National Library of Energy BETA

Sample records for method detection limit

  1. Tritium Detection Methods and Limitations

    Office of Environmental Management (EM)

    Detection Methods and Limitations Tritium Focus Group Meeting, April 2014 Tom Voss, Northern New Mexico DOE-HDBK-1105-2002 RADIOLOGICAL TRAINING FOR TRITIUM FACILITIES U.S. Department of Energy AREA TRNG Washington, D.C. 20585 DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. DOE-HDBK-1105-2002 Radiological Training for Tritium Facilities U.S. Department of Energy, Radiological Control Programs for Special Tritium Compounds, DOE-STD- draft, Washington, D.C.

  2. Tritium Detection Methods and Limitations | Department of Energy

    Office of Environmental Management (EM)

    Detection Methods and Limitations Tritium Detection Methods and Limitations Presentation from the 33rd Tritium Focus Group Meeting held in Aiken, South Carolina on April 22-24, 2014. PDF icon Tritium Detection Methods and Limitations More Documents & Publications Methods to Improve the Lower Limit of Detectionfor Tritium in the Air and on Surfaces Improved Monitor Design and Configuration for Reducing Reported Tritium Discharges from the Orphee Research Reactor

  3. Methods to Improve the Lower Limit of Detection for Tritium in the Air and on Surfaces

    Office of Environmental Management (EM)

    Group LANL Nov. 3 - 5, 2015 Methods to Improve the Lower Limit of Detection for Tritium in the Air and on Surfaces James T. (Tom) Voss, LANL LA-UR-15-28465 Present methods for the detection of tritium are adequate for most applications. However, the technology is becoming antiquated and in need of improvement, especially to address methods to achieve a lower limit of detection for Tritium in the air and on surfaces. The present methods to detect tritium in air are with the use of ion chamber

  4. Determination of Method Detection Limits for Trace 232-Thorium and 238-Uranium in Copper using Ion Exchange and ICPMS

    SciTech Connect (OSTI)

    Hoppe, Eric W.; LaFerriere, Brian D.; Maiti, Tapas C.; Soin, Aleksandr

    2014-04-15

    Determination of Method Detection Limits for Trace 232-Thorium and 238-Uranium in Copper using Ion Exchange and ICPMS

  5. Method for improving the limit of detection in a data signal

    DOE Patents [OSTI]

    Synovec, Robert E. (Ames, IA); Yueng, Edward S. (Ames, IA)

    1989-10-17

    A method for improving the limit of detection for a data set in which experimental noise is uncorrelated along a given abscissa and an analytical signal is correlated to the abscissa, the steps comprising collecting the data set, converting the data set into a data signal including an analytical portion and the experimental noise portion, designating and adjusting a baseline of the data signal to center the experimental noise numerically about a zero reference, and integrating the data signal preserving the corresponding information for each point of the data signal. The steps of the method produce an enhanced integrated data signal which improves the limit of detection of the data signal.

  6. Method for improving the limit of detection in a data signal

    DOE Patents [OSTI]

    Synovec, R.E.; Yueng, E.S.

    1989-10-17

    Disclosed is a method for improving the limit of detection for a data set in which experimental noise is uncorrelated along a given abscissa and an analytical signal is correlated to the abscissa, the steps comprising collecting the data set, converting the data set into a data signal including an analytical portion and the experimental noise portion, designating and adjusting a baseline of the data signal to center the experimental noise numerically about a zero reference, and integrating the data signal preserving the corresponding information for each point of the data signal. The steps of the method produce an enhanced integrated data signal which improves the limit of detection of the data signal. 8 figs.

  7. The Capabilities and Limitation of Remote Visual Methods to Detect Service-Induced Cracks in Reactor Components

    SciTech Connect (OSTI)

    Cumblidge, Stephen E.; Doctor, Steven R.; Anderson, Michael T.

    2006-11-01

    Since 1977, the U.S. Nuclear Regulatory Commission (NRC) Office of Nuclear Regulatory Research has funded a multiyear program at the Pacific Northwest National Laboratory (PNNL) to evaluate the reliability and accuracy of nondestructive evaluation (NDE) techniques employed for inservice inspection (ISI). Recently, the U.S. nuclear industry proposed replacing current volumetric and/or surface examinations of certain components in commercial nuclear power plants, as required by ASME Boiler and Pressure Vessel Code Section XI, with a simpler visual testing (VT) method. The advantages of VT are that these tests generally involve much less radiation exposure and examination times than do volumetric examinations such as ultrasonic testing (UT). However, for industry to justify supplamenting volumetric metods with VT, and analysis of pertinent issues is needed to support the reliability of VT in determining the structural intefrity of reactor components. As piping and pressure vessel compoents in a nuclear power station are generally underwater and in high radiation field, they need to be examined by VT from a distance with radiation-hardened video systems. Remote visual testing has been used by nuclear utilities to find cracks in pressure vessel cladding in pressurized water reactors, for shrouds in boiling water reactors, and to investigate leaks in piping and reactor components. These visual tests are performed using a wide variety of procedures and equipment. The techniques for remote visual testing use submersible closed-circuit video cameras to examine reactor components and welds. PNNL has conducted a parametric study that examines the important variables that affect the effectiveness of a remote visual test. Tested variables include lighting techniques, camera resolution, camera movement, and magnification. PNNL has also conductrd a laboratory test using a commercial visual testing camera system to experimentally determine the ability of the camera system to detect cracks of various widths under ideal conditions.

  8. Recovery Efficiency, False Negative Rate, and Limit of Detection...

    Office of Scientific and Technical Information (OSTI)

    Recovery Efficiency, False Negative Rate, and Limit of Detection Performance of a Validated Macrofoam-Swab Sampling Method with Low Surface Concentrations of Two Bacillus anthracis...

  9. Tritium Detection Methods and Limitations

    Office of Environmental Management (EM)

    Control Technical Position 2001-02, Washington, D.C. (2001). Voss (2000), J. T., LA-UR-00-2584, Los Alamos Radiation Monitoring Notebook, (2000). Woehr (1994), W.J., Gatami,...

  10. Error detection method

    DOE Patents [OSTI]

    Olson, Eric J.

    2013-06-11

    An apparatus, program product, and method that run an algorithm on a hardware based processor, generate a hardware error as a result of running the algorithm, generate an algorithm output for the algorithm, compare the algorithm output to another output for the algorithm, and detect the hardware error from the comparison. The algorithm is designed to cause the hardware based processor to heat to a degree that increases the likelihood of hardware errors to manifest, and the hardware error is observable in the algorithm output. As such, electronic components may be sufficiently heated and/or sufficiently stressed to create better conditions for generating hardware errors, and the output of the algorithm may be compared at the end of the run to detect a hardware error that occurred anywhere during the run that may otherwise not be detected by traditional methodologies (e.g., due to cooling, insufficient heat and/or stress, etc.).

  11. Method for detecting biomolecules

    DOE Patents [OSTI]

    Huo, Qisheng (Albuquerque, NM); Liu, Jun (Albuquerque, NM)

    2008-08-12

    A method for detecting and measuring the concentration of biomolecules in solution, utilizing a conducting electrode in contact with a solution containing target biomolecules, with a film with controllable pore size distribution characteristics applied to at least one surface of the conducting electrode. The film is functionalized with probe molecules that chemically interact with the target biomolecules at the film surface, blocking indicator molecules present in solution from diffusing from the solution to the electrode, thereby changing the electrochemical response of the electrode

  12. Recovery Efficiency, False Negative Rate, and Limit of Detection Performance of a Validated Macrofoam-Swab Sampling Method with Low Surface Concentrations of Two Bacillus anthracis Surrogates

    SciTech Connect (OSTI)

    Piepel, Gregory F.; Hutchison, Janine R.; Deatherage Kaiser, Brooke L; Amidan, Brett G.; Sydor, Michael A.; Barrett, Christopher A.

    2015-03-31

    The performance of a macrofoam-swab sampling method was evaluated using Bacillus anthracis Sterne (BAS) and Bacillus atrophaeus Nakamura (BG) spores applied at nine low target amounts (2-500 spores) to positive-control plates and test coupons (2 in. × 2 in.) of four surface materials (glass, stainless steel, vinyl tile, and plastic). Test results from cultured samples were used to evaluate the effects of surrogate, surface concentration, and surface material on recovery efficiency (RE), false negative rate (FNR), and limit of detection. For RE, surrogate and surface material had statistically significant effects, but concentration did not. Mean REs were the lowest for vinyl tile (50.8% with BAS, 40.2% with BG) and the highest for glass (92.8% with BAS, 71.4% with BG). FNR values ranged from 0 to 0.833 for BAS and 0 to 0.806 for BG, with values increasing as concentration decreased in the range tested (0.078 to 19.375 CFU/cm2, where CFU denotes ‘colony forming units’). Surface material also had a statistically significant effect. A FNR-concentration curve was fit for each combination of surrogate and surface material. For both surrogates, the FNR curves tended to be the lowest for glass and highest for vinyl title. The FNR curves for BG tended to be higher than for BAS at lower concentrations, especially for glass. Results using a modified Rapid Viability-Polymerase Chain Reaction (mRV-PCR) analysis method were also obtained. The mRV-PCR results and comparisons to the culture results will be discussed in a subsequent report.

  13. Nucleic Acid Detection Methods

    DOE Patents [OSTI]

    Smith, Cassandra L. (Boston, MA); Yaar, Ron (Brookline, MA); Szafranski, Przemyslaw (Boston, MA); Cantor, Charles R. (Boston, MA)

    1998-05-19

    The invention relates to methods for rapidly determining the sequence and/or length a target sequence. The target sequence may be a series of known or unknown repeat sequences which are hybridized to an array of probes. The hybridized array is digested with a single-strand nuclease and free 3'-hydroxyl groups extended with a nucleic acid polymerase. Nuclease cleaved heteroduplexes can be easily distinguish from nuclease uncleaved heteroduplexes by differential labeling. Probes and target can be differentially labeled with detectable labels. Matched target can be detected by cleaving resulting loops from the hybridized target and creating free 3-hydroxyl groups. These groups are recognized and extended by polymerases added into the reaction system which also adds or releases one label into solution. Analysis of the resulting products using either solid phase or solution. These methods can be used to detect characteristic nucleic acid sequences, to determine target sequence and to screen for genetic defects and disorders. Assays can be conducted on solid surfaces allowing for multiple reactions to be conducted in parallel and, if desired, automated.

  14. Nucleic acid detection methods

    DOE Patents [OSTI]

    Smith, C.L.; Yaar, R.; Szafranski, P.; Cantor, C.R.

    1998-05-19

    The invention relates to methods for rapidly determining the sequence and/or length a target sequence. The target sequence may be a series of known or unknown repeat sequences which are hybridized to an array of probes. The hybridized array is digested with a single-strand nuclease and free 3{prime}-hydroxyl groups extended with a nucleic acid polymerase. Nuclease cleaved heteroduplexes can be easily distinguish from nuclease uncleaved heteroduplexes by differential labeling. Probes and target can be differentially labeled with detectable labels. Matched target can be detected by cleaving resulting loops from the hybridized target and creating free 3-hydroxyl groups. These groups are recognized and extended by polymerases added into the reaction system which also adds or releases one label into solution. Analysis of the resulting products using either solid phase or solution. These methods can be used to detect characteristic nucleic acid sequences, to determine target sequence and to screen for genetic defects and disorders. Assays can be conducted on solid surfaces allowing for multiple reactions to be conducted in parallel and, if desired, automated. 18 figs.

  15. Waveguide disturbance detection method

    DOE Patents [OSTI]

    Korneev, Valeri A. (Albany, CA); Nihei, Kurt T. (Oakland, CA); Myer, Larry R. (Benicia, CA)

    2000-01-01

    A method for detection of a disturbance in a waveguide comprising transmitting a wavefield having symmetric and antisymmetric components from a horizontally and/or vertically polarized source and/or pressure source disposed symmetrically with respect to the longitudinal central axis of the waveguide at one end of the waveguide, recording the horizontal and/or vertical component or a pressure of the wavefield with a vertical array of receivers disposed at the opposite end of the waveguide, separating the wavenumber transform of the wavefield into the symmetric and antisymmetric components, integrating the symmetric and antisymmetric components over a broad frequency range, and comparing the magnitude of the symmetric components and the antisymmetric components to an expected magnitude for the symmetric components and the antisymmetric components for a waveguide of uniform thickness and properties thereby determining whether or not a disturbance is present inside the waveguide.

  16. Method for detecting an element

    DOE Patents [OSTI]

    Blackwood, Larry G.; Reber, Edward L.; Rohde, Kenneth W.

    2007-02-06

    A method for detecting an element is disclosed and which includes the steps of providing a gamma-ray spectrum which depicts, at least in part, a test region having boundaries, and which has a small amount of the element to be detected; providing a calculation which detects the small amount of the element to be detected; and providing a moving window and performing the calculation within the moving window, and over a range of possible window boundaries within the test region to determine the location of the optimal test region within the gamma-ray spectrum.

  17. Limits on the thermoacoustic detectability of electric and magnetic charges

    SciTech Connect (OSTI)

    Akerlof, C.W.

    1982-09-01

    The energy loss is estimated for a slow magnetic monopole traveling through a conductor. The thermoacoustic signal derived from this process is compared to the acoustic phonon fluctuation pressure. The results show that single-monopole detectability is strongly limited by thermal noise. These calculations also imply severe limits for the detectability of charged-particle cascades.

  18. Method for detecting toxic gases

    DOE Patents [OSTI]

    Stetter, J.R.; Zaromb, S.; Findlay, M.W. Jr.

    1991-10-08

    A method is disclosed which is capable of detecting low concentrations of a pollutant or other component in air or other gas. This method utilizes a combination of a heating filament having a catalytic surface of a noble metal for exposure to the gas and producing a derivative chemical product from the component. An electrochemical sensor responds to the derivative chemical product for providing a signal indicative of the product. At concentrations in the order of about 1-100 ppm of tetrachloroethylene, neither the heating filament nor the electrochemical sensor is individually capable of sensing the pollutant. In the combination, the heating filament converts the benzyl chloride to one or more derivative chemical products which may be detected by the electrochemical sensor. 6 figures.

  19. Method for detecting toxic gases

    DOE Patents [OSTI]

    Stetter, Joseph R. (Naperville, IL); Zaromb, Solomon (Hinsdale, IL); Findlay, Jr., Melvin W. (Bolingbrook, IL)

    1991-01-01

    A method capable of detecting low concentrations of a pollutant or other component in air or other gas, utilizing a combination of a heating filament having a catalytic surface of a noble metal for exposure to the gas and producing a derivative chemical product from the component, and an electrochemical sensor responsive to the derivative chemical product for providing a signal indicative of the product. At concentrations in the order of about 1-100 ppm of tetrachloroethylene, neither the heating filament nor the electrochemical sensor is individually capable of sensing the pollutant. In the combination, the heating filament converts the benzyl chloride to one or more derivative chemical products which may be detected by the electrochemical sensor.

  20. Explosives detection system and method

    DOE Patents [OSTI]

    Reber, Edward L. (Idaho Falls, ID); Jewell, James K. (Idaho Falls, ID); Rohde, Kenneth W. (Idaho Falls, ID); Seabury, Edward H. (Idaho Falls, ID); Blackwood, Larry G. (Idaho Falls, ID); Edwards, Andrew J. (Idaho Falls, ID); Derr, Kurt W. (Idaho Falls, ID)

    2007-12-11

    A method of detecting explosives in a vehicle includes providing a first rack on one side of the vehicle, the rack including a neutron generator and a plurality of gamma ray detectors; providing a second rack on another side of the vehicle, the second rack including a neutron generator and a plurality of gamma ray detectors; providing a control system, remote from the first and second racks, coupled to the neutron generators and gamma ray detectors; using the control system, causing the neutron generators to generate neutrons; and performing gamma ray spectroscopy on spectra read by the gamma ray detectors to look for a signature indicative of presence of an explosive. Various apparatus and other methods are also provided.

  1. Global limits and interference patterns in dark matter direct detection

    SciTech Connect (OSTI)

    Catena, Riccardo; Gondolo, Paolo

    2015-08-13

    We compare the general effective theory of one-body dark matter nucleon interactions to current direct detection experiments in a global multidimensional statistical analysis. We derive exclusion limits on the 28 isoscalar and isovector coupling constants of the theory, and show that current data place interesting constraints on dark matter-nucleon interaction operators usually neglected in this context. We characterize the interference patterns that can arise in dark matter direct detection from pairs of dark matter-nucleon interaction operators, or from isoscalar and isovector components of the same operator. We find that commonly neglected destructive interference effects weaken standard direct detection exclusion limits by up to one order of magnitude in the coupling constants.

  2. Particle detection systems and methods

    DOE Patents [OSTI]

    Morris, Christopher L.; Makela, Mark F.

    2010-05-11

    Techniques, apparatus and systems for detecting particles such as muons and neutrons. In one implementation, a particle detection system employs a plurality of drift cells, which can be for example sealed gas-filled drift tubes, arranged on sides of a volume to be scanned to track incoming and outgoing charged particles, such as cosmic ray-produced muons. The drift cells can include a neutron sensitive medium to enable concurrent counting of neutrons. The system can selectively detect devices or materials, such as iron, lead, gold, uranium, plutonium, and/or tungsten, occupying the volume from multiple scattering of the charged particles passing through the volume and can concurrently detect any unshielded neutron sources occupying the volume from neutrons emitted therefrom. If necessary, the drift cells can be used to also detect gamma rays. The system can be employed to inspect occupied vehicles at border crossings for nuclear threat objects.

  3. Method For Detecting Biological Agents

    DOE Patents [OSTI]

    Chen, Liaohai (Los Alamos, NM); McBranch, Duncan W. (Santa Fe, NM); Wang, Hsing-Lin (Los Alamos, NM); Whitten, David G. (Santa Fe, NM)

    2005-12-27

    A sensor is provided including a polymer capable of having an alterable measurable property from the group of luminescence and electrical conductivity, the polymer having an intermediate combination of a recognition element, a tethering element and a property-altering element bound thereto and capable of altering the measurable property, the intermediate combination adapted for subsequent separation from the polymer upon exposure to an agent having an affinity for binding to the recognition element whereupon the separation of the intermediate combination from the polymer results in a detectable change in the alterable measurable property, and, detecting said detectable change in the alterable measurable property.

  4. Maximum patch method for directional dark matter detection

    SciTech Connect (OSTI)

    Henderson, Shawn; Monroe, Jocelyn; Fisher, Peter [Department of Physics, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States); Laboratory for Nuclear Science, MIT Kavli Institute for Astrophysics and Space Research, Department of Physics, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139 (United States)

    2008-07-01

    Present and planned dark matter detection experiments search for WIMP-induced nuclear recoils in poorly known background conditions. In this environment, the maximum gap statistical method provides a way of setting more sensitive cross section upper limits by incorporating known signal information. We give a recipe for the numerical calculation of upper limits for planned directional dark matter detection experiments, that will measure both recoil energy and angle, based on the gaps between events in two-dimensional phase space.

  5. Method of detecting sulfur dioxide

    DOE Patents [OSTI]

    Spicer, Leonard D.; Bennett, Dennis W.; Davis, Jon F.

    1985-01-01

    (CH.sub.3).sub.3 SiNSO is produced by the reaction of ((CH.sub.3).sub.3 Si).sub.2 NH with SO.sub.2. Also produced in the reaction are ((CH.sub.3).sub.3 Si).sub.2 O and a new solid compound [NH.sub.4 ][(CH.sub.3).sub.3 SiOSO.sub.2 ]. Both (CH.sub.3).sub.3 SiNSO and [NH.sub.4 ][(CH.sub.3).sub.3 SiOSO.sub.2 ] have fluorescent properties. The reaction of the subject invention is used in a method of measuring the concentration of SO.sub.2 pollutants in gases. By the method, a sample of gas is bubbled through a solution of ((CH.sub.3).sub.3 Si).sub.2 NH, whereby any SO.sub.2 present in the gas will react to produce the two fluorescent products. The measured fluorescence of these products can then be used to calculate the concentration of SO.sub.2 in the original gas sample. The solid product [NH.sub.4][(CH.sub.3).sub.3 SiOSO.sub.2 ] may be used as a standard in solid state NMR spectroscopy.

  6. Spectral analysis method for detecting an element

    DOE Patents [OSTI]

    Blackwood, Larry G [Idaho Falls, ID; Edwards, Andrew J [Idaho Falls, ID; Jewell, James K [Idaho Falls, ID; Reber, Edward L [Idaho Falls, ID; Seabury, Edward H [Idaho Falls, ID

    2008-02-12

    A method for detecting an element is described and which includes the steps of providing a gamma-ray spectrum which has a region of interest which corresponds with a small amount of an element to be detected; providing nonparametric assumptions about a shape of the gamma-ray spectrum in the region of interest, and which would indicate the presence of the element to be detected; and applying a statistical test to the shape of the gamma-ray spectrum based upon the nonparametric assumptions to detect the small amount of the element to be detected.

  7. Bioluminescent bioreporter integrated circuit detection methods

    DOE Patents [OSTI]

    Simpson, Michael L.; Paulus, Michael J.; Sayler, Gary S.; Applegate, Bruce M.; Ripp, Steven A.

    2005-06-14

    Disclosed are monolithic bioelectronic devices comprising a bioreporter and an OASIC. These bioluminescent bioreporter integrated circuit are useful in detecting substances such as pollutants, explosives, and heavy-metals residing in inhospitable areas such as groundwater, industrial process vessels, and battlefields. Also disclosed are methods and apparatus for detection of particular analytes, including ammonia and estrogen compounds.

  8. Apparatus and methods for detecting chemical permeation

    DOE Patents [OSTI]

    Vo-Dinh, Tuan (Knoxville, TN)

    1994-01-01

    Apparatus and methods for detecting the permeation of hazardous or toxic chemicals through protective clothing are disclosed. The hazardous or toxic chemicals of interest do not possess the spectral characteristic of luminescence. The apparatus and methods utilize a spectrochemical modification technique to detect the luminescence quenching of an indicator compound which upon permeation of the chemical through the protective clothing, the indicator is exposed to the chemical, thus indicating chemical permeation.

  9. Method for early detection of cooling-loss events

    DOE Patents [OSTI]

    Bermudez, Sergio A.; Hamann, Hendrik; Marianno, Fernando J.

    2015-06-30

    A method of detecting cooling-loss event early is provided. The method includes defining a relative humidity limit and change threshold for a given space, measuring relative humidity in the given space, determining, with a processing unit, whether the measured relative humidity is within the defined relative humidity limit, generating a warning in an event the measured relative humidity is outside the defined relative humidity limit and determining whether a change in the measured relative humidity is less than the defined change threshold for the given space and generating an alarm in an event the change is greater than the defined change threshold.

  10. Method for early detection of cooling-loss events

    DOE Patents [OSTI]

    Bermudez, Sergio A.; Hamann, Hendrik F.; Marianno, Fernando J.

    2015-12-22

    A method of detecting cooling-loss event early is provided. The method includes defining a relative humidity limit and change threshold for a given space, measuring relative humidity in the given space, determining, with a processing unit, whether the measured relative humidity is within the defined relative humidity limit, generating a warning in an event the measured relative humidity is outside the defined relative humidity limit and determining whether a change in the measured relative humidity is less than the defined change threshold for the given space and generating an alarm in an event the change is greater than the defined change threshold.

  11. Radionuclide detection devices and associated methods

    DOE Patents [OSTI]

    Mann, Nicholas R. (Rigby, ID); Lister, Tedd E. (Idaho Falls, ID); Tranter, Troy J. (Idaho Falls, ID)

    2011-03-08

    Radionuclide detection devices comprise a fluid cell comprising a flow channel for a fluid stream. A radionuclide collector is positioned within the flow channel and configured to concentrate one or more radionuclides from the fluid stream onto at least a portion of the radionuclide collector. A scintillator for generating scintillation pulses responsive to an occurrence of a decay event is positioned proximate at least a portion of the radionuclide collector and adjacent to a detection system for detecting the scintillation pulses. Methods of selectively detecting a radionuclide are also provided.

  12. Method for remote detection of trace contaminants

    DOE Patents [OSTI]

    Simonson, Robert J.; Hance, Bradley G.

    2003-09-09

    A method for remote detection of trace contaminants in a target area comprises applying sensor particles that preconcentrate the trace contaminant to the target area and detecting the contaminant-sensitive fluorescence from the sensor particles. The sensor particles can have contaminant-sensitive and contaminant-insensitive fluorescent compounds to enable the determination of the amount of trace contaminant present in the target are by relative comparison of the emission of the fluorescent compounds by a local or remote fluorescence detector. The method can be used to remotely detect buried minefields.

  13. High sensitivity leak detection method and apparatus

    DOE Patents [OSTI]

    Myneni, Ganapatic R. (Grafton, VA)

    1994-01-01

    An improved leak detection method is provided that utilizes the cyclic adsorption and desorption of accumulated helium on a non-porous metallic surface. The method provides reliable leak detection at superfluid helium temperatures. The zero drift that is associated with residual gas analyzers in common leak detectors is virtually eliminated by utilizing a time integration technique. The sensitivity of the apparatus of this disclosure is capable of detecting leaks as small as 1.times.10.sup.-18 atm cc sec.sup.-1.

  14. High sensitivity leak detection method and apparatus

    DOE Patents [OSTI]

    Myneni, G.R.

    1994-09-06

    An improved leak detection method is provided that utilizes the cyclic adsorption and desorption of accumulated helium on a non-porous metallic surface. The method provides reliable leak detection at superfluid helium temperatures. The zero drift that is associated with residual gas analyzers in common leak detectors is virtually eliminated by utilizing a time integration technique. The sensitivity of the apparatus of this disclosure is capable of detecting leaks as small as 1 [times] 10[sup [minus]18] atm cc sec[sup [minus]1]. 2 figs.

  15. Automated macromolecular crystal detection system and method

    DOE Patents [OSTI]

    Christian, Allen T. (Tracy, CA); Segelke, Brent (San Ramon, CA); Rupp, Bernard (Livermore, CA); Toppani, Dominique (Fontainebleau, FR)

    2007-06-05

    An automated macromolecular method and system for detecting crystals in two-dimensional images, such as light microscopy images obtained from an array of crystallization screens. Edges are detected from the images by identifying local maxima of a phase congruency-based function associated with each image. The detected edges are segmented into discrete line segments, which are subsequently geometrically evaluated with respect to each other to identify any crystal-like qualities such as, for example, parallel lines, facing each other, similarity in length, and relative proximity. And from the evaluation a determination is made as to whether crystals are present in each image.

  16. Apparatus and methods for detecting chemical permeation

    DOE Patents [OSTI]

    Vo-Dinh, T.

    1994-12-27

    Apparatus and methods for detecting the permeation of hazardous or toxic chemicals through protective clothing are disclosed. The hazardous or toxic chemicals of interest do not possess the spectral characteristic of luminescence. The apparatus and methods utilize a spectrochemical modification technique to detect the luminescence quenching of an indicator compound which upon permeation of the chemical through the protective clothing, the indicator is exposed to the chemical, thus indicating chemical permeation. The invention also relates to the fabrication of protective clothing materials. 13 figures.

  17. Novel methods for detecting buried explosive devices

    SciTech Connect (OSTI)

    Kercel, S.W.; Burlage, R.S.; Patek, D.R.; Smith, C.M.; Hibbs, A.D.; Rayner, T.J.

    1997-04-01

    Oak Ridge National Laboratory (ORNL) and Quantum Magnetics, Inc. (QM) are exploring novel landmine detection technologies. Technologies considered here include bioreporter bacteria, swept acoustic resonance, nuclear quadrupole resonance (NQR), and semiotic data fusion. Bioreporter bacteria look promising for third-world humanitarian applications; they are inexpensive, and deployment does not require high-tech methods. Swept acoustic resonance may be a useful adjunct to magnetometers in humanitarian demining. For military demining, NQR is a promising method for detecting explosive substances; of 50,000 substances that have been tested, none has an NQR signature that can be mistaken for RDX or TNT. For both military and commercial demining, sensor fusion entails two daunting tasks, identifying fusible features in both present-day and emerging technologies, and devising a fusion algorithm that runs in real-time on cheap hardware. Preliminary research in these areas is encouraging. A bioreporter bacterium for TNT detection is under development. Investigation has just started in swept acoustic resonance as an approach to a cheap mine detector for humanitarian use. Real-time wavelet processing appears to be a key to extending NQR bomb detection into mine detection, including TNT-based mines. Recent discoveries in semiotics may be the breakthrough that will lead to a robust fused detection scheme.

  18. Optical limiting device and method of preparation thereof

    DOE Patents [OSTI]

    Wang, Hsing-Lin (Los Alamos, NM); Xu, Su (Santa Clara, CA); McBranch, Duncan W. (Santa Fe, NM)

    2003-01-01

    Optical limiting device and method of preparation thereof. The optical limiting device includes a transparent substrate and at least one homogeneous layer of an RSA material in polyvinylbutyral attached to the substrate. The device may be produced by preparing a solution of an RSA material, preferably a metallophthalocyanine complex, and a solution of polyvinylbutyral, and then mixing the two solutions together to remove air bubbles. The resulting solution is layered onto the substrate and the solvent is evaporated. The method can be used to produce a dual tandem optical limiting device.

  19. Flow cytometric detection method for DNA samples

    DOE Patents [OSTI]

    Nasarabadi,Shanavaz (Livermore, CA); Langlois, Richard G. (Livermore, CA); Venkateswaran, Kodumudi S. (Round Rock, TX)

    2011-07-05

    Disclosed herein are two methods for rapid multiplex analysis to determine the presence and identity of target DNA sequences within a DNA sample. Both methods use reporting DNA sequences, e.g., modified conventional Taqman.RTM. probes, to combine multiplex PCR amplification with microsphere-based hybridization using flow cytometry means of detection. Real-time PCR detection can also be incorporated. The first method uses a cyanine dye, such as, Cy3.TM., as the reporter linked to the 5' end of a reporting DNA sequence. The second method positions a reporter dye, e.g., FAM.TM. on the 3' end of the reporting DNA sequence and a quencher dye, e.g., TAMRA.TM., on the 5' end.

  20. Flow cytometric detection method for DNA samples

    DOE Patents [OSTI]

    Nasarabadi, Shanavaz (Livermore, CA); Langlois, Richard G. (Livermore, CA); Venkateswaran, Kodumudi S. (Livermore, CA)

    2006-08-01

    Disclosed herein are two methods for rapid multiplex analysis to determine the presence and identity of target DNA sequences within a DNA sample. Both methods use reporting DNA sequences, e.g., modified conventional Taqman.RTM. probes, to combine multiplex PCR amplification with microsphere-based hybridization using flow cytometry means of detection. Real-time PCR detection can also be incorporated. The first method uses a cyanine dye, such as, Cy3.TM., as the reporter linked to the 5' end of a reporting DNA sequence. The second method positions a reporter dye, e.g., FAM, on the 3' end of the reporting DNA sequence and a quencher dye, e.g., TAMRA, on the 5' end.

  1. Method for detecting sophisticated cyber attacks

    SciTech Connect (OSTI)

    Potok, Thomas E. (Oak Ridge, TN)

    2008-11-18

    A method of analyzing computer intrusion detection information that looks beyond known attacks and abnormal access patterns to the critical information that an intruder may want to access. Unique target identifiers and type of work performed by the networked targets is added to audit log records. Analysis using vector space modeling, dissimilarity matrix comparison, and clustering of the event records is then performed.

  2. Method for detecting gas turbine engine flashback

    DOE Patents [OSTI]

    Singh, Kapil Kumar; Varatharajan, Balachandar; Kraemer, Gilbert Otto; Yilmaz, Ertan; Lacy, Benjamin Paul

    2012-09-04

    A method for monitoring and controlling a gas turbine, comprises predicting frequencies of combustion dynamics in a combustor using operating conditions of a gas turbine, receiving a signal from a sensor that is indicative of combustion dynamics in the combustor, and detecting a flashback if a frequency of the received signal does not correspond to the predicted frequencies.

  3. Method and apparatus for detecting an analyte

    DOE Patents [OSTI]

    Allendorf, Mark D. (Pleasanton, CA); Hesketh, Peter J. (Atlanta, GA)

    2011-11-29

    We describe the use of coordination polymers (CP) as coatings on microcantilevers for the detection of chemical analytes. CP exhibit changes in unit cell parameters upon adsorption of analytes, which will induce a stress in a static microcantilever upon which a CP layer is deposited. We also describe fabrication methods for depositing CP layers on surfaces.

  4. Method and system for detecting an explosive

    DOE Patents [OSTI]

    Reber, Edward L.; Rohde, Kenneth W.; Blackwood, Larry G.

    2010-12-07

    A method and system for detecting at least one explosive in a vehicle using a neutron generator and a plurality of NaI detectors. Spectra read from the detectors is calibrated by performing Gaussian peak fitting to define peak regions, locating a Na peak and an annihilation peak doublet, assigning a predetermined energy level to one peak in the doublet, and predicting a hydrogen peak location based on a location of at least one peak of the doublet. The spectra are gain shifted to a common calibration, summed for respective groups of NaI detectors, and nitrogen detection analysis performed on the summed spectra for each group.

  5. System and method for anomaly detection

    DOE Patents [OSTI]

    Scherrer, Chad

    2010-06-15

    A system and method for detecting one or more anomalies in a plurality of observations is provided. In one illustrative embodiment, the observations are real-time network observations collected from a stream of network traffic. The method includes performing a discrete decomposition of the observations, and introducing derived variables to increase storage and query efficiencies. A mathematical model, such as a conditional independence model, is then generated from the formatted data. The formatted data is also used to construct frequency tables which maintain an accurate count of specific variable occurrence as indicated by the model generation process. The formatted data is then applied to the mathematical model to generate scored data. The scored data is then analyzed to detect anomalies.

  6. Neutron-detecting apparatuses and methods of fabrication (Patent...

    Office of Scientific and Technical Information (OSTI)

    Patent: Neutron-detecting apparatuses and methods of fabrication Citation Details In-Document Search Title: Neutron-detecting apparatuses and methods of fabrication You are...

  7. Surface property detection apparatus and method

    DOE Patents [OSTI]

    Martens, Jon S. (Albuquerque, NM); Ginley, David S. (Evergreen, CO); Hietala, Vincent M. (Placitas, NM); Sorensen, Neil R. (Albuquerque, NM)

    1995-01-01

    Apparatus and method for detecting, determining, and imaging surface resistance corrosion, thin film growth, and oxide formation on the surface of conductors or other electrical surface modification. The invention comprises a modified confocal resonator structure with the sample remote from the radiating mirror. Surface resistance is determined by analyzing and imaging reflected microwaves; imaging reveals anomalies due to surface impurities, non-stoichiometry, and the like, in the surface of the superconductor, conductor, dielectric, or semiconductor.

  8. Surface property detection apparatus and method

    DOE Patents [OSTI]

    Martens, J.S.; Ginley, D.S.; Hietala, V.M.; Sorensen, N.R.

    1995-08-08

    Apparatus and method for detecting, determining, and imaging surface resistance corrosion, thin film growth, and oxide formation on the surface of conductors or other electrical surface modification. The invention comprises a modified confocal resonator structure with the sample remote from the radiating mirror. Surface resistance is determined by analyzing and imaging reflected microwaves; imaging reveals anomalies due to surface impurities, non-stoichiometry, and the like, in the surface of the superconductor, conductor, dielectric, or semiconductor. 4 figs.

  9. Method and apparatus for detecting neutrons

    DOE Patents [OSTI]

    Perkins, R.W.; Reeder, P.L.; Wogman, N.A.; Warner, R.A.; Brite, D.W.; Richey, W.C.; Goldman, D.S.

    1997-10-21

    The instant invention is a method for making and using an apparatus for detecting neutrons. Scintillating optical fibers are fabricated by melting SiO{sub 2} with a thermal neutron capturing substance and a scintillating material in a reducing atmosphere. The melt is then drawn into fibers in an anoxic atmosphere. The fibers may then be coated and used directly in a neutron detection apparatus, or assembled into a geometrical array in a second, hydrogen-rich, scintillating material such as a polymer. Photons generated by interaction with thermal neutrons are trapped within the coated fibers and are directed to photoelectric converters. A measurable electronic signal is generated for each thermal neutron interaction within the fiber. These electronic signals are then manipulated, stored, and interpreted by normal methods to infer the quality and quantity of incident radiation. When the fibers are arranged in an array within a second scintillating material, photons generated by kinetic neutrons interacting with the second scintillating material and photons generated by thermal neutron capture within the fiber can both be directed to photoelectric converters. These electronic signals are then manipulated, stored, and interpreted by normal methods to infer the quality and quantity of incident radiation. 5 figs.

  10. Method and apparatus for detecting neutrons

    DOE Patents [OSTI]

    Perkins, Richard W. (Richland, WA); Reeder, Paul L. (Richland, WA); Wogman, Ned A. (Richland, WA); Warner, Ray A. (Benton City, WA); Brite, Daniel W. (Richland, WA); Richey, Wayne C. (Richland, WA); Goldman, Don S. (Orangevale, CA)

    1997-01-01

    The instant invention is a method for making and using an apparatus for detecting neutrons. Scintillating optical fibers are fabricated by melting SiO.sub.2 with a thermal neutron capturing substance and a scintillating material in a reducing atmosphere. The melt is then drawn into fibers in an anoxic atmosphere. The fibers may then be coated and used directly in a neutron detection apparatus, or assembled into a geometrical array in a second, hydrogen-rich, scintillating material such as a polymer. Photons generated by interaction with thermal neutrons are trapped within the coated fibers and are directed to photoelectric converters. A measurable electronic signal is generated for each thermal neutron interaction within the fiber. These electronic signals are then manipulated, stored, and interpreted by normal methods to infer the quality and quantity of incident radiation. When the fibers are arranged in an array within a second scintillating material, photons generated by kinetic neutrons interacting with the second scintillating material and photons generated by thermal neutron capture within the fiber can both be directed to photoelectric converters. These electronic signals are then manipulated, stored, and interpreted by normal methods to infer the quality and quantity of incident radiation.

  11. Systems and methods for detecting and processing

    DOE Patents [OSTI]

    Johnson, Michael M. (Livermore, CA); Yoshimura, Ann S. (Tracy, CA)

    2006-03-28

    Embodiments of the present invention provides systems and method for detecting. Sensing modules are provided in communication with one or more detectors. In some embodiments, detectors are provided that are sensitive to chemical, biological, or radiological agents. Embodiments of sensing modules include processing capabilities to analyze, perform computations on, and/or run models to predict or interpret data received from one or more detectors. Embodiments of sensing modules form various network configurations with one another and/or with one or more data aggregation devices. Some embodiments of sensing modules include power management functionalities.

  12. Method and apparatus for detecting explosives

    DOE Patents [OSTI]

    Moore, David Steven

    2011-05-10

    A method and apparatus is provided for detecting explosives by thermal imaging. The explosive material is subjected to a high energy wave which can be either a sound wave or an electromagnetic wave which will initiate a chemical reaction in the explosive material which chemical reaction will produce heat. The heat is then sensed by a thermal imaging device which will provide a signal to a computing device which will alert a user of the apparatus to the possibility of an explosive device being present.

  13. Method and system for detecting explosives

    DOE Patents [OSTI]

    Reber, Edward L.; Jewell, James K.; Rohde, Kenneth W.; Seabury, Edward H.; Blackwood, Larry G.; Edwards, Andrew J.; Derr, Kurt W.

    2009-03-10

    A method of detecting explosives in a vehicle includes providing a first rack on one side of the vehicle, the rack including a neutron generator and a plurality of gamma ray detectors; providing a second rack on another side of the vehicle, the second rack including a neutron generator and a plurality of gamma ray detectors; providing a control system, remote from the first and second racks, coupled to the neutron generators and gamma ray detectors; using the control system, causing the neutron generators to generate neutrons; and performing gamma ray spectroscopy on spectra read by the gamma ray detectors to look for a signature indicative of presence of an explosive. Various apparatus and other methods are also provided.

  14. Nucleic acid detection system and method for detecting influenza

    DOE Patents [OSTI]

    Cai, Hong; Song, Jian

    2015-03-17

    The invention provides a rapid, sensitive and specific nucleic acid detection system which utilizes isothermal nucleic acid amplification in combination with a lateral flow chromatographic device, or DNA dipstick, for DNA-hybridization detection. The system of the invention requires no complex instrumentation or electronic hardware, and provides a low cost nucleic acid detection system suitable for highly sensitive pathogen detection. Hybridization to single-stranded DNA amplification products using the system of the invention provides a sensitive and specific means by which assays can be multiplexed for the detection of multiple target sequences.

  15. Method and system for turbomachinery surge detection

    DOE Patents [OSTI]

    Faymon, David K.; Mays, Darrell C.; Xiong, Yufei

    2004-11-23

    A method and system for surge detection within a gas turbine engine, comprises: measuring the compressor discharge pressure (CDP) of the gas turbine over a period of time; determining a time derivative (CDP.sub.D ) of the measured (CDP) correcting the CDP.sub.D for altitude, (CDP.sub.DCOR); estimating a short-term average of CDP.sub.DCOR.sup.2 ; estimating a short-term average of CDP.sub.DCOR ; and determining a short-term variance of corrected CDP rate of change (CDP.sub.roc) based upon the short-term average of CDP.sub.DCOR and the short-term average of CDP.sub.DCOR.sup.2. The method and system then compares the short-term variance of corrected CDP rate of change with a pre-determined threshold (CDP.sub.proc) and signals an output when CDP.sub.roc >CDP.sub.proc. The method and system provides a signal of a surge within the gas turbine engine when CDP.sub.roc remains>CDP.sub.proc for pre-determined period of time.

  16. Systems and methods for detecting neutrons

    DOE Patents [OSTI]

    Bross, Alan D.; Mellott, Kerry L.; Pla-Dalmau, Anna

    2005-08-09

    Systems and methods for detecting neutrons. One or more neutron-sensitive scintillators can be configured from a plurality of nano-sized particles, dopants and an extruded plastic material, such as polystyrene. The nano-sized particles can be compounded into the extruded plastic material with at least one dopant that permits the plastic material to scintillate. One or more plastic light collectors can be associated with a neutron-sensitive scintillator, such that the plastic light collector includes a central hole thereof. A wavelength-shifting fiber can then be located within the hole. The wavelength shifting (WLS) fiber absorbs scintillation light having a wavelength thereof and re-emits the light at a longer wavelength.

  17. Liquid chromatography detection unit, system, and method

    DOE Patents [OSTI]

    Derenzo, Stephen E; Moses, William W

    2015-11-06

    An embodiment of a liquid chromatography detection unit includes a fluid channel and a radiation detector. The radiation detector is operable to image a distribution of a radiolabeled compound as the distribution travels along the fluid channel. An embodiment of a liquid chromatography system includes an injector, a separation column, and a radiation detector. The injector is operable to inject a sample that includes a radiolabeled compound into a solvent stream. The position sensitive radiation detector is operable to image a distribution of the radiolabeled compound as the distribution travels along a fluid channel. An embodiment of a method of liquid chromatography includes injecting a sample that comprises radiolabeled compounds into a solvent. The radiolabeled compounds are then separated. A position sensitive radiation detector is employed to image distributions of the radiolabeled compounds as the radiolabeled compounds travel along a fluid channel.

  18. Liquid chromatography detection unit, system, and method

    DOE Patents [OSTI]

    Derenzo, Stephen E.; Moses, William W.

    2015-10-27

    An embodiment of a liquid chromatography detection unit includes a fluid channel and a radiation detector. The radiation detector is operable to image a distribution of a radiolabeled compound as the distribution travels along the fluid channel. An embodiment of a liquid chromatography system includes an injector, a separation column, and a radiation detector. The injector is operable to inject a sample that includes a radiolabeled compound into a solvent stream. The position sensitive radiation detector is operable to image a distribution of the radiolabeled compound as the distribution travels along a fluid channel. An embodiment of a method of liquid chromatography includes injecting a sample that comprises radiolabeled compounds into a solvent. The radiolabeled compounds are then separated. A position sensitive radiation detector is employed to image distributions of the radiolabeled compounds as the radiolabeled compounds travel along a fluid channel.

  19. Methods to Improve the Lower Limit of Detection for Tritium...

    Office of Environmental Management (EM)

    Tritium Surface Contamination 10,000 DPM100 cm 2 STCs are Special Tritium Compounds STCs as metal tritides MAY be the MOST dangerous of ALL tritium forms. One case of death due to ...

  20. Temporary Emergency Exposure Limits for Chemicals: Methods and Practice

    Energy Savers [EERE]

    DOE-HDBK-1046-2008 August 2008 DOE HANDBOOK TEMPORARY EMERGENCY EXPOSURE LIMITS FOR CHEMICALS: METHODS AND PRACTICE U.S. Department of Energy AREA EMER Washington, D.C. 20585 DOE-HDBK-1046-2008 ii DISTRIBUTION STATEMENT A. Approved for public release; distribution is unlimited. DOE-HDBK-1046-2008 iii Available on the Department of Energy Technical Standards Program Web site at http://www.hss.energy.gov/nuclearsafety/techstds/ DOE-HDBK-1046-2008 iv FOREWORD In 2005, the Office of Emergency

  1. Method and apparatus to trigger superconductors in current limiting devices

    DOE Patents [OSTI]

    Yuan, Xing; Hazelton, Drew Willard; Walker, Michael Stephen

    2004-10-26

    A method and apparatus for magnetically triggering a superconductor in a superconducting fault current limiter to transition from a superconducting state to a resistive state. The triggering is achieved by employing current-carrying trigger coil or foil on either or both the inner diameter and outer diameter of a superconductor. The current-carrying coil or foil generates a magnetic field with sufficient strength and the superconductor is disposed within essentially uniform magnetic field region. For superconductor in a tubular-configured form, an additional magnetic field can be generated by placing current-carrying wire or foil inside the tube and along the center axial line.

  2. Radio frequency detection assembly and method for detecting radio frequencies

    DOE Patents [OSTI]

    Cown, Steven H. (Rigby, ID); Derr, Kurt Warren (Idaho Falls, ID)

    2010-03-16

    A radio frequency detection assembly is described and which includes a radio frequency detector which detects a radio frequency emission produced by a radio frequency emitter from a given location which is remote relative to the radio frequency detector; a location assembly electrically coupled with the radio frequency detector and which is operable to estimate the location of the radio frequency emitter from the radio frequency emission which has been received; and a radio frequency transmitter electrically coupled with the radio frequency detector and the location assembly, and which transmits a radio frequency signal which reports the presence of the radio frequency emitter.

  3. Methods, microfluidic devices, and systems for detection of an...

    Office of Scientific and Technical Information (OSTI)

    Methods, microfluidic devices, and systems for detection of an active enzymatic agent Citation Details In-Document Search Title: Methods, microfluidic devices, and systems for...

  4. System and method for detecting cells or components thereof

    DOE Patents [OSTI]

    Porter, Marc D. (Ames, IA); Lipert, Robert J. (Ames, IA); Doyle, Robert T. (Ames, IA); Grubisha, Desiree S. (Corona, CA); Rahman, Salma (Ames, IA)

    2009-01-06

    A system and method for detecting a detectably labeled cell or component thereof in a sample comprising one or more cells or components thereof, at least one cell or component thereof of which is detectably labeled with at least two detectable labels. In one embodiment, the method comprises: (i) introducing the sample into one or more flow cells of a flow cytometer, (ii) irradiating the sample with one or more light sources that are absorbed by the at least two detectable labels, the absorption of which is to be detected, and (iii) detecting simultaneously the absorption of light by the at least two detectable labels on the detectably labeled cell or component thereof with an array of photomultiplier tubes, which are operably linked to two or more filters that selectively transmit detectable emissions from the at least two detectable labels.

  5. Limiter

    DOE Patents [OSTI]

    Cohen, S.A.; Hosea, J.C.; Timberlake, J.R.

    1984-10-19

    A limiter with a specially contoured front face is provided. The front face of the limiter (the plasma-side face) is flat with a central indentation. In addition, the limiter shape is cylindrically symmetric so that the limiter can be rotated for greater heat distribution. This limiter shape accommodates the various power scrape-off distances lambda p, which depend on the parallel velocity, V/sub parallel/, of the impacting particles.

  6. Nuclear material detection apparatus and method

    DOE Patents [OSTI]

    Jones, James L.; Hoggan, Jerry M.; Harker, Yale D.; Yoon, Woo Y.; Johnson, Larry O.

    2006-11-28

    A device for detecting photonuclear-induced neutrons is described herein. One embodiment of the device may comprise a neutron detector and a detection circuit. The neutron detector may comprise a detector output. The detection circuit may be operatively connected to the detector output and may comprise an amplifier, a low-pass filter, and a high pass filter. The amplifier may comprise an amplifier input and an amplifier output. The amplifier input may be being operatively connected to the detector output. The low-pass filter may comprise a low-pass filter input and a low-pass filter output. The low-pass filter input may be operatively connected to the amplifier output. The high-pass filter may comprise a high-pass filter input and a high-pass filter output. The high-pass filter input may be operatively connected to the amplifier output.

  7. Limiter

    DOE Patents [OSTI]

    Cohen, Samuel A. (Hopewell, NJ); Hosea, Joel C. (Princeton, NJ); Timberlake, John R. (Allentown, NJ)

    1986-01-01

    A limiter with a specially contoured front face accommodates the various power scrape-off distances .lambda..sub.p, which depend on the parallel velocity, V.sub..parallel., of the impacting particles. The front face of the limiter (the plasma-side face) is flat with a central indentation. In addition, the limiter shape is cylindrically symmetric so that the limiter can be rotated for greater heat distribution.

  8. Methods and systems for detection of radionuclides

    DOE Patents [OSTI]

    Coates, Jr., John T.; DeVol, Timothy A.

    2010-05-25

    Disclosed are materials and systems useful in determining the existence of radionuclides in an aqueous sample. The materials provide the dual function of both extraction and scintillation to the systems. The systems can be both portable and simple to use, and as such can beneficially be utilized to determine presence and optionally concentration of radionuclide contamination in an aqueous sample at any desired location and according to a relatively simple process without the necessity of complicated sample handling techniques. The disclosed systems include a one-step process, providing simultaneous extraction and detection capability, and a two-step process, providing a first extraction step that can be carried out in a remote field location, followed by a second detection step that can be carried out in a different location.

  9. Methods, microfluidic devices, and systems for detection of an active

    Office of Scientific and Technical Information (OSTI)

    enzymatic agent (Patent) | SciTech Connect Methods, microfluidic devices, and systems for detection of an active enzymatic agent Citation Details In-Document Search Title: Methods, microfluidic devices, and systems for detection of an active enzymatic agent Embodiments of the present invention provide methods, microfluidic devices, and systems for the detection of an active target agent in a fluid sample. A substrate molecule is used that contains a sequence which may cleave in the presence

  10. Method for detection of extremely low concentration

    DOE Patents [OSTI]

    Andresen, Brian D. (Livermore, CA); Miller, Fred S. (Bethal Island, CA)

    2002-01-01

    An ultratrace detector system for hand-held gas chromatography having high sensitivity, for example, to emissions generated during production of weapons, biological compounds, drugs, etc. The detector system is insensitive to water, air, helium, argon, oxygen, and CO.sub.2. The detector system is basically composed of a hand-held capillary gas chromatography (GC), an insulated heated redox-chamber, a detection chamber, and a vapor trap. For example, the detector system may use gas phase redox reactions and spectral absorption of mercury vapor. The gas chromatograph initially separates compounds that percolate through a bed of heated mercuric oxide (HgO) in a silica--or other metal--aerogel material which acts as an insulator. Compounds easily oxidized by HgO liberate atomic mercury that subsequently pass through a detection chamber which includes a detector cell, such as quartz, that is illuminated with a 254 nm ultra-violet (UV) mercury discharge lamp which generates the exact mercury absorption bands that are used to detect the liberated mercury atoms. Atomic mercury strongly absorbs 254 nm energy is therefore a specific signal for reducing compounds eluting from the capillary GC, whereafter the atomic mercury is trapped for example, in a silicon-aerogel trap.

  11. Method for early detection of infectious mononucleosis

    DOE Patents [OSTI]

    Willard, K.E.

    1982-08-10

    Early detection of infectious mononucleosis is carried out using a sample of human blood by isolating and identifying the presence of Inmono proteins in the sample from a two-dimensional protein map with the proteins being characterized by having isoelectric banding as measured in urea of about -16 to -17 with respect to certain isoelectric point standards and molecular mass of about 70 to 75 K daltons as measured in the presence of sodium dodecylsulfate containing polyacrylamide gels, the presence of the Inmono proteins being correlated with the existence of infectious mononucleosis.

  12. System and method for detecting gas

    DOE Patents [OSTI]

    Chow, Oscar Ken; Moulthrop, Lawrence Clinton; Dreier, Ken Wayne; Miller, Jacob Andrew

    2010-03-16

    A system to detect a presence of a specific gas in a mixture of gaseous byproducts comprising moisture vapor is disclosed. The system includes an electrochemical cell, a transport to deliver the mixture of gaseous byproducts from the electrochemical cell, a gas sensor in fluid communication with the transport, the sensor responsive to a presence of the specific gas to generate a signal corresponding to a concentration of the specific gas, and a membrane to prevent transmission of liquid moisture, the membrane disposed between the transport and the gas sensor.

  13. Method and apparatus for detecting halogenated hydrocarbons

    DOE Patents [OSTI]

    Monagle, Matthew (Los Alamos, NM); Coogan, John J. (Los Alamos, NM)

    1997-01-01

    A halogenated hydrocarbon (HHC) detector is formed from a silent discharge (also called a dielectric barrier discharge) plasma generator. A silent discharge plasma device receives a gas sample that may contain one or more HHCs and produces free radicals and excited electrons for oxidizing the HHCs in the gas sample to produce water, carbon dioxide, and an acid including halogens in the HHCs. A detector is used to sensitively detect the presence of the acid. A conductivity cell detector combines the oxidation products with a solvent where dissociation of the acid increases the conductivity of the solvent. The conductivity cell output signal is then functionally related to the presence of HHCs in the gas sample. Other detectors include electrochemical cells, infrared spectrometers, and negative ion mobility spectrometers.

  14. Methods for detection of ataxia telangiectasia mutations

    DOE Patents [OSTI]

    Gatti, Richard A.

    2005-10-04

    The present invention is directed to a method of screening large, complex, polyexonic eukaryotic genes such as the ATM gene for mutations and polymorphisms by an improved version of single strand conformation polymorphism (SSCP) electrophoresis that allows electrophoresis of two or three amplified segments in a single lane. The present invention also is directed to new mutations and polymorphisms in the ATM gene that are useful in performing more accurate screening of human DNA samples for mutations and in distinguishing mutations from polymorphisms, thereby improving the efficiency of automated screening methods.

  15. Method for detection of antibodies for metallic elements

    DOE Patents [OSTI]

    Barrick, C.W.; Clarke, S.M.; Nordin, C.W.

    1993-11-30

    An apparatus and method for detecting antibodies specific to non-protein antigens. The apparatus is an immunological plate containing a plurality of plastic projections coated with a non-protein material. Assays utilizing the plate are capable of stabilizing the non-protein antigens with detection levels for antibodies specific to the antigens on a nanogram level. A screening assay with the apparatus allows for early detection of exposure to non-protein materials. Specifically metallic elements are detected. 10 figures.

  16. Method for detection of antibodies for metallic elements

    DOE Patents [OSTI]

    Barrick, Charles W.; Clarke, Sara M.; Nordin, Carl W.

    1993-11-30

    An apparatus and method for detecting antibodies specific to non-protein antigens. The apparatus is an immunological plate containing a plurality of plastic projections coated with a non-protein material. Assays utilizing the plate are capable of stabilizing the non-protein antigens with detection levels for antibodies specific to the antigens on a nanogram level. A screening assay with the apparatus allows for early detection of exposure to non-protein materials. Specifically metallic elements are detected.

  17. Ultra-high sensitivity radiation detection apparatus and method

    DOE Patents [OSTI]

    Gross, Kenneth C. (Bolingbrook, IL); Valentine, John D. (Cincinnati, OH); Markum, Francis (Joliet, IL); Zawadzki, Mary (Rouses Point, NY); Dickerman, Charles (Downers Grove, IL)

    1999-01-01

    A method and apparatus are provided to concentrate and detect very low levels of radioactive noble gases from the atmosphere. More specifically the invention provides a method and apparatus to concentrate xenon, krypton and radon in an organic fluid and to detect these gases by the radioactive emissions.

  18. Method for detecting trace impurities in gases

    DOE Patents [OSTI]

    Freund, Samuel M. (Santa Fe, NM); Maier, II, William B. (Los Alamos, NM); Holland, Redus F. (Los Alamos, NM); Beattie, Willard H. (Los Alamos, NM)

    1981-01-01

    A technique for considerably improving the sensitivity and specificity of infrared spectrometry as applied to quantitative determination of trace impurities in various carrier or solvent gases is presented. A gas to be examined for impurities is liquefied and infrared absorption spectra of the liquid are obtained. Spectral simplification and number densities of impurities in the optical path are substantially higher than are obtainable in similar gas-phase analyses. Carbon dioxide impurity (.about.2 ppm) present in commercial Xe and ppm levels of Freon 12 and vinyl chloride added to liquefied air are used to illustrate the method.

  19. Vapor generation methods for explosives detection research

    SciTech Connect (OSTI)

    Grate, Jay W.; Ewing, Robert G.; Atkinson, David A.

    2012-12-01

    The generation of calibrated vapor samples of explosives compounds remains a challenge due to the low vapor pressures of the explosives, adsorption of explosives on container and tubing walls, and the requirement to manage (typically) multiple temperature zones as the vapor is generated, diluted, and delivered. Methods that have been described to generate vapors can be classified as continuous or pulsed flow vapor generators. Vapor sources for continuous flow generators are typically explosives compounds supported on a solid support, or compounds contained in a permeation or diffusion device. Sources are held at elevated isothermal temperatures. Similar sources can be used for pulsed vapor generators; however, pulsed systems may also use injection of solutions onto heated surfaces with generation of both solvent and explosives vapors, transient peaks from a gas chromatograph, or vapors generated by s programmed thermal desorption. This article reviews vapor generator approaches with emphasis on the method of generating the vapors and on practical aspects of vapor dilution and handling. In addition, a gas chromatographic system with two ovens that is configurable with up to four heating ropes is proposed that could serve as a single integrated platform for explosives vapor generation and device testing. Issues related to standards, calibration, and safety are also discussed.

  20. Method and apparatus for detecting chemical binding

    DOE Patents [OSTI]

    Warner, Benjamin P.; Havrilla, George J.; Miller, Thomasin C.; Wells, Cyndi A.

    2007-07-10

    The method for screening binding between a target binder and potential pharmaceutical chemicals involves sending a solution (preferably an aqueous solution) of the target binder through a conduit to a size exclusion filter, the target binder being too large to pass through the size exclusion filter, and then sending a solution of one or more potential pharmaceutical chemicals (preferably an aqueous solution) through the same conduit to the size exclusion filter after target binder has collected on the filter. The potential pharmaceutical chemicals are small enough to pass through the filter. Afterwards, x-rays are sent from an x-ray source to the size exclusion filter, and if the potential pharmaceutical chemicals form a complex with the target binder, the complex produces an x-ray fluorescence signal having an intensity that indicates that a complex has formed.

  1. Method And Apparatus For Detecting Chemical Binding

    DOE Patents [OSTI]

    Warner, Benjamin P.; Havrilla, George J.; Miller, Thomasin C.; Wells, Cyndi A.

    2005-02-22

    The method for screening binding between a target binder and potential pharmaceutical chemicals involves sending a solution (preferably an aqueous solution) of the target binder through a conduit to a size exclusion filter, the target binder being too large to pass through the size exclusion filter, and then sending a solution of one or more potential pharmaceutical chemicals (preferably an aqueous solution) through the same conduit to the size exclusion filter after target binder has collected on the filter. The potential pharmaceutical chemicals are small enough to pass through the filter. Afterwards, x-rays are sent from an x-ray source to the size exclusion filter, and if the potential pharmaceutical chemicals form a complex with the target binder, the complex produces an x-ray fluorescence signal having an intensity that indicates that a complex has formed.

  2. Method for FractMethod for Fracture Detection Using Multicomponent Seismic

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Dataure Detection Using Multicomponent Seismic Data - Energy Innovation Portal Method for FractMethod for Fracture Detection Using Multicomponent Seismic Dataure Detection Using Multicomponent Seismic Data Dr. Bryan DeVault Department of Geophysics Colorado School of Mines Contact CSM About This Technology Technology Marketing SummaryThis invention provides a method for detecting fractures in the subsurface of the earth's crust by using seismic shear waves. DescriptionAdditionally, it can be

  3. Systems and methods for detection of blowout precursors in combustors

    DOE Patents [OSTI]

    Lieuwen, Tim C.; Nair, Suraj

    2006-08-15

    The present invention comprises systems and methods for detecting flame blowout precursors in combustors. The blowout precursor detection system comprises a combustor, a pressure measuring device, and blowout precursor detection unit. A combustion controller may also be used to control combustor parameters. The methods of the present invention comprise receiving pressure data measured by an acoustic pressure measuring device, performing one or a combination of spectral analysis, statistical analysis, and wavelet analysis on received pressure data, and determining the existence of a blowout precursor based on such analyses. The spectral analysis, statistical analysis, and wavelet analysis further comprise their respective sub-methods to determine the existence of blowout precursors.

  4. Method of enhancing radiation response of radiation detection materials

    DOE Patents [OSTI]

    Miller, Steven D. (Richland, WA)

    1997-01-01

    The present invention is a method of increasing radiation response of a radiation detection material for a given radiation signal by first pressurizing the radiation detection material. Pressurization may be accomplished by any means including mechanical and/or hydraulic. In this application, the term "pressure" includes fluid pressure and/or mechanical stress.

  5. Method for the detection of Salmonella enterica serovar Enteritidis

    DOE Patents [OSTI]

    Agron, Peter G. (Castro Valley, CA); Andersen, Gary L. (Berkeley, CA); Walker, Richard L. (Davis, CA)

    2008-10-28

    Described herein is the identification of a novel Salmonella enterica serovar Enteritidis locus that serves as a marker for DNA-based identification of this bacterium. In addition, three primer pairs derived from this locus that may be used in a nucleotide detection method to detect the presence of the bacterium are also disclosed herein.

  6. Passive background correction method for spatially resolved detection

    DOE Patents [OSTI]

    Schmitt, Randal L. (Tijeras, NM); Hargis, Jr., Philip J. (Albuquerque, NM)

    2011-05-10

    A method for passive background correction during spatially or angularly resolved detection of emission that is based on the simultaneous acquisition of both the passive background spectrum and the spectrum of the target of interest.

  7. Nested methylation-specific polymerase chain reaction cancer detection method

    DOE Patents [OSTI]

    Belinsky, Steven A.; Palmisano, William A.

    2007-05-08

    A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.

  8. Computational Method for Detecting and Enhancing Protein Dynamics - Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Innovation Portal Energy Analysis Energy Analysis Biomass and Biofuels Biomass and Biofuels Find More Like This Return to Search Computational Method for Detecting and Enhancing Protein Dynamics Oak Ridge National Laboratory Contact ORNL About This Technology Technology Marketing SummaryORNL researchers have developed a method that uses simulation and experimental data to detect, analyze, and manipulate protein activity. This approach enables enhancement of the chemical reaction rates of

  9. Emergency First Responders' Experience with Colorimetric Detection Methods

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    (Technical Report) | SciTech Connect Emergency First Responders' Experience with Colorimetric Detection Methods Citation Details In-Document Search Title: Emergency First Responders' Experience with Colorimetric Detection Methods × You are accessing a document from the Department of Energy's (DOE) SciTech Connect. This site is a product of DOE's Office of Scientific and Technical Information (OSTI) and is provided as a public service. Visit OSTI to utilize additional information resources

  10. Detection limits for real-time source water monitoring using indigenous freshwater microalgae

    SciTech Connect (OSTI)

    Rodriguez Jr, Miguel; Greenbaum, Elias

    2009-01-01

    This research identified toxin detection limits using the variable fluorescence of naturally occurring microalgae in source drinking water for five chemical toxins with different molecular structures and modes of toxicity. The five chemicals investigated were atrazine, Diuron, paraquat, methyl parathion, and potassium cyanide. Absolute threshold sensitivities of the algae for detection of the toxins in unmodified source drinking water were measured. Differential kinetics between the rate of action of the toxins and natural changes in algal physiology, such as diurnal photoinhibition, are significant enough that effects of the toxin can be detected and distinguished from the natural variance. This is true even for physiologically impaired algae where diminished photosynthetic capacity may arise from uncontrollable external factors such as nutrient starvation. Photoinhibition induced by high levels of solar radiation is a predictable and reversible phenomenon that can be dealt with using a period of dark adaption of 30 minutes or more.

  11. Methods, systems and devices for detecting and locating ferromagnetic objects

    DOE Patents [OSTI]

    Roybal, Lyle Gene (Idaho Falls, ID) [Idaho Falls, ID; Kotter, Dale Kent (Shelley, ID) [Shelley, ID; Rohrbaugh, David Thomas (Idaho Falls, ID) [Idaho Falls, ID; Spencer, David Frazer (Idaho Falls, ID) [Idaho Falls, ID

    2010-01-26

    Methods for detecting and locating ferromagnetic objects in a security screening system. One method includes a step of acquiring magnetic data that includes magnetic field gradients detected during a period of time. Another step includes representing the magnetic data as a function of the period of time. Another step includes converting the magnetic data to being represented as a function of frequency. Another method includes a step of sensing a magnetic field for a period of time. Another step includes detecting a gradient within the magnetic field during the period of time. Another step includes identifying a peak value of the gradient detected during the period of time. Another step includes identifying a portion of time within the period of time that represents when the peak value occurs. Another step includes configuring the portion of time over the period of time to represent a ratio.

  12. Detect

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Detect Detect Scientists and engineers develop detection technologies for every conceivable type of explosive under a variety of scenarios. v Detection technologies for every conceivable type of explosive Los Alamos scientists and engineers develop detection technologies for every conceivable type of explosive under a variety of scenarios. Detection methods range from trace and signature characterization to bulk detection and new methods that address homemade or esoteric explosives. Los Alamos

  13. Statistical Methods and Software for the Analysis of Occupational Exposure Data with Non-detectable Values

    SciTech Connect (OSTI)

    Frome, EL

    2005-09-20

    Environmental exposure measurements are, in general, positive and may be subject to left censoring; i.e,. the measured value is less than a ''detection limit''. In occupational monitoring, strategies for assessing workplace exposures typically focus on the mean exposure level or the probability that any measurement exceeds a limit. Parametric methods used to determine acceptable levels of exposure, are often based on a two parameter lognormal distribution. The mean exposure level, an upper percentile, and the exceedance fraction are used to characterize exposure levels, and confidence limits are used to describe the uncertainty in these estimates. Statistical methods for random samples (without non-detects) from the lognormal distribution are well known for each of these situations. In this report, methods for estimating these quantities based on the maximum likelihood method for randomly left censored lognormal data are described and graphical methods are used to evaluate the lognormal assumption. If the lognormal model is in doubt and an alternative distribution for the exposure profile of a similar exposure group is not available, then nonparametric methods for left censored data are used. The mean exposure level, along with the upper confidence limit, is obtained using the product limit estimate, and the upper confidence limit on an upper percentile (i.e., the upper tolerance limit) is obtained using a nonparametric approach. All of these methods are well known but computational complexity has limited their use in routine data analysis with left censored data. The recent development of the R environment for statistical data analysis and graphics has greatly enhanced the availability of high-quality nonproprietary (open source) software that serves as the basis for implementing the methods in this paper.

  14. Method of detecting genetic translocations identified with chromosomal abnormalities

    DOE Patents [OSTI]

    Gray, Joe W.; Pinkel, Daniel; Tkachuk, Douglas

    2001-01-01

    Methods and compositions for staining based upon nucleic acid sequence that employ nucleic acid probes are provided. Said methods produce staining patterns that can be tailored for specific cytogenetic analyses. Said probes are appropriate for in situ hybridization and stain both interphase and metaphase chromosomal material with reliable signals. The nucleic acid probes are typically of a complexity greater than 50 kb, the complexity depending upon the cytogenetic application. Methods and reagents are provided for the detection of genetic rearrangements. Probes and test kits are provided for use in detecting genetic rearrangements, particularly for use in tumor cytogenetics, in the detection of disease related loci, specifically cancer, such as chronic myelogenous leukemia (CML) and for biological dosimetry. Methods and reagents are described for cytogenetic research, for the differentiation of cytogenetically similar but genetically different diseases, and for many prognostic and diagnostic applications.

  15. Method of detecting genetic deletions identified with chromosomal abnormalities

    DOE Patents [OSTI]

    Gray, Joe W; Pinkel, Daniel; Tkachuk, Douglas

    2013-11-26

    Methods and compositions for staining based upon nucleic acid sequence that employ nucleic acid probes are provided. Said methods produce staining patterns that can be tailored for specific cytogenetic analyzes. Said probes are appropriate for in situ hybridization and stain both interphase and metaphase chromosomal material with reliable signals. The nucleic acids probes are typically of a complexity greater tha 50 kb, the complexity depending upon the cytogenetic application. Methods and reagents are provided for the detection of genetic rearrangements. Probes and test kits are provided for use in detecting genetic rearrangements, particlularly for use in tumor cytogenetics, in the detection of disease related loci, specifically cancer, such as chronic myelogenous leukemia (CML) and for biological dosimetry. Methods and reagents are described for cytogenetic research, for the differentiation of cytogenetically similar ut genetically different diseases, and for many prognostic and diagnostic applications.

  16. Detection of forced oscillations in power systems with multichannel methods

    SciTech Connect (OSTI)

    Follum, James D.

    2015-09-30

    The increasing availability of high fidelity, geographically dispersed measurements in power systems improves the ability of researchers and engineers to study dynamic behaviors in the grid. One such behavior that is garnering increased attention is the presence of forced oscillations. Power system engineers are interested in forced oscillations because they are often symptomatic of the malfunction or misoperation of equipment. Though the resulting oscillation is not always large in amplitude, the root cause may be serious. In this report, multi-channel forced oscillation detection methods are developed. These methods leverage previously developed detection approaches based on the periodogram and spectral-coherence. Making use of geographically distributed channels of data is shown to improved detection performance and shorten the delay before an oscillation can be detected in the online environment. Results from simulated and measured power system data are presented.

  17. Transistor-based particle detection systems and methods

    DOE Patents [OSTI]

    Jain, Ankit; Nair, Pradeep R.; Alam, Muhammad Ashraful

    2015-06-09

    Transistor-based particle detection systems and methods may be configured to detect charged and non-charged particles. Such systems may include a supporting structure contacting a gate of a transistor and separating the gate from a dielectric of the transistor, and the transistor may have a near pull-in bias and a sub-threshold region bias to facilitate particle detection. The transistor may be configured to change current flow through the transistor in response to a change in stiffness of the gate caused by securing of a particle to the gate, and the transistor-based particle detection system may configured to detect the non-charged particle at least from the change in current flow.

  18. Methods and systems for remote detection of gases

    DOE Patents [OSTI]

    Johnson, Timothy J

    2012-09-18

    Novel systems and methods for remotely detecting at least one constituent of a gas via infrared detection are provided. A system includes at least one extended source of broadband infrared radiation and a spectrally sensitive receiver positioned remotely from the source. The source and the receiver are oriented such that a surface of the source is in the field of view of the receiver. The source includes a heating component thermally coupled to the surface, and the heating component is configured to heat the surface to a temperature above ambient temperature. The receiver is operable to collect spectral infrared absorption data representative of a gas present between the source and the receiver. The invention advantageously overcomes significant difficulties associated with active infrared detection techniques known in the art, and provides an infrared detection technique with a much greater sensitivity than passive infrared detection techniques known in the art.

  19. Methods and systems for remote detection of gases

    DOE Patents [OSTI]

    Johnson, Timothy J.

    2007-11-27

    Novel systems and methods for remotely detecting at least one constituent of a gas via infrared detection are provided. A system includes at least one extended source of broadband infrared radiation and a spectrally sensitive receiver positioned remotely from the source. The source and the receiver are oriented such that a surface of the source is in the field of view of the receiver. The source includes a heating component thermally coupled to the surface, and the heating component is configured to heat the surface to a temperature above ambient temperature. The receiver is operable to collect spectral infrared absorption data representative of a gas present between the source and the receiver. The invention advantageously overcomes significant difficulties associated with active infrared detection techniques known in the art, and provides an infrared detection technique with a much greater sensitivity than passive infrared detection techniques known in the art.

  20. Method for predicting peptide detection in mass spectrometry

    DOE Patents [OSTI]

    Kangas, Lars [West Richland, WA; Smith, Richard D [Richland, WA; Petritis, Konstantinos [Richland, WA

    2010-07-13

    A method of predicting whether a peptide present in a biological sample will be detected by analysis with a mass spectrometer. The method uses at least one mass spectrometer to perform repeated analysis of a sample containing peptides from proteins with known amino acids. The method then generates a data set of peptides identified as contained within the sample by the repeated analysis. The method then calculates the probability that a specific peptide in the data set was detected in the repeated analysis. The method then creates a plurality of vectors, where each vector has a plurality of dimensions, and each dimension represents a property of one or more of the amino acids present in each peptide and adjacent peptides in the data set. Using these vectors, the method then generates an algorithm from the plurality of vectors and the calculated probabilities that specific peptides in the data set were detected in the repeated analysis. The algorithm is thus capable of calculating the probability that a hypothetical peptide represented as a vector will be detected by a mass spectrometry based proteomic platform, given that the peptide is present in a sample introduced into a mass spectrometer.

  1. The COBE Diffuse Infrared Background Experiment search for thecosmic infrared background. I. Limits and detections

    SciTech Connect (OSTI)

    Hauser, M.G.; Arendt, R.G.; Kelsall, T.; Dwek, E.; Odegard, N.; Weiland, J.L.; Freudenreich, H.T.; Reach, W.T.; Silverberg, R.F.; Moseley, S.H.; Pei, Y.C.; Lubin, P.; Mather, J.C.; Shafer, R.A.; Smoot,G.F.; Weiss, R.; Wilkinson, D.T.; Wright, E.L.

    1998-01-06

    The Diffuse Infrared Background Experiment (DIRBE) on the Cosmic Background Explorer (COBE) spacecraft was designed primarily to conduct a systematic search for an isotropic cosmic infrared background (CIB) in 10 photometric bands from 1.25 to 240 mu m. The results of that search are presented here. Conservative limits on the CIB are obtained from the minimum observed brightness in all-sky maps at each wavelength, with the faintest limits in the DIRBE spectral range being at 3.5 mu m(nu l nu<64 nW m-2 sr-1, 95 percent confidence level) and at 240 mu m (nu l nu < 28 nW m-1 sr-1, 95 percent confidence level). The bright foregrounds from interplanetary dust scattering and emission, stars, and interstellar dust emission are the principal impediments to the DIRBE measurements of the CIB. These foregrounds have been modeled and removed from the sky maps. Assessment of the random and systematic uncertainties in the residuals and tests for isotropy show that only the 140 and 240 mum data provide candidate detections of the CIB. The residuals and their uncertainties provide CIB upper limits more restrictive than the dark sky limits at wavelengths from 1.25 to 100 mu m. No plausible solar system or Galactic source of the observed 140 and 240 mu m residuals can be identified, leading to the conclusion that the CIB has been detected at levels of nu l nu = 25 +- 7 and 14 +- 3 nW m-2 sr-1 at 140 and 240 mu m, respectively. The integrated energy from 140 to 240 mu m, 10.3 nW m-2sr-1, is about twice the integrated optical light from the galaxies in the Hubble Deep Field, suggesting that star formation might have been heavily enshrouded by dust at high redshift. The detections and upper limits reported here provide new constraints on models of the history of energy-releasing processes and dust production since the decoupling of the cosmic microwave background from matter.

  2. Method and apparatus for detection of chemical vapors

    DOE Patents [OSTI]

    Mahurin, Shannon Mark (Knoxville, TN); Dai, Sheng (Knoxville, TN); Caja, Josip (Knoxville, TN)

    2007-05-15

    The present invention is a gas detector and method for using the gas detector for detecting and identifying volatile organic and/or volatile inorganic substances present in unknown vapors in an environment. The gas detector comprises a sensing means and a detecting means for detecting electrical capacitance variance of the sensing means and for further identifying the volatile organic and volatile inorganic substances. The sensing means comprises at least one sensing unit and a sensing material allocated therein the sensing unit. The sensing material is an ionic liquid which is exposed to the environment and is capable of dissolving a quantity of said volatile substance upon exposure thereto. The sensing means constitutes an electrochemical capacitor and the detecting means is in electrical communication with the sensing means.

  3. Apparatus and method for detecting leaks in piping

    DOE Patents [OSTI]

    Trapp, Donald J. (Aiken, SC)

    1994-01-01

    A method and device for detecting the location of leaks along a wall or piping system, preferably in double-walled piping. The apparatus comprises a sniffer probe, a rigid cord such as a length of tube attached to the probe on one end and extending out of the piping with the other end, a source of pressurized air and a source of helium. The method comprises guiding the sniffer probe into the inner pipe to its distal end, purging the inner pipe with pressurized air, filling the annulus defined between the inner and outer pipe with helium, and then detecting the presence of helium within the inner pipe with the probe as is pulled back through the inner pipe. The length of the tube at the point where a leak is detected determines the location of the leak in the pipe.

  4. Method for detecting an image of an object

    DOE Patents [OSTI]

    Chapman, Leroy Dean (4 Vermont Cir., Bolingbrook, IL 60440); Thomlinson, William C. (32 E. Masem, East Patchogue, NY 11772); Zhong, Zhong (Apt. I 1131 Chaping 700 E. Loop Rd., Stonybrook, NY 11790)

    1999-11-16

    A method for detecting an absorption, refraction and scatter image of an object by independently analyzing, detecting, digitizing, and combining images acquired on a high and a low angle side of a rocking curve of a crystal analyzer. An x-ray beam which is generated by any suitable conventional apparatus can be irradiated upon either a Bragg type crystal analyzer or a Laue type crystal analyzer. Images of the absorption, refraction and scattering effects are detected, such as on an image plate, and then digitized. The digitized images are simultaneously solved, preferably on a pixel-by-pixel basis, to derive a combined visual image which has dramatically improved contrast and spatial resolution over an image acquired through conventional radiology methods.

  5. Methods for gas detection using stationary hyperspectral imaging sensors

    DOE Patents [OSTI]

    Conger, James L. (San Ramon, CA); Henderson, John R. (Castro Valley, CA)

    2012-04-24

    According to one embodiment, a method comprises producing a first hyperspectral imaging (HSI) data cube of a location at a first time using data from a HSI sensor; producing a second HSI data cube of the same location at a second time using data from the HSI sensor; subtracting on a pixel-by-pixel basis the second HSI data cube from the first HSI data cube to produce a raw difference cube; calibrating the raw difference cube to produce a calibrated raw difference cube; selecting at least one desired spectral band based on a gas of interest; producing a detection image based on the at least one selected spectral band and the calibrated raw difference cube; examining the detection image to determine presence of the gas of interest; and outputting a result of the examination. Other methods, systems, and computer program products for detecting the presence of a gas are also described.

  6. Apparatus and method for detecting leaks in piping

    DOE Patents [OSTI]

    Trapp, D.J.

    1994-12-27

    A method and device are disclosed for detecting the location of leaks along a wall or piping system, preferably in double-walled piping. The apparatus comprises a sniffer probe, a rigid cord such as a length of tube attached to the probe on one end and extending out of the piping with the other end, a source of pressurized air and a source of helium. The method comprises guiding the sniffer probe into the inner pipe to its distal end, purging the inner pipe with pressurized air, filling the annulus defined between the inner and outer pipe with helium, and then detecting the presence of helium within the inner pipe with the probe as is pulled back through the inner pipe. The length of the tube at the point where a leak is detected determines the location of the leak in the pipe. 2 figures.

  7. Monoclonal antibodies and method for detecting dioxins and dibenzofurans

    DOE Patents [OSTI]

    Vanderlaan, Martin (San Ramon, CA); Stanker, Larry H. (Livermore, CA); Watkins, Bruce E. (Livermore, CA); Bailey, Nina R. (Berkley, CA)

    1989-01-01

    Compositions of matter are described which include five monoclonal antibodies that react with dioxins and dibenzofurans, and the five hybridomas that produce these monoclonal antibodies. In addition, a method for the use of these antibodies in a sensitive immunoassay for dioxins and dibenzofurans is given, which permits detection of these pollutants in samples at concentrations in the range of a few parts per billion.

  8. Method for immunodiagnostic detection of dioxins at low concentrations

    DOE Patents [OSTI]

    Vanderlaan, Martin (Danville, CA); Stanker, Larry H. (Livermore, CA); Watkins, Bruce E. (Livermore, CA); Petrovic, Peter (Hochheim am Main, DE); Gorbach, Siegbert (Eppstein/Ts., DE)

    1995-01-01

    A method is described for the use of monoclonal antibodies in a sensitive immunoassay for halogenated dioxins and dibenzofurans in industrial samples which contain impurities. Appropriate sample preparation and selective enzyme amplification of the immunoassay sensitivity permits detection of dioxin contaminants in industrial or environmental samples at concentrations in the range of a few parts per trillion.

  9. System for detecting and limiting electrical ground faults within electrical devices

    DOE Patents [OSTI]

    Gaubatz, Donald C. (Cupertino, CA)

    1990-01-01

    An electrical ground fault detection and limitation system for employment with a nuclear reactor utilizing a liquid metal coolant. Elongate electromagnetic pumps submerged within the liquid metal coolant and electrical support equipment experiencing an insulation breakdown occasion the development of electrical ground fault current. Without some form of detection and control, these currents may build to damaging power levels to expose the pump drive components to liquid metal coolant such as sodium with resultant undesirable secondary effects. Such electrical ground fault currents are detected and controlled through the employment of an isolated power input to the pumps and with the use of a ground fault control conductor providing a direct return path from the affected components to the power source. By incorporating a resistance arrangement with the ground fault control conductor, the amount of fault current permitted to flow may be regulated to the extent that the reactor may remain in operation until maintenance may be performed, notwithstanding the existence of the fault. Monitors such as synchronous demodulators may be employed to identify and evaluate fault currents for each phase of a polyphase power, and control input to the submerged pump and associated support equipment.

  10. Device and method for detecting sulfur dioxide at high temperatures

    DOE Patents [OSTI]

    West, David L. (Oak Ridge, TN); Montgomery, Frederick C. (Oak Ridge, TN); Armstrong, Timothy R. (Clinton, TN)

    2011-11-01

    The present invention relates to a method for selectively detecting and/or measuring gaseous SO.sub.2 at a temperature of at least 500.degree. C., the method involving: (i) providing a SO.sub.2-detecting device including an oxygen ion-conducting substrate having on its surface at least three electrodes comprising a first, second, and third electrode; (ii) driving a starting current of specified magnitude and temporal variation between the first and second electrodes; (iii) contacting the SO.sub.2-detecting device with the SO.sub.2-containing sample while maintaining the magnitude and any temporal variation of the starting current, wherein said SO.sub.2-containing sample causes a change in the electrical conductance of said device; and (iv) detecting the change in electrical conductance of the device based on measuring an electrical property related to or indicative of the conductance of the device between the first and third electrodes, or between the second and third electrodes, and detecting SO.sub.2 in the SO.sub.2-containing sample based on the measured change in electrical conductance.

  11. Earth analysis methods, subsurface feature detection methods, earth analysis devices, and articles of manufacture

    DOE Patents [OSTI]

    West, Phillip B.; Novascone, Stephen R.; Wright, Jerry P.

    2012-05-29

    Earth analysis methods, subsurface feature detection methods, earth analysis devices, and articles of manufacture are described. According to one embodiment, an earth analysis method includes engaging a device with the earth, analyzing the earth in a single substantially lineal direction using the device during the engaging, and providing information regarding a subsurface feature of the earth using the analysis.

  12. Earth analysis methods, subsurface feature detection methods, earth analysis devices, and articles of manufacture

    DOE Patents [OSTI]

    West, Phillip B.; Novascone, Stephen R.; Wright, Jerry P.

    2011-09-27

    Earth analysis methods, subsurface feature detection methods, earth analysis devices, and articles of manufacture are described. According to one embodiment, an earth analysis method includes engaging a device with the earth, analyzing the earth in a single substantially lineal direction using the device during the engaging, and providing information regarding a subsurface feature of the earth using the analysis.

  13. Image change detection systems, methods, and articles of manufacture

    DOE Patents [OSTI]

    Jones, James L.; Lassahn, Gordon D.; Lancaster, Gregory D.

    2010-01-05

    Aspects of the invention relate to image change detection systems, methods, and articles of manufacture. According to one aspect, a method of identifying differences between a plurality of images is described. The method includes loading a source image and a target image into memory of a computer, constructing source and target edge images from the source and target images to enable processing of multiband images, displaying the source and target images on a display device of the computer, aligning the source and target edge images, switching displaying of the source image and the target image on the display device, to enable identification of differences between the source image and the target image.

  14. Method for detecting a mass density image of an object

    DOE Patents [OSTI]

    Wernick, Miles N. (Chicago, IL); Yang, Yongyi (Westmont, IL)

    2008-12-23

    A method for detecting a mass density image of an object. An x-ray beam is transmitted through the object and a transmitted beam is emitted from the object. The transmitted beam is directed at an angle of incidence upon a crystal analyzer. A diffracted beam is emitted from the crystal analyzer onto a detector and digitized. A first image of the object is detected from the diffracted beam emitted from the crystal analyzer when positioned at a first angular position. A second image of the object is detected from the diffracted beam emitted from the crystal analyzer when positioned at a second angular position. A refraction image is obtained and a regularized mathematical inversion algorithm is applied to the refraction image to obtain a mass density image.

  15. Means and method of detection in chemical separation procedures

    DOE Patents [OSTI]

    Yeung, Edward S. (Ames, IA); Koutny, Lance B. (Ames, IA); Hogan, Barry L. (Ames, IA); Cheung, Chan K. (Ames, IA); Ma, Yinfa (Ames, IA)

    1993-03-09

    A means and method for indirect detection of constituent components of a mixture separated in a chemical separation process. Fluorescing ions are distributed across the area in which separation of the mixture will occur to provide a generally uniform background fluorescence intensity. For example, the mixture is comprised of one or more charged analytes which displace fluorescing ions where its constituent components separate to. Fluorescing ions of the same charge as the charged analyte components cause a displacement. The displacement results in the location of the separated components having a reduced fluorescence intensity to the remainder of the background. Detection of the lower fluorescence intensity areas can be visually, by photographic means and methods, or by automated laser scanning.

  16. Means and method of detection in chemical separation procedures

    DOE Patents [OSTI]

    Yeung, E.S.; Koutny, L.B.; Hogan, B.L.; Cheung, C.K.; Yinfa Ma.

    1993-03-09

    A means and method are described for indirect detection of constituent components of a mixture separated in a chemical separation process. Fluorescing ions are distributed across the area in which separation of the mixture will occur to provide a generally uniform background fluorescence intensity. For example, the mixture is comprised of one or more charged analytes which displace fluorescing ions where its constituent components separate to. Fluorescing ions of the same charge as the charged analyte components cause a displacement. The displacement results in the location of the separated components having a reduced fluorescence intensity to the remainder of the background. Detection of the lower fluorescence intensity areas can be visually, by photographic means and methods, or by automated laser scanning.

  17. Method and apparatus for detecting gem-polyhalogenated hydrocarbons

    DOE Patents [OSTI]

    Anderson, deceased, William G. (late of Livermore, CA); Anderson, legal representative, Johanna S. (Palm Springs, CA)

    1990-01-01

    A method and optrode for detecting gem polyhalogenated hydrocarbons in a sample fluid based on a single phase Fujiwara reaction as provided. The method comprises contacting a reaction mixture with a sample fluid which contains the gem-polyhalogenated hydrocarbons. The reaction mixture comprises an aqueous solution of pyridine or derivative thereof and a hindered nitrogen base. Upon contact a fluorescent and/or chromgenic reaction product forms whose fluorescence and/or absorbance is related to the concentration of gem-polyhalogenated hydrocarbons in the sample fluid.

  18. Detection limits for actinides in a monochromatic, wavelength-dispersive x-ray fluorescence instrument

    SciTech Connect (OSTI)

    Collins, Michael L [Los Alamos National Laboratory; Havrilla, George J [Los Alamos National Laboratory

    2009-01-01

    Recent developments in x-ray optics have made it possible to examine the L x-rays of actinides using doubly-curved crystals in a bench-top device. A doubly-curved crystal (DCC) acts as a focusing monochromatic filter for polychromatic x-rays. A Monochromatic, Wavelength-Dispersive X-Ray Fluorescence (MWDXRF) instrument that uses DCCs to measure Cm and Pu in reprocessing plant liquors was proposed in 2007 by the authors at Los Alamos National Laboratory. A prototype design of this MWDXRF instrument was developed in collaboration with X-ray Optical Systems Inc. (XOS), of East Greenbush, New York. In the MWDXRF instrument, x-rays from a Rhodium-anode x-ray tube are passed through a primary DCC to produce a monochromatic beam of 20.2-keV photons. This beam is focused on a specimen that may contain actinides. The 20.2-keV interrogating beam is just above the L3 edge of Californium; each actinide (with Z = 90 to 98) present in the specimen emits characteristic L x-rays as the result of L3-shell vacancies. In the LANL-XOS prototype MWDXRf, these x-rays enter a secondary DCC optic that preferentially passes 14.961-keV photons, corresponding to the L-alpha-1 x-ray peak of Curium. In the present stage of experimentation, Curium-bearing specimens have not been analyzed with the prototype MWDXRF instrument. Surrogate materials for Curium include Rubidium, which has a K-beta-l x-ray at 14.961 keV, and Yttrium, which has a K-alpha-1 x-ray at 14.958 keV. In this paper, the lower limit of detection for Curium in the LANL-XOS prototype MWDXRF instrument is estimated. The basis for this estimate is described, including a description of computational models and benchmarking techniques used. Detection limits for other actinides are considered, as well as future safeguards applications for MWDXRF instrumentation.

  19. Method of detecting luminescent target ions with modified magnetic microspheres

    DOE Patents [OSTI]

    Shkrob, Ilya A; Kaminski, Michael D

    2014-05-13

    This invention provides methods of using modified magnetic microspheres to extract target ions from a sample in order to detect their presence in a microfluidic environment. In one or more embodiments, the microspheres are modified with molecules on the surface that allow the target ions in the sample to form complexes with specific ligand molecules on the microsphere surface. In one or more embodiments, the microspheres are modified with molecules that sequester the target ions from the sample, but specific ligand molecules in solution subsequently re-extract the target ions from the microspheres into the solution, where the complexes form independent of the microsphere surface. Once the complexes form, they are exposed to an excitation wavelength light source suitable for exciting the target ion to emit a luminescent signal pattern. Detection of the luminescent signal pattern allows for determination of the presence of the target ions in the sample.

  20. Methods for use in detecting seismic waves in a borehole

    DOE Patents [OSTI]

    West, Phillip B.; Fincke, James R.; Reed, Teddy R.

    2007-02-20

    The invention provides methods and apparatus for detecting seismic waves propagating through a subterranean formation surrounding a borehole. In a first embodiment, a sensor module uses the rotation of bogey wheels to extend and retract a sensor package for selective contact and magnetic coupling to casing lining the borehole. In a second embodiment, a sensor module is magnetically coupled to the casing wall during its travel and dragged therealong while maintaining contact therewith. In a third embodiment, a sensor module is interfaced with the borehole environment to detect seismic waves using coupling through liquid in the borehole. Two or more of the above embodiments may be combined within a single sensor array to provide a resulting seismic survey combining the optimum of the outputs of each embodiment into a single data set.

  1. Neutron-detecting apparatuses and methods of fabrication

    DOE Patents [OSTI]

    Dahal, Rajendra P.; Huang, Jacky Kuan-Chih; Lu, James J. Q.; Danon, Yaron; Bhat, Ishwara B.

    2015-10-06

    Neutron-detecting structures and methods of fabrication are provided which include: a substrate with a plurality of cavities extending into the substrate from a surface; a p-n junction within the substrate and extending, at least in part, in spaced opposing relation to inner cavity walls of the substrate defining the plurality of cavities; and a neutron-responsive material disposed within the plurality of cavities. The neutron-responsive material is responsive to neutrons absorbed for releasing ionization radiation products, and the p-n junction within the substrate spaced in opposing relation to and extending, at least in part, along the inner cavity walls of the substrate reduces leakage current of the neutron-detecting structure.

  2. Method of detecting system function by measuring frequency response

    DOE Patents [OSTI]

    Morrison, John L.; Morrison, William H.; Christophersen, Jon P.; Motloch, Chester G.

    2013-01-08

    Methods of rapidly measuring an impedance spectrum of an energy storage device in-situ over a limited number of logarithmically distributed frequencies are described. An energy storage device is excited with a known input signal, and a response is measured to ascertain the impedance spectrum. An excitation signal is a limited time duration sum-of-sines consisting of a select number of frequencies. In one embodiment, magnitude and phase of each frequency of interest within the sum-of-sines is identified when the selected frequencies and sample rate are logarithmic integer steps greater than two. This technique requires a measurement with a duration of one period of the lowest frequency. In another embodiment, where selected frequencies are distributed in octave steps, the impedance spectrum can be determined using a captured time record that is reduced to a half-period of the lowest frequency.

  3. Methods and compositions for protein detection using nanoparticle-fluorescent polymer complexes

    DOE Patents [OSTI]

    Rotello, Vincent; Bunz, Uwe; You, Chang-Cheng; Miranda, Oscar; Kim, Ik-Bum

    2011-09-20

    Compositions, methods and related apparatus, as can be used for selective protein detection and identification.

  4. Methods and compositions for pathogen detection using nanoparticle-fluorescent polymer complexes

    DOE Patents [OSTI]

    Rotello, Vincent (Belchertown, MA); Bunz, Uwe (Atlanta, GA); Phillips, Ronnie (Atlanta, GA); Miranda, Oscar (Amherst, MA); You, Chang-Cheng (Waltham, MA)

    2011-08-23

    Compositions, methods and related apparatus, as can be used for selective pathogen detection and identification.

  5. Methods and systems for detecting abnormal digital traffic

    DOE Patents [OSTI]

    Goranson, Craig A [Kennewick, WA; Burnette, John R [Kennewick, WA

    2011-03-22

    Aspects of the present invention encompass methods and systems for detecting abnormal digital traffic by assigning characterizations of network behaviors according to knowledge nodes and calculating a confidence value based on the characterizations from at least one knowledge node and on weighting factors associated with the knowledge nodes. The knowledge nodes include a characterization model based on prior network information. At least one of the knowledge nodes should not be based on fixed thresholds or signatures. The confidence value includes a quantification of the degree of confidence that the network behaviors constitute abnormal network traffic.

  6. Radioisotope Detection Device and Methods of Radioisotope Collection

    DOE Patents [OSTI]

    Tranter, Troy J. (Idaho Falls, ID); Oertel, Christopher P. (Idaho Falls, ID); Giles, John R. (Pocatello, ID); Mann, Nicholas R. (Rigby, ID); McIlwain, Michael E. (Idaho Falls, ID)

    2011-04-12

    A device for collection of radionuclides includes a mixture of a polymer, a fluorescent organic scintillator and a chemical extractant. A radionuclide detector system includes a collection device comprising a mixture of a polymer, a fluorescent agent and a selective ligand. The system includes at least one photomultiplier tube (PMT). A method of detecting radionuclides includes providing a collector device comprising a mixture comprising a polymer, a fluorescent organic scintillator and a chemical extractant. An aqueous environment is exposed to the device and radionuclides are collected from the environment. Radionuclides can be concentrated within the device.

  7. Method For Detecting The Presence Of A Ferromagnetic Object

    DOE Patents [OSTI]

    Roybal, Lyle G. (Idaho Falls, ID)

    2000-11-21

    A method for detecting a presence or an absence of a ferromagnetic object within a sensing area may comprise the steps of sensing, during a sample time, a magnetic field adjacent the sensing area; producing surveillance data representative of the sensed magnetic field; determining an absolute value difference between a maximum datum and a minimum datum comprising the surveillance data; and determining whether the absolute value difference has a positive or negative sign. The absolute value difference and the corresponding positive or negative sign thereof forms a representative surveillance datum that is indicative of the presence or absence in the sensing area of the ferromagnetic material.

  8. Probability of detection models for eddy current NDE methods

    SciTech Connect (OSTI)

    Rajesh, S.N.

    1993-04-30

    The development of probability of detection (POD) models for a variety of nondestructive evaluation (NDE) methods is motivated by a desire to quantify the variability introduced during the process of testing. Sources of variability involved in eddy current methods of NDE include those caused by variations in liftoff, material properties, probe canting angle, scan format, surface roughness and measurement noise. This thesis presents a comprehensive POD model for eddy current NDE. Eddy current methods of nondestructive testing are used widely in industry to inspect a variety of nonferromagnetic and ferromagnetic materials. The development of a comprehensive POD model is therefore of significant importance. The model incorporates several sources of variability characterized by a multivariate Gaussian distribution and employs finite element analysis to predict the signal distribution. The method of mixtures is then used for estimating optimal threshold values. The research demonstrates the use of a finite element model within a probabilistic framework to the spread in the measured signal for eddy current nondestructive methods. Using the signal distributions for various flaw sizes the POD curves for varying defect parameters have been computed. In contrast to experimental POD models, the cost of generating such curves is very low and complex defect shapes can be handled very easily. The results are also operator independent.

  9. Methods and apparatus for rotor blade ice detection

    DOE Patents [OSTI]

    LeMieux, David Lawrence

    2006-08-08

    A method for detecting ice on a wind turbine having a rotor and one or more rotor blades each having blade roots includes monitoring meteorological conditions relating to icing conditions and monitoring one or more physical characteristics of the wind turbine in operation that vary in accordance with at least one of the mass of the one or more rotor blades or a mass imbalance between the rotor blades. The method also includes using the one or more monitored physical characteristics to determine whether a blade mass anomaly exists, determining whether the monitored meteorological conditions are consistent with blade icing; and signaling an icing-related blade mass anomaly when a blade mass anomaly is determined to exist and the monitored meteorological conditions are determined to be consistent with icing.

  10. System and method for detection of dispersed broadband signals

    DOE Patents [OSTI]

    Qian, S.; Dunham, M.E.

    1999-06-08

    A system and method for detecting the presence of dispersed broadband signals in real time are disclosed. The present invention utilizes a bank of matched filters for detecting the received dispersed broadband signals. Each matched filter uses a respective robust time template that has been designed to approximate the dispersed broadband signals of interest, and each time template varies across a spectrum of possible dispersed broadband signal time templates. The received dispersed broadband signal x(t) is received by each of the matched filters, and if one or more matches occurs, then the received data is determined to have signal data of interest. This signal data can then be analyzed and/or transmitted to Earth for analysis, as desired. The system and method of the present invention will prove extremely useful in many fields, including satellite communications, plasma physics, and interstellar research. The varying time templates used in the bank of matched filters are determined as follows. The robust time domain template is assumed to take the form w(t)=A(t)cos[l brace]2[phi](t)[r brace]. Since the instantaneous frequency f(t) is known to be equal to the derivative of the phase [phi](t), the trajectory of a joint time-frequency representation of x(t) is used as an approximation of [phi][prime](t). 10 figs.

  11. System and method for detection of dispersed broadband signals

    DOE Patents [OSTI]

    Qian, Shie; Dunham, Mark E.

    1999-06-08

    A system and method for detecting the presence of dispersed broadband signals in real time. The present invention utilizes a bank of matched filters for detecting the received dispersed broadband signals. Each matched filter uses a respective robust time template that has been designed to approximate the dispersed broadband signals of interest, and each time template varies across a spectrum of possible dispersed broadband signal time templates. The received dispersed broadband signal x(t) is received by each of the matched filters, and if one or more matches occurs, then the received data is determined to have signal data of interest. This signal data can then be analyzed and/or transmitted to Earth for analysis, as desired. The system and method of the present invention will prove extremely useful in many fields, including satellite communications, plasma physics, and interstellar research. The varying time templates used in the bank of matched filters are determined as follows. The robust time domain template is assumed to take the form w(t)=A(t)cos{2.phi.(t)}. Since the instantaneous frequency f(t) is known to be equal to the derivative of the phase .phi.(t), the trajectory of a joint time-frequency representation of x(t) is used as an approximation of .phi.'(t).

  12. Gas sensitive materials for gas detection and methods of making

    DOE Patents [OSTI]

    Trakhtenberg, Leonid Israilevich; Gerasimov, Genrikh Nikolaevich; Gromov, Vladimir Fedorovich; Rozenberg, Valeriya Isaakovna

    2014-07-15

    A gas sensitive material comprising SnO.sub.2 nanocrystals doped with In.sub.2O.sub.3 and an oxide of a platinum group metal, and a method of making the same. The platinum group metal is preferably Pd, but also may include Pt, Ru, Ir, and combinations thereof. The SnO.sub.2 nanocrystals have a specific surface of 7 or greater, preferably about 20 m2/g, and a mean particle size of between about 10 nm and about 100 nm, preferably about 40 nm. A gas detection device made from the gas sensitive material deposited on a substrate, the gas sensitive material configured as a part of a current measuring circuit in communication with a heat source.

  13. Gas sensitive materials for gas detection and method of making

    DOE Patents [OSTI]

    Trakhtenberg, Leonid Israilevich; Gerasimov, Genrikh Nikolaevich; Gromov, Vladimir Fedorovich; Rozenberg, Valeriya Isaakovna

    2012-12-25

    A gas sensitive material comprising SnO2 nanocrystals doped with In2O3 and an oxide of a platinum group metal, and a method of making the same. The platinum group metal is preferably Pd, but also may include Pt, Ru, Ir, and combinations thereof. The SnO2 nanocrystals have a specific surface of 7 or greater, preferably about 20 m2/g, and a mean particle size of between about 10 nm and about 100 nm, preferably about 40 nm. A gas detection device made from the gas sensitive material deposited on a substrate, the gas sensitive material configured as a part of a current measuring circuit in communication with a heat source.

  14. Systems and methods for detecting x-rays

    DOE Patents [OSTI]

    Bross, Alan D.; Mellott, Kerry L.; Pla-Dalmau, Anna

    2006-05-02

    Systems and methods for detecting x-rays are disclosed herein. One or more x-ray-sensitive scintillators can be configured from a plurality of heavy element nano-sized particles and a plastic material, such as polystyrene. As will be explained in greater detail herein, the heavy element nano-sized particles (e.g., PbWO4) can be compounded into the plastic material with at least one dopant that permits the plastic material to scintillate. X-rays interact with the heavy element nano-sized particles to produce electrons that can deposit energy in the x-ray sensitive scintillator, which in turn can produce light.

  15. Method and apparatus for enhanced detection of toxic agents

    DOE Patents [OSTI]

    Greenbaum, Elias; Rodriguez, Jr., Miguel; Wu, Jie Jayne; Qi, Hairong

    2013-10-01

    A biosensor based detection of toxins includes enhancing a fluorescence signal by concentrating a plurality of photosynthetic organisms in a fluid into a concentrated region using biased AC electro-osmosis. A measured photosynthetic activity of the photosynthetic organisms is obtained in the concentrated region, where chemical, biological or radiological agents reduce a nominal photosynthetic activity of the photosynthetic organisms. A presence of the chemical, biological and/or radiological agents or precursors thereof, is determined in the fluid based on the measured photosynthetic activity of the concentrated plurality of photosynthetic organisms. A lab-on-a-chip system is used for the concentrating step. The presence of agents is determined from feature vectors, obtained from processing a time dependent signal using amplitude statistics and/or time-frequency analysis, relative to a control signal. A linear discriminant method including support vector machine classification (SVM) is used to identify the agents.

  16. Ionization detector, electrode configuration and single polarity charge detection method

    DOE Patents [OSTI]

    He, Zhong (Ann Arbor, MI)

    1998-01-01

    An ionization detector, an electrode configuration and a single polarity charge detection method each utilize a boundary electrode which symmetrically surrounds first and second central interlaced and symmetrical electrodes. All of the electrodes are held at a voltage potential of a first polarity type. The first central electrode is held at a higher potential than the second central or boundary electrodes. By forming the first and second central electrodes in a substantially interlaced and symmetrical pattern and forming the boundary electrode symmetrically about the first and second central electrodes, signals generated by charge carriers are substantially of equal strength with respect to both of the central electrodes. The only significant difference in measured signal strength occurs when the charge carriers move to within close proximity of the first central electrode and are received at the first central electrode. The measured signals are then subtracted and compared to quantitatively measure the magnitude of the charge.

  17. Ionization detector, electrode configuration and single polarity charge detection method

    DOE Patents [OSTI]

    He, Z.

    1998-07-07

    An ionization detector, an electrode configuration and a single polarity charge detection method each utilize a boundary electrode which symmetrically surrounds first and second central interlaced and symmetrical electrodes. All of the electrodes are held at a voltage potential of a first polarity type. The first central electrode is held at a higher potential than the second central or boundary electrodes. By forming the first and second central electrodes in a substantially interlaced and symmetrical pattern and forming the boundary electrode symmetrically about the first and second central electrodes, signals generated by charge carriers are substantially of equal strength with respect to both of the central electrodes. The only significant difference in measured signal strength occurs when the charge carriers move to within close proximity of the first central electrode and are received at the first central electrode. The measured signals are then subtracted and compared to quantitatively measure the magnitude of the charge. 10 figs.

  18. Apparatuses for large area radiation detection and related method

    DOE Patents [OSTI]

    Akers, Douglas W; Drigert, Mark W

    2015-04-28

    Apparatuses and a related method relating to radiation detection are disclosed. In one embodiment, an apparatus includes a first scintillator and a second scintillator adjacent to the first scintillator, with each of the first scintillator and second scintillator being structured to generate a light pulse responsive to interacting with incident radiation. The first scintillator is further structured to experience full energy deposition of a first low-energy radiation, and permit a second higher-energy radiation to pass therethrough and interact with the second scintillator. The apparatus further includes a plurality of light-to-electrical converters operably coupled to the second scintillator and configured to convert light pulses generated by the first scintillator and the second scintillator into electrical signals. The first scintillator and the second scintillator exhibit at least one mutually different characteristic for an electronic system to determine whether a given light pulse is generated by the first scintillator or the second scintillator.

  19. Position detectors, methods of detecting position, and methods of providing positional detectors

    DOE Patents [OSTI]

    Weinberg, David M. (Idaho Falls, ID); Harding, L. Dean (Chubbuck, ID); Larsen, Eric D. (Idaho Falls, ID)

    2002-01-01

    Position detectors, welding system position detectors, methods of detecting various positions, and methods of providing position detectors are described. In one embodiment, a welding system positional detector includes a base that is configured to engage and be moved along a curved surface of a welding work piece. At least one position detection apparatus is provided and is connected with the base and configured to measure angular position of the detector relative to a reference vector. In another embodiment, a welding system positional detector includes a weld head and at least one inclinometer mounted on the weld head. The one inclinometer is configured to develop positional data relative to a reference vector and the position of the weld head on a non-planar weldable work piece.

  20. Gearbox Typical Failure Modes, Detection, and Mitigation Methods (Presentation)

    SciTech Connect (OSTI)

    Sheng, S.

    2014-01-01

    This presentation was given at the AWEA Operations & Maintenance and Safety Seminar and focused on what the typical gearbox failure modes are, how to detect them using detection techniques, and strategies that help mitigate these failures.

  1. Room-temperature quantum noise limited spectrometry and methods of the same

    DOE Patents [OSTI]

    Stevens, Charles G.; Tringe, Joseph W.; Cunningham, Christopher Thomas

    2014-08-26

    In one embodiment, a heterodyne detection system for detecting light includes a first input aperture adapted for receiving first light from a scene input, a second input aperture adapted for receiving second light from a local oscillator input, a broadband local oscillator adapted for providing the second light to the second input aperture, a dispersive element adapted for dispersing the first light and the second light, and a final condensing lens coupled to an infrared detector. The final condensing lens is adapted for concentrating incident light from a primary condensing lens onto the infrared detector, and the infrared detector is a square-law detector capable of sensing the frequency difference between the first light and the second light. More systems and methods for detecting light are described according to other embodiments.

  2. Room-temperature quantum noise limited spectrometry and methods of the same

    DOE Patents [OSTI]

    Stevens, Charles G; Tringe, Joseph W

    2014-12-02

    In one embodiment, a heterodyne detection system for detecting light includes a first input aperture adapted for receiving a first light from a scene input, a second input aperture adapted for receiving a second light from a local oscillator input, a broadband local oscillator adapted for providing the second light to the second input aperture, a dispersive element adapted for dispersing the first light and the second light, and a final condensing lens coupled to an infrared detector. The final condensing lens is adapted for concentrating incident light from a primary condensing lens onto the detector, and the detector is a square-law detector capable of sensing the frequency difference between the first light and the second light. More systems and methods for detecting light are disclosed according to more embodiments.

  3. Bioluminescent bioreporter integrated circuit devices and methods for detecting estrogen

    DOE Patents [OSTI]

    Simpson, Michael L.; Paulus, Michael J.; Sayler, Gary S.; Applegate, Bruce M.; Ripp, Steven A.

    2006-08-15

    Bioelectronic devices for the detection of estrogen include a collection of eukaryotic cells which harbor a recombinant lux gene from a high temperature microorganism wherein the gene is operably linked with a heterologous promoter gene. A detectable light-emitting lux gene product is expressed in the presence of the estrogen and detected by the device.

  4. Portable TXRF Spectrometer with 10{sup -11}g Detection Limit and Portable XRF Spectromicroscope with Sub-mm Spatial Resolution

    SciTech Connect (OSTI)

    Kunimura, Shinsuke; Hatakeyama, So; Sasaki, Nobuharu; Yamamoto, Takashi; Kawai, Jun

    2010-04-06

    A portable total reflection X-ray fluorescence (TXRF) spectrometer that we have developed is applied to trace elemental analysis of water solutions. Although a 5 W X-ray tube is used in the portable TXRF spectrometer, detection limits of several ppb are achieved for 3d transition metal elements and trace elements in a leaching solution of soils, a leaching solution of solder, and alcoholic beverages are detected. Portable X-ray fluorescence (XRF) spectromicroscopes with a 1 W X-ray tube and an 8 W X-ray tube are also presented. Using the portable XRF spectromicroscope with the 1 W X-ray tube, 93 ppm of Cr is detected with an about 700 {mu}m spatial resolution. Spatially resolved elemental analysis of a mug painted with blue, red, green, and white is performed using the two portable spectromicroscopes, and the difference in elemental composition at each paint is detected.

  5. Method and apparatus for detection of fluorescently labeled materials

    DOE Patents [OSTI]

    Stern, David; Fiekowsky, Peter

    2004-05-25

    Fluorescently marked targets bind to a substrate 230 synthesized with polymer sequences at known locations. The targets are detected by exposing selected regions of the substrate 230 to light from a light source 100 and detecting the photons from the light fluoresced therefrom, and repeating the steps of exposure and detection until the substrate 230 is completely examined. The resulting data can be used to determine binding affinity of the targets to specific polymer sequences.

  6. Super-resolving quantum radar: Coherent-state sources with homodyne detection suffice to beat the diffraction limit

    SciTech Connect (OSTI)

    Jiang, Kebei; Lee, Hwang; Gerry, Christopher C.; Dowling, Jonathan P.

    2013-11-21

    There has been much recent interest in quantum metrology for applications to sub-Raleigh ranging and remote sensing such as in quantum radar. For quantum radar, atmospheric absorption and diffraction rapidly degrades any actively transmitted quantum states of light, such as N00N states, so that for this high-loss regime the optimal strategy is to transmit coherent states of light, which suffer no worse loss than the linear Beer's law for classical radar attenuation, and which provide sensitivity at the shot-noise limit in the returned power. We show that coherent radar radiation sources, coupled with a quantum homodyne detection scheme, provide both longitudinal and angular super-resolution much below the Rayleigh diffraction limit, with sensitivity at shot-noise in terms of the detected photon power. Our approach provides a template for the development of a complete super-resolving quantum radar system with currently available technology.

  7. A conservative spectral method for the Boltzmann equation with anisotropic scattering and the grazing collisions limit

    SciTech Connect (OSTI)

    Gamba, Irene M.; Haack, Jeffrey R.

    2014-08-01

    We present the formulation of a conservative spectral method for the Boltzmann collision operator with anisotropic scattering cross-sections. The method is an extension of the conservative spectral method of Gamba and Tharkabhushanam [17,18], which uses the weak form of the collision operator to represent the collisional term as a weighted convolution in Fourier space. The method is tested by computing the collision operator with a suitably cut-off angular cross section and comparing the results with the solution of the Landau equation. We analytically study the convergence rate of the Fourier transformed Boltzmann collision operator in the grazing collisions limit to the Fourier transformed Landau collision operator under the assumption of some regularity and decay conditions of the solution to the Boltzmann equation. Our results show that the angular singularity which corresponds to the Rutherford scattering cross section is the critical singularity for which a grazing collision limit exists for the Boltzmann operator. Additionally, we numerically study the differences between homogeneous solutions of the Boltzmann equation with the Rutherford scattering cross section and an artificial cross section, which give convergence to solutions of the Landau equation at different asymptotic rates. We numerically show the rate of the approximation as well as the consequences for the rate of entropy decay for homogeneous solutions of the Boltzmann equation and Landau equation.

  8. Methods for detection, identification and specification of listerias

    DOE Patents [OSTI]

    Bochner, Barry

    1992-01-01

    The present invention relates generally to differential carbon source metabolism in the genus Listeria, metabolic, biochemical, immunological and genetic procedures to measure said differential carbon source metabolism and the use of these produces to detect, isolate and/or distinguish species of the genus Listeria as well as detect, isolate and/or distinguish strains of species of Listeria. The present invention also contemplates test kits and enrichment media to facilitate these procedures.

  9. Methods of detection and identificationoc carbon- and nitrogen-containing materials

    DOE Patents [OSTI]

    Karev, Alexander Ivanovich; Raevsky, Valery Georgievich; Dzhalivyan, Leonid Zavenovich; Brothers, Louis Joseph; Wilhide, Larry K

    2013-11-12

    Methods for detecting and identifying carbon- and/or nitrogen-containing materials are disclosed. The methods may comprise detection of photo-nuclear reaction products of nitrogen and carbon to detect and identify the carbon- and/or nitrogen-containing materials.

  10. Detectability limitations with 3-D point reconstruction algorithms using digital radiography

    SciTech Connect (OSTI)

    Lindgren, Erik

    2015-03-31

    The estimated impact of pores in clusters on component fatigue will be highly conservative when based on 2-D rather than 3-D pore positions. To 3-D position and size defects using digital radiography and 3-D point reconstruction algorithms in general require a lower inspection time and in some cases work better with planar geometries than X-ray computed tomography. However, the increase in prior assumptions about the object and the defects will increase the intrinsic uncertainty in the resulting nondestructive evaluation output. In this paper this uncertainty arising when detecting pore defect clusters with point reconstruction algorithms is quantified using simulations. The simulation model is compared to and mapped to experimental data. The main issue with the uncertainty is the possible masking (detectability zero) of smaller defects around some other slightly larger defect. In addition, the uncertainty is explored in connection to the expected effects on the component fatigue life and for different amount of prior object-defect assumptions made.

  11. Eddy current probe and method for flaw detection in metals

    DOE Patents [OSTI]

    Watjen, J.P.

    1987-06-23

    A flaw detecting system is shown which includes a probe having a pair of ferrite cores with in-line gaps in close proximity to each other. An insulating, non-magnetic, non-conducting holder fills the gaps and supports the ferrite cores in a manner such that the cores form a generally V-shape. Each core is provided with an excitation winding and a detection winding. The excitation windings are connected in series or parallel with an rf port for connection thereof to a radio frequency source. The detection windings, which are differentially wound, are connected in series circuit to a detector port for connection to a voltage measuring instrument. The ferrite cores at the in-line gaps directly engage the metal surface of a test piece, and the probe is scanned along the test piece. In the presence of a flaw in the metal surface the detection winding voltages are unbalanced, and the unbalance is detected by the voltage measuring instrument. The insulating holder is provided with a profile which conforms to that of a prominent feature of the test piece to facilitate movement of the probe along the feature, typically an edge or a corner. 9 figs.

  12. System and method for automated object detection in an image

    DOE Patents [OSTI]

    Kenyon, Garrett T.; Brumby, Steven P.; George, John S.; Paiton, Dylan M.; Schultz, Peter F.

    2015-10-06

    A contour/shape detection model may use relatively simple and efficient kernels to detect target edges in an object within an image or video. A co-occurrence probability may be calculated for two or more edge features in an image or video using an object definition. Edge features may be differentiated between in response to measured contextual support, and prominent edge features may be extracted based on the measured contextual support. The object may then be identified based on the extracted prominent edge features.

  13. Method for detecting pathogens attached to specific antibodies

    DOE Patents [OSTI]

    Miles, Robin R.; Venkateswaran, Kodumudi S.; Fuller, Christopher K.

    2005-01-25

    The use of impedance measurements to detect the presence of pathogens attached to antibody-coated beads. In a fluidic device antibodies are immobilized on a surface of a patterned interdigitated electrode. Pathogens in a sample fluid streaming past the electrode attach to the immobilized antibodies, which produces a change in impedance between two adjacent electrodes, which impedance change is measured and used to detect the presence of a pathogen. To amplify the signal, beads coated with antibodies are introduced and the beads would stick to the pathogen causing a greater change in impedance between the two adjacent electrodes.

  14. Method for detecting radiation dose utilizing thermoluminescent material

    DOE Patents [OSTI]

    Miller, Steven D. (Richland, WA); McDonald, Joseph C. (Pasco, WA); Eichner, Fred N. (Kennewick, WA); Durham, James S. (Richland, WA)

    1992-01-01

    The amount of ionizing radiation to which a thermoluminescent material has been exposed is determined by first cooling the thermoluminescent material and then optically stimulating the thermoluminescent material by exposure to light. Visible light emitted by the thermoluminescent material as it is allowed to warm up to room temperature is detected and counted. The thermoluminescent material may be annealed by exposure to ultraviolet light.

  15. Bioluminescent bioreporter integrated circuit devices and methods for detecting ammonia

    DOE Patents [OSTI]

    Simpson, Michael L [Knoxville, TN; Paulus, Michael J [Knoxville, TN; Sayler, Gary S [Blaine, TN; Applegate, Bruce M [West Lafayette, IN; Ripp, Steven A [Knoxville, TN

    2007-04-24

    Monolithic bioelectronic devices for the detection of ammonia includes a microorganism that metabolizes ammonia and which harbors a lux gene fused with a heterologous promoter gene stably incorporated into the chromosome of the microorganism and an Optical Application Specific Integrated Circuit (OASIC). The microorganism is generally a bacterium.

  16. Method, memory media and apparatus for detection of grid disconnect

    SciTech Connect (OSTI)

    Ye, Zhihong; Du, Pengwei

    2008-09-23

    A phase shift procedure for detecting a disconnect of a power grid from a feeder that is connected to a load and a distributed generator. The phase shift procedure compares a current phase shift of the output voltage of the distributed generator with a predetermined threshold and if greater, a command is issued for a disconnect of the distributed generator from the feeder. To extend the range of detection, the phase shift procedure is used when a power mismatch between the distributed generator and the load exceeds a threshold and either or both of an under/over frequency procedure and an under/over voltage procedure is used when any power mismatch does not exceed the threshold.

  17. Method and device for detecting leaks from pipelines

    SciTech Connect (OSTI)

    Murphy, R.J.

    1983-05-31

    To detect leaks from pipelines carrying fluids, especially oil, light is transmitted through a fibre-optic held in proximity with the pipeline. The fibre-optic is surrounded by a medium of which the refractive index is altered by the influence of the leaked fluid. In a preferred embodiment the medium is a silicone rubber (4) of which the refractive index is normally lower than that of a quartz fibre optic (3), but of which the index increases to that of the quartz or above when oil (7) soaks into it through a permeable cladding (1) and elastomeric protective layer (2), thus rendering the fibre optic non-internally-reflective so that light (6) is absorbed. Control means linked to a light receiver detect that change and the position of the leak is located to within the length of the optic. In another embodiment the medium is a liquid which is expelled from around the optic by the action of leaked fluid.

  18. Method and apparatus for phase for and amplitude detection

    DOE Patents [OSTI]

    Cernosek, Richard W. (Albuquerque, NM); Frye, Gregory C. (Cedar Crest, NM); Martin, Stephen J. (Albuquerque, NM)

    1998-06-09

    A new class of techniques been developed which allow inexpensive application of SAW-type chemical sensor devices while retaining high sensitivity (ppm) to chemical detection. The new techniques do not require that the sensor be part of an oscillatory circuit, allowing large concentrations of, e.g., chemical vapors in air, to be accurately measured without compromising the capacity to measure trace concentrations. Such devices have numerous potential applications in environmental monitoring, from manufacturing environments to environmental restoration.

  19. Method for detecting radiation dose utilizing thermoluminescent material

    DOE Patents [OSTI]

    Miller, Steven D. (Richland, WA); McDonald, Joseph C. (Pasco, WA); Eichner, Fred N. (Kennewick, WA); Tomeraasen, Paul L. (Richland, WA)

    1991-01-01

    The amount of ionizing radiation to which a thermoluminescent material has been exposed is determined by first cooling the thermoluminescent material to a cryogenic temperature. The thermoluminescent material is then optically stimulated by exposure to ultraviolet light. Visible light emitted by the thermoluminescent material as it is allowed to warm up to room temperature is detected and counted. The thermoluminescent material may be annealed by exposure to ultraviolet light.

  20. Method and apparatus for phase and amplitude detection

    DOE Patents [OSTI]

    Cernosek, R.W.; Frye, G.C.; Martin, S.J.

    1998-06-09

    A new class of techniques has been developed which allow inexpensive application of SAW-type chemical sensor devices while retaining high sensitivity (ppm) to chemical detection. The new techniques do not require that the sensor be part of an oscillatory circuit, allowing large concentrations of, e.g., chemical vapors in air, to be accurately measured without compromising the capacity to measure trace concentrations. Such devices have numerous potential applications in environmental monitoring, from manufacturing environments to environmental restoration. 12 figs.

  1. Method for detecting radiation dose utilizing thermoluminescent material

    DOE Patents [OSTI]

    Miller, S.D.; McDonald, J.C.; Eichner, F.N.; Durham, J.S.

    1992-08-04

    The amount of ionizing radiation to which a thermoluminescent material has been exposed is determined by first cooling the thermoluminescent material and then optically stimulating the thermoluminescent material by exposure to light. Visible light emitted by the thermoluminescent material as it is allowed to warm up to room temperature is detected and counted. The thermoluminescent material may be annealed by exposure to ultraviolet light. 5 figs.

  2. Circuitry, systems and methods for detecting magnetic fields

    DOE Patents [OSTI]

    Kotter, Dale K. [Shelley, ID; Spencer, David F. [Idaho Falls, ID; Roybal, Lyle G. [Idaho Falls, ID; Rohrbaugh, David T. [Idaho Falls, ID

    2010-09-14

    Circuitry for detecting magnetic fields includes a first magnetoresistive sensor and a second magnetoresistive sensor configured to form a gradiometer. The circuitry includes a digital signal processor and a first feedback loop coupled between the first magnetoresistive sensor and the digital signal processor. A second feedback loop which is discrete from the first feedback loop is coupled between the second magnetoresistive sensor and the digital signal processor.

  3. Neutron-detecting apparatuses and methods of fabrication (Patent) | SciTech

    Office of Scientific and Technical Information (OSTI)

    Connect Patent: Neutron-detecting apparatuses and methods of fabrication Citation Details In-Document Search Title: Neutron-detecting apparatuses and methods of fabrication Neutron-detecting structures and methods of fabrication are provided which include: a substrate with a plurality of cavities extending into the substrate from a surface; a p-n junction within the substrate and extending, at least in part, in spaced opposing relation to inner cavity walls of the substrate defining the

  4. Detection method for dissociation of multiple-charged ions

    DOE Patents [OSTI]

    Smith, Richard D. (Richland, WA); Udseth, Harold R. (Richland, WA); Rockwood, Alan L. (Richland, WA)

    1991-01-01

    Dissociations of multiple-charged ions are detected and analyzed by charge-separation tandem mass spectrometry. Analyte molecules are ionized to form multiple-charged parent ions. A particular charge parent ion state is selected in a first-stage mass spectrometer and its mass-to-charge ratio (M/Z) is detected to determine its mass and charge. The selected parent ions are then dissociated, each into a plurality of fragments including a set of daughter ions each having a mass of at least one molecular weight and a charge of at least one. Sets of daughter ions resulting from the dissociation of one parent ion (sibling ions) vary in number but typically include two to four ions, one or more multiply-charged. A second stage mass spectrometer detects mass-to-charge ratio (m/z) of the daughter ions and a temporal or temporo-spatial relationship among them. This relationship is used to correlate the daughter ions to determine which (m/z) ratios belong to a set of sibling ions. Values of mass and charge of each of the sibling ions are determined simultaneously from their respective (m/z) ratios such that the sibling ion charges are integers and sum to the parent ion charge.

  5. Methods for detection of methyl-CpG dinucleotides

    DOE Patents [OSTI]

    Dunn, John J.

    2013-01-29

    The invention provides methods for enriching methyl-CpG sequences from a DNA sample. The method makes use of conversion of cytosine residues to uracil under conditions in which methyl-cytosine residues are preserved. Additional methods of the invention enable to preservation of the context of me-CpG dinucleotides. The invention also provides a recombinant, full length and substantially pure McrA protein (rMcrA) for binding and isolation of DNA fragments containing the sequence 5'-C.sup.MeCpGG-3'. Methods for making and using the rMcrA protein, and derivatives thereof are provided.

  6. Methods for detection of methyl-CpG dinucleotides

    DOE Patents [OSTI]

    Dunn, John J.

    2012-09-11

    The invention provides methods for enriching methyl-CpG sequences from a DNA sample. The method makes use of conversion of cytosine residues to uracil under conditions in which methyl-cytosine residues are preserved. Additional methods of the invention enable to preservation of the context of me-CpG dinucleotides. The invention also provides a recombinant, full length and substantially pure McrA protein (rMcrA) for binding and isolation of DNA fragments containing the sequence 5'-C.sup.MeCpGG-3'. Methods for making and using the rMcrA protein, and derivatives thereof are provided.

  7. Methods for detection of methyl-CpG dinucleotides

    DOE Patents [OSTI]

    Dunn, John J

    2013-11-26

    The invention provides methods for enriching methyl-CpG sequences from a DNA sample. The method makes use of conversion of cytosine residues to uracil under conditions in which methyl-cytosine residues are preserved. Additional methods of the invention enable to preservation of the context of me-CpG dinucleotides. The invention also provides a recombinant, full length and substantially pure McrA protein (rMcrA) for binding and isolation of DNA fragments containing the sequence 5'-C.sup.MeCpGG-3'. Methods for making and using the rMcrA protein, and derivatives thereof are provided.

  8. The {ital COBE} Diffuse Infrared Background Experiment Search for the Cosmic Infrared Background. I. Limits and Detections

    SciTech Connect (OSTI)

    Hauser, M.G.; Arendt, R.G.; Kelsall, T.; Dwek, E.; Odegard, N.; Weiland, J.L.; Freudenreich, H.T.; Reach, W.T.; Pei, Y.C.; Lubin, P.; Mather, J.C.; Shafer, R.A.; Smoot, G.F.; Weiss, R.; Wilkinson, D.T.; Wright, E.L.

    1998-11-01

    The Diffuse Infrared Background Experiment (DIRBE) on the Cosmic Background Explorer ({ital COBE}) spacecraft was designed primarily to conduct a systematic search for an isotropic cosmic infrared background (CIB) in 10 photometric bands from 1.25 to 240 {mu}m. The results of that search are presented here. Conservative limits on the CIB are obtained from the minimum observed brightness in all-sky maps at each wavelength, with the faintest limits in the DIRBE spectral range being at 3.5 {mu}m ({nu}{ital I}{sub {nu}} {lt} 64 nW m{sup {minus}2} sr{sup {minus}1}, 95{percent} confidence level) and at 240 {mu}m ({nu}{ital I}{sub {nu}} {lt} 28 nW m{sup {minus}2} sr{sup {minus}1}, 95{percent} confidence level). The bright foregrounds from interplanetary dust scattering and emission, stars, and interstellar dust emission are the principal impediments to the DIRBE measurements of the CIB. These foregrounds have been modeled and removed from the sky maps. Assessment of the random and systematic uncertainties in the residuals and tests for isotropy show that only the 140 and 240 {mu}m data provide candidate detections of the CIB. The residuals and their uncertainties provide CIB upper limits more restrictive than the dark sky limits at wavelengths from 1.25 to 100 {mu}m. No plausible solar system or Galactic source of the observed 140 and 240 {mu}m residuals can be identified, leading to the conclusion that the CIB has been detected at levels of {nu}{ital I}{sub {nu}} = 25 {plus_minus} 7 and 14 {plus_minus} 3 nW m{sup {minus}2} sr{sup {minus}1} at 140 and 240 {mu}m, respectively. The integrated energy from 140 to 240 {mu}m, 10.3 nW m{sup {minus}2} sr{sup {minus}1}, is about twice the integrated optical light from the galaxies in the Hubble Deep Field, suggesting that star formation might have been heavily enshrouded by dust at high redshift. The detections and upper limits reported here provide new constraints on models of the history of energy-releasing processes and dust production since the decoupling of the cosmic microwave background from matter. {copyright} {ital {copyright} 1998.} {ital The American Astronomical Society}

  9. Method for detecting the presence of prostate cancer

    DOE Patents [OSTI]

    Karin, Michael; Luo, Jun-Li; Tan, Wei

    2010-04-13

    The present invention relates to compositions and methods for cancer diagnosis, treatment and drug screening. In particular, the present invention provides compositions and methods for targeting the nuclear translocation of IkB kinase-.alpha. (IKK.alpha.) and the IKK.alpha.-mediated suppression of Maspin expression observed in metastatic prostate cancer cells.

  10. Iterative optimizing quantization method for reconstructing three-dimensional images from a limited number of views

    DOE Patents [OSTI]

    Lee, H.R.

    1997-11-18

    A three-dimensional image reconstruction method comprises treating the object of interest as a group of elements with a size that is determined by the resolution of the projection data, e.g., as determined by the size of each pixel. One of the projections is used as a reference projection. A fictitious object is arbitrarily defined that is constrained by such reference projection. The method modifies the known structure of the fictitious object by comparing and optimizing its four projections to those of the unknown structure of the real object and continues to iterate until the optimization is limited by the residual sum of background noise. The method is composed of several sub-processes that acquire four projections from the real data and the fictitious object: generate an arbitrary distribution to define the fictitious object, optimize the four projections, generate a new distribution for the fictitious object, and enhance the reconstructed image. The sub-process for the acquisition of the four projections from the input real data is simply the function of acquiring the four projections from the data of the transmitted intensity. The transmitted intensity represents the density distribution, that is, the distribution of absorption coefficients through the object. 5 figs.

  11. Iterative optimizing quantization method for reconstructing three-dimensional images from a limited number of views

    DOE Patents [OSTI]

    Lee, Heung-Rae (Dublin, CA)

    1997-01-01

    A three-dimensional image reconstruction method comprises treating the object of interest as a group of elements with a size that is determined by the resolution of the projection data, e.g., as determined by the size of each pixel. One of the projections is used as a reference projection. A fictitious object is arbitrarily defined that is constrained by such reference projection. The method modifies the known structure of the fictitious object by comparing and optimizing its four projections to those of the unknown structure of the real object and continues to iterate until the optimization is limited by the residual sum of background noise. The method is composed of several sub-processes that acquire four projections from the real data and the fictitious object: generate an arbitrary distribution to define the fictitious object, optimize the four projections, generate a new distribution for the fictitious object, and enhance the reconstructed image. The sub-process for the acquisition of the four projections from the input real data is simply the function of acquiring the four projections from the data of the transmitted intensity. The transmitted intensity represents the density distribution, that is, the distribution of absorption coefficients through the object.

  12. Method for enhancing the resolving power of ion mobility separations over a limited mobility range

    DOE Patents [OSTI]

    Shvartsburg, Alexandre A; Tang, Keqi; Smith, Richard D

    2014-09-23

    A method for raising the resolving power, specificity, and peak capacity of conventional ion mobility spectrometry is disclosed. Ions are separated in a dynamic electric field comprising an oscillatory field wave and opposing static field, or at least two counter propagating waves with different parameters (amplitude, profile, frequency, or speed). As the functional dependencies of mean drift velocity on the ion mobility in a wave and static field or in unequal waves differ, only single species is equilibrated while others drift in either direction and are mobility-separated. An ion mobility spectrum over a limited range is then acquired by measuring ion drift times through a fixed distance inside the gas-filled enclosure. The resolving power in the vicinity of equilibrium mobility substantially exceeds that for known traveling-wave or drift-tube IMS separations, with spectra over wider ranges obtainable by stitching multiple segments. The approach also enables low-cutoff, high-cutoff, and bandpass ion mobility filters.

  13. Method and apparatus for enhanced detection of toxic agents

    DOE Patents [OSTI]

    Greenbaum, Elias (Knoxville, TN); Rodriguez, Jr., Miguel (Oak Ridge, TN); Wu, Jie Jayne (Knoxville, TN); Qi, Hairong (Knoxville, TN)

    2012-06-12

    A water quality analyzer for real-time detection according to the invention comprises a biased AC electro-osmosis (ACEO) cell for receiving a fluid to be analyzed having a plurality photosynthetic organisms therein, and concentrating the plurality photosynthetic organisms into at least one concentrated region. A photodetector is provided for obtaining a measured photosynthetic activity of the plurality of photosynthetic organisms in the concentrated region, wherein chemical, biological or radiological agents reduce a nominal photosynthetic activity of the photosynthetic organisms. An electronics package analyzes the measured photosynthetic activity to indicate a presence of the chemical, biological or radiological agents in the fluid.

  14. Compositions and methods for detecting gene rearrangements and translocations

    DOE Patents [OSTI]

    Rowley, Janet D.; Diaz, Manuel O.

    2000-01-01

    Disclosed is a series of nucleic acid probes for use in diagnosing and monitoring certain types of leukemia using, e.g., Southern and Northern blot analyses and fluorescence in situ hybridization (FISH). These probes detect rearrangements, such as translocations involving chromosome band 11q23 with other chromosomes bands, including 4q21, 6q27, 9p22, 19p13.3, in both dividing leukemic cells and interphase nuclei. The breakpoints in all such translocations are clustered within an 8.3 kb BamHI genomic region of the MLL gene. A novel 0.7 kb BamH1 cDNA fragment derived from this gene detects rearrangements on Southern blot analysis with a single BamHI restriction digest in all patients with the common 11q23 translocations and in patients with other 11q23 anomalies. Northern blot analyses are presented demonstrating that the MLL gene has multiple transcripts and that transcript size differentiates leukemic cells from normal cells. Also disclosed are MLL fusion proteins, MLL protein domains and anti-MLL antibodies.

  15. Monoclonal antibodies to cyclodiene insecticides and method for detecting the same

    DOE Patents [OSTI]

    Stanker, Larry H. (Livermore, CA); Vanderlaan, Martin (Danville, CA); Watkins, Bruce E. (Livermore, CA)

    1994-01-01

    Methods are described for making specific monoclonal antibodies useful for detection of cyclodienes in foods and environmental samples. Monoclonal antibodies specifically reactive with cyclodienes can detect accumulated pesticides in food, tissue or environmental samples. Extraction and preparation of organic samples for immunoassay in a polar-nonpolar reaction medium permits detection of halogenated organic ring structures at concentrations in samples.

  16. Monoclonal antibodies to cyclodiene insecticides and method for detecting the same

    DOE Patents [OSTI]

    Stanker, L.H.; Vanderlaan, M.; Watkins, B.E.

    1994-08-02

    Methods are described for making specific monoclonal antibodies useful for detection of cyclodienes in foods and environmental samples. Monoclonal antibodies specifically reactive with cyclodienes can detect accumulated pesticides in food, tissue or environmental samples. Extraction and preparation of organic samples for immunoassay in a polar-nonpolar reaction medium permits detection of halogenated organic ring structures at concentrations in samples. 13 figs.

  17. Method for detecting organic contaminants in water supplies

    DOE Patents [OSTI]

    Dooley, Kirk J. (Shelley, ID); Barrie, Scott L. (Idaho Falls, ID); Buttner, William J. (White Bear Lake, MN)

    1999-01-01

    A system for detecting organic contaminants in water supplies. A sampling unit is employed which includes a housing having at least one opening therein and a tubular member positioned within the housing having a central passageway surrounded by a side wall. The side wall is made of a composition designed to absorb the contaminants. In use, the sampling unit is immersed in a water supply. The water supply contacts the tubular member through the opening in the housing, with any contaminants being absorbed into the side wall of the tubular member. A carrier gas is then passed through the central passageway of the tubular member. The contaminants will diffuse out of the side wall and into the central passageway where they will subsequently combine with the carrier gas, thereby yielding a gaseous product. The gaseous product is then analyzed to determine the amount and type of contaminants therein.

  18. Method for detecting organic contaminants in water supplies

    DOE Patents [OSTI]

    Dooley, K.J.; Barrie, S.L.; Buttner, W.J.

    1999-08-24

    A system is described for detecting organic contaminants in water supplies. A sampling unit is employed which includes a housing having at least one opening therein and a tubular member positioned within the housing having a central passageway surrounded by a side wall. The side wall is made of a composition designed to absorb the contaminants. In use, the sampling unit is immersed in a water supply. The water supply contacts the tubular member through the opening in the housing, with any contaminants being absorbed into the side wall of the tubular member. A carrier gas is then passed through the central passageway of the tubular member. The contaminants will diffuse out of the side wall and into the central passageway where they will subsequently combine with the carrier gas, thereby yielding a gaseous product. The gaseous product is then analyzed to determine the amount and type of contaminants therein. 5 figs.

  19. Apparatus and method for detecting tampering in flexible structures

    DOE Patents [OSTI]

    Maxey, Lonnie C. (Knoxville, TN); Haynes, Howard D. (Knoxville, TN)

    2011-02-01

    A system for monitoring or detecting tampering in a flexible structure includes taking electrical measurements on a sensing cable coupled to the structure, performing spectral analysis on the measured data, and comparing the spectral characteristics of the event to those of known benign and/or known suspicious events. A threshold or trigger value may used to identify an event of interest and initiate data collection. Alternatively, the system may be triggered at preset intervals, triggered manually, or triggered by a signal from another sensing device such as a motion detector. The system may be used to monitor electrical cables and conduits, hoses and flexible ducts, fences and other perimeter control devices, structural cables, flexible fabrics, and other flexible structures.

  20. Comparison of enclosed space detection system with conventional methods

    SciTech Connect (OSTI)

    Kercel, S.W.; Baylor, V.M.; Labaj, L.E.

    1997-09-01

    Enclosed Space Detection System (ESDS) is a fast, inexpensive, and reliable device for detecting human occupants hidden in vehicles. Operation requires less than two minutes. ESDS is used to foil attempts at smuggling illegal aliens, terrorists, and escaping prisoners. It is being tested at nuclear weapons facilities and has been operated at several prisons and international border crossings. ESDS is the first practical electronic alternative to physical searches of vehicles for hidden passengers. At critical checkpoints, a thorough physical search of a single fully loaded truck requires a team of from two to six people, and may take as long as eight hours. Despite this level of security, experience has shown that the search can occasionally be foiled. Due to the enormous time and expense of thorough physical searches of vehicles, they are seldom conducted at any but the most critical of locations, simply leaving many sites vulnerable to crime and terrorism. Prior to the development of the ESDS, the only other effective alternative to physical search was the use of specially-trained canines, which can be vastly superior to the physical search in both time and accuracy. However, as discussed in this paper, canine inspection is not really a competitive substitute for ESDS because canine reliability (80% at most) is not as high as that of the ESDS (99%+), while the costs, training requirements, and operator skill needed are significantly higher with canines than with the ESDS. In addition, the ESDS has straightforward self-diagnostic tests to ensure the system is operating correctly; such tests are not currently available with either canine or human inspectors. ESDS offers an attractive supplement or alternative to meet current security requirements for vehicle searches at portals at government, nuclear, industrial, and other facilities where concealed persons may pose a threat either by entering or leaving.

  1. Method for detecting a pericentric inversion in a chromosome

    DOE Patents [OSTI]

    Lucas, Joe N. (San Ramon, CA)

    2000-01-01

    A method is provided for determining a clastogenic signature of a sample of chromosomes by quantifying a frequency of a first type of chromosome aberration present in the sample; quantifying a frequency of a second, different type of chromosome aberration present in the sample; and comparing the frequency of the first type of chromosome aberration to the frequency of the second type of chromosome aberration. A method is also provided for using that clastogenic signature to identify a clastogenic agent or dosage to which the cells were exposed.

  2. Method and apparatus for continuous fluid leak monitoring and detection in analytical instruments and instrument systems

    DOE Patents [OSTI]

    Weitz, Karl K.; Moore, Ronald J.

    2010-07-13

    A method and device are disclosed that provide for detection of fluid leaks in analytical instruments and instrument systems. The leak detection device includes a collection tube, a fluid absorbing material, and a circuit that electrically couples to an indicator device. When assembled, the leak detection device detects and monitors for fluid leaks, providing a preselected response in conjunction with the indicator device when contacted by a fluid.

  3. Taggants, method for forming a taggant, and a method for detecting an object

    DOE Patents [OSTI]

    Harrup, Mason K.; Stewart, Frederick F.; Stone, Mark L.

    2012-02-28

    A taggant comprising at least one perfluorocarbon compound surrounded by a polyphosphazene compound. The polyphosphazene compound has the chemical structure: ##STR00001## wherein G.sub.1 and G.sub.2 are pendant groups having different polarities, m is an integer greater than or equal to 100, and each of A and B is independently selected from hydrogen, an alkyl, an alkene, an alkoxide, a polyether, a polythioether, a siloxane, and --X(CH.sub.2).sub.nY.sup.1(CH.sub.2)p.sub.1Y.sup.2(CH.sub.2)p.sub.2 . . . Y.sup.i(CH.sub.2)p.sub.iCH.sub.3, where n ranges from 1 to 6, X and Y are independently selected from oxygen, sulfur, selenium, tellurium, and polonium, and p.sub.1 through p.sub.i range from 1 to 6. Cyclic polyphosphazene compounds lacking the A and B groups are also disclosed, as are methods of forming the taggant and of detecting an object.

  4. Methods of detection using a cellulose binding domain fusion product

    DOE Patents [OSTI]

    Shoseyov, Oded (Shimshon, IL); Shpiegl, Itai (North Gallilea, IL); Goldstein, Marc A. (Davis, CA); Doi, Roy H. (Davis, CA)

    1999-01-01

    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production thereof. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques.

  5. Methods of detection using a cellulose binding domain fusion product

    DOE Patents [OSTI]

    Shoseyov, O.; Shpiegl, I.; Goldstein, M.A.; Doi, R.H.

    1999-01-05

    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques. 34 figs.

  6. Method for non-invasive detection of ocular melanoma

    DOE Patents [OSTI]

    Lambrecht, R.M.; Packer, S.

    1984-10-30

    An apparatus and method is disclosed for diagnosing ocular cancer that is both non-invasive and accurate. The apparatus comprises two radiation detectors positioned before each of the patient's eyes which will measure the radiation level produced in each eye after the administration of a tumor-localizing radiopharmaceutical such as gallium-67. 2 figs.

  7. Method for non-invasive detection of ocular melanoma

    DOE Patents [OSTI]

    Lambrecht, Richard M.; Packer, Samuel

    1984-01-01

    There is described an apparatus and method for diagnosing ocular cancer that is both non-invasive and accurate which comprises two radiation detectors positioned before each of the patient's eyes which will measure the radiation level produced in each eye after the administration of a tumor-localizing radiopharmaceutical such as gallium-67.

  8. Optical vibration detection spectral analysis assembly and method for detecting vibration in an object of interest

    DOE Patents [OSTI]

    Hale, T.C.; Telschow, K.L.

    1998-10-27

    A vibration detection assembly is described which includes an emitter of light which has object and reference beams, the object beam reflected off of a vibrating object of interest; and a photorefractive substance having a given response time and which passes the reflected object beam and the reference beam, the reference beam and the object beam interfering within the photorefractive substance to create a space charge field which develops within the response time of the photorefractive substance. 6 figs.

  9. Optical vibration detection spectral analysis assembly and method for detecting vibration in an object of interest

    DOE Patents [OSTI]

    Hale, Thomas C. (Los Alamos, NM); Telschow, Kenneth L. (Idaho Falls, ID)

    1998-01-01

    A vibration detection assembly is described which includes an emitter of light which has object and reference beams, the object beam reflected off of a vibrating object of interest; and a photorefractive substance having a given response time and which passes the reflected object beam and the reference beam, the reference beam and the object beam interfering within the photorefractive substance to create a space charge field which develops within the response time of the photorefractive substance.

  10. Method of manufacturing a matrix for the detection of mismatches

    DOE Patents [OSTI]

    Ershov, Gennady Moiseevich (Moscow, RU); Mirzabekov, Andrei Darievich (Moscow, RU)

    1998-01-01

    This method for preparing micromatrices consists in applying a specially-patterned intermediate layer of laser-absorbing substance on a solid support. The configuration of the sublayer fully corresponds to the topology of the manufactured matrix. The intermediate layer is further covered by a continuous layer of gel , the gel and the material of the support being transparent towards laser radiation. The gel layer is irradiated by a laser beam for a time needed to evaporate simultaneously the gel in the places immediately above the laser-absorbing sublayer and the sublayer itself. Oligonucleotides from a chosen set are then attached to the formed gel `cells`, one oligonucleotide to each cell. This method is intended for use in biotechnology, specifically for deciphering the nucleotide sequence of DNA.

  11. Statistically qualified neuro-analytic failure detection method and system

    DOE Patents [OSTI]

    Vilim, Richard B. (Aurora, IL); Garcia, Humberto E. (Idaho Falls, ID); Chen, Frederick W. (Naperville, IL)

    2002-03-02

    An apparatus and method for monitoring a process involve development and application of a statistically qualified neuro-analytic (SQNA) model to accurately and reliably identify process change. The development of the SQNA model is accomplished in two stages: deterministic model adaption and stochastic model modification of the deterministic model adaptation. Deterministic model adaption involves formulating an analytic model of the process representing known process characteristics, augmenting the analytic model with a neural network that captures unknown process characteristics, and training the resulting neuro-analytic model by adjusting the neural network weights according to a unique scaled equation error minimization technique. Stochastic model modification involves qualifying any remaining uncertainty in the trained neuro-analytic model by formulating a likelihood function, given an error propagation equation, for computing the probability that the neuro-analytic model generates measured process output. Preferably, the developed SQNA model is validated using known sequential probability ratio tests and applied to the process as an on-line monitoring system. Illustrative of the method and apparatus, the method is applied to a peristaltic pump system.

  12. Initial Results in Using a Self-Coherence Method for Detecting Sustained Oscillations

    SciTech Connect (OSTI)

    Zhou, Ning; Dagle, Jeffery E.

    2015-01-01

    This paper develops a self-coherence method for detecting sustained oscillations using phasor measurement unit (PMU) data. Sustained oscillations decrease system performance and introduce potential reliability issues. Timely detection of the oscillations at an early stage provides the opportunity for taking remedial reaction. Using high-speed time-synchronized PMU data, this paper details a self-coherence method for detecting sustained oscillation, even when the oscillation amplitude is lower than ambient noise. Simulation and field measurement data are used to evaluate the proposed methods performance. It is shown that the proposed method can detect sustained oscillations and estimate oscillation frequencies with a low signal-to-noise ratio. Comparison with a power spectral density method also shows that the proposed self-coherence method performs better. Index Termscoherence, power spectral density, phasor measurement unit (PMU), oscillations, power system dynamics

  13. Systems and methods of detecting force and stress using tetrapod nanocrystal

    DOE Patents [OSTI]

    Choi, Charina L.; Koski, Kristie J.; Sivasankar, Sanjeevi; Alivisatos, A. Paul

    2013-08-20

    Systems and methods of detecting force on the nanoscale including methods for detecting force using a tetrapod nanocrystal by exposing the tetrapod nanocrystal to light, which produces a luminescent response by the tetrapod nanocrystal. The method continues with detecting a difference in the luminescent response by the tetrapod nanocrystal relative to a base luminescent response that indicates a force between a first and second medium or stresses or strains experienced within a material. Such systems and methods find use with biological systems to measure forces in biological events or interactions.

  14. Method and apparatus for acoustic plate mode liquid-solid phase transition detection

    DOE Patents [OSTI]

    Blair, Dianna S. (Albuquerque, NM); Freye, Gregory C. (Cedar Crest, NM); Hughes, Robert C. (Albuquerque, NM); Martin, Stephen J. (Albuquerque, NM); Ricco, Antonio J. (Albuquerque, NM)

    1993-01-01

    A method and apparatus for sensing a liquid-solid phase transition event is provided which comprises an acoustic plate mode detecting element placed in contact with a liquid or solid material which generates a high-frequency acoustic wave that is attenuated to an extent based on the physical state of the material is contact with the detecting element. The attenuation caused by the material in contact with the acoustic plate mode detecting element is used to determine the physical state of the material being detected. The method and device are particularly suited for detecting conditions such as the icing and deicing of wings of an aircraft. In another aspect of the present invention, a method is provided wherein the adhesion of a solid material to the detecting element can be measured using the apparatus of the invention.

  15. Method for detection and imaging over a broad spectral range

    DOE Patents [OSTI]

    Yefremenko, Volodymyr (Westmont, IL); Gordiyenko, Eduard (Westmont, IL); Pishko, legal representative, Olga (Kharkov, UA); Novosad, Valentyn (Chicago, IL); Pishko, deceased; Vitalii (Westmont, IL)

    2007-09-25

    A method of controlling the coordinate sensitivity in a superconducting microbolometer employs localized light, heating or magnetic field effects to form normal or mixed state regions on a superconducting film and to control the spatial location. Electron beam lithography and wet chemical etching were applied as pattern transfer processes in epitaxial Y--Ba--Cu--O films. Two different sensor designs were tested: (i) a 3 millimeter long and 40 micrometer wide stripe and (ii) a 1.25 millimeters long, and 50 micron wide meandering-like structure. Scanning the laser beam along the stripe leads to physical displacement of the sensitive area, and, therefore, may be used as a basis for imaging over a broad spectral range. Forming the superconducting film as a meandering structure provides the equivalent of a two-dimensional detector array. Advantages of this approach are simplicity of detector fabrication, and simplicity of the read-out process requiring only two electrical terminals.

  16. Method of detecting system function by measuring frequency response

    DOE Patents [OSTI]

    Morrison, John L.; Morrison, William H.; Christophersen, Jon P.

    2012-04-03

    Real-time battery impedance spectrum is acquired using a one-time record. Fast Summation Transformation (FST) is a parallel method of acquiring a real-time battery impedance spectrum using a one-time record that enables battery diagnostics. An excitation current to a battery is a sum of equal amplitude sine waves of frequencies that are octave harmonics spread over a range of interest. A sample frequency is also octave and harmonically related to all frequencies in the sum. The time profile of this signal has a duration that is a few periods of the lowest frequency. The voltage response of the battery, average deleted, is the impedance of the battery in the time domain. Since the excitation frequencies are known and octave and harmonically related, a simple algorithm, FST, processes the time record by rectifying relative to the sine and cosine of each frequency. Another algorithm yields real and imaginary components for each frequency.

  17. Apparatus and method for detecting full-capture radiation events

    DOE Patents [OSTI]

    Odell, Daniel M. C. (Aiken, SC)

    1994-01-01

    An apparatus and method for sampling the output signal of a radiation detector and distinguishing full-capture radiation events from Compton scattering events. The output signal of a radiation detector is continuously sampled. The samples are converted to digital values and input to a discriminator where samples that are representative of events are identified. The discriminator transfers only event samples, that is, samples representing full-capture events and Compton events, to a signal processor where the samples are saved in a three-dimensional count matrix with time (from the time of onset of the pulse) on the first axis, sample pulse current amplitude on the second axis, and number of samples on the third axis. The stored data are analyzed to separate the Compton events from full-capture events, and the energy of the full-capture events is determined without having determined the energies of any of the individual radiation detector events.

  18. Apparatus and method for detecting full-capture radiation events

    DOE Patents [OSTI]

    Odell, D.M.C.

    1994-10-11

    An apparatus and method are disclosed for sampling the output signal of a radiation detector and distinguishing full-capture radiation events from Compton scattering events. The output signal of a radiation detector is continuously sampled. The samples are converted to digital values and input to a discriminator where samples that are representative of events are identified. The discriminator transfers only event samples, that is, samples representing full-capture events and Compton events, to a signal processor where the samples are saved in a three-dimensional count matrix with time (from the time of onset of the pulse) on the first axis, sample pulse current amplitude on the second axis, and number of samples on the third axis. The stored data are analyzed to separate the Compton events from full-capture events, and the energy of the full-capture events is determined without having determined the energies of any of the individual radiation detector events. 4 figs.

  19. System and method for detecting a faulty object in a system (Patent) |

    Office of Scientific and Technical Information (OSTI)

    SciTech Connect System and method for detecting a faulty object in a system Citation Details In-Document Search Title: System and method for detecting a faulty object in a system A method (and system) for detecting at least one faulty object in a system including a plurality of objects in communication with each other in an n-dimensional architecture, includes probing a first plane of objects in the n-dimensional architecture and probing at least one other plane of objects in the

  20. System and method for detecting a faulty object in a system (Patent) |

    Office of Scientific and Technical Information (OSTI)

    SciTech Connect System and method for detecting a faulty object in a system Citation Details In-Document Search Title: System and method for detecting a faulty object in a system A method (and system) for detecting at least one faulty object in a system including a plurality of objects in communication with each other in an n-dimensional architecture, includes probing a first plane of objects in the n-dimensional architecture and probing at least one other plane of objects in the

  1. Real-time method for establishing a detection map for a network of sensors

    DOE Patents [OSTI]

    Nguyen, Hung D; Koch, Mark W; Giron, Casey; Rondeau, Daniel M; Russell, John L

    2012-09-11

    A method for establishing a detection map of a dynamically configurable sensor network. This method determines an appropriate set of locations for a plurality of sensor units of a sensor network and establishes a detection map for the network of sensors while the network is being set up; the detection map includes the effects of the local terrain and individual sensor performance. Sensor performance is characterized during the placement of the sensor units, which enables dynamic adjustment or reconfiguration of the placement of individual elements of the sensor network during network set-up to accommodate variations in local terrain and individual sensor performance. The reconfiguration of the network during initial set-up to accommodate deviations from idealized individual sensor detection zones improves the effectiveness of the sensor network in detecting activities at a detection perimeter and can provide the desired sensor coverage of an area while minimizing unintentional gaps in coverage.

  2. Methods and apparatus using commutative error detection values for fault isolation in multiple node computers

    DOE Patents [OSTI]

    Almasi, Gheorghe (Ardsley, NY) [Ardsley, NY; Blumrich, Matthias Augustin (Ridgefield, CT) [Ridgefield, CT; Chen, Dong (Croton-On-Hudson, NY) [Croton-On-Hudson, NY; Coteus, Paul (Yorktown, NY) [Yorktown, NY; Gara, Alan (Mount Kisco, NY) [Mount Kisco, NY; Giampapa, Mark E. (Irvington, NY) [Irvington, NY; Heidelberger, Philip (Cortlandt Manor, NY) [Cortlandt Manor, NY; Hoenicke, Dirk I. (Ossining, NY) [Ossining, NY; Singh, Sarabjeet (Mississauga, CA) [Mississauga, CA; Steinmacher-Burow, Burkhard D. (Wernau, DE) [Wernau, DE; Takken, Todd (Brewster, NY) [Brewster, NY; Vranas, Pavlos (Bedford Hills, NY) [Bedford Hills, NY

    2008-06-03

    Methods and apparatus perform fault isolation in multiple node computing systems using commutative error detection values for--example, checksums--to identify and to isolate faulty nodes. When information associated with a reproducible portion of a computer program is injected into a network by a node, a commutative error detection value is calculated. At intervals, node fault detection apparatus associated with the multiple node computer system retrieve commutative error detection values associated with the node and stores them in memory. When the computer program is executed again by the multiple node computer system, new commutative error detection values are created and stored in memory. The node fault detection apparatus identifies faulty nodes by comparing commutative error detection values associated with reproducible portions of the application program generated by a particular node from different runs of the application program. Differences in values indicate a possible faulty node.

  3. Nucleotide sequences specific to Brucella and methods for the detection of Brucella

    DOE Patents [OSTI]

    McCready, Paula M. (Tracy, CA); Radnedge, Lyndsay (San Mateo, CA); Andersen, Gary L. (Berkeley, CA); Ott, Linda L. (Livermore, CA); Slezak, Thomas R. (Livermore, CA); Kuczmarski, Thomas A. (Livermore, CA)

    2009-02-24

    Nucleotide sequences specific to Brucella that serves as a marker or signature for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  4. Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

    DOE Patents [OSTI]

    McCready, Paula M. (Tracy, CA); Radnedge, Lyndsay (San Mateo, CA); Andersen, Gary L. (Berkeley, CA); Ott, Linda L. (Livermore, CA); Slezak, Thomas R. (Livermore, CA); Kuczmarski, Thomas A. (Livermore, CA); Vitalis, Elizabeth A (Livermore, CA)

    2007-02-06

    Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  5. Nucleotide sequences specific to Francisella tularensis and methods for the detection of Francisella tularensis

    DOE Patents [OSTI]

    McCready, Paula M. (Tracy, CA); Radnedge, Lyndsay (San Mateo, CA); Andersen, Gary L. (Berkeley, CA); Ott, Linda L. (Livermore, CA); Slezak, Thomas R. (Livermore, CA); Kuczmarski, Thomas A. (Livermore, CA); Vitalis, Elizabeth A (Livermore, CA)

    2009-02-24

    Described herein is the identification of nucleotide sequences specific to Francisella tularensis that serves as a marker or signature for identification of this bacterium. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  6. Means and method for capillary zone electrophoresis with laser-induced indirect fluorescence detection

    DOE Patents [OSTI]

    Yeung, Edward S. (Ames, IA); Kuhr, Werner G. (Riverside, CA)

    1996-02-20

    A means and method for capillary zone electrphoresis with laser-induced indirect fluorescence detection. A detector is positioned on the capillary tube of a capillary zone electrophoresis system. The detector includes a laser which generates a laser beam which is imposed upon a small portion of the capillary tube. Fluorescence of the elutant electromigrating through the capillary tube is indirectly detected and recorded.

  7. Means and method for capillary zone electrophoresis with laser-induced indirect fluorescence detection

    DOE Patents [OSTI]

    Yeung, Edwards (Ames, IA); Kuhr, Werner G. (Riverside, CA)

    1991-04-09

    A means and method for capillary zone electrphoresis with laser-induced indirect fluorescence detection. A detector is positioned on the capillary tube of a capillary zone electrophoresis system. The detector includes a laser which generates a laser beam which is imposed upon a small portion of the capillary tube. Fluorescence of the elutant electromigrating through the capillary tube is indirectly detected and recorded.

  8. Monoclonal antibodies to synthetic pyrethroids and method for detecting the same

    DOE Patents [OSTI]

    Stanker, Larry H. (Livermore, CA); Vanderlaan, Martin (Danville, CA); Watkins, Bruce E. (Livermore, CA); Van Emon, Jeanette M. (Henderson, NV); Bigbee, Carolyn L. (Livermore, CA)

    1992-01-01

    Methods are described for making specific monoclonal antibodies which may be used in a sensitive immunoassay for detection of synthetic pyrethroids in foods and environmental samples. Appropriate sample preparation and enzyme amplification of the immunoassay for this widely-used class of pesticides permits detection at low levels in laboratory and field tested samples.

  9. Nucleotide sequences specific to Yersinia pestis and methods for the detection of Yersinia pestis

    DOE Patents [OSTI]

    McCready, Paula M. (Tracy, CA); Radnedge, Lyndsay (San Mateo, CA); Andersen, Gary L. (Berkeley, CA); Ott, Linda L. (Livermore, CA); Slezak, Thomas R. (Livermore, CA); Kuczmarski, Thomas A. (Livermore, CA); Motin, Vladinir L. (League City, TX)

    2009-02-24

    Nucleotide sequences specific to Yersinia pestis that serve as markers or signatures for identification of this bacterium were identified. In addition, forward and reverse primers and hybridization probes derived from these nucleotide sequences that are used in nucleotide detection methods to detect the presence of the bacterium are disclosed.

  10. Monoclonal antibodies to synthetic pyrethroids and method for detecting the same

    DOE Patents [OSTI]

    Stanker, L.H.; Vanderlaan, M.; Watkins, B.E.; Van Emon, J.M.; Bigbee, C.L.

    1992-04-28

    Methods are described for making specific monoclonal antibodies which may be used in a sensitive immunoassay for detection of synthetic pyrethroids in foods and environmental samples. Appropriate sample preparation and enzyme amplification of the immunoassay for this widely-used class of pesticides permits detection at low levels in laboratory and field tested samples. 6 figs.

  11. Method for detecting and diagnosing disease caused by pathological protein aggregation

    DOE Patents [OSTI]

    Stevens, Fred J. (Naperville, IL); Myatt, Elizabeth A. (Riverside, IL); Solomon, Alan (Knoxville, TN)

    2000-01-01

    A method is provided for detecting pathological macromolecules in a patient, comprising obtaining body fluid from the patient, pretreating the body fluid, subjecting the pretreated body fluid to size-exclusion chromatography to create an excluded fluid, and analyzing the excluded fluid to detect macromolecules having a predetermined molecular weight. The method also allows for comparing elution spectra with reference spectra of suspect pathologic proteins.

  12. Magnetic force microscopy method and apparatus to detect and image currents in integrated circuits

    DOE Patents [OSTI]

    Campbell, A.N.; Anderson, R.E.; Cole, E.I. Jr.

    1995-11-07

    A magnetic force microscopy method and improved magnetic tip for detecting and quantifying internal magnetic fields resulting from current of integrated circuits are disclosed. Detection of the current is used for failure analysis, design verification, and model validation. The interaction of the current on the integrated chip with a magnetic field can be detected using a cantilevered magnetic tip. Enhanced sensitivity for both ac and dc current and voltage detection is achieved with voltage by an ac coupling or a heterodyne technique. The techniques can be used to extract information from analog circuits. 17 figs.

  13. Magnetic force microscopy method and apparatus to detect and image currents in integrated circuits

    DOE Patents [OSTI]

    Campbell, Ann. N. (13170-B Central SE #188, Albuquerque, NM 87123); Anderson, Richard E. (2800 Tennessee NE, Albuquerque, NM 87110); Cole, Jr., Edward I. (2116 White Cloud NE, Albuquerque, NM 87112)

    1995-01-01

    A magnetic force microscopy method and improved magnetic tip for detecting and quantifying internal magnetic fields resulting from current of integrated circuits. Detection of the current is used for failure analysis, design verification, and model validation. The interaction of the current on the integrated chip with a magnetic field can be detected using a cantilevered magnetic tip. Enhanced sensitivity for both ac and dc current and voltage detection is achieved with voltage by an ac coupling or a heterodyne technique. The techniques can be used to extract information from analog circuits.

  14. Method of analyzing multiple sample simultaneously by detecting absorption and systems for use in such a method

    DOE Patents [OSTI]

    Yeung, Edward S.; Gong, Xiaoyi

    2004-09-07

    The present invention provides a method of analyzing multiple samples simultaneously by absorption detection. The method comprises: (i) providing a planar array of multiple containers, each of which contains a sample comprising at least one absorbing species, (ii) irradiating the planar array of multiple containers with a light source and (iii) detecting absorption of light with a detetion means that is in line with the light source at a distance of at leaat about 10 times a cross-sectional distance of a container in the planar array of multiple containers. The absorption of light by a sample indicates the presence of an absorbing species in it. The method can further comprise: (iv) measuring the amount of absorption of light detected in (iii) indicating the amount of the absorbing species in the sample. Also provided by the present invention is a system for use in the abov metho.The system comprises; (i) a light source comrnpising or consisting essentially of at leaat one wavelength of light, the absorption of which is to be detected, (ii) a planar array of multiple containers, and (iii) a detection means that is in line with the light source and is positioned in line with and parallel to the planar array of multiple contiainers at a distance of at least about 10 times a cross-sectional distance of a container.

  15. Ultrasound based monitoring of the injection moulding process - Methods, applications and limitations

    SciTech Connect (OSTI)

    Praher, B., E-mail: bernhard.praher@jku.at, E-mail: klaus.straka@jku.at, E-mail: jesenka.usanovic@jku.at, E-mail: georg.steinbichler@jku.at; Straka, K., E-mail: bernhard.praher@jku.at, E-mail: klaus.straka@jku.at, E-mail: jesenka.usanovic@jku.at, E-mail: georg.steinbichler@jku.at; Usanovic, J., E-mail: bernhard.praher@jku.at, E-mail: klaus.straka@jku.at, E-mail: jesenka.usanovic@jku.at, E-mail: georg.steinbichler@jku.at; Steinbichler, G., E-mail: bernhard.praher@jku.at, E-mail: klaus.straka@jku.at, E-mail: jesenka.usanovic@jku.at, E-mail: georg.steinbichler@jku.at [Institute of Polymer Injection Moulding and Process Automation, Johannes Kepler University Linz (Austria)

    2014-05-15

    We developed novel non-invasive ultrasound based systems for the measurement of temperature distributions in the screw-ante chamber, the detection of unmelted granules and for the monitoring of the plasticizing process along the screw channel. The temperature of the polymer melt stored in the screw ante-chamber after the plasticization should be homogeneous. However, in reality the polymer melt in the screw ante-chamber is not homogeneous. Due to the fact the sound velocity in a polymer melt is temperature depending, we developed a tomography system using the measured transit times of ultrasonic pulses along different sound paths for calculating the temperature distribution in radial direction of a polymer melt in the screw ante-chamber of an injection moulding machine. For the detection of unmelted granules in the polymer melt we implemented an ultrasound transmission measurement. By analyzing the attenuation of the received pulses it is possible to detect unwanted inclusions. For the monitoring of the plasticizing process in the channels of the screw an ultrasonic pulse is transmitted into the barrel. By analyzing the reflected pulses it is possible to estimate solid bed and melt regions in the screw channel. The proposed systems were tested for accuracy and validity by simulations and test measurements.

  16. Methods, systems and devices for detecting threatening objects and for classifying magnetic data

    DOE Patents [OSTI]

    Kotter, Dale K.; Roybal, Lyle G.; Rohrbaugh, David T.; Spencer, David F.

    2012-01-24

    A method for detecting threatening objects in a security screening system. The method includes a step of classifying unique features of magnetic data as representing a threatening object. Another step includes acquiring magnetic data. Another step includes determining if the acquired magnetic data comprises a unique feature.

  17. Methods for point-of-care detection of nucleic acid in a sample

    DOE Patents [OSTI]

    Bearinger, Jane P.; Dugan, Lawrence C.

    2015-12-29

    Provided herein are methods and apparatus for detecting a target nucleic acid in a sample and related methods and apparatus for diagnosing a condition in an individual. The condition is associated with presence of nucleic acid produced by certain pathogens in the individual.

  18. Systems and methods of monitoring acoustic pressure to detect a flame condition in a gas turbine

    DOE Patents [OSTI]

    Ziminsky, Willy Steve (Simpsonville, SC); Krull, Anthony Wayne (Anderson, SC); Healy, Timothy Andrew (Simpsonville, SC), Yilmaz, Ertan (Glenville, NY)

    2011-05-17

    A method may detect a flashback condition in a fuel nozzle of a combustor. The method may include obtaining a current acoustic pressure signal from the combustor, analyzing the current acoustic pressure signal to determine current operating frequency information for the combustor, and indicating that the flashback condition exists based at least in part on the current operating frequency information.

  19. Method and compositions for detecting of bloodstains using fluorescin-fluorescein reaction

    DOE Patents [OSTI]

    Di Benedetto, John; Kyle, Kevin; Boan, Terry; Marie, Charlene

    2004-02-17

    A method, compositions and kit are set forth for detecting blood stains. A reactant solution includes fluorescin solubilized (reduced) in acetic acid in ethanol. The solution may be buffered to a pH of approximately 9. After spraying the reactant solution on the suspected area an oxidizer is applied to promote the fluorescin to fluorescein reaction with the blood. The reacted fluorescein is then detected through luminescence for capture by photography.

  20. Method and means of passive detection of leaks in buried pipes

    DOE Patents [OSTI]

    Claytor, Thomas N. (Woodridge, IL)

    1981-01-01

    A method and means for passive detection of a leak in a buried pipe containing fluid under pressure includes a plurality of acoustic detectors that are placed in contact with the pipe. Noise produced by the leak is detected by the detectors, and the detected signals are correlated to locate the leak. In one embodiment of the invention two detectors are placed at different locations to locate a leak between them. In an alternate embodiment two detectors of different waves are placed at substantially the same location to determine the distance of the leak from the location.

  1. Rapid method to detect duplex formation in sequencing by hybridization methods

    DOE Patents [OSTI]

    Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.

    1999-01-19

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.

  2. Rapid method to detect duplex formation in sequencing by hybridization methods

    DOE Patents [OSTI]

    Mirzabekov, Andrei Darievich (Moscow, RU); Timofeev, Edward Nikolaevich (Moscow, RU); Florentiev, Vladimer Leonidovich (Moscow, RU); Kirillov, Eugene Vladislavovich (Moscow, RU)

    1999-01-01

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

  3. Method and Pd/V2 O5 device for H2 detection

    DOE Patents [OSTI]

    Liu, Ping (San Diego, CA); Tracy, C. Edwin (Golden, CO); Pitts, J. Roland (Lakewood, CO); Smith, II, R. Davis (Golden, CO); Lee, Se-Hee (Lakewood, CO)

    2011-12-27

    Methods and Pd/V.sub.2O.sub.5 devices for hydrogen detection are disclosed. An exemplary method of preparing an improved sensor for chemochromic detection of hydrogen gas over a wide response range exhibits stability during repeated coloring/bleaching cycles upon exposure and removal of hydrogen gas. The method may include providing a substrate. The method may also include depositing a V.sub.20.sub.5 layer that functions as a H.sub.2 insertion host in a Pd/V.sub.20.sub.5 hydrogen sensor to be formed on said substrate. The method may also include depositing a Pd layer onto said V.sub.20.sub.5 layer; said Pd layer functioning as an optical modulator.

  4. An Assessment of Remote Visual Methods to Detect Cracking in Reactor Components

    SciTech Connect (OSTI)

    Cumblidge, Stephen E.; Anderson, Michael T.; Doctor, Steven R.; Simonen, Fredric A.; Elliot, Anthony J.

    2008-01-01

    Recently, the U.S. nuclear industry has proposed replacing current volumetric and/or surface examinations of certain components in commercial nuclear power plants, as required by the American Society of Mechanical Engineers Boiler and Pressure Vessel Code Section XI, “Inservice Inspection of Nuclear Power Plant Components,” with a simpler visual testing (VT) method. The advantages of VT are that these tests generally involve much less radiation exposure and time to perform the examination than do volumetric examinations such as ultrasonic testing. The issues relative to the reliability of VT in determining the structural integrity of reactor components were examined. Some piping and pressure vessel components in a nuclear power station are examined using VT as they are either in high radiation fields or component geometry precludes the use of ultrasonic testing (UT) methodology. Remote VT with radiation-hardened video systems has been used by nuclear utilities to find cracks in pressure vessel cladding in pressurized water reactors, core shrouds in boiling water reactors, and to investigate leaks in piping and reactor components. These visual tests are performed using a wide variety of procedures and equipment. The techniques for remote VT use submersible closed-circuit video cameras to examine reactor components and welds. PNNL conducted a parametric study that examined the important variables influencing the effectiveness of a remote visual test. Tested variables included lighting techniques, camera resolution, camera movement, and magnification. PNNL also conducted a limited laboratory test using a commercial visual testing camera system to experimentally determine the ability of the camera system to detect cracks of various widths under ideal conditions. The results of these studies and their implications are presented in this paper.

  5. detection

    National Nuclear Security Administration (NNSA)

    of 25 Million Grant to Improve Technological Capabilities for Detecting Nuclear Proliferation http:www.nnsa.energy.govmediaroompressreleasesncstateconsortium

  6. Method and apparatus for providing pulse pile-up correction in charge quantizing radiation detection systems

    DOE Patents [OSTI]

    Britton, Jr., Charles L. (Alcoa, TN); Wintenberg, Alan L. (Knoxville, TN)

    1993-01-01

    A radiation detection method and system for continuously correcting the quantization of detected charge during pulse pile-up conditions. Charge pulses from a radiation detector responsive to the energy of detected radiation events are converted to voltage pulses of predetermined shape whose peak amplitudes are proportional to the quantity of charge of each corresponding detected event by means of a charge-sensitive preamplifier. These peak amplitudes are sampled and stored sequentially in accordance with their respective times of occurrence. Based on the stored peak amplitudes and times of occurrence, a correction factor is generated which represents the fraction of a previous pulses influence on a preceding pulse peak amplitude. This correction factor is subtracted from the following pulse amplitude in a summing amplifier whose output then represents the corrected charge quantity measurement.

  7. Method for tracking the location of mobile agents using stand-off detection technique

    DOE Patents [OSTI]

    Schmitt, Randal L. (Tijeras, NM); Bender, Susan Fae Ann (Tijeras, NM); Rodacy, Philip J. (Albuquerque, NM); Hargis, Jr., Philip J. (Albuquerque, NM); Johnson, Mark S. (Albuquerque, NM)

    2006-12-26

    A method for tracking the movement and position of mobile agents using light detection and ranging (LIDAR) as a stand-off optical detection technique. The positions of the agents are tracked by analyzing the time-history of a series of optical measurements made over the field of view of the optical system. This provides a (time+3-D) or (time+2-D) mapping of the location of the mobile agents. Repeated pulses of a laser beam impinge on a mobile agent, such as a bee, and are backscattered from the agent into a LIDAR detection system. Alternatively, the incident laser pulses excite fluorescence or phosphorescence from the agent, which is detected using a LIDAR system. Analysis of the spatial location of signals from the agents produced by repeated pulses generates a multidimensional map of agent location.

  8. Method and apparatus for detecting external cracks from within a metal tube

    DOE Patents [OSTI]

    Caffey, Thurlow W. H. (Albuquerque, NM)

    2001-08-07

    A method and tool using a continuous electromagnetic wave from a transverse magnetic-dipole source with a coaxial electric-dipole receiver is described for the detection of external sidewall cracks and other anomalies in boiler tubes and other enclosures. The invention utilizes the concept of radar backscatter rather than eddy-currents or ultrasound, which are sometimes used in prior art crack-detection methods. A numerical study of the distribution of the fields shows that the direct transmission from the source to the receiver is reduced from that in free space. Further, if the diameter of the receiver dipole is made sufficiently small, it should be possible to detect cracks with a scattering loss of up to -40 dB in thin-walled boiler tubes.

  9. Apparatus and method for rapid separation and detection of hydrocarbon fractions in a fluid stream

    DOE Patents [OSTI]

    Sluder, Charles S.; Storey, John M.; Lewis, Sr., Samuel A.

    2013-01-22

    An apparatus and method for rapid fractionation of hydrocarbon phases in a sample fluid stream are disclosed. Examples of the disclosed apparatus and method include an assembly of elements in fluid communication with one another including one or more valves and at least one sorbent chamber for removing certain classifications of hydrocarbons and detecting the remaining fractions using a detector. The respective ratios of hydrocarbons are determined by comparison with a non separated fluid stream.

  10. Method and apparatus for detecting timing errors in a system oscillator

    DOE Patents [OSTI]

    Gliebe, Ronald J. (Library, PA); Kramer, William R. (Bethel Park, PA)

    1993-01-01

    A method of detecting timing errors in a system oscillator for an electronic device, such as a power supply, includes the step of comparing a system oscillator signal with a delayed generated signal and generating a signal representative of the timing error when the system oscillator signal is not identical to the delayed signal. An LED indicates to an operator that a timing error has occurred. A hardware circuit implements the above-identified method.

  11. Sample-morphology effects on x-ray photoelectron peak intensities. II. Estimation of detection limits for thin-film materials

    SciTech Connect (OSTI)

    Powell, Cedric J.; Werner, Wolfgang S. M.; Smekal, Werner

    2014-09-01

    The authors show that the National Institute of Standards and Technology database for the simulation of electron spectra for surface analysis (SESSA) can be used to determine detection limits for thin-film materials such as a thin film on a substrate or buried at varying depths in another material for common x-ray photoelectron spectroscopy (XPS) measurement conditions. Illustrative simulations were made for a W film on or in a Ru matrix and for a Ru film on or in a W matrix. In the former case, the thickness of a W film at a given depth in the Ru matrix was varied so that the intensity of the W 4d{sub 5/2} peak was essentially the same as that for a homogeneous RuW{sub 0.001} alloy. Similarly, the thickness of a Ru film at a selected depth in the W matrix was varied so that the intensity of the Ru 3p{sub 3/2} peak matched that from a homogeneous WRu{sub 0.01} alloy. These film thicknesses correspond to the detection limits of each minor component for measurement conditions where the detection limits for a homogeneous sample varied between 0.1 at.?% (for the RuW{sub 0.001} alloy) and 1 at.?% (for the WRu{sub 0.01} alloy). SESSA can be similarly used to convert estimates of XPS detection limits for a minor species in a homogeneous solid to the corresponding XPS detection limits for that species as a thin film on or buried in the chosen solid.

  12. Including shielding effects in application of the TPCA method for detection of embedded radiation sources.

    SciTech Connect (OSTI)

    Johnson, William C.; Shokair, Isaac R.

    2011-12-01

    Conventional full spectrum gamma spectroscopic analysis has the objective of quantitative identification of all the radionuclides present in a measurement. For low-energy resolution detectors such as NaI, when photopeaks alone are not sufficient for complete isotopic identification, such analysis requires template spectra for all the radionuclides present in the measurement. When many radionuclides are present it is difficult to make the correct identification and this process often requires many attempts to obtain a statistically valid solution by highly skilled spectroscopists. A previous report investigated using the targeted principal component analysis method (TPCA) for detection of embedded sources for RPM applications. This method uses spatial/temporal information from multiple spectral measurements to test the hypothesis of the presence of a target spectrum of interest in these measurements without the need to identify all the other radionuclides present. The previous analysis showed that the TPCA method has significant potential for automated detection of target radionuclides of interest, but did not include the effects of shielding. This report complements the previous analysis by including the effects of spectral distortion due to shielding effects for the same problem of detection of embedded sources. Two examples, one with one target radionuclide and the other with two, show that the TPCA method can successfully detect shielded targets in the presence of many other radionuclides. The shielding parameters are determined as part of the optimization process using interpolation of library spectra that are defined on a 2D grid of atomic numbers and areal densities.

  13. Method and apparatus for extraction of low-frequency artifacts from brain waves for alertness detection

    DOE Patents [OSTI]

    Clapp, N.E.; Hively, L.M.

    1997-05-06

    Methods and apparatus automatically detect alertness in humans by monitoring and analyzing brain wave signals. Steps include: acquiring the brain wave (EEG or MEG) data from the subject, digitizing the data, separating artifact data from raw data, and comparing trends in f-data to alertness indicators, providing notification of inadequate alertness. 4 figs.

  14. Method and apparatus for extraction of low-frequency artifacts from brain waves for alertness detection

    DOE Patents [OSTI]

    Clapp, Ned E.; Hively, Lee M.

    1997-01-01

    Methods and apparatus automatically detect alertness in humans by monitoring and analyzing brain wave signals. Steps include: acquiring the brain wave (EEG or MEG) data from the subject, digitizing the data, separating artifact data from raw data, and comparing trends in f-data to alertness indicators, providing notification of inadequate alertness.

  15. Control method for peak power delivery with limited DC-bus voltage

    DOE Patents [OSTI]

    Edwards, John; Xu, Longya; Bhargava, Brij B.

    2006-09-05

    A method for driving a neutral point-clamped multi-level voltage source inverter supplying a synchronous motor is provided. A DC current is received at a neutral point-clamped multi-level voltage source inverter. The inverter has first, second, and third output nodes. The inverter also has a plurality of switches. A desired speed of a synchronous motor connected to the inverter by the first second and third nodes is received by the inverter. The synchronous motor has a rotor and the speed of the motor is defined by the rotational rate of the rotor. A position of the rotor is sensed, current flowing to the motor out of at least two of the first, second, and third output nodes is sensed, and predetermined switches are automatically activated by the inverter responsive to the sensed rotor position, the sensed current, and the desired speed.

  16. detection

    National Nuclear Security Administration (NNSA)

    of 25 Million Grant to Improve Technological Capabilities for Detecting Nuclear Proliferation http:nnsa.energy.govmediaroompressreleasesncstateconsortium

  17. Rapid method to detect duplex formation in sequencing by hybridization methods, a method for constructing containment structures for reagent interaction

    DOE Patents [OSTI]

    Mirzabekov, Andrei Darievich (Moscow, RU); Yershov, Gennadiy Moiseyevich (Zelenograd, RU); Guschin, Dmitry Yuryevich (Hinsale, IL); Gemmell, Margaret Anne (Western Springs, IL); Shick, Valentine V. (Moscow, RU); Proudnikov, Dmitri Y. (Samara, RU); Timofeev, Edward N. (Moscow, RU)

    2002-01-01

    A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to polymerize into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

  18. In-situ fault detection apparatus and method for an encased energy storing device

    DOE Patents [OSTI]

    Hagen, Ronald A.; Comte, Christophe; Knudson, Orlin B.; Rosenthal, Brian; Rouillard, Jean

    2000-01-01

    An apparatus and method for detecting a breach in an electrically insulating surface of an electrically conductive power system enclosure within which a number of series connected energy storing devices are disposed. The energy storing devices disposed in the enclosure are connected to a series power connection. A detector is coupled to the series connection and detects a change of state in a test signal derived from the series connected energy storing devices. The detector detects a breach in the insulating layer of the enclosure by detecting a state change in the test signal from a nominal state to a non-nominal state. A voltage detector detects a state change of the test signals from a nominal state, represented by a voltage of a selected end energy storing device, to a non-nominal state, represented by a voltage that substantially exceeds the voltage of the selected opposing end energy storing device. Alternatively, the detector may comprise a signal generator that produces the test signal as a time-varying or modulated test signal and injects the test signal into the series connection. The detector detects the state change of the time-varying or modulated test signal from a nominal state, represented by a signal substantially equivalent to the test signal, to a non-nominal state, representative by an absence of the test signal.

  19. Optical methods and systems for detecting a constituent in a gas containing oxygen in harsh environments

    DOE Patents [OSTI]

    Carpenter, Michael A. (Scotia, NY); Sirinakis, George (Bronx, NY)

    2011-01-04

    A method for detecting a gas phase constituent such as carbon monoxide, nitrogen dioxide, hydrogen, or hydrocarbons in a gas comprising oxygen such as air, includes providing a sensing material or film having a metal embedded in a catalytically active matrix such as gold embedded in a yttria stabilized zirconia (YSZ) matrix. The method may include annealing the sensing material at about 900.degree. C., exposing the sensing material and gas to a temperature above 400.degree. C., projecting light onto the sensing material, and detecting a change in the absorption spectrum of the sensing material due to the exposure of the sensing material to the gas in air at the temperature which causes a chemical reaction in the sensing material compared to the absorption spectrum of the sensing material in the absence of the gas. Systems employing such a method are also disclosed.

  20. Apparatus and methods for real-time detection of explosives devices

    DOE Patents [OSTI]

    Blackburn, Brandon W [Idaho Falls, ID; Hunt, Alan W [Pocatello, ID; Chichester, David L [Idaho Falls, ID

    2014-01-07

    The present disclosure relates, according to some embodiments, to apparatus, devices, systems, and/or methods for real-time detection of a concealed or camouflaged explosive device (e.g., EFPs and IEDs) from a safe stand-off distance. Apparatus, system and/or methods of the disclosure may also be operable to identify and/or spatially locate and/or detect an explosive device. An apparatus or system may comprise an x-ray generator that generates high-energy x-rays and/or electrons operable to contact and activate a metal comprised in an explosive device from a stand-off distance; and a detector operable to detect activation of the metal. Identifying an explosive device may comprise detecting characteristic radiation signatures emitted by metals specific to an EFP, an IED or a landmine. Apparatus and systems of the disclosure may be mounted on vehicles and methods of the disclosure may be performed while moving in the vehicle and from a safe stand-off distance.

  1. Methods, media, and systems for detecting attack on a digital processing device

    DOE Patents [OSTI]

    Stolfo, Salvatore J.; Li, Wei-Jen; Keromylis, Angelos D.; Androulaki, Elli

    2014-07-22

    Methods, media, and systems for detecting attack are provided. In some embodiments, the methods include: comparing at least part of a document to a static detection model; determining whether attacking code is included in the document based on the comparison of the document to the static detection model; executing at least part of the document; determining whether attacking code is included in the document based on the execution of the at least part of the document; and if attacking code is determined to be included in the document based on at least one of the comparison of the document to the static detection model and the execution of the at least part of the document, reporting the presence of an attack. In some embodiments, the methods include: selecting a data segment in at least one portion of an electronic document; determining whether the arbitrarily selected data segment can be altered without causing the electronic document to result in an error when processed by a corresponding program; in response to determining that the arbitrarily selected data segment can be altered, arbitrarily altering the data segment in the at least one portion of the electronic document to produce an altered electronic document; and determining whether the corresponding program produces an error state when the altered electronic document is processed by the corresponding program.

  2. Apparatus and method for rapid detection of explosives residue from the deflagration signature thereof

    DOE Patents [OSTI]

    Funsten, H.O.; McComas, D.J.

    1999-06-15

    Apparatus and method are disclosed for rapid detection of explosives residue from the deflagration signature thereof. A property inherent to most explosives is their stickiness, resulting in a strong tendency of explosive particulate to contaminate the environment of a bulk explosive. An apparatus for collection of residue particulate, burning the collected particulate, and measurement of the ultraviolet emission produced thereby, is described. The present invention can be utilized for real-time screening of personnel, cars, packages, suspected devices, etc., and provides an inexpensive, portable, and noninvasive means for detecting explosives. 4 figs.

  3. Radiation detection method and system using the sequential probability ratio test

    DOE Patents [OSTI]

    Nelson, Karl E.; Valentine, John D.; Beauchamp, Brock R.

    2007-07-17

    A method and system using the Sequential Probability Ratio Test to enhance the detection of an elevated level of radiation, by determining whether a set of observations are consistent with a specified model within a given bounds of statistical significance. In particular, the SPRT is used in the present invention to maximize the range of detection, by providing processing mechanisms for estimating the dynamic background radiation, adjusting the models to reflect the amount of background knowledge at the current point in time, analyzing the current sample using the models to determine statistical significance, and determining when the sample has returned to the expected background conditions.

  4. Method for detecting binding events using micro-X-ray fluorescence spectrometry

    DOE Patents [OSTI]

    Warner, Benjamin P. (Los Alamos, NM); Havrilla, George J. (Los Alamos, NM); Mann, Grace (Hong Kong, HK)

    2010-12-28

    Method for detecting binding events using micro-X-ray fluorescence spectrometry. Receptors are exposed to at least one potential binder and arrayed on a substrate support. Each member of the array is exposed to X-ray radiation. The magnitude of a detectable X-ray fluorescence signal for at least one element can be used to determine whether a binding event between a binder and a receptor has occurred, and can provide information related to the extent of binding between the binder and receptor.

  5. Apparatus and method for rapid detection of explosives residue from the deflagration signature thereof

    DOE Patents [OSTI]

    Funsten, Herbert O. (Los Alamos, NM); McComas, David J. (Los Alamos, NM)

    1999-01-01

    Apparatus and method for rapid detection of explosives residue from the deflagration signature thereof. A property inherent to most explosives is their stickiness, resulting in a strong tendency of explosive particulate to contaminate the environment of a bulk explosive. An apparatus for collection of residue particulate, burning the collected particulate, and measurement of the ultraviolet emission produced thereby, is described. The present invention can be utilized for real-time screening of personnel, cars, packages, suspected devices, etc., and provides an inexpensive, portable, and noninvasive means for detecting explosives.

  6. Apparatus and method for rapid detection of explosives residue from the deflagration signature thereof

    DOE Patents [OSTI]

    Funsten, Herbert O. (Los Alamos, NM); McComas, David J. (Los Alamos, NM)

    1997-01-01

    Apparatus and method for rapid detection of explosives residue from the deflagration signature thereof. A property inherent to most explosives is their stickiness, resulting in a strong tendency of explosive particulate to contaminate the environment of a bulk explosive. An apparatus for collection of residue particulate, burning the collected particulate, and measurement of the optical emission produced thereby is described. The present invention can be utilized for real-time screening of personnel, cars, packages, suspected devices, etc., and provides an inexpensive, portable, and noninvasive means for detecting explosives.

  7. Materials, methods and devices to detect and quantify water vapor concentrations in an atmosphere

    DOE Patents [OSTI]

    Allendorf, Mark D; Robinson, Alex L

    2014-12-09

    We have demonstrated that a surface acoustic wave (SAW) sensor coated with a nanoporous framework material (NFM) film can perform ultrasensitive water vapor detection at concentrations in air from 0.05 to 12,000 ppmv at 1 atmosphere pressure. The method is extendable to other MEMS-based sensors, such as microcantilevers, or to quartz crystal microbalance sensors. We identify a specific NFM that provides high sensitivity and selectivity to water vapor. However, our approach is generalizable to detection of other species using NFM to provide sensitivity and selectivity.

  8. Method for the detection of specific nucleic acid sequences by polymerase nucleotide incorporation

    DOE Patents [OSTI]

    Castro, Alonso

    2004-06-01

    A method for rapid and efficient detection of a target DNA or RNA sequence is provided. A primer having a 3'-hydroxyl group at one end and having a sequence of nucleotides sufficiently homologous with an identifying sequence of nucleotides in the target DNA is selected. The primer is hybridized to the identifying sequence of nucleotides on the DNA or RNA sequence and a reporter molecule is synthesized on the target sequence by progressively binding complementary nucleotides to the primer, where the complementary nucleotides include nucleotides labeled with a fluorophore. Fluorescence emitted by fluorophores on single reporter molecules is detected to identify the target DNA or RNA sequence.

  9. Phase-based x-ray scatteringA possible method to detect cancer cells in a very early stage

    SciTech Connect (OSTI)

    Feye-Treimer, U. Treimer, W.

    2014-05-15

    Purpose: This theoretical work contains a detailed investigation of the potential and sensitivity of phase-based x-ray scattering for cancer detection in biopsies if cancer is in a very early stage of development. Methods: Cancer cells in their early stage of development differ from healthy ones mainly due to their faster growing cell nuclei and the enlargement of their densities. This growth is accompanied by an altered nucleusplasma relation for the benefit of the cell nuclei, that changes the physical properties especially the index of refraction of the cell and the one of the cell nuclei. Interaction of radiation with matter is known to be highly sensitive to small changes of the index of refraction of matter; therefore a detection of such changes of volume and density of cell nuclei by means of high angular resolved phase-based scattering of x rays might provide a technique to distinguish malignant cells from healthy ones ifthe cellcell nucleus system is considered as a coherent phase shifting object. Then one can observe from a thin biopsy which represents a monolayer of cells (no multiple scattering) that phase-based x-ray scattering curves from healthy cells differ from those of cancer cells in their early stage of development. Results: Detailed calculations of x-ray scattering patterns from healthy and cancer cell nuclei yield graphs and numbers with which one can distinguish healthy cells from cancer ones, taking into account that both kinds of cells occur in a tissue within a range of size and density. One important result is the role and the influence of the (lateral) coherence width of the radiation on the scattering curves and the sensitivity of phase-based scattering for cancer detection. A major result is that a larger coherence width yields a larger sensitivity for cancer detection. Further import results are calculated limits for critical sizes and densities of cell nuclei in order to attribute the investigated tissue to be healthy or diseased. Conclusions: With this proposed method it should be in principle possible to detect cancer cells in apparently healthy tissues in biopsies and/or in samples of the far border region of abscised or excised tissues. Thus this method could support established methods in diagnostics of cancer-suspicious samples.

  10. Method for the detection of nitro-containing compositions using ultraviolet photolysis

    DOE Patents [OSTI]

    Reagen, William K. (Stillwater, MN); Lancaster, Gregory D. (Idaho Falls, ID); Partin, Judy K. (Idaho Falls, ID); Moore, Glenn A. (Idaho Falls, ID)

    2000-01-01

    A method for detecting nitro-containing compositions (e.g. nitrate/nitrite materials) in water samples and on solid substrates. In a water sample, ultraviolet light is applied to the sample so that dissolved nitro compositions therein will photolytically dissociate into gaseous nitrogen oxides (NO.sub.2(g) and/or NO.sub.(g)). A carrier gas is then introduced into the sample to generate a gaseous stream which includes the carrier gas combined with any gaseous nitrogen oxides. The carrier gas is thereafter directed into a detector. To detect nitro-compositions on solid substrates, ultraviolet light is applied thereto. A detector is then used to detect any gaseous nitrogen oxides which are photolytically generated during ultraviolet illumination. An optional carrier gas may be applied to the substrate during illumination to produce a gaseous stream which includes the carrier gas and any gaseous nitrogen oxides. The gaseous stream is then supplied to the detector.

  11. Method and apparatus for automatically detecting patterns in digital point-ordered signals

    DOE Patents [OSTI]

    Brudnoy, D.M.

    1998-10-20

    The present invention is a method and system for detecting a physical feature of a test piece by detecting a pattern in a signal representing data from inspection of the test piece. The pattern is detected by automated additive decomposition of a digital point-ordered signal which represents the data. The present invention can properly handle a non-periodic signal. A physical parameter of the test piece is measured. A digital point-ordered signal representative of the measured physical parameter is generated. The digital point-ordered signal is decomposed into a baseline signal, a background noise signal, and a peaks/troughs signal. The peaks/troughs from the peaks/troughs signal are located and peaks/troughs information indicating the physical feature of the test piece is output. 14 figs.

  12. Method and apparatus for detecting irregularities on or in the wall of a vessel

    DOE Patents [OSTI]

    Bowling, Michael Keith (Blackborough Cullompton, GB)

    2000-09-12

    A method of detecting irregularities on or in the wall of a vessel by detecting localized spatial temperature differentials on the wall surface, comprising scanning the vessel surface with a thermal imaging camera and recording the position of the or each region for which the thermal image from the camera is indicative of such a temperature differential across the region. The spatial temperature differential may be formed by bacterial growth on the vessel surface; alternatively, it may be the result of defects in the vessel wall such as thin regions or pin holes or cracks. The detection of leaks through the vessel wall may be enhanced by applying a pressure differential or a temperature differential across the vessel wall; the testing for leaks may be performed with the vessel full or empty, and from the inside or the outside.

  13. Method Apparatus And System For Detecting Seismic Waves In A Borehole

    DOE Patents [OSTI]

    West, Phillip B. (Idaho Falls, ID); Sumstine, Roger L. (St. George, UT)

    2006-03-14

    A method, apparatus and system for detecting seismic waves. A sensing apparatus is deployed within a bore hole and may include a source magnet for inducing a magnetic field within a casing of the borehole. An electrical coil is disposed within the magnetic field to sense a change in the magnetic field due to a displacement of the casing. The electrical coil is configured to remain substantially stationary relative to the well bore and its casing along a specified axis such that displacement of the casing induces a change within the magnetic field which may then be sensed by the electrical coil. Additional electrical coils may be similarly utilized to detect changes in the same or other associated magnetic fields along other specified axes. The additional sensor coils may be oriented substantially orthogonally relative to one another so as to detect seismic waves along multiple orthogonal axes in three dimensional space.

  14. Method and apparatus for automatically detecting patterns in digital point-ordered signals

    DOE Patents [OSTI]

    Brudnoy, David M. (Albany, NY)

    1998-01-01

    The present invention is a method and system for detecting a physical feature of a test piece by detecting a pattern in a signal representing data from inspection of the test piece. The pattern is detected by automated additive decomposition of a digital point-ordered signal which represents the data. The present invention can properly handle a non-periodic signal. A physical parameter of the test piece is measured. A digital point-ordered signal representative of the measured physical parameter is generated. The digital point-ordered signal is decomposed into a baseline signal, a background noise signal, and a peaks/troughs signal. The peaks/troughs from the peaks/troughs signal are located and peaks/troughs information indicating the physical feature of the test piece is output.

  15. Radiation sensitive devices and systems for detection of radioactive materials and related methods

    DOE Patents [OSTI]

    Kotter, Dale K

    2014-12-02

    Radiation sensitive devices include a substrate comprising a radiation sensitive material and a plurality of resonance elements coupled to the substrate. Each resonance element is configured to resonate responsive to non-ionizing incident radiation. Systems for detecting radiation from a special nuclear material include a radiation sensitive device and a sensor located remotely from the radiation sensitive device and configured to measure an output signal from the radiation sensitive device. In such systems, the radiation sensitive device includes a radiation sensitive material and a plurality of resonance elements positioned on the radiation sensitive material. Methods for detecting a presence of a special nuclear material include positioning a radiation sensitive device in a location where special nuclear materials are to be detected and remotely interrogating the radiation sensitive device with a sensor.

  16. Systems and methods for detecting nuclear radiation in the presence of backgrounds

    DOE Patents [OSTI]

    Bross, Alan D.; Mellott, Kerry L.; Pla-Dalmau, Anna

    2005-06-21

    Systems and methods for the simultaneous detection and identification of radiation species, including neutrons, gammas/x-rays and minimum ionizing particles (MIPs). A plurality of rectangular and/or triangularly shaped radiation sensitive scintillators can be configured from a plurality of nano-sized particles, dopants and an extruded plastic material. A wavelength-shifting fiber can then be located within a central hole of each extruded scintillator, wherein the wavelength-shifting fiber absorbs scintillation light and re-emits the light at a longer wavelength, thereby piping the light to a photodetector whose response to the light indicates the presence of radiation The resulting method and system can simultaneously detect neutrons, gamma rays, x-rays and cosmic rays (MIPs) and identify each.

  17. Apparatus and method for detecting electromagnetic radiation using electron photoemission in a micromechanical sensor

    DOE Patents [OSTI]

    Datskos, Panagiotis G. (Knoxville, TN); Rajic, Slobodan (Knoxville, TN); Datskou, Irene C. (Knoxville, TN); Egert, Charles M. (Oak Ridge, TN)

    2002-01-01

    A micromechanical sensor and method for detecting electromagnetic radiation involve producing photoelectrons from a metal surface in contact with a semiconductor. The photoelectrons are extracted into the semiconductor, which causes photo-induced bending. The resulting bending is measured, and a signal corresponding to the measured bending is generated and processed. A plurality of individual micromechanical sensors can be arranged in a two-dimensional matrix for imaging applications.

  18. System and method for detecting a faulty object in a system

    DOE Patents [OSTI]

    Gunnels, John A. (Brewster, NY); Gustavson, Fred Gehrung (Briarcliff Manor, NY); Engle, Robert Daniel (St. Louis, MO)

    2010-12-14

    A method (and system) for detecting at least one faulty object in a system including a plurality of objects in communication with each other in an n-dimensional architecture, includes probing a first plane of objects in the n-dimensional architecture and probing at least one other plane of objects in the n-dimensional architecture which would result in identifying a faulty object in the system.

  19. System and method for detecting a faulty object in a system

    DOE Patents [OSTI]

    Gunnels, John A. (Brewster, NY); Gustavson, Fred Gehrung (Briarcliff Manor, NY); Engle, Robert Daniel (St. Louis, MO)

    2009-03-17

    A method (and system) for detecting at least one faulty object in a system including a plurality of objects in communication with each other in an n-dimensional architecture, includes probing a first plane of objects in the n-dimensional architecture and probing at least one other plane of objects in the n-dimensional architecture which would result in identifying a faulty object in the system.

  20. Mass spectrometry-based methods for detection and differentiation of botulinum neurotoxins

    DOE Patents [OSTI]

    Schmidt, Jurgen G. (Los Alamos, NM); Boyer, Anne E. (Atlanta, GA); Kalb, Suzanne R. (Atlanta, GA); Moura, Hercules (Tucker, GA); Barr, John R. (Suwannee, GA); Woolfitt, Adrian R. (Atlanta, GA)

    2009-11-03

    The present invention is directed to a method for detecting the presence of clostridial neurotoxins in a sample by mixing a sample with a peptide that can serve as a substrate for proteolytic activity of a clostridial neurotoxin; and measuring for proteolytic activity of a clostridial neurotoxin by a mass spectroscopy technique. In one embodiment, the peptide can have an affinity tag attached at two or more sites.

  1. Method and apparatus for the detection of neutrons and gamma rays

    DOE Patents [OSTI]

    Reber, Edward L.; Aryaeinejad, Rahmat; Spencer, David F.

    2005-10-11

    A pulse discrimination method for discriminating between pulses having a short decay period and a long decay period, may comprise: Detecting the pulse; integrating a rise portion of the pulse; integrating a decay portion of the pulse; and comparing the integrated rise portion of the pulse with the integrated decay portion of the pulse to distinguish between a pulse having a long decay period and a pulse having a short decay period.

  2. Method and apparatus for operating a powertrain system upon detecting a stuck-closed clutch

    DOE Patents [OSTI]

    Hansen, R. Anthony

    2014-02-18

    A powertrain system includes a multi-mode transmission having a plurality of torque machines. A method for controlling the powertrain system includes identifying all presently applied clutches including commanded applied clutches and the stuck-closed clutch upon detecting one of the torque-transfer clutches is in a stuck-closed condition. A closed-loop control system is employed to control operation of the multi-mode transmission accounting for all the presently applied clutches.

  3. Apparatus and method for epileptic seizure detection using non-linear techniques

    DOE Patents [OSTI]

    Hively, L.M.; Clapp, N.E.; Daw, C.S.; Lawkins, W.F.

    1998-04-28

    Methods and apparatus are disclosed for automatically detecting epileptic seizures by monitoring and analyzing brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis; obtaining time serial trends in the nonlinear measures; determining that one or more trends in the nonlinear measures indicate a seizure, and providing notification of seizure occurrence. 76 figs.

  4. Apparatus and method for epileptic seizure detection using non-linear techniques

    DOE Patents [OSTI]

    Hively, Lee M.; Clapp, Ned E.; Daw, C. Stuart; Lawkins, William F.

    1998-01-01

    Methods and apparatus for automatically detecting epileptic seizures by monitoring and analyzing brain wave (EEG or MEG) signals. Steps include: acquiring the brain wave data from the patient; digitizing the data; obtaining nonlinear measures of the data via chaotic time series analysis; obtaining time serial trends in the nonlinear measures; determining that one or more trends in the nonlinear measures indicate a seizure, and providing notification of seizure occurrence.

  5. Electrically conductive proppant and methods for detecting, locating and characterizing the electrically conductive proppant

    DOE Patents [OSTI]

    Cannan, Chad; Bartel, Lewis; Palisch, Terrence; Aldridge, David

    2015-01-13

    Electrically conductive proppants and methods for detecting, locating, and characterizing same are provided. The electrically conductive proppant can include a substantially uniform coating of an electrically conductive material having a thickness of at least 500 nm. The method can include injecting a hydraulic fluid into a wellbore extending into a subterranean formation at a rate and pressure sufficient to open a fracture therein, injecting into the fracture a fluid containing the electrically conductive proppant, electrically energizing the earth at or near the fracture, and measuring three dimensional (x, y, and z) components of electric and magnetic field responses at a surface of the earth or in an adjacent wellbore.

  6. Method of detecting leakage from geologic formations used to sequester CO.sub.2

    DOE Patents [OSTI]

    White, Curt; Wells, Arthur; Diehl, J. Rodney; Strazisar, Brian

    2010-04-27

    The invention provides methods for the measurement of carbon dioxide leakage from sequestration reservoirs. Tracer moieties are injected along with carbon dioxide into geological formations. Leakage is monitored by gas chromatographic analyses of absorbents. The invention also provides a process for the early leak detection of possible carbon dioxide leakage from sequestration reservoirs by measuring methane (CH.sub.4), ethane (C.sub.2H.sub.6), propane (C.sub.3H.sub.8), and/or radon (Rn) leakage rates from the reservoirs. The invention further provides a method for branding sequestered carbon dioxide using perfluorcarbon tracers (PFTs) to show ownership.

  7. Oxazine-based sensor for contaminant detection, fabrication method therefor, and uses thereof

    DOE Patents [OSTI]

    Nnanna, Agbai Agwu; Jalal, Ahmed Hasnian

    2014-05-27

    A sensor, a method for its fabrication, and a method for its use to detect contaminants, for example, ammonia, in stagnant and dynamic fluid media, especially liquid media. The sensor is an opto-chemical sensor that includes a polymer optical fiber, a sensing layer comprising oxazine 170 perchlorate on the polymer optical fiber, and a membrane layer on the sensing layer. The membrane layer is gas permeable and not permeable to the fluid in the fluid system, and moisture is entrapped by and between the sensing and membrane layers.

  8. A clinically feasible method for the detection of potential collision in proton therapy

    SciTech Connect (OSTI)

    Zou Wei; Lin Haibo; Plastaras, John P.; Wang Huanshu; Bui, Viet; Vapiwala, Neha; McDonough, James; Tochner, Zelig; Both, Stefan

    2012-11-15

    Purpose: Potential collision between the patient/couch and the gantry could delay the start of the treatment and reduce clinical efficiency. The ability to accurately detect possible collisions during the treatment planning phase is desired. Such collision detection should account for the specific proton gantry design, the treatment beam configuration, couch orientation, and the patient specific geometry. In this paper the authors developed an approach to detect possible patient-machine collisions using patient treatment plan data. Methods: The geometry of the machine and the patient was reconstructed relative to the isocenter of the proton treatment room. The surface contour of the gantry was first captured from the proton computer aided design and reconstructed to account for specific gantry rotation, snout position, collimator rotation, and range compensator dimensions based on the patient treatment plan data. The patient body and couch contours were captured from the patient's CT DICOM structure file. They were reconstructed relative to the isocenter taking into account treatment couch rotation. For potential collision that occurs at body portions where no CT images exist, scout images are used to construct the body contour. A software program was developed using a ray casting algorithm that was applied to detect collisions by determining if any of the patient and couch contour points fall into the spatial polygons formed by the proton gantry surfaces. Results: Twenty-four patient plans with or without potential collisions were retrospectively identified and analyzed using the collision detection software. In addition, five collision cases were artificially generated using an anthropomorphic phantom. The program successfully detected the collisions in all cases. The calculation time for each case was within 20 s. The software program was implemented in the authors' clinic to detect patient-gantry or gantry-couch collisions in the treatment planning phase. Conclusions: The authors developed a fast and clinically feasible patient-specific collision detection program for proton therapy based on a ray casting algorithm. If incorporated during the treatment planning phase it may lead to improved clinical efficiency. This methodology could also be applied to patient collision detection in photon therapy.

  9. Laser-ultrasound spectroscopy apparatus and method with detection of shear resonances for measuring anisotropy, thickness, and other properties

    DOE Patents [OSTI]

    Levesque, Daniel (Terrebonne, CA); Moreau, Andre (St-Bruno-de-Montarville, CA); Dubois, Marc (Montreal, CA); Monchalin, Jean-Pierre (Montreal, CA); Bussiere, Jean (St-Bruno, CA); Lord, Martin (Beloeil, CA); Padioleau, Christian (Montreal, CA)

    2000-01-01

    Apparatus and method for detecting shear resonances includes structure and steps for applying a radiation pulse from a pulsed source of radiation to an object to generate elastic waves therein, optically detecting the elastic waves generated in the object, and analyzing the elastic waves optically detected in the object. These shear resonances, alone or in combination with other information, may be used in the present invention to improve thickness measurement accuracy and to determine geometrical, microstructural, and physical properties of the object. At least one shear resonance in the object is detected with the elastic waves optically detected in the object. Preferably, laser-ultrasound spectroscopy is utilized to detect the shear resonances.

  10. Methods and systems for low frequency seismic and infrasound detection of geo-pressure transition zones

    DOE Patents [OSTI]

    Shook, G. Michael; LeRoy, Samuel D.; Benzing, William M.

    2006-07-18

    Methods for determining the existence and characteristics of a gradational pressurized zone within a subterranean formation are disclosed. One embodiment involves employing an attenuation relationship between a seismic response signal and increasing wavelet wavelength, which relationship may be used to detect a gradational pressurized zone and/or determine characteristics thereof. In another embodiment, a method for analyzing data contained within a response signal for signal characteristics that may change in relation to the distance between an input signal source and the gradational pressurized zone is disclosed. In a further embodiment, the relationship between response signal wavelet frequency and comparative amplitude may be used to estimate an optimal wavelet wavelength or range of wavelengths used for data processing or input signal selection. Systems for seismic exploration and data analysis for practicing the above-mentioned method embodiments are also disclosed.

  11. System and method for bearing fault detection using stator current noise cancellation

    DOE Patents [OSTI]

    Zhou, Wei (Los Angeles, CA); Lu, Bin (Kenosha, WI); Habetler, Thomas G. (Snellville, GA); Harley, Ronald G. (Lawrenceville, GA); Theisen, Peter J. (West Bend, WI)

    2010-08-17

    A system and method for detecting incipient mechanical motor faults by way of current noise cancellation is disclosed. The system includes a controller configured to detect indicia of incipient mechanical motor faults. The controller further includes a processor programmed to receive a baseline set of current data from an operating motor and define a noise component in the baseline set of current data. The processor is also programmed to repeatedly receive real-time operating current data from the operating motor and remove the noise component from the operating current data in real-time to isolate any fault components present in the operating current data. The processor is then programmed to generate a fault index for the operating current data based on any isolated fault components.

  12. GraphPrints: Towards a Graph Analytic Method for Network Anomaly Detection

    SciTech Connect (OSTI)

    Harshaw, Chris R; Bridges, Robert A; Iannacone, Michael D; Reed, Joel W; Goodall, John R

    2016-01-01

    This paper introduces a novel graph-analytic approach for detecting anomalies in network flow data called \\textit{GraphPrints}. Building on foundational network-mining techniques, our method represents time slices of traffic as a graph, then counts graphlets\\textemdash small induced subgraphs that describe local topology. By performing outlier detection on the sequence of graphlet counts, anomalous intervals of traffic are identified, and furthermore, individual IPs experiencing abnormal behavior are singled-out. Initial testing of GraphPrints is performed on real network data with an implanted anomaly. Evaluation shows false positive rates bounded by 2.84\\% at the time-interval level, and 0.05\\% at the IP-level with 100\\% true positive rates at both.

  13. System and method for motor fault detection using stator current noise cancellation

    DOE Patents [OSTI]

    Zhou, Wei (Los Angeles, CA); Lu, Bin (Kenosha, WI); Nowak, Michael P. (Menomonee Falls, WI); Dimino, Steven A. (Wauwatosa, WI)

    2010-12-07

    A system and method for detecting incipient mechanical motor faults by way of current noise cancellation is disclosed. The system includes a controller configured to detect indicia of incipient mechanical motor faults. The controller further includes a processor programmed to receive a baseline set of current data from an operating motor and define a noise component in the baseline set of current data. The processor is also programmed to acquire at least on additional set of real-time operating current data from the motor during operation, redefine the noise component present in each additional set of real-time operating current data, and remove the noise component from the operating current data in real-time to isolate any fault components present in the operating current data. The processor is then programmed to generate a fault index for the operating current data based on any isolated fault components.

  14. Methods for radiation detection and characterization using a multiple detector probe

    DOE Patents [OSTI]

    Akers, Douglas William; Roybal, Lyle Gene

    2014-11-04

    Apparatuses, methods, and systems relating to radiological characterization of environments are disclosed. Multi-detector probes with a plurality of detectors in a common housing may be used to substantially concurrently detect a plurality of different radiation activities and types. Multiple multi-detector probes may be used in a down-hole environment to substantially concurrently detect radioactive activity and contents of a buried waste container. Software may process, analyze, and integrate the data from the different multi-detector probes and the different detector types therein to provide source location and integrated analysis as to the source types and activity in the measured environment. Further, the integrated data may be used to compensate for differential density effects and the effects of radiation shielding materials within the volume being measured.

  15. Methods and apparatus for use in detecting seismic waves in a borehole

    DOE Patents [OSTI]

    West, Phillip B.; Fincke, James R.; Reed, Teddy R.

    2006-05-23

    The invention provides methods and apparatus for detecting seismic waves propagating through a subterranean formation surrounding a borehole. In a first embodiment, a sensor module uses the rotation of bogey wheels to extend and retract a sensor package for selective contact and magnetic coupling to casing lining the borehole. In a second embodiment, a sensor module is magnetically coupled to the casing wall during its travel and dragged therealong while maintaining contact therewith. In a third embodiment, a sensor module is interfaced with the borehole environment to detect seismic waves using coupling through liquid in the borehole. Two or more of the above embodiments may be combined within a single sensor array to provide a resulting seismic survey combining the optimum of the outputs of each embodiment into a single data set.

  16. Method and apparatus for clockless analog-to-digital conversion and peak detection

    DOE Patents [OSTI]

    DeGeronimo, Gianluigi

    2007-03-06

    An apparatus and method for analog-to-digital conversion and peak detection includes at least one stage, which includes a first switch, second switch, current source or capacitor, and discriminator. The discriminator changes state in response to a current or charge associated with the input signal exceeding a threshold, thereby indicating whether the current or charge associated with the input signal is greater than the threshold. The input signal includes a peak or a charge, and the converter includes a peak or charge detect mode in which a state of the switch is retained in response to a decrease in the current or charge associated with the input signal. The state of the switch represents at least a portion of a value of the peak or of the charge.

  17. Apparatus and method for the simultaneous detection of neutrons and ionizing electromagnetic radiation

    DOE Patents [OSTI]

    Bell, Zane W. (Oak Ridge, TN)

    2000-01-01

    A sensor for simultaneously detecting neutrons and ionizing electromagnetic radiation comprising: a sensor for the detection of gamma radiation, the sensor defining a sensing head; the sensor further defining an output end in communication with the sensing head; and an exterior neutron-sensitive material configured to form around the sensing head; wherein the neutron-sensitive material, subsequent to the capture of the neutron, fissions into an alpha-particle and a .sup.7 Li ion that is in a first excited state in a majority of the fissions, the first excited state decaying via the emission of a single gamma ray at 478 keV which can in turn be detected by the sensing head; and wherein the sensing head can also detect the ionizing electromagnetic radiation from an incident radiation field without significant interference from the neutron-sensitive material. A method for simultaneously detecting neutrons and ionizing electromagnetic radiation comprising the steps of: providing a gamma ray sensitive detector comprising a sensing head and an output end; conforming an exterior neutron-sensitive material configured to form around the sensing head of the detector; capturing neutrons by the sensing head causing the neutron-sensitive material to fission into an alpha-particle and a .sup.7 Li ion that is in a first excited state in a majority of the fissions, the state decaying via the emission of a single gamma ray at 478 keV; sensing gamma rays entering the detector through the neutron-sensitive material; and producing an output through a readout device coupled to the output end; wherein the detector provides an output which is proportional to the energy of the absorbed ionizing electromagnetic radiation.

  18. Methods for improved selectivity in photo-activation and detection of molecular diagnostic agents

    DOE Patents [OSTI]

    Wachter, Eric A. (Oak Ridge, TN); Fisher, Walter G. (Knoxville, TN); Dees, H. Craig (Knoxville, TN)

    2008-03-18

    A method for the imaging of a particular volume of plant or animal tissue, wherein the plant or animal tissue contains at least one photo-active molecular agent. The method comprises the steps of treating the particular volume of the plant or animal tissue with light sufficient to promote a simultaneous two-photon excitation of the photo-active molecular agent contained in the particular volume of the plant or animal tissue, photo-activating at least one of the at least one photo-active molecular agent in the particular volume of the plant or animal tissue, thereby producing at least one photo-activated molecular agent, wherein the at least one photo-activated molecular agent emits energy, detecting the energy emitted by the at least one photo-activated molecular agent, and producing a detected energy signal which is characteristic of the particular volume of plant or animal tissue. The present invention also provides a method for the imaging of a particular volume of material, wherein the material contains at least one photo-active molecular agent.

  19. Method for improved selectivity in photo-activation and detection of molecular diagnostic agents

    DOE Patents [OSTI]

    Wachter, Eric A. (Oak Ridge, TN); Fisher, Walter G. (Knoxville, TN); Dees, H. Craig (Knoxville, TN)

    1998-01-01

    A method for the imaging of a particular volume of plant or animal tissue, wherein the plant or animal tissue contains at least one photo-active molecular agent. The method includes the steps of treating the particular volume of the plant or animal tissue with light sufficient to promote a simultaneous two-photon excitation of the photo-active molecular agent contained in the particular volume of the plant or animal tissue, photo-activating at least one of the at least one photo-active molecular agent in the particular volume of the plant or animal tissue, thereby producing at least one photo-activated molecular agent, wherein the at least one photo-activated molecular agent emits energy, detecting the energy emitted by the at least one photo-activated molecular agent, and producing a detected energy signal which is characteristic of the particular volume of plant or animal tissue. The present invention is also a method for the imaging of a particular volume of material, wherein the material contains at least one photo-active molecular agent.

  20. Method for improved selectivity in photo-activation and detection of molecular diagnostic agents

    DOE Patents [OSTI]

    Wachter, E.A.; Fisher, W.G.; Dees, H.C.

    1998-11-10

    A method for the imaging of a particular volume of plant or animal tissue, wherein the plant or animal tissue contains at least one photo-active molecular agent. The method includes the steps of treating the particular volume of the plant or animal tissue with light sufficient to promote a simultaneous two-photon excitation of the photo-active molecular agent contained in the particular volume of the plant or animal tissue, photo-activating at least one of the at least one photo-active molecular agent in the particular volume of the plant or animal tissue, thereby producing at least one photo-activated molecular agent, wherein the at least one photo-activated molecular agent emits energy, detecting the energy emitted by the at least one photo-activated molecular agent, and producing a detected energy signal which is characteristic of the particular volume of plant or animal tissue. The present invention is also a method for the imaging of a particular volume of material, wherein the material contains at least one photo-active molecular agent. 13 figs.

  1. Interferometric apparatus and method for detection and characterization of particles using light scattered therefrom

    DOE Patents [OSTI]

    Johnston, Roger G. (Los Alamos, NM)

    1988-01-01

    Interferometric apparatus and method for detection and characterization of particles using light scattered therefrom. Differential phase measurements on scattered light from particles are possible using the two-frequency Zeeman effect laser which emits two frequencies of radiation 250 kHz apart. Excellent discrimination and reproducibility for various pure pollen and bacterial samples in suspension have been observed with a single polarization element. Additionally, a 250 kHz beat frequency was recorded from an individual particle traversing the focused output from the laser in a flow cytometer.

  2. Apparatus and method for detection and characterization of particles using light scattered therefrom

    DOE Patents [OSTI]

    Johnston, R.G.

    1987-03-23

    Apparatus and method for detection and characterization of particles using light scattered therefrom. Differential phase measurements on scattered light from particles are possible using the two-frequency Zeeman effect laser which emits two frequencies of radiation 250 kHz apart. Excellent discrimination and reproducibility for various pure pollen and bacterial samples in suspension have been observed with a single polarization element. Additionally, a 250 kHz beat frequency was recorded from an individual particle traversing the focused output from the laser in a flow cytometer. 13 figs.

  3. Methods, microfluidic devices, and systems for detection of an active enzymatic agent

    DOE Patents [OSTI]

    Sommer, Gregory J; Hatch, Anson V; Singh, Anup K; Wang, Ying-Chih

    2014-10-28

    Embodiments of the present invention provide methods, microfluidic devices, and systems for the detection of an active target agent in a fluid sample. A substrate molecule is used that contains a sequence which may cleave in the presence of an active target agent. A SNAP25 sequence is described, for example, that may be cleaved in the presence of Botulinum Neurotoxin. The substrate molecule includes a reporter moiety. The substrate molecule is exposed to the sample, and resulting reaction products separated using electrophoretic separation. The elution time of the reporter moiety may be utilized to identify the presence or absence of the active target agent.

  4. Method for detecting point mutations in DNA utilizing fluorescence energy transfer

    DOE Patents [OSTI]

    Parkhurst, Lawrence J. (Lincoln, NE); Parkhurst, Kay M. (Lincoln, NE); Middendorf, Lyle (Lincoln, NE)

    2001-01-01

    A method for detecting point mutations in DNA using a fluorescently labeled oligomeric probe and Forster resonance energy transfer (FRET) is disclosed. The selected probe is initially labeled at each end with a fluorescence dye, which act together as a donor/acceptor pair for FRET. The fluorescence emission from the dyes changes dramatically from the duplex stage, wherein the probe is hybridized to the complementary strand of DNA, to the single strand stage, when the probe is melted to become detached from the DNA. The change in fluorescence is caused by the dyes coming into closer proximity after melting occurs and the probe becomes detached from the DNA strand. The change in fluorescence emission as a function of temperature is used to calculate the melting temperature of the complex or T.sub.m. In the case where there is a base mismatch between the probe and the DNA strand, indicating a point mutation, the T.sub.m has been found to be significantly lower than the T.sub.m for a perfectly match probelstand duplex. The present invention allows for the detection of the existence and magnitude of T.sub.m, which allows for the quick and accurate detection of a point mutation in the DNA strand and, in some applications, the determination of the approximate location of the mutation within the sequence.

  5. Methods and computer executable instructions for marking a downhole elongate line and detecting same

    DOE Patents [OSTI]

    Watkins, Arthur D.

    2003-05-13

    Methods and computer executable instructions are provided for making an elongate line (22) with a plurality of marks (30) and detecting those marks (30) to determine a distance of the elongate line (22) in a downhole or a physical integrity thereof. In a preferred embodiment, each mark comprises a plurality of particles (44) having a substantially permanent magnetizing capability adhered to an exterior surface of the elongate line (22) at preselected intervals with an epoxy paint. The particles (44) are arranged at each interval as a plurality of bands (40). Thereafter, the particles are oriented into a magnetic signature for that interval by magnetizing the particles to create a magnetic field substantially normal to the exterior surface. This facilitates detection by a Hall effect probe. The magnetic signatures are stored in a computing configuration and, once a mark is detected, a correlation is made to a unique position on the elongate line by comparison with the stored magnetic signatures. Preferred particles include samarium-cobalt and neodymium-iron-boride.

  6. Method of remote powering and detecting multiple UWB passive tags in an RFID system

    DOE Patents [OSTI]

    Dowla, Farid U. (Castro Valley, CA); Nekoogar, Faranak (San Ramon, CA); Benzel, David M. (Livermore, CA); Dallum, Gregory E. (Livermore, CA); Spiridon, Alex (Palo Alto, CA)

    2012-05-29

    A new Radio Frequency Identification (RFID), tracking, powering apparatus/system and method using coded Ultra-wideband (UWB) signaling is introduced. The proposed hardware and techniques disclosed herein utilize a plurality of passive UWB transponders in a field of an RFID-radar system. The radar system itself enables multiple passive tags to be remotely powered (activated) at about the same time frame via predetermined frequency UWB pulsed formats. Once such tags are in an activated state, an UWB radar transmits specific "interrogating codes" to put predetermined tags in an awakened status. Such predetermined tags can then communicate by a unique "response code" so as to be detected by an UWB system using radar methods.

  7. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOE Patents [OSTI]

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  8. Ion detection device and method with compressing ion-beam shutter

    DOE Patents [OSTI]

    Sperline, Roger P [Tucson, AZ; Roger P. (Tucson, AZ)

    2009-05-26

    An ion detection device, method and computer readable medium storing instructions for applying voltages to shutter elements of the detection device to compress ions in a volume defined by the shutter elements and to output the compressed ions to a collector. The ion detection device has a chamber having an inlet and receives ions through the inlet, a shutter provided in the chamber opposite the inlet and configured to allow or prevent the ions to pass the shutter, the shutter having first and second shutter elements, a collector provided in the chamber opposite the shutter and configured to collect ions passed through the shutter, and a processing unit electrically connected to the first and second shutter elements. The processing unit applies, during a first predetermined time interval, a first voltage to the first shutter element and a second voltage to the second shutter element, the second voltage being lower than the first voltage such that ions from the inlet enter a volume defined by the first and second shutter elements, and during a second predetermined time interval, a third voltage to the first shutter element, higher than the first voltage, and a fourth voltage to the second shutter element, the third voltage being higher than the fourth voltage such that ions that entered the volume are compressed as the ions exit the volume and new ions coming from the inlet are prevented from entering the volume. The processing unit is electrically connected to the collector and configured to detect the compressed ions based at least on a current received from the collector and produced by the ions collected by the collector.

  9. AUTOMATED LEAK DETECTION OF BURIED TANKS USING GEOPHYSICAL METHODS AT THE HANFORD NUCLEAR SITE

    SciTech Connect (OSTI)

    CALENDINE S; SCHOFIELD JS; LEVITT MT; FINK JB; RUCKER DF

    2011-03-30

    At the Hanford Nuclear Site in Washington State, the Department of Energy oversees the containment, treatment, and retrieval of liquid high-level radioactive waste. Much of the waste is stored in single-shelled tanks (SSTs) built between 1943 and 1964. Currently, the waste is being retrieved from the SSTs and transferred into newer double-shelled tanks (DSTs) for temporary storage before final treatment. Monitoring the tanks during the retrieval process is critical to identifying leaks. An electrically-based geophysics monitoring program for leak detection and monitoring (LDM) has been successfully deployed on several SSTs at the Hanford site since 2004. The monitoring program takes advantage of changes in contact resistance that will occur when conductive tank liquid leaks into the soil. During monitoring, electrical current is transmitted on a number of different electrode types (e.g., steel cased wells and surface electrodes) while voltages are measured on all other electrodes, including the tanks. Data acquisition hardware and software allow for continuous real-time monitoring of the received voltages and the leak assessment is conducted through a time-series data analysis. The specific hardware and software combination creates a highly sensitive method of leak detection, complementing existing drywell logging as a means to detect and quantify leaks. Working in an industrial environment such as the Hanford site presents many challenges for electrical monitoring: cathodic protection, grounded electrical infrastructure, lightning strikes, diurnal and seasonal temperature trends, and precipitation, all of which create a complex environment for leak detection. In this discussion we present examples of challenges and solutions to working in the tank farms of the Hanford site.

  10. Ion mobility spectrometer, spectrometer analyte detection and identification verification system, and method

    DOE Patents [OSTI]

    Atkinson, David A. (Idaho Falls, ID)

    2002-01-01

    Methods and apparatus for ion mobility spectrometry and analyte detection and identification verification system are disclosed. The apparatus is configured to be used in an ion mobility spectrometer and includes a plurality of reactant reservoirs configured to contain a plurality of reactants which can be reacted with the sample to form adducts having varying ion mobilities. A carrier fluid, such as air or nitrogen, is used to carry the sample into the spectrometer. The plurality of reactants are configured to be selectively added to the carrier stream by use inlet and outlet manifolds in communication with the reagent reservoirs, the reservoirs being selectively isolatable by valves. The invention further includes a spectrometer having the reagent system described. In the method, a first reactant is used with the sample. Following a positive result, a second reactant is used to determine whether a predicted response occurs. The occurrence of the second predicted response tends to verify the existence of a component of interest within the sample. A third reactant can also be used to provide further verification of the existence of a component of interest. A library can be established of known responses of compounds of interest with various reactants and the results of a specific multi-reactant survey of a sample can be compared against the library to determine whether a component detected in the sample is likely to be a specific component of interest.

  11. SU-D-12A-02: DeTECT, a Method to Enhance Soft Tissue Contrast From Mega Voltage CT

    SciTech Connect (OSTI)

    Sheng, K; Gou, S; Qi, S

    2014-06-01

    Purpose: MVCT images have been used on TomoTherapy system to align patients based on bony anatomies but its usefulness for soft tissue registration, delineation and adaptive radiation therapy is severely limited due to minimal photoelectric interaction and prominent presence of noise resulting from low detector quantum efficiency of megavoltage x-rays. We aim to utilize a non-local means denoising method and texture analysis to recover the soft tissue information for MVCT. Methods: A block matching 3D (BM3D) algorithm was adapted to reduce the noise while keeping the texture information of the MVCT images. BM3D is an imaging denoising algorithm developed from non-local means methods. BM3D additionally creates 3D groups by stacking 2D patches by the order of similarity. 3D denoising operation is then performed. The resultant 3D group is inversely transformed back to 2D images. In this study, BM3D was applied to MVCT images of a CT quality phantom, a head and neck and a prostate patient. Following denoising, imaging texture was enhanced to create the denoised and texture enhanced CT (DeTECT). Results: The original MVCT images show prevalent noise and poor soft tissue contrast. By applying BM3D denoising and texture enhancement, all MVCT images show remarkable improvements. For the phantom, the contrast to noise ratio for the low contrast plug was improved from 2.2 to 13.1 without compromising line pair conspicuity. For the head and neck patient, the lymph nodes and vein in the carotid space inconspicuous in the original MVCT image becomes highly visible in DeTECT. For the prostate patient, the boundary between the bladder and the prostate in the original MVCT is successfully recovered. Both results are visually validated by kVCT images of the corresponding patients. Conclusion: DeTECT showed the promise to drastically improve the soft tissue contrast of MVCT for image guided radiotherapy and adaptive radiotherapy.

  12. Experimental verification of the method for detection of water microleakages in plasma vacuum chambers by using the hydroxyl spectrum

    SciTech Connect (OSTI)

    Antipenkov, A. B.; Afonin, O. N.; Ochkin, V. N.; Savinov, S. Yu.; Tskhai, S. N.

    2012-03-15

    Experimental determination of the sensitivity of the method for detection of water microleakages in the cooling systems of the plasma vacuum chambers of complex electrophysical devices (such as tokamaks, fuel elements of nuclear reactors, and plasmachemical reactors) is considered. It was shown that the spectroscopic method for detection of water microleakages by using the hydroxyl radiation spectrum makes it possible to detect leakages at a level of 10{sup -5} Pa m{sup 3} s{sup -1}. The spatial resolution of the method allows one to localize defects with an accuracy of several centimeters.

  13. METHOD AND APPARATUS FOR THE DETECTION OF LEAKS IN PIPE LINES

    DOE Patents [OSTI]

    Jefferson, S.; Cameron, J.F.

    1961-11-28

    A method is described for detecting leaks in pipe lines carrying fluid. The steps include the following: injecting a radioactive solution into a fluid flowing in the line; flushing the line clear of the radioactive solution; introducing a detector-recorder unit, comprising a radioactivity radiation detector and a recorder which records the detector signal over a time period at a substantially constant speed, into the line in association with a go-devil capable of propelling the detector-recorder unit through the line in the direction of the fluid flow at a substantia1ly constant velocity; placing a series of sources of radioactivity at predetermined distances along the downstream part of the line to make a characteristic signal on the recorder record at intervals corresponding to the location of said sources; recovering the detector-recorder unit at a downstream point along the line; transcribing the recorder record of any radioactivity detected during the travel of the detector- recorder unit in terms of distance along the line. (AEC)

  14. Method and apparatus for detecting a desired behavior in digital image data

    DOE Patents [OSTI]

    Kegelmeyer, Jr., W. Philip (11755 Shadow Dr., Dublin, CA 94568)

    1997-01-01

    A method for detecting stellate lesions in digitized mammographic image data includes the steps of prestoring a plurality of reference images, calculating a plurality of features for each of the pixels of the reference images, and creating a binary decision tree from features of randomly sampled pixels from each of the reference images. Once the binary decision tree has been created, a plurality of features, preferably including an ALOE feature (analysis of local oriented edges), are calculated for each of the pixels of the digitized mammographic data. Each of these plurality of features of each pixel are input into the binary decision tree and a probability is determined, for each of the pixels, corresponding to the likelihood of the presence of a stellate lesion, to create a probability image. Finally, the probability image is spatially filtered to enforce local consensus among neighboring pixels and the spatially filtered image is output.

  15. Method and apparatus for detecting a desired behavior in digital image data

    DOE Patents [OSTI]

    Kegelmeyer, Jr., W. Philip (11755 Shadow Dr., Dublin, CA 94568)

    1997-01-01

    A method for detecting stellate lesions in digitized mammographic image data includes the steps of prestoring a plurality of reference images, calculating a plurality of features for each of the pixels of the reference images, and creating a binary decision tree from features of randomly sampled pixels from each of the reference images. Once the binary decision tree has been created, a plurality of features, preferably including an ALOE feature (analysis of local oriented edges), are calculated for each of the pixels of the digitized mammographic data. Each of these plurality of features of each pixel are input into the binary decision tree and a probability is determined, for each of the pixels, corresponding to the likelihood of the presence of a stellate lesion, to create a probability image. Finally, the probability image is spacially filtered to enforce local consensus among neighboring pixels and the spacially filtered image is output.

  16. Method and apparatus for detecting combustion instability in continuous combustion systems

    DOE Patents [OSTI]

    Benson, Kelly J.; Thornton, Jimmy D.; Richards, George A.; Straub, Douglas L.

    2006-08-29

    An apparatus and method to sense the onset of combustion stability is presented. An electrode is positioned in a turbine combustion chamber such that the electrode is exposed to gases in the combustion chamber. A control module applies a voltage potential to the electrode and detects a combustion ionization signal and determines if there is an oscillation in the combustion ionization signal indicative of the occurrence of combustion stability or the onset of combustion instability. A second electrode held in a coplanar but spaced apart manner by an insulating member from the electrode provides a combustion ionization signal to the control module when the first electrode fails. The control module broadcasts a notice if the parameters indicate the combustion process is at the onset of combustion instability or broadcasts an alarm signal if the parameters indicate the combustion process is unstable.

  17. Method for detection of dental caries and periodontal disease using optical imaging

    DOE Patents [OSTI]

    Nathel, Howard (Albany, CA); Kinney, John H. (Danville, CA); Otis, Linda L. (San Francisco, CA)

    1996-01-01

    A method for detecting the presence of active and inactive caries in teeth and diagnosing periodontal disease uses non-ionizing radiation with techniques for reducing interference from scattered light. A beam of non-ionizing radiation is divided into sample and reference beams. The region to be examined is illuminated by the sample beam, and reflected or transmitted radiation from the sample is recombined with the reference beam to form an interference pattern on a detector. The length of the reference beam path is adjustable, allowing the operator to select the reflected or transmitted sample photons that recombine with the reference photons. Thus radiation scattered by the dental or periodontal tissue can be prevented from obscuring the interference pattern. A series of interference patterns may be generated and interpreted to locate dental caries and periodontal tissue interfaces.

  18. Method for detection of dental caries and periodontal disease using optical imaging

    DOE Patents [OSTI]

    Nathel, H.; Kinney, J.H.; Otis, L.L.

    1996-10-29

    A method is disclosed for detecting the presence of active and inactive caries in teeth and diagnosing periodontal disease uses non-ionizing radiation with techniques for reducing interference from scattered light. A beam of non-ionizing radiation is divided into sample and reference beams. The region to be examined is illuminated by the sample beam, and reflected or transmitted radiation from the sample is recombined with the reference beam to form an interference pattern on a detector. The length of the reference beam path is adjustable, allowing the operator to select the reflected or transmitted sample photons that recombine with the reference photons. Thus radiation scattered by the dental or periodontal tissue can be prevented from obscuring the interference pattern. A series of interference patterns may be generated and interpreted to locate dental caries and periodontal tissue interfaces. 7 figs.

  19. Physics-based, Bayesian sequential detection method and system for radioactive contraband

    DOE Patents [OSTI]

    Candy, James V; Axelrod, Michael C; Breitfeller, Eric F; Chambers, David H; Guidry, Brian L; Manatt, Douglas R; Meyer, Alan W; Sale, Kenneth E

    2014-03-18

    A distributed sequential method and system for detecting and identifying radioactive contraband from highly uncertain (noisy) low-count, radionuclide measurements, i.e. an event mode sequence (EMS), using a statistical approach based on Bayesian inference and physics-model-based signal processing based on the representation of a radionuclide as a monoenergetic decomposition of monoenergetic sources. For a given photon event of the EMS, the appropriate monoenergy processing channel is determined using a confidence interval condition-based discriminator for the energy amplitude and interarrival time and parameter estimates are used to update a measured probability density function estimate for a target radionuclide. A sequential likelihood ratio test is then used to determine one of two threshold conditions signifying that the EMS is either identified as the target radionuclide or not, and if not, then repeating the process for the next sequential photon event of the EMS until one of the two threshold conditions is satisfied.

  20. Method and system for early detection of incipient faults in electric motors

    DOE Patents [OSTI]

    Parlos, Alexander G; Kim, Kyusung

    2003-07-08

    A method and system for early detection of incipient faults in an electric motor are disclosed. First, current and voltage values for one or more phases of the electric motor are measured during motor operations. A set of current predictions is then determined via a neural network-based current predictor based on the measured voltage values and an estimate of motor speed values of the electric motor. Next, a set of residuals is generated by combining the set of current predictions with the measured current values. A set of fault indicators is subsequently computed from the set of residuals and the measured current values. Finally, a determination is made as to whether or not there is an incipient electrical, mechanical, and/or electromechanical fault occurring based on the comparison result of the set of fault indicators and a set of predetermined baseline values.

  1. Real-Time Detection Methods to Monitor TRU Compositions in UREX+Process Streams

    SciTech Connect (OSTI)

    McDeavitt, Sean; Charlton, William; Indacochea, J Ernesto; taleyarkhan, Rusi; Pereira, Candido

    2013-03-01

    The U.S. Department of Energy has developed advanced methods for reprocessing spent nuclear fuel. The majority of this development was accomplished under the Advanced Fuel Cycle Initiative (AFCI), building on the strong legacy of process development R&D over the past 50 years. The most prominent processing method under development is named UREX+. The name refers to a family of processing methods that begin with the Uranium Extraction (UREX) process and incorporate a variety of other methods to separate uranium, selected fission products, and the transuranic (TRU) isotopes from dissolved spent nuclear fuel. It is important to consider issues such as safeguards strategies and materials control and accountability methods. Monitoring of higher actinides during aqueous separations is a critical research area. By providing on-line materials accountability for the processes, covert diversion of the materials streams becomes much more difficult. The importance of the nuclear fuel cycle continues to rise on national and international agendas. The U.S. Department of Energy is evaluating and developing advanced methods for safeguarding nuclear materials along with instrumentation in various stages of the fuel cycle, especially in material balance areas (MBAs) and during reprocessing of used nuclear fuel. One of the challenges related to the implementation of any type of MBA and/or reprocessing technology (e.g., PUREX or UREX) is the real-time quantification and control of the transuranic (TRU) isotopes as they move through the process. Monitoring of higher actinides from their neutron emission (including multiplicity) and alpha signatures during transit in MBAs and in aqueous separations is a critical research area. By providing on-line real-time materials accountability, diversion of the materials becomes much more difficult. The objective of this consortium was to develop real time detection methods to monitor the efficacy of the UREX+ process and to safeguard the separated TRUs against unlawful diversion from within a processing facility. To achieve this, a comprehensive strategy was implemented to incorporate traditional detectors and advanced Tensioned Metastable Fluid (TMFD) metastable fluid detectors (developed, in part, under this project) into a novel detector assembly coupled to the UREX+ centrifugal contactor array. The sections below provide a brief summary of the technical achievements completed during this project. The principal outcomes are documented in more complete details contained the doctoral dissertations and masters theses, journal papers, conference proceedings and additional items for more than the 35 publications that are listed in the program bibliography in Section 3.

  2. WIMP Dark Matter Limit-Direct Detection Data and Sensitivity Plots from the Cryogenic Dark Matter Search II and the University of California at Santa Barbara

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Expectations for non-baryonic dark matter are founded principally in Big Bang nucleosynthesis calculations, which indicate that the missing mass of the universe is not likely to be baryonic. The supersymmetric standard model (SUSY) offers a promising framework for expectations of particle species which could satisfy the observed properties of dark matter. WIMPs are the most likely SUSY candidate for a dark matter particle. The High Energy Physics Group at University of California, Santa Barbara, is part of the CDMSII Collaboration and have provided the Interactive Plotter for WIMP Dark Matter Limit-Direct Detection Data on their website. They invite other collaborations working on dark matter research to submit datasets and, as a result, have more than 150 data sets now available for use with the plotting tool. The published source of the data is provided with each data set.

  3. System and method for constructing filters for detecting signals whose frequency content varies with time

    DOE Patents [OSTI]

    Qian, S.; Dunham, M.E.

    1996-11-12

    A system and method are disclosed for constructing a bank of filters which detect the presence of signals whose frequency content varies with time. The present invention includes a novel system and method for developing one or more time templates designed to match the received signals of interest and the bank of matched filters use the one or more time templates to detect the received signals. Each matched filter compares the received signal x(t) with a respective, unique time template that has been designed to approximate a form of the signals of interest. The robust time domain template is assumed to be of the order of w(t)=A(t)cos(2{pi}{phi}(t)) and the present invention uses the trajectory of a joint time-frequency representation of x(t) as an approximation of the instantaneous frequency function {phi}{prime}(t). First, numerous data samples of the received signal x(t) are collected. A joint time frequency representation is then applied to represent the signal, preferably using the time frequency distribution series. The joint time-frequency transformation represents the analyzed signal energy at time t and frequency f, P(t,f), which is a three-dimensional plot of time vs. frequency vs. signal energy. Then P(t,f) is reduced to a multivalued function f(t), a two dimensional plot of time vs. frequency, using a thresholding process. Curve fitting steps are then performed on the time/frequency plot, preferably using Levenberg-Marquardt curve fitting techniques, to derive a general instantaneous frequency function {phi}{prime}(t) which best fits the multivalued function f(t). Integrating {phi}{prime}(t) along t yields {phi}{prime}(t), which is then inserted into the form of the time template equation. A suitable amplitude A(t) is also preferably determined. Once the time template has been determined, one or more filters are developed which each use a version or form of the time template. 7 figs.

  4. System and method for constructing filters for detecting signals whose frequency content varies with time

    DOE Patents [OSTI]

    Qian, Shie; Dunham, Mark E.

    1996-01-01

    A system and method for constructing a bank of filters which detect the presence of signals whose frequency content varies with time. The present invention includes a novel system and method for developing one or more time templates designed to match the received signals of interest and the bank of matched filters use the one or more time templates to detect the received signals. Each matched filter compares the received signal x(t) with a respective, unique time template that has been designed to approximate a form of the signals of interest. The robust time domain template is assumed to be of the order of w(t)=A(t)cos{2.pi..phi.(t)} and the present invention uses the trajectory of a joint time-frequency representation of x(t) as an approximation of the instantaneous frequency function {.phi.'(t). First, numerous data samples of the received signal x(t) are collected. A joint time frequency representation is then applied to represent the signal, preferably using the time frequency distribution series (also known as the Gabor spectrogram). The joint time-frequency transformation represents the analyzed signal energy at time t and frequency .function., P(t,f), which is a three-dimensional plot of time vs. frequency vs. signal energy. Then P(t,f) is reduced to a multivalued function f(t), a two dimensional plot of time vs. frequency, using a thresholding process. Curve fitting steps are then performed on the time/frequency plot, preferably using Levenberg-Marquardt curve fitting techniques, to derive a general instantaneous frequency function .phi.'(t) which best fits the multivalued function f(t), a trajectory of the joint time-frequency domain representation of x(t). Integrating .phi.'(t) along t yields .phi.(t), which is then inserted into the form of the time template equation. A suitable amplitude A(t) is also preferably determined. Once the time template has been determined, one or more filters are developed which each use a version or form of the time template.

  5. Limited Test Ban Treaty

    National Nuclear Security Administration (NNSA)

    Detection System (USNDS), which monitors compliance with the international Limited Test Ban Treaty (LTBT). The LTBT, signed by 108 countries, prohibits nuclear testing in the...

  6. Method to improve cancerous lesion detection sensitivity in a dedicated dual-head scintimammography system

    DOE Patents [OSTI]

    Kieper, Douglas Arthur (Newport News, VA); Majewski, Stanislaw (Yorktown, VA); Welch, Benjamin L. (Hampton, VA)

    2008-10-28

    An improved method for enhancing the contrast between background and lesion areas of a breast undergoing dual-head scintimammographic examination comprising: 1) acquiring a pair of digital images from a pair of small FOV or mini gamma cameras compressing the breast under examination from opposing sides; 2) inverting one of the pair of images to align or co-register with the other of the images to obtain co-registered pixel values; 3) normalizing the pair of images pixel-by-pixel by dividing pixel values from each of the two acquired images and the co-registered image by the average count per pixel in the entire breast area of the corresponding detector; and 4) multiplying the number of counts in each pixel by the value obtained in step 3 to produce a normalization enhanced two dimensional contrast map. This enhanced (increased contrast) contrast map enhances the visibility of minor local increases (uptakes) of activity over the background and therefore improves lesion detection sensitivity, especially of small lesions.

  7. Method for detection of long-lived radioisotopes in small biochemical samples

    DOE Patents [OSTI]

    Turteltaub, Kenneth W.; Vogel, John S.; Felton, James S.; Gledhill, Barton L.; Davis, Jay C.

    1994-01-01

    Disclosed is a method for detection of long-lived radioisotopes in small bio-chemical samples, comprising: a. selecting a biological host in which radioisotopes are present in concentrations equal to or less than those in the ambient biosphere, b. preparing a long-lived radioisotope labeled reactive chemical specie, c. administering said chemical specie to said biologist host in doses sufficiently low to avoid significant overt damage to the biological system thereof, d. allowing a period of time to elapse sufficient for dissemination and interaction of said chemical specie with said host throughout said biological system of said host, e. isolating a reacted fraction of the biological substance from said host in a manner sufficient to avoid contamination of said substance from extraneous sources, f. converting said fraction of biological substance by suitable means to a material which efficiently produces charged ions in at least one of several possible ion sources without introduction of significant isotopic fractionation, and, g. measuring the radioisotope concentration in said material by means of direct isotopic counting.

  8. Method for detection of long-lived radioisotopes in small biochemical samples

    DOE Patents [OSTI]

    Turteltaub, K.W.; Vogel, J.S.; Felton, J.S.; Gledhill, B.L.; Davis, J.C.

    1994-11-22

    Disclosed is a method for detection of long-lived radioisotopes in small biochemical samples, comprising: a. selecting a biological host in which radioisotopes are present in concentrations equal to or less than those in the ambient biosphere, b. preparing a long-lived radioisotope labeled reactive chemical specie, c. administering the chemical specie to the biologist host in doses sufficiently low to avoid significant overt damage to the biological system, d. allowing a period of time to elapse sufficient for dissemination and interaction of the chemical specie with the host throughout the biological system of the host, e. isolating a reacted fraction of the biological substance from the host in a manner sufficient to avoid contamination of the substance from extraneous sources, f. converting the fraction of biological substance by suitable means to a material which efficiently produces charged ions in at least one of several possible ion sources without introduction of significant isotopic fractionation, and, g. measuring the radioisotope concentration in the material by means of direct isotopic counting. 5 figs.

  9. Method to improve cancerous lesion detection sensitivity in a dedicated dual-head scintimammography system

    DOE Patents [OSTI]

    Kieper, Douglas Arthur (Seattle, WA); Majewski, Stanislaw (Morgantown, WV); Welch, Benjamin L. (Hampton, VA)

    2012-07-03

    An improved method for enhancing the contrast between background and lesion areas of a breast undergoing dual-head scintimammographic examination comprising: 1) acquiring a pair of digital images from a pair of small FOV or mini gamma cameras compressing the breast under examination from opposing sides; 2) inverting one of the pair of images to align or co-register with the other of the images to obtain co-registered pixel values; 3) normalizing the pair of images pixel-by-pixel by dividing pixel values from each of the two acquired images and the co-registered image by the average count per pixel in the entire breast area of the corresponding detector; and 4) multiplying the number of counts in each pixel by the value obtained in step 3 to produce a normalization enhanced two dimensional contrast map. This enhanced (increased contrast) contrast map enhances the visibility of minor local increases (uptakes) of activity over the background and therefore improves lesion detection sensitivity, especially of small lesions.

  10. Methods for detecting and correcting inaccurate results in inductively coupled plasma-atomic emission spectrometry

    DOE Patents [OSTI]

    Chan, George C. Y. (Bloomington, IN); Hieftje, Gary M. (Bloomington, IN)

    2010-08-03

    A method for detecting and correcting inaccurate results in inductively coupled plasma-atomic emission spectrometry (ICP-AES). ICP-AES analysis is performed across a plurality of selected locations in the plasma on an unknown sample, collecting the light intensity at one or more selected wavelengths of one or more sought-for analytes, creating a first dataset. The first dataset is then calibrated with a calibration dataset creating a calibrated first dataset curve. If the calibrated first dataset curve has a variability along the location within the plasma for a selected wavelength, errors are present. Plasma-related errors are then corrected by diluting the unknown sample and performing the same ICP-AES analysis on the diluted unknown sample creating a calibrated second dataset curve (accounting for the dilution) for the one or more sought-for analytes. The cross-over point of the calibrated dataset curves yields the corrected value (free from plasma related errors) for each sought-for analyte.

  11. Method for the depth corrected detection of ionizing events from a co-planar grids sensor

    DOE Patents [OSTI]

    De Geronimo, Gianluigi (Syosset, NY); Bolotnikov, Aleksey E. (South Setauket, NY); Carini, Gabriella (Port Jefferson, NY)

    2009-05-12

    A method for the detection of ionizing events utilizing a co-planar grids sensor comprising a semiconductor substrate, cathode electrode, collecting grid and non-collecting grid. The semiconductor substrate is sensitive to ionizing radiation. A voltage less than 0 Volts is applied to the cathode electrode. A voltage greater than the voltage applied to the cathode is applied to the non-collecting grid. A voltage greater than the voltage applied to the non-collecting grid is applied to the collecting grid. The collecting grid and the non-collecting grid are summed and subtracted creating a sum and difference respectively. The difference and sum are divided creating a ratio. A gain coefficient factor for each depth (distance between the ionizing event and the collecting grid) is determined, whereby the difference between the collecting electrode and the non-collecting electrode multiplied by the corresponding gain coefficient is the depth corrected energy of an ionizing event. Therefore, the energy of each ionizing event is the difference between the collecting grid and the non-collecting grid multiplied by the corresponding gain coefficient. The depth of the ionizing event can also be determined from the ratio.

  12. Testing of the method for water microleakage detection from OH hydroxyl spectral lines at the L-2M stellarator

    SciTech Connect (OSTI)

    Voronov, G. S. Berezhetskii, M. S.; Bondar', Yu. F.; Vafin, I. Yu.; Vasil'kov, D. G.; Voronova, E. V.; Grebenshchikov, S. E.; Grishina, I. A.; Larionova, N. F.; Letunov, A. A.; Logvinenko, V. P.; Meshcheryakov, A. I.; Pleshkov, E. I.; Khol'nov, Yu. V.; Fedyanin, O. I.; Tsygankov, V. A.; Shchepetov, S. V.; Kurnaev, V. A.; Vizgalov, I. V.; Urusov, V. A.; and others

    2013-04-15

    Results are presented from L-2M stellarator experiments on testing a possible method for detection of water microleakages in the cooling system of the first wall and vacuum chamber of ITER. The method consists in the spectroscopic detection of spectral lines of the OH hydroxyl, which forms via the dissociation of water molecules in plasma. Emission in the spectral band of 305-310 nm can be detected even at water leakage rates less than 10{sup -4} Pa m{sup 3}/s. Chemical reactions between water and boron compounds on the vacuum chamber wall delay the detection of leakages up to {approx}2000 s. A similar phenomenon can be expected when a leakage will occur in ITER, where the materials suggested for the first wall (Be, Li) can also chemically react with water.

  13. Systems and methods for detecting a flame in a fuel nozzle of a gas turbine

    DOE Patents [OSTI]

    Kraemer, Gilbert Otto; Storey, James Michael; Lipinski, John; Mestroni, Julio Enrique; Williamson, David Lee; Marshall, Jason Randolph; Krull, Anthony

    2013-05-07

    A system may detect a flame about a fuel nozzle of a gas turbine. The gas turbine may have a compressor and a combustor. The system may include a first pressure sensor, a second pressure sensor, and a transducer. The first pressure sensor may detect a first pressure upstream of the fuel nozzle. The second pressure sensor may detect a second pressure downstream of the fuel nozzle. The transducer may be operable to detect a pressure difference between the first pressure sensor and the second pressure sensor.

  14. Surveillance and prediction methods for the plutonium limit in the K-East Fuel Storage Basin Sandfilter Backwash Pit

    SciTech Connect (OSTI)

    Harris, R.A.

    1995-06-01

    Methods to predict and measure the amount of plutonium added to the 105-K East fuel storage basin sandfilter backwash pit have been developed. The bases for the methods and an evaluation of available data used in the methods are described.

  15. Comparison of Different Arc Detection Methods during Plasma Operations with ICRF Heating on ASDEX Upgrade

    SciTech Connect (OSTI)

    D'Inca, R.; Assas, S.; Bobkov, V.; Braun, F.; Eckert, B.; Noterdaeme, J.-M.

    2007-09-28

    The Sub-Harmonic Arc Detection (SHAD) system used on ASDEX-Upgrade has been designed with the double objective to detect arcs on the ICRF system and to discriminate them from plasma transients like ELMs. This preliminary study focuses on the achievement of these requirements by analyzing and comparing the behavior of the SHAD with existing arc detectors in operation on AUG.

  16. Apparatus and method for servicing an elongated suspended pump motor in an electric power plant with limited access

    DOE Patents [OSTI]

    Chavez, Rossemary V.; Ekeroth, Douglas E.; Johnson, F. Thomas; Matusz, John M.

    1994-01-01

    Elongated coolant pumps suspended under steam generators within containment in a power plant with limited access space, are removed and replaced by an elongated maintenance cart with an elongated opening along one side in which the motor is received. Rollers support the cart for conveying the elongated motor in an upright position out from under the steam generator and onto an elevator. The elevator is lowered to transfer support of the cart and motor through trunnions to saddles straddling the elevator for rotation of the cart to a generally horizontal position. The elevator then raises the horizontally disposed cart carrying the motor to a higher floor where it is rolled off the elevator and out through the auxiliary equipment hatch.

  17. Apparatus and method for servicing an elongated suspended pump motor in an electric power plant with limited access

    DOE Patents [OSTI]

    Chavez, R.V.; Ekeroth, D.E.; Johnson, F.T.; Matusz, J.M.

    1994-04-26

    Elongated coolant pumps suspended under steam generators within containment in a power plant with limited access space, are removed and replaced by an elongated maintenance cart with an elongated opening along one side in which the motor is received. Rollers support the cart for conveying the elongated motor in an upright position out from under the steam generator and onto an elevator. The elevator is lowered to transfer support of the cart and motor through trunnions to saddles straddling the elevator for rotation of the cart to a generally horizontal position. The elevator then raises the horizontally disposed cart carrying the motor to a higher floor where it is rolled off the elevator and out through the auxiliary equipment hatch. 14 figures.

  18. Portable instrument and method for detecting reduced sulfur compounds in a gas

    DOE Patents [OSTI]

    Gaffney, J.S.; Kelly, T.J.; Tanner, R.L.

    1983-06-01

    A portable real time instrument for detecting concentrations in the part per billion range of reduced sulfur compounds in a sample gas. Ozonized air or oxygen and reduced sulfur compounds in a sample gas stream react to produce chemiluminescence in a reaction chamber and the emitted light is filtered and observed by a photomultiplier to detect reduced sulfur compounds. Selective response to individual sulfur compounds is achieved by varying reaction chamber temperature and ozone and sample gas flows, and by the use of either air or oxygen as the ozone source gas.

  19. Method and means for detecting optically transmitted signals and establishing optical interference pattern between electrodes

    DOE Patents [OSTI]

    Kostenbauder, A.G.

    1988-06-28

    A photodetector for detecting signal pulses transmitted in an optical carrier signal relies on the generation of electron-hole pairs and the diffusion of the generated electrons and holes to the electrodes on the surface of the semiconductor detector body for generating photovoltaic pulses. The detector utilizes the interference of optical waves for generating an electron-hole grating within the semiconductor body, and, by establishing an electron-hole pair maximum at one electrode and a minimum at the other electrode, a detectable voltaic pulse is generated across the electrode. 4 figs.

  20. Method and means for detecting optically transmitted signals and establishing optical interference pattern between electrodes

    DOE Patents [OSTI]

    Kostenbauder, Adnah G. (Palo Alto, CA)

    1988-01-01

    A photodetector for detecting signal pulses transmitted in an optical carrier signal relies on the generation of electron-hole pairs and the diffusion of the generated electrons and holes to the electrodes on the surface of the semiconductor detector body for generating photovoltaic pulses. The detector utilizes the interference of optical waves for generating an electron-hole grating within the semiconductor body, and, by establishing an electron-hole pair maximum at one electrode and a minimum at the other electrode, a detectable voltaic pulse is generated across the electrode.

  1. Scintillator assembly for alpha radiation detection and an associated method of making

    DOE Patents [OSTI]

    Lauf, R.J.; McElhaney, S.A.; Bates, J.B.

    1994-07-26

    A scintillator assembly for use in conjunction with a photomultiplier or the like in the detection of alpha radiation utilizes a substrate or transparent yttrium aluminum garnet and a relatively thin film of cerium-doped yttrium aluminum garnet coated upon the substrate. The film material is applied to the substrate in a sputtering process, and the applied film and substrate are annealed to effect crystallization of the film upon the substrate. The resultant assembly provides relatively high energy resolution during use in a detection instrument and is sufficiently rugged for use in field environments. 4 figs.

  2. Scintillator assembly for alpha radiation detection and an associated method of making

    DOE Patents [OSTI]

    Lauf, Robert J. (Oak Ridge, TN); McElhaney, Stephanie A. (Oak Ridge, TN); Bates, John B. (Oak Ridge, TN)

    1994-01-01

    A scintillator assembly for use in conjunction with a photomultiplier or the like in the detection of alpha radiation utilizes a substrate or transparent yttrium aluminum garnet and a relatively thin film of cerium-doped yttrium aluminum garnet coated upon the substrate. The film material is applied to the substrate in a sputtering process, and the applied film and substrate are annealed to effect crystallization of the film upon the substrate. The resultant assembly provides relatively high energy resolution during use in a detection instrument and is sufficiently rugged for use in field environments.

  3. Optical method and apparatus for detection of defects and microstructural changes in ceramics and ceramic coatings

    DOE Patents [OSTI]

    Ellingson, William A. (Naperville, IL); Todd, Judith A. (Hinsdale, IL); Sun, Jiangang (Westmont, IL)

    2001-01-01

    Apparatus detects defects and microstructural changes in hard translucent materials such as ceramic bulk compositions and ceramic coatings such as after use under load conditions. The beam from a tunable laser is directed onto the sample under study and light reflected by the sample is directed to two detectors, with light scattered with a small scatter angle directed to a first detector and light scattered with a larger scatter angle directed to a second detector for monitoring the scattering surface. The sum and ratio of the two detector outputs respectively provide a gray-scale, or "sum" image, and an indication of the lateral spread of the subsurface scatter, or "ratio" image. This two detector system allows for very high speed crack detection for on-line, real-time inspection of damage in ceramic components. Statistical image processing using a digital image processing approach allows for the quantative discrimination of the presence and distribution of small flaws in a sample while improving detection reliability. The tunable laser allows for the penetration of the sample to detect defects from the sample's surface to the laser's maximum depth of penetration. A layered optical fiber directs the incoming laser beam to the sample and transmits each scattered signal to a respective one of the two detectors.

  4. Optical method and apparatus for detection of surface and near-subsurface defects in dense ceramics

    DOE Patents [OSTI]

    Ellingson, William A.; Brada, Mark P.

    1995-01-01

    A laser is used in a non-destructive manner to detect surface and near-subsurface defects in dense ceramics and particularly in ceramic bodies with complex shapes such as ceramic bearings, turbine blades, races, and the like. The laser's wavelength is selected based upon the composition of the ceramic sample and the laser can be directed on the sample while the sample is static or in dynamic rotate or translate motion. Light is scattered off surface and subsurface defects using a preselected polarization. The change in polarization angle is used to select the depth and characteristics of surface/subsurface defects. The scattered light is detected by an optical train consisting of a charge coupled device (CCD), or vidicon, television camera which, in turn, is coupled to a video monitor and a computer for digitizing the image. An analyzing polarizer in the optical train allows scattered light at a given polarization angle to be observed for enhancing sensitivity to either surface or near-subsurface defects. Application of digital image processing allows subtraction of digitized images in near real-time providing enhanced sensitivity to subsurface defects. Storing known "feature masks" of identified defects in the computer and comparing the detected scatter pattern (Fourier images) with the stored feature masks allows for automatic classification of detected defects.

  5. Optical method and apparatus for detection of surface and near-subsurface defects in dense ceramics

    DOE Patents [OSTI]

    Ellingson, W.A.; Brada, M.P.

    1995-06-20

    A laser is used in a non-destructive manner to detect surface and near-subsurface defects in dense ceramics and particularly in ceramic bodies with complex shapes such as ceramic bearings, turbine blades, races, and the like. The laser`s wavelength is selected based upon the composition of the ceramic sample and the laser can be directed on the sample while the sample is static or in dynamic rotate or translate motion. Light is scattered off surface and subsurface defects using a preselected polarization. The change in polarization angle is used to select the depth and characteristics of surface/subsurface defects. The scattered light is detected by an optical train consisting of a charge coupled device (CCD), or vidicon, television camera which, in turn, is coupled to a video monitor and a computer for digitizing the image. An analyzing polarizer in the optical train allows scattered light at a given polarization angle to be observed for enhancing sensitivity to either surface or near-subsurface defects. Application of digital image processing allows subtraction of digitized images in near real-time providing enhanced sensitivity to subsurface defects. Storing known ``feature masks`` of identified defects in the computer and comparing the detected scatter pattern (Fourier images) with the stored feature masks allows for automatic classification of detected defects. 29 figs.

  6. A coherent method for the detection and parameter estimation of continuous gravitational wave signals using a pulsar timing array

    SciTech Connect (OSTI)

    Wang, Yan; Mohanty, Soumya D.; Jenet, Fredrick A. [Department of Physics and Astronomy, University of Texas at Brownsville, 1 West University Boulevard, Brownsville, TX 78520 (United States)

    2014-11-01

    The use of a high precision pulsar timing array is a promising approach to detecting gravitational waves in the very low frequency regime (10{sup 6}-10{sup 9} Hz) that is complementary to ground-based efforts (e.g., LIGO, Virgo) at high frequencies (?10-10{sup 3} Hz) and space-based ones (e.g., LISA) at low frequencies (10{sup 4}-10{sup 1} Hz). One of the target sources for pulsar timing arrays is individual supermassive black hole binaries which are expected to form in galactic mergers. In this paper, a likelihood-based method for detection and parameter estimation is presented for a monochromatic continuous gravitational wave signal emitted by such a source. The so-called pulsar terms in the signal that arise due to the breakdown of the long-wavelength approximation are explicitly taken into account in this method. In addition, the method accounts for equality and inequality constraints involved in the semi-analytical maximization of the likelihood over a subset of the parameters. The remaining parameters are maximized over numerically using Particle Swarm Optimization. Thus, the method presented here solves the monochromatic continuous wave detection and parameter estimation problem without invoking some of the approximations that have been used in earlier studies.

  7. Analytical platform evaluation for quantification of ERG in prostate cancer using protein and mRNA detection methods

    SciTech Connect (OSTI)

    He, Jintang; Schepmoes, Athena A.; Shi, Tujin; Wu, Chaochao; Fillmore, Thomas L.; Gao, Yuqian; Smith, Richard D.; Qian, Weijun; Rodland, Karin D.; Liu, Tao; Camp, David G.; Rastogi, Anshu; Tan, Shyh-Han; Yan, Wusheng; Mohamed, Ahmed A.; Huang, Wei; Banerjee, Sreedatta; Kagan, Jacob; Srivastava, Sudhir; McLeod, David; Srivastava, Shiv; Petrovics, Gyorgy; Dobi, Albert; Srinivasan, Alagarsamy

    2015-01-01

    Background: The established methods for detecting prostate cancer (CaP) are based on tests using PSA (blood), PCA3 (urine), and AMACR (tissue) as biomarkers in patient samples. The demonstration of ERG oncoprotein overexpression due to gene fusion in CaP has thus provided ERG as an additional biomarker. Based on this, we hypothesized that ERG protein quantification methods can be of use in the diagnosis of prostate cancer. Methods: Therefore, an antibody-free assay for ERG3 protein detection was developed based on PRISM (high-pressure high-resolution separations with intelligent selection and multiplexing)-SRM (selected reaction monitoring) mass spectrometry. We utilized TMPRSS2-ERG positive VCaP and TMPRSS2-ERG negative LNCaP cells to simulate three different sample types (cells, tissue, and post-DRE urine sediment). Results: Recombinant ERG3 protein spiked into LNCaP cell lysates could be detected at levels as low as 20 pg by PRISM-SRM analysis. The sensitivity of the PRISM-SRM assay was around approximately 10,000 VCaP cells in a mixed cell population model of VCaP and LNCaP cells. Interestingly, ERG protein could be detected in as few as 600 VCaP cells spiked into female urine. The sensitivity of the in-house enzyme-linked immunosorbent assay (ELISA) was similar to the PRISM-SRM assay, with detection of 30 pg of purified recombinant ERG3 protein and 10,000 VCaP cells. On the other hand, qRT-PCR exhibited a higher sensitivity, as TMPRSS2-ERG transcripts were detected in as few as 100 VCaP cells, in comparison to NanoString methodologies which detected ERG from 10,000 cells. Conclusions: Based on this data, we propose that the detection of both ERG transcriptional products with RNA-based assays, as well as protein products of ERG using PRISM-SRM assays, may be of clinical value in developing diagnostics and prognostics assays for prostate cancer given their sensitivity, specificity, and reproducibility.

  8. Analytical platform evaluation for quantification of ERG in prostate cancer using protein and mRNA detection methods

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    He, Jintang; Schepmoes, Athena A.; Shi, Tujin; Wu, Chaochao; Fillmore, Thomas L.; Gao, Yuqian; Smith, Richard D.; Qian, Weijun; Rodland, Karin D.; Liu, Tao; et al

    2015-01-01

    Background: The established methods for detecting prostate cancer (CaP) are based on tests using PSA (blood), PCA3 (urine), and AMACR (tissue) as biomarkers in patient samples. The demonstration of ERG oncoprotein overexpression due to gene fusion in CaP has thus provided ERG as an additional biomarker. Based on this, we hypothesized that ERG protein quantification methods can be of use in the diagnosis of prostate cancer. Methods: Therefore, an antibody-free assay for ERG3 protein detection was developed based on PRISM (high-pressure high-resolution separations with intelligent selection and multiplexing)-SRM (selected reaction monitoring) mass spectrometry. We utilized TMPRSS2-ERG positive VCaP and TMPRSS2-ERGmore » negative LNCaP cells to simulate three different sample types (cells, tissue, and post-DRE urine sediment). Results: Recombinant ERG3 protein spiked into LNCaP cell lysates could be detected at levels as low as 20 pg by PRISM-SRM analysis. The sensitivity of the PRISM-SRM assay was around approximately 10,000 VCaP cells in a mixed cell population model of VCaP and LNCaP cells. Interestingly, ERG protein could be detected in as few as 600 VCaP cells spiked into female urine. The sensitivity of the in-house enzyme-linked immunosorbent assay (ELISA) was similar to the PRISM-SRM assay, with detection of 30 pg of purified recombinant ERG3 protein and 10,000 VCaP cells. On the other hand, qRT-PCR exhibited a higher sensitivity, as TMPRSS2-ERG transcripts were detected in as few as 100 VCaP cells, in comparison to NanoString methodologies which detected ERG from 10,000 cells. Conclusions: Based on this data, we propose that the detection of both ERG transcriptional products with RNA-based assays, as well as protein products of ERG using PRISM-SRM assays, may be of clinical value in developing diagnostics and prognostics assays for prostate cancer given their sensitivity, specificity, and reproducibility.« less

  9. System and method for the detection of anomalies in an image

    DOE Patents [OSTI]

    Prasad, Lakshman; Swaminarayan, Sriram

    2013-09-03

    Preferred aspects of the present invention can include receiving a digital image at a processor; segmenting the digital image into a hierarchy of feature layers comprising one or more fine-scale features defining a foreground object embedded in one or more coarser-scale features defining a background to the one or more fine-scale features in the segmentation hierarchy; detecting a first fine-scale foreground feature as an anomaly with respect to a first background feature within which it is embedded; and constructing an anomalous feature layer by synthesizing spatially contiguous anomalous fine-scale features. Additional preferred aspects of the present invention can include detecting non-pervasive changes between sets of images in response at least in part to one or more difference images between the sets of images.

  10. Methods of sequencing and detection using energy transfer labels with cyanine dyes as donor chromophores

    DOE Patents [OSTI]

    Glazer, Alexander N. (Orinda, CA); Mathies, Richard A. (Moraga, CA); Hung, Su-Chun (Richmond, CA); Ju, Jingyue (Redwood City, CA)

    2000-01-01

    Cyanine dyes are used as the donor fluorophore in energy transfer labels in which light energy is absorbed by a donor fluorophore and transferred to an acceptor fluorophore which responds to the transfer by emitting fluorescent light for detection. The cyanine dyes impart an unusually high sensitivity to the labels thereby improving their usefulness in a wide variety of biochemical procedures, particularly nucleic acid sequencing, nucleic acid fragment sizing, and related procedures.

  11. Oil and gas exploration system and method for detecting trace amounts of hydrocarbon gases in the atmosphere

    DOE Patents [OSTI]

    Wamsley, Paula R. (Littleton, CO); Weimer, Carl S. (Littleton, CO); Nelson, Loren D. (Evergreen, CO); O'Brien, Martin J. (Pine, CO)

    2003-01-01

    An oil and gas exploration system and method for land and airborne operations, the system and method used for locating subsurface hydrocarbon deposits based upon a remote detection of trace amounts of gases in the atmosphere. The detection of one or more target gases in the atmosphere is used to indicate a possible subsurface oil and gas deposit. By mapping a plurality of gas targets over a selected survey area, the survey area can be analyzed for measurable concentration anomalies. The anomalies are interpreted along with other exploration data to evaluate the value of an underground deposit. The system includes a differential absorption lidar (DIAL) system with a spectroscopic grade laser light and a light detector. The laser light is continuously tunable in a mid-infrared range, 2 to 5 micrometers, for choosing appropriate wavelengths to measure different gases and avoid absorption bands of interference gases. The laser light has sufficient optical energy to measure atmospheric concentrations of a gas over a path as long as a mile and greater. The detection of the gas is based on optical absorption measurements at specific wavelengths in the open atmosphere. Light that is detected using the light detector contains an absorption signature acquired as the light travels through the atmosphere from the laser source and back to the light detector. The absorption signature of each gas is processed and then analyzed to determine if a potential anomaly exists.

  12. Rosetta stone method for detecting protein function and protein-protein interactions from genome sequences

    DOE Patents [OSTI]

    Eisenberg, David; Marcotte, Edward M.; Pellegrini, Matteo; Thompson, Michael J.; Yeates, Todd O.

    2002-10-15

    A computational method system, and computer program are provided for inferring functional links from genome sequences. One method is based on the observation that some pairs of proteins A' and B' have homologs in another organism fused into a single protein chain AB. A trans-genome comparison of sequences can reveal these AB sequences, which are Rosetta Stone sequences because they decipher an interaction between A' and B. Another method compares the genomic sequence of two or more organisms to create a phylogenetic profile for each protein indicating its presence or absence across all the genomes. The profile provides information regarding functional links between different families of proteins. In yet another method a combination of the above two methods is used to predict functional links.

  13. Method and apparatus for detecting and/or imaging clusters of small scattering centers in the body

    DOE Patents [OSTI]

    Perez-Mendez, V.; Sommer, F.G.

    1982-07-13

    An ultrasonic method and apparatus are provided for detecting and imaging clusters of small scattering centers in the breast wherein periodic pulses are applied to an ultrasound emitting transducer and projected into the body, thereafter being received by at least one receiving transducer positioned to receive scattering from the scattering center clusters. The signals are processed to provide an image showing cluster extent and location. 6 figs.

  14. Method and apparatus for detecting and/or imaging clusters of small scattering centers in the body

    DOE Patents [OSTI]

    Perez-Mendez, Victor (Berkeley, CA); Sommer, Frank G. (Palo Alto, CA)

    1982-01-01

    An ultrasonic method and apparatus are provided for detecting and imaging clusters of small scattering centers in the breast wherein periodic pulses are applied to an ultrasound emitting transducer and projected into the body, thereafter being received by at least one receiving transducer positioned to receive scattering from the scattering center clusters. The signals are processed to provide an image showing cluster extent and location.

  15. Photo-activated luminescence sensor and method of detecting trichloroethylene and related volatile organochloride compounds

    DOE Patents [OSTI]

    Dinh, T.V.

    1996-06-11

    A sensor for detecting trichloroethylene and related volatile organochloride compounds uses a photo-activator that produces a photo-product complex with the contaminant. Characteristics of the light emitted from the complex will indicate the presence of the contaminant. A probe containing the photo-activator has an excitation light interface and a contaminant interface. One particular embodiment uses a porous membrane as the contaminant interface, so that the contaminant can migrate there through to the photo-activator and thereby form the complex. 23 figs.

  16. Method for early detection of infectious mononucleosis by identifying Inmono proteins

    DOE Patents [OSTI]

    Willard, Karen E. (Woodridge, IL)

    1984-01-01

    Early detection of infectious mononucleosis is carried out using a sample of human blood by isolating and identifying the presence of Inmono proteins in the sample from a two-dimensional protein map with the proteins being characterized by having isoelectric banding as measured in urea of about -16 to -17 with respect to certain isoelectric point standards and molecular mass of about 70 to 75 K daltons as measured in the presence of sodium dodecylsulfate containing polyacrylamide gels, the presence of the Inmono proteins being correlated with the existence of infectious mononucleosis.

  17. Method of and device for detecting oil pollutions on water surfaces

    DOE Patents [OSTI]

    Belov, Michael Leonidovich; Gorodnichev, Victor Aleksandrovich; Kozintsev, Valentin Ivanovich; Smimova, Olga Alekseevna; Fedotov, Yurii Victorovich; Khroustaleva, Anastasiva Michailovnan

    2008-08-26

    Detection of oil pollution on water surfaces includes providing echo signals obtained from optical radiation of a clean water area at two wavelengths, optically radiating an investigated water area at two wavelengths and obtaining echo signals from the optical radiation of the investigated water area at the two wavelengths, comparing the echo signals obtained from the radiation of the investigated area at two wavelengths with the echo signals obtained from the radiation of the clean water area, and based on the comparison, determining presence or absence of oil pollution in the investigated water area.

  18. Photo-activated luminescence sensor and method of detecting trichloroethylene and related volatile organochloride compounds

    DOE Patents [OSTI]

    Dinh, Tuan V. (Knoxville, TN)

    1996-01-01

    A sensor for detecting trichloroethylene and related volatile organochloride compounds uses a photo-activator that produces a photo-product complex with the contaminant. Characteristics of the light emitted from the complex will indicate the presence of the contaminant. A probe containing the photo-activator has an excitation light interface and a contaminant interface. One particular embodiment uses a porous membrane as the contaminant interface, so that the contaminant can migrate therethrough to the photo-activator and thereby form the complex.

  19. Method to improve reliability of a fuel cell system using low performance cell detection at low power operation

    DOE Patents [OSTI]

    Choi, Tayoung; Ganapathy, Sriram; Jung, Jaehak; Savage, David R.; Lakshmanan, Balasubramanian; Vecasey, Pamela M.

    2013-04-16

    A system and method for detecting a low performing cell in a fuel cell stack using measured cell voltages. The method includes determining that the fuel cell stack is running, the stack coolant temperature is above a certain temperature and the stack current density is within a relatively low power range. The method further includes calculating the average cell voltage, and determining whether the difference between the average cell voltage and the minimum cell voltage is greater than a predetermined threshold. If the difference between the average cell voltage and the minimum cell voltage is greater than the predetermined threshold and the minimum cell voltage is less than another predetermined threshold, then the method increments a low performing cell timer. A ratio of the low performing cell timer and a system run timer is calculated to identify a low performing cell.

  20. Geophysical methods for coal seam variability detection in front of mining face. Report No. 1, state of the art report

    SciTech Connect (OSTI)

    Zakolski, R.

    1980-07-01

    Problems in detecting geologic faults or washouts in coal seams by the use of seismic waves are considered. For transmission, the shot point should not be greater than 500 m from the detection point. A minimum thickness of the seam for transmission is equivalent to the lower limit of thickness for mining. The interpretation of the results is more difficult for thick seams (25 m) and the resolution is lower. The throw of a fault should be equal to the seam thickness or greater; throws of half the thickness can be detected only in favorable conditions; the fault must not be parallel to the propagation. The nature of the fault or washout cannot usually be determined. Problems are even greater when use is made of reflected waves: shorter distances (< 250 m), inclination to seam plane must be 25 to 30/sup 0/ and angle of incidence at a plane of the seam is equal to the angle of reflection. The theory of such measurements is given, the use of models for interpretation considered; the availability of equipment; and the processing of the data are discussed. (LTN)

  1. Method for detecting cancer in a single cell using mitochondrial correlation microscopy

    DOE Patents [OSTI]

    Gourley, Paul L.

    2012-03-06

    A method for distinguishing a normal cell from an abnormal cell, such as, for example a cancer cell or diseased cell, of the same tissue type using mitochondrial correlation microscopy.

  2. Method of detecting cancer in a single cell using mitochondrial correlation microscopy

    DOE Patents [OSTI]

    Gourley, Paul L

    2013-06-25

    A method for distinguishing a normal cell from an abnormal cell, such as, for example a cancer cell or diseased cell, of the same tissue type using mitochondrial correlation microscopy.

  3. Nondestructive method for detecting defects in photodetector and solar cell devices

    DOE Patents [OSTI]

    Sawyer, David E.

    1981-01-01

    The invention described herein is a method for locating semiconductor device defects and for measuring the internal resistance of such devices by making use of the intrinsic distributed resistance nature of the devices. The method provides for forward-biasing a solar cell or other device while it is scanning with an optical spot. The forward-biasing is achieved with either an illuminator light source or an external current source.

  4. Nondestructive method for detecting defects in photodetector and solar cell devices

    DOE Patents [OSTI]

    Not Available

    The invention described herein is a method for locating semiconductor device defects and for measuring the internal resistance of such devices by making use of the intrinsic distributed resistance nature of the devices. The method provides for forward-biasing a solar cell or other device while it is scanning with an optical spot. The forward-biasing is achieved with either an illuminator light source or an external current source.

  5. Systems and methods for selective detection and imaging in coherent Raman microscopy by spectral excitation shaping

    DOE Patents [OSTI]

    Xie, Xiaoliang Sunney; Freudiger, Christian; Min, Wei

    2016-03-15

    A microscopy imaging system is disclosed that includes a light source system, a spectral shaper, a modulator system, an optics system, an optical detector and a processor. The light source system is for providing a first train of pulses and a second train of pulses. The spectral shaper is for spectrally modifying an optical property of at least some frequency components of the broadband range of frequency components such that the broadband range of frequency components is shaped producing a shaped first train of pulses to specifically probe a spectral feature of interest from a sample, and to reduce information from features that are not of interest from the sample. The modulator system is for modulating a property of at least one of the shaped first train of pulses and the second train of pulses at a modulation frequency. The optical detector is for detecting an integrated intensity of substantially all optical frequency components of a train of pulses of interest transmitted or reflected through the common focal volume. The processor is for detecting a modulation at the modulation frequency of the integrated intensity of substantially all of the optical frequency components of the train of pulses of interest due to the non-linear interaction of the shaped first train of pulses with the second train of pulses as modulated in the common focal volume, and for providing an output signal for a pixel of an image for the microscopy imaging system.

  6. RCUT: A Non-Invasive Method for Detection, Location, and Quantification of Radiological Contaminants in Pipes and Ducts - 12514

    SciTech Connect (OSTI)

    Bratton, Wesley L.; Maresca, Joseph W. Jr.; Beck, Deborah A.

    2012-07-01

    Radiological Characterization Using Tracers (RCUT) is a minimally invasive method for detection and location of residual radiological contamination in pipes and ducts. The RCUT technology utilizes reactive gaseous tracers that dissociate when exposed to gamma and/or beta radiation emitting from a radiological contaminant in a pipe or duct. Sulfur hexafluoride (SF{sub 6}) was selected as a tracer for this radiological application, because it is a chemically inert gas that is both nonflammable, nontoxic, and breaks down when exposed to gamma radiation. Laboratory tests demonstrated that the tracer pair of SF{sub 6} and O{sub 2} formed SO{sub 2}F{sub 2} when exposed to a gamma or beta radioactive field, which indicated the presence of radiological contamination. Field application of RCUT involves first injecting the reactive tracers into the pipe to fill the pipe being inspected and allowing sufficient time for the tracer to interact with any contaminants present. This is followed by the injection of an inert gas at one end of the pipe to push the reactive tracer at a known or constant flow velocity along the pipe and then out the exit and sampling port at the end of the pipeline where its concentration is measured by a gas chromatograph. If a radiological contaminant is present in the pipe being tested, the presence of SO{sub 2}F{sub 2} will be detected. The time of arrival of the SO{sub 2}F{sub 2} can be used to locate the contaminant. If the pipe is free of radiological contamination, no SO{sub 2}F{sub 2} will be detected. RCUT and PCUT are both effective technologies that can be used to detect contamination within pipelines without the need for mechanical or human inspection. These methods can be used to detect, locate, and/or estimate the volume of a variety of radioactive materials and hazardous chemicals such as chlorinated solvents, petroleum products, and heavy metals. While further optimization is needed for RCUT, the key first step of identification of a tracer compound appropriate for the application of detecting radioactive pipeline contamination through the detection of decomposition products of SF{sub 6} has been demonstrated. Other tracer gases that will also undergo radiolysis will be considered in the future. The next step for the RCUT development process is conducting laboratory scale tests using short pipelines to define analytical requirements, establish performance boundaries, and develop strategies for lower exposure levels. Studies to identify additional analytical techniques using equipment that is more field rugged than a GC/MS would also be beneficial. (authors)

  7. A Method for the Automatic Detection of Insect Clutter in Doppler-Radar Returns.

    SciTech Connect (OSTI)

    Luke,E.; Kollias, P.; Johnson, K.

    2006-06-12

    The accurate detection and removal of insect clutter from millimeter wavelength cloud radar (MMCR) returns is of high importance to boundary layer cloud research (e.g., Geerts et al., 2005). When only radar Doppler moments are available, it is difficult to produce a reliable screening of insect clutter from cloud returns because their distributions overlap. Hence, screening of MMCR insect clutter has historically involved a laborious manual process of cross-referencing radar moments against measurements from other collocated instruments, such as lidar. Our study looks beyond traditional radar moments to ask whether analysis of recorded Doppler spectra can serve as the basis for reliable, automatic insect clutter screening. We focus on the MMCR operated by the Department of Energy's (DOE) Atmospheric Radiation Measurement (ARM) program at its Southern Great Plains (SGP) facility in Oklahoma. Here, archiving of full Doppler spectra began in September 2003, and during the warmer months, a pronounced insect presence regularly introduces clutter into boundary layer returns.

  8. Scintillator assembly for alpha radiation detection and method of making the assembly

    DOE Patents [OSTI]

    McElhaney, S.A.; Bauer, M.L.; Chiles, M.M.

    1992-09-22

    A scintillator assembly for use in the detection of alpha radiation includes a body of optically-transparent epoxy and an amount of phosphor particles embedded within the body adjacent one surface thereof. When making the body, the phosphor particles are mixed with the epoxy when in an uncured condition and permitted to settle to the bottom surface of a mold within which the epoxy/phosphor mixture is contained. When the mixture subsequently cures to form a hardened body, the one surface of the body which cured against the bottom surface of the mold is coated with a thin layer of opaque material for preventing ambient light form entering the body through the one surface. The layer of opaque material is thereafter coated with a layer of protective material to provide the assembly with a damage-resistant entrance window. 6 figs.

  9. Scintillator assembly for alpha radiation detection and method of making the assembly

    DOE Patents [OSTI]

    McElhaney, Stephanie A. (Oak Ridge, TN); Bauer, Martin L. (Oak Ridge, TN); Chiles, Marion M. (Koxville, TN)

    1992-01-01

    A scintillator assembly for use in the detection of alpha radiation includes a body of optically-transparent epoxy and an amount of phosphor particles embedded within the body adjacent one surface thereof. When making the body, the phosphor particles are mixed with the epoxy when in an uncured condition and permitted to settle to the bottom surface of a mold within which the epoxy/phosphor mixture is contained. When the mixture subsequently cures to form a hardened body, the one surface of the body which cured against the bottom surface of the mold is coated with a thin layer of opaque material for preventing ambient light form entering the body through the one surface. The layer of opaque material is thereafter coated with a layer of protective material to provide the assembly with a damage-resistant entrance window.

  10. Method and apparatus of spectro-acoustically enhanced ultrasonic detection for diagnostics

    DOE Patents [OSTI]

    Vo-Dinh, Tuan (Knoxville, TN); Norton, Stephen J. (Raleigh, NC)

    2001-01-01

    An apparatus for detecting a discontinuity in a material includes a source of electromagnetic radiation has a wavelength and an intensity sufficient to induce an enhancement in contrast between a manifestation of an acoustic property in the material and of the acoustic property in the discontinuity, as compared to when the material is not irradiated by the electromagnetic radiation. An acoustic emitter directs acoustic waves to the discontinuity in the material. The acoustic waves have a sensitivity to the acoustic property. An acoustic receiver receives the acoustic waves generated by the acoustic emitter after the acoustic waves have interacted with the material and the discontinuity. The acoustic receiver also generates a signal representative of the acoustic waves received by the acoustic receiver. A processor, in communication with the acoustic receiver and responsive to the signal generated by the acoustic receiver, is programmed to generate informational output about the discontinuity based on the signal generated by the acoustic receiver.

  11. Method and apparatus for generating motor current spectra to enhance motor system fault detection

    DOE Patents [OSTI]

    Linehan, Daniel J.; Bunch, Stanley L.; Lyster, Carl T.

    1995-01-01

    A method and circuitry for sampling periodic amplitude modulations in a nonstationary periodic carrier wave to determine frequencies in the amplitude modulations. The method and circuit are described in terms of an improved motor current signature analysis. The method insures that the sampled data set contains an exact whole number of carrier wave cycles by defining the rate at which samples of motor current data are collected. The circuitry insures that a sampled data set containing stationary carrier waves is recreated from the analog motor current signal containing nonstationary carrier waves by conditioning the actual sampling rate to adjust with the frequency variations in the carrier wave. After the sampled data is transformed to the frequency domain via the Discrete Fourier Transform, the frequency distribution in the discrete spectra of those components due to the carrier wave and its harmonics will be minimized so that signals of interest are more easily analyzed.

  12. Method and apparatus for generating motor current spectra to enhance motor system fault detection

    DOE Patents [OSTI]

    Linehan, D.J.; Bunch, S.L.; Lyster, C.T.

    1995-10-24

    A method and circuitry are disclosed for sampling periodic amplitude modulations in a nonstationary periodic carrier wave to determine frequencies in the amplitude modulations. The method and circuit are described in terms of an improved motor current signature analysis. The method insures that the sampled data set contains an exact whole number of carrier wave cycles by defining the rate at which samples of motor current data are collected. The circuitry insures that a sampled data set containing stationary carrier waves is recreated from the analog motor current signal containing nonstationary carrier waves by conditioning the actual sampling rate to adjust with the frequency variations in the carrier wave. After the sampled data is transformed to the frequency domain via the Discrete Fourier Transform, the frequency distribution in the discrete spectra of those components due to the carrier wave and its harmonics will be minimized so that signals of interest are more easily analyzed. 29 figs.

  13. Performance of the moving voxel image reconstruction (MVIR) method in the fixed site detection system (FSDS) prototype

    SciTech Connect (OSTI)

    Estep, Robert J.

    2012-05-31

    We have developed a dynamic image reconstruction method called MVIR (Moving Voxel Image Reconstruction) for lane detection in multilane portal monitor systems. MVIR was evaluated for use in the Fixed Site Detection System, a prototype three-lane portal monitor system for EZ-pass toll plazas. As a baseline, we compared MVIR with a static image reconstruction method in analyzing the same real and simulated data sets. Performance was judged by the distributions of image intensities for source and no-source vehicles over many trials as a function of source strength. We found that MVIR produced significantly better results in all cases. The performance difference was greatest at low count rates, where source/no-source distributions were well separated with the MVIR method, allowing reliable source vehicle identification with a low probability of false positive identifications. Static reconstruction of the same data produced overlapping distributions that made source vehicle identification unreliable. The performance of the static method was acceptable at high count rates. Both algorithms reliably identified two strong sources passing through at nearly the same time.

  14. Kits and methods of detection using cellulose binding domain fusion proteins

    DOE Patents [OSTI]

    Shoseyov, O.; Yosef, K.

    1998-04-14

    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques. 16 figs.

  15. Kits and methods of detection using cellulose binding domain fusion proteins

    DOE Patents [OSTI]

    Shoseyov, Oded (Karmey Yosef, IL)

    1998-01-01

    A cellulose binding domain (CBD) having a high affinity for crystalline cellulose and chitin is disclosed, along with methods for the molecular cloning and recombinant production thereof. Fusion products comprising the CBD and a second protein are likewise described. A wide range of applications are contemplated for both the CBD and the fusion products, including drug delivery, affinity separations, and diagnostic techniques.

  16. Fiber optic detector and method for using same for detecting chemical species

    DOE Patents [OSTI]

    Baylor, Lewis C. (North Augusta, SC); Buchanan, Bruce R. (Perkiomenville, PA)

    1995-01-01

    An optical sensing device for uranyl and other substances, a method for making an optical sensing device and a method for chemically binding uranyl and other indicators to glass, quartz, cellulose and similar substrates. The indicator, such as arsenazo III, is immobilized on the substrate using a chemical binding process. The immobilized arsenazo III causes uranyl from a fluid sample to bind irreversibly to the substrate at its active sites, thus causing absorption of a portion of light transmitted through the substrate. Determination of the amount of light absorbed, using conventional means, yields the concentration of uranyl present in the sample fluid. The binding of uranyl on the substrate can be reversed by subsequent exposure of the substrate to a solution of 2,6-pyridinedicarboxylic acid. The chemical binding process is suitable for similarly binding other indicators, such as bromocresol green.

  17. Elastomeric optical fiber sensors and method for detecting and measuring events occurring in elastic materials

    DOE Patents [OSTI]

    Muhs, Jeffrey D. (Lenoir City, TN); Capps, Gary J. (Knoxville, TN); Smith, David B. (Oak Ridge, TN); White, Clifford P. (Knoxville, TN)

    1994-01-01

    Fiber optic sensing means for the detection and measurement of events such as dynamic loadings imposed upon elastic materials including cementitious materials, elastomers, and animal body components and/or the attrition of such elastic materials are provided. One or more optical fibers each having a deformable core and cladding formed of an elastomeric material such as silicone rubber are embedded in the elastic material. Changes in light transmission through any of the optical fibers due the deformation of the optical fiber by the application of dynamic loads such as compression, tension, or bending loadings imposed on the elastic material or by the attrition of the elastic material such as by cracking, deterioration, aggregate break-up, and muscle, tendon, or organ atrophy provide a measurement of the dynamic loadings and attrition. The fiber optic sensors can be embedded in elastomers subject to dynamic loadings and attrition such as commonly used automobiles and in shoes for determining the amount and frequency of the dynamic loadings and the extent of attrition. The fiber optic sensors are also useable in cementitious material for determining the maturation thereof.

  18. Method and apparatus for detecting internal structures of bulk objects using acoustic imaging

    DOE Patents [OSTI]

    Deason, Vance A. (Idaho Falls, ID); Telschow, Kenneth L. (Idaho Falls, ID)

    2002-01-01

    Apparatus for producing an acoustic image of an object according to the present invention may comprise an excitation source for vibrating the object to produce at least one acoustic wave therein. The acoustic wave results in the formation of at least one surface displacement on the surface of the object. A light source produces an optical object wavefront and an optical reference wavefront and directs the optical object wavefront toward the surface of the object to produce a modulated optical object wavefront. A modulator operatively associated with the optical reference wavefront modulates the optical reference wavefront in synchronization with the acoustic wave to produce a modulated optical reference wavefront. A sensing medium positioned to receive the modulated optical object wavefront and the modulated optical reference wavefront combines the modulated optical object and reference wavefronts to produce an image related to the surface displacement on the surface of the object. A detector detects the image related to the surface displacement produced by the sensing medium. A processing system operatively associated with the detector constructs an acoustic image of interior features of the object based on the phase and amplitude of the surface displacement on the surface of the object.

  19. Sensitive ion detection device and method for analysis of compounds as vapors in gases

    DOE Patents [OSTI]

    Denton, M. Bonner; Sperline, Roger P.

    2015-09-15

    An ion mobility spectrometer (IMS) for the detection of trace gaseous molecular compounds dissolved or suspended in a carrier gas, particularly in ambient air, without preconcentration or the trapping of analyte particles. The IMS of the invention comprises an ionization volume of greater than 5 cm.sup.3 and preferably greater than 100 cm.sup.3. The larger size ionizers of this invention enable analysis of trace (<1 ppb) of sample compounds in the gas phase. To facilitate efficient ion motion through the large volume ionization and reaction regions of the IMS, an electric field gradient can be provided in the ionization region or in both the ionization and reaction regions. The systems can be implemented with radioactive ionization sources, corona discharge ion sources or ions can be formed by photoionization. In specific embodiments, particularly when the sample gas is ambient air, the sample gas is heater prior to entry into the instrument, the instrument is run at temperatures above ambient, and the instrument can be heated by contact with heated sample gas exiting the instrument.

  20. Sensitive ion detection device and method for analysis of compounds as vapors in gases

    DOE Patents [OSTI]

    Denton, M. Bonner; Sperline, Roger P

    2014-02-18

    An ion mobility spectrometer (IMS) for the detection of trace gaseous molecular compounds dissolved or suspended in a carrier gas, particularly in ambient air, without preconcentration or the trapping of analyte particles. The IMS of the invention comprises an ionization volume of greater than 5 cm.sup.3 and preferably greater than 100 cm.sup.3. The larger size ionizers of this invention enable analysis of trace (<1 ppb) of sample compounds in the gas phase. To facilitate efficient ion motion through the large volume ionization and reaction regions of the IMS, an electric field gradient can be provided in the ionization region or in both the ionization and reaction regions. The systems can be implemented with radioactive ionization sources, corona discharge ion sources or ions can be formed by photoionization. In specific embodiments, particularly when the sample gas is ambient air, the sample gas is heater prior to entry into the instrument, the instrument is run at temperatures above ambient, and the instrument can be heated by contact with heated sample gas exiting the instrument.

  1. ASSESSMENT OF HYDROCARBON SEEPAGE DETECTION METHODS ON THE FORT PECK RESERVATION, NORTHEAST MONTANA

    SciTech Connect (OSTI)

    Lawrence M. Monson

    2003-06-30

    Surface exploration techniques have been employed in separate study areas on the Fort Peck Reservation in northeastern Montana. Anomalies associated with hydrocarbon seepage are documented in all three areas and a variety of surface exploration techniques can be compared. In a small area with established production, Head Gas and Thermal Desorption methods best match production; other methods also map depletion. In a moderate-size area that has prospects defined by 3D seismic data, Head Gas along with Microbial, Iodine, and Eh soil anomalies are all associated with the best hydrocarbon prospect. In a large area that contains many curvilinear patterns observed on Landsat images, that could represent micro-seepage chimneys, results are inconclusive. Reconnaissance mapping using Magnetic Susceptibility has identified a potential prospect; subsequent Soil Gas and Head Gas surveys suggest hydrocarbon potential. In the final year of this project the principle contractor, the Fort Peck Tribes, completed a second survey in the Wicape 3D Seismic Prospect Area (also known as Area 6 in Phase I of the project) and sampled several Landsat image features contained in the Smoke Creek Aeromag Anomaly Area (also known as Area 1 in Phase II of the project). Methods determined to be most useful in Phases I and II, were employed in this final Phase III of the study. The Southwest Wicape seismic anomaly was only partially confirmed. The abundant curvilinears proposed to be possible hydrocarbon micro-seepage chimneys in the Smoke Creek Area were not conclusively verified as such. Insufficient sampling of background data precludes affirmative identification of these mostly topographic Landsat features as gas induced soil and vegetation anomalies. However relatively higher light gas concentrations were found associated with some of the curvilinears. Based on the findings of this work the Assiniboine & Sioux Tribes of the Fort Peck Reservation intend to utilize surface hydrocarbon exploration techniques for future identification and confirmation of oil and gas prospects.

  2. Method for warning of radiological and chemical agents using detection paints on a vehicle surface

    DOE Patents [OSTI]

    Farmer, Joseph C. (Tracy, CA); Brunk, James L. (Martinez, CA); Day, S. Daniel (Danville, CA)

    2012-03-27

    A paint that warns of radiological or chemical substances comprising a paint operatively connected to the surface, an indicator material carried by the paint that provides an indication of the radiological or chemical substances, and a thermo-activation material carried by the paint. In one embodiment, a method of warning of radiological or chemical substances comprising the steps of painting a surface with an indicator material, and monitoring the surface for indications of the radiological or chemical substances. In another embodiment, a paint is operatively connected to a vehicle and an indicator material is carried by the paint that provides an indication of the radiological or chemical substances.

  3. Method and apparatus for remote tube crevice detection by current and voltage probe resistance measurement

    DOE Patents [OSTI]

    Kikta, T.J.; Mitchell, R.D.

    1992-11-24

    A method and apparatus for determining the extent of contact between an electrically conducting tube and an electrically conductive tubesheet surrounding the tube, based upon the electrical resistance of the tube and tubesheet. A constant current source is applied to the interior of the electrically conducting tube by probes and a voltmeter is connected between other probes to measure the voltage at the point of current injection, which is inversely proportional to the amount of contact between the tube and tubesheet. Namely, the higher the voltage measured by the voltmeter, the less contact between the tube and tubesheet. 4 figs.

  4. Monoclonal antibodies for the separate detection of halodeoxyuridines and method for their use

    DOE Patents [OSTI]

    Vanderlaan, Martin (Danville, CA); Watkins, Bruce E. (Livermore, CA); Stanker, Larry H. (Livermore, CA)

    1991-01-01

    Monoclonal antibodies are described which have specific affinities for halogenated nucleoside analogs and are preferentially selective for one particular halogen. Such antibodies, when incorporated into immunochemical reagents, may be used to identify and independently quantify the cell division character of more than one population or subpopulation in flow cytometric measurements. Independent assessment of division activity in cell sub-populations facilitates selection of appropriate time and dose for administration of anti-proliferative agents. The hybridomas which secrete halogen selective antibodies and the method of making them are described.

  5. Monoclonal antibodies for the separate detection of halodeoxyuridines and method for their use

    DOE Patents [OSTI]

    Vanderlaan, M.; Watkins, B.E.; Stanker, L.H.

    1991-10-01

    Monoclonal antibodies are described which have specific affinities for halogenated nucleoside analogs and are preferentially selective for one particular halogen. Such antibodies, when incorporated into immunochemical reagents, may be used to identify and independently quantify the cell division character of more than one population or subpopulation in flow cytometric measurements. Independent assessment of division activity in cell sub-populations facilitates selection of appropriate time and dose for administration of anti-proliferative agents. The hybridomas which secrete halogen selective antibodies and the method of making them are described. 14 figures.

  6. Method and apparatus for millimeter-wave detection of thermal waves for materials evaluation

    DOE Patents [OSTI]

    Gopalsami, Nachappa; Raptis, Apostolos C.

    1991-01-01

    A method and apparatus for generating thermal waves in a sample and for measuring thermal inhomogeneities at subsurface levels using millimeter-wave radiometry. An intensity modulated heating source is oriented toward a narrow spot on the surface of a material sample and thermal radiation in a narrow volume of material around the spot is monitored using a millimeter-wave radiometer; the radiometer scans the sample point-by-point and a computer stores and displays in-phase and quadrature phase components of thermal radiations for each point on the scan. Alternatively, an intensity modulated heating source is oriented toward a relatively large surface area in a material sample and variations in thermal radiation within the full field of an antenna array are obtained using an aperture synthesis radiometer technique.

  7. Real-time detection method and system for identifying individual aerosol particles

    DOE Patents [OSTI]

    Gard, Eric E. (San Francisco, CA); Coffee, Keith R. (Patterson, CA); Frank, Matthias (Oakland, CA); Tobias, Herbert J. (Kensington, CA); Fergenson, David P. (Alamo, CA); Madden, Norm (Livermore, CA); Riot, Vincent J. (Berkeley, CA); Steele, Paul T. (Livermore, CA); Woods, Bruce W. (Livermore, CA)

    2007-08-21

    An improved method and system of identifying individual aerosol particles in real time. Sample aerosol particles are collimated, tracked, and screened to determine which ones qualify for mass spectrometric analysis based on predetermined qualification or selection criteria. Screening techniques include one or more of determining particle size, shape, symmetry, and fluorescence. Only qualifying particles passing all screening criteria are subject to desorption/ionization and single particle mass spectrometry to produce corresponding test spectra, which is used to determine the identities of each of the qualifying aerosol particles by comparing the test spectra against predetermined spectra for known particle types. In this manner, activation cycling of a particle ablation laser of a single particle mass spectrometer is reduced.

  8. Real-Time Detection Method And System For Identifying Individual Aerosol Particles

    DOE Patents [OSTI]

    Gard, Eric Evan (San Francisco, CA); Fergenson, David Philip (Livermore, CA)

    2005-10-25

    A method and system of identifying individual aerosol particles in real time. Sample aerosol particles are compared against and identified with substantially matching known particle types by producing positive and negative test spectra of an individual aerosol particle using a bipolar single particle mass spectrometer. Each test spectrum is compared to spectra of the same respective polarity in a database of predetermined positive and negative spectra for known particle types and a set of substantially matching spectra is obtained. Finally the identity of the individual aerosol particle is determined from the set of substantially matching spectra by determining a best matching one of the known particle types having both a substantially matching positive spectrum and a substantially matching negative spectrum associated with the best matching known particle type.

  9. Method and apparatus for noble gas atom detection with isotopic selectivity

    DOE Patents [OSTI]

    Hurst, G. Samuel (Oak Ridge, TN); Payne, Marvin G. (Harriman, TN); Chen, Chung-Hsuan (Knoxville, TN); Parks, James E. (Oak Ridge, TN)

    1984-01-01

    Apparatus and methods of operation are described for determining, with isotopic selectivity, the number of noble gas atoms in a sample. The analysis is conducted within an evacuated chamber which can be isolated by a valve from a vacuum pumping system capable of producing a pressure of 10.sup.-8 Torr. Provision is made to pass pulses of laser beams through the chamber, these pulses having wavelengths appropriate for the resonance ionization of atoms of the noble gas under analysis. A mass filter within the chamber selects ions of a specific isotope of the noble gas, and means are provided to accelerate these selected ions sufficiently for implantation into a target. Specific types of targets are discussed. An electron measuring device produces a signal relatable to the number of ions implanted into the target and thus to the number of atoms of the selected isotope of the noble gas removed from the gas sample. The measurement can be continued until a substantial fraction, or all, of the atoms in the sample have been counted. Furthermore, additional embodiments of the apparatus are described for bunching the atoms of a noble gas for more rapid analysis, and for changing the target for repetitive cycling of the gas in the chamber. The number of repetitions of the cyclic steps depend upon the concentration of the isotope of interest, the separative efficiency of the mass filter, etc. The cycles are continued until a desired selectivity is achieved. Also described are components and a method of operation for a pre-enrichment operation for use when an introduction of a total sample would elevate the pressure within the chamber to levels in excess of those for operation of the mass filter, specifically a quadrupole mass filter. Specific examples of three noble gas isotope analyses are described.

  10. Methods for detecting and locating leaks in containment facilities using electrical potential data and electrical resistance tomographic imaging techniques

    DOE Patents [OSTI]

    Daily, W.D.; Laine, D.L.; Laine, E.F.

    1997-08-26

    Methods are provided for detecting and locating leaks in liners used as barriers in the construction of landfills, surface impoundments, water reservoirs, tanks, and the like. Electrodes are placed in the ground around the periphery of the facility, in the leak detection zone located between two liners if present, and/or within the containment facility. Electrical resistivity data is collected using these electrodes. This data is used to map the electrical resistivity distribution beneath the containment liner between two liners in a double-lined facility. In an alternative embodiment, an electrode placed within the lined facility is driven to an electrical potential with respect to another electrode placed at a distance from the lined facility (mise-a-la-masse). Voltage differences are then measured between various combinations of additional electrodes placed in the soil on the periphery of the facility, the leak detection zone, or within the facility. A leak of liquid though the liner material will result in an electrical potential distribution that can be measured at the electrodes. The leak position is located by determining the coordinates of an electrical current source pole that best fits the measured potentials with the constraints of the known or assumed resistivity distribution. 6 figs.

  11. Methods for detecting and locating leaks in containment facilities using electrical potential data and electrical resistance tomographic imaging techniques

    DOE Patents [OSTI]

    Daily, William D. (Livermore, CA); Laine, Daren L. (San Anotonio, TX); Laine, Edwin F. (Penn Valley, CA)

    2001-01-01

    Methods are provided for detecting and locating leaks in liners used as barriers in the construction of landfills, surface impoundments, water reservoirs, tanks, and the like. Electrodes are placed in the ground around the periphery of the facility, in the leak detection zone located between two liners if present, and/or within the containment facility. Electrical resistivity data is collected using these electrodes. This data is used to map the electrical resistivity distribution beneath the containment liner or between two liners in a double-lined facility. In an alternative embodiment, an electrode placed within the lined facility is driven to an electrical potential with respect to another electrode placed at a distance from the lined facility (mise-a-la-masse). Voltage differences are then measured between various combinations of additional electrodes placed in the soil on the periphery of the facility, the leak detection zone, or within the facility. A leak of liquid through the liner material will result in an electrical potential distribution that can be measured at the electrodes. The leak position is located by determining the coordinates of an electrical current source pole that best fits the measured potentials with the constraints of the known or assumed resistivity distribution.

  12. Methods for detecting and locating leaks in containment facilities using electrical potential data and electrical resistance tomographic imaging techniques

    DOE Patents [OSTI]

    Daily, William D. (Livermore, CA); Laine, Daren L. (San Antonio, TX); Laine, Edwin F. (Alamo, CA)

    1997-01-01

    Methods are provided for detecting and locating leaks in liners used as barriers in the construction of landfills, surface impoundments, water reservoirs, tanks, and the like. Electrodes are placed in the ground around the periphery of the facility, in the leak detection zone located between two liners if present, and/or within the containment facility. Electrical resistivity data is collected using these electrodes. This data is used to map the electrical resistivity distribution beneath the containment liner between two liners in a double-lined facility. In an alternative embodiment, an electrode placed within the lined facility is driven to an electrical potential with respect to another electrode placed at a distance from the lined facility (mise-a-la-masse). Voltage differences are then measured between various combinations of additional electrodes placed in the soil on the periphery of the facility, the leak detection zone, or within the facility. A leak of liquid though the liner material will result in an electrical potential distribution that can be measured at the electrodes. The leak position is located by determining the coordinates of an electrical current source pole that best fits the measured potentials with the constraints of the known or assumed resistivity distribution.

  13. Method for detecting and correcting for isotope burn-in during long-term neutron dosimetry exposure

    DOE Patents [OSTI]

    Ruddy, Francis H. (Monroeville, PA)

    1988-01-01

    A method is described for detecting and correcting for isotope burn-in during-long term neutron dosimetry exposure. In one embodiment, duplicate pairs of solid state track recorder fissionable deposits are used, including a first, fissionable deposit of lower mass to quantify the number of fissions occuring during the exposure, and a second deposit of higher mass to quantify the number of atoms of for instance .sup.239 Pu by alpha counting. In a second embodiment, only one solid state track recorder fissionable deposit is used and the resulting higher track densities are counted with a scanning electron microscope. This method is also applicable to other burn-in interferences, e.g., .sup.233 U in .sup.232 Th or .sup.238 Pu in .sup.237 Np.

  14. Method and apparatus for fast laser-pulse detection using gaseous plasmas

    DOE Patents [OSTI]

    McLellan, E.J.; Webb, J.A.

    1981-06-18

    The method and device of the instant invention is a detector of pulsed laser radiation which utilizes the electromotive force generated by the plasma formed when such radiation is focused onto a surface. Measurements are made with a 10.6 ..mu..m CO/sub 2/ laser capable of producing peak intensities of 10/sup 13/ W/cm/sup 2/ when directed through a converging lens. Evacuated detector response to such laser intensity if 1 kV signal peak amplitude and subnanosecond risetimes into a 50 ..cap omega.. load. Detector performance is found to be greatly altered with the introduction of a background gas. For example, with one atmosphere of air, the detector produces prompt signals of the order of 1 V with subnanosecond response for pulse trains lasting 100 ns. With argon, krypton, or zenon at pressures of the order of 10 torr, the detector generates trigger pulses of about 250 V amplitude and 0.2 ns risetimes. Such detectors are quite robust when irradiated with high intensity laser radiation and are useful for qualitative laser beam monitoring.

  15. Method and apparatus for fast laser pulse detection using gaseous plasmas

    DOE Patents [OSTI]

    McLellan, Edward J.; Webb, John A.

    1984-01-01

    The method and device of the instant invention is a detector of pulsed laser radiation which utilizes the electromotive force generated by the plasma formed when such radiation is focused onto a surface (1). Measurements are made with a 10.6 .mu.m CO.sub.2 laser capable of producing peak intensities of 10.sup.13 W/cm.sup.2 when directed through a converging lens (2). Evacuated detector response to such laser intensity is 1 kV signal peak amplitude and subnanosecond risetimes into a 50.OMEGA. load (3). Detector performance is found to be greatly altered with the introduction of a background gas (4). For example, with one atmosphere of air, the detector produces prompt signals of the order of 1 V with subnanosecond response for pulse trains lasting 100 ns. With argon, krypton, or zenon at pressures of the order of 10 torr, the detector generates "trigger pulses" of about 250 V amplitude and 0.2 ns risetimes. Such detectors are quite robust when irradiated with high intensity laser radiation and are useful for qualitative laser beam monitoring.

  16. Method for selective detection of explosives in mass spectrometer or ion mobility spectrometer at parts-per-quadrillion level

    DOE Patents [OSTI]

    Ewing, Robert G.; Atkinson, David A.; Clowers, Brian H.

    2015-09-01

    A method for selective detection of volatile and non-volatile explosives in a mass spectrometer or ion mobility spectrometer at a parts-per-quadrillion level without preconcentration is disclosed. The method comprises the steps of ionizing a carrier gas with an ionization source to form reactant ions or reactant adduct ions comprising nitrate ions (NO.sub.3.sup.-); selectively reacting the reactant ions or reactant adduct ions with at least one volatile or non-volatile explosive analyte at a carrier gas pressure of at least about 100 Ton in a reaction region disposed between the ionization source and an ion detector, the reaction region having a length which provides a residence time (tr) for reactant ions therein of at least about 0.10 seconds, wherein the selective reaction yields product ions comprising reactant ions or reactant adduct ions that are selectively bound to the at least one explosive analyte when present therein; and detecting product ions with the ion detector to determine presence or absence of the at least one explosive analyte.

  17. Electrical leakage detection circuit

    DOE Patents [OSTI]

    Wild, Arthur

    2006-09-05

    A method is provided for detecting electrical leakage between a power supply and a frame of a vehicle or machine. The disclosed method includes coupling a first capacitor between a frame and a first terminal of a power supply for a predetermined period of time. The current flowing between the frame and the first capacitor is limited to a predetermined current limit. It is determined whether the voltage across the first capacitor exceeds a threshold voltage. A first output signal is provided when the voltage across the capacitor exceeds the threshold voltage.

  18. System and method for ultrafast optical signal detecting via a synchronously coupled anamorphic light pulse encoded laterally

    DOE Patents [OSTI]

    Heebner, John E. (Livermore, CA)

    2010-08-03

    In one general embodiment, a method for ultrafast optical signal detecting is provided. In operation, a first optical input signal is propagated through a first wave guiding layer of a waveguide. Additionally, a second optical input signal is propagated through a second wave guiding layer of the waveguide. Furthermore, an optical control signal is applied to a top of the waveguide, the optical control signal being oriented diagonally relative to the top of the waveguide such that the application is used to influence at least a portion of the first optical input signal propagating through the first wave guiding layer of the waveguide. In addition, the first and the second optical input signals output from the waveguide are combined. Further, the combined optical signals output from the waveguide are detected. In another general embodiment, a system for ultrafast optical signal recording is provided comprising a waveguide including a plurality of wave guiding layers, an optical control source positioned to propagate an optical control signal towards the waveguide in a diagonal orientation relative to a top of the waveguide, at least one optical input source positioned to input an optical input signal into at least a first and a second wave guiding layer of the waveguide, and a detector for detecting at least one interference pattern output from the waveguide, where at least one of the interference patterns results from a combination of the optical input signals input into the first and the second wave guiding layer. Furthermore, propagation of the optical control signal is used to influence at least a portion of the optical input signal propagating through the first wave guiding layer of the waveguide.

  19. Detection method and observed data of high-energy gamma rays under the influence of quantum gravity

    SciTech Connect (OSTI)

    Kifune, T.

    2014-05-20

    The interaction of high-energy particles affected by quantum gravity is argued from the experimental viewpoint of raising a question, 'our detection method for high-energy ?-rays supplies trustworthy observation data and we are now seeing the true image of the universe through high-energy ?-rays?' The modified dispersion relation (MDR) for particles' energy and momentum is applied to the equation of energy-momentum conservation in particle reactions, to study the restriction imposed on the kinematic state of high-energy particles by the Lorentz invariance violation (LIV) due to quantum gravity, as a function of the incident particle energy of the reaction. The result suggests that the interaction utilized for ?-ray detection is not free from the effect of quantum gravity when ?-ray energy is higher than 10{sup 13} ? 10{sup 17} eV depending on models of MDR. Discussion is presented on the prospect of finding clear evidence of the LIV effect from ?-ray observations, as well as on the radiation and propagation mechanism of ?-rays under the influence of the LIV effect.

  20. Process Limits

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Process Limits Process Limits Limit Hard Soft core file size (blocks) 0 unlimited data seg size (kbytes) unlimited unlimited scheduling priority 0 0 file size (blocks) unlimited unlimited pending signals 4199424 4199424 max locked memory (kbytes) 32 32 max memory size (kbytes) unlimited unlimited open files 1024 1024 pipe size (512 bytes) 8 8 POSIX message queues (bytes) 819200 819200 real-time priority 0 0 stack size (kbytes) 10240 unlimited cpu time (seconds) unlimited unlimited max user

  1. Apparatus and method for detecting a magnetic anomaly contiguous to remote location by SQUID gradiometer and magnetometer systems

    DOE Patents [OSTI]

    Overton, W.C. Jr.; Steyert, W.A. Jr.

    1981-05-22

    A superconducting quantum interference device (SQUID) magnetic detection apparatus detects magnetic fields, signals, and anomalies at remote locations. Two remotely rotatable SQUID gradiometers may be housed in a cryogenic environment to search for and locate unambiguously magnetic anomalies. The SQUID magnetic detection apparatus can be used to determine the azimuth of a hydrofracture by first flooding the hydrofracture with a ferrofluid to create an artificial magnetic anomaly therein.

  2. Method and apparatus for selectively detecting one of two immiscible liquids in the presence of the other liquid

    DOE Patents [OSTI]

    Cry, John W. (Richland, WA); Kirkham, Randy R. (Richland, WA); McBride, John F. (Richland, WA); Simmons, Carver S. (Richland, WA); Gee, Glendon W. (Richland, WA)

    1990-01-01

    Oil is detected in the presence of water by placing a translucent, porous body of hydrophobic material in contact with the oil and water and detecting the amount by which light incident on the body is attenuated on propagation through the body.

  3. Method and apparatus for selectively detecting one of two immiscible liquids in the presence of the other liquid

    DOE Patents [OSTI]

    Cry, J.W.; Kirkham, R.R.; McBride, J.F.; Simmons, C.S.; Gee, G.W.

    1990-02-06

    Oil is detected in the presence of water by placing a translucent, porous body of hydrophobic material in contact with the oil and water and detecting the amount by which light incident on the body is attenuated on propagation through the body. 4 figs.

  4. Novel absorption detection techniques for capillary electrophoresis

    SciTech Connect (OSTI)

    Xue, Y.

    1994-07-27

    Capillary electrophoresis (CE) has emerged as one of the most versatile separation methods. However, efficient separation is not sufficient unless coupled to adequate detection. The narrow inner diameter (I.D.) of the capillary column raises a big challenge to detection methods. For UV-vis absorption detection, the concentration sensitivity is only at the {mu}M level. Most commercial CE instruments are equipped with incoherent UV-vis lamps. Low-brightness, instability and inefficient coupling of the light source with the capillary limit the further improvement of UV-vis absorption detection in CE. The goals of this research have been to show the utility of laser-based absorption detection. The approaches involve: on-column double-beam laser absorption detection and its application to the detection of small ions and proteins, and absorption detection with the bubble-shaped flow cell.

  5. Method and apparatus for simultaneous detection and measurement of charged particles at one or more levels of particle flux for analysis of same

    DOE Patents [OSTI]

    Denton, M. Bonner (Tucson, AZ); Sperline, Roger (Tucson, AZ), Koppenaal, David W. (Richland, WA), Barinaga, Charles J. (Richland, WA), Hieftje, Gary (Bloomington, IN), Barnes, IV, James H. (Santa Fe, NM); Atlas, Eugene (Irvine, CA)

    2009-03-03

    A charged particle detector and method are disclosed providing for simultaneous detection and measurement of charged particles at one or more levels of particle flux in a measurement cycle. The detector provides multiple and independently selectable levels of integration and/or gain in a fully addressable readout manner.

  6. System and method of reducing motion-induced noise in the optical detection of an ultrasound signal in a moving body of material

    DOE Patents [OSTI]

    Habeger, Jr., Charles C. (Smyrna, GA); LaFond, Emmanuel F. (Atlanta, GA); Brodeur, Pierre (Smyrna, GA); Gerhardstein, Joseph P. (Decatur, GA)

    2002-01-01

    The present invention provides a system and method to reduce motion-induced noise in the detection of ultrasonic signals in a moving sheet or body of material. An ultrasonic signal is generated in a sheet of material and a detection laser beam is moved along the surface of the material. By moving the detection laser in the same direction as the direction of movement of the sheet of material the amount of noise induced in the detection of the ultrasonic signal is reduced. The scanner is moved at approximately the same speed as the moving material. The system and method may be used for many applications, such in a paper making process or steel making process. The detection laser may be directed by a scanner. The movement of the scanner is synchronized with the anticipated arrival of the ultrasonic signal under the scanner. A photodetector may be used to determine when a ultrasonic pulse has been directed to the moving sheet of material so that the scanner may be synchronized the anticipated arrival of the ultrasonic signal.

  7. Systems and methods for detecting an image of an object by use of an X-ray beam having a polychromatic distribution

    DOE Patents [OSTI]

    Parham, Christopher; Zhong, Zhong; Pisano, Etta; Connor, Dean; Chapman, Leroy D.

    2010-06-22

    Systems and methods for detecting an image of an object using an X-ray beam having a polychromatic energy distribution are disclosed. According to one aspect, a method can include detecting an image of an object. The method can include generating a first X-ray beam having a polychromatic energy distribution. Further, the method can include positioning a single monochromator crystal in a predetermined position to directly intercept the first X-ray beam such that a second X-ray beam having a predetermined energy level is produced. Further, an object can be positioned in the path of the second X-ray beam for transmission of the second X-ray beam through the object and emission from the object as a transmitted X-ray beam. The transmitted X-ray beam can be directed at an angle of incidence upon a crystal analyzer. Further, an image of the object can be detected from a beam diffracted from the analyzer crystal.

  8. Method and apparatus for detecting the presence and thickness of carbon and oxide layers on EUV reflective surfaces

    DOE Patents [OSTI]

    Malinowski, Michael E.

    2005-01-25

    The characteristics of radiation that is reflected from carbon deposits and oxidation formations on highly reflective surfaces such as Mo/Si mirrors can be quantified and employed to detect and measure the presence of such impurities on optics. Specifically, it has been shown that carbon deposits on a Mo/Si multilayer mirror decreases the intensity of reflected HeNe laser (632.8 nm) light. In contrast, oxide layers formed on the mirror should cause an increase in HeNe power reflection. Both static measurements and real-time monitoring of carbon and oxide surface impurities on optical elements in lithography tools should be achievable.

  9. Method to detect the end-point for PCR DNA amplification using an ionically labeled probe and measuring impedance change

    DOE Patents [OSTI]

    Miles, Robin R.; Belgrader, Phillip; Fuller, Christopher D.

    2007-01-02

    Impedance measurements are used to detect the end-point for PCR DNA amplification. A pair of spaced electrodes are located on a surface of a microfluidic channel and an AC or DC voltage is applied across the electrodes to produce an electric field. An ionically labeled probe will attach to a complementary DNA segment, and a polymerase enzyme will release the ionic label. This causes the conductivity of the solution in the area of the electrode to change. This change in conductivity is measured as a change in the impedance been the two electrodes.

  10. Method and system for detecting polygon boundaries of structures in images as particle tracks through fields of corners and pixel gradients

    DOE Patents [OSTI]

    Paglieroni, David W. (Pleasanton, CA); Manay, Siddharth (Livermore, CA)

    2011-12-20

    A stochastic method and system for detecting polygon structures in images, by detecting a set of best matching corners of predetermined acuteness .alpha. of a polygon model from a set of similarity scores based on GDM features of corners, and tracking polygon boundaries as particle tracks using a sequential Monte Carlo approach. The tracking involves initializing polygon boundary tracking by selecting pairs of corners from the set of best matching corners to define a first side of a corresponding polygon boundary; tracking all intermediate sides of the polygon boundaries using a particle filter, and terminating polygon boundary tracking by determining the last side of the tracked polygon boundaries to close the polygon boundaries. The particle tracks are then blended to determine polygon matches, which may be made available, such as to a user, for ranking and inspection.

  11. Batteryless Chemical Detection - Energy Innovation Portal

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Advanced Materials Advanced Materials Find More Like This Return to Search Batteryless Chemical Detection Lawrence Livermore National Laboratory Contact LLNL About This Technology Publications: PDF Document Publication Advanced Materials, 2011, 23, 117-121. (1,804 KB) Technology Marketing Summary Existing nanosensor technologies employ gas, chemical, and biological detection methods that depend on an external power source (typically a battery) to operate. This limits conventional technologies by

  12. Systems and methods for detecting an image of an object using multi-beam imaging from an X-ray beam having a polychromatic distribution

    DOE Patents [OSTI]

    Parham, Christopher A; Zhong, Zhong; Pisano, Etta; Connor, Jr., Dean M

    2015-03-03

    Systems and methods for detecting an image of an object using a multi-beam imaging system from an x-ray beam having a polychromatic energy distribution are disclosed. According to one aspect, a method can include generating a first X-ray beam having a polychromatic energy distribution. Further, the method can include positioning a plurality of monochromator crystals in a predetermined position to directly intercept the first X-ray beam such that a plurality of second X-ray beams having predetermined energy levels are produced. Further, an object can be positioned in the path of the second X-ray beams for transmission of the second X-ray beams through the object and emission from the object as transmitted X-ray beams. The transmitted X-ray beams can each be directed at an angle of incidence upon one or more crystal analyzers. Further, an image of the object can be detected from the beams diffracted from the analyzer crystals.

  13. Cell Phone Detection Techniques

    SciTech Connect (OSTI)

    Pratt, Richard M.; Bunch, Kyle J.; Puzycki, David J.; Slaugh, Ryan W.; Good, Morris S.; McMakin, Douglas L.

    2007-10-01

    A team composed of Rick Pratt, Dave Puczyki, Kyle Bunch, Ryan Slaugh, Morris Good, and Doug McMakin teamed together to attempt to exploit cellular telephone features and detect if a person was carrying a cellular telephone into a Limited Area. The cell phones electromagnetic properties were measured, analyzed, and tested in over 10 different ways to determine if an exploitable signature exists. The method that appears to have the most potential for success without adding an external tag is to measure the RF spectrum, not in the cell phone band, but between 240 and 400MHz. Figures 1- 7 show the detected signal levels from cell phones from three different manufacturers.

  14. Methods for using redox liposome biosensors

    DOE Patents [OSTI]

    Cheng, Quan (SF, CA); Stevens, Raymond C. (La Jolla, CA)

    2002-01-01

    The present invention provides methods and compositions for detecting the presence of biologically-important analytes by using redox liposome biosensors. In particular, the present invention provides liposome/sol-gel electrodes suitable for the detection of a wide variety of organic molecules, including but not limited to bacterial toxins.

  15. Fingerprint detection

    DOE Patents [OSTI]

    Saunders, George C. (Rt. 1, Box 428B, Espanola, NM 87532)

    1992-01-01

    A method for detection and visualization of latent fingerprints is provided and includes contacting a substrate containing a latent print thereon with a colloidal metal composition for time sufficient to allow reaction of said colloidal metal composition with said latent print, and preserving or recording the observable print. Further, the method for detection and visualization of latent fingerprints can include contacting the metal composition-latent print reaction product with a secondary metal-containing solution for time sufficient to allow precipitation of said secondary metal thereby enhancing the visibility of the latent print, and preserving or recording the observable print.

  16. Method of detecting sulfur dioxide. [DOE patent application; 1,1,1-trimethyl-N-sulfinyl silanamine

    DOE Patents [OSTI]

    Spicer, L.D.; Bennett, D.W.; Davis, J.F.

    1981-06-12

    (CH/sub 3/)/sub 3/SiNSO is produced by the reaction of ((CH/sub 3/)/sub 3/Si)/sub 2/NH with SO/sub 2/. Also produced in the reaction are ((CH/sub 3/)/sub 3/Si)/sub 2/O and a new solid compound (NH/sub 4/)((CH/sub 3/)/sub 3/SiOSO/sub 2/). Both (C/sub 3/)/sub 3/SiNSO and (NH/sub 4/)((CH/sub 3/)/sub 3/SiOSO/sub 2/) have fluorescent properties. The reaction of the subject invention is used in a method of measuring the concentration of SO/sub 2/ pollutants in gases. By the method, a sample of gas is bubbled through a solution of ((CH/sub 3/)/sub 3/Si)/sub 2/NH, whereby any SO/sub 2/ present in the gas will react to produce the two fluorescent products. The measured fluorescence of these products can then be used to calculate the concentration of SO/sub 2/ in the original gas sample. The solid product (NH/sub 4/)((CH/sub 3/)/sub 3/SiOSO/sub 2/) may be used as a standard in solid state NMR spectroscopy.

  17. Method of using 5,10,15,20-tetrakis(carboxyphenyl)porphine for detecting cancers of the lung

    DOE Patents [OSTI]

    Cole, D.A.; Moody, D.C. III; Ellinwood, L.E.; Klein, M.G.

    1992-11-10

    A method is described for using tetra-aryl porphyrins for and, in particular, 5,10,15,20-tetrakis(4-carboxyphenyl)porphine as a fluorescent tracer for cancers of the lung, and as a radiotracer therefor as a complex with [sup 67]Cu. The latter complex also provides a source of beta radiation for selective destruction of lung malignancies as well as gamma radiation useful for image analysis of the lungs by single photon emission computed tomography, as an example, both in vivo. Copper-64 may be substituted for the [sup 67]Cu if only radiotracer characteristics are of interest. This lighter isotope of copper is a positron emitter, and positron emission tomography techniques can be used to locate the malignant tissue mass. 1 figure.

  18. Method of using 5,10,15,20-tetrakis(carboxyphenyl)porphine for detecting cancers of the lung

    DOE Patents [OSTI]

    Cole, Dean A. (60 San Juan St., Los Alamos, NM 87544); Moody, III, David C. (402 Pine Tree La., Boulder, CO 80304); Ellinwood, L. Edward (694 Sperber La., Grand Junction, CO 81506); Klein, M. Gerard (715 Victor Dr., Grand Junction, CO 81506)

    1992-01-01

    Method using tetra-aryl porphyrins for and, in particular, 5,10,15,20-tetrakis(4-carboxyphenyl)porphine as a fluorescent tracer for cancers of the lung, and as a radiotracer therefor as a complex with .sup.67 Cu. The latter complex also provides a source of beta radiation for selective destruction of lung malignancies as well as gamma radiation useful for image analysis of the situs thereof by single photon emission computed tomography, as an example, both in vivo. Copper-64 may be substituted for the .sup.67 Cu if only radiotracer characteristics are of interest. This lighter isotope of copper is a positron emitter, and positron emission tomography techniques cna be used to locate the malignant tissue mass.

  19. Advancing Explosives Detection Capabilities: Vapor Detection

    SciTech Connect (OSTI)

    Atkinson, David

    2012-10-15

    A new, PNNL-developed method provides direct, real-time detection of trace amounts of explosives such as RDX, PETN and C-4. The method selectively ionizes a sample before passing the sample through a mass spectrometer to detect explosive vapors. The method could be used at airports to improve aviation security.

  20. Advancing Explosives Detection Capabilities: Vapor Detection

    ScienceCinema (OSTI)

    Atkinson, David

    2014-07-24

    A new, PNNL-developed method provides direct, real-time detection of trace amounts of explosives such as RDX, PETN and C-4. The method selectively ionizes a sample before passing the sample through a mass spectrometer to detect explosive vapors. The method could be used at airports to improve aviation security.

  1. Portable modular detection system

    DOE Patents [OSTI]

    Brennan, James S. (Rodeo, CA); Singh, Anup (Danville, CA); Throckmorton, Daniel J. (Tracy, CA); Stamps, James F. (Livermore, CA)

    2009-10-13

    Disclosed herein are portable and modular detection devices and systems for detecting electromagnetic radiation, such as fluorescence, from an analyte which comprises at least one optical element removably attached to at least one alignment rail. Also disclosed are modular detection devices and systems having an integrated lock-in amplifier and spatial filter and assay methods using the portable and modular detection devices.

  2. Method for manufacturing solid-state thermal neutron detectors with simultaneous high thermal neutron detection efficiency (>50%) and neutron to gamma discrimination (>1.0E4)

    DOE Patents [OSTI]

    Nikolic, Rebecca J.; Conway, Adam M.; Heineck, Daniel; Voss, Lars F.; Wang, Tzu Fang; Shao, Qinghui

    2013-10-15

    Methods for manufacturing solid-state thermal neutron detectors with simultaneous high thermal neutron detection efficiency (>50%) and neutron to gamma discrimination (>10.sup.4) are provided. A structure is provided that includes a p+ region on a first side of an intrinsic region and an n+ region on a second side of the intrinsic region. The thickness of the intrinsic region is minimized to achieve a desired gamma discrimination factor of at least 1.0E+04. Material is removed from one of the p+ region or the n+ region and into the intrinsic layer to produce pillars with open space between each pillar. The open space is filed with a neutron sensitive material. An electrode is placed in contact with the pillars and another electrode is placed in contact with the side that is opposite of the intrinsic layer with respect to the first electrode.

  3. Evaluation of Islanding Detection Methods

    Office of Scientific and Technical Information (OSTI)

    This phenomenon is demonstrated in the simulation shown in Figure 4. In the top panel, a single inverter's output is shown. This system is designed to reduce its output...

  4. Experimental and semiempirical method to determine the Pauli-limiting field in quasi-two-dimensional superconductors as applied to κ-(BEDT-TTF)2Cu(NCS)2: strong evidence of a FFLO state

    SciTech Connect (OSTI)

    Agosta, C. C.; Jin, J.; Coniglio, W. A.; Smith, B. E.; Cho, K.; Mihut, I.; Martin, C.; Tozer, S. W.; Murphy, T. P.; Palm, E. C.; Schlueter, J. A.; Kurmoo, M.

    2012-01-01

    We present upper critical field data for {kappa}-(BEDT-TTF){sub 2}Cu(NCS){sub 2} with the magnetic field close to parallel and parallel to the conducting layers. We show that we can eliminate the effect of vortex dynamics in these layered materials if the layers are oriented within 0.3-inch of parallel to the applied magnetic field. Eliminating vortex effects leaves one remaining feature in the data that corresponds to the Pauli paramagnetic limit (H{sub p}). We propose a semiempirical method to calculate the H{sub p} in quasi-2D superconductors. This method takes into account the energy gap of each of the quasi-2D superconductors, which is calculated from specific-heat data, and the influence of many-body effects. The calculated Pauli paramagnetic limits are then compared to critical field data for the title compound and other organic conductors. Many of the examined quasi-2D superconductors, including the above organic superconductors and CeCoIn{sub 5}, exhibit upper critical fields that exceed their calculated H{sub p} suggesting unconventional superconductivity. We show that the high-field low-temperature state in {kappa}-(BEDT-TTF){sub 2}Cu(NCS){sub 2} is consistent with the Fulde-Ferrell-Larkin-Ovchinnikov state.

  5. ON COMPUTING UPPER LIMITS TO SOURCE INTENSITIES

    SciTech Connect (OSTI)

    Kashyap, Vinay L.; Siemiginowska, Aneta [Smithsonian Astrophysical Observatory, 60 Garden Street, Cambridge, MA 02138 (United States); Van Dyk, David A.; Xu Jin [Department of Statistics, University of California, Irvine, CA 92697-1250 (United States); Connors, Alanna [Eureka Scientific, 2452 Delmer Street, Suite 100, Oakland, CA 94602-3017 (United States); Freeman, Peter E. [Department of Statistics, Carnegie Mellon University, 5000 Forbes Avenue, Pittsburgh, PA 15213 (United States); Zezas, Andreas, E-mail: vkashyap@cfa.harvard.ed, E-mail: asiemiginowska@cfa.harvard.ed, E-mail: dvd@ics.uci.ed, E-mail: jinx@ics.uci.ed, E-mail: aconnors@eurekabayes.co, E-mail: pfreeman@cmu.ed, E-mail: azezas@cfa.harvard.ed [Physics Department, University of Crete, P.O. Box 2208, GR-710 03, Heraklion, Crete (Greece)

    2010-08-10

    A common problem in astrophysics is determining how bright a source could be and still not be detected in an observation. Despite the simplicity with which the problem can be stated, the solution involves complicated statistical issues that require careful analysis. In contrast to the more familiar confidence bound, this concept has never been formally analyzed, leading to a great variety of often ad hoc solutions. Here we formulate and describe the problem in a self-consistent manner. Detection significance is usually defined by the acceptable proportion of false positives (background fluctuations that are claimed as detections, or Type I error), and we invoke the complementary concept of false negatives (real sources that go undetected, or Type II error), based on the statistical power of a test, to compute an upper limit to the detectable source intensity. To determine the minimum intensity that a source must have for it to be detected, we first define a detection threshold and then compute the probabilities of detecting sources of various intensities at the given threshold. The intensity that corresponds to the specified Type II error probability defines that minimum intensity and is identified as the upper limit. Thus, an upper limit is a characteristic of the detection procedure rather than the strength of any particular source. It should not be confused with confidence intervals or other estimates of source intensity. This is particularly important given the large number of catalogs that are being generated from increasingly sensitive surveys. We discuss, with examples, the differences between these upper limits and confidence bounds. Both measures are useful quantities that should be reported in order to extract the most science from catalogs, though they answer different statistical questions: an upper bound describes an inference range on the source intensity, while an upper limit calibrates the detection process. We provide a recipe for computing upper limits that applies to all detection algorithms.

  6. Methods for threshold determination in multiplexed assays

    DOE Patents [OSTI]

    Tammero, Lance F. Bentley; Dzenitis, John M; Hindson, Benjamin J

    2014-06-24

    Methods for determination of threshold values of signatures comprised in an assay are described. Each signature enables detection of a target. The methods determine a probability density function of negative samples and a corresponding false positive rate curve. A false positive criterion is established and a threshold for that signature is determined as a point at which the false positive rate curve intersects the false positive criterion. A method for quantitative analysis and interpretation of assay results together with a method for determination of a desired limit of detection of a signature in an assay are also described.

  7. Apparatuses and methods for detecting, identifying and quantitating radioactive nuclei and methods of distinguishing neutron stimulation of a radiation particle detector from gamma-ray stimulation of a detector

    DOE Patents [OSTI]

    Cole, Jerald D. (Idaho Falls, ID); Drigert, Mark W. (Idaho Falls, ID); Reber, Edward L. (Idaho Falls, ID); Aryaeinejad, Rahmat (Idaho Falls, ID)

    2001-01-01

    In one aspect, the invention encompasses a method of detecting radioactive decay, comprising: a) providing a sample comprising a radioactive material, the radioactive material generating decay particles; b)providing a plurality of detectors proximate the sample, the detectors comprising a first set and a second set, the first set of the detectors comprising liquid state detectors utilizing liquid scintillation material coupled with photo tubes to generate a first electrical signal in response to decay particles stimulating the liquid scintillation material, the second set of the detectors comprising solid state detectors utilizing a crystalline solid to generate a second electrical signal in response to decay particles stimulating the crystalline solid; c) stimulating at least one of the detectors to generate at least one of the first and second electrical signals, the at least one of the first and second electrical signals being indicative of radioactive decay in the sample. In another aspect, the invention encompasses an apparatus for identifying and quantitating radioactive nuclei of a sample comprising radioactive material that decays to generate neutrons and high-energy .gamma.-rays.

  8. Sulfide chemiluminescence detection

    DOE Patents [OSTI]

    Spurlin, Stanford R. (Ames, IA); Yeung, Edward S. (Ames, IA)

    1985-01-01

    A method of chemiluminescently determining a sulfide which is either hydrogen sulfide or methyl mercaptan by reacting the sulfide with chlorine dioxide at low pressure and under conditions which allow a longer reaction time in emission of a single photon for every two sulfide containing species, and thereafter, chemiluminescently detecting and determining the sulfide. The invention also relates not only to the detection method, but the novel chemical reaction and a specifically designed chemiluminescence detection cell for the reaction.

  9. Sulfide chemiluminescence detection

    DOE Patents [OSTI]

    Spurlin, S.R.; Yeung, E.S.

    1985-11-26

    A method is described for chemiluminescently determining a sulfide which is either hydrogen sulfide or methyl mercaptan by reacting the sulfide with chlorine dioxide at low pressure and under conditions which allow a longer reaction time in emission of a single photon for every two sulfide containing species, and thereafter, chemiluminescently detecting and determining the sulfide. The invention also relates not only to the detection method, but the novel chemical reaction and a specifically designed chemiluminescence detection cell for the reaction. 4 figs.

  10. Image Change Detection via Ensemble Learning

    SciTech Connect (OSTI)

    Martin, Benjamin W; Vatsavai, Raju

    2013-01-01

    The concept of geographic change detection is relevant in many areas. Changes in geography can reveal much information about a particular location. For example, analysis of changes in geography can identify regions of population growth, change in land use, and potential environmental disturbance. A common way to perform change detection is to use a simple method such as differencing to detect regions of change. Though these techniques are simple, often the application of these techniques is very limited. Recently, use of machine learning methods such as neural networks for change detection has been explored with great success. In this work, we explore the use of ensemble learning methodologies for detecting changes in bitemporal synthetic aperture radar (SAR) images. Ensemble learning uses a collection of weak machine learning classifiers to create a stronger classifier which has higher accuracy than the individual classifiers in the ensemble. The strength of the ensemble lies in the fact that the individual classifiers in the ensemble create a mixture of experts in which the final classification made by the ensemble classifier is calculated from the outputs of the individual classifiers. Our methodology leverages this aspect of ensemble learning by training collections of weak decision tree based classifiers to identify regions of change in SAR images collected of a region in the Staten Island, New York area during Hurricane Sandy. Preliminary studies show that the ensemble method has approximately 11.5% higher change detection accuracy than an individual classifier.

  11. Smoke detection

    DOE Patents [OSTI]

    Warmack, Robert J. Bruce; Wolf, Dennis A.; Frank, Steven Shane

    2015-10-27

    Various apparatus and methods for smoke detection are disclosed. In one embodiment, a method of training a classifier for a smoke detector comprises inputting sensor data from a plurality of tests into a processor. The sensor data is processed to generate derived signal data corresponding to the test data for respective tests. The derived signal data is assigned into categories comprising at least one fire group and at least one non-fire group. Linear discriminant analysis (LDA) training is performed by the processor. The derived signal data and the assigned categories for the derived signal data are inputs to the LDA training. The output of the LDA training is stored in a computer readable medium, such as in a smoke detector that uses LDA to determine, based on the training, whether present conditions indicate the existence of a fire.

  12. Smoke detection

    DOE Patents [OSTI]

    Warmack, Robert J Bruce; Wolf, Dennis A.; Frank, Steven Shane

    2015-11-05

    Various apparatus and methods for smoke detection are disclosed. In one embodiment, a method of training a classifier for a smoke detector comprises inputting sensor data from a plurality of tests into a processor. The sensor data is processed to generate derived signal data corresponding to the test data for respective tests. The derived signal data is assigned into categories comprising at least one fire group and at least one non-fire group. Linear discriminant analysis (LDA) training is performed by the processor. The derived signal data and the assigned categories for the derived signal data are inputs to the LDA training. The output of the LDA training is stored in a computer readable medium, such as in a smoke detector that uses LDA to determine, based on the training, whether present conditions indicate the existence of a fire.

  13. Limited Test Ban Treaty

    National Nuclear Security Administration (NNSA)

    Satellite Carrying NNSA-provided Nuclear Detonation Detection Sensors http:www.nnsa.energy.govmediaroompressreleasesafsatellite

  14. Spectroscopic Detection of Pathogens

    SciTech Connect (OSTI)

    ALAM,M. KATHLEEN; TIMLIN,JERILYN A.; MARTIN,LAURA E.; HJELLE,DRIAN; LYONS,RICK; GARRISON,KRISTIN

    2000-11-01

    The goal of this LDRD Research project was to provide a preliminary examination of the use of infrared spectroscopy as a tool to detect the changes in cell cultures upon activation by an infectious agent. Due to a late arrival of funding, only 5 months were available to transfer and setup equipment at UTTM,develop cell culture lines, test methods of in-situ activation and collect kinetic data from activated cells. Using attenuated total reflectance (ATR) as a sampling method, live cell cultures were examined prior to and after activation. Spectroscopic data were collected from cells immediately after activation in situ and, in many cases for five successive hours. Additional data were collected from cells activated within a test tube (pre-activated), in both transmission mode as well as in ATR mode. Changes in the infrared data were apparent in the transmission data collected from the pre-activated cells as well in some of the pre-activated ATR data. Changes in the in-situ activated spectral data were only occasionally present due to (1) the limited time cells were studied and (2) incomplete activation. Comparison of preliminary data to infrared bands reported in the literature suggests the primary changes seen are due an increase in ribonucleic acid (RNA) production. This work will be continued as part of a 3 year DARPA grant.

  15. Correlation methods

    SciTech Connect (OSTI)

    Balcomb, J.D.

    1981-01-01

    Correlation methods have been developed to provide a quick and relatively simple technique for estimating the performance of passive solar systems. The correlations are done with respect to data generated from simulation models. The techniques and accuracies are described. Both the Solar Load Ratio and Un-Utilizability methods are described. The advantages and limitations of correlation methods as design tools are discussed.

  16. Optical limiting materials

    DOE Patents [OSTI]

    McBranch, Duncan W. (Santa Fe, NM); Mattes, Benjamin R. (Santa Fe, NM); Koskelo, Aaron C. (Los Alamos, NM); Heeger, Alan J. (Santa Barbara, CA); Robinson, Jeanne M. (Los Alamos, NM); Smilowitz, Laura B. (Los Alamos, NM); Klimov, Victor I. (Los Alamos, NM); Cha, Myoungsik (Goleta, CA); Sariciftci, N. Serdar (Santa Barbara, CA); Hummelen, Jan C. (Groningen, NL)

    1998-01-01

    Optical limiting materials. Methanofullerenes, fulleroids and/or other fullerenes chemically altered for enhanced solubility, in liquid solution, and in solid blends with transparent glass (SiO.sub.2) gels or polymers, or semiconducting (conjugated) polymers, are shown to be useful as optical limiters (optical surge protectors). The nonlinear absorption is tunable such that the energy transmitted through such blends saturates at high input energy per pulse over a wide range of wavelengths from 400-1100 nm by selecting the host material for its absorption wavelength and ability to transfer the absorbed energy into the optical limiting composition dissolved therein. This phenomenon should be generalizable to other compositions than substituted fullerenes.

  17. Evaluation of a Method for Remote Detection of Fuel Relocation Outside the Original Core Volumes of Fukushima Reactor Units 1-3

    SciTech Connect (OSTI)

    Douglas W. Akers; Edwin A. Harvego

    2012-08-01

    This paper presents the results of a study to evaluate the feasibility of remotely detecting and quantifying fuel relocation from the core to the lower head, and to regions outside the reactor vessel primary containment of the Fukushima 1-3 reactors. The goals of this study were to determine measurement conditions and requirements, and to perform initial radiation transport sensitivity analyses for several potential measurement locations inside the reactor building. The radiation transport sensitivity analyses were performed based on reactor design information for boiling water reactors (BWRs) similar to the Fukushima reactors, ORIGEN2 analyses of 3-cycle BWR fuel inventories, and data on previously molten fuel characteristics from TMI- 2. A 100 kg mass of previously molten fuel material located on the lower head of the reactor vessel was chosen as a fuel interrogation sensitivity target. Two measurement locations were chosen for the transport analyses, one inside the drywell and one outside the concrete biological shield surrounding the drywell. Results of these initial radiation transport analyses indicate that the 100 kg of previously molten fuel material may be detectable at the measurement location inside the drywell, but that it is highly unlikely that any amount of fuel material inside the RPV will be detectable from a location outside the concrete biological shield surrounding the drywell. Three additional fuel relocation scenarios were also analyzed to assess detection sensitivity for varying amount of relocated material in the lower head of the reactor vessel, in the control rods perpendicular to the detector system, and on the lower head of the drywell. Results of these analyses along with an assessment of background radiation effects and a discussion of measurement issues, such as the detector/collimator design, are included in the paper.

  18. Correlation and image compression for limited-bandwidth CCD.

    SciTech Connect (OSTI)

    Thompson, Douglas G.

    2005-07-01

    As radars move to Unmanned Aerial Vehicles with limited-bandwidth data downlinks, the amount of data stored and transmitted with each image becomes more significant. This document gives the results of a study to determine the effect of lossy compression in the image magnitude and phase on Coherent Change Detection (CCD). We examine 44 lossy compression types, plus lossless zlib compression, and test each compression method with over 600 CCD image pairs. We also derive theoretical predictions for the correlation for most of these compression schemes, which compare favorably with the experimental results. We recommend image transmission formats for limited-bandwidth programs having various requirements for CCD, including programs which cannot allow performance degradation and those which have stricter bandwidth requirements at the expense of CCD performance.

  19. Lean blowoff detection sensor

    DOE Patents [OSTI]

    Thornton, Jimmy (Morgantown, WV); Straub, Douglas L. (Morgantown, WV); Chorpening, Benjamin T. (Morgantown, WV); Huckaby, David (Morgantown, WV)

    2007-04-03

    Apparatus and method for detecting incipient lean blowoff conditions in a lean premixed combustion nozzle of a gas turbine. A sensor near the flame detects the concentration of hydrocarbon ions and/or electrons produced by combustion and the concentration monitored as a function of time are used to indicate incipient lean blowoff conditions.

  20. Method of intrinsic marking

    DOE Patents [OSTI]

    Adams, David P; McDonald, Joel Patrick; Jared, Bradley Howell; Hodges, V. Carter; Hirschfeld, Deidre; Blair, Dianna S

    2014-04-01

    A method of pulsed laser intrinsic marking can provide a unique identifier to detect tampering or counterfeiting.

  1. Detection of counterfeit currency

    DOE Patents [OSTI]

    Burns, Donald A. (Los Alamos, NM)

    1998-01-01

    A method of detecting counterfeit currency by contacting the currency to be tested with near infrared beams in the spectrum below 1250 namometers, measuring reflectance of the near infrared beams and comparing the reflectance values with those from genuine currency.

  2. Parallel Heuristics for Scalable Community Detection

    SciTech Connect (OSTI)

    Lu, Howard; Kalyanaraman, Anantharaman; Halappanavar, Mahantesh; Choudhury, Sutanay

    2014-05-17

    Community detection has become a fundamental operation in numerous graph-theoretic applications. It is used to reveal natural divisions that exist within real world networks without imposing prior size or cardinality constraints on the set of communities. Despite its potential for application, there is only limited support for community detection on large-scale parallel computers, largely owing to the irregular and inherently sequential nature of the underlying heuristics. In this paper, we present parallelization heuristics for fast community detection using the Louvain method as the serial template. The Louvain method is an iterative heuristic for modularity optimization. Originally developed by Blondel et al. in 2008, the method has become increasingly popular owing to its ability to detect high modularity community partitions in a fast and memory-efficient manner. However, the method is also inherently sequential, thereby limiting its scalability to problems that can be solved on desktops. Here, we observe certain key properties of this method that present challenges for its parallelization, and consequently propose multiple heuristics that are designed to break the sequential barrier. Our heuristics are agnostic to the underlying parallel architecture. For evaluation purposes, we implemented our heuristics on shared memory (OpenMP) and distributed memory (MapReduce-MPI) machines, and tested them over real world graphs derived from multiple application domains (internet, biological, natural language processing). Experimental results demonstrate the ability of our heuristics to converge to high modularity solutions comparable to those output by the serial algorithm in nearly the same number of iterations, while also drastically reducing time to solution.

  3. Detection Science

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Chemistry for Measurement and Detection Science Chemistry for Measurement and Detection Science Project Description Chemistry used in measurement and detection science plays a crucial role in the Laboratory's Science of Signatures scientific thrust. Measurement and detection science areas that require chemistry include nuclear and radiological, materials, biological, energy, climate, and space. Los Alamos scientists integrate chemical-science capabilities to ensure that the Laboratory can

  4. Optical limiting materials

    DOE Patents [OSTI]

    McBranch, D.W.; Mattes, B.R.; Koskelo, A.C.; Heeger, A.J.; Robinson, J.M.; Smilowitz, L.B.; Klimov, V.I.; Cha, M.; Sariciftci, N.S.; Hummelen, J.C.

    1998-04-21

    Methanofullerenes, fulleroids and/or other fullerenes chemically altered for enhanced solubility, in liquid solution, and in solid blends with transparent glass (SiO{sub 2}) gels or polymers, or semiconducting (conjugated) polymers, are shown to be useful as optical limiters (optical surge protectors). The nonlinear absorption is tunable such that the energy transmitted through such blends saturates at high input energy per pulse over a wide range of wavelengths from 400--1,100 nm by selecting the host material for its absorption wavelength and ability to transfer the absorbed energy into the optical limiting composition dissolved therein. This phenomenon should be generalizable to other compositions than substituted fullerenes. 5 figs.

  5. Security Clearances; Limitations

    Energy Savers [EERE]

    SEC. 1072. SECURITY CLEARANCES; LIMITATIONS. (a) In General.-Title III of the Intelligence Reform and Terrorism Prevention Act of 2004 (50 U.S.C. 435b) is amended by adding at the end the following new section: "SEC. 3002. SECURITY CLEARANCES; LIMITATIONS. "(a) Definitions.-In this section: "(1) Controlled substance.-The term `controlled substance' has the meaning given that term in section 102 of the Controlled Substances Act (21 U.S.C. 802). "(2) Covered person.-The term

  6. Optical sensing elements for nitrogen dioxide (NO.sub.2) gas detection, a sol-gel method for making the sensing elements and fiber optic sensors incorporating nitrogen dioxide gas optical sensing elements

    DOE Patents [OSTI]

    Mechery, Shelly John (Mississippi State, MS); Singh, Jagdish P. (Starkville, MS)

    2007-07-03

    A sensing element, a method of making a sensing element, and a fiber optic sensor incorporating the sensing element are described. The sensor can be used for the quantitative detection of NO.sub.2 in a mixture of gases. The sensing element can be made by incorporating a diazotizing reagent which reacts with nitrous ions to produce a diazo compound and a coupling reagent which couples with the diazo compound to produce an azo dye into a sol and allowing the sol to form an optically transparent gel. The sensing element changes color in the presence of NO.sub.2 gas. The temporal response of the absorption spectrum at various NO.sub.2 concentrations has also been recorded and analyzed. Sensors having different design configurations are described. The sensing element can detect NO.sub.2 gas at levels of parts per billion.

  7. detonation detection

    National Nuclear Security Administration (NNSA)

    7%2A en US Air Force Launches Satellite Carrying NNSA-provided Nuclear Detonation Detection Sensors http:nnsa.energy.govmediaroompressreleasesafsatellite

  8. detonation detection

    National Nuclear Security Administration (NNSA)

    Satellite Carrying NNSA-provided Nuclear Detonation Detection Sensors http:www.nnsa.energy.govmediaroompressreleasesafsatellite

  9. Micro-Machined Thin Film Sensor Arrays For The Detection Of H2, Containing Gases, And Method Of Making And Using The Same.

    DOE Patents [OSTI]

    DiMeo, Jr., Frank (Danbury, CT); Baum, Thomas H. (New Fairfield, CT)

    2003-07-22

    The present invention provides a hydrogen sensor including a thin film sensor element formed by metal organic chemical vapor deposition (MOCVD) or physical vapor deposition (PVD), on a micro-hotplate structure. The thin film sensor element includes a film of a hydrogen-interactive metal film that reversibly interacts with hydrogen to provide a correspondingly altered response characteristic, such as optical transmissivity, electrical conductance, electrical resistance, electrical capacitance, magneto resistance, photoconductivity, etc., relative to the response characteristic of the film in the absence of hydrogen. The hydrogen-interactive metal film may be overcoated with a thin film hydrogen-permeable barrier layer to protect the hydrogen-interactive film from deleterious interaction with non-hydrogen species. The hydrogen permeable barrier may comprise species to scavenge oxygen and other like species. The hydrogen sensor of the invention may be usefully employed for the detection of hydrogen in an environment susceptible to the incursion or generation of hydrogen and may be conveniently configured as a hand-held apparatus.

  10. Nucleic acid detection kits

    DOE Patents [OSTI]

    Hall, Jeff G.; Lyamichev, Victor I.; Mast, Andrea L.; Brow, Mary Ann; Kwiatkowski, Robert W.; Vavra, Stephanie H.

    2005-03-29

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof. The present invention further relates to methods and devices for the separation of nucleic acid molecules based on charge. The present invention also provides methods for the detection of non-target cleavage products via the formation of a complete and activated protein binding region. The invention further provides sensitive and specific methods for the detection of nucleic acid from various viruses in a sample.

  11. Heat flux limiting sleeves

    DOE Patents [OSTI]

    Harris, William G. (Tampa, FL)

    1985-01-01

    A heat limiting tubular sleeve extending over only a portion of a tube having a generally uniform outside diameter, the sleeve being open on both ends, having one end thereof larger in diameter than the other end thereof and having a wall thickness which decreases in the same direction as the diameter of the sleeve decreases so that the heat transfer through the sleeve and tube is less adjacent the large diameter end of the sleeve than adjacent the other end thereof.

  12. Fault Current Limiters

    Office of Environmental Management (EM)

    Fault Current Limiters Superconducting & Solid-state Power Equipment Office of Electricity Delivery and Energy Reliability www.oe.energy.gov Office of Electricity Delivery and Energy Reliability, OE-1 U.S. Department of Energy - 1000 Independence Avenue, SW - Washington, DC 20585 Plugging America Into the Future of Power What are FCLs? A fault is an unintentional short circuit, or partial short-circuit, in an electric circuit. A variety of factors such as lightning, downed power lines, or

  13. Review of NDE Methods for Detection and Monitoring of Atmospheric SCC in Welded Canisters for the Storage of Used Nuclear Fuel

    SciTech Connect (OSTI)

    Meyer, Ryan M.; Pardini, Allan F.; Hanson, Brady D.; Sorenson, Ken B.

    2013-01-14

    Dry cask storage systems (DCSSs) for used nuclear fuel (UNF) were originally envisioned for storage periods of short duration (~ a few decades). However, uncertainty challenges the opening of a permanent repository for UNF implying that UNF will need to remain in dry storage for much longer durations than originally envisioned (possibly for centuries). Thus, aging degradation of DCSSs becomes an issue that may not have been sufficiently considered in the design phase and that can challenge the efficacy of very long-term storage of UNF. A particular aging degradation concern is atmospheric stress corrosion cracking (SCC) of DCSSs located in marine environments. In this report, several nondestructive (NDE) methods are evaluated with respect to their potential for effective monitoring of atmospheric SCC in welded canisters of DCSSs. Several of the methods are selected for evaluation based on their usage for in-service inspection applications in the nuclear power industry. The technologies considered include bulk ultrasonic techniques, acoustic emission, visual techniques, eddy current, and guided ultrasonic waves.

  14. Fault current limiter

    DOE Patents [OSTI]

    Darmann, Francis Anthony

    2013-10-08

    A fault current limiter (FCL) includes a series of high permeability posts for collectively define a core for the FCL. A DC coil, for the purposes of saturating a portion of the high permeability posts, surrounds the complete structure outside of an enclosure in the form of a vessel. The vessel contains a dielectric insulation medium. AC coils, for transporting AC current, are wound on insulating formers and electrically interconnected to each other in a manner such that the senses of the magnetic field produced by each AC coil in the corresponding high permeability core are opposing. There are insulation barriers between phases to improve dielectric withstand properties of the dielectric medium.

  15. Leak detection aid

    DOE Patents [OSTI]

    Steeper, T.J.

    1989-12-26

    A leak detection apparatus and method for detecting leaks across an O-ring sealing a flanged surface to a mating surface is an improvement in a flanged surface comprising a shallow groove following O-ring in communication with an entrance and exit port intersecting the shallow groove for injecting and withdrawing, respectively, a leak detection fluid, such as helium. A small quantity of helium injected into the entrance port will flow to the shallow groove, past the O-ring and to the exit port. 2 figs.

  16. Leak detection aid

    DOE Patents [OSTI]

    Steeper, Timothy J. (Graniteville, SC)

    1989-01-01

    A leak detection apparatus and method for detecting leaks across an O-ring sealing a flanged surface to a mating surface is an improvement in a flanged surface comprising a shallow groove following O-ring in communication with an entrance and exit port intersecting the shallow groove for injecting and withdrawing, respectively, a leak detection fluid, such as helium. A small quantity of helium injected into the entrance port will flow to the shallow groove, past the O-ring and to the exit port.

  17. (Limiting the greenhouse effect)

    SciTech Connect (OSTI)

    Rayner, S.

    1991-01-07

    Traveler attended the Dahlem Research Conference organized by the Freien Universitat, Berlin. The subject of the conference was Limiting the Greenhouse Effect: Options for Controlling Atmospheric CO{sub 2} Accumulation. Like all Dahlem workshops, this was a meeting of scientific experts, although the disciplines represented were broader than usual, ranging across anthropology, economics, international relations, forestry, engineering, and atmospheric chemistry. Participation by scientists from developing countries was limited. The conference was divided into four multidisciplinary working groups. Traveler acted as moderator for Group 3 which examined the question What knowledge is required to tackle the principal social and institutional barriers to reducing CO{sub 2} emissions'' The working rapporteur was Jesse Ausubel of Rockefeller University. Other working groups examined the economic costs, benefits, and technical feasibility of options to reduce emissions per unit of energy service; the options for reducing energy use per unit of GNP; and the significant of linkage between strategies to reduce CO{sub 2} emissions and other goals. Draft reports of the working groups are appended. Overall, the conference identified a number of important research needs in all four areas. It may prove particularly important in bringing the social and institutional research needs relevant to climate change closer to the forefront of the scientific and policy communities than hitherto.

  18. Timminco Limited | Open Energy Information

    Open Energy Info (EERE)

    Limited Jump to: navigation, search Name: Timminco Limited Place: Toronto, Ontario, Canada Zip: M5H 1J9 Product: Canadian manufacturer of magnesium and silicon; operates its...

  19. CHAPTER 7. BERYLLIUM ANALYSIS BY NON-PLASMA BASED METHODS

    SciTech Connect (OSTI)

    Ekechukwu, A

    2009-04-20

    The most common method of analysis for beryllium is inductively coupled plasma atomic emission spectrometry (ICP-AES). This method, along with inductively coupled plasma mass spectrometry (ICP-MS), is discussed in Chapter 6. However, other methods exist and have been used for different applications. These methods include spectroscopic, chromatographic, colorimetric, and electrochemical. This chapter provides an overview of beryllium analysis methods other than plasma spectrometry (inductively coupled plasma atomic emission spectrometry or mass spectrometry). The basic methods, detection limits and interferences are described. Specific applications from the literature are also presented.

  20. Nitrogen dioxide detection

    DOE Patents [OSTI]

    Sinha, Dipen N. (Los Alamos, NM); Agnew, Stephen F. (Los Alamos, NM); Christensen, William H. (Buena Park, CA)

    1993-01-01

    Method and apparatus for detecting the presence of gaseous nitrogen dioxide and determining the amount of gas which is present. Though polystyrene is normally an insulator, it becomes electrically conductive in the presence of nitrogen dioxide. Conductance or resistance of a polystyrene sensing element is related to the concentration of nitrogen dioxide at the sensing element.

  1. Detection of counterfeit currency

    DOE Patents [OSTI]

    Burns, D.A.

    1998-05-26

    A method is disclosed of detecting counterfeit currency by contacting the currency to be tested with near infrared beams in the spectrum below 1,250 nanometers, measuring reflectance of the near infrared beams and comparing the reflectance values with those from genuine currency. 18 figs.

  2. Detection device

    DOE Patents [OSTI]

    Smith, J.E.

    1981-02-27

    The present invention is directed to a detection device comprising: (1) an entrance chamber; (2) a central chamber; and (3) an exit chamber. The central chamber includes an ionizing gas, anode, and means for connecting the anode with an external power supply and pulse counter.

  3. Detection device

    DOE Patents [OSTI]

    Smith, Jay E.

    1984-01-01

    The present invention is directed to a detection device comprising: (1) an entrance chamber, (2) a central chamber, and (3) an exit chamber. The central chamber includes an ionizing gas, anode, and means for connecting the anode with an external power supply and pulse counter.

  4. Compositions and methods for detecting Noonan syndrome

    DOE Patents [OSTI]

    Gelb, Bruce D. (New York, NY); Tartaglia, Marco (Rome, IT); Pennacchio, Len (Walnut Creek, CA)

    2012-07-17

    Diagnostic and therapeutic applications for Noonan Syndrome are described. The diagnostic and therapeutic applications are based on certain mutations in a RAS-specific guanine nucleotide exchange factor gene SOS1 or its expression product. The diagnostic and therapeutic applications are also based on certain mutations in a serine/threonine protein kinase gene RAF1 or its expression product thereof. Also described are nucleotide sequences, amino acid sequences, probes, and primers related to RAF1 or SOS1, and variants thereof, as well as host cells expressing such variants.

  5. Apparatus and method for detecting gamma radiation

    DOE Patents [OSTI]

    Sigg, Raymond A. (Martinez, GA)

    1994-01-01

    A high efficiency radiation detector for measuring X-ray and gamma radiation from small-volume, low-activity liquid samples with an overall uncertainty better than 0.7% (one sigma SD). The radiation detector includes a hyperpure germanium well detector, a collimator, and a reference source. The well detector monitors gamma radiation emitted by the reference source and a radioactive isotope or isotopes in a sample source. The radiation from the reference source is collimated to avoid attenuation of reference source gamma radiation by the sample. Signals from the well detector are processed and stored, and the stored data is analyzed to determine the radioactive isotope(s) content of the sample. Minor self-attenuation corrections are calculated from chemical composition data.

  6. Method and apparatus for detecting concealed weapons

    DOE Patents [OSTI]

    Kotter, Dale K.; Fluck, Frederick D.

    2006-03-14

    Apparatus for classifying a ferromagnetic object within a sensing area may include a magnetic field sensor that produces magnetic field data. A signal processing system operatively associated with the magnetic field sensor includes a neural network. The neural network compares the magnetic field data with magnetic field data produced by known ferromagnetic objects to make a probabilistic determination as to the classification of the ferromagnetic object within the sensing area. A user interface operatively associated with the signal processing system produces a user-discernable output indicative of the probabilistic determination of the classification of the ferromagnetic object within a sensing area.

  7. Apparatus and method for detecting gamma radiation

    DOE Patents [OSTI]

    Sigg, R.A.

    1994-12-13

    A high efficiency radiation detector is disclosed for measuring X-ray and gamma radiation from small-volume, low-activity liquid samples with an overall uncertainty better than 0.7% (one sigma SD). The radiation detector includes a hyperpure germanium well detector, a collimator, and a reference source. The well detector monitors gamma radiation emitted by the reference source and a radioactive isotope or isotopes in a sample source. The radiation from the reference source is collimated to avoid attenuation of reference source gamma radiation by the sample. Signals from the well detector are processed and stored, and the stored data is analyzed to determine the radioactive isotope(s) content of the sample. Minor self-attenuation corrections are calculated from chemical composition data. 4 figures.

  8. Method for radiation detection and measurement

    DOE Patents [OSTI]

    Miller, S.D.

    1993-12-21

    Dose of radiation to which a body of crystalline material has been exposed is measured by exposing the body to optical radiation at a first wavelength, which is greater than about 540 nm, and measuring optical energy emitted from the body by luminescence at a second wavelength, which is longer than the first wavelength. 9 figures.

  9. Occupancy change detection system and method

    DOE Patents [OSTI]

    Bruemmer, David J. [Idaho Falls, ID; Few, Douglas A. [Idaho Falls, ID

    2009-09-01

    A robot platform includes perceptors, locomotors, and a system controller. The system controller executes instructions for producing an occupancy grid map of an environment around the robot, scanning the environment to generate a current obstacle map relative to a current robot position, and converting the current obstacle map to a current occupancy grid map. The instructions also include processing each grid cell in the occupancy grid map. Within the processing of each grid cell, the instructions include comparing each grid cell in the occupancy grid map to a corresponding grid cell in the current occupancy grid map. For grid cells with a difference, the instructions include defining a change vector for each changed grid cell, wherein the change vector includes a direction from the robot to the changed grid cell and a range from the robot to the changed grid cell.

  10. Method for radiation detection and measurement

    DOE Patents [OSTI]

    Miller, Steven D. (Richland, WA)

    1993-01-01

    Dose of radiation to which a body of crystalline material has been exposed is measured by exposing the body to optical radiation at a first wavelength, which is greater than about 540 nm, and measuring optical energy emitted from the body by luminescence at a second wavelength, which is longer than the first wavelength.

  11. Probe and method for DNA detection

    DOE Patents [OSTI]

    Yeh, Hsin-Chih; Werner, James Henry; Sharma, Jaswinder Kumar; Martinez, Jennifer Suzanne

    2013-07-02

    A hybridization probe containing two linear strands of DNA lights up upon hybridization to a target DNA using silver nanoclusters that have been templated onto one of the DNA strands. Hybridization induces proximity between the nanoclusters on one strand and an overhang on the other strand, which results in enhanced fluorescence emission from the nanoclusters.

  12. Transcription factor-based biosensors for detecting dicarboxylic acids

    DOE Patents [OSTI]

    Dietrich, Jeffrey; Keasling, Jay

    2014-02-18

    The invention provides methods and compositions for detecting dicarboxylic acids using a transcription factor biosensor.

  13. COMMENTARY:Limits to adaptation

    SciTech Connect (OSTI)

    Preston, Benjamin L

    2013-01-01

    An actor-centered, risk-based approach to defining limits to social adaptation provides a useful analytic framing for identifying and anticipating these limits and informing debates over society s responses to climate change.

  14. Dark matter effective field theory scattering in direct detection experiments

    SciTech Connect (OSTI)

    Schneck, K.; Cabrera, B.; Cerdeno, D. G.; Mandic, V.; Rogers, H. E.; Agnese, R.; Anderson, A. J.; Asai, M.; Balakishiyeva, D.; Barker, D.; Basu Thakur, R.; Bauer, D. A.; Billard, J.; Borgland, A.; Brandt, D.; Brink, P. L.; Bunker, R.; Caldwell, D. O.; Calkins, R.; Chagani, H.; Chen, Y.; Cooley, J.; Cornell, B.; Crewdson, C. H.; Cushman, Priscilla B.; Daal, M.; Di Stefano, P. C.; Doughty, T.; Esteban, L.; Fallows, S.; Figueroa-Feliciano, E.; Godfrey, G. L.; Golwala, S. R.; Hall, Jeter C.; Harris, H. R.; Hofer, T.; Holmgren, D.; Hsu, L.; Huber, M. E.; Jardin, D. M.; Jastram, A.; Kamaev, O.; Kara, B.; Kelsey, M. H.; Kennedy, A.; Leder, A.; Loer, B.; Lopez Asamar, E.; Lukens, W.; Mahapatra, R.; McCarthy, K. A.; Mirabolfathi, N.; Moffatt, R. A.; Morales Mendoza, J. D.; Oser, S. M.; Page, K.; Page, W. A.; Partridge, R.; Pepin, M.; Phipps, A.; Prasad, K.; Pyle, M.; Qiu, H.; Rau, W.; Redl, P.; Reisetter, A.; Ricci, Y.; Roberts, A.; Saab, T.; Sadoulet, B.; Sander, J.; Schnee, R. W.; Scorza, S.; Serfass, B.; Shank, B.; Speller, D.; Toback, D.; Upadhyayula, S.; Villano, A. N.; Welliver, B.; Wilson, J. S.; Wright, D. H.; Yang, X.; Yellin, S.; Yen, J. J.; Young, B. A.; Zhang, J.

    2015-05-01

    We examine the consequences of the effective eld theory (EFT) of dark matter-nucleon scattering or current and proposed direct detection experiments. Exclusion limits on EFT coupling constants computed using the optimum interval method are presented for SuperCDMS Soudan, CDMS II, and LUX, and the necessity of combining results from multiple experiments in order to determine dark matter parameters is discussed. We demonstrate that spectral di*erences between the standard dark matter model and a general EFT interaction can produce a bias when calculating exclusion limits and when developing signal models for likelihood and machine learning techniques. We also discuss the implications of the EFT for the next-generation (G2) direct detection experiments and point out regions of complementarity in the EFT parameter space.

  15. Relating to ion detection

    DOE Patents [OSTI]

    Orr, Christopher Henry (Calderbridge, GB); Luff, Craig Janson (Calderbridge, GB); Dockray, Thomas (Calderbridge, GB); Macarthur, Duncan Whittemore (Los Alamos, NM)

    2001-01-01

    The apparatus and method provide a technique for improving detection of alpha and/or beta emitting sources on items or in locations using indirect means. The emission forms generate ions in a medium surrounding the item or location and the medium is then moved to a detecting location where the ions are discharged to give a measure of the emission levels. To increase the level of ions generated and render the system particularly applicable for narrow pipes and other forms of conduits, the medium pressure is increased above atmospheric pressure. STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

  16. Luminescent MOFs for Mycotoxin Detection

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Luminescent MOFs for Mycotoxin Detection Luminescent MOFs for Mycotoxin Detection Print Thursday, 04 February 2016 16:26 Mycotoxins-toxic chemical products produced by fungi-contaminate 25% of global food crops, leading to the loss of 1 billion metric tons of food products annually. Although current mycotoxin detection methods are effective, they are also expensive and require complex sample preparation. Researchers from Rutgers University, Northern Illinois University, and the Advanced Light

  17. Inherent limitations and current status of the unresolved resonance treatment

    SciTech Connect (OSTI)

    Hwang, R.N.

    1984-01-01

    The two general methods for representing the behavior of the unresolved resonances and the limitations of these methods are discussed. Possible solutions to the problem are considered. 17 references. (WHK)

  18. Spectroscopic detection

    DOE Patents [OSTI]

    Woskov, Paul P. (Bedford, MA); Hadidi, Kamal (Cambridge, MA)

    2003-01-01

    In embodiments, spectroscopic monitor monitors modulated light signals to detect low levels of contaminants and other compounds in the presence of background interference. The monitor uses a spectrometer that includes a transmissive modulator capable of causing different frequency ranges to move onto and off of the detector. The different ranges can include those with the desired signal and those selected to subtract background contributions from those with the desired signal. Embodiments of the system are particularly useful for monitoring metal concentrations in combustion effluent.

  19. Solar system fault detection

    DOE Patents [OSTI]

    Farrington, Robert B. (Wheatridge, CO); Pruett, Jr., James C. (Lakewood, CO)

    1986-01-01

    A fault detecting apparatus and method are provided for use with an active solar system. The apparatus provides an indication as to whether one or more predetermined faults have occurred in the solar system. The apparatus includes a plurality of sensors, each sensor being used in determining whether a predetermined condition is present. The outputs of the sensors are combined in a pre-established manner in accordance with the kind of predetermined faults to be detected. Indicators communicate with the outputs generated by combining the sensor outputs to give the user of the solar system and the apparatus an indication as to whether a predetermined fault has occurred. Upon detection and indication of any predetermined fault, the user can take appropriate corrective action so that the overall reliability and efficiency of the active solar system are increased.

  20. Solar system fault detection

    DOE Patents [OSTI]

    Farrington, R.B.; Pruett, J.C. Jr.

    1984-05-14

    A fault detecting apparatus and method are provided for use with an active solar system. The apparatus provides an indication as to whether one or more predetermined faults have occurred in the solar system. The apparatus includes a plurality of sensors, each sensor being used in determining whether a predetermined condition is present. The outputs of the sensors are combined in a pre-established manner in accordance with the kind of predetermined faults to be detected. Indicators communicate with the outputs generated by combining the sensor outputs to give the user of the solar system and the apparatus an indication as to whether a predetermined fault has occurred. Upon detection and indication of any predetermined fault, the user can take appropriate corrective action so that the overall reliability and efficiency of the active solar system are increased.

  1. Composition for detecting uranyl

    DOE Patents [OSTI]

    Baylor, L.C.; Stephens, S.M.

    1994-01-01

    The present invention relates to an indicator composition for use in spectrophotometric detection of a substance in a solution, and a method for making the composition. Useful indicators are sensitive to the particular substance being measured, but are unaffected by the fluid and other chemical species that may be present in the fluid. Optical indicators are used to measure the uranium concentration of process solutions in facilities for extracting uranium from ores, production of nuclear fuels, and reprocessing of irradiated fuels. The composition comprises an organohalide covalently bonded to an indicator for the substance, in such a manner that the product is itself an indicator that provides increased spectral resolution for detecting the substance. The indicator is preferably arsenazo III and the organohalide is preferably cyanuric chloride. These form a composition that is ideally suited for detecting uranyl.

  2. A brightness exceeding simulated Langmuir limit

    SciTech Connect (OSTI)

    Nakasuji, Mamoru

    2013-08-15

    When an excitation of the first lens determines a beam is parallel beam, a brightness that is 100 times higher than Langmuir limit is measured experimentally, where Langmuir limits are estimated using a simulated axial cathode current density which is simulated based on a measured emission current. The measured brightness is comparable to Langmuir limit, when the lens excitation is such that an image position is slightly shorter than a lens position. Previously measured values of brightness for cathode apical radii of curvature 20, 60, 120, 240, and 480 ?m were 8.7, 5.3, 3.3, 2.4, and 3.9 times higher than their corresponding Langmuir limits, respectively, in this experiment, the lens excitation was such that the lens and the image positions were 180 mm and 400 mm, respectively. From these measured brightness for three different lens excitation conditions, it is concluded that the brightness depends on the first lens excitation. For the electron gun operated in a space charge limited condition, some of the electrons emitted from the cathode are returned to the cathode without having crossed a virtual cathode. Therefore, method that assumes a Langmuir limit defining method using a Maxwellian distribution of electron velocities may need to be revised. For the condition in which the values of the exceeding the Langmuir limit are measured, the simulated trajectories of electrons that are emitted from the cathode do not cross the optical axis at the crossover, thus the law of sines may not be valid for high brightness electron beam systems.

  3. PURAC Limited | Open Energy Information

    Open Energy Info (EERE)

    technology and project management company in the environment sector and specialising in water, wastewater and municpal waste treatment. References: PURAC Limited1 This article...

  4. Lysanda Limited | Open Energy Information

    Open Energy Info (EERE)

    CM8 3GA Product: US-based vehicle engineering consultancy with a technology capable of playing a role in vehicle emissions management. References: Lysanda Limited1 This...

  5. Solfex Limited | Open Energy Information

    Open Energy Info (EERE)

    Jump to: navigation, search Name: Solfex Limited Address: Energy Arena Bannister Hall Works Off Shop Lane, Higher Walton Preston, Lancashire PR5 4DZ Place: Preston, United...

  6. Radon detection

    DOE Patents [OSTI]

    MacArthur, Duncan W. (Los Alamos, NM); Allander, Krag S. (Ojo Caliente, NM); Bounds, John A. (Los Alamos, NM)

    1994-01-01

    A detector for atmospheric radon using a long range alpha detector as its sensing element. An electrostatic filter removes ions from ambient air, while allowing radon atoms to pass into a decay cavity. Here, radon atoms are allowed to decay, creating air ions. These air ions are drawn by a fan through a second electrostatic filter which can be activated or deactivated, and into the long range alpha detector. With the second electrostatic filter activated, no air ions are allowed to pass, and the signal output from the long range alpha detector consists of only the electronic background. With the second electrostatic filter deactivated, air ions and cosmic rays will be detected. The cosmic ray contribution can be minimized by shielding.

  7. Radon detection

    DOE Patents [OSTI]

    MacArthur, D.W.; Allander, K.S.; Bounds, J.A.

    1994-01-25

    A detector for atmospheric radon using a long range alpha detector as its sensing element is described. An electrostatic filter removes ions from ambient air, while allowing radon atoms to pass into a decay cavity. Here, radon atoms are allowed to decay, creating air ions. These air ions are drawn by a fan through a second electrostatic filter which can be activated or deactivated, and into the long range alpha detector. With the second electrostatic filter activated, no air ions are allowed to pass, and the signal output from the long range alpha detector consists of only the electronic background. With the second electrostatic filter deactivated, air ions and cosmic rays will be detected. The cosmic ray contribution can be minimized by shielding. 3 figures.

  8. Fraud Detection in Healthcare

    SciTech Connect (OSTI)

    Chandola, Varun; Schryver, Jack C; Sukumar, Sreenivas R

    2015-01-01

    We discuss the problem of fraud detection in healthcare in this chapter. Given the recent scrutiny of the ineciencies in the US healthcare system, identifying fraud has been on the forefront of the eorts towards reducing the healthcare costs. In this chapter we will focus on understanding the issue of healthcare fraud in detail, and review methods that have been proposed in the literature to combat this issue using data driven approach.

  9. FUEL CASK IMPACT LIMITER VULNERABILITIES

    SciTech Connect (OSTI)

    Leduc, D; Jeffery England, J; Roy Rothermel, R

    2009-02-09

    Cylindrical fuel casks often have impact limiters surrounding just the ends of the cask shaft in a typical 'dumbbell' arrangement. The primary purpose of these impact limiters is to absorb energy to reduce loads on the cask structure during impacts associated with a severe accident. Impact limiters are also credited in many packages with protecting closure seals and maintaining lower peak temperatures during fire events. For this credit to be taken in safety analyses, the impact limiter attachment system must be shown to retain the impact limiter following Normal Conditions of Transport (NCT) and Hypothetical Accident Conditions (HAC) impacts. Large casks are often certified by analysis only because of the costs associated with testing. Therefore, some cask impact limiter attachment systems have not been tested in real impacts. A recent structural analysis of the T-3 Spent Fuel Containment Cask found problems with the design of the impact limiter attachment system. Assumptions in the original Safety Analysis for Packaging (SARP) concerning the loading in the attachment bolts were found to be inaccurate in certain drop orientations. This paper documents the lessons learned and their applicability to impact limiter attachment system designs.

  10. Detection of latent prints by Raman imaging

    DOE Patents [OSTI]

    Lewis, Linda Anne (Andersonville, TN); Connatser, Raynella Magdalene (Knoxville, TN); Lewis, Sr., Samuel Arthur (Andersonville, TN)

    2011-01-11

    The present invention relates to a method for detecting a print on a surface, the method comprising: (a) contacting the print with a Raman surface-enhancing agent to produce a Raman-enhanced print; and (b) detecting the Raman-enhanced print using a Raman spectroscopic method. The invention is particularly directed to the imaging of latent fingerprints.

  11. Hydrate detection

    SciTech Connect (OSTI)

    Dillon, W.P.; Ahlbrandt, T.S.

    1992-06-01

    Project objectives were: (1) to create methods of analyzing gas hydrates in natural sea-floor sediments, using available data, (2) to make estimates of the amount of gas hydrates in marine sediments, (3) to map the distribution of hydrates, (4) to relate concentrations of gas hydrates to natural processes and infer the factors that control hydrate concentration or that result in loss of hydrate from the sea floor. (VC)

  12. Hydrate detection

    SciTech Connect (OSTI)

    Dillon, W.P.; Ahlbrandt, T.S.

    1992-01-01

    Project objectives were: (1) to create methods of analyzing gas hydrates in natural sea-floor sediments, using available data, (2) to make estimates of the amount of gas hydrates in marine sediments, (3) to map the distribution of hydrates, (4) to relate concentrations of gas hydrates to natural processes and infer the factors that control hydrate concentration or that result in loss of hydrate from the sea floor. (VC)

  13. Apparatus and method for radioactive waste screening

    DOE Patents [OSTI]

    Akers, Douglas W.; Roybal, Lyle G.; Salomon, Hopi; Williams, Charles Leroy

    2012-09-04

    An apparatus and method relating to screening radioactive waste are disclosed for ensuring that at least one calculated parameter for the measurement data of a sample falls within a range between an upper limit and a lower limit prior to the sample being packaged for disposal. The apparatus includes a radiation detector configured for detecting radioactivity and radionuclide content of the of the sample of radioactive waste and generating measurement data in response thereto, and a collimator including at least one aperture to direct a field of view of the radiation detector. The method includes measuring a radioactive content of a sample, and calculating one or more parameters from the radioactive content of the sample.

  14. Nuclear Structure at the Limits

    SciTech Connect (OSTI)

    Nazarewicz, W.

    1998-01-12

    One of the frontiers of today?s nuclear science is the ?journey to the limits? of atomic charge and nuclear mass, of neutron-to-proton ratio, and of angular momentum. The tour to the limits is not only a quest for new, exciting phenomena, but the new data are expected, as well, to bring qualitatively new information about the fundamental properties of the nucleonic many-body system, the nature of the nuclear interaction, and nucleonic correlations at various energy-distance scales. In this series of lectures, current developments in nuclear structure at the limits are discussed from a theoretical perspective, mainly concentrating on medium-mass and heavy nuclei.

  15. Nuclear Structure at the Limits

    SciTech Connect (OSTI)

    Nazarewicz, Witold

    1997-12-31

    One of the frontiers of today`s nuclear science is the ``journey to the limits``: of atomic charge and nuclear mass, of neutron-to-proton ratio, and of angular momentum. The tour to the limits is not only a quest for new, exciting phenomena but the new data are expected, as well, to bring qualitatively new information about the fundamental properties of the nucleonic many-body system, the nature of the nuclear interaction, and nucleonic correlations at various energy-distance scales. In this talk, current developments in nuclear structure at the limits are discussed from a theoretical perspective.

  16. Dose Limits | Department of Energy

    Office of Environmental Management (EM)

    Limits Dose Limits (Question Posted to ERAD in May 2012) Who do you define as a member of the public for the onsite MEI? This question implies that there may be more than one maximally exposed individual (MEI), one on-site and one off-site, when demonstrating compliance with the Public Dose Limit of DOE Order 458.1. Although all potential MEIs should be considered and documented, as well as the calculated doses and pathways considered, the intent of DOE Order 458.1 is in fact to ultimately

  17. Plaxica Limited | Open Energy Information

    Open Energy Info (EERE)

    Zip: SW7 2AZ Product: UK-based technology company developing a new generation of polymers derived from sustainable resources. References: Plaxica Limited1 This article is a...

  18. Passive fault current limiting device

    DOE Patents [OSTI]

    Evans, D.J.; Cha, Y.S.

    1999-04-06

    A passive current limiting device and isolator is particularly adapted for use at high power levels for limiting excessive currents in a circuit in a fault condition such as an electrical short. The current limiting device comprises a magnetic core wound with two magnetically opposed, parallel connected coils of copper, a high temperature superconductor or other electrically conducting material, and a fault element connected in series with one of the coils. Under normal operating conditions, the magnetic flux density produced by the two coils cancel each other. Under a fault condition, the fault element is triggered to cause an imbalance in the magnetic flux density between the two coils which results in an increase in the impedance in the coils. While the fault element may be a separate current limiter, switch, fuse, bimetal strip or the like, it preferably is a superconductor current limiter conducting one-half of the current load compared to the same limiter wired to carry the total current of the circuit. The major voltage during a fault condition is in the coils wound on the common core in a preferred embodiment. 6 figs.

  19. Passive fault current limiting device

    DOE Patents [OSTI]

    Evans, Daniel J. (Wheeling, IL); Cha, Yung S. (Darien, IL)

    1999-01-01

    A passive current limiting device and isolator is particularly adapted for use at high power levels for limiting excessive currents in a circuit in a fault condition such as an electrical short. The current limiting device comprises a magnetic core wound with two magnetically opposed, parallel connected coils of copper, a high temperature superconductor or other electrically conducting material, and a fault element connected in series with one of the coils. Under normal operating conditions, the magnetic flux density produced by the two coils cancel each other. Under a fault condition, the fault element is triggered to cause an imbalance in the magnetic flux density between the two coils which results in an increase in the impedance in the coils. While the fault element may be a separate current limiter, switch, fuse, bimetal strip or the like, it preferably is a superconductor current limiter conducting one-half of the current load compared to the same limiter wired to carry the total current of the circuit. The major voltage during a fault condition is in the coils wound on the common core in a preferred embodiment.

  20. Protein detection system

    DOE Patents [OSTI]

    Fruetel, Julie A. (Livermore, CA); Fiechtner, Gregory J. (Bethesda, MD); Kliner, Dahv A. V. (San Ramon, CA); McIlroy, Andrew (Livermore, CA)

    2009-05-05

    The present embodiment describes a miniature, microfluidic, absorption-based sensor to detect proteins at sensitivities comparable to LIF but without the need for tagging. This instrument utilizes fiber-based evanescent-field cavity-ringdown spectroscopy, in combination with faceted prism microchannels. The combination of these techniques will increase the effective absorption path length by a factor of 10.sup.3 to 10.sup.4 (to .about.1-m), thereby providing unprecedented sensitivity using direct absorption. The coupling of high-sensitivity absorption with high-performance microfluidic separation will enable real-time sensing of biological agents in aqueous samples (including aerosol collector fluids) and will provide a general method with spectral fingerprint capability for detecting specific bio-agents.

  1. Chlorofluorocarbon leak detection technology

    SciTech Connect (OSTI)

    Munday, E.B.

    1990-12-01

    There are about 590 large coolant systems located at the Portsmouth Gaseous Diffusion Plant (PORTS) and the Paducah Gaseous Diffusion Plant (PGDP) leaking nearly 800,000 lb of R-114 refrigerant annually (1989 estimate). A program is now under way to reduce the leakage to 325,000 lb/year -- an average loss of 551 lb/year (0.063 lb/h) per coolant system, some of which are as large as 800 ft. This report investigates leak detection technologies that can be used to locate leaks in the coolant systems. Included are descriptions, minimum leak detection rate levels, advantages, disadvantages, and vendor information on the following technologies: bubbling solutions; colorimetric leak testing; dyes; halogen leak detectors (coronea discharge detectors; halide torch detectors, and heated anode detectors); laser imaging; mass spectroscopy; organic vapor analyzers; odorants; pressure decay methods; solid-state electrolytic-cell gas sensors; thermal conductivity leak detectors; and ultrasonic leak detectors.

  2. Detection of electromagnetic radiation using micromechanical multiple

    Office of Scientific and Technical Information (OSTI)

    quantum wells structures (Patent) | SciTech Connect Patent: Detection of electromagnetic radiation using micromechanical multiple quantum wells structures Citation Details In-Document Search Title: Detection of electromagnetic radiation using micromechanical multiple quantum wells structures An apparatus and method for detecting electromagnetic radiation employs a deflectable micromechanical apparatus incorporating multiple quantum wells structures. When photons strike the quantum-well

  3. Arc fault detection system

    DOE Patents [OSTI]

    Jha, K.N.

    1999-05-18

    An arc fault detection system for use on ungrounded or high-resistance-grounded power distribution systems is provided which can be retrofitted outside electrical switchboard circuits having limited space constraints. The system includes a differential current relay that senses a current differential between current flowing from secondary windings located in a current transformer coupled to a power supply side of a switchboard, and a total current induced in secondary windings coupled to a load side of the switchboard. When such a current differential is experienced, a current travels through a operating coil of the differential current relay, which in turn opens an upstream circuit breaker located between the switchboard and a power supply to remove the supply of power to the switchboard. 1 fig.

  4. Arc fault detection system

    DOE Patents [OSTI]

    Jha, Kamal N. (Bethel Park, PA)

    1999-01-01

    An arc fault detection system for use on ungrounded or high-resistance-grounded power distribution systems is provided which can be retrofitted outside electrical switchboard circuits having limited space constraints. The system includes a differential current relay that senses a current differential between current flowing from secondary windings located in a current transformer coupled to a power supply side of a switchboard, and a total current induced in secondary windings coupled to a load side of the switchboard. When such a current differential is experienced, a current travels through a operating coil of the differential current relay, which in turn opens an upstream circuit breaker located between the switchboard and a power supply to remove the supply of power to the switchboard.

  5. Nucleic acid sequence detection using multiplexed oligonucleotide PCR

    DOE Patents [OSTI]

    Nolan, John P. (Santa Fe, NM); White, P. Scott (Los Alamos, NM)

    2006-12-26

    Methods for rapidly detecting single or multiple sequence alleles in a sample nucleic acid are described. Provided are all of the oligonucleotide pairs capable of annealing specifically to a target allele and discriminating among possible sequences thereof, and ligating to each other to form an oligonucleotide complex when a particular sequence feature is present (or, alternatively, absent) in the sample nucleic acid. The design of each oligonucleotide pair permits the subsequent high-level PCR amplification of a specific amplicon when the oligonucleotide complex is formed, but not when the oligonucleotide complex is not formed. The presence or absence of the specific amplicon is used to detect the allele. Detection of the specific amplicon may be achieved using a variety of methods well known in the art, including without limitation, oligonucleotide capture onto DNA chips or microarrays, oligonucleotide capture onto beads or microspheres, electrophoresis, and mass spectrometry. Various labels and address-capture tags may be employed in the amplicon detection step of multiplexed assays, as further described herein.

  6. Method and Apparatus for Concentrating Vapors for Analysis

    DOE Patents [OSTI]

    Grate, Jay W. (West Richland, WA); Baldwin, David L. (Kennewick, WA); Anheier, Jr., Norman C. (Richland, WA)

    2008-10-07

    An apparatus and method are disclosed for pre-concentrating gaseous vapors for analysis. The invention finds application in conjunction with, e.g., analytical instruments where low detection limits for gaseous vapors are desirable. Vapors sorbed and concentrated within the bed of the apparatus can be thermally desorbed achieving at least partial separation of vapor mixtures. The apparatus is suitable, e.g., for preconcentration and sample injection, and provides greater resolution of peaks for vapors within vapor mixtures, yielding detection levels that are 10-10,000 times better than for direct sampling and analysis systems. Features are particularly useful for continuous unattended monitoring applications.

  7. V Fuels Biodiesel Limited | Open Energy Information

    Open Energy Info (EERE)

    Biodiesel Limited Jump to: navigation, search Name: V-Fuels Biodiesel Limited Place: United Kingdom Product: UK-based biodiesel producers. References: V-Fuels Biodiesel Limited1...

  8. Belize Electricity Limited | Open Energy Information

    Open Energy Info (EERE)

    Belize Electricity Limited Jump to: navigation, search Logo: Belize Electricity Limited Name: Belize Electricity Limited Abbreviation: BEL Address: PO Box 327 Place: Belize City,...

  9. Opaque cloud detection

    DOE Patents [OSTI]

    Roskovensky, John K. (Albuquerque, NM)

    2009-01-20

    A method of detecting clouds in a digital image comprising, for an area of the digital image, determining a reflectance value in at least three discrete electromagnetic spectrum bands, computing a first ratio of one reflectance value minus another reflectance value and the same two values added together, computing a second ratio of one reflectance value and another reflectance value, choosing one of the reflectance values, and concluding that an opaque cloud exists in the area if the results of each of the two computing steps and the choosing step fall within three corresponding predetermined ranges.

  10. Flaw detection and evaluation

    DOE Patents [OSTI]

    Wilks, Robert S. (Plum, PA); Sturges, Jr., Robert H. (Plum, PA)

    1983-01-01

    The invention provides a method of and apparatus for optically inspecting nuclear fuel pellets for surface flaws. The inspection system includes a prism and lens arrangement for scanning the surface of each pellet as the same is rotated. The resulting scan produces data indicative of the extent and shape of each flaw which is employed to generate a flaw quality index for each detected flaw. The flaw quality indexes from all flaws are summed and compared with an acceptable surface quality index. The result of the comparison is utilized to control the acceptance or rejection of the pellet.

  11. Nucleic acid detection compositions

    DOE Patents [OSTI]

    Prudent, James R. (Madison, WI); Hall, Jeff G. (Madison, WI); Lyamichev, Victor I. (Madison, WI); Brow, Mary Ann (Madison, WI); Dahlberg, James L. (Madison, WI)

    2008-08-05

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  12. Nucleic acid detection assays

    DOE Patents [OSTI]

    Prudent, James R.; Hall, Jeff G.; Lyamichev, Victor I.; Brow, Mary Ann; Dahlberg, James E.

    2005-04-05

    The present invention relates to means for the detection and characterization of nucleic acid sequences, as well as variations in nucleic acid sequences. The present invention also relates to methods for forming a nucleic acid cleavage structure on a target sequence and cleaving the nucleic acid cleavage structure in a site-specific manner. The structure-specific nuclease activity of a variety of enzymes is used to cleave the target-dependent cleavage structure, thereby indicating the presence of specific nucleic acid sequences or specific variations thereof.

  13. Acoustic enhancement for photo detecting devices

    DOE Patents [OSTI]

    Thundat, Thomas G; Senesac, Lawrence R; Van Neste, Charles W

    2013-02-19

    Provided are improvements to photo detecting devices and methods for enhancing the sensitivity of photo detecting devices. A photo detecting device generates an electronic signal in response to a received light pulse. An electro-mechanical acoustic resonator, electrically coupled to the photo detecting device, damps the electronic signal and increases the signal noise ratio (SNR) of the electronic signal. Increased photo detector standoff distances and sensitivities will result.

  14. Plasmonic trace sensing below the photon shot noise limit

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Pooser, Raphael C.; Lawrie, Benjamin J.

    2015-12-09

    Plasmonic sensors are important detectors of biochemical trace compounds, but those that utilize optical readout are approaching their absolute limits of detection as defined by the Heisenberg uncertainty principle in both differential intensity and phase readout. However, the use of more general minimum uncertainty states in the form of squeezed light can push the noise floor in these sensors below the shot noise limit (SNL) in one analysis variable at the expense of another. Here, we demonstrate a quantum plasmonic sensor whose noise floor is reduced below the SNL in order to perform index of refraction measurements with sensitivities unobtainablemore » with classical plasmonic sensors. The increased signal-to-noise ratio can result in faster detection of analyte concentrations that were previously lost in the noise. As a result, these benefits are the hallmarks of a sensor exploiting quantum readout fields in order to manipulate the limits of the Heisenberg uncertainty principle.« less

  15. Detection of foreign body using fast thermoacoustic tomography with a multielement linear transducer array

    SciTech Connect (OSTI)

    Nie Liming; Xing Da; Yang Diwu; Zeng Lvming; Zhou Quan

    2007-04-23

    Current imaging modalities face challenges in clinical applications due to limitations in resolution or contrast. Microwave-induced thermoacoustic imaging may provide a complementary modality for medical imaging, particularly for detecting foreign objects due to their different absorption of electromagnetic radiation at specific frequencies. A thermoacoustic tomography system with a multielement linear transducer array was developed and used to detect foreign objects in tissue. Radiography and thermoacoustic images of objects with different electromagnetic properties, including glass, sand, and iron, were compared. The authors' results demonstrate that thermoacoustic imaging has the potential to become a fast method for surgical localization of occult foreign objects.

  16. Apparatus for use in sulfide chemiluminescence detection

    DOE Patents [OSTI]

    Spurlin, S.R.; Yeung, E.S.

    1987-01-06

    A method is described for chemiluminescently determining a sulfide which is either hydrogen sulfide or methyl mercaptan by reacting the sulfide with chlorine dioxide at low pressure and under conditions which allow a longer reaction time in emission of a single photon for every two sulfide containing species, and thereafter, chemiluminescently detecting and determining the sulfide. The invention also relates not only to the detection method, but the novel chemical reaction and a specifically designed chemiluminescence detection cell for the reaction. 4 figs.

  17. Apparatus for use in sulfide chemiluminescence detection

    DOE Patents [OSTI]

    Spurlin, Stanford R. (Ames, IA); Yeung, Edward S. (Ames, IA)

    1987-01-01

    A method of chemiluminescently determining a sulfide which is either hydrogen sulfide or methyl mercaptan by reacting the sulfide with chlorine dioxide at low pressure and under conditions which allow a longer reaction time in emission of a single photon for every two sulfide containing species, and thereafter, chemiluminescently detecting and determining the sulfide. The invention also relates not only to the detection method, but the novel chemical reaction and a specifically designed chemiluminescence detection cell for the reaction.

  18. How to Detect Radiation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    How to Detect Radiation How to Survey Measurement Safety Around Radiation Sources Types of Radiation Exposure Managing Radiation Emergencies Procedure Demonstration Detection How to Detect Radiation Radiation cannot be detected by human senses. A variety of instruments are available for detecting and measuring radiation. Examples of radiation survey meters: photos of survey meters alphacounter1.JPG (28857 bytes) This probe is used for the detection of alpha radiation. The most common type of

  19. Toxicity Data to Determine Refrigerant Concentration Limits

    SciTech Connect (OSTI)

    Calm, James M.

    2000-09-30

    This report reviews toxicity data, identifies sources for them, and presents resulting exposure limits for refrigerants for consideration by qualified parties in developing safety guides, standards, codes, and regulations. It outlines a method to calculate an acute toxicity exposure limit (ATEL) and from it a recommended refrigerant concentration limit (RCL) for emergency exposures. The report focuses on acute toxicity with particular attention to lethality, cardiac sensitization, anesthetic and central nervous system effects, and other escape-impairing effects. It addresses R-11, R-12, R-22, R-23, R-113, R-114, R-116, R-123, R-124, R-125, R-134, R-134a, R-E134, R-141b, R-142b, R-143a, R-152a, R-218, R-227ea, R-236fa, R-245ca, R-245fa, R-290, R-500, R-502, R-600a, R-717, and R-744. It summarizes additional data for R-14, R-115, R-170 (ethane), R-C318, R-600 (n-butane), and R-1270 (propylene) to enable calculation of limits for blends incorporating them. The report summarizes the data a nd related safety information, including classifications and flammability data. It also presents a series of tables with proposed ATEL and RCL concentrations-in dimensionless form and the latter also in both metric (SI) and inch-pound (IP) units of measure-for both the cited refrigerants and 66 zerotropic and azeotropic blends. They include common refrigerants, such as R-404A, R-407C, R-410A, and R-507A, as well as others in commercial or developmental status. Appendices provide profiles for the cited single-compound refrigerants and for R-500 and R-502 as well as narrative toxicity summaries for common refrigerants. The report includes an extensive set of references.

  20. Ultrasensitive microanalytical diagnostic methods for rickettsial pathogens

    SciTech Connect (OSTI)

    Hatch, A. V.

    2012-03-01

    A strategic CRADA was established between Sandia National Laboratories (SNL) and the University of Texas Medical Branch (UTMB) at Galveston to address pressing needs for US protection against biological weapons of mass destruction (WMD) and emerging infectious diseases. The combination of unique expertise and facilities at UTMB and SNL enabled interdisciplinary research efforts in the development of rapid and accurate diagnostic methods for early detection of trace priority pathogen levels. Outstanding postdoctoral students were also trained at both institutions to help enable the next generation of scientists to tackle the challenging interdisciplinary problems in the area of biodefense and emerging infectious diseases. Novel approaches to diagnostics were developed and the both the speed of assays as well as the detection sensitivity were improved by over an order of magnitude compared to traditional methods. This is a significant step toward more timely and specific detection of dangerous infections. We developed in situ polymerized porous polymer monoliths that can be used as (1) size exclusion elements for capture and processing of rickettsial infected cells from a sample, (2) photopatternable framework for grafting high densities of functionalized antibodies/fluorescent particles using novel monolith chemistry. Grafting affinity reagents specific to rickettsial particles enables rapid, ultra-sensitive assays by overcoming transport limitations of traditional planar assay approaches. We have selectively trapped particles and bacteria at the cell trap and have also detected picomolar mouse IL-6 captured with only 20 minutes total incubation times using the densely patterned monolith framework. As predicted, the monolith exhibits >10x improvements in both capture speed and capture density compared to traditional planar approaches. The most significant advancements as part of this CRADA is the optimization of techniques allowing the detection of <10 rickettsial cells in a whole blood sample. This detection limit is over 2 orders of magnitude more sensitive that previously reported methods and overcomes a key hurdle in ability to sense dangerous infections before they are too late to treat and contain. We also showed that in the new format, cross-reactivity with interfering species is reduced thereby increasing the specificity of such tests. Promising options to treat whole blood and avoid clogging and non-specific fouling of sensors were also developed.