation, search Name Slash Pine Elec Member Corp Place Georgia Utility Id 17290 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Outdoor Lighting 100 Watt HPS Security Light Lighting Outdoor Lighting 1000 Watt HPS Flood Light* Lighting Outdoor Lighting 1000 Watt MH Flood Light* Lighting Outdoor Lighting 1500 Watt MH Flood Light* Lighting Outdoor Lighting 175 Watt HPS Security Light Lighting Outdoor Lighting 250 Watt HPS Security Light Lighting

285

Data:1472f979-d16f-49e7-9ac7-ff4d314f3651 | Open Energy Information  

Open Energy Info (EERE)

f979-d16f-49e7-9ac7-ff4d314f3651 f979-d16f-49e7-9ac7-ff4d314f3651 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Leavenworth-Jefferson E C, Inc Effective date: 2010/05/01 End date if known: Rate name: Street Light Rate (MH 400 W) Sector: Lighting Description: Available for municipal outdoor lighting service on public thoroughfares, city housing development, and in public parks where service can be supplied from a breaker box installed by the cooperative on existing facilities of the cooperative. Street Light Rate (MH 400 W) Source or reference: Rate Binder #7 (Illinois State University)

286

Tallahatchie Valley E P A | Open Energy Information  

Open Energy Info (EERE)

Valley E P A Valley E P A Jump to: navigation, search Name Tallahatchie Valley E P A Place Mississippi Utility Id 18447 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png General Power GSA-1 (Class 40) General Power GSA-2 (Class 50) Lighting 1 175 MV Lighting Lighting 2 100 HPS Lighting Lighting 3 250 HPS Lighting Lighting 4 400 MV Lighting Lighting 6 400 MH Lighting Lighting 7 1000 MH Lighting Lighting 8 250 HPS Flood Lighting Residential (Class 22) Residential Average Rates Residential: $0.0951/kWh

287

Effects on the positive electrode of the corrosion of AB{sub 5} alloys in nickel-metal-hydride batteries  

SciTech Connect (OSTI)

Effects of corrosion of MmNi{sub 4.3{minus}x}Mn{sub 0.3}Al{sub 0.4}Co{sub x} alloys (where Mm = Ce 50%, La 30%, Nd 15%, Pr 5%) are evaluated in nickel-metal-hydride (Ni-MH) cells. Particularly, it is shown how Al released by the corroded alloys pollutes the positive electrode, which endures a loss of charging efficiency, due to the formation of a hydrotalcite-like phase stabilized with Al. Furthermore, since Al is eluted from the hydride electrode and is completely trapped in the positive active material, the titration of this element in the positive electrode is a powerful technique for quantification of the corrosion of AB{sub 5} alloys in Ni-MH cells.

Bernard, P. [SAFT, Marcoussis (France). Research Dept.

1998-02-01T23:59:59.000Z

288

QoS and energy efficiency in network wide broadcasting: A MAC layer perspective  

Science Journals Connector (OSTI)

In this paper we investigate the role of medium access control on the performance of network-wide real-time data broadcasting through flooding using three MAC protocols (IEEE 802.11, CPS, and MH-TRACE) in terms of QoS (packet delivery ratio, packet delay, ... Keywords: Energy efficiency, Multi-access communication, Protocols, Quality of Service (QoS), Real-time systems, Speech communication

Bulent Tavli; Wendi B. Heinzelman

2007-12-01T23:59:59.000Z

289

Plant Physiol. (1992) 99, 1381-1387 0032-0889/92/99/1 381/07/$01 .00/0  

E-Print Network [OSTI]

, Universite du Quebec a Montreal, C.P. 8888, Succ. "A", Montreal, Quebec, H3C 3P8 Canada (M.H., J.D., E.R., F.S.); Department of Biology, McGill University, 1205 Avenue Docteur Penfield, Montreal, Quebec, H3A IBI Canada (R.S.D.); and Departement de virologie, Institut Armand-Frappier, 531 Boul. des Prairies, Laval des Rapides, Quebec, H7V 1B7

Sarhan, Fathey

290

From Beads-on-a-String to Colloidal Aggregation:? Novel Crystallization Phenomena in the PEO?SDS System  

Science Journals Connector (OSTI)

Department of Natural Sciences, University of Cyprus, P.O. ... This analysis was performed by displacing free S using concentrated H2SO4 and trapping the evolving H2S gas in a Pb(NO3)2 solution. ... In method A, MSe particles were generated in situ from M2+-coated DHP or (MH2EDTA)2--coated DODAB vesicles by exposure to gaseous H2Se. ...

Epameinondas Leontidis; Tasoula Kyprianidou-Leodidou; Walter Caseri; Kyriacos C. Kyriacou

1999-04-24T23:59:59.000Z

291

Maximal CP and Bounds on the Neutron Electric Dipole Moment from P and CP Breaking  

E-Print Network [OSTI]

We find in theories with spontaneous P and CP violation that symmetries needed to set the tree level strong CP phase to zero can also set all non-zero tree level CP violating phases to the maximal value \\pi / 2 in the symmetry basis simultaneously explaining the smallness of \\bar{\\theta} and the largeness of the CKM CP violating phase. In these models we find the one loop lower bound \\bar{\\theta} > 10^{-11} relevant for early discovery of neutron edm d_n > 10^{-27} ecm. The lower bound relaxes to \\bar{\\theta} > 10^{-13} or d_n > 10^{-29} ecm for the case where the CP phases are non-maximal. Interestingly the spontaneous CP phase appears in the quark sector, not the Higgs sector, and is enabled by a heavy left-right symmetric vectorlike quark family with mass M. These results do not vanish in the decoupling limit of M_{H_2^+} > M \\rightarrow \\infty (where M_{H_2^+} is the mass of heavy Higgs at the parity breaking scale) and the age-old expectation that laws of nature (or its Lagrangian) are parity and matter-antimatter symmetric may be testable by the above predictions and EDM experiments, even if new physics occurs only at see-saw, GUT or Planck scales. There is also a region in parameter space with M_{H_2^+} < M where the above bounds are dampened by the factor (M_{H_2^+}/M)^2. By using flavour symmetries and texture arguments we also make predictions for the CKM phase that arises from the maximal phase on diagonalization to the physical basis. There are no axions predicted in this model.

Ravi Kuchimanchi

2012-03-13T23:59:59.000Z

292

Synthesis Sets for H + C PAMELA GORKIN AND RAYMOND MORTINI  

E-Print Network [OSTI]

(page 287) Synthesis Sets for H + C PAMELA GORKIN AND RAYMOND MORTINI ABSTRACT. We show that every closed set E in the spec- trum of H + C is a weak synthesis set; that is the clo- sure of the ideal J(H + C) \\ M(L ) to be a set of synthesis. Finally we show that for every closed E in M(H + C), the hull k

Mortini, Raymond

293

Search for the Standard Model Higgs Boson at the LEP2 Collider near  

E-Print Network [OSTI]

Search for the Standard Model Higgs Boson at the LEP2 Collider near ps = 183 GeV The ALEPHV. These data are used to look for possible signals from the production of the Standard Model Higgs boson on the mass of the Higgs boson: mH > 87:9 GeV=c2 at 95% con#12;dence level. The ALEPH Collaboration wish

Boyer, Edmond

294

Search for new physics in high pT like-sign dilepton events at CDF II  

DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

We present a search for new physics in events with two high pT leptons of the same electric charge, using data with an integrated luminosity of 6.1 fb-1. The observed data are consistent with standard model predictions. We set 95% C.L. lower limits on the mass of doubly-charged scalars decaying to like-sign dileptons, mH > 190 - 245 GeV/c2, depending on the decay mode and coupling.

Aaltonen, T [Helsinki Inst. of Phys.; Alvarez Gonzalez, B [Oviedo U., Cantabria Inst. of Phys.; Amerio, S [INFN, Padua; Amidei, D [Michigan U.; Anastassov, A [Northwestern U.; Annovi, A [Frascati; Antos, J [Comenius U.; Apollinari, G [Fermilab; Appel, J A [Fermilab; Apresyan, A [Purdue U.; Arisawa, T [Waseda U., Dubna, JINR

2011-10-25T23:59:59.000Z

295

VOLUME 89, NUMBER 2 P H Y S I C A L R E V I E W L E T T E R S 8 JULY 2002 Anomalous Roughening of Hele-Shaw Flows with Quenched Disorder  

E-Print Network [OSTI]

VOLUME 89, NUMBER 2 P H Y S I C A L R E V I E W L E T T E R S 8 JULY 2002 Anomalous Roughening, France (Received 7 December 2001; published 24 June 2002) The kinetic roughening of a stable oil.026102 PACS numbers: 68.35.Ct, 05.40.­a, 47.55.Mh The kinetic roughening of surfaces and interfaces

Ramasco, José Javier

296

math.FA/9810131 Compact endomorphisms of H 1 (D)  

E-Print Network [OSTI]

, is a subset of MH 1 for which there exists a continuous bijection Lm : D ! P (m) such that Lm (0) = m and ?? f(Lm (z)) is analytic on D for each f 2 H 1 (D). Moreover, the map Lm has the form Lm (z) = w \\Lambda lim z + z ff 1 + z ff z for some net z ff ! m in the w*topology, whence ?? f (Lm (z)) = limf( z + z ff 1

Feinstein, Joel

297

star-forming regions, suggesting that the out-er parts of the solar nebula inherited, to a  

E-Print Network [OSTI]

reflect their formation at higher temperatures than for Hale-Bopp, that is, closer to the Sun (14 in the millimetric and submillimetric domains were analyzed with the excitation model of (7, 11), adopting a gas, is the gas-to-dust mass ratio, mH2O is the H2O molecular mass, and ZH2O is the H2O sublimation rate per unit

Meech, Karen Jean

298

Search for Resonant Pair Production of Neutral Long-Lived Particles Decaying to bb-bar in pp-bar Collisions at s?=1.96??TeV  

E-Print Network [OSTI]

(H +X ) ? 1 10 =15 GeVHV=120 GeV, mHM -1 , 3.6 fbOD Observed limit Expected limit SM Higgs FIG. 4 (color online). The expected and observed 95% C.L. limits on #6;H X #4; BRH ! HVHV #4; BR2HV ! b #1;b for each MH studied, mHV 15, 40 Ge...

Baringer, Philip S.; Bean, Alice; Clutter, Justace Randall; Moulik, Tania; Wilson, Graham Wallace

2009-08-13T23:59:59.000Z

299

Energy Savings and Peak Demand Reduction of a SEER 21 Heat Pump vs. a SEER 13 Heat Pump with Attic and Indoor Duct Systems  

SciTech Connect (OSTI)

This report describes results of experiments that were conducted in an unoccupied 1600 square foot house--the Manufactured Housing (MH Lab) at the Florida Solar Energy Center (FSEC)--to evaluate the delivered performance as well as the relative performance of a SEER 21 variable capacity heat pump versus a SEER 13 heat pump. The performance was evaluated with two different duct systems: a standard attic duct system and an indoor duct system located in a dropped-ceiling space.

Cummings, J.; Withers, C.

2014-03-01T23:59:59.000Z

300

Structural Characteristics of Forest Stands Within Home Ranges of Mexican Spotted Owls  

E-Print Network [OSTI]

, J. Iniguez, S. Jojola, E. Kenney, D. Kitterman, J. Kitterman, W. Kunkle, H. Lineiro, K. Maddock, G. Stoddard, J.Todd, V. Ray, and especially A.J. Helgenberg. J.F. Cully, Jr., A.B. Franklin, M.H. Reiser,W, and W. Shepperd and J.K. Dwyer assisted with debugging the habitat data files. R.A. Wilson and B

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

The SCORE and CitySmart Programs: Sustaining Investment in High Performance Buildings in Schools and Cities  

E-Print Network [OSTI]

17 N/A N/A Total 432 143 89 ESL-IC-09-11-22 Proceedings of the Ninth International Conference for Enhanced Building Operations, Austin, Texas, November 17 - 19, 2009 8 Lighting Quality The types of projects completed under the SCORE and City.... Cities and city buildings utilize all lighting technologies available ? incandescent and halogen, fluorescent (linear and CFL), high-intensity discharge (MH, HPS, LPS, MV), LED, cold cathode, and neon. No matter the application, there are almost...

Kleinman, J.; McMinn, S.

302

An Automated Home Made Low Cost Vibrating Sample Magnetometer  

Science Journals Connector (OSTI)

The design and operation of a homemade low cost vibrating sample magnetometer is described here. The sensitivity of this instrument is better than 10 ?2 ? emu and found to be very efficient for the measurement of magnetization of most of the ferromagnetic and other magnetic materials as a function of temperature down to 77 K and magnetic field upto 800 Oe. Both M(H) and M(T) data acquisition are fully automated employing computer and Labview software.

S. Kundu; T. K. Nath

2011-01-01T23:59:59.000Z

303

An Automated Home Made Low Cost Vibrating Sample Magnetometer  

E-Print Network [OSTI]

The design and operation of a homemade low cost vibrating sample magnetometer is described here. The sensitivity of this instrument is better than 10-2 emu and found to be very efficient for the measurement of magnetization of most of the ferromagnetic and other magnetic materials as a function of temperature down to 77 K and magnetic field upto 800 Oe. Both M(H) and M(T) data acquisition are fully automated employing computer and Labview software

Kundu, S

2011-01-01T23:59:59.000Z

304

NMR investigation of atomic ordering in AlxGa1xAs thin films C. Degen, M. Tomaselli, and B. H. Meier*  

E-Print Network [OSTI]

-range order with a modulated composition along specific lattice directions has been found.3 The fully ordered by MOVPE in a horizontal Aixtron 200 reactor at a growth temperature of 923 K and a rate of 1.8 m/h using assembly. Two peaks can be observed in both spectra. A comparison with AlAs Alfa Aesar, 99.9% and GaAs semi

Leonardo, Degiorgi

305

Publications for T.G. Caldwell My ResearcherID: H51292011 at http://www.researcherid.com/rid/H51292011  

E-Print Network [OSTI]

shrublands: Biotic and abiotic processes. Water Resources Research 48, W09551, doi:10.1029/2012WR011963, D.L. Hughson, E.V. McDonald, and D.M. Miller (eds.) The Mojave Desert: Ecosystem Processes, Nottingham, UK. Shafer, D.S., M.H. Young, S.F. Zitzer, T.G. Caldwell and E.V. McDonald (2007), Interrelated

Yang, Zong-Liang

306

3D Multiprocessor with 3D NoC Architecture Based on Tezzaron Technology  

E-Print Network [OSTI]

1 3D Multiprocessor with 3D NoC Architecture Based on Tezzaron Technology M.H Jabbar1,2 , D. Houzet the architecture and implementation of 3D multiprocessor with 3D NoC. The 2 tiers design is based on 16 processors simulation, the purpose of this work is to accurately measure NoC performances in real 3D chip when running

Paris-Sud XI, Université de

307

ALLSMOG: an APEX Low-redshift Legacy Survey for MOlecular Gas. I - molecular gas scaling relations, and the effect of the CO/H2 conversion factor  

E-Print Network [OSTI]

We present ALLSMOG, the APEX Low-redshift Legacy Survey for MOlecular Gas. ALLSMOG is a survey designed to observe the CO(2-1) emission line with the APEX telescope, in a sample of local galaxies (0.01 conversion factor. We find an increase in the H2/HI mass ratio with stellar mass which closely matches semi-analytic predictions. We find a mean molecular gas fraction for ALLSMOG galaxies of MH2/M* = (0.09 - 0.13),...

Bothwell, M S; Cicone, C; Maiolino, R; Mller, P; Aravena, M; De Breuck, C; Peng, Y; Espada, D; Hodge, J A; Impellizzeri, C M V; Martn, S; Riechers, D; Walter, F

2014-01-01T23:59:59.000Z

308

Nuclear Instruments and Methods in Physics Research A 572 (2007) 526527 Radiation-tolerant, red-sensitive CCDs for dark energy investigations  

E-Print Network [OSTI]

designed by the Dark Energy Survey (DES) team for the 4 m Blanco telescope at the Cerro Tolo Inter will carry out a 5000 square-degree survey in five filters to study dark energy. The selection of LBNL CCDs-sensitive CCDs for dark energy investigations N.A. Roe?, C.J. Bebek, K.S. Dawson, J.H. Emes, M.H. Fabricius, J

Dawson, Kyle

309

2004 Fall GTAC Review:2004 Fall GTAC Review: A Monolithic, SelfA Monolithic, Self--Powered SystemPowered System--  

E-Print Network [OSTI]

Technology unbalance between IC fabrication and conventional battery technology (e.g., Li-ion, NiCd, NiMH) l-CapacitorMicro-Fuel Cell Thin-Film Li-ion Battery Li-ion or Li- polymer #12;GEDC Industry Advisory Board, October 2004 Application) l Single configuration: micro-fuel cell (t1); thin film Li-ion battery (t2) l Hybrid

Rincon-Mora, Gabriel A.

310

A SELF-POWERED, SELF-SUSTAINING SYSTEM-ON-CHIP (SOC) SOLUTION POWERED FROM HYBRID MICRO-FUEL CELLS  

E-Print Network [OSTI]

batteries (e.g., Li-ion, NiMH, NiCd, etc.). Therefore, integrating the battery with a power efficient system-on-ship (SOC) solution with fully integrated micro-fuel cell/thin-film lithium-ion battery hybrids. A power scheme is proposed whereby micro-fuel cells charge an in-package thin-film lithium-ion battery, which

Rincon-Mora, Gabriel A.

311

SUSY Predictions for the LHC  

E-Print Network [OSTI]

In the CMSSM we find preferences for sparticle masses that are relatively light. In the NUHM1 the best-fit values for many sparticle masses are even slightly smaller, but with greater uncertainties. We find that at the 95% C.L. all colored particles are in the reach of the LHC. While the light Higgs boson is bounded from above by M_h LHC searches, but might be accessible at the ILC.

S. Heinemeyer

2009-09-25T23:59:59.000Z

312

Hydration and complex formation study on concentrated MCl2 solutions [M=Co(II), Ni(II), Cu(II)] by x?ray diffraction technique  

Science Journals Connector (OSTI)

Concentrated aqueous chloride solutions containing equal amounts of transition metal ions of almost equal ionic radii (Co2+ Ni2+ and Cu2+) have been examined by the x?ray diffraction technique. CoCl2 and Nicl2solutions show distribution curves very similar to each other which leads to the conclusion that the same dominant species should occur in both systems. The analysis of the structure functions can be achieved by considering M(H2O)2+ 6 (M=Co2+ Ni2+) as the dominant species although indication is given in favor of the presence of about 50% of the M(H2O)5Cl+ complex [and the rest M(H2O)2+ 6] in both solutions. The distribution curve of CuCl2solution is markedly different from those of cobalt and nickel. Equatorial positions in the distorted octahedral copper coordination are on the average occupied by about 2.8 water molecules (at 1.95 ) and about 1.2 chloride ions (at 2.25 ). Occupancy of the axial copper positions is discussed though no unique conclusion can be obtained with respect to this point from the scattering data.

Mauro Magini

1981-01-01T23:59:59.000Z

313

METAL HYDRIDE HYDROGEN COMPRESSORS: A REVIEW  

SciTech Connect (OSTI)

Metal hydride (MH) thermal sorption compression is an efficient and reliable method allowing a conversion of energy from heat into a compressed hydrogen gas. The most important component of such a thermal engine the metal hydride material itself should possess several material features in order to achieve an efficient performance in the hydrogen compression. Apart from the hydrogen storage characteristics important for every solid H storage material (e.g. gravimetric and volumetric efficiency of H storage, hydrogen sorption kinetics and effective thermal conductivity), the thermodynamics of the metal-hydrogen systems is of primary importance resulting in a temperature dependence of the absorption/desorption pressures). Several specific features should be optimized to govern the performance of the MH-compressors including synchronisation of the pressure plateaus for multi-stage compressors, reduction of slope of the isotherms and hysteresis, increase of cycling stability and life time, together with challenges in system design associated with volume expansion of the metal matrix during the hydrogenation. The present review summarises numerous papers and patent literature dealing with MH hydrogen compression technology. The review considers (a) fundamental aspects of materials development with a focus on structure and phase equilibria in the metal-hydrogen systems suitable for the hydrogen compression; and (b) applied aspects, including their consideration from the applied thermodynamic viewpoint, system design features and performances of the metal hydride compressors and major applications.

Bowman Jr, Robert C [ORNL] [ORNL; Yartys, Dr. Volodymyr A. [Institute for Energy Technology (IFE)] [Institute for Energy Technology (IFE); Lototskyy, Dr. Michael V [University of the Western Cape, South Africa] [University of the Western Cape, South Africa; Pollet, Dr. B.G. [University of the Western Cape, South Africa

2014-01-01T23:59:59.000Z

314

Higgs Boson Spectra in Supersymmetric Left-Right Models  

E-Print Network [OSTI]

We present a comprehensive analysis of the Higgs boson spectra in several versions of the supersymmetric left--right model based on the gauge symmetry $SU(3)_c \\times SU(2)_L \\times SU(2)_R \\times U(1)_{B-L}$. A variety of symmetry breaking sectors are studied, with a focus on the constraints placed on model parameters by the lightest neutral CP even Higgs boson mass $M_h$. The breaking of $SU(2)_R$ symmetry is achieved by Higgs fields transforming either as triplets or doublets, and the electroweak symmetry breaking is triggered by either bi--doublets or doublets. The Higgs potential is analyzed with or without a gauge singlet Higgs field present. Seesaw models of Type I and Type II, inverse seesaw models, universal seesaw models and an $E_6$ inspired alternate left--right model are included in our analysis. Several of these models lead to the tree--level relation $M_h \\leq \\sqrt{2}\\,m_W$ (rather than $M_h \\leq m_Z$ that arises in the MSSM), realized when the $SU(2)_R$ symmetry breaking scale is of order TeV...

Babu, K S

2014-01-01T23:59:59.000Z

315

Data:2ba424b9-6ef3-4c96-ba45-c8709ca36cb9 | Open Energy Information  

Open Energy Info (EERE)

Energy Ohio Inc Effective date: 20130506 End date if known: Rate name: Rate SE - Mercury Vapor 175 W - Aspen Sector: Lighting Description: Applicable to municipal, county,...

316

Data:C5936b43-9507-4cef-b654-02d2a7a90dd1 | Open Energy Information  

Open Energy Info (EERE)

date if known: Rate name: Private Street and Area Lighting (PSL-06)(175 W Unmetered Mercury Vapor) Sector: Lighting Description: Outdoor Lighting service to individual...

317

Data:284d8c6c-e487-4130-a4c7-09ac686e2ec6 | Open Energy Information  

Open Energy Info (EERE)

End date if known: Rate name: Private Street and Area Lighting (PSL-06) (175 W Metered Mercury Vapor) Sector: Lighting Description: Outdoor Lighting service to individual...

318

INNOVATIVE FOSSIL FUEL FIRED VITRIFICATION TECHNOLOGY FOR SOIL REMEDIATION  

SciTech Connect (OSTI)

This Final Report summarizes the progress of Phases 3,3A and 4 of a waste technology Demonstration Project sponsored under a DOE Environmental Management Research and Development Program and administered by the U.S. Department of Energy National Energy Technology Laboratory-Morgantown (DOE-NETL) for an ''Innovative Fossil Fuel Fired Vitrification Technology for Soil Remediation''. The Summary Reports for Phases 1 and 2 of the Program were previously submitted to DOE. The total scope of Phase 3 was to have included the design, construction and demonstration of Vortec's integrated waste pretreatment and vitrification process for the treatment of low level waste (LLW), TSCA/LLW and mixed low-level waste (MLLW). Due to funding limitations and delays in the project resulting from a law suit filed by an environmental activist and the extended time for DOE to complete an Environmental Assessment for the project, the scope of the project was reduced to completing the design, construction and testing of the front end of the process which consists of the Material Handling and Waste Conditioning (MH/C) Subsystem of the vitrification plant. Activities completed under Phases 3A and 4 addressed completion of the engineering, design and documentation of the MH/C System such that final procurement of the remaining process assemblies can be completed and construction of a Limited Demonstration Project be initiated in the event DOE elects to proceed with the construction and demonstration testing of the MH/C Subsystem. Because of USEPA policies and regulations that do not require treatment of low level or low-level/PCB contaminated wastes, DOE terminated the project because there is no purported need for this technology.

J. Hnat; L.M. Bartone; M. Pineda

2001-10-31T23:59:59.000Z

319

Experimental and theoretical studies of nonclassical d{sup 0} cyclopentadienyl polyhydride complexes of molybdenum and tungsten  

SciTech Connect (OSTI)

Low-temperature protonation of compounds Cp{sup *}MH{sub 5}(PMe{sub 3}) (M = Mo, 1; W, 2) by HBF{sub 4}{center_dot}Et{sub 2}O in CD{sub 2}Cl{sub 2} or CDFCl{sub 2} affords the thermally unstable hexahydride derivatives [Cp{sup *}MH{sub 6}(PMe{sub 3})]{sup +} (M = Mo, 3; W, 4). The corresponding protonation of 1- and 2-d{sup 5} affords 3- and 4-d{sup 5}, respectively. The {Delta}{delta} on going from H{sub 6} to HD{sub 5} is small for both compounds, but positive for 3 and negative for 4, and no isotopic perturbation of resonance (IPR) is observed. The T{sub 1min} at 400 MHz for [Cp{sup *}MH{sub 6}(PMe{sub 3})]{sup +} apparently doubles on going from Mo to W (52 ms for 3 and approximately 100 ms for 4). Optimized geometries at the restricted Hartree-Fock (RHF) and second-order Moeller-Plesset (MP2) levels and energy calculations at higher levels of theory show that these complexes are dihydrogen complexes [Cp{sup *}M(H{sub 2})(H){sub 4}(PR{sub 3})]{sup +}. The theoretical determination of a dihydrogen complex is consistent with the fact that the experimental T{sub 1min} values lie within the expected range for dihydrogen complexes. Examination of the potential energy surface at the MP2 level gives two mechanisms for hydride dihydrogen ligand about its axis. The barrier for the hydride exchange ({approximately}4 kcal/mol) is consistent with the inability to decoalesce the proton NMR signal.

Bayse, C.A.; Hall, M.B. [Texas A and M Univ., College Station, TX (United States). Dept. of Chemistry] [Texas A and M Univ., College Station, TX (United States). Dept. of Chemistry; Pleune, B. [Univ. of Maryland, College Park, MD (United States). Dept. of Chemistry and Biochemistry] [Univ. of Maryland, College Park, MD (United States). Dept. of Chemistry and Biochemistry; Poli, R. [Univ. de Bourgogne, Dijon (France)] [Univ. de Bourgogne, Dijon (France)

1998-09-14T23:59:59.000Z

320

Origin of the metallicity distribution of the NGC 5128 stellar halo  

E-Print Network [OSTI]

Recent {\\it Hubble Space Telescope} photometry in the nearby elliptical galaxy NGC 5128 shows that its halo field star population is dominated by moderately metal-rich stars, with a peak at [m/H] $\\simeq$ -0.4 and with a very small fraction of metal-poor ([m/H] $<$ -1.0) stars. In order to investigate the physical processes which may have produced this metallicity distribution function (MDF), we consider a model in which NGC 5128 is formed by merging of two major spiral galaxies. We find that the halo of an elliptical formed this way is predominantly populated by moderately metal-rich stars with [m/H] $\\sim$ -0.4 which were initially within the outer parts of the two merging discs and were tidally stripped during the merger. To match the NGC 5128 data, we find that the progenitor spiral discs must have rather steep metallicity gradients similar to the one defined by the Milky Way open clusters, as well as sparse metal-poor haloes (5% or less of the disc mass). Very few stars from the central bulges of the spiral galaxies end up in the halo, so the results are not sensitive to the relative sizes (bulge-to-disc ratios) or metallicities of the initial bulges. Finally, we discuss the effects on the globular cluster system (GCS). The emergent elliptical will end up with metal-poor halo clusters from the original spiral haloes, but with moderately metal-rich halo stars from the progenitor discs, thus creating a mean offset between the MDFs of the halo stars and the GCS.

Kenji Bekki; William E. Harris; Gretchen L. H. Harris

2002-12-27T23:59:59.000Z

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

General trend for pressurized superconducting hydrogen-dense materials  

SciTech Connect (OSTI)

The long-standing prediction that hydrogen can assume a metallic state under high pressure, combined with arguments put forward more recently that this state might even be superconducting up to high temperatures, continues to spur tremendous research activities toward the experimental realization of metallic hydrogen. These efforts have however so far been impeded by the enormous challenges associated with the exceedingly large required pressure. Hydrogen-dense materials, of the MH{sub 4} form (where M can be, e.g., Si, Ge, or Sn) or of the MH{sub 3} form (with M being, e.g., Al, Sc, Y, or La), allow for the rather exciting opportunity to carry out a proxy study of metallic hydrogen and associated high-temperature superconductivity at pressures within the reach of current techniques. At least one experimental report indicates that a superconducting state might have been observed already in SiH{sub 4}, and several theoretical studies have predicted superconductivity in pressurized hydrogen-rich materials; however, no systematic dependence on the applied pressure has yet been identified so far. In the present work, we have used first-principles methods in an attempt to predict the superconducting critical temperature (T{sub c}) as a function of pressure (P) for three metal-hydride systems of the MH{sub 3} form, namely ScH{sub 3}, YH{sub 3}, and LaH{sub 3}. By comparing the obtained results, we are able to point out a general trend in the T{sub c}-dependence on P. These gained insights presented here are likely to stimulate further theoretical studies of metallic phases of hydrogen-dense materials and should lead to new experimental investigations of their superconducting properties.

Kim, D. Y.; Scheicher, R. H.; Mao, Ho-kwang; Kang, T. W.; Ahuja, R.

2010-01-01T23:59:59.000Z

322

Alvaro_Report.PDF  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Field Operations Program Field Operations Program Chevrolet S-10 Electric with NiMH Battery PERFORMANCE CHARACTERIZATION U.S DEPARTMENT OF ENERGY Agreement No. DE-FC07-96ID13474 ELECTRIC TRANSPORTATION DIVISION Report prepared by: Alvaro Mendoza, Jordan Smith, Juan Argueta, Michel Wehrey, Tom Knipe. September 1999 2 DISCLAIMER OF WARRANTIES AND LIMITATION OF LIABILITIES THIS REPORT WAS PREPARED BY THE ELECTRIC TRANSPORTATION DIVISION OF SOUTHERN CALIFORNIA EDISON, A SUBSIDIARY OF EDISON INTERNATIONAL. NEITHER THE ELECTRIC TRANSPORTATION DIVISION OF SOUTHERN CALIFORNIA EDISON, SOUTHERN CALIFORNIA EDISON, EDISON INTERNATIONAL, NOR ANY PERSON WORKING FOR OR ON BEHALF OF ANY OF THEM MAKES ANY WARRANTY OR REPRESENTATION, EXPRESS OR IMPLIED,

323

ORISE: REAC/TS Courses in Medical Management of Radiation Emergencies 2013-14  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

K. Livingston PhD K. Livingston PhD Radiobiology/Cytogenetics Technical Director, REAC/TS Cytogenetic Biodosimetry Laboratory (CBL) Gail Mack-Bramlette REAC/TS Course Registrar Becky Murdock REAC/TS Education Coordinator and Radiation Accident Registry Technician Steve Sugarman MS CHP CHCM REAC/TS Health Physics Project Manager REAC/TS Cytogenetic Biodosimetry Laboratory (CBL) Coordinator Richard Toohey PhD, CHP REAC/TS Senior Scientific Advisor M.H. Chew & Associates, Inc. Name: Last First Middle Initial Degree/Certification

324

An integrated genetics approach to systemic low-dose radiation responses  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

integrated genetics approach to systemic low-dose radiation responses integrated genetics approach to systemic low-dose radiation responses G. Huang 1 , Y. Huang 1 , D.H. Nguyen 1 , K. Bjornstad 1 , C. Rosen 1 , P. Chang 2 , R. DelRosario 3 , Do Yup Lee 1 , B. Bowen 1 , W. Reindl 1 , J. Mott 1 , A. Balmain 3 , M.H. Barcellos-Hoff 4 , Joe W Gray 1,5 , Mina Bissell 1 , Gary Karpen 1 , T. Northen 1 , E. A. Blakely 1 , J. H. Mao 1 1 Life Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, CA 2 SRI International, Menlo Park, CA

325

Jet conversions in a quark-gluon plasma  

E-Print Network [OSTI]

. Wang, Phys. Rev. C 58, 2321 (1998). [9] R. C. Hwa and C. B. Yang, Phys. Rev. C 67, 034902 (2003); 67, 064902 (2003). [10] V. Greco, C. M. Ko, and P. Le?vai, Phys. Rev. Lett. 90, 202302 (2003); Phys. Rev. C 68, 034904 (2003). [11] R. J. Fries, B. Mu?ller... the one given by the lowest order QCD is needed to account for the observed similar ratios in central Au+Au and p+p collisions at the same energy. Implications of our results are discussed. DOI: 10.1103/PhysRevC.75.051901 PACS number(s): 12.38.Mh, 25...

Liu, W.; Ko, Che Ming; Zhang, B. W.

2007-01-01T23:59:59.000Z

326

Triangular flow in heavy ion collisions in a multiphase transport model  

E-Print Network [OSTI]

, S. A. Bass, and B. Mu?ller, Phys. Rev. C 82, 041901 (2010). [16] B. Schenke, S. Jeon, and C. Gale, Phys. Rev. Lett. 106, 042301 (2011). [17] J. Xu and C. M. Ko, Phys. Rev. C 83, 021903(R) (2011). [18] Z. W. Lin, C. M. Ko, B. A. Li, B. Zhang... correlations in both central and midcentral collisions. DOI: 10.1103/PhysRevC.84.014903 PACS number(s): 25.75.Ld, 12.38.Mh, 24.10.Lx I. INTRODUCTION Studies of anisotropic azimuthal flows in heavy ion col- lisions at the Relativistic Heavy Ion Collider...

Xu, Jun; Ko, Che Ming.

2011-01-01T23:59:59.000Z

327

An investigation of the effects of luminaire mounting height on roadside sign placement and visibility  

E-Print Network [OSTI]

320 340 280 320 400 400 280 390 340 310 TABLE V-2 SUMMARY OF DATA OBSERVER 2 Legibility Distance in Ft. 30 M. -H 40 M-H Bright-No Opposing Dim-Dim Opposing Brgght-No Opposing Dim-Dim Opposing 12. 5 0 -12. 5 12. 5 0 -12. 5 12. 5 0 -12. 5...AN INVESTiGATION OF THE EFFE( TS OF LUMINAIRE MOJNIING HEIGHT ON ROADSIDE SIGN PLACEMENT AND VISiBILITY A Thesis By NED E. WALTON Submitted to the Graduate College of the Texas A&M University in partial fulfrllment of the requirements...

Walton, Ned Ephram

1966-01-01T23:59:59.000Z

328

Spot-spraying Johnsongrass.  

E-Print Network [OSTI]

of naphtha and diesel fuel oil is the oil spray most generally used. Various other oil mixtures may be used for economy, for increased contact toxicity, or for a combination of contact toxicity and residual effectiveness. Oil sprays kill on contact... mixture of 40 pounds of sodium TCA and 20 pounds of sodium dalapon can be used for spot-treating sparsely infested cotton fields. It is a knock-out spray under some conditions. Maleic hydrazide (MH-30) is a translocated growth inhibitor with no residual...

Rea, H. E.

1958-01-01T23:59:59.000Z

329

A Measurement of Time-Averaged Aerosol Optical Depth using Air-Showers Observed in Stereo by HiRes  

E-Print Network [OSTI]

.F. Hanlon,1 C.M. Hoffman,2 M.H. Holzscheiter,2 G.A. Hughes,6 P. H¨untemeyer,1 C.C.H. Jui,1 M.A. Kirn,3 BZvi,5 D.R. Bergman,6 J.H. Boyer,4 C.T. Cannon,1 Z. Cao,1 B.M. Connolly,5 Y. Fedorova,1 C.B. Finley,5 W K. Reil,1 M.D. Roberts,8 S.R. Schnetzer,6 M. Seman,4 G. Sinnis,2 J.D. Smith,1 P. Sokolsky,1 C. Song

330

The thermodynamic properties of some aminophosphonic acids  

E-Print Network [OSTI]

to the activity of the species. The activity of a substance is related to its molality by the product a. = v. m. i where y. is the activitv coefficient of species i. Since the activity of water in dilute solutions can be con- sidered to be constant... "B (4) e + mH+ mOH VHB it is apparent that (4) is of the form of a straight line. The activity coefficients, y~ and yB-, are related to the ionic strength of the solution. This suggests that the thermodynamic ionization constant must be obtained...

Austin, James Richard

2012-06-07T23:59:59.000Z

331

Probing minimal supersymmetry at the LHC with the Higgs boson masses  

Science Journals Connector (OSTI)

The ATLAS and CMS collaborations report indications of a Higgs boson at Mh~125GeV. In addition, CMS data show a tenuous bump in the ZZ channel, at about 320GeV. We make the bold assumption that it might be the indication of a secondary line corresponding to the heaviest scalar Higgs boson of minimal supersymmetry, H, and discuss the viability of this hypothesis. We discuss also the case of a heavier H. The relevance of the decay channel is underlined.

L Maiani; A D Polosa; V Riquer

2012-01-01T23:59:59.000Z

332

Search for Higgs Boson Production in Dilepton and Missing Energy Final States with 5.4??fb-1 of pp Collisions at s=1.96??TeV  

Science Journals Connector (OSTI)

A search for the standard model Higgs boson is presented using events with two charged leptons and large missing transverse energy selected from 5.4??fb-1 of integrated luminosity in pp collisions at s=1.96??TeV collected with the D0 detector at the Fermilab Tevatron collider. No significant excess of events above background predictions is found, and observed (expected) upper limits at 95% confidence level on the rate of Higgs boson production are derived that are a factor of 1.55 (1.36) above the predicted standard model cross section at mH=165??GeV.

V. M. Abazov et al. (D0 Collaboration)

2010-02-12T23:59:59.000Z

333

An experimental investigation of a large-flange, thin-web, tapered beam  

E-Print Network [OSTI]

. Dunlap, H. E. Fairbanks, and 8. M. Gallaway for their generous help with the instrumentation; and Mr. T. J. Meiller for his suggestions and assistance with the fabrication of the test specimen. I also wish to thank Professor Alfred E. Cronk for his... = ? I + tano& M 2 h The average stress in the flange is M f =, without taper f hAf M 2 and f = ? 1 + tan o( with taper. hAf Therefore, the maximum fiber stress would be, ff = ? + Mh M + tenor -1 - - ? (5) 2 MAX 21 hAf The assumptions in Equation...

Duncan, John Van

2012-06-07T23:59:59.000Z

334

Svar / answer1001: Mass balance in + production = out + change inside system  

E-Print Network [OSTI]

PPc = 0. b. Qb = Qa + mS·[ cS·(0 - T°) + mH + cW·(15-0)] Example: abcde = 33102 Qa = 4680 kJ; Qb = 4680 kJ + 8066 kJ = 12746 kJ Svar / answer 1004: = cp/cv. a. Polytropic processes: p·V = constant (course-3 = - p2·(V3 - V2) = - p2·((z+b)·R·T1/p1 - R·T2/p2) = -R·(T1 - T2) using R·T3/p3 = R·T1/p1 · p1/p3 = R·T1

Zevenhoven, Ron

335

PET 424304 2013 Exercises 1+2 of 4 17 Jan + 31 Jan 2013 1. 1kg ice at 263 K 1 kg water at 293 K. Heat Q at T = T is supplied by the surroundings.  

E-Print Network [OSTI]

. Heat Q at T = T° is supplied by the surroundings. Specific heat ice : ci = 2,14 kJ/(kgK); water cw = 4,18 kJ/(kgK) melting heat mH = 333,4 kJ/kg 2nd Law: m.sin + Qin/Tin + Sgen = dS/dt + m.sout + Qout)·cw. = 438,4 kJ (per kg) S/m = s = ci·ln(273/263) + melth / 273 + cw·ln(293/273) = 1,6 kJ/(kgK) using

Zevenhoven, Ron

336

Technical review and summary of soil stabilization methods  

E-Print Network [OSTI]

method ~ (16) e IXised numbers refer to rofcrunces listed in Seotion X, MhLLog rcphy s Two theories, one by proctor and the other by Hogentoglex hove been advanced and used to explain what action oocuro when so%3. (4) is oonpacted ~ i...~tor , in exylcining the theory of soil conpaction~ (1&) states that conpaction is the act oi fox'cing thc fine grains of soil irto the voids between the largex grains, Xn thin process water is introduced into che coil to lubricate the soil particles, and thus help...

Flatt, Douglas Evans

2012-06-07T23:59:59.000Z

337

Elastic and anelastic relaxations associated with phase transitions in EuTiO3  

E-Print Network [OSTI]

the parent material showed the same form of heat capacity anomaly as originally reported by Bussmann-Holder et al.15. Following Bussman-Holder et al.15 (their Figure 2) Bettis et al.16 have argued that the free energy 5 potential governing the soft mode... . Bussmann-Holder, J. Khler, R. K. Kremer, and J. M. Law, Phys. Rev. B 83, 212102 (2011). 16J. L. Bettis, M.-H. Whangbo, J. Khler, A. Bussmann-Holder, and A. R. Bishop, Phys. Rev. B 84, 184114 (2011). 17D. S. Ellis, H. Uchiyama, S. Tsutsui, K. Sugimoto...

Spalek, Leszek J.; Saxena, Siddharth S.; Panagopoulos, Christos; Katsufuji, Takuro; Schiemer, Jason A.; Carpenter, Michael A.

2014-08-29T23:59:59.000Z

338

Antibiotic Resistance Mechanisms Inform Discovery: Identification and Characterization of a Novel Amycolatopsis Strain Producing Ristocetin  

E-Print Network [OSTI]

sequencing facility at the Department of 177 Biochemistry, University of Cambridge using a combined Illumina MiSeq and Roche 454 sequencing 178 approach. Assembly using the 454 GS De Novo Assembler (v.2.8) produced a draft sequence of 9.3 179 Mb in 149... of soil actinomycetes. J. Ferment. Technol. 65:501-509. 439 20. Atlas RM. 2004. Handbook of microbiological media, CRC press. 440 21. Medema MH, Blin K, Cimermancic P, de Jager V, Zakrzewski P, Fischbach MA, Weber 441 T, Takano E, Breitling R. 2011...

Truman, Andrew W.; Kwun, Min Jung; Cheng, Jinhua; Yang, Seung Hwan; Suh, Joo-Won; Hong, Hee-Jeon

2014-07-16T23:59:59.000Z

339

Measurement of the Higgs boson mass with the ATLAS detector  

E-Print Network [OSTI]

A summary of the latest results on the combined measurement of the Higgs boson mass in the H-> ZZ->4l and the H ->gamma gamma decay channels with the ATLAS detector is presented. The analysis uses 25 fb-1 of pp collision data recorded by the ATLAS detector at the CERN Large Hadron Collider at centre-of-mass energies of 7 TeV and 8 TeV during 2011 and 2012. The combined measured value of the Higgs boson mass is mH=125.36+- 0.37(stat)+- 0.18(syst) GeV.

Garay Walls, F M; The ATLAS collaboration

2014-01-01T23:59:59.000Z

340

Dark photons and resonant monophoton signatures in Higgs boson decays at the LHC  

E-Print Network [OSTI]

Motivated by dark-photon $\\bar{\\gamma}$ scenarios extensively considered in the literature, we explore experimentally allowed models where the Higgs boson coupling to photon and dark photon $H\\gamma\\bar{\\gamma}$ can be enhanced. Correspondingly, large rates for the $H\\to \\gamma\\bar \\gamma$ decay become plausible, giving rise to one monochromatic photon with $E^{\\gamma}\\simeq m_H/2$ (i.e., more than twice the photon energy in the rare standard-model decay $H\\to \\gamma Z\\to\\gamma\\bar\

Emidio Gabrielli; Matti Heikinheimo; Barbara Mele; Martti Raidal

2014-09-23T23:59:59.000Z

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Magnetization of in situ multifilamentary superconducting Nb/sub 3/Sn-Cu composites  

SciTech Connect (OSTI)

Magnetic properties are reported for in situ superconducting Nb/sub 3/Sn composites that have exhibited attractive electrical properties and superior mechanical characteristics. Magnetization measurements were conducted up to 4 T at 4.2 K on a variety of samples of different sizes and twist pitches, and the results are presented in absolute M-H curves and losses per cycle. It is observed that the magnetization of such composites is generally proportional to the size of the wire (approx. 0.25 to 0.51 mm) rather than the fiber size (approx. 10/sup -7/ m), which indicates a strong coupling effect among Nb/sub 3/Sn fibers.

Shen, S.S.; Verhoeven, J.D.

1980-01-01T23:59:59.000Z

342

The lysis genes of bacteriophage 21: structure and function  

E-Print Network [OSTI]

(Campbell and Rolfe, 1975, Garret et al. , 1981). The most distal gene in the lysis "overlappon", le, is of unknown function and is required for lysis only under conditions of high osmolarity such as 10mH HgC12 (Young et al. , 1979). The fl gene encodes.... As mentioned above, respiratory poisons such as cyanide or dinitrophenol have been shown to trigger pg pr'ematurely in the lytic cycle, presumably by subverting the delayed action timing of pS (Campbell and Rolfe, 1975, Garret et al. , 1981). This model...

Bonovich, Maria Teresa

2012-06-07T23:59:59.000Z

343

W W W . Q I A G E N . C O M Scoring Sheet --The PACT Suite  

E-Print Network [OSTI]

Lithium chloride, 0.1M Na acetate pH 5, 20% PEG 6000 A10 1,B4 0.2M Magnesium chloride, 0.1M Na acetate p acetate pH 5, 20% PEG 6000 A8 1,B2 0.2M Ammonium chloride, 0.1M Na acetate pH 5, 20% PEG 6000 A9 1,B3 0.2MH 5, 20% PEG 6000 A11 1,B5 0.2M Calcium chloride, 0.1M Na acetate pH 5, 20% PEG 6000 A12 1,B6 0.01M

Hill, Chris

344

The cardiac output response and the oxygen cost of increased work of breathing  

E-Print Network [OSTI]

. By back extrapolation from the measured values, Liljestrand estimated the oxygen cost of breathing at rest to be about 0. 5 ml Op per liter of ventilation. This resting value was later substantiated by Neilsen ( 1936). In addition, Nei lsen also...-smokers and free from any 20 WORlC 8. 1750 cal VOLUME 1142 el s M*X IHSP PRE -8. 48 cwH20 MAX EXP PRE 2 ' 22 cMH2Q Figure 4. Work of breathing measurement of a single breath at rest. The shaded and black areas to the left of the base pressure (-4. 5 cm...

Krause, Kevin Michael

1989-01-01T23:59:59.000Z

345

Implication on Higgs invisible width in light of the new CDMS result  

E-Print Network [OSTI]

With the assumption that the dominant diagram in supersymmetry for the spin-independent cross section of the dark matter particle is due to Higgs boson exchange, we obtain an upper limit on the Higgs-dark-matter coupling based on the new result of the CDMSII Collaborations. We then obtain an upper limit on the invisible width of the Higgs boson, numerically it is less than 20-120 MeV for $m_h \\simeq 120 - 180$ GeV. Implications for Higgs boson search are also discussed.

Kingman Cheung; Tzu-Chiang Yuan

2009-12-23T23:59:59.000Z

346

Probing for Invisible Higgs Decays with Global Fits  

E-Print Network [OSTI]

We demonstrate by performing a global fit on Higgs signal strength data that large invisible branching ratios Br_{inv} for a Standard Model (SM) Higgs particle are currently consistent with the experimental hints of a scalar resonance at the mass scale m_h ~ 124 GeV. For this mass scale, we find Br_{inv} invisible branching ratio to be experimentally supported. We examine in some detail how our conclusions and method are affected when a scalar resonance at this mass scale has couplings deviating from the SM ones.

Jose R. Espinosa; Margarete Muhlleitner; Christophe Grojean; Michael Trott

2012-05-30T23:59:59.000Z

347

SUSY Predictions for and from the LHC  

E-Print Network [OSTI]

On the basis of frequentist analyses of experimental constraints from electroweak precision data, (g-2)_mu, B-physics and cosmological data, we predict the masses of Higgs bosons and SUSY particles of the CMSSM, NUHM1, VCMSSM and mSUGRA. In the CMSSM, NUHM1 and VCMSSM we find preferences for sparticle masses that are relatively light, leading to good prospects for the LHC and the ILC. Including first data from SUSY searches at the LHC leads to an increase of the preferred sparticle mass scales, but improves the consistency of the model predictions for M_h with the LEP exclusion bounds.

S. Heinemeyer

2011-03-04T23:59:59.000Z

348

Batteries - EnerDel Lithium-Ion Battery  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

EnerDel/Argonne Advanced High-Power Battery for Hybrid Electric Vehicles EnerDel/Argonne Advanced High-Power Battery for Hybrid Electric Vehicles EnerDel lithium-ion battery The EnerDel Lithium-Ion Battery The EnerDel/Argonne lithium-ion battery is a highly reliable and extremely safe device that is lighter in weight, more compact, more powerful and longer-lasting than the nickel-metal hydride (Ni-MH) batteries in today's hybrid electric vehicles (HEVs). The battery is expected to meet the U.S. Advanced Battery Consortium's $500 manufacturing price criterion for a 25-kilowatt battery, which is almost a sixth of the cost to make comparable Ni-MH batteries intended for use in HEVs. It is also less expensive to make than comparable Li-ion batteries. That cost reduction is expected to help make HEVs more competitive in the marketplace and enable consumers to receive an immediate payback in

349

Data:89f6d69a-85f5-4a51-936d-0f72768c0a56 | Open Energy Information  

Open Energy Info (EERE)

9f6d69a-85f5-4a51-936d-0f72768c0a56 9f6d69a-85f5-4a51-936d-0f72768c0a56 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Nueces Electric Coop, Inc Effective date: 2009/11/20 End date if known: Rate name: Security/Street Light Service- 1000w MH Sector: Lighting Description: *Security/Street Light Service is available to Members, municipalities and governmental authorities in accordance with the Cooperative's Service Rules and Regulations for pole mounted area security and street lighting near the Cooperative's electric distribution lines with existing transformers. MV = Mercury Vapor; HPS = High Pressure Sodium; MH = Metal Halide; X= Cobra Head assembly.

350

INNOVATIVE FOSSIL FUEL FIRED VITRIFICATION TECHNOLOGY FOR SOIL REMEDIATION  

SciTech Connect (OSTI)

This Summary Report summarizes the progress of Phases 3, 3A and 4 of a waste technology Demonstration Project sponsored under a DOE Environmental Management Research and Development Program and administered by the U.S. Department of Energy National Energy Technology Laboratory-Morgantown (DOE-NETL) for an ''Innovative Fossil Fuel Fired Vitrification Technology for Soil Remediation''. The Summary Reports for Phases 1 and 2 of the Program were previously submitted to DOE. The total scope of Phase 3 was to have included the design, construction and demonstration of Vortec's integrated waste pretreatment and vitrification process for the treatment of low level waste (LLW), TSCA/LLW and mixed low-level waste (MLLW). Due to funding limitations and delays in the project resulting from a law suit filed by an environmental activist and the extended time for DOE to complete an Environmental Assessment for the project, the scope of the project was reduced to completing the design, construction and testing of the front end of the process which consists of the Material Handling and Waste Conditioning (MH/C) Subsystem of the vitrification plant. Activities completed under Phases 3A and 4 addressed completion of the engineering, design and documentation of the Material Handling and Conditioning System such that final procurement of the remaining process assemblies can be completed and construction of a Limited Demonstration Project be initiated in the event DOE elects to proceed with the construction and demonstration testing of the MH/C Subsystem.

J. Hnat; L.M. Bartone; M. Pineda

2001-07-13T23:59:59.000Z

351

Discovery of Large Molecular Gas Reservoirs in Post-Starburst Galaxies  

E-Print Network [OSTI]

Post-starburst (or "E+A") galaxies are characterized by low H$\\alpha$ emission and strong Balmer absorption, suggesting a recent starburst, but little current star formation. Although many of these galaxies show evidence of recent mergers, the mechanism for ending the starburst is not yet understood. To study the fate of the molecular gas, we search for CO (1-0) and (2-1) emission with the IRAM 30m and SMT 10m telescopes in 32 nearby ($0.01M(H_2)=10^{8.6}$-$10^{9.8} M_\\odot$ and molecular gas mass to stellar mass fractions of $\\sim10^{-2}$-$10^{-0.5}$, comparable to those of star-forming galaxies. The large amounts of molecular gas rule out complete gas consumption, expulsion, or starvation as the primary mechanism that ends the starburst in these galaxies. The upper limits on $M(H_2)$ for th...

French, K Decker; Zabludoff, Ann; Narayanan, Desika; Shirley, Yancy; Walter, Fabian; Smith, John-David; Tremonti, Christy A

2015-01-01T23:59:59.000Z

352

Treatment of nitrate-rich water in a baffled membrane bioreactor (BMBR) employing waste derived materials  

Science Journals Connector (OSTI)

Abstract Nitrate removal in submerged membrane bioreactors (MBRs) is limited as intensive aeration (for maintaining adequate dissolved oxygen levels and for membrane scouring) deters the formation of anoxic zones essential for biological denitrification. The present study employs baffled membrane bioreactor (BMBR) to overcome this constraint. Treatment of nitrate rich water (synthetic and real groundwater) was investigated. Sludge separation was achieved using ceramic membrane filters prepared from waste sugarcane bagasse ash. A complex external carbon source (leachate from anaerobic digestion of food waste) was used to maintain an appropriate C/N ratio. Over 90% COD and 95% NO3N reduction was obtained. The bagasse ash filters produced a clear permeate, free of suspended solids. Sludge aggregates were observed in the reactor and were linked to the high extracellular polymeric substances (EPS) content. Lower sludge volume index (40mL/g compared to 150mL/g for seed sludge), higher settling velocity (47m/h compared to 10m/h for seed sludge) and sludge aggregates (0.7mm aggregates compared to <0.2mm for seed sludge) was observed. The results demonstrate the potential of waste-derived materials viz. food waste leachate and bagasse ash filters in water treatment.

Subhankar Basu; Saurabh K. Singh; Prahlad K. Tewari; Vidya S. Batra; Malini Balakrishnan

2014-01-01T23:59:59.000Z

353

LHCD and ICRF heating experiments in H-mode plasmas on EAST  

SciTech Connect (OSTI)

An ICRF system with power up to 6.0 MW and a LHCD system up to 4MW have been applied for heating and current drive experiments on EAST. Intensive lithium wall coating was intensively used to reduce particle recycling and Hydrogen concentration in Deuterium plasma, which is needed for effective ICRF and LHCD power absorption in high density plasmas. Significant progress has been made with ICRF heating and LHW current drive for realizing the H-mode plasma operation in EAST. In 2010, H-mode was generated and sustained by LHCD alone, where lithium coating and gas puffing launcher mouth were applied to improve the LHCD power coupling and penetration into the core plasmas at high density of H-modes. During the last two experimental campaigns, ICRF Heating experiments were carried out at the fixed frequency of 27MHz, achieving effective ions and electrons heating with the H Minority Heating (H-MH) mode, where electrons are predominantly heated by collisions with high energy minority ions. The H-MH mode gave the best plasma performance, and realized H-mode alone in 2012. Combination of ICRF and LHW power injection generated the H-mode plasmas with various ELMy characteristics. The first successful application of the ICRF Heating in the D (He3) plasma was also achieved. The progress on ICRF heating, LHCD experiments and their application in achieving H-mode operation from last two years will be discussed in this report.

Zhang, X. J.; Zhao, Y. P.; Wan, B. N.; Ding, B. J.; Xu, G. S.; Gong, X. Z.; Li, J. G. [Institute of Plasma Physics, Chinese Academy of Sciences, Hefei 230031 (China); Lin, Y.; Wukitch, S. [MIT Plasma Science and Fusion Center, Cambridge, MA 02139 (United States); Taylor, G. [Princeton Plasma Physics Laboratory (United States); Noterdaeme, J. M. [Max-Planck Institute for Plasma Physics, D-85748, Garching, Germany and University of Gent (Belgium); Braun, F. [Max-Planck Institute for Plasma Physics, D-85748, Garching (Germany); Magne, R.; Litaudon, X. [CEA, IRFM, F-13108 Saint-Paul Lez Durance (France); Kumazawa, R.; Kasahara, H. [National Institute for Fusion Science, Toki (Japan); Collaboration: EAST Team

2014-02-12T23:59:59.000Z

354

Search for WH associated production in pp collisions at s=1.96??TeV  

Science Journals Connector (OSTI)

This report describes a search for associated production of W and Higgs bosons based on data corresponding to an integrated luminosity of L?5.3??fb-1 collected with the D0 detector at the Fermilab Tevatron pp Collider. Events containing a W??? candidate (with ? corresponding to e or ?) are selected in association with two or three reconstructed jets. One or two of the jets are required to be consistent with having evolved from a b quark. A multivariate discriminant technique is used to improve the separation of signal and backgrounds. Expected and observed upper limits are obtained for the product of the WH production cross section and branching ratios and reported in terms of ratios relative to the prediction of the standard model as a function of the mass of the Higgs boson (MH). The observed and expected 95%C.L. upper limits obtained for an assumed MH=115??GeV are, respectively, factors of 4.5 and 4.8 larger than the value predicted by the standard model.

V. M. Abazov et al. (D0 Collaboration)

2012-08-13T23:59:59.000Z

355

Search for the dark photon and the dark Higgs boson at Belle  

E-Print Network [OSTI]

The dark photon, $A^\\prime$, and the dark Higgs boson, $h^\\prime$, are hypothetical constituents featured in a number of recently proposed Dark Sector Models. Assuming prompt decays of both dark particles, we search for their production in the so-called Higgs-strahlung channel, $e^+e^- \\rightarrow A^\\prime h'$, with $h^\\prime \\rightarrow A^\\prime A^\\prime$. We investigate ten exclusive final-states with $A^\\prime \\rightarrow e^+e^-$, $\\mu^+\\mu^-$, or $\\pi^+\\pi^-$, in the mass ranges $0.1$~GeV/$c^2$~$< m_{A^\\prime} < 3.5$~GeV/$c^2$ and $0.2$~GeV/$c^2$~$< m_{h'} < 10.5$~GeV/$c^2$. We also investigate three inclusive final-states, $2(e^+e^-)X$, $2(\\mu^+\\mu^-)X$, and $(e^+e^-)(\\mu^+\\mu^-)X$, where $X$ denotes a dark photon candidate detected via missing mass, in the mass ranges $1.1$~GeV/$c^2$~$< m_{A^\\prime} < 3.5$~GeV/$c^2$ and $2.2$~GeV/$c^2$~$< m_{h'} < 10.5$~GeV/$c^2$. Using the entire $977\\,\\mathrm{fb}^{-1}$ data set collected by Belle, we observe no significant signal. We obtain ind...

,

2015-01-01T23:59:59.000Z

356

Drivers of phytoplankton, bacterioplankton, and zooplankton carbon biomass in tropical hydroelectric reservoirs  

Science Journals Connector (OSTI)

Abstract Studies of carbon sources in plankton communities are important because carbon content has become the main currency used in functional studies of aquatic ecosystems. We evaluated the contribution to the total organic carbon pool from different plankton communities (phytoplankton, bacterioplankton, and zooplankton C-biota) and its drivers in eight tropical hydroelectric reservoirs with different trophic and hydrological status and different physical features. Our systems were separated into three groups based on trophic status and water residence time: (i) mesotrophic with low residence time (ML); (ii) mesotrophic with high residence time (MH); and (iii) eutrophic with low residence time (EL). Our hypothesis that reservoirs with low water residence times and low nutrient concentrations would show the lowest C-biota was supported. Phytoplankton carbon (C-phy) showed the highest concentrations in the EL, followed by MH and ML systems. The EL group also showed significantly higher zooplankton carbon (C-zoo). No significant difference was observed for bacteria carbon (C-bac) among the three system groups. In addition to trophic status and water residence time, regression analyses revealed that water temperature, light, pH, and dissolved organic carbon concentrations were the main drivers of plankton communities in these large tropical hydroelectric reservoirs.

Lcia H.S. Silva; Vera L.M. Huszar; Marcelo M. Marinho; Luciana M. Rangel; Jandeson Brasil; Carolina D. Domingues; Christina C. Branco; Fbio Roland

2014-01-01T23:59:59.000Z

357

System for exchange of hydrogen between liquid and solid phases  

DOE Patents [OSTI]

The reversible reaction M + x/2 H/sub 2/ reversible MH/sub x/, wherein M is a reversible metal hydride former that forms a hydride MH/sub x/ in the presence of H/sub 2/, generally used to store and recall H/sub 2/, is found to proceed under an inert liquid, thereby reducing contamination, providing better temperature control, providing in situ mobility of the reactants, and increasing flexibility in process design. Thus, a slurry of particles of a metal hydride former with an inert solvent is subjected to a temperature and pressure controlled atmosphere containing H/sub 2/, to store hydrogen and to release previously stored hydrogen. The direction of the flow of the H/sub 2/ through the liquid is dependent upon the H/sub 2/ pressure in the gas phase at a given temperature. When the actual H/sub 2/ pressure is above the equilibrium absorption pressure of the respective hydride the reaction proceeds to the right, i.e., the metal hydride is formed and hydrogen is stored in the solid particle. When the actual pressure in the gas phase is below the equilibrium dissociation pressure of the respective hydride the reaction proceeds to the left, the metal hydride is decomposed and hydrogen is released into the gas phase.

Reilly, J.J.; Grohse, E.W.; Johnson, J.R.; Winsche, W.E.

1985-02-22T23:59:59.000Z

358

Liquid suspensions of reversible metal hydrides  

DOE Patents [OSTI]

The reversibility of the process M + x/2 H/sub 2/ ..-->.. MH/sub x/, where M is a metal hydride former that forms a hydride MH/sub x/ in the presence of H/sub 2/, generally used to store and recall H/sub 2/, is found to proceed under a liquid, thereby to reduce contamination, provide better temperature control and provide in situ mobility of the reactants. Thus, a slurry of particles of a metal hydride former with an inert solvent is subjected to temperature and pressure controlled atmosphere containing H/sub 2/, to store hydrogen (at high pressures) and to release (at low pressures) previously stored hydrogen. The direction of the flow of the H/sub 2/ through the liquid is dependent upon the H/sub 2/ pressure in the gas phase at a given temperature. When the former is above the equilibrium absorption pressure of the respective hydride the reaction proceeds to the right, i.e., the metal hydride is formed and hydrogen is stored in the solid particle. When the H/sub 2/ pressure in the gas phase is below the equilibrium dissociation pressure of the respective hydride the reaction proceeds to the left, the metal hydride is decomposed and hydrogen is released into the gas phase.

Reilly, J.J.; Grohse, E.W.; Winsche, W.E.

1983-12-08T23:59:59.000Z

359

High-power TSP bits. [Thermally Stable Polycrystalline diamond  

SciTech Connect (OSTI)

This paper reviews a three-year R D project to develop advanced thermally stable polycrystalline diamond (TSP) bits that can operate at power levels 5 to 10 times greater than those typically delivered by rotary rigs. These bits are designed to operate on advanced drilling motors that drill 3 to 6 times faster than rotary rigs. TSP bit design parameters that were varied during these tests include cutter size, shape, density, and orientation. Drilling tests conducted in limestone, sandstone, marble, and granite blocks showed that these optimized bits drilled many of these rocks at 500 to 1,000 ft/hr (150 to 300 m/h), compared to 50 to 100 ft/hr (15 to 30 m/h) for roller bits. These tests demonstrated that TSP bits are capable of operating at the high speeds and high torques delivered by advanced drilling motors now being developed. These advanced bits and motors are designed for use in slim-hole and horizontal drilling applications.

Cohen, J.H.; Maurer, W.C. (Maurer Engineering Inc., Houston, TX (United States)); Westcott, P.A. (Gas Research Inst., Chicago, IL (United States))

1994-03-01T23:59:59.000Z

360

Search for Invisibly Decaying Higgs Bosons with Large Decay Width Using the OPAL Detector at LEP  

E-Print Network [OSTI]

This paper describes a topological search for an invisibly decaying Higgs boson,H, produced via the Bjorken process (e+e- -> HZ). The analysis is based on data recorded using the OPAL detector at LEP at centre-of-mass energies from 183 to 209 GeV corresponding to a total integrated luminosity of 629pb-1. In the analysis only hadronic decays of the Z boson are considered. A scan over Higgs boson masses from 1 to 120 GeV and decay widths from 1 to 3000 GeV revealed no indication for a signal in the data. From a likelihood ratio of expected signal and Standard Model background we determine upper limits on cross-section times branching ratio to an invisible final state. For moderate Higgs boson decay widths, these range from about 0.07pb Mh = 60GeV) to 0.57pb (Mh = 114GeV). For decay widths above 200GeV the upper limits are of the order of 0.15pb. The results can be interpreted in general scenarios predicting a large invisible decay width of the Higgs boson. As an example we interpret the results in the so-called stealthy Higgs scenario. The limits from this analysis exclude a large part of the parameter range of this scenario experimentally accessible at LEP2.

The OPAL collaboration

2006-10-18T23:59:59.000Z

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Clustering of gamma-ray selected 2LAC Fermi Blazars  

E-Print Network [OSTI]

We present the first measurement of the projected correlation function of 485 gamma-ray selected Blazars, divided in 175 BLLacertae (BL Lacs) and 310 Flat Spectrum Radio Quasars (FSRQs) detected in the 2-year all-sky survey by Fermi-Large Area Telescope. We find that Fermi BL Lacs and FSRQs reside in massive dark matter halos (DMHs) with logMh=13.35+0.20/-0.14 and logMh = 13.40+0.15/-0.19 Msun/h, respectively, at low (z=0.4) and high (z =1.2) redshift. In terms of clustering properties, these results suggest that BL Lacs and FSRQs are similar objects residing in the same dense environment typical of galaxy groups, despite their different spectral energy distribution, power and accretion rate. We find no difference in the typical bias and hosting halo mass between Fermi Blazars and radio-loud AGN, supporting the unifcation scheme simply equating radio-loud objects with misaligned Blazar counterparts. This similarity in terms of typical environment they preferentially live in, suggests that Blazars preferential...

Allevato, Viola; Cappelluti, Nico

2014-01-01T23:59:59.000Z

362

System for exchange of hydrogen between liquid and solid phases  

DOE Patents [OSTI]

The reversible reaction M+x/2 H.sub.2 .rarw..fwdarw.MH.sub.x, wherein M is a reversible metal hydride former that forms a hydride MH.sub.x in the presence of H.sub.2, generally used to store and recall H.sub.2, is found to proceed under an inert liquid, thereby reducing contamination, providing better temperature control, providing in situ mobility of the reactants, and increasing flexibility in process design. Thus, a slurry of particles of a metal hydride former with an inert solvent is subjected to a temperature and pressure controlled atmosphere containing H.sub.2, to store hydrogen and to release previously stored hydrogen. The direction of the flow of the H.sub.2 through the liquid is dependent upon the H.sub.2 pressure in the gas phase at a given temperature. When the actual H.sub.2 pressure is above the equilibrium absorption pressure of the respective hydride the reaction proceeds to the right, i.e., the metal hydride is formed and hydrogen is stored in the solid particles. When the actual pressure in the gas phase is below the equilibrium dissociation pressure of the respective hydride the reaction proceeds to the left, the metal hydride is decomposed and hydrogen is released into the gas phase.

Reilly, James J. (Bellport, NY); Grohse, Edward W. (Port Jefferson Station, NY); Johnson, John R. (Calverton, NY); Winsche, deceased, Warren E. (late of Bellport, NY)

1988-01-01T23:59:59.000Z

363

Deep Currents in the Central Subarctic Pacific Ocean  

Science Journals Connector (OSTI)

Sections of closely spaced CTD stations along Longs. 165W, 175W and 175E, in combination with 14-month current records from the central longitude, define two deep, nearly zonal currants, with speed increasing upward, in the subarctic Pacific. ...

Bruce A. Warren; W. Brechner Owens

1988-04-01T23:59:59.000Z

364

Appliances and Commercial Equipment Standards  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

High Intensity Discharge Lamps Test Procedures High Intensity Discharge Lamps Test Procedures Sign up for e-mail updates on regulations for this and other products High-intensity discharge (HID) lamps include mercury vapor (MV), metal halide (MH), and high-pressure sodium (HPS) lamps. The Department of Energy (DOE) is establishing test procedures for HID lamps. This rulemaking is mandated by the Energy Policy and Conservation Act (EPCA). ( 42 U.S.C. 6291-6309) This Rulemaking is related to the High-Intensity Discharge Lamps Standard and Test Procedure. Recent Updates | Public Meeting Information | Submitting Public Comments | Milestones and Documents | Related Rulemakings | Statutory Authority | Contact Information Recent Updates DOE published a notice of proposed rulemaking regarding test procedures for HID lamps. 76 FR 77914 (Dec. 15, 2011).

365

Data:C83fdfb5-8648-4985-a2ef-61de8da45662 | Open Energy Information  

Open Energy Info (EERE)

fdfb5-8648-4985-a2ef-61de8da45662 fdfb5-8648-4985-a2ef-61de8da45662 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Lee County Electric Coop, Inc Effective date: 2008/07/01 End date if known: Rate name: Private Area Lighting- Shoebox Fixture (250W HPS or MH) Sector: Lighting Description: Applicable to customers, other than Street Light Districts, for automatically controlled dusk-to-dawn outdoor lighting where existing overhead secondary circuits are located. Source or reference: https://www.lcec.net/pdf/EntireRateTariff.pdf#page=18 Source Parent: Comments Applicability Demand (kW) Minimum (kW):

366

Data:Cee0536d-f29b-4c17-87ec-992a568520cc | Open Energy Information  

Open Energy Info (EERE)

Cee0536d-f29b-4c17-87ec-992a568520cc Cee0536d-f29b-4c17-87ec-992a568520cc No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Entergy Louisiana Inc Effective date: 2011/10/28 End date if known: Rate name: Street/Lighting Rate Schedules DSL - (Directional security lighting rate) MH 250W (NA) Sector: Lighting Description: For service to customers contracting for directional security lighting service from flood lighting equipment supplied by Company. The service provided pursuant to this Rate Schedule is not for the benefit of any person, firm, legal entity, or governing body other than Customer.

367

Data:C9771caa-2916-49d3-a56e-0e12f3d403df | Open Energy Information  

Open Energy Info (EERE)

caa-2916-49d3-a56e-0e12f3d403df caa-2916-49d3-a56e-0e12f3d403df No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Springfield, Oregon (Utility Company) Effective date: 2013/05/01 End date if known: Rate name: Street Lighting 150 W MH Opt. 1 L-1 Sector: Lighting Description: Option 1 refers to a Customer owned and installed fixture. The fixed monthly charge covers energy, operation and fixture maintenance fees. Possible Additional Fees include: Transfer of a street light, mast arm, overhead conductor, and conductor support to a new pole, and make necessary electrical connection: $175 each.

368

Data:D45500ec-a27b-481a-a5e3-9c927b664a5c | Open Energy Information  

Open Energy Info (EERE)

ec-a27b-481a-a5e3-9c927b664a5c ec-a27b-481a-a5e3-9c927b664a5c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Algoma Utility Comm Effective date: 2008/05/28 End date if known: Rate name: Street Lighting Service - 250 W HPS(Overhead) Sector: Lighting Description: Application: This schedule will be applied to municipal street lighting. Power Cost Adjustment Clause: Charge per all kWh varies monthly. See schedule PCAC. Note: HPS = High Pressure Sodium MH = Metal Halide Source or reference: http://www.algomautilities.com/media/Electric_Rate_Tariff_Sheets.pdf Source Parent: Comments Applicability

369

Data:Db8442bd-14e5-4f44-aa3a-840479199ced | Open Energy Information  

Open Energy Info (EERE)

bd-14e5-4f44-aa3a-840479199ced bd-14e5-4f44-aa3a-840479199ced No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Pontotoc Electric Power Assn Effective date: 2013/07/01 End date if known: Rate name: Flood Light MH 400 W 30' pole Sector: Lighting Description: Source or reference: http://www.sitemason.com/files/fjDo1q/May%202012.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

370

Data:A47b4b43-2d26-4146-9f47-d8f406576e5c | Open Energy Information  

Open Energy Info (EERE)

b43-2d26-4146-9f47-d8f406576e5c b43-2d26-4146-9f47-d8f406576e5c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Lea County Electric Coop, Inc Effective date: 2009/08/30 End date if known: Rate name: Lighting Service - 1000 Mh Lamp Sector: Lighting Description: Available system wide to all security, street, and signal lighting. Additional charge if transformer is required - $3.23 monthly. Additional charge if service and pole are required - $1.08. Source or reference: Illinois State University Archive Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months):

371

Farmers Electric Coop, Inc (Texas) | Open Energy Information  

Open Energy Info (EERE)

182 182 Utility Location Yes Ownership C NERC Location TRE NERC ERCOT Yes ISO Ercot Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Commercial Residential Residential Street Lighting 100 W HPS Lighting Street Lighting 250 W HPS Lighting Street Lighting 400 W HPS Lighting Street Lighting 400 W MH Lighting Average Rates Residential: $0.1140/kWh Commercial: $0.1070/kWh Industrial: $0.0775/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=Farmers_Electric_Coop,_Inc_(Texas)&oldid=410685

372

Data:B2130051-20d6-48db-99f4-8552773dcd96 | Open Energy Information  

Open Energy Info (EERE)

51-20d6-48db-99f4-8552773dcd96 51-20d6-48db-99f4-8552773dcd96 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Barnesville, Georgia (Utility Company) Effective date: 2011/11/01 End date if known: Rate name: Security Lighting Service 1000 W MH Sector: Lighting Description: To unmetered dusk-to-down electric service provided by high pressure by high pressure sodium vapor luminaries supported by short brackets and mounted on either the city's existing wood poles or poles owned by the customer which conform to the city's specifications. Source or reference: Rate Binder # 2 Source Parent:

373

Data:239dd8c3-2660-4fb5-a10f-200895eb226c | Open Energy Information  

Open Energy Info (EERE)

c3-2660-4fb5-a10f-200895eb226c c3-2660-4fb5-a10f-200895eb226c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jefferson Electric Member Corp Effective date: 2010/11/01 End date if known: Rate name: STREET LIGHTING SERVICE ( 250W HPS - Shoebox ) Sector: Lighting Description: Additional fees for poles and transformers may apply Source or reference: ISU Documentation Source Parent: Comments Applicable only to outdoor lighting by ballast operated vapor lamp fixtures, either high pressure sodium (HPS) or metal halide (MH), and poles conforming to Cooperative specifications. Applicability Demand (kW)

374

Data:18e20c46-69d0-4690-8c21-bfb6018a68b7 | Open Energy Information  

Open Energy Info (EERE)

c46-69d0-4690-8c21-bfb6018a68b7 c46-69d0-4690-8c21-bfb6018a68b7 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jefferson Electric Member Corp Effective date: 2010/11/01 End date if known: Rate name: SECURITY LIGHT SERVICE (1000W MH) Sector: Lighting Description: Additional fees for poles and transformers may apply Source or reference: ISU Documentation Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring:

375

Albemarle Electric Member Corp | Open Energy Information  

Open Energy Info (EERE)

Albemarle Electric Member Corp Albemarle Electric Member Corp Place North Carolina Utility Id 240 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Athletic Field Lighting Lighting Irrigation TOD Industrial Large General Service Industrial Large General TOD Industrial Medium General Service Industrial Medium General Service - kWhs charge only Industrial Medium General TOD Industrial Outdoor Security Lighting - 100 watt HPS - Pendant Lighting Outdoor Security Lighting - 1000 watt MH - Flood Lighting Outdoor Security Lighting - 150 watt HPS - Ornamental Cobra Lighting

376

Data:6abe6dcf-4386-4be2-a9bd-0b94736d7240 | Open Energy Information  

Open Energy Info (EERE)

abe6dcf-4386-4be2-a9bd-0b94736d7240 abe6dcf-4386-4be2-a9bd-0b94736d7240 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of New Smyrna Beach, Florida (Utility Company) Effective date: 2011/02/01 End date if known: Rate name: MH-Providence 250 watts Sector: Lighting Description: Fixed Monthly Charge= Energy Rate + Maintenance Source or reference: http://ucnsb.org/pdf/Rates%20Charges%20and%20Fees.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service

377

City of Douglas, Georgia (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Douglas, Georgia (Utility Company) Douglas, Georgia (Utility Company) Jump to: navigation, search Name City of Douglas Place Georgia Utility Id 5325 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Operates Generating Plant Yes Activity Generation Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Irrigation Time of Use Service Commercial Large Power Industrial Medium Power Industrial Residential Residential Seasonal Agricultural Service Commercial Security Lights - 100 Watt HPS Vapor - Non-Metered Lighting Security Lights - 1000 Watt MH Flood Vapor - Metered Lighting

378

Data:28a5617c-5342-4916-aa52-55b56e0f9d6e | Open Energy Information  

Open Energy Info (EERE)

7c-5342-4916-aa52-55b56e0f9d6e 7c-5342-4916-aa52-55b56e0f9d6e No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jackson Electric Member Corp Effective date: End date if known: Rate name: Outdoor Lighting Directional Flood MH 250 W Non Wood Pole Sector: Lighting Description: Source or reference: http://www.jacksonemc.com/business-manage-my-account-commercial-rates-options/schedules/outdoor-lighting-service Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V):

379

Data:6aa3ee57-71b6-4488-ab33-7c78feecf79a | Open Energy Information  

Open Energy Info (EERE)

ee57-71b6-4488-ab33-7c78feecf79a ee57-71b6-4488-ab33-7c78feecf79a No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Village of Davenport, Nebraska (Utility Company) Effective date: 2012/11/11 End date if known: Rate name: Directional Lighting MH 1000 W Unmetered Sector: Lighting Description: Area/directional lighting of farmyards, backyards, patios, parking lots, storage yards, trailer courts, industrial sites, schools churches, apartments, businesses and many other applications where lighting is needed for identification, merchandising, environment, aesthetics, safety, security, protection or convenience.

380

Data:5b44a54d-2284-43db-acbf-981f07d169e3 | Open Energy Information  

Open Energy Info (EERE)

4a54d-2284-43db-acbf-981f07d169e3 4a54d-2284-43db-acbf-981f07d169e3 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Singing River Elec Pwr Assn (Mississippi) Effective date: 2009/12/04 End date if known: Rate name: Security Lighting MH 1000 W Sector: Lighting Description: *Subject to power cost adjustment, tax expense adjustment, and an environmental compliance charge. Source or reference: http://www.singingriver.com/Files/R-18.pdf Source Parent: Comments Energy Adjustment is Power Cost Adjustment plus Environmental Clause plus Regulatory Adjustment Applicability Demand (kW) Minimum (kW): Maximum (kW):

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Data:E87c1d68-e3f8-4ba9-8f94-3e5ec50105e4 | Open Energy Information  

Open Energy Info (EERE)

7c1d68-e3f8-4ba9-8f94-3e5ec50105e4 7c1d68-e3f8-4ba9-8f94-3e5ec50105e4 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Excelsior Electric Member Corp Effective date: 2009/01/01 End date if known: Rate name: Outdoor Lighting Service- 400W MH Sector: Lighting Description: Applicable only to outdoor lighting by means of ballast operated lamp fixtures that do not require a dedicated transformer and street lighting service by means of ballast operated lamp fixtures, subject to the established rules and regulations of the Cooperative. Source or reference: ISU Documentation Source Parent: Comments

382

Data:073ad7fb-02ff-4a3b-9c39-952bccf0e427 | Open Energy Information  

Open Energy Info (EERE)

fb-02ff-4a3b-9c39-952bccf0e427 fb-02ff-4a3b-9c39-952bccf0e427 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Midwest Energy Inc Effective date: 2012/06/29 End date if known: Rate name: LAL- MH 1000 Watt 362 kWh (Standard Extenstion)- Metered Sector: Lighting Description: Source or reference: http://www.mwenergy.com/elecrate.aspx Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

383

Data:44d53d39-0487-414d-a06d-0523ece8bb14 | Open Energy Information  

Open Energy Info (EERE)

d39-0487-414d-a06d-0523ece8bb14 d39-0487-414d-a06d-0523ece8bb14 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Albemarle Electric Member Corp Effective date: 2012/06/01 End date if known: Rate name: Outdoor Security Lighting - 175 watt MV/MH - American Revolution Sector: Lighting Description: * Single-phase, 60-cycle alternating current, providing service to automatically controlled dusk-to-dawn lighting, using either the Cooperative's standard fixtures on a new or existing pole or one of the Cooperative's standard ornamental lighting packages. Source or reference: http://www.albemarle-emc.com/Documents/rateschedule.pdf

384

Data:B82382c9-42bd-4a41-81de-fbe3e5175669 | Open Energy Information  

Open Energy Info (EERE)

382c9-42bd-4a41-81de-fbe3e5175669 382c9-42bd-4a41-81de-fbe3e5175669 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Minnesota Power Inc Effective date: 2013/01/01 End date if known: Rate name: OUTDOOR AND AREA LIGHTING SERVICE MH1000 W (OPT 1) Sector: Lighting Description: To all classes of retail customers for outdoor lighting purposes (Rate Codes 76) and to persons other than governmental subdivisions for the purpose of lighting streets, alleys, roads, driveways and parking lots (Rate Code 77) subject to any applicable Riders. Rate Code 76 is not available on a seasonal or temporary basis.

385

Data:Dd22700a-56e8-486d-bc84-85cde9a09055 | Open Energy Information  

Open Energy Info (EERE)

a-56e8-486d-bc84-85cde9a09055 a-56e8-486d-bc84-85cde9a09055 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Frankfort, Kentucky (Utility Company) Effective date: 2012/07/01 End date if known: Rate name: Area Lighting- (1000W MH With 45' Metal Pole) Sector: Lighting Description: Source or reference: ISU Documentation Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

386

Data:Dfa6f82d-6ac2-4973-952f-3ab55981d083 | Open Energy Information  

Open Energy Info (EERE)

Dfa6f82d-6ac2-4973-952f-3ab55981d083 Dfa6f82d-6ac2-4973-952f-3ab55981d083 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jackson Electric Member Corp Effective date: End date if known: Rate name: Outdoor Lighting Decashield MH 1000 W Non Wood Pole Sector: Lighting Description: Source or reference: http://www.jacksonemc.com/business-manage-my-account-commercial-rates-options/schedules/outdoor-lighting-service Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V):

387

Electritek AVT | Open Energy Information  

Open Energy Info (EERE)

Electritek AVT Electritek AVT Jump to: navigation, search Name Electritek AVT Place Littleton, Colorado Zip CO 80122 Product Manufacturer of Lithium Ion, Lithium Polymer, Lithium Sulfur, NiMH, NiCd, Sealed Lead Acid, Alkaline and Lithium primary batteries. Coordinates 39.697285°, -80.51095° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.697285,"lon":-80.51095,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

388

Data:Eda86a80-0ed0-40a2-9f60-0167286c1311 | Open Energy Information  

Open Energy Info (EERE)

Eda86a80-0ed0-40a2-9f60-0167286c1311 Eda86a80-0ed0-40a2-9f60-0167286c1311 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Singing River Elec Pwr Assn (Mississippi) Effective date: 2009/12/04 End date if known: Rate name: Security Lighting MH 400 W Flood Sector: Lighting Description: *Subject to power cost adjustment, tax expense adjustment, and an environmental compliance charge. Source or reference: http://www.singingriver.com/Files/R-18.pdf Source Parent: Comments Energy Adjustment is Power Cost Adjustment plus Environmental Clause plus Regulatory Adjustment Applicability Demand (kW) Minimum (kW):

389

Data:A804fbaf-6c7f-420a-97e1-eb57e9ffa2e1 | Open Energy Information  

Open Energy Info (EERE)

A804fbaf-6c7f-420a-97e1-eb57e9ffa2e1 A804fbaf-6c7f-420a-97e1-eb57e9ffa2e1 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Duncan, Oklahoma (Utility Company) Effective date: End date if known: Rate name: Security Lighting- (250W MH Directional Flood Lighting on existing 38 ft. steel Pole- Underground Wiring) Sector: Lighting Description: This rate schedule is available on an annual basis to any customer for illumination of outdoor areas. Source or reference: ISU Documentation Rate Binder Ted #9 Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh)

390

Data:A69a2e79-6973-408a-b059-606aec47c379 | Open Energy Information  

Open Energy Info (EERE)

e79-6973-408a-b059-606aec47c379 e79-6973-408a-b059-606aec47c379 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Southwest Rural Elec Assn Inc Effective date: 2010/11/01 End date if known: Rate name: 250 Watt HPS or MH, No Energy Sector: Lighting Description: * Subject to Power Cost Adjustment. All bills are adjusted by applicable taxes. Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service

391

Data:1a964176-ea9b-49e8-92b9-47621faed243 | Open Energy Information  

Open Energy Info (EERE)

76-ea9b-49e8-92b9-47621faed243 76-ea9b-49e8-92b9-47621faed243 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Lea County Electric Coop, Inc Effective date: 2009/08/30 End date if known: Rate name: Lighting Service - 400 MH Lamp Sector: Lighting Description: Available system wide to all security, street, and signal lighting. Additional charge if transformer is required - $3.23 monthly. Additional charge if service and pole are required - $1.08. Source or reference: Illinois State University Archive Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months):

392

Washington Elec Member Corp | Open Energy Information  

Open Energy Info (EERE)

Washington Elec Member Corp Washington Elec Member Corp Place Georgia Utility Id 20146 Utility Location Yes Ownership C NERC Location SERC NERC SERC Yes ISO Other Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png 1,000 Watt HPS Cobra Lighting 1,000 Watt HPS Flood Lighting 1,000 Watt MH Flood Lighting 100 Watt HPS Lighting 175 Watt MV 250 Watt HPS Lighting 250 Watt HPS Cobra Head Lighting 250 Watt HPS Flood Lighting 400 Watt HPS Cobra Head Lighting 400 Watt HPS Flood Lighting Rate-01 (RS) Residential Rate-02 (GSND) Commercial Rate-07 (GSD) Commercial Rate-08 (GS) Primary

393

Data:Cb20bd3d-3943-4147-8c28-58d01d1a5f49 | Open Energy Information  

Open Energy Info (EERE)

d-3943-4147-8c28-58d01d1a5f49 d-3943-4147-8c28-58d01d1a5f49 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jackson Electric Member Corp Effective date: End date if known: Rate name: Outdoor Lighting Directional Flood MH 1000 W Non Wood Pole Sector: Lighting Description: Source or reference: http://www.jacksonemc.com/business-manage-my-account-commercial-rates-options/schedules/outdoor-lighting-service Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V):

394

Data:C7476902-5b6f-4bba-930a-b5704e484ba9 | Open Energy Information  

Open Energy Info (EERE)

02-5b6f-4bba-930a-b5704e484ba9 02-5b6f-4bba-930a-b5704e484ba9 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Lee County Electric Coop, Inc Effective date: 2008/07/01 End date if known: Rate name: Public Street and Highway Lighting Service- Cooperative Owned Floodlight Fixture (400W MH or HPS) Sector: Lighting Description: Applicable to customers, under the qualification Street Light Districts and governmental agencies for automatically controlled dusk-to-dawn outdoor lighting where existing overhead secondary circuits are located. Source or reference: https://www.lcec.net/pdf/EntireRateTariff.pdf#page=18

395

Data:982a1454-aa93-4ab1-a5cd-76205b2d6aa6 | Open Energy Information  

Open Energy Info (EERE)

aa93-4ab1-a5cd-76205b2d6aa6 aa93-4ab1-a5cd-76205b2d6aa6 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jefferson Electric Member Corp Effective date: 2010/11/01 End date if known: Rate name: STREET LIGHTING SERVICE ( 100W HPS - Traditional ) Sector: Lighting Description: Additional fees for poles and transformers may apply Source or reference: ISU Documentation Source Parent: Comments Applicable only to outdoor lighting by ballast operated vapor lamp fixtures, either high pressure sodium (HPS) or metal halide (MH), and poles conforming to Cooperative specifications. Applicability Demand (kW)

396

Data:982fa5fd-b44a-4196-8c97-39a136f8ea38 | Open Energy Information  

Open Energy Info (EERE)

b44a-4196-8c97-39a136f8ea38 b44a-4196-8c97-39a136f8ea38 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jefferson Electric Member Corp Effective date: 2010/11/01 End date if known: Rate name: STREET LIGHTING SERVICE ( 150W HPS - Expressway ) Sector: Lighting Description: Additional fees for poles and transformers may apply Source or reference: ISU Documentation Source Parent: Comments Applicable only to outdoor lighting by ballast operated vapor lamp fixtures, either high pressure sodium (HPS) or metal halide (MH), and poles conforming to Cooperative specifications. Applicability Demand (kW)

397

Data:E399b20c-1600-4059-ab26-da6d829a2d89 | Open Energy Information  

Open Energy Info (EERE)

c-1600-4059-ab26-da6d829a2d89 c-1600-4059-ab26-da6d829a2d89 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: C & L Electric Coop Corp Effective date: 2012/09/24 End date if known: Rate name: Outdoor Lighting Service - 400 Watt HPS/MH Sector: Lighting Description: Source or reference: ISU Documentation Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous

398

Data:586c5dea-8078-45fb-90e2-096a3821f21f | Open Energy Information  

Open Energy Info (EERE)

8078-45fb-90e2-096a3821f21f 8078-45fb-90e2-096a3821f21f No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Amicalola Electric Member Corp Effective date: End date if known: Rate name: Security Lights Shoebox MH 250 W Sector: Lighting Description: Source or reference: http://www.amicalolaemc.com/securitylights.htm Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous

399

Page not found | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

71 - 10180 of 28,905 results. 71 - 10180 of 28,905 results. Download CX-003237: Categorical Exclusion Determination Chehalis-Raymond Number 1 2010 Line Rebuild CX(s) Applied: B4.6 Date: 07/19/2010 Location(s): Lewis County, Washington Office(s): Bonneville Power Administration http://energy.gov/nepa/downloads/cx-003237-categorical-exclusion-determination Download VBA-0060- In the Matter of Robert Burd On November 16, 2001, BWXT Pantex, as successor to Mason & Hanger Corporation (M&H) (collectively referred to as "the contractor"), filed an appeal of an Initial Agency Decision (IAD)... http://energy.gov/oha/downloads/vba-0060-matter-robert-burd Download Notice of proposed rulemaking and public hearing The U.S. Department of Energy (DOE or the Department) proposes to amend

400

ARM - Publications: Science Team Meeting Documents  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Using ARM Measurements to Evaluate and Improve the Turbulent Boundary-Layer Using ARM Measurements to Evaluate and Improve the Turbulent Boundary-Layer Parameterization in the CCM Zhang, M.H. (a) and Yu, R.C. (a), State University of New York(a) Eleventh Atmospheric Radiation Measurement (ARM) Science Team Meeting Three-Dimensional advective tendencies at the Atmospheric Radiation Measurement (ARM) Program Southern Great Plains (SGP) site, together with diurnal variation of the clear-sky boundary layer atmosphere temperature and moisture, are used to study the down-gradient and "non-local" turbulent transport of heat and moisture in the atmospheric boundary layer. The observational results are then used to evaluate the boundary layer parameterization in the National Center for Atmospheric Research (NCAR) CCM3. It is found that the down-gradient turbulent transport in the CCM3 is

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Data:A2a1424e-14da-4e24-a8a1-328099fd68b1 | Open Energy Information  

Open Energy Info (EERE)

e-14da-4e24-a8a1-328099fd68b1 e-14da-4e24-a8a1-328099fd68b1 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Frankfort, Kentucky (Utility Company) Effective date: 2012/07/01 End date if known: Rate name: Area Lighting- (250W MH With 35' Wood Pole) Sector: Lighting Description: Source or reference: ISU Documentation Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

402

Data:B560d64c-37ab-48a4-87d6-9ef08af93ede | Open Energy Information  

Open Energy Info (EERE)

d64c-37ab-48a4-87d6-9ef08af93ede d64c-37ab-48a4-87d6-9ef08af93ede No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Duncan, Oklahoma (Utility Company) Effective date: End date if known: Rate name: Security Lighting- (1000W MH Directional Flood Lighting on existing 45 ft. metal pole- Underground Wiring) Sector: Lighting Description: This rate schedule is available on an annual basis to any customer for illumination of outdoor areas. Source or reference: ISU Documentation Rate Binder Ted #9 Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh)

403

Data:090e4648-8231-4149-94ea-3800624b744c | Open Energy Information  

Open Energy Info (EERE)

8-8231-4149-94ea-3800624b744c 8-8231-4149-94ea-3800624b744c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Oncor Electric Delivery Company LLC Effective date: 2012/01/01 End date if known: Rate name: Outdoor Lighting Service (CLOSED), Flood Lights - MH - 250W Sector: Lighting Description: Applicable to Competitive Retailers for unmetered lighting service supplied exclusively to one or more existing outdoor lamps as specified below operating automatically from dusk to dawn. Not applicable to street lighting. Source or reference: http://www.oncor.com/EN/Documents/About%20Oncor/Billing%20Rate%20Schedules/Tariff%20for%20Retail%20Delivery%20Service_05-30-13.pdf

404

City of Paris, Missouri (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Paris City of Paris City of Place Missouri Utility Id 14456 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Commercial Power Rate Commercial Residential Residential Security Lighting- (100 W HPS) Lighting Security Lighting- (1000 W MH) Lighting Average Rates Residential: $0.1180/kWh Commercial: $0.0982/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from "http://en.openei.org/w/index.php?title=City_of_Paris,_Missouri_(Utility_Company)&oldid=410090

405

Data:8aa54d43-c41f-4c77-868d-c9549b34a148 | Open Energy Information  

Open Energy Info (EERE)

-c41f-4c77-868d-c9549b34a148 -c41f-4c77-868d-c9549b34a148 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Frankfort, Kentucky (Utility Company) Effective date: 2012/07/01 End date if known: Rate name: Area Lighting- (250W MH With 35' Metal Pole) Sector: Lighting Description: Source or reference: ISU Documentation Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

406

Data:3e6508be-932f-484a-9dea-6ceab827b3ac | Open Energy Information  

Open Energy Info (EERE)

32f-484a-9dea-6ceab827b3ac 32f-484a-9dea-6ceab827b3ac No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Lee County Electric Coop, Inc Effective date: 2008/07/01 End date if known: Rate name: Public Street and Highway Lighting Service- Cooperative Owned Shoebox Fixture (1000W MH Galleria) Sector: Lighting Description: Applicable to customers, under the qualification Street Light Districts and governmental agencies for automatically controlled dusk-to-dawn outdoor lighting where existing overhead secondary circuits are located. Source or reference: https://www.lcec.net/pdf/EntireRateTariff.pdf#page=18

407

PowerPoint Presentation  

Broader source: Energy.gov (indexed) [DOE]

Technology Technology Radar V-V NaNiCl2 Li-ion ZnCl2 Pb-A NiCad H2Br2 ZnBr2 NiMH NaS Fe2Cr3 trouble trouble trouble trouble trouble trouble trouble trouble trouble trouble trouble Opportunity ! Opportunity ! Opportunity ! Opportunity ! Opportunity ! Opportunity ! Opportunity ! Opportunity ! Opportunity ! Opportunity ! Opportunity ! 2  Bridge the gap to the practical application of a mature and high-performance electrochemistry for grid storage.  Provide the required application definition with utility and other customer input to optimize benefits to the community  Facilitate technology and system development in 2010 - 2011  Field demonstration at PG&E Modular Generation Substation early 2012  Field deployment at Modesto Irrigation District late 2012 Proof of Principle Technology

408

Data:0424192a-b057-4857-b8c8-efc6131d36ea | Open Energy Information  

Open Energy Info (EERE)

92a-b057-4857-b8c8-efc6131d36ea 92a-b057-4857-b8c8-efc6131d36ea No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Albemarle Electric Member Corp Effective date: 2012/06/01 End date if known: Rate name: Outdoor Security Lighting - 400 watt MH - Cobra Head Sector: Lighting Description: * Single-phase, 60-cycle alternating current, providing service to automatically controlled dusk-to-dawn lighting, using either the Cooperative's standard fixtures on a new or existing pole or one of the Cooperative's standard ornamental lighting packages. Source or reference: http://www.albemarle-emc.com/Documents/rateschedule.pdf

409

Data:263f3444-2c70-4931-b1ce-197aaa8748e9 | Open Energy Information  

Open Energy Info (EERE)

44-2c70-4931-b1ce-197aaa8748e9 44-2c70-4931-b1ce-197aaa8748e9 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Baltimore Gas & Electric Co Effective date: 2013/02/23 End date if known: Rate name: 13000 lumen 205 wat MH (pendant) Sector: Lighting Description: Source or reference: http://www.bge.com/myaccount/billsrates/ratestariffs/electricservice/pages/electric-services-rates-and-tariffs.aspx Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service

410

CX-007390: Categorical Exclusion Determination | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

390: Categorical Exclusion Determination 390: Categorical Exclusion Determination CX-007390: Categorical Exclusion Determination "Hot Carrier Collection in Thin Film Silicon with Tailored Nanocrystalline/Amorphous Structure CX(s) Applied: B3.15, A9, B3.6 Date: 12/05/2011 Location(s): Colorado Offices(s): Golden Field Office DOE proposes to provide federal funding to the Colorado School of Mines (CSM) to conduct research on the synthesis and testing of nanocrystalline/amorphous, hybrid, thin film silicon. This material has application in photovoltaic cells. The goal would be to commercialize a machine that would meet market and certification requirements, and reduce the cost of energy. The work will take place at several existing facilities: Hill (HH) and Meyer Halls (MH) on the campus of CSM, and

411

Data:4ee48fa9-dcae-496b-b213-b3bb96a480ea | Open Energy Information  

Open Energy Info (EERE)

dcae-496b-b213-b3bb96a480ea dcae-496b-b213-b3bb96a480ea No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Duncan, Oklahoma (Utility Company) Effective date: End date if known: Rate name: Security Lighting- (400W MH Directional Flood Lighting on existing 38 ft. steel pole- Underground Wiring) Sector: Lighting Description: This rate schedule is available on an annual basis to any customer for illumination of outdoor areas. Source or reference: ISU Documentation Rate Binder Ted #9 Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh)

412

Data:Fd4a1d85-7f5c-46aa-90b2-bccb09df9df3 | Open Energy Information  

Open Energy Info (EERE)

-7f5c-46aa-90b2-bccb09df9df3 -7f5c-46aa-90b2-bccb09df9df3 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Crisp County Power Comm Effective date: 2012/01/01 End date if known: Rate name: Rental Light Service-Parking Lot Shoebox- One Fixture (350/400 W MH/HPS) Sector: Lighting Description: Applicable only to outdoor lighting by ballast operated vapor lamp fixtures, either Mercury Vapor, Pressure Sodium, or Metal Halide. Source or reference: ISU Documentation Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh):

413

Data:Dd98c2ec-2371-4b18-a704-cc297cdd5bd2 | Open Energy Information  

Open Energy Info (EERE)

8c2ec-2371-4b18-a704-cc297cdd5bd2 8c2ec-2371-4b18-a704-cc297cdd5bd2 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Woodruff Electric Coop Corp Effective date: 2012/10/24 End date if known: Rate name: Outdoor lighting - Security Lamps 400 W MH Sector: Lighting Description: To unmetered automatically controlled outdoor lighting service burning all night. Source or reference: Illinois State University Archive Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V):

414

City of Milford, Iowa (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Milford Milford Place Iowa Utility Id 12541 Utility Location Yes Ownership M NERC Location MRO NERC MRO Yes ISO Other Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Distribution Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png COMMERCIAL RATES Commercial DEMAND RATES Industrial RESIDENTIAL RATES Residential SECURITY LIGHTS RATES (150 Watt) Lighting SECURITY LIGHTS RATES (1500 MH) Lighting SECURITY LIGHTS RATES (250 Watt) Lighting SECURITY LIGHTS RATES (400 HPS) Lighting SECURITY LIGHTS RATES 100 W HPS Lighting

415

Data:Ec8a2a34-0d66-487d-a4d3-3d24e442eb86 | Open Energy Information  

Open Energy Info (EERE)

4-0d66-487d-a4d3-3d24e442eb86 4-0d66-487d-a4d3-3d24e442eb86 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jefferson Electric Member Corp Effective date: 2010/11/01 End date if known: Rate name: STREET LIGHTING SERVICE ( 250W HPS - Expressway ) Sector: Lighting Description: Additional fees for poles and transformers may apply Source or reference: ISU Documentation Source Parent: Comments Applicable only to outdoor lighting by ballast operated vapor lamp fixtures, either high pressure sodium (HPS) or metal halide (MH), and poles conforming to Cooperative specifications. Applicability

416

Data:068c2cb8-9f67-41a8-9a2d-9091b85ad20b | Open Energy Information  

Open Energy Info (EERE)

cb8-9f67-41a8-9a2d-9091b85ad20b cb8-9f67-41a8-9a2d-9091b85ad20b No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Springfield, Oregon (Utility Company) Effective date: 2013/05/01 End date if known: Rate name: Street Lighting 400 W MH Opt. 1 L-1 Sector: Lighting Description: Option 1 refers to a Customer owned and installed fixture. The fixed monthly charge covers energy, operation and fixture maintenance fees. Possible Additional Fees include: Transfer of a street light, mast arm, overhead conductor, and conductor support to a new pole, and make necessary electrical connection: $175 each.

417

Data:4606a955-c084-41cd-a1db-bf45da525156 | Open Energy Information  

Open Energy Info (EERE)

5-c084-41cd-a1db-bf45da525156 5-c084-41cd-a1db-bf45da525156 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Lee County Electric Coop, Inc Effective date: 2008/07/01 End date if known: Rate name: Private Area Lighting- Shoebox Fixture (400W MH Galleria) Sector: Lighting Description: Applicable to customers, other than Street Light Districts, for automatically controlled dusk-to-dawn outdoor lighting where existing overhead secondary circuits are located. Source or reference: https://www.lcec.net/pdf/EntireRateTariff.pdf#page=18 Source Parent: Comments Applicability Demand (kW) Minimum (kW):

418

Data:3ccb946d-c797-4dad-a187-b51dd6863811 | Open Energy Information  

Open Energy Info (EERE)

ccb946d-c797-4dad-a187-b51dd6863811 ccb946d-c797-4dad-a187-b51dd6863811 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Nebraska Public Power District Effective date: 2013/01/01 End date if known: Rate name: Directional Lighting MH 250 W Metered 825 Sector: Lighting Description: To directional lighting of farmyards, backyards, patios, parking lots, storage yards, trailer courts, industrial sites, schools, churches, apartments, businesses, and many other applications where lighting is needed for identification, merchandising, environment, aesthetics, safety, protection, or convenience. Equipment Rental Charge means the district will install, own, operate, and maintain the lighting equipment.

419

Data:3b1e233c-f243-428b-92f9-89970491bd93 | Open Energy Information  

Open Energy Info (EERE)

e233c-f243-428b-92f9-89970491bd93 e233c-f243-428b-92f9-89970491bd93 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Albemarle Electric Member Corp Effective date: 2012/06/01 End date if known: Rate name: Outdoor Security Lighting - 400 watt MV/MH - Flood Sector: Lighting Description: * Single-phase, 60-cycle alternating current, providing service to automatically controlled dusk-to-dawn lighting, using either the Cooperative's standard fixtures on a new or existing pole or one of the Cooperative's standard ornamental lighting packages. Source or reference: http://www.albemarle-emc.com/Documents/rateschedule.pdf

420

McMinnville Electric System | Open Energy Information  

Open Energy Info (EERE)

McMinnville Electric System McMinnville Electric System Jump to: navigation, search Name McMinnville Electric System Place Tennessee Utility Id 12186 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial < 50 kW Commercial Commercial 1000-5000 kW Commercial Commercial 50-1000 kW Commercial Commercial 5000-15000 kW Commercial Manufacturing Metered kW 1001-5000 kW Industrial Manufacturing Metered kW 5001-15000 kW Industrial Outdoor Lighting 1000w M.H. Lighting Outdoor Lighting 100w H.P.S. Lighting

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Data:3bbd170f-5446-4965-b533-b978147a31ff | Open Energy Information  

Open Energy Info (EERE)

bbd170f-5446-4965-b533-b978147a31ff bbd170f-5446-4965-b533-b978147a31ff No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Minnesota Power Inc Effective date: 2013/01/01 End date if known: Rate name: OUTDOOR AND AREA LIGHTING SERVICE MH 400 W (OPT 1) Sector: Lighting Description: To all classes of retail customers for outdoor lighting purposes (Rate Codes 76) and to persons other than governmental subdivisions for the purpose of lighting streets, alleys, roads, driveways and parking lots (Rate Code 77) subject to any applicable Riders. Rate Code 76 is not available on a seasonal or temporary basis.

422

Data:8e5b5421-a764-4d85-8852-2279a5717b41 | Open Energy Information  

Open Energy Info (EERE)

a764-4d85-8852-2279a5717b41 a764-4d85-8852-2279a5717b41 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Duke Energy Ohio Inc Effective date: 2013/05/06 End date if known: Rate name: Rate OL - Outdoor Lighting Service - MH 250 Watts Sector: Lighting Description: Applicable for outdoor lighting services on private property with Company owned fixtures in the Company's entire service area where secondary distribution lines are adjacent to the premises to be served. Not applicable for lighting public roadways which are dedicated, or anticipated to be dedicated, except to meet the occasional singular need of a customer who has obtained written approval from the proper governmental authority.

423

Data:Cc836610-fe61-4a96-b75b-dde63bda480c | Open Energy Information  

Open Energy Info (EERE)

Cc836610-fe61-4a96-b75b-dde63bda480c Cc836610-fe61-4a96-b75b-dde63bda480c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: C & L Electric Coop Corp Effective date: 2012/09/24 End date if known: Rate name: Outdoor Lighting Service - 250 Watt HPS/MH Sector: Lighting Description: Source or reference: ISU Documentation Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous

424

Data:Db239874-2117-4094-9105-d17332e53af8 | Open Energy Information  

Open Energy Info (EERE)

Db239874-2117-4094-9105-d17332e53af8 Db239874-2117-4094-9105-d17332e53af8 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jackson Electric Member Corp Effective date: End date if known: Rate name: Outdoor Lighting Decashield MH 250 W Wood Pole Sector: Lighting Description: Source or reference: http://www.jacksonemc.com/business-manage-my-account-commercial-rates-options/schedules/outdoor-lighting-service Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service

425

Data:D96a197b-661d-43e7-83c0-879ab36d94c2 | Open Energy Information  

Open Energy Info (EERE)

97b-661d-43e7-83c0-879ab36d94c2 97b-661d-43e7-83c0-879ab36d94c2 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jefferson Electric Member Corp Effective date: 2010/11/01 End date if known: Rate name: STREET LIGHTING SERVICE ( 100W HPS - Cobrahead ) Sector: Lighting Description: Additional fees for poles and transformers may apply Source or reference: ISU Documentation Source Parent: Comments Applicable only to outdoor lighting by ballast operated vapor lamp fixtures, either high pressure sodium (HPS) or metal halide (MH), and poles conforming to Cooperative specifications. Applicability

426

Data:8bb186f5-3c77-45d0-8366-872069957ae1 | Open Energy Information  

Open Energy Info (EERE)

f5-3c77-45d0-8366-872069957ae1 f5-3c77-45d0-8366-872069957ae1 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Grantville, Georgia (Utility Company) Effective date: End date if known: Rate name: Security/ Street-Monthly 1000 W MH Sector: Lighting Description: Source or reference: Rate Binder#2 Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous 1 2 3 Next >>

427

Data:C31a2f37-c090-4d4c-acef-3d205838968e | Open Energy Information  

Open Energy Info (EERE)

7-c090-4d4c-acef-3d205838968e 7-c090-4d4c-acef-3d205838968e No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Calhoun, Georgia (Utility Company) Effective date: 2006/07/01 End date if known: Rate name: Security Light 400 W MH Flood Type Sector: Lighting Description: Initial charge if a pole must be set for the security light only $150.00. Source or reference: Rate Binder # 2 Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service

428

Data:7e6d2079-5664-4349-9618-5a5fb780dd9b | Open Energy Information  

Open Energy Info (EERE)

79-5664-4349-9618-5a5fb780dd9b 79-5664-4349-9618-5a5fb780dd9b No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jackson Electric Member Corp Effective date: End date if known: Rate name: Outdoor Lighting Decashield MH 1000 W Wood Pole Sector: Lighting Description: Source or reference: http://www.jacksonemc.com/business-manage-my-account-commercial-rates-options/schedules/outdoor-lighting-service Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service

429

Data:Dfeb10f5-b315-4b62-880c-3b952e4d4e63 | Open Energy Information  

Open Energy Info (EERE)

Dfeb10f5-b315-4b62-880c-3b952e4d4e63 Dfeb10f5-b315-4b62-880c-3b952e4d4e63 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Algoma Utility Comm Effective date: 2008/05/28 End date if known: Rate name: Street Lighting Service - 200 W HPS(Overhead) Sector: Lighting Description: Application: This schedule will be applied to municipal street lighting. Power Cost Adjustment Clause: Charge per all kWh varies monthly. See schedule PCAC. Note: HPS = High Pressure Sodium MH = Metal Halide Source or reference: http://www.algomautilities.com/media/Electric_Rate_Tariff_Sheets.pdf Source Parent: Comments Applicability

430

Data:2924d044-a548-477a-aae1-5cb218b743b1 | Open Energy Information  

Open Energy Info (EERE)

-a548-477a-aae1-5cb218b743b1 -a548-477a-aae1-5cb218b743b1 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Pontotoc Electric Power Assn Effective date: 2013/07/01 End date if known: Rate name: Flood Light MH 400 W Sector: Lighting Description: Source or reference: http://www.sitemason.com/files/fjDo1q/May%202012.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous

431

Consent Order, Mason & Hanger Corporation - EA-2000-07 | Department of  

Broader source: Energy.gov (indexed) [DOE]

Mason & Hanger Corporation - EA-2000-07 Mason & Hanger Corporation - EA-2000-07 Consent Order, Mason & Hanger Corporation - EA-2000-07 June 21, 2000 Price-Anderson Enforcement Consent Order issued to Mason & Hanger Corporation related to Fire Suppression System Issues at the Pantex Plant, (EA-2000-07) This letter refers to the Department of Energy's (DOE) evaluation of the facts and circumstances presented to DOE by Mason & Hanger Corporation's (M&H or the contractor) internal evaluation of the Building 12-79 HPFL Valve Misposition at the Pantex Plant, which was identified on November 19, 1999. Consent Order, Mason & Hanger Corporation - EA-2000-07 More Documents & Publications Preliminary Notice of Violation, Argonne National Laboratory-West - EA-2001-01 Preliminary Notice of Violation, Mason & Hanger Corporation - EA-1999-05

432

Data:D3a24e35-e29e-4251-8807-30b55cc9ac2b | Open Energy Information  

Open Energy Info (EERE)

-e29e-4251-8807-30b55cc9ac2b -e29e-4251-8807-30b55cc9ac2b No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Entergy Gulf States Louisiana LLC Effective date: 2011/10/28 End date if known: Rate name: 2 Area Lighting - Flood light MH - 320W - and 35 foot wood pole Sector: Lighting Description: This rate is applicable under the regular terms and conditions of the company in areas designated by company where facilities of adequate capacity and suitable voltage are available. Source or reference: http://www.entergy-louisiana.com/content/price/tariffs/egsi/egsila_als.pdf Source Parent: Comments

433

Data:D2b6958d-5cb7-4ed9-b319-7ce27278150a | Open Energy Information  

Open Energy Info (EERE)

d-5cb7-4ed9-b319-7ce27278150a d-5cb7-4ed9-b319-7ce27278150a No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Lee County Electric Coop, Inc Effective date: 2008/07/01 End date if known: Rate name: Public Street and Highway Lighting Service- Cooperative Owned Floodlight Fixture (1000W MH ) Sector: Lighting Description: Applicable to customers, under the qualification Street Light Districts and governmental agencies for automatically controlled dusk-to-dawn outdoor lighting where existing overhead secondary circuits are located. Source or reference: https://www.lcec.net/pdf/EntireRateTariff.pdf#page=18

434

Data:4d472bbc-43cb-4726-8f49-f13237f58ce2 | Open Energy Information  

Open Energy Info (EERE)

3cb-4726-8f49-f13237f58ce2 3cb-4726-8f49-f13237f58ce2 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Southwest Rural Elec Assn Inc Effective date: 2010/11/01 End date if known: Rate name: 1000 Watt HPS or MH, No Energy Sector: Lighting Description: * Subject to Power Cost Adjustment. All bills are adjusted by applicable taxes. Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service

435

Data:E34f9f94-8fc9-4a6a-91c7-2f524452357f | Open Energy Information  

Open Energy Info (EERE)

8fc9-4a6a-91c7-2f524452357f 8fc9-4a6a-91c7-2f524452357f No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Lee County Electric Coop, Inc Effective date: 2008/07/01 End date if known: Rate name: Private Area Lighting- Floodlight Fixture (400W HPS or MH) Sector: Lighting Description: Applicable to customers, other than Street Light Districts, for automatically controlled dusk-to-dawn outdoor lighting where existing overhead secondary circuits are located. Source or reference: https://www.lcec.net/pdf/EntireRateTariff.pdf#page=18 Source Parent: Comments Applicability Demand (kW) Minimum (kW):

436

Data:1bc22f5e-5822-45da-99e1-5fa76b04164c | Open Energy Information  

Open Energy Info (EERE)

2f5e-5822-45da-99e1-5fa76b04164c 2f5e-5822-45da-99e1-5fa76b04164c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: United Illuminating Co Effective date: 2013/01/01 End date if known: Rate name: Rate MH - Underground colonial 175 Watt Sector: Lighting Description: Source or reference: www.uinet.com Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous 1 2 3 Next >>

437

Data:E1a4c40d-9778-4e58-ac80-13cee875027d | Open Energy Information  

Open Energy Info (EERE)

d-9778-4e58-ac80-13cee875027d d-9778-4e58-ac80-13cee875027d No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Sumter Electric Member Corp Effective date: 2012/01/01 End date if known: Rate name: Outdoor Lighting Shoebox/Flood MH 400 W Sector: Lighting Description: * Fixed Monthly Charge does not include monthly pole rate charges Source or reference: http://www.sumteremc.com/pdfs/OL-9.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service

438

FY06 DOE Energy Storage Program PEER Review  

Broader source: Energy.gov (indexed) [DOE]

6 DOE Energy Storage Program 6 DOE Energy Storage Program PEER REVIEW John D. Boyes Sandia National Laboratories ESS Program Makeup ESS Base Program - CEC/DOE Data Acquisition and Project Support - NYSERDA/DOE Data Acquisition and Project Support - Boeing Superconducting Flywheel - ACONF Coast Guard Project - HybSim Hybrid Storage Model Development Congressionally-Directed Programs - University of Missouri-Rolla - Grid Modernization - Iowa Stored Energy Project - EEI - BiPolar Ni-MH Battery Development - Sprint - Storage for Telecommunications Apps. - Emerson - Network Power - Beacon Power - Frequency Regulation Plant Design - Mead Westvaco - Research on Lead-Carbon Asymmetric Super capacitors (FY05) ESS Program Makeup (cont.) ESS Program Makeup cont. SBIR - Aegis Technology - PII - Arkansas Power Electronic International -

439

Data:245bd7d1-d33d-4993-aba9-822ff9f1fdfc | Open Energy Information  

Open Energy Info (EERE)

-d33d-4993-aba9-822ff9f1fdfc -d33d-4993-aba9-822ff9f1fdfc No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jefferson Electric Member Corp Effective date: 2010/11/01 End date if known: Rate name: STREET LIGHTING SERVICE ( 250W HPS - Cobrahead ) Sector: Lighting Description: Additional fees for poles and transformers may apply Source or reference: ISU Documentation Source Parent: Comments Applicable only to outdoor lighting by ballast operated vapor lamp fixtures, either high pressure sodium (HPS) or metal halide (MH), and poles conforming to Cooperative specifications. Applicability Demand (kW)

440

Data:29ce8116-fb00-4144-b529-88169a033f8f | Open Energy Information  

Open Energy Info (EERE)

-fb00-4144-b529-88169a033f8f -fb00-4144-b529-88169a033f8f No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jackson Electric Member Corp Effective date: End date if known: Rate name: Outdoor Lighting Directional Flood MH 250 W Wood Pole Sector: Lighting Description: Source or reference: http://www.jacksonemc.com/business-manage-my-account-commercial-rates-options/schedules/outdoor-lighting-service Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

City of Ellaville, Georgia (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Ellaville, Georgia (Utility Company) Ellaville, Georgia (Utility Company) Jump to: navigation, search Name City of Ellaville Place Georgia Utility Id 5796 Utility Location Yes Ownership M NERC Location SERC Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Non-Demand Electric Service Commercial Commercial-Demand Electric Service Commercial Municiple Electric Service Public Schools Electric Service Commercial Residential Residential Security Lighting Service 100 W HPSV Lighting Security Lighting Service 1000 W MH Lighting Security Lighting Service 150 W HPSV Lighting

442

City of Commerce, Georgia (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Commerce, Georgia (Utility Company) Commerce, Georgia (Utility Company) Jump to: navigation, search Name City of Commerce Place Georgia Utility Id 4091 Utility Location Yes Ownership M NERC Location SERC Activity Distribution Yes Activity Wholesale Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png CITY RATES Commercial CONTRACTOR'S Commercial LARGE POWER Commercial MEDIUM POWER Commercial RESIDENTIAL Residential SECURITY LIGHTING SERVICE, HPS 100 Lighting SECURITY LIGHTING SERVICE, HPS 250 Lighting SECURITY LIGHTING SERVICE, HPS 400 Lighting SECURITY LIGHTING SERVICE, MH 400 Lighting SECURITY LIGHTING SERVICE, MV 175 Lighting

443

DOE Science Showcase - Rare Earth Metal Research from DOE Databases |  

Office of Scientific and Technical Information (OSTI)

Rare Earth Metal Research from DOE Databases Rare Earth Metal Research from DOE Databases Information Bridge Energy Citations Database Highlighted documents of Rare Earth Metal research in DOE databases Information Bridge - Corrosion-resistant metal surfaces DOE R&D Project Summaries - Structural and magnetic studies on heavy rare earth metals at high pressures using designer diamonds Energy Citations Database - Intermultiplet transitions in rare-earth metals DOE Green Energy - LaNi.sub.5 is-based metal hydride electrode in Ni-MH rechargeable cells Science.gov - H.R.4866 - Rare Earths Supply-Chain Technology and Resources Transformation Act of 2010 WorldWideScience.org - China produces most of the world's rare earth metals DOepatents - Recycling of rare earth metals from rare earth-transition metal alloy scrap by liquid metal extraction

444

Microsoft Word - lbnl5401E-rev.2.doc  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Development of a Development of a Residential Integrated Ventilation Controller I.S. Walker, M.H. Sherman and D.J. Dickerhoff Environmental Energy Technologies Division December 2011 (revised July 2012) also known as LBNL-5401E This work was supported by the California Energy Commission Public Interest Energy Research Program BERG Grant #55044A/06-27and the Assistant Secretary for Energy Efficiency and Renewable Energy, Building Technologies Program, of the U.S. Department of Energy under contract No. DE-AC02- 05CH11231. LBNL 5554E 2 Disclaimer This document was prepared as an account of work sponsored by the United States Government. While this document is believed to contain correct information, neither the

445

Consent Order EA-2000-07  

Broader source: Energy.gov (indexed) [DOE]

1, 2000 1, 2000 Dr. Benjamin Pellegrini [ ] Mason & Hanger Corporation P.O. Box 30020 Amarillo, TX 79120-0020 EA 2000-07 Subject: Consent Order Incorporating Agreement between U.S. Department of Energy and Mason & Hanger Corporation Dear Dr. Pellegrini: This letter refers to the Department of Energy's (DOE) evaluation of the facts and circumstances presented to DOE by Mason & Hanger Corporation's (M&H or the contractor) internal evaluation of the Building 12-79 HPFL Valve Misposition at the Pantex Plant, which was identified on November 19, 1999. In January 1998, the contractor identified a systemic problem at the site in Building 12-98 when it was determined that certain high-pressure fire suppression valves were left in the closed position, which would have prevented their activation in

446

Data:0ba2bb04-66a4-4df5-a34a-2b7200ebaa38 | Open Energy Information  

Open Energy Info (EERE)

-66a4-4df5-a34a-2b7200ebaa38 -66a4-4df5-a34a-2b7200ebaa38 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Pearl River Valley El Pwr Assn Effective date: 2012/08/01 End date if known: Rate name: 70 OL-8 1000 MH, Flood Sector: Lighting Description: Available to all Consumer's subject to Association's established rules and regulations. Association's standard outdoor lighting facilities. Service includes Association furnishing, operating, and maintaining lighting fixture, control equipment and lamp. When Association is required to alter its normal facilities to furnish a special outdoor lighting service, there will be an additional monthly charge.

447

Data:4f6017b3-eeea-4d52-83b7-7be1c2b7d251 | Open Energy Information  

Open Energy Info (EERE)

b3-eeea-4d52-83b7-7be1c2b7d251 b3-eeea-4d52-83b7-7be1c2b7d251 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Amicalola Electric Member Corp Effective date: End date if known: Rate name: Security Lights Shoebox MH 400 W Sector: Lighting Description: Source or reference: http://www.amicalolaemc.com/securitylights.htm Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous

448

Canadian Valley Elec Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Valley Elec Coop, Inc Valley Elec Coop, Inc Jump to: navigation, search Name Canadian Valley Elec Coop, Inc Place Oklahoma Utility Id 2911 Utility Location Yes Ownership C NERC Location SPP Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Irrigation-Rate I Industrial Lage Power-2 ,Distribution Service Commercial Lage Power-2 ,Secondary Service Commercial Large Power -Rate LP,Distribution Serivce Commercial Large Power-2 Commercial Residential - Rate A, Single Phase Residential Residential - Rate A, Three Phase Residential Security Lighting 1000Watt MH Lighting

449

Data:65163c0e-9684-487a-93b4-784a0bcb11b3 | Open Energy Information  

Open Energy Info (EERE)

e-9684-487a-93b4-784a0bcb11b3 e-9684-487a-93b4-784a0bcb11b3 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of New Smyrna Beach, Florida (Utility Company) Effective date: 2011/02/01 End date if known: Rate name: MH-Providence 150 watts Sector: Lighting Description: Fixed Monthly Charge= Energy Rate + Maintenance Source or reference: http://ucnsb.org/pdf/Rates%20Charges%20and%20Fees.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service

450

Clarksville Light & Water Co | Open Energy Information  

Open Energy Info (EERE)

Clarksville Light & Water Co Clarksville Light & Water Co Jump to: navigation, search Name Clarksville Light & Water Co Place Arkansas Utility Id 3705 Utility Location Yes Ownership M NERC Location SPP NERC SPP Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Large Commercial (Rate schedule p) Commercial Large Industrial (Rate schedule p) Industrial Residential (R1) Residential Residential Rate Schedule R-2 Residential Security Light Service (Rate schedule L)HPS 100 W Commercial Security Light Service 1000 W MH Commercial Security light service 150 W HPS Commercial

451

TO: FILE SITE NAME:  

Office of Legacy Management (LM)

NAME: NAME: f REBP\c E, +a.%# FLIP de\, 3;: Mh.wJ FlLLtJvl b G, ALTERNATE -------.------- NAME: -----------------__ 5 83 ihv.s:, p-de, a.<- NJe w ---------_ I I 0!9!!5_RL_s~ past: Fdr.-C Fin d- Current: ------------------------ ~~~~-----------___________ Owner contacted q yes po; if yee, date contacted ______ TYPE OF OPERATION ~_----~------____ pr Research & Development 0 Production scale testing Cl Pilot Scale 0 Bench Scale Process a Theoretical Studies a Sample & Analysis 0 Production 0 Disposal/Storage a Facility Type 3 Manufacturing q University 0 Research Organization fJ Government Sponsored Facility 0 Other --------------------- q Prime a a Subcontract& Other information (i.e., cost + fixed fee, unit price, Cl Purchase Order time b material, qtc) _

452

Microsoft Word - UDAC MEMBER FINAL ROSTER.doc  

Broader source: Energy.gov (indexed) [DOE]

2007 - 2008 Ultra-Deepwater Advisory Committee Members Mr. Kent F. Abadie Manager, Development and Production Shell Exploration & Production Company New Orleans, LA Mr. Ronald G. Bland Shared Technologies Manager Baker Hughes Drilling Fluids Houston, TX Mr. Raymond G. Charles Area Exploration & Geoscience Manager ExxonMobil Exploration Company Houston, TX Mr. Quenton R.Dokken Executive Director Gulf of Mexico Foundation Corpus Christi, TX Dr. Joe R. Fowler* President Stress Engineering Services, Inc. Houston, TX Mr. Phil Grossweiler* Energy Industry Consultant M&H Energy Services Houston, TX Mr. Michael Idelchik Vice President, Advanced Technologies General Electric Company Niskayuna, NY Dr. Luc T. Ikelle* Robert R. Berg Professor Texas A&M University College Station,

453

Disrupted epithelial morphogenesis and aberrant lineage commitment following radiation and TGFβ  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Disrupted epithelial morphogenesis and aberrant lineage Disrupted epithelial morphogenesis and aberrant lineage commitment following radiation and TGFβ I. Fernandez-Garcia and M.H. Barcellos-Hoff Department of Radiation Oncology, New York University School of Medicine, NY. In the present study, we evaluated cell lineage plasticity and its phenotypic effects in the non-malignant human mammary epithelial cell line MCF10A in response to ionizing radiation and TGFβ. We have recently shown that the molecular profiles of mammary tumors and normal mammary gland from irradiated mice are distinct from those arising in unirradiated mice by virtue of enriched stem cell and progenitor markers. Consistent with this, we found that radiation (10-100 cGy) increases the mammary repopulation capacity in a functional and marker assays (Nguyen et al. Cancer Cell

454

Temperature, thermal-conductivity, and heat-flux data,Raft River area,  

Open Energy Info (EERE)

Temperature, thermal-conductivity, and heat-flux data,Raft River area, Temperature, thermal-conductivity, and heat-flux data,Raft River area, Cassia County, Idaho (1974-1976) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Report: Temperature, thermal-conductivity, and heat-flux data,Raft River area, Cassia County, Idaho (1974-1976) Details Activities (1) Areas (1) Regions (0) Abstract: Basin and Range Province; Cassia County Idaho; economic geology; exploration; geophysical surveys; geothermal energy; heat flow; heat flux; Idaho; North America; Raft River basin; south-central Idaho; surveys; temperature; thermal conductivity; United States; USGS Author(s): Urban, T.C.; Diment, W.H.; Nathenson, M.; Smith, E.P.; Ziagos, J.P.; Shaeffer, M.H. Published: Open-File Report - U. S. Geological Survey, 1/1/1986 Document Number: Unavailable

455

Data:893cd1dd-10f9-4c69-a0c1-6369572ac325 | Open Energy Information  

Open Energy Info (EERE)

cd1dd-10f9-4c69-a0c1-6369572ac325 cd1dd-10f9-4c69-a0c1-6369572ac325 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Village of Davenport, Nebraska (Utility Company) Effective date: 2012/11/11 End date if known: Rate name: Directional Lighting MH 250 W Unmetered Sector: Lighting Description: Area/directional lighting of farmyards, backyards, patios, parking lots, storage yards, trailer courts, industrial sites, schools churches, apartments, businesses and many other applications where lighting is needed for identification, merchandising, environment, aesthetics, safety, security, protection or convenience.

456

Data:89e28637-8ea5-4c45-80fe-181cad369697 | Open Energy Information  

Open Energy Info (EERE)

637-8ea5-4c45-80fe-181cad369697 637-8ea5-4c45-80fe-181cad369697 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jacksonville Electric Authority Effective date: 2012/01/01 End date if known: Rate name: SL70 Standard MH 175 watts Sector: Lighting Description: To any Public Agency (State, County, or Municipal governments) and to Owner's Associations for automatically controlled lighting of public thoroughfares and to JEA's private residential customers who are owners of the property in question for automatically controlled area lighting. Source or reference: https://www.jea.com/About_Us/Tariffs_and_Reports/Tariffs_and_Reports.aspx

457

City of Elizabeth City, North Carolina (Utility Company) | Open Energy  

Open Energy Info (EERE)

Elizabeth City, North Carolina (Utility Company) Elizabeth City, North Carolina (Utility Company) Jump to: navigation, search Name City of Elizabeth City Place North Carolina Utility Id 5760 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes ISO Other Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png ALLEY LIGHTING Lighting BILATERAL METERING FOR RENEWABLE ENERGY GENERATION RIDER Residential Directional Lighting Service 1000 W Power Flood MH Lighting Directional Lighting Service HPS 400 W Lighting ELECTRIC LOAD MANAGEMENT RIDER NUMBER 1 Commercial

458

Data:042eb420-7802-4b5a-9228-e829cba1421a | Open Energy Information  

Open Energy Info (EERE)

7802-4b5a-9228-e829cba1421a 7802-4b5a-9228-e829cba1421a No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jefferson Electric Member Corp Effective date: 2010/11/01 End date if known: Rate name: STREET LIGHTING SERVICE ( 400W HPS - Cobrahead ) Sector: Lighting Description: Additional fees for poles and transformers may apply Source or reference: ISU Documentation Source Parent: Comments Applicable only to outdoor lighting by ballast operated vapor lamp fixtures, either high pressure sodium (HPS) or metal halide (MH), and poles conforming to Cooperative specifications. Applicability Demand (kW)

459

Data:Ee1d2f5b-819c-45a4-bbbb-5559a8a45fc0 | Open Energy Information  

Open Energy Info (EERE)

b-819c-45a4-bbbb-5559a8a45fc0 b-819c-45a4-bbbb-5559a8a45fc0 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Lee County Electric Coop, Inc Effective date: 2008/07/01 End date if known: Rate name: Private Area Lighting- Shoebox Fixture (400W HPS or MH) Sector: Lighting Description: Applicable to customers, other than Street Light Districts, for automatically controlled dusk-to-dawn outdoor lighting where existing overhead secondary circuits are located. Source or reference: https://www.lcec.net/pdf/EntireRateTariff.pdf#page=18 Source Parent: Comments Applicability Demand (kW) Minimum (kW):

460

City of Barnesville, Georgia (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Barnesville Barnesville Place Georgia Utility Id 1232 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Demand Commercial Commercial Non-Demand Commercial Electric Rates- Large Industrial Industrial Large Industrial Power Cost Adjustment Industrial Municipal Service Commercial Public Schools Demand Commercial Public schools Non-Demand Commercial Residential Service Residential Security Lighting 100 W HPSV Lighting Security Lighting Service 1000 W MH Lighting Security Lighting Service 150 W HPSV Lighting

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Data:3d66a1c8-5546-424a-bf40-c7daf42e89ff | Open Energy Information  

Open Energy Info (EERE)

c8-5546-424a-bf40-c7daf42e89ff c8-5546-424a-bf40-c7daf42e89ff No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Walton Electric Member Corp Effective date: 2006/06/01 End date if known: Rate name: Directional Floodlight- MH 1000 Watt Sector: Lighting Description: Source or reference: http://www.waltonemc.com/commercial/ Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous

462

Central Hudson Gas & Elec Corp | Open Energy Information  

Open Energy Info (EERE)

Hudson Gas & Elec Corp Hudson Gas & Elec Corp Jump to: navigation, search Name Central Hudson Gas & Elec Corp Place New York Utility Id 3249 Utility Location Yes Ownership I NERC Location NPCC NERC NPCC Yes ISO NY Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Activity Bundled Services Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png DS-IN 85 Watt (acorn Decorative) Lighting DS-MH 175 Watt (acorn Decorative) Lighting

463

Data:4223cbca-00da-4da1-babe-259a364fd559 | Open Energy Information  

Open Energy Info (EERE)

cbca-00da-4da1-babe-259a364fd559 cbca-00da-4da1-babe-259a364fd559 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Singing River Elec Pwr Assn (Mississippi) Effective date: 2009/12/04 End date if known: Rate name: Security Lighting MH 1000 W w/ Pole Sector: Lighting Description: *Subject to power cost adjustment, tax expense adjustment, and an environmental compliance charge. Source or reference: http://www.singingriver.com/Files/R-18.pdf Source Parent: Comments Energy Adjustment is Power Cost Adjustment plus Environmental Clause plus Regulatory Adjustment Applicability Demand (kW) Minimum (kW):

464

Low Dose Radiation Research Program: Interaction between Tissue and  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

between Tissue and Cellular Stress Responses: Effect of between Tissue and Cellular Stress Responses: Effect of TGF-ß Depletion on Radiation-Induced p53 Response M.H. Barcellos-Hoff, S.A. Ravani, R.L. Henshall, K.B. Ewan, R.L. Warters,* B. Parvin Lawrence Berkeley National Laboratory *University of Utah One of the most widely studied cellular responses to radiation is the activation of the transcription factor, p53, whose abundance and action dictates individual cellular fate decisions regarding proliferation, differentiation and death. A cell's response to damage needs to be rapid. Thus, it is not surprising that the activation of the p53 stress response primarily involves post-translational changes in the p53 protein. Whereas intracellular radiation-induced mediators of p53 stability have been the subject of intense study, little is known about the extracellular factors

465

Appliances and Commercial Equipment Standards  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

High-Intensity Discharge Lamps Energy Conservation Standard High-Intensity Discharge Lamps Energy Conservation Standard Sign up for e-mail updates on regulations for this and other products High-intensity discharge (HID) lamps include mercury vapor (MV), metal halide (MH), and high-pressure sodium (HPS) lamps. The Department of Energy (DOE) is considering establishing energy conservation standards for certain HID lamps. This rulemaking is mandated by the Energy Policy and Conservation Act (EPCA). (42 USC 6311-6317) Recent Updates | Public Meeting Information | Submitting Public Comments | Milestones and Documents | Related Rulemakings | Statutory Authority | Contact Information Recent Updates DOE published a notice of public meeting and availability of interim technical support document regarding energy conservation standards for high-intensity discharge lamps. 78 FR 13566 (February 28, 2013).

466

Batteries - Beyond Lithium Ion Breakout session  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

BEYOND LITHIUM ION BREAKOUT BEYOND LITHIUM ION BREAKOUT Breakout Session #1 - Discussion of Performance Targets and Barriers Comments on the Achievability of the Targets * 1 - Zn-Air possible either w/ or w/o electric-hybridization; also possible with a solid electrolyte variant * 2 - Multivalent systems (e.g Mg), potentially needing hybrid-battery * 3 - Advanced Li-ion with hybridization @ cell / molecular level for high-energy and high- power * 4 - MH-air, Li-air, Li-S, all show promise * 5 - High-energy density (e.g. Na-metal ) flow battery can meet power and energy goals * 6 - Solid-state batteries (all types) * 7 - New cathode chemistries (beyond S) to increase voltage * 8 - New high-voltage non-flammable electrolytes (both li-ion and beyond li-ion) * 9 - Power to energy ratio of >=12 needed for fast charge (10 min)  So liquid refill capable

467

NEWTON, Ask a Scientist at Argonne National Labs  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Internal Battery Resistance Change During Use Internal Battery Resistance Change During Use Name: Mikus Status: student Grade: 9-12 Country: Latvia Date: Spring 2012 Question: Does the internal resistance of a battery change if the battery is being discharged? Replies: Yes. Batteries play a lot of messy games with their internal resistance. The resistance can depend on temperature, percent-of-charge-remaining, recent history of current drain, and battery aging. Each kind of battery (lithium, alkaline, lead-acid, Ni-Cd, NiMH) has a different set of behaviors. I have seen a lithium battery, when suddenly asked to push a large load, allow its output voltage to drop a lot at first, because its internal resistance was high, because the battery was cold. Then the large current flowing through that internal resistance warmed up the battery, and the voltage delivered actually increased with time, for a little while.

468

On the remarkable optical and structural transformations in Mg-Ti-H thin  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

On the remarkable optical and structural transformations in Mg-Ti-H thin On the remarkable optical and structural transformations in Mg-Ti-H thin films Speaker(s): Dana Borsa Date: October 16, 2006 - 12:00pm Location: 90-3122 Seminar Host/Point of Contact: Venkat Srinivasan In searching for battery electrode materials, Mg-Ti-H thin films triggered much interest with its hydrogen storage capacity of approx. 4 times larger than that of conventional NiMH batteries [1]. Besides this, the same system has also absolutely remarkable optical properties [2]. Highly reflective in the metallic state, the films become highly absorbing upon hydrogen absorption. Mg0.80Ti0.20Hx thin films combine a high absorption (87% of the solar spectrum) with a low thermal emissivity (only 10%), while after removal of hydrogen Mg0.80Ti0.20 absorbs no more than 1/3 of the solar

469

Data:E08b82a8-7a08-491e-acd6-cfdf7c886863 | Open Energy Information  

Open Energy Info (EERE)

a8-7a08-491e-acd6-cfdf7c886863 a8-7a08-491e-acd6-cfdf7c886863 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Three Notch Elec Member Corp Effective date: 2012/03/01 End date if known: Rate name: 400W Overhead Wiring (Non Mercury vapor fixtures) - (Type - 'MH-Flood',Wood Pole (2)) Sector: Lighting Description: Applicable only for dusk to dawn lighting by means of photo-electric controlled, ballast operated vapor lamp luminaries and poles conforming to the Cooperative's specifications. Service will be rendered only at locations that, solely in the opinion of the Cooperative, are readily accessible for installation and maintenance.

470

Data:5d84711a-9d1e-4879-8b9f-1d493a3fd0ea | Open Energy Information  

Open Energy Info (EERE)

a-9d1e-4879-8b9f-1d493a3fd0ea a-9d1e-4879-8b9f-1d493a3fd0ea No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Platte-Clay Electric Coop, Inc Effective date: 2013/01/01 End date if known: Rate name: SL - 1000 watt MH Ball Park Light Sector: Lighting Description: Available for lighting streets, walkways, or outdoor lighting of public or private areas when such facilities are operated and maintained as an extension of the Cooperative's distribution system. Electric usage will be unmetered. Source or reference: Rate Binder Kelly 11 ISU Documentation Source Parent: Comments Applicability Demand (kW)

471

Data:145fc303-7af3-41d6-9477-84efc52d95d7 | Open Energy Information  

Open Energy Info (EERE)

7af3-41d6-9477-84efc52d95d7 7af3-41d6-9477-84efc52d95d7 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Frankfort, Kentucky (Utility Company) Effective date: 2012/07/01 End date if known: Rate name: Area Lighting- (400W MH With 35' Wood Pole) Sector: Lighting Description: Source or reference: ISU Documentation Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

472

Data:A4423bc0-5f8d-4ef2-a967-bea6ed1f5fc9 | Open Energy Information  

Open Energy Info (EERE)

A4423bc0-5f8d-4ef2-a967-bea6ed1f5fc9 A4423bc0-5f8d-4ef2-a967-bea6ed1f5fc9 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Nueces Electric Coop, Inc Effective date: 2009/11/20 End date if known: Rate name: Security/Street Light Service Metered 1000w Sector: Lighting Description: *Security/Street Light Service is available to Members, municipalities and governmental authorities in accordance with the Cooperative's Service Rules and Regulations for pole mounted area security and street lighting near the Cooperative's electric distribution lines with existing transformers. MV = Mercury Vapor; HPS = High Pressure Sodium; MH = Metal Halide; X= Cobra Head assembly.

473

Data:90acd062-4f0d-4df0-959b-7abc8bffd59a | Open Energy Information  

Open Energy Info (EERE)

acd062-4f0d-4df0-959b-7abc8bffd59a acd062-4f0d-4df0-959b-7abc8bffd59a No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Ellaville, Georgia (Utility Company) Effective date: 2011/01/01 End date if known: Rate name: Security Lighting Service 1000 W MH Sector: Lighting Description: To unmetered dusk-to-down electric service used for illuminating public thoroughfares and private outdoor areas,including, but not limited to ,roadways,parking lots and yards. Source or reference: Rate Binder#2 Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh)

474

Data:7d6e144f-1ee4-4317-9d4d-5000bbb042b0 | Open Energy Information  

Open Energy Info (EERE)

4f-1ee4-4317-9d4d-5000bbb042b0 4f-1ee4-4317-9d4d-5000bbb042b0 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Crisp County Power Comm Effective date: 2012/01/01 End date if known: Rate name: Rental Light Service-Parking Lot Shoebox- Two Fixture (350/400 W MH/HPS) Sector: Lighting Description: Applicable only to outdoor lighting by ballast operated vapor lamp fixtures, either Mercury Vapor, Pressure Sodium, or Metal Halide. Source or reference: ISU Documentation Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh):

475

Data:91cd1e52-e955-4f61-9aba-edbde01958c8 | Open Energy Information  

Open Energy Info (EERE)

e52-e955-4f61-9aba-edbde01958c8 e52-e955-4f61-9aba-edbde01958c8 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Lee County Electric Coop, Inc Effective date: 2008/07/01 End date if known: Rate name: Private Area Lighting- Shoebox Fixture (1000W MH) Sector: Lighting Description: Applicable to customers, other than Street Light Districts, for automatically controlled dusk-to-dawn outdoor lighting where existing overhead secondary circuits are located. Source or reference: https://www.lcec.net/pdf/EntireRateTariff.pdf#page=18 Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW):

476

Data:273289df-3e81-4909-acbd-1c9508283eda | Open Energy Information  

Open Energy Info (EERE)

df-3e81-4909-acbd-1c9508283eda df-3e81-4909-acbd-1c9508283eda No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Midwest Energy Inc Effective date: 2012/06/29 End date if known: Rate name: LAL- MH 1000 Watt 362 kWh (Existing Pole)- Metered Sector: Lighting Description: Source or reference: http://www.mwenergy.com/elecrate.aspx Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

477

Data:2794db62-46e3-4c1f-9aae-b3f8afae9f38 | Open Energy Information  

Open Energy Info (EERE)

db62-46e3-4c1f-9aae-b3f8afae9f38 db62-46e3-4c1f-9aae-b3f8afae9f38 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Albemarle Electric Member Corp Effective date: 2012/06/01 End date if known: Rate name: Outdoor Security Lighting - 1000 watt MH - Flood Sector: Lighting Description: * Single-phase, 60-cycle alternating current, providing service to automatically controlled dusk-to-dawn lighting, using either the Cooperative's standard fixtures on a new or existing pole or one of the Cooperative's standard ornamental lighting packages. Source or reference: http://www.albemarle-emc.com/Documents/rateschedule.pdf

478

Data:42e7a416-d7ef-49c0-8052-172981434dd3 | Open Energy Information  

Open Energy Info (EERE)

a416-d7ef-49c0-8052-172981434dd3 a416-d7ef-49c0-8052-172981434dd3 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Pontotoc Electric Power Assn Effective date: 2013/07/01 End date if known: Rate name: Street Light MH 400 W 35' pole Sector: Lighting Description: Source or reference: http://www.sitemason.com/files/fjDo1q/May%202012.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

479

Lea County Electric Coop, Inc | Open Energy Information  

Open Energy Info (EERE)

Lea County Electric Coop, Inc Lea County Electric Coop, Inc Jump to: navigation, search Name Lea County Electric Coop, Inc Place New Mexico Utility Id 10817 Utility Location Yes Ownership C NERC Location SPP NERC SPP Yes Activity Transmission Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Cottin Gin Service Residential Large Commercial Service Commercial Large Irrigation Service Residential Lighting Service - 100 HPS Lamp Lighting Lighting Service - 1000 Mh Lamp Lighting Lighting Service - 150 HPS Lamp Lighting Lighting Service - 175 MV Lamp Lighting Lighting Service - 310 HPS Lamp Lighting

480

Data:5e38534c-bfcf-44fd-8a64-061c83c333ff | Open Energy Information  

Open Energy Info (EERE)

534c-bfcf-44fd-8a64-061c83c333ff 534c-bfcf-44fd-8a64-061c83c333ff No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Natchez Trace Elec Power Assn Effective date: End date if known: Rate name: Outdoor Lighting MH 1000 W Dedicated Transformer Sector: Lighting Description: Source or reference: http://www.ntepa.com/ Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous

Note: This page contains sample records for the topic "mh 175w mh" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Data:C8ffd874-e95a-4c9e-8250-6299cf7b5832 | Open Energy Information  

Open Energy Info (EERE)

74-e95a-4c9e-8250-6299cf7b5832 74-e95a-4c9e-8250-6299cf7b5832 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Pontotoc Electric Power Assn Effective date: 2013/07/01 End date if known: Rate name: Street Light MH 400 W 30' pole Sector: Lighting Description: Source or reference: http://www.sitemason.com/files/fjDo1q/May%202012.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

482

Argonne Transportation - 2008 Features Archive  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

8 Features Archive 8 Features Archive Battery Test Facility Since 1976, researchers have used Argonne's Electrochemical Analysis and Diagnostics Laboratory to study advanced battery systems for applications such as hybrid and plug-in hybrid electric vehicles and utility load-leveling during peak demand periods. The facility houses a computer-operated test laboratory, where individual cells and multicell modules of battery systems are subjected to performance and lifetime tests under simulated real-world conditions. (More...) EnerDel/Argonne Advanced High-Power Battery for Hybrid Electric Vehicles The EnerDel/Argonne lithium-ion battery is a highly reliable and extremely safe device that is lighter in weight, more compact, more powerful and longer-lasting than the nickel-metal hydride (Ni-MH) batteries in today's hybrid electric vehicles (HEVs). (More...)

483

Data:84782c60-4ea0-432a-a280-1aa9a80cbdbf | Open Energy Information  

Open Energy Info (EERE)

0-4ea0-432a-a280-1aa9a80cbdbf 0-4ea0-432a-a280-1aa9a80cbdbf No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Jacksonville Electric Authority Effective date: 2012/01/01 End date if known: Rate name: SL71 Standard MH 400 watts Sector: Lighting Description: To any Public Agency (State, County, or Municipal governments) and to Owner's Associations for automatically controlled lighting of public thoroughfares and to JEA's private residential customers who are owners of the property in question for automatically controlled area lighting. Source or reference: https://www.jea.com/About_Us/Tariffs_and_Reports/Tariffs_and_Reports.aspx

484

Data:98a24d0c-4268-40bc-9f74-ae5cf441444c | Open Energy Information  

Open Energy Info (EERE)

d0c-4268-40bc-9f74-ae5cf441444c d0c-4268-40bc-9f74-ae5cf441444c No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: South Carolina Pub Serv Auth Effective date: 2012/10/01 End date if known: Rate name: Outdoor Lighting - Shoebox 1000 Watt MH Sector: Residential Description: Source or reference: https://www.santeecooper.com/business/equipment-leases/outdoor-lighting.aspx Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring:

485

Big Sandy Rural Elec Coop Corp | Open Energy Information  

Open Energy Info (EERE)

Rural Elec Coop Corp Rural Elec Coop Corp Jump to: navigation, search Name Big Sandy Rural Elec Coop Corp Place Kentucky Utility Id 1708 Utility Location Yes Ownership C NERC Location RFC NERC RFC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png (SCHEDULE A-1 FARM & HOMO),Residential Residential Commercial and Small Power Commercial Large Power Rate - Primary Meter Industrial Large Power Rate - Secondary Meter Industrial Large Power Service - Primary Meter Industrial Large Power Service - Secondary Meter Industrial Light - 1,500 watt Lighting Light - 100 watt MH Lighting

486

Microsoft PowerPoint - anderson_epri.ppt  

Broader source: Energy.gov (indexed) [DOE]

Review Review ETO STATCOM Demonstration Project Update September 30, 2008 Wayne Litzenberger-DesignTech Loren Anderson-BPA Participants * DOE Energy Storage Program * Sandia National Lab * NCSU * EPRI * TVA * BPA * Florida State University-Center for Advanced Power Systems * Tri-State * AES-SeaWest * Commercial Vendor ? CONDON WIND FARM Proposed Host Site Full Scale Demonstration Project * 10 MVA STATCOM with battery storage * Adjacent to Condon Wind Park * Mitsubishi Type 1 induction machines * Poor voltage regulation * Long line with many small customers Proposed 10 MVA ETO STATCOM for Condon Wind Farm 0.6886mH I=1400 A (RMS) with IEEE 519 standards ETO Voltage Source Converter (transformer leakage inductance) I=1400 A (RMS) with IEEE 519 standards 69kv bus Condon Windfarm Problems

487

Data:736b3d2a-0890-4a1d-b714-6b9d22080543 | Open Energy Information  

Open Energy Info (EERE)

a-0890-4a1d-b714-6b9d22080543 a-0890-4a1d-b714-6b9d22080543 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Duncan, Oklahoma (Utility Company) Effective date: End date if known: Rate name: Security Lighting- (250W MH Directional Flood Lighting on existing DPUA utility Pole) Sector: Lighting Description: This rate schedule is available on an annual basis to any customer for illumination of outdoor areas. Source or reference: ISU Documentation Rate Binder Ted #9 Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh):

488

Data:E8c109ea-8737-4450-b26c-bac98d3526b4 | Open Energy Information  

Open Energy Info (EERE)

c109ea-8737-4450-b26c-bac98d3526b4 c109ea-8737-4450-b26c-bac98d3526b4 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Excelsior Electric Member Corp Effective date: 2009/01/01 End date if known: Rate name: Outdoor Lighting Service- 400W MH with Directional Flood Lamp Sector: Lighting Description: Applicable only to outdoor lighting by means of ballast operated lamp fixtures that do not require a dedicated transformer and street lighting service by means of ballast operated lamp fixtures, subject to the established rules and regulations of the Cooperative. Source or reference: ISU Documentation

489

Data:C21af719-0dfa-402d-a80c-77d90d969418 | Open Energy Information  

Open Energy Info (EERE)

19-0dfa-402d-a80c-77d90d969418 19-0dfa-402d-a80c-77d90d969418 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Otter Tail Power Co Effective date: 2011/10/01 End date if known: Rate name: OUTDOOR LIGHTING MH-8 100 W Sector: Lighting Description: RULES AND REGULATIONS: Terms and conditions of this electric rate schedule and the General Rules and Regulations govern use of this service. APPLICATION OF SCHEDULE: This schedule is applicable to any Customer for automatically operated dusk to dawn outdoor lighting supplied and operated by the Company. Source or reference: https://www.otpco.com/RatesPricing/Documents/PDF/MN/MN_11.04.pdf

490

City of Monroe, Georgia (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Monroe, Georgia (Utility Company) Monroe, Georgia (Utility Company) (Redirected from Monroe Water, Light & Gas Comm) Jump to: navigation, search Name City of Monroe Place Georgia Utility Id 12800 Utility Location Yes Ownership M NERC Location SERC NERC SERC Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png COMMERCIAL DEMAND RATE Commercial COMMERCIAL NON DEMAND RATE Commercial Church Service Commercial City Electric Service Commercial Industrial Service Industrial RESIDENTIAL RATE Residential SECURITY LIGHT - 1000 Watt MH Lighting SECURITY LIGHT - 400 Watt HPS Lighting

491

Data:E07f1adb-4fd8-4279-8a0b-7b2218929f74 | Open Energy Information  

Open Energy Info (EERE)

f1adb-4fd8-4279-8a0b-7b2218929f74 f1adb-4fd8-4279-8a0b-7b2218929f74 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: United Illuminating Co Effective date: 2013/01/01 End date if known: Rate name: Rate MH - Underground Modern Fixture 400 Watt Sector: Lighting Description: Source or reference: www.uinet.com Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous 1 2

492

Data:653f8e21-b66d-4dee-985b-d4e1da31742d | Open Energy Information  

Open Energy Info (EERE)

f8e21-b66d-4dee-985b-d4e1da31742d f8e21-b66d-4dee-985b-d4e1da31742d No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Excelsior Electric Member Corp Effective date: 2009/01/01 End date if known: Rate name: Outdoor Lighting Service- 250W MH Sector: Lighting Description: Applicable only to outdoor lighting by means of ballast operated lamp fixtures that do not require a dedicated transformer and street lighting service by means of ballast operated lamp fixtures, subject to the established rules and regulations of the Cooperative. Source or reference: ISU Documentation Source Parent: Comments

493

Data:05b70f7b-417b-4988-bd32-e4e910732d68 | Open Energy Information  

Open Energy Info (EERE)

417b-4988-bd32-e4e910732d68 417b-4988-bd32-e4e910732d68 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Southwest Rural Elec Assn Inc Effective date: 2010/11/01 End date if known: Rate name: 250 Watt HPS or MH, Unmetered Sector: Lighting Description: * Subject to Power Cost Adjustment. All bills are adjusted by applicable taxes. Source or reference: Rate binder # 4(Illinios State University) Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service

494

City of Bryant, South Dakota (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Bryant, South Dakota (Utility Company) Bryant, South Dakota (Utility Company) Jump to: navigation, search Name City of Bryant Place South Dakota Utility Id 2448 Utility Location Yes Ownership M NERC Location MRO Activity Transmission Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Heavy Commercial Rate Commercial Light Commercial Rate Commercial Private Security Lights- (175 MV and 100W HPS) Lighting Private Security Lights- (400 Metal Halide) Lighting Private Security Lights- (400W MH) Lighting Residential Rate Residential Seasonal Electric Rate Commercial Average Rates Residential: $0.1050/kWh

495

Data:1fb894cb-3e2c-4dba-8e17-dd8dd9321d94 | Open Energy Information  

Open Energy Info (EERE)

cb-3e2c-4dba-8e17-dd8dd9321d94 cb-3e2c-4dba-8e17-dd8dd9321d94 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Natchez Trace Elec Power Assn Effective date: End date if known: Rate name: Outdoor Lighting MH 1000 W Sector: Lighting Description: Source or reference: http://www.ntepa.com/ Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >> << Previous 1 2 3 Next >> Seasonal/Monthly Demand Charge Structures

496

Data:6f694771-bdcf-4386-b77d-270eecef6d26 | Open Energy Information  

Open Energy Info (EERE)

bdcf-4386-b77d-270eecef6d26 bdcf-4386-b77d-270eecef6d26 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: Southwestern Electric Power Co (Louisiana) Effective date: 2013/03/01 End date if known: Rate name: Municipal Street and Parkway Lighting - Closed offering - 250 Watt MH Sector: Lighting Description: Source or reference: http://www.swepco.com/global/utilities/lib/docs/ratesandtariffs/Louisiana/LouisianaA_06_06_2013.pdf Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V):

497

Data:66485587-48a0-40d0-9e12-71505deeff9a | Open Energy Information  

Open Energy Info (EERE)

87-48a0-40d0-9e12-71505deeff9a 87-48a0-40d0-9e12-71505deeff9a No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Frankfort, Kentucky (Utility Company) Effective date: 2012/07/01 End date if known: Rate name: Area Lighting- (320W MH With 35' Wood Pole) Sector: Lighting Description: Source or reference: ISU Documentation Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh): Maximum (kWh): History (months): Service Voltage Minimum (V): Maximum (V): Character of Service Voltage Category: Phase Wiring: << Previous 1 2 3 Next >>

498

Data:3a196224-1f61-4483-9fb9-0b57059ad0b3 | Open Energy Information  

Open Energy Info (EERE)

6224-1f61-4483-9fb9-0b57059ad0b3 6224-1f61-4483-9fb9-0b57059ad0b3 No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Franklin, Virginia (Utility Company) Effective date: 2012/07/01 End date if known: Rate name: Outdoor Lighting - MH - 1000w Sector: Lighting Description: * APPLICABILITY. This schedule is applicable to any Customer for outdoor lighting service, except where installations are prevented by any public authority having jurisdiction or are otherwise unlawful. Premium Fixture Rates (Municipal & Subdivision) 1. When the light fixture is not a security light or cobra head the rate shall be increased by the following fees:

499

Data:B355a02c-4afe-4052-a5f1-366d13fe7eaf | Open Energy Information  

Open Energy Info (EERE)

2c-4afe-4052-a5f1-366d13fe7eaf 2c-4afe-4052-a5f1-366d13fe7eaf No revision has been approved for this page. It is currently under review by our subject matter experts. Jump to: navigation, search Loading... 1. Basic Information 2. Demand 3. Energy << Previous 1 2 3 Next >> Basic Information Utility name: City of Duncan, Oklahoma (Utility Company) Effective date: End date if known: Rate name: Security Lighting- (1000W MH Directional Flood Lighting on existing DPUA utility Pole) Sector: Lighting Description: This rate schedule is available on an annual basis to any customer for illumination of outdoor areas. Source or reference: ISU Documentation Rate Binder Ted #9 Source Parent: Comments Applicability Demand (kW) Minimum (kW): Maximum (kW): History (months): Energy (kWh) Minimum (kWh):

500

RAV4_24551_Report_DOE_Final_.PDF  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

TOYOTA RAV4 EV - CONDUCTIVE TOYOTA RAV4 EV - CONDUCTIVE Panasonic NiMH Battery ELECTRIC TRANSPORTATION DIVISION Report prepared by: Alvaro Mendoza Juan Argueta January 2000 DISCLAIMER OF WARRANTIES AND LIMITATION OF LIABILITIES THIS REPORT WAS PREPARED BY THE ELECTRIC TRANSPORTATION DIVISION OF SOUTHERN CALIFORNIA EDISON, A SUBSIDIARY OF EDISON INTERNATIONAL. NEITHER THE ELECTRIC TRANSPORTATION DIVISION OF SOUTHERN CALIFORNIA EDISON, SOUTHERN CALIFORNIA EDISON, EDISON INTERNATIONAL, NOR ANY PERSON WORKING FOR OR ON BEHALF OF ANY OF THEM MAKES ANY WARRANTY OR REPRESENTATION, EXPRESS OR IMPLIED, (I) WITH RESPECT TO THE USE OF ANY INFORMATION, PRODUCT, PROCESS OR PROCEDURE DISCUSSED IN THIS REPORT, INCLUDING MERCHANTABILITY AND FITNESS FOR A PARTICULAR PURPOSE, OR (II) THAT SUCH USE DOES NOT INFRINGE UPON OR INTERFERE WITH RIGHTS OF OTHERS, INCLUDING