National Library of Energy BETA

Sample records for mentor vic morris

  1. Kevin Morris

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse Bergkamp Graduate student Subtask 4Photo4> TheKevin Morris Title:

  2. Vic Comello | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN A County roadFeet) DeliveriesVeteran'sVic Comello

  3. GREEN MOUNTAIN MORRIS DANCERS

    E-Print Network [OSTI]

    GREEN MOUNTAIN MORRIS DANCERS A young men's team performing Morris & Sword dances from England Mountain (boys) and Maple Leaf (girls) will be recruiting new members in January 2009, typically 6th grade, but as a springtime dance, to awaken the earth. The Green Mountain Morris and Maple Leaf Morris are based in Norwich

  4. www.vics.org1 2008 Voluntary Interindustry Commerce Solutions (VICS) Association September 27, 2011

    E-Print Network [OSTI]

    Lin, Xiaodong

    . Production is already past its peak in 54 of the 65 largest oil-producing countries. New oil takes more and energy. Oil contributes about 40% of global energy production, but over 95% of all transport fuel. #12 (VICS) Association Time is Up! Production growth will eventually stop and production will peak

  5. Petrography -GEOL 525 Dr. Vic Camp Spring -2004

    E-Print Network [OSTI]

    Camp, Vic

    Petrography - GEOL 525 Dr. Vic Camp Spring - 2004 GMCS - 228K vcamp@geology.sdsu.edu Lecture: MF;Lab Schedule: Igneous Systems Jan. 12 Mineral review Jan. 26 - Feb. 2 Petrography of granites Feb. 9 - Feb. 16 Petrography of mafic and ultramafic plutonic rocks Feb. 23 XRF lab March 1 Petrography

  6. Learning Communities Peer Mentor

    E-Print Network [OSTI]

    Lin, Zhiqun

    , focused communities in which students, staff, and faculty can learn and grow together. Intended Outcomes Experience -Student Evaluations Archive Materials -Reflections of Previous Peer Mentors -Learning Community Activities -Student Evaluation Archives -Former Mentor Contact list #12;Learning Communities Vision Statement

  7. DOE MENTOR-PROTÉGÉ

    Broader source: Energy.gov (indexed) [DOE]

    goal, 52% small business subcontracting goal, and statutory socio-economic goal 2 HISTORY OF DOE MENTOR-PROTG PROGRAM June 9, 1995 The DOE Mentor Protg Program Initiative...

  8. DOE MENTOR-PROTÉGÉ

    Broader source: Energy.gov (indexed) [DOE]

    goal , 52% small business subcontracting goal, and statutory socio-economic goals 2 HISTORY OF DOE MENTOR-PROTG PROGRAM June 9, 1995 The DOE Mentor Protg Program Initiative...

  9. Morris: Noncompliance Determination (2013-SE-5403)

    Broader source: Energy.gov [DOE]

    DOE issued a Notice of Noncompliance Determination to Morris Products, Inc. finding that various models of metal halide lamp fixtures do not comport with the energy conservation standards.

  10. ACM General Meeting Chip Senkbeil & Zack Morris

    E-Print Network [OSTI]

    Cao, Yong

    ACM General Meeting Chip Senkbeil & Zack Morris ACM at VT September 2, 2013 #12;Overview Introduction to Officers Who is your president? Who is your vice president? Who is your treasurer? About ACM? What student talks are queued? Chip Senkbeil & Zack Morris (ACM at VT) ACM General Meeting September 2

  11. Graduate Student Peer Mentoring Handbook

    E-Print Network [OSTI]

    Subramanian, Venkat

    Graduate Student Peer Mentoring Handbook Written by members of the Peer Mentoring Committee. This handbook is designed to help peer mentors meet the needs of students in their department and navigate

  12. Mentors and Projects

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ideas. Borovsky, Joe Mentor Joe Borovsky General Interests Magnetospheric physics, solar-wind physics, solar-windmagnetosphere coupling Suggested Project Topics Theory and...

  13. From: To: Cc: Subject: Date: Morris Alexander

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    To: Cc: Subject: Date: Morris Alexander "Hlls Shawn" Humphrey Shonda CCONJRl: Bartos Miriam RE: Multiple FOIA request filed by the DNC Tuesday, March 17, 2015 8:15:16 AM Thank you...

  14. Mentoring | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on dark matter ByMentor-Protege Application Mentor-ProtegeMentoring

  15. University of Minnesota Morris Clean Energy Investments Recognized...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    of Minnesota Morris Clean Energy Investments Recognized by U.S. Department of Energy University of Minnesota Morris Clean Energy Investments Recognized by U.S. Department of Energy...

  16. MENTORING PAIRINGS (plus others with mentors in common)

    E-Print Network [OSTI]

    May, J. Peter

    -mails, and mentors. (All e-mails are @midway.uchicago.edu.) Philip Ascher pa7 Fowler, Scheels, and Iyer Emil Bojanov and Patel Emily Witt emily1 Amin and Patel #12;MENTORING PAIRINGS 3 SESAME Graduate students and e

  17. UC BERKELEY LIBRARY MENTORING PROGRAM

    E-Print Network [OSTI]

    Alvarez-Cohen, Lisa

    The Library, promoting consistent and excellent public service. Goals of the Mentoring Program: z To createi UC BERKELEY LIBRARY MENTORING PROGRAM for Circulation Services Staff Developed by the Mentoring Program Subcommittee Of the Circulation Services Group © The Library, June 2002 Last Revision July 29

  18. Mentoring | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse BergkampCentermillion MeasurementMemorandumMentoringMentoring Why

  19. ORISE: Mentor Training

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesseworkSURVEY UNIVERSE TheForensic ScienceHow toMentor Training Mentor

  20. GEOL 301 --GEOLOGY OF NATIONAL PARKS AND MONUMENTS Dr. Vic Camp

    E-Print Network [OSTI]

    Camp, Vic

    GEOL 301 -- GEOLOGY OF NATIONAL PARKS AND MONUMENTS Dr. Vic Camp Office: CG-225 Office Hours: MWF 11:00-12:00 a.m. E-mail: vcamp@geology.sdsu.edu Text: Harris et al. (1995) Geology of National Parks Course Description: The constantly evolving earth has been shaped by a variety of geologic processes

  1. Mentor and Protege of the Year

    Broader source: Energy.gov [DOE]

    The DOE Mentor of the Year award recognizes the efforts of a DOE Mentor that has exceeded the requirements of their Mentor-Protégé agreement. These results have enhanced the protégé’s capabilities...

  2. Group Decisions: Analyzing Decision Strategy and Structure in Households Wiktor Adamowicz (U Alberta) Vic.Adamowicz@ualberta.ca

    E-Print Network [OSTI]

    Kammen, Daniel M.

    Alberta) Vic.Adamowicz@ualberta.ca Michael Hanemann (UC Berkeley) hanemann@are.berkeley.edu Joffre Swait (U Alberta & Advanis) Joffre_Swait@Advanis.ca Reed Johnson (Research Triangle Institute, NC

  3. model Anderson, Ryan; Bates, Liana; Johnson, Erick; Morris, Jeffrey...

    Office of Scientific and Technical Information (OSTI)

    Ryan; Bates, Liana; Johnson, Erick; Morris, Jeffrey F. Elsevier None USDOE Netherlands 2015-12-01 English Journal Article Journal Name: Journal of Energy Storage; Journal Volume:...

  4. Mentoring | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse BergkampCentermillion MeasurementMemorandumMentoring

  5. Mentors and Projects

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on dark matter ByMentor-Protege Application

  6. Nominate Your Mentor for the Presidential Award in Science, Math...

    Energy Savers [EERE]

    Nominate Your Mentor for the Presidential Award in Science, Math, and Engineering Mentoring Nominate Your Mentor for the Presidential Award in Science, Math, and Engineering...

  7. VBH-0015- In the Matter of Morris J. Osborne

    Broader source: Energy.gov [DOE]

    This Decision involves a complaint filed by Mr. Morris J. Osborne (hereinafter the complainant) under the Department of Energy (DOE) Contractor Employee Protection Program, 10 C.F.R. Part 708. The...

  8. The perceived influence of past mentoring experiences on the mentoring practices of selected female school executives 

    E-Print Network [OSTI]

    Ashley, Betty Diane

    2009-05-15

    superintendents in this state a unique opportunity to profit from 7 the learning alliance of a mentoring relationship. In 1999, The Texas Association of School Administrators [TASA] implemented a formal mentoring program in response to a legislative mandate... which stated all newly appointed school district superintendents would be assigned a mentor (Rue, 2002). This state program established specific criteria and standards for both the mentor and mentee participants. What Is Mentoring? Although earlier...

  9. ARM Lead Mentor Selection Process

    SciTech Connect (OSTI)

    Sisterson, DL

    2013-03-13

    The ARM Climate Research Facility currently operates more than 300 instrument systems that provide ground-based observations of the atmospheric column. To keep ARM at the forefront of climate observations, the ARM infrastructure depends heavily on instrument scientists and engineers, also known as Instrument Mentors. Instrument Mentors must have an excellent understanding of in situ and remote-sensing instrumentation theory and operation and have comprehensive knowledge of critical scale-dependent atmospheric processes. They also possess the technical and analytical skills to develop new data retrievals that provide innovative approaches for creating research-quality data sets.

  10. Mentoring Resources | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse BergkampCentermillion MeasurementMemorandumMentoring PoliciesMentoring

  11. Effects of Absolute Proximity Between Landmark and Platform in a Virtual Morris Pool Task with Humans

    E-Print Network [OSTI]

    Artigas, A. A.; Aznar-Casanova, J. A.; Chamizo, V. D.

    2005-01-01

    overshadowing in a virtual pool: Simple guidance is a goodin the Morris swimming pool navigation task. Learning andand Platform in a Virtual Morris Pool Task with Humans A. A.

  12. 188 University of Minnesota Morris 200911 Catalog Campus Directory

    E-Print Network [OSTI]

    Thomas, David D.

    188 University of Minnesota Morris 2009­11 Catalog Campus Directory Questions? Problems? Need information? The following UMM directory should assist persons in directing their requests to the proper-related excuses. Human Resources 589-6024 Personnel services, employee benefits and payroll. Humanities, Division

  13. Research Mentors | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram: Report AppendicesA Token Requesting A Token RequestingResearch Mentors

  14. OVERVIEW of STEM MENTORING CAFÉ MODEL

    Energy Savers [EERE]

    a volunteer contact sheet, using STEM mentor's contact information and profile pictures. DOE and the museum will work collaboratively. Contact sheet will need to be compiled...

  15. Mentoring and Educating to Increase Diversity in Science, Tech...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Mentoring and Educating to Increase Diversity in Science, Tech, Engineering and Math Mentoring and Educating to Increase Diversity in Science, Tech, Engineering and Math October...

  16. Home Performance Training and Mentoring: Lessons and Resources...

    Energy Savers [EERE]

    Home Performance Training and Mentoring: Lessons and Resources Home Performance Training and Mentoring: Lessons and Resources Better Buildings Residential Network Workforce...

  17. Former NERSC Consultant Mentors Math, Computer Science Students

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Former NERSC Consultant Mentors Math, Computer Science Students Former NERSC Consultant Mentors Math, Computer Science Students March 10, 2015 Frank Hale, a former consultant in...

  18. Mentoring Among Scientists: Implications of Interpersonal Relationships within a Formal Mentoring Program

    SciTech Connect (OSTI)

    Bryan D. Maughan

    2006-11-01

    Mentoring is an established strategy for learning that has its root in antiquity. Most, if not all, successful scientists and engineers had an effective mentor at some point in their career. In the context of scientists and engineers, mentoring has been undefined. Reports addressing critical concerns regarding the future of science and engineering in the U.S. mention the practice of mentoring a priori, leaving organizations without guidance in its application. Preliminary results from this study imply that formal mentoring can be effective when properly defined and operationalized. Recognizing the uniqueness of the individual in a symbiotic mentor-protégé relationship significantly influences a protégé’s learning experience which carries repercussions into their career intentions. The mentor-protégé relationship is a key factor in succession planning and preserving and disseminating critical information and tacit knowledge essential to the development of leadership in the science and technological industry.

  19. Morris County Improvement Authority, Morris County, New Jersey Renewable Energy Initiative

    SciTech Connect (OSTI)

    Bonanni, John Chair, Morris County Improvement Authority

    2013-05-01

    The Morris County Improvement Authority (?Authority?), a public body corporate and politic of the State of New Jersey and created and controlled by the County, at the direction of the County and through the Program guaranteed by the County, financed 3.2 MW of solar projects (?Solar Projects?) at fifteen (15) sites for seven (7) local government units (?Local Units?) in and including the County. The Program uses a Power Purchase Agreement (?PPA?) structure, where the Solar Developer constructs, operates and maintains all of the Solar Projects, for the benefit of the Local Units and the Authority, for the maximum State law allowable PPA period of fifteen (15) years. Although all fifteen (15) sites were funded by the Authority, only the Mennen Arena site was considered for the purposes of the required local match funding for this grant. Specifically at the Mennen Arena site, the Authority financed 1.6 MW of solar panels. On October 18, 2013, the DOE Grant was drawn down following completion of the necessary application documents and final execution of an agreement memorializing the contemplated transaction by the Local Units, the County, The Authority and the solar developer. The proceeds of the DOE Grant were then applied to reduce the PPA price to all Local Units across the program and increase the savings from approximately 1/3 to almost half off the existing and forecasted utility pricing over the fifteen (15) year term, without adversely affecting all of the other benefits. With the application of the rate buy down, the price of electricity purchased under the PPA dropped from 10.9 to 7.7 cents/kWh. This made acquisition of renewable energy much more affordable for the Local Units, and it enhanced the success of the program, which will encourage other counties and local units to develop similar programs.

  20. Mentoring Program | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse BergkampCentermillion MeasurementMemorandumMentoring Policies

  1. Mentor Responsibilities | Robotics Internship Program

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on dark matter By SarahMODELINGMeetingsMembranesMemorialProgramMentor

  2. "The Big WHY": Philip Morris's failed search for corporate social value.

    E-Print Network [OSTI]

    McDaniel, Patricia A; Malone, Ruth E

    2012-01-01

    quality system regulatory affairs Marketing Operations Sabrina Gissendanner Director, packaging services Operations David Lowy Vice president, environmental affairs Philip Morris Management

  3. Morris. Alexander From: Sent: To: Subject: FOlA-Central@hq.doe...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    RIEHLE FOIA AND PRIVACYACT OFFICER RICHLAND OPERATIONS OFFICE FROM: ALEXANDER C. MORRIS FOIA OFFICER OFFICEOF INFORMATION RESOURCES SUBJECT: FOIA REQUESTOF JON STEIN The...

  4. 10 CFR 850, Request for Information- Docket Number: HS-RM-10-CBDPP- Thomas W. Morris

    Broader source: Energy.gov [DOE]

    Commenter: Thomas W. Morris 10 CFR 850 - Request for Information Docket Number: HS-RM-10-CBDPP Comment Close Date: 2/22/2011

  5. Mentoring at Argonne | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on dark matter ByMentor-Protege Application Mentor-ProtegeMentoring

  6. Webinar: Energy Is Everywhere! STEM Mentoring

    Broader source: Energy.gov [DOE]

    As part of the “Energy Is Everywhere” webinar series and in honor of Mentoring Month, the U.S. Departments of Housing & Urban Development, Energy, and Education are pleased to offer a STEM...

  7. University of Minnesota -- Morris Wind Farm | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThin FilmUnited States: Energy ResourcesPark-- Morris Wind Farm Jump

  8. University of Minnesota Morris II - PES | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EISTJThin FilmUnited States: Energy ResourcesPark-- Morris Wind Farm

  9. Veterans and STEM Mentoring Programs- Info Session and Brown Bag Networking

    Broader source: Energy.gov [DOE]

    January is National Mentoring Month. Join the Veterans Mentoring Program and the STEM Mentoring Program at DOE for information distribution and networking to meet current and potential mentors and...

  10. Mentoring Blog Learning Project* Platinum Level of Recognition Purpose: The Mentoring Blog Learning Project provides you with the opportunity to mentor two other UIC

    E-Print Network [OSTI]

    Illinois at Chicago, University of

    Mentoring Blog Learning Project* ­ Platinum Level of Recognition Purpose: The Mentoring Blog to earn a UIC Experience Certificate. The Mentoring Blog Project consists of approaching two other UIC to earn a UIC Experience Certificate. You will then submit a written blog in which you describe your

  11. Mentor & Intern Teacher Boundary Practices: Integrating Theory and Practice in Effective Alternative Certification Programs

    E-Print Network [OSTI]

    Tompkins, R Page

    2011-01-01

    handbook, training materials, and course catalog, as appropriate to each program. Program Characteristics: Mentoring MS=Mentor Selection

  12. C:\\idrive\\web\\intro6e\\supplement\\Supplement6(c)XML.doc Last printed Supplement VI.C: XML

    E-Print Network [OSTI]

    Liang, Y. Daniel

    C:\\idrive\\web\\intro6e\\supplement\\Supplement6(c)XML.doc Last printed Supplement VI.C: XML For Introduction to Java Programming By Y. Daniel Liang This supplement covers the following topics: · Creating XML to format and display query results and process database operations in Oracle. 1 #12;C:\\idrive\\web\\intro6e\\supplement\\Supplement

  13. Mentoring Program | National Nuclear Security Administration

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse BergkampCentermillion MeasurementMemorandumMentoring Policies andMentoring

  14. Mentor-Protege Application | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on dark matter ByMentor-Protege Application Mentor-Protege

  15. NSF Mentoring Plan for Post Docs: Postdoctoral Researcher Mentoring Plan. Each proposal that requests funding to

    E-Print Network [OSTI]

    Rhode Island, University of

    . See GPG Chapter II.D.4 for additional information on collaborative proposals. Examples of mentoring will be returned without review (see GPG Chapter IV.B.) If you need additional information on preparing a post doc

  16. Failing to Mentor Sapphire: The Actionability of Blocking Black Women from Intiating Mentoring Relationships

    E-Print Network [OSTI]

    Smith, Pamela J.

    2000-01-01

    find 10. See M. Carole Pistole, Mentoring Women's Academicwhite colleagues). But cf. Pistole, supra note 10, at 29 (note 22, at 24. 39. See Pistole, supra note 10, at 29. 40.

  17. THESIS DEFENSE COMMITTEE FORM Mentor:Department

    E-Print Network [OSTI]

    Emmons, Scott

    THESIS DEFENSE COMMITTEE FORM Student: Mentor:Department: Thesis Seminar Date: 2. 1 be submitted to the Graduate Office at least 2 months prior to the Defense date. § The thesis defense seminar announcement and full CV must be submitted together with this form. Check if Collaborator Attended Thesis

  18. LAUC-LA Mentoring Application Unit/ Department

    E-Print Network [OSTI]

    Williams, Gary A.

    what type of role you'd like to take on in the mentoring relationship. (If you are interested in being/ Involvement at the Local/ State/ National Level Assessment/ User Surveys What areas are you interested completed form to your computer and submit it via e-mail as a PDF attachment to kbalster@library

  19. Mentor, Ohio: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: Energy Resources Jump to:ElectricCoordinationMenomonie, Wisconsin:Mentor, Ohio:

  20. Mentor, Wisconsin: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: Energy Resources Jump to:ElectricCoordinationMenomonie, Wisconsin:Mentor,

  1. Mentoring and Job Training in the Field for Newly Trained Contractors...

    Energy Savers [EERE]

    Mentoring and Job Training in the Field for Newly Trained Contractors Mentoring and Job Training in the Field for Newly Trained Contractors Better Buildings Neighborhood Program...

  2. AGREEMENT FOR A MENTOR/PROTG ENGAGEMENT ARRANGED BY

    E-Print Network [OSTI]

    notice to the other parties. 4. Neither BATTELLE nor the DOE nor the MENTOR shall be liable for any own conduct. #12;TERMS AND CONDITIONS OF AGREEMENT (cont'd) ______ 6. Neither the PROTÉGÉ nor contract, DE-AC05-76RL0 1830, with the DOE. Accordingly, neither the PROTÉGÉ nor the MENTOR will receive

  3. Mentoring Policies and Procedures | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse BergkampCentermillion MeasurementMemorandumMentoring Policies and

  4. Revised By: Lucy Paltoo, Retention Specialist & Mentor Program Coordinator Revised: March 2012 Peer Mentor Application 2012-2013

    E-Print Network [OSTI]

    Rutledge, Steven

    ): Second Year Third Year Fourth Year + Transferred to CSU Year involved with AAC (currently): First Year Second Year Third Year Fourth Year + Cumulative CSU GPA : ___________ Major Mentor Application 2012-2013 To be consider for a Peer Mentor position for the 2012-2013 academic year

  5. Sample Postdoctoral Mentoring Plan for an NSF Proposal (1 page limit) [Note: The following mentoring plan is provided as an example; however, the mentoring plan should fit the

    E-Print Network [OSTI]

    mentoring plans, please see the NSF GPG Chapter II, Proposal Preparation Instructions, item j: http://www.nsf.gov/pubs/policydocs/pappguide/nsf09_29/gpg_2.jsp#IIC2j #12;

  6. UFlood: High-Throughput Flooding over Wireless Mesh Networks Jayashree Subramanian, Robert Morris, and Hari Balakrishnan

    E-Print Network [OSTI]

    UFlood: High-Throughput Flooding over Wireless Mesh Networks Jayashree Subramanian, Robert Morris--This paper proposes UFlood, a flooding protocol for wireless mesh networks. UFlood targets situations of completion of a flood to the slowest receiving node and total time spent transmitting. The key to achieving

  7. Smart Sensor Snow Thomas C. Henderson, Mohamed Dekhil, Scott Morris, Yu Chen and William B. Thompson

    E-Print Network [OSTI]

    Henderson, Thomas C.

    Smart Sensor Snow Thomas C. Henderson, Mohamed Dekhil, Scott Morris, Yu Chen and William B. Thompson Department of Computer Science University of Utah Salt Lake City, Utah 84112 Abstract We propose to them automat- ically and by means of a distributed algorithm. For ex- ample, given a 200 by 200 grid

  8. Interior Duct Wall Pressure Downstream of a Low-Speed Scott C. Morris

    E-Print Network [OSTI]

    Alonso, Juan J.

    Interior Duct Wall Pressure Downstream of a Low-Speed Rotor Scott C. Morris , David B. Stephens The region downstream of a ducted rotor has been experimentally investigated in terms of its wake characteristics and the duct wall pressure fluctuations. The motivation for the measurements was to document

  9. Natural versus forced convection in laminar starting plumes Michael C. Rogers and Stephen W. Morris

    E-Print Network [OSTI]

    Morris, Stephen W.

    fluid from a small, submerged outlet. The plumes were laminar and spanned a wide range of plume, the most important fac- tor determining jet or plume behaviour and evolution is whether the flow is laminar orNatural versus forced convection in laminar starting plumes Michael C. Rogers and Stephen W. Morris

  10. UC Student Sustainability Survey Dr Matt Morris, Sustainability Advocate, UC Sustainability Office, October 2013

    E-Print Network [OSTI]

    Hickman, Mark

    1 2013 UC Student Sustainability Survey Dr Matt Morris, Sustainability Advocate, UC Sustainability (but like the 2011 survey, n=300) it also asked about specific sustainability initiatives on campus the findings from the 2012 survey, again indicating a strong level of student interest in sustainability

  11. UC Student Sustainability Survey Dr Matt Morris, Sustainability Advocate, UC Sustainability Office, October 2012

    E-Print Network [OSTI]

    Hickman, Mark

    1 2012 UC Student Sustainability Survey Dr Matt Morris, Sustainability Advocate, UC Sustainability the results of the inaugural 2011 UC Sustainability Survey, and partly to test an alternative method asked questions relating to attitudes to and awareness of sustainability, as well as knowledge

  12. Monday, April 18 at 1 p.m. Morris Library Auditorium

    E-Print Network [OSTI]

    Cheatwood, Joseph L.

    Monday, April 18 at 1 p.m. Morris Library Auditorium Refreshments in First Floor Rotunda following lecture Open to the Public Abstract: Alzheimer's disease is the most common form of dementia resulting in a progressive loss of intellectual function that is characterized in its earliest stages as a loss of memory

  13. Internet use and non-use: views of older users ANNE MORRIS*, JOY GOODMAN

    E-Print Network [OSTI]

    Goodman, Joy

    1 Internet use and non-use: views of older users ANNE MORRIS*, JOY GOODMAN + AND HELENA BRADING: older people elderly Internet digital divide technology Abstract: This paper reports the results of two connected surveys of computer and Internet use among the older population in the UK. 120 questionnaires

  14. The anisotropic free energy of the Lennard-Jones crystal-melt interface James R. Morris

    E-Print Network [OSTI]

    Song, Xueyu

    The anisotropic free energy of the Lennard-Jones crystal-melt interface James R. Morris Metal; accepted 22 May 2003 We have calculated the free energy of the crystal-melt interface for the Lennard are in good agreement with previous calculations of the free energies, based upon simulations used

  15. Dynamic Pricing Strategies under a Finite Time Horizon Joan Morris DiMicco

    E-Print Network [OSTI]

    to scalpers. Cost has been perhaps the greatest factor precluding the widespread use of dynamic pricing goods, but in digital markets, the costs associated with making frequent, instantaneous price changesDynamic Pricing Strategies under a Finite Time Horizon Joan Morris DiMicco MIT Media Laboratory 20

  16. Page 1 of 3, August 2014 GBAS Mentoring

    E-Print Network [OSTI]

    Sin, Peter

    program. Commitment A key component of the mentoring program is the commitment to self-development through that was accomplished for the benefit of the mentee's unit. This goal or project can also serve to support a mentee

  17. Hydrogen and Fuel Cell Mentors Honored as Outstanding | Awards...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Hydrogen and Fuel Cell Mentors Honored as Outstanding June 5, 2015 Photo of two women and one man posing for a photo in front of a scientific poster. (Left to Right) Huyen Dinh,...

  18. A review of "Popular Measures: Poetry and Church Order in Seventeenth-Century Massachusetts." by Amy M. E. Morris 

    E-Print Network [OSTI]

    William J. Scheick

    2006-01-01

    REVIEWS 57 Amy M. E. Morris. Popular Measures: Poetry and Church Order in Seventeenth- Century Massachusetts. Newark: University of Delaware Press, 2005. 282 pp. $53.50. Review by WILLIAM J. SCHEICK, UNIVERSITY OF TEXAS AT AUSTIN. During recent...

  19. Morris. Alexander From: Sent: To: Subject: FOIA-Central@hq.doe.gov

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGEMissionStress Newradical changes atDOECMS-SupportMorris.

  20. Mentoring programme The New York Academy of Sciences

    E-Print Network [OSTI]

    Cai, Long

    in Washington DC are collaborating on a mentoring programme in science, technology, engineering and maths (STEM a growth of 5.7% for 2014­15. Community colleges, which offer basic tertiary education, reported a 7. As a science-trained PhD- holder, if you seek employment outside aca- demia -- and greater economic reward

  1. Revised By: Lucy Paltoo, Retention Specialist & Mentor Program Coordinator Revised: January 2013 Peer Mentor Application 2013-2014

    E-Print Network [OSTI]

    Stephens, Graeme L.

    ): Second Year Third Year Fourth Year + Transferred to CSU Year involved with AAC: First Year Second Year Third Year Fourth Year + Cumulative CSU GPA : ___________ Major year, please complete and submit this application along with a copy of your resume. Peer Mentor

  2. Congruence of perceptions among the principal, mentor teacher, and novice teacher regarding the principal's role in a campus mentoring program 

    E-Print Network [OSTI]

    Larrison, Lucy Elaine

    2006-10-30

    are an effective means of addressing this issue and that principals serve a critical role in the success of these programs (Moir 2001; Ingersoll, 2001a). Although mentoring and principal support have been recognized as key components in the retention of novice...

  3. Ethane Oxidative Dehydrogenation Pathways on Vanadium Oxide Catalysts Morris D. Argyle, Kaidong Chen, Alexis T. Bell,* and Enrique Iglesia*

    E-Print Network [OSTI]

    Iglesia, Enrique

    Ethane Oxidative Dehydrogenation Pathways on Vanadium Oxide Catalysts Morris D. Argyle, Kaidong to determine the identity and reversibility of elementary steps involved in ethane oxidative dehydrogenation concurrent formation of C2H6-xDx or C2H4-xDx isotopomers, suggesting that C-H bond cleavage in ethane

  4. Wide-area cooperative storage with CFS Frank Dabek, M. Frans Kaashoek, David Karger, Robert Morris, Ion Stoica

    E-Print Network [OSTI]

    Sirer, Emin Gun

    Wide-area cooperative storage with CFS Frank Dabek, M. Frans Kaashoek, David Karger, Robert Morris://pdos.lcs.mit.edu/chord/ Abstract The Cooperative File System (CFS) is a new peer-to-peer read- only storage system that provides provable guarantees for the ef- ficiency, robustness, and load-balance of file storage and retrieval. CFS

  5. Transient spatiotemporal chaos in the Morris-Lecar neuronal ring network

    SciTech Connect (OSTI)

    Keplinger, Keegan Wackerbauer, Renate

    2014-03-15

    Transient behavior is thought to play an integral role in brain functionality. Numerical simulations of the firing activity of diffusively coupled, excitable Morris-Lecar neurons reveal transient spatiotemporal chaos in the parameter regime below the saddle-node on invariant circle bifurcation point. The neighborhood of the chaotic saddle is reached through perturbations of the rest state, in which few initially active neurons at an effective spatial distance can initiate spatiotemporal chaos. The system escapes from the neighborhood of the chaotic saddle to either the rest state or to a state of pulse propagation. The lifetime of the chaotic transients is manipulated in a statistical sense through a singular application of a synchronous perturbation to a group of neurons.

  6. Mentoring to Increase Diversity in Science, Tech, Engineering and Math |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICESpecial ReportProposal to changeNovemberEnergy Mentoring Our

  7. Mentor Protege Overview and History | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data CenterFinancialInvesting in MinorityOverview and History Mentor Protege

  8. Mentor Protege Policy and Guidelines | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data CenterFinancialInvesting in MinorityOverview and History Mentor

  9. HowtoMentorGraduateStudents Professional and Academic Development (PAD) Seminar Series

    E-Print Network [OSTI]

    Finley Jr., Russell L.

    HowtoMentorGraduateStudents Professional and Academic Development (PAD) Seminar Series Friday Vice President for Research Compliance, Division of Research philc@wayne.edu David Rueda, Associate

  10. Congratulations to all of the award recipients and thank you to all of the presenters! Graduate Dean's Excellence in Doctoral Student Mentoring Award

    E-Print Network [OSTI]

    Chiao, Jung-Chih

    ($300) - Kallie Kosc (History) Title: \\"Friends of Our Fathers\\": Praying Indian Patriots and American FOR LANGUAGE PRESERVATION Faculty Mentor(s): Cynthia Kilpatrick Undergraduate Afternoon Oral Presentation

  11. Comparison Table of Department of Energy Mentor-Protege Program |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data Center HomeVehicleDepartment of Energy Programs » Mentor-Protégé

  12. Mentor Protege Requirements and Agreement | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data CenterFinancialInvesting in MinorityOverview and History MentorProtégé

  13. Accretions of Dark Matter and Dark Energy onto ($n+2$)-dimensional Schwarzschild Black Hole and Morris-Thorne Wormhole

    E-Print Network [OSTI]

    Ujjal Debnath

    2015-03-06

    We have studied accretion of the dark matter and dark energy onto of $(n+2)$-dimensional Schwarzschild black hole and Morris-Thorne wormhole. The mass and the rate of change of mass for $(n+2)$-dimensional Schwarzschild black hole and Morris-Thorne wormhole have been found. We have assumed some candidates of dark energy like holographic dark energy, new agegraphic dark energy, quintessence, tachyon, DBI-essence, etc. The black hole mass and the wormhole mass have been calculated in term of redshift when dark matter and above types of dark energies accrete onto them separately. We have shown that the black hole mass increases and wormhole mass decreases for holographic dark energy, new agegraphic dark energy, quintessence, tachyon accretion and the slope of increasing/decreasing of mass sensitively depends on the dimension. But for DBI-essence accretion, the black hole mass first increases and then decreases and the wormhole mass first decreases and then increases and the slope of increasing/decreasing of mass not sensitively depends on the dimension.

  14. Driven magnetic reconnection in the COMPASSC tokamak A. W. Morris, P. G. Carolan, R. Fitzpatrick, T. C. Hender, and T. N. Todd

    E-Print Network [OSTI]

    Fitzpatrick, Richard

    Driven magnetic reconnection in the COMPASSC tokamak A. W. Morris, P. G. Carolan, R. Fitzpatrick, T measurements on COMPASSC tokamak from electron cyclotron emission cutoffs Rev. Sci. Instrum. 67, 462 (1996); 10.1063/1.1146613 Spontaneous and driven perpendicular rotation in tokamaks Phys. Fluids B 5, 2519 (1993); 10

  15. Karanjkar, J. L., J. Morris (2012). "Surfactant Effects on Hydrate Crystallization at the Water-Oil Interface: Hollow-Conical Crystals." American Chemical Society 12: 3817-3824.

    E-Print Network [OSTI]

    2012-01-01

    of hydrogen bonded water molecules. Typically, clathrate hydrates form under high pressure and low temperatureKaranjkar, J. L., J. Morris (2012). "Surfactant Effects on Hydrate Crystallization at the Water-Oil in environments containing both oil and water. After initial formation, the hydrate structures bond to each other

  16. "When you want to give up, you want to give in": Mentoring perceptions of African American women doctoral students at a predominately White institution 

    E-Print Network [OSTI]

    Fowler, Rhonda Michelle

    2013-08-08

    meaning of their mentoring experiences with at a predominantly White institution (PWI). The research questions to guide this study were: (1) what are the perceptions of faculty mentoring for African American female doctoral students in this HRD program...

  17. PNNL Mentor-Protg Program Making strategic connections to help small technology

    E-Print Network [OSTI]

    , stabilization, and growth of regional technology- based businesses by providing a network of individualsPNNL Mentor-Protégé Program Making strategic connections to help small technology businesses thrive Office at the Pacific Northwest National Laboratory (PNNL) is to encourage the expansion of technology

  18. EVALUATION OF THE WOMEN FACULTY MENTORING PROGRAM AT THE UNIVERSITY OF WISCONSIN-MADISON

    E-Print Network [OSTI]

    Sheridan, Jennifer

    : DIVISIONAL INFORMATION 35 #12;1 INTRODUCTION The Women in Science & Engineering Leadership Institute (WISELI sources of data to inform the evaluation of the Women Faculty Mentoring Program (WFMP). First, we rates of the two data sources. Next, we briefly outline the history, purpose, and implementation

  19. Mentoring and Faculty Development Handbook for the Department of Preventive Medicine

    E-Print Network [OSTI]

    Mentoring and Faculty Development Handbook for the Department of Preventive Medicine 20112012.D. Assistant Professor Donald M. LloydJones, MD, ScM Chair, Department of Preventive Medicine Associate Professor of Preventive Medicine and Medicine (Cardiology) Please forward all comments and suggested

  20. The Effects of School-Based Mentoring on Student Achievement for Junior High School Students 

    E-Print Network [OSTI]

    Schnautz, Bradley Michael

    2014-08-26

    The purpose of this study was to examine the effectiveness of the ISAGE program, a school-based mentoring program designed to facilitate the achievement of junior high school students who were deemed “at-risk.” Participants included a total of 72...

  1. Insights into a researcher's attempt to study the mentoring needs of first-year, white, female teachers in diverse schools 

    E-Print Network [OSTI]

    Attaway, Kathy Ann

    2008-10-10

    While schools in America are becoming more culturally diverse, the majority of first-year teachers continue to be white females. Although mentoring has proven to be an effective means of supporting first-year teachers, ...

  2. Exploration of the Impact of the Same Developmental Mentor Training Within the Infrastructure of Two Different School Districts 

    E-Print Network [OSTI]

    Anderson, Amy E.

    2010-01-16

    with implications for including or deleting infrastructure from program design are considered. The outcomes from this study will be useful for those in the midst of creating and improving district level mentoring programs. The findings offer the potential...

  3. DHS National Technical Nuclear Forensics Program FY 10 Summary Report: Graduate Mentoring Assistance Program (GMAP)

    SciTech Connect (OSTI)

    Martha R. Finck Ph.D.

    2011-10-01

    This program provides practical training to DHS graduate fellows in the DOE laboratory complex. It involves coordinating students, their thesis advisors, and their laboratory project mentors in establishing a meaningful program of research which contributes to the graduate student's formation as a member of the nuclear forensics community. The summary report details the student/mentor experience and future plans after the first summer practicum. This program provides practical training to DHS graduate fellows in the DOE laboratory complex. It involves coordinating students, their thesis advisors, and their laboratory project mentors in establishing a meaningful program of research which contributes to the graduate student's formation as a member of the nuclear forensics community. This final written report includes information concerning the overall mentoring experience, including benefits (to the lab, the mentors, and the students), challenges, student research contributions, and lab mentor interactions with students home universities. Idaho National Laboratory hosted two DHS Nuclear Forensics graduate Fellows (nuclear engineering) in summer 2011. Two more Fellows (radiochemistry) are expected to conduct research at the INL under this program starting in 2012. An undergraduate Fellow (nuclear engineering) who worked in summer 2011 at the laboratory is keenly interested in applying for the NF Graduate Fellowship this winter with the aim of returning to INL. In summary, this program appears to have great potential for success in supporting graduate level students who pursue careers in nuclear forensics. This relatively specialized field may not have been an obvious choice for some who have already shown talent in the traditional areas of chemistry or nuclear engineering. The active recruiting for this scholarship program for candidates at universities across the U.S. brings needed visibility to this field. Not only does this program offer critical practical training to these students, it brings attention to a very attractive field of work where young professionals are urgently required in order for the future. The effectiveness of retaining such talent remains to be seen and may be primarily controlled by the availability of DOE laboratory research funding in this field in the years to come.

  4. The Morris Worm

    E-Print Network [OSTI]

    Kelty, Christopher

    2011-01-01

    risk posed by a virus to a particular computer multiplied byviolence a virus or worm might visit on a computer and itsof computer security. The language of viruses and worms

  5. The Morris Worm

    E-Print Network [OSTI]

    Kelty, Christopher

    2011-01-01

    and data acquisition (SCADA) software, especially when it isW32.Stuxnet worm targeted SCADA software made by Siemensa computer running the Siemens SCADA software.   The worm

  6. Morris Boundary Facility

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGEMissionStress Newradical changes at

  7. Morris Extended Facility

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGEMissionStress Newradical changes at

  8. Physics PhD Mentors at CCNY, 2014 (Please also see faculty and staff profiles on the Physics website)

    E-Print Network [OSTI]

    Sun, Yi

    Physics PhD Mentors at CCNY, 2014 (Please also see faculty and staff profiles on the Physics molecular biological physics; electron and proton transfer reactions; solar energy Koder, Ronald koder@sci.ccny.c uny.edu http://web.sci.ccny.cuny.edu/~koder/koder.ht ml experimental biological physics; de novo #12

  9. 2015 W2's Outstanding Woman Mentor Award Presented at the W2: The Women to Women Conference

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    2015 W2's Outstanding Woman Mentor Award Presented at the W2: The Women to Women Conference As we be able to accept the award in person, at the 2015 W2: Women to Women Conference, scheduled for Thursday a complimentary registration to the conference. To submit a nomination, please complete the nomination form below

  10. A critical analysis of power in the institutionalization of changes in a new teacher mentoring program: a case study 

    E-Print Network [OSTI]

    Ferguson, Phyllis Cavanaugh

    2009-05-15

    The purpose of this case study is to describe the way power, as individual agency, works in the space of institutionalization of a new teacher mentoring program. The space of institutionalization is thought of as a space in which the design...

  11. Character and Object Becky Morris

    E-Print Network [OSTI]

    Avigad, Jeremy

    - siderably (see e.g. [Mon72], [You76], [Kle89], [Luz98a], and [Luz98b]). Most of the historical literature [Luz98a], [Luz98b]. In particular, we will follow Kleiner's presentation closely. The purpose

  12. Morris Swartz Johns Hopkins University

    E-Print Network [OSTI]

    Weaver, Harold A. "Hal"

    Classical Mechanics Laboratory/Electricty& Magnetism Laboratory, 1 credit, 16 semesters: Fall 2005 - Spring

  13. Morris Plant Energy Efficiency Program 

    E-Print Network [OSTI]

    Betczynski, M. T.

    2004-01-01

    to existing operating practices. Plant management also takes an active role in recognizing accomplishments and holding personnel accountable for continued improvement in energy efficiency. The control systems group at Equistar has integrated an Aspen...

  14. J.W. Morris, Jr.

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACT EVALUATIONIntroducing theActivation byIs aItem NotJ.NOON

  15. Experiences with TeleMentoring: Lab Teaching over ATM Networks J. M. Smith, C. B. S. Traw, W. S. Marcus, T. J. Bogovic, S. B. Davidson,

    E-Print Network [OSTI]

    Smith, Jonathan M.

    . In our trial, the interaction was between teams of undergraduate computer science students the laboratory portion of an undergraduate computer science course through interaction with remote ``mentors could be accelerated. Further, projects could be chosen which were meaningful to industrial research

  16. Meteorological Data Report Quinault Indian Reservation (vic. Point Grenville), Washington

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: Energy Resources

  17. Microsoft PowerPoint - Vic.Reis.Salishan.09

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on darkMicroorganismsnowReport ARM28Greg Ball DNV

  18. Training and Mentoring the Next Generation of Scientists and Engineers to Secure Continuity and Successes of the US DOE's Environmental Remediation Efforts - 13387

    SciTech Connect (OSTI)

    Lagos, L.

    2013-07-01

    The DOE Office of Environmental Management (DOE-EM) oversees one of the largest and most technically challenging cleanup programs in the world. The mission of DOE-EM is to complete the safe cleanup of the environmental legacy from five decades of nuclear weapons development and government-sponsored nuclear energy research. Since 1995, Florida International University's Applied Research Center (FIU-ARC) has supported the DOE-EM mission and provided unique research capabilities to address some of these highly technical and difficult challenges. This partnership has allowed FIU-ARC to create a unique infrastructure that is critical for the training and mentoring of science, technology, engineering, and math (STEM) students and has exposed many STEM students to 'hands-on' DOE-EM applied research, supervised by the scientists and engineers at ARC. As a result of this successful partnership between DOE and FIU, DOE requested FIU-ARC to create the DOE-FIU Science and Technology Workforce Development Initiative in 2007. This innovative program was established to create a 'pipeline' of minority STEM students trained and mentored to enter DOE's environmental cleanup workforce. The program was designed to help address DOE's future workforce needs by partnering with academic, government and private companies (DOE contractors) to mentor future minority scientists and engineers in the research, development, and deployment of new technologies and processes addressing DOE's environmental cleanup challenges. Since its inception in 2007, the program has trained and mentored 78 FIU STEM minority students. Although, the program has been in existence for only five years, a total of 75 internships have been conducted at DOE National Laboratories, DOE sites, DOE Headquarters and field offices, and DOE contractors. Over 85 DOE Fellows have participated in the Waste Management Symposia since 2008 with a total of 68 student posters and 7 oral presentations given at WM. The DOE Fellows participation at WM has resulted in three Best Student Poster Awards (WM09, WM10, and WM11) and one Best Professional Poster Award (WM09). DOE Fellows have also presented their research at ANS DD and R and ANS Robotics Topical meetings. Moreover, several of our DOE Fellows have already obtained employment with DOE-EM, other federal agencies, DOE contractors. This paper will discuss how DOE Fellows program is training and mentoring FIU STEM students in Department of Energy's Office of Environmental Management technical challenges and research. This training and mentoring has resulted in the development of well trained and polished young scientists and engineers that will become the future workforce in charge of carrying on DOE-EM's environmental cleanup mission. The paper will showcase FIU's DOE Fellows model and highlight some of the applied research the DOE Fellows have conducted at FIU's Applied Research Center and across the Complex by participating in summer internship assignments. This paper will also present and highlight other Fellowships and internships programs sponsored by National Nuclear Security Agency (NNSA), DOE-EM, NRC, Energy (NE), and other federal agencies targeting workforce development. (authors)

  19. USC's 10 Best Practices for Establishing a Successful Mentoring Culture (Draft): Below are a few best-practices currently in use by some of the Schools at USC and other peer universities

    E-Print Network [OSTI]

    Zhou, Chongwu

    of the academic culture of your unit. (Each school is unique. Particular levels of excellence and performance must as a reportable activity on every school's Annual Review Form. (As well as then publicly rewarding the intellectual contribution and time commitment given by good mentors--perhaps creating inventive ways

  20. Training, Certification, and Mentoring

    Office of Energy Efficiency and Renewable Energy (EERE)

    The Project Management Coordination Office (PMCO) is working to support programs in ensuring that team members have the necessary training and certifications to enable meaningful stewardship of...

  1. ARM Mentor Selection Process

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News Publications Traditional Knowledge Kiosks Barrow, Alaska TropicalStorms7 ARMData72 ARM51

  2. MENTORING PROGRAM Purpose

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACTThousandReport) | SciTech ConnectFuture3,Last Revised: February 5,

  3. Morris, Alexander From: WEBMASTER, DOE Sent:

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    WEBMASTER, DOE Sent: Wednesday, May 13, 2015 11:46 AM FOIA-Central To: Subject: Form submission from: DOE Headquarters FOIA Request Form Submitted on Wednesday, May 13, 2015...

  4. A. Biographical Information: Donald P. Morris

    E-Print Network [OSTI]

    Morris, Donald P.

    .D, Environmental Biology, University of Colorado, Boulder 1990. M.A., Environmental Biology, University of Colorado, Boulder, 1985. B.A., Biology, University of Colorado, Boulder, 1978. Employment: Associate Professor Properties of Water. In: Encyclopedia of Inland Waters. G.E. Likens, Editor. Oxford: Elsevier. Osburn C

  5. Morris, Alexander From: DOECMS-Support

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGEMissionStress Newradical changes atDOECMS-Support Sent

  6. Morris Cogeneration LLC | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation,Mereg GmbHMontebalito SA JumpDialogue,GreenCogeneration

  7. Cori Sue Morris | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p aDepartmentEnergy comparingDeepDecember

  8. R. Buyya, University of Melbourne, Carlton, VIC, Australia; M. Pathan, University of Melbourne, Carl-ton, VIC, Australia; A. Vakali, Aristotle University of Thessaloniki, Greece (Eds.)

    E-Print Network [OSTI]

    Buyya, Rajkumar

    to change. Springer Distribution Center GmbH Haberstrasse 7 69126 Heidelberg Germany All and £ prices are net prices subject to local VAT, e.g. in Germany 7% VAT for books and 19% VAT for electronic products. (Lecture Notes in Electrical Engineering, Vol. 9) Hardcover 99,95 , $149.00, SFr. 174.00, £79.00 ISBN 978

  9. Herman-Morris folio : Herman, Barrett, Chokio, and Morris quadrangles, Minnesota 

    E-Print Network [OSTI]

    Sardeson, Frederick W. (Frederick William), 1866-1958.

    1919-01-01

    FOURIER DOMAIN PUMP PROBE OPTICAL COHERENCE TOMOGRAPHY SYSTEM A Thesis by DESMOND JACOB Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE... May 2009 Major Subject: Biomedical Engineering DESIGN AND OPTIMIZE A TWO COLOR FOURIER DOMAIN PUMP PROBE OPTICAL COHERENCE TOMOGRAPHY SYSTEM A Thesis by DESMOND JACOB Submitted to the Office of Graduate Studies of Texas A...

  10. GE Announces Vic Abate as New Chief Technology Officer | GE Global...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Industrial Internet and Brilliant Factory. This transition marks another chapter in GE's transformation to become the world's premiere Digital Industrial company. Enabled by a...

  11. GE Announces Vic Abate as New Chief Technology Officer | GE Global Research

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HABFESOpportunities Nuclear Physics (NP)about a majorHKL-2000 siteNames

  12. STEM Mentoring Café- Engaging Young Women in an Authentic Mentoring...

    Broader source: Energy.gov (indexed) [DOE]

    intervals, enabling students and teachers to ask questions and learn about STEM professions during each roundtable discussion. As a facilitator, I watched the students engage...

  13. mentor memo University of Washington

    E-Print Network [OSTI]

    Doty, Sharon Lafferty

    . These are the opportunities and responsibilities that consume most of our time and energy, because we care about what's going, these responsibilities consume us on a daily basis. The only professional problem with this--and it's a big one

  14. Excellence in Doctoral Mentoring Initiative

    E-Print Network [OSTI]

    life. Be a role model, share experiences and demonstrate personal integrity. Teach mentees how: Commit to and meet with your mentee regularly. Listen and learn. Discover who your mentee is as a person goals and clear expectations. Guide, encourage and support your mentee in their academic and personal

  15. DOE MENTOR-PROTÉGÉ

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based| Department ofRefrigerators |Departmentof Energy Public3.1-1 DOE

  16. DOE MENTOR-PROTÉGÉ

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based| Department ofRefrigerators |Departmentof Energy Public3.1-1 DOEgoal ,

  17. Ideas for Mentoring Program Activities

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (JournalvivoHighHussein KhalilResearch88 SignPriceresponse | Department

  18. Morris, Alexander From: Sent: To: Subject; DOECMS-Support

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Subject; DOECMS-Support 'Wednesday, December 07, 2011 10: 1.2AM FOIA-Cel1tral Fcrm submission from DOE Headquarters FOIA Request Form Submitted on edJ 12872e11 - 10:11...

  19. 58 University of Minnesota Morris 200911 Catalog Academic Division Structure

    E-Print Network [OSTI]

    Amin, S. Massoud

    (page 157) Spanish (page 173) Theatre Arts (page 178) The Division of the Humanities is composed of 10, and Spanish student clubs with a variety of projects; opportunities for language students to travel and study

  20. Balanced Cayley graphs and balanced planar Joy Morris 1

    E-Print Network [OSTI]

    Morris, Joy

    University of Lethbridge Department of Mathematics and Computer Science 4401 University Drive, Lethbridge of the complete graph Kt, i.e. Kt has t vertices and no edges. Further, we denote by Cl the cycle of length l with Kt is called an (l, t)-cycle. Fig. 1.1. (8, 3)-cycle Figure 1.1 shows the example of an (8, 3)-cycle

  1. Education Secretary Morris, Senator Norment visit Jefferson Lab...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    met with Virginia teachers participating in a Department of Energy, summer science and math enrichment program at Jefferson Lab. Here he meets teacher Pamela Rheinlander, from...

  2. Morris Dees Co-Founder and Chief Trial Counsel

    E-Print Network [OSTI]

    of the Macedonia Baptist Church in South Carolina. This was the largest civil award ever won for damages

  3. Alexander Morris, FOIA Officer United States Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O O D S TA I N P A T TSorbents forCO 2P R O GAlexyour7, 2010

  4. Morris County, Kansas: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformation MontanaOhio:Hill, California:Morrill County,Kansas:

  5. Morris County, Texas: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformation MontanaOhio:Hill, California:Morrill County,Kansas:Texas:

  6. Morris Plains, New Jersey: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformation MontanaOhio:Hill, California:Morrill

  7. Mount Morris, Michigan: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformation MontanaOhio:Hill,Morrisville,MountHealthy,Ivy,Michigan:

  8. Mount Morris, New York: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformation

  9. Morris, Alexander From: Sent: To: Subject: FOIA-Central Friday,

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGEMissionStress Newradical changes atDOECMS-Support Sent

  10. Morris, Minnesota: Creating a Sustainable College Campus and Local Jobs |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGEMissionStress Newradical changes atDOECMS-Support

  11. Seafarers: Tim Morris | Y-12 National Security Complex

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust, High-ThroughputUpcomingmagnetoresistance | ArgonnePrinceton PlasmaSea change for

  12. Morris County, New Jersey: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to: navigation, searchsource History ViewMoeOhio:LightNew Jersey: Energy

  13. Morris: Order (2013-SE-5403) | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -Department of Energy Moratorium and Suspension of theOrder

  14. Morris: Proposed Penalty (2013-SE-5403) | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -Department of Energy Moratorium and Suspension of

  15. Morris named NPO assistant manager for Environment, Safety Health and

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJessework uses concrete7ModificationsMonitoringAdministrationLosQuality |

  16. 122 NEWS AND VIEWS .\\iouth African JOllrnal a/Science Vol. <)2 i'vic.:-r:/11996 WORKSHOP REPORT

    E-Print Network [OSTI]

    Pretoria, University of

    On the rehabilitation of the coastal dunes of KwaZulu-Natal R.I. van Aarde, M. Coe and W.A. Niering Enhanced at establishing indi genous coastal dune forests on one-third of the mining path. The remaining two thirds. The workshop aimed to: consolidate knowledge on the bio physical nature of the coastal dune systems of northern

  17. Variable Infiltration Capacity model (VIC) is a macro-scale energy and water balance model with lake and wetland

    E-Print Network [OSTI]

    Cherkauer, Keith

    drainage, and expanding industrial and urban areas. The water table position usually acts as the dominant) and soil heat flux · Water table depth (3 locations, 6-7 ft depth) Kankakee (Indiana, USA) outwash plain and pumps. 1. Averaged Organic matter fraction is calculated for each soil layer 2. Soil thermal

  18. Hadley Patten Faculty Mentor: Dr. Erin Baker

    E-Print Network [OSTI]

    Mountziaris, T. J.

    covering different energy technologies: CCS, nuclear, wind and solar, and bioenergy. Each study involves. They consider not only these different technologies, but also possible levels of R&D funding levels and time periods. The goal is to make it possible to find the optimal combination of technologies, funding

  19. How to Mentor Students: A Guide

    E-Print Network [OSTI]

    Tilbury, Dawn

    of Elaine Dowell and Ellen Meader. I am grateful, too, for the edits suggested by another of the Graduate

  20. OVERVIEW of STEM MENTORING CAFÉ MODEL

    Energy Savers [EERE]

    to local students and teachers (optional, the National Girls Collaborative Project, HUD, DOE, and Education will all be assisting with this) Providing a photographer or...

  1. Mentoring for Academic Careers in Engineering

    E-Print Network [OSTI]

    Gray, Robert M.

    ? . . . . . . . . . . . . 34 5.2 Who's most at risk? . . . . . . . . . . . . . . . . . . . 35 5.3 If they only knew.1 Survey of doctorate recipients . . . . . . . . . . . . . . 90 9.2 Leaks in the pipeline to tenure

  2. Professor Pedro Castillo: Historian, Chicano Leader, Mentor

    E-Print Network [OSTI]

    Castillo, Pedro; Reti, Irene

    2013-01-01

    You can do that the third year. For assistant professors weyou can have it in the third year. ” And then I said, “Well,first year, but maybe the third year, we did a team teaching

  3. OVERVIEW of STEM MENTORING CAFÉ MODEL

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematics AndBeryllium Disease | DepartmentOLED Stakeholder Meeting Report OLEDONEORSSAB monthly

  4. Monitoring and Mentoring | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICESpecialAPPENDIX F Wetlandsof EnergyGap Analysis | Revised:

  5. OVERVIEW of STEM MENTORING CAFÉ MODEL

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURINGEnergy Bills and ReduceNovember 2014Marketing2014) |D D O TECHNOLOGIES

  6. STEM Mentoring - Alaska | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Financing Tool FitsProjectData Dashboard RutlandSTEAB's Priorities through 2012 To

  7. Postdoctoral Mentoring Agreement | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass mapSpeeding

  8. Postdoctoral Mentoring Program Guidelines | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass mapSpeedingProgram Guidelines This document outlines the major steps in participating

  9. DOE Mentoring Program | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:FinancingPetroleum Based| Department ofRefrigerators |Departmentof Energy1 Reports fromServices

  10. Tools for the Mentor | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCEDInstallers/ContractorsPhotovoltaicsState ofSavings forTitle XVII FinalRenewables |Mentee

  11. Instrument Mentor Monthly Summary Reporting System

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACT EVALUATION PLANIs gravity a particleInstructionalWagetoTethered

  12. Junior Solar Sprint - Teacher and Mentor Guide

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACT EVALUATIONIntroducingJobs2015 Bonneville1June 26 Training:FOR8869

  13. Internship Program Mentors | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenryInhibitingInteractive JobsEngagement

  14. Divisional Mentoring Program Contacts | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would like submit theCovalentLaboratory |Sector Full reportTown Hall

  15. Mentor, Protégé Program

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on dark matter By

  16. Mentor-Protege Program | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data CenterFinancialInvesting in MinorityOverview and History

  17. Conflict and quality in the mentoring relationship: the role of mentor attachment 

    E-Print Network [OSTI]

    Alfonso, Laura Magdalena

    2000-01-01

    Aggression in childhood has been linked to concurrent maladaptive socioemotional functioning (Kazdin, 1993; Loeber, 1990) and future social incompetence, academic failure, substance abuse, mental health problems, and criminality (Coie, Lochman...

  18. THE 2015 CHARLOTTE RESEARCH SCHOLARS SCHOLAR NAME SCHOLAR MAJOR(S) MENTOR(S)

    E-Print Network [OSTI]

    Nasipuri, Asis

    watersheds Jessica Lu Computer Science Dr. Srinivas Akella Project: Building a Raspberry Pi Mobile Robot

  19. STEM Mentoring Café- Engaging Young Women in an Authentic Mentoring

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Financing Tool FitsProjectData Dashboard RutlandSTEAB's Priorities through 2012 To|

  20. STEM Mentoring Café- Engaging Young Women in an Authentic Mentoring

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann JacksonDepartment ofOffice|inWestMay 13, 2015reports issuedExperience | Department of

  1. Assistive Human-Machine Interfaces for Smart Homes Armando Roy Delgado, Alexia Robinet, John McGinn, Vic Grout and Rich Picking

    E-Print Network [OSTI]

    Davies, John N.

    Assistive Human-Machine Interfaces for Smart Homes Armando Roy Delgado, Alexia Robinet, John Mc-for-all, Accessibility, Smart homes, Home automation systems, Multi-agent systems, White goods, Embedded systems 1. Introduction: Design aspects of smart homes for an ageing population As a generic concept, home automation

  2. GEOL 502 --Geology of North America Vic Camp (CG-225; 594-7170; vcamp@geology.sdsu.edu; hrs. 11:00-12:00 MWF or by appt.)

    E-Print Network [OSTI]

    Camp, Vic

    The Columbia Plateau and the Snake River Plain Final Exam (100 points) #12; Breakup of Pangaea Evolution of the Atlantic Coastal Plain The Ouachita Tectonic Belt Evolution of the Gulf Coastal Plain Permian Basins of West Texas Mid-term Exam (100 points) ­ date to be determined

  3. An Investigation into Signal Strength of 802.11n WLAN Kemisola Ogunjemilua, John N. Davies, Vic Grout and Rich Picking

    E-Print Network [OSTI]

    Grout, Vic

    provision of access points to enable town centres to be covered. For a network design engineer this is a relatively simple problem to solve since most design criteria provided by manufacturers is based on operation of a Grout and Rich Picking Centre for Applied Internet Research (CAIR) Glyndr University, University

  4. Designation Order 00-011.03-02 to Alexander Morris - DOE Directives,

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would like submit theCovalent BondingMeeting |Design Competitions Designthe 29 th

  5. Conversational Agents for Game-Like Virtual Environments Thomas William Morris

    E-Print Network [OSTI]

    Forbus, Kenneth D.

    who are suspects for the murder of another character, Dr Black. The players must, via a text-based natural language interface, interrogate the characters to determine the details of the murder that occurred (Murderer identity, murder location and murder weapon). The game proceeds in two distinct phases

  6. Jane Morris & Clare Beghtol Faculty of Information Studies, University of Toronto

    E-Print Network [OSTI]

    Toronto, University of

    to investigate these issues, as well as address the lack of research that uses human subjects to identify reader-oriented relations have potential relevance to improving access to text-based information. As well, the structured words. For example, sail/wind and garden/digging are instances of non-classical relations, whereas car

  7. Hybrid Invariance in Bipedal Robots with Series Compliant Actuators B. Morris and J.W. Grizzle

    E-Print Network [OSTI]

    Grizzle, Jessy W.

    the overall energy efficiency of locomotion. I. INTRODUCTION In legged robots, the physical introduction of tuned springs into an otherwise rigid mechanism can significantly improve energy efficiency touchdown events, springs isolate reflected motor inertias from the energy- dissipating effects of rigid

  8. Robert Morris : from a crisis in vision to a vision of crisis

    E-Print Network [OSTI]

    Snyder, Benjamin Andrews

    2012-01-01

    Neo-Dada: A Critique of Pop Art." Art Journal 23.3 Klein,2002): 38- Lippard, Lucy R. Pop Art: With Contributions byPop, Minimalism, and Performance 1958 – 1964, (Whitney Museum of American Art,

  9. Simulating BDI-based Wireless Sensor Networks Alexis Morris, Paolo Giorgini, Sameh Abdel-Naby

    E-Print Network [OSTI]

    in constructing complex distributed systems. Wireless Sensor Networks (WSN) represent such systems, and may techniques have been recently applied to WSN's; however, due to hardware limitations nodes (agents simulator for testing interactions in autonomous WSN's. The belief, desire, intention (BDI) agent model

  10. Learning to Improve Earth Observation Flight Planning Robert A. Morris2

    E-Print Network [OSTI]

    Oza, Nikunj C.

    processes related to things like climate change or pollution. Further observations of such targets Ames Research Center Abstract This paper describes a method and system for integrating ma- chine learning with planning and data visualization for the management of mobile sensors for Earth science

  11. Impairment on the hippocampal-dependent virtual Morris water task in schizophrenia

    E-Print Network [OSTI]

    Hamilton, Derek

    been shown in human and non-human animal studies to be hippocampus-dependent. In the virtual MWT, human. However, these tests cannot be used in non-human animal research, which is important for the discovery between human and non-human animal research on hippocampal function in schizophrenia, this study sought

  12. Robert Morris : from a crisis in vision to a vision of crisis

    E-Print Network [OSTI]

    Snyder, Benjamin Andrews

    2012-01-01

    Tar Babies of the New World Order. Milano: Charta, 1997.the Tar Babies of the New World Order (1997) and House andlater Tar Babies of a New World Order (Venice, 1997), where

  13. Morris, Alexander From: Sent: To: Subject: FOIA-Central@l1q,dOc.qo'/

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on77 PAGEMissionStress Newradical changes atDOECMS-Support Sent

  14. William Morris | Center for Gas SeparationsRelevant to Clean Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDidDevelopmentatabout Who Works for NIF & PS? The National

  15. University of Minnesota Morris Clean Energy Investments Recognized by U.S.

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann JacksonDepartment| Department of Energy OfficeResources

  16. The director's mentoring project: an analysis of the experiences of mentors and proteges and the impact of mentoring on selected child care centers in San Antonio, Texas 

    E-Print Network [OSTI]

    Castillo, Cathleen F.

    2004-09-30

    : together, we did it! I want to offer another special thank you to Joanne Bastien and Norma Padilla, who are my left and right hands! Finally, I wish to thank the women who shared their stories with me. There is no more important job than working...

  17. CMOP Undergraduate Intern Mentoring Opportunity Deadline: March 28, 2011

    E-Print Network [OSTI]

    for SLA sensor array format for rapid detection of microorganisms in environmental water samples Context assays. To detect individual microorganisms of interest, we chose three model genes present in Escherichia coli, two of which are present only in pathogenic strains. PCR amplification was performed

  18. Summary of the Undergraduate Mentoring Assistance Program for PNNL

    SciTech Connect (OSTI)

    Schwantes, Jon M.

    2013-04-01

    Kelly Fitzgerald Kelly Fitzgerald assisted with laboratory testing for an ongoing R&D project known as Electrochemically Modulated Separation (EMS) for on-line rapid preseparations of actinides prior to mass spectrometry analysis. Ryne Burgess Ryne Burgess used SCALE 5.1 ORIGEN-ARP to predict isotope libraries for the Units 1, 2 and 3 reactors and Unit 4 spent fuel pool for comparing against measurements of environmental sampled collected at the site in order to identify the source terms of the accident. Comparison of the cesium 134/137 and cesium 136/137 ratios observed in environmental samples and ORIGEN-ARP predictions indicated that the Unit 4 Spent Fuel Pool did not significantly contribute to radionuclide release during the Fukushima Daiichi accident.

  19. Hollings Scholars -Class of 2005 Institution Major Mentor

    E-Print Network [OSTI]

    Christopher University of Alabama Biology Brad Hall OAR, ESRL/GMD, Boulder, CO Analysis of Air Samples Chandler

  20. Some Thoughts on a Teacher, Father Figure, and Mentor

    E-Print Network [OSTI]

    Achebe, Nwando

    2002-01-01

    Ans 10 Hislory and as many limes as I have been asked thaiBoniface Obichere. From lhe lime Ihall was a liule girl. IthaI I was al vari- ous limes a member of my primary school

  1. Join the STEM and Mentoring Interagency Open House Friday, January...

    Energy Savers [EERE]

    tem--cool-tools-for-your-community-rsvp STEM - Science, Technology, Engineering, and Mathematics - are critical to the nation's economy. In order to be competitive as a nation, we...

  2. Virtual Mentor American Medical Association Journal of Ethics

    E-Print Network [OSTI]

    Fujimura, Joan

    ). These "genetic markers" of human variation are thought to comprise only a tiny proportion, around 0.5 percent allowed researchers interested in human genetic variation to begin to catalogue the range of genetic such as the International Haplotype Mapping Project [1]. These studies of human genetic variation promise to produce new

  3. PSYC 395 Undergraduate Research/Independent Study Research Mentor List

    E-Print Network [OSTI]

    Hopfinger, Joseph B.

    dbauer@email.unc.edu http://dbauer.web.unc.edu/ Patrick Curran curran@unc.edu http://www.unc.edu/~curran

  4. Mentoring and Diversity Sharon L Youmans, Pharm D, MPH

    E-Print Network [OSTI]

    Mullins, Dyche

    origin. Unconscious Bias - social stereotypes about certain demographics or Groups of people be difficult because of negative stereotypes, difficulty with identification and role modeling, skepticism Business Review, 2001 13 #12;Unconscious Bias The Implicit Association Test IAT consistently demonstrates

  5. Mentoring and Diversity J. Renee Navarro, Pharm D, MD

    E-Print Network [OSTI]

    Mullins, Dyche

    , or national origin. Unconscious Bias - social stereotypes about certain demographics or Groups of people be difficult because of negative stereotypes, difficulty with identification and role modeling, skepticism Business Review, 2001 #12;Unconscious Bias The Implicit Association Test #12;2009 Literature Review

  6. Scott Angus Mentor: Dr. Jeong-Yeol Yoon

    E-Print Network [OSTI]

    Fay, Noah

    Used Cryptosporidium parvum from Sterling Parasitology Lab Anti-Cryptosporidium parvum from Thermo & Biosystems Engineering Department Farm Sump Old Main Fountain Sierra Pointe Apartments Pool Sierra Pointe

  7. Seven Companies Selected for ORNL Mentor Protégé Program |...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Engineering Inc., Oliver Springs. This Woman-Owned Small Business provides mechanical engineering and analysis, project management and professional engineering software training...

  8. Evidence of Purifying Selection in Mentor: Angela Yen (Kellis Lab)

    E-Print Network [OSTI]

    Poonen, Bjorn

    Background Genomes Expression Regulation Selection Goal Methods Progress Future Work #12;Human Genome Genome Set of genetic information Grouped into chromosomes Chromosomes made of nucleotides The Human Genome Project (2003) Reference Genome Function? Genes (2%) Regulatory (10-50%) Junk (50-90%) #12

  9. Extending a hand: Argonne Hispanic Latino Club mentors Chicago...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    the lower gallery of the Advanced Photon Source where they learned about Argonne and the types of research the laboratory conducts. Smaller groups were then guided through several...

  10. ORISE and Fayetteville State University establish mentor-protégé...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    agreement Standing (left to right) are Heidi Timmerman, Cindy Snow, Arlene Garrison, Ph.D., Desmond Stubbs, Cathy Fore, John Bellamy (FSU), Christin Lane, and Rebecca...

  11. Checklist for New Employee's Buddy/Mentor BEFORE EMPLOYEE STARTS

    E-Print Network [OSTI]

    New Mexico, University of

    on day one Explain use of refrigerator, oven, microwave, dishwasher, break area, etc. Review fire alarm

  12. Argonne mentors students for the next generation of scientists | Argonne

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsiclouddenDVA N C E D B L O O D SFederal8823 RevisionAprilSTEMfest | Argonne

  13. Lemelson Recognition and Mentoring Programme L RAMP | Open Energy

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona: EnergyLebanon County,LefloreInformation East,

  14. Department of Energy STEM Mentoring Program | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About1996 EM Health and Safety PlanFosterInnovativeEnergy

  15. Department of Energy STEM Mentoring Program | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-in electricLaboratory |EducationDepartment5-3:Washington,andDepartment ofSTEM

  16. Energy Department Launches Veterans Mentoring Program | Department of

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLfor Innovative Solar Power Plant |Projects |of EnergyEnergy The

  17. Environmental Contractor Mentors Young Students | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLfor InnovativeProcessing Facility ConstructionTheguarantee.Office ofJeff

  18. Former NERSC Consultant Mentors Math, Computer Science Students

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HABFES OctoberEvanServicesAmes Laboratory Former Ames70thFormer

  19. Sponsoring, Mentoring and Guiding Cultural Diverse Young Scientists and

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effect Photovoltaics -7541C.3 SpecialSponsor Guidelines Candidates f or t he

  20. STEM Mentoring Café | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:Financing Tool FitsProjectData Dashboard RutlandSTEAB's Priorities through 2012 To| Department

  1. Working With PNNL Mentors, Engineering Students Deliver Prototype

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReport forRetirementAdministrationWayne JonesSeason |

  2. Home Performance Training and Mentoring: Lessons and Resources | Department

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nA Guide to TappingWORKof Energy Before andThisVersion)45ofExcel sheet

  3. Audit Report Contract Awards to Small Businesses Under the Mentor-

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a l De p u tCorporationIt'sDOE PhasedareU.S. DepartmentInformation

  4. WRPS Earns Award for Mentoring Local Small Businesses | Department of

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyThe U.S.Lacledeutilities. TheEnergyEnergyMedia Contact Deb

  5. The Entrepreneurial Mentor Corps at Work: Algaeventure Systems | Department

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With U.S.Week Day Year(active tab) 2016TheThe Energy Data JamEnergyof

  6. Mentoring Our Future Generation of STEM Professionals | Department of

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties - WAPAEnergy May 28 WebinarProtect MigratoryRegulators,

  7. Mentoring and Educating to Increase Diversity in Science, Tech, Engineering

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties - WAPAEnergy May 28 WebinarProtect MigratoryRegulators,and Math |

  8. Expectations of Mentors and Mentees | Argonne National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would like submitKansasCommunitiesof Energy8) WignerEnergyAbout UsExpectations of

  9. EERE Postdoctoral Research Awards Letter of Support from Research Mentor |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels DataEnergy Webinar:IAboutReuben Sarkar, Deputy

  10. STEM Mentoring Café | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservation of Fe(II) byMultidayAlumni > The2/01/12 Page 1NEWSSupport RequestSTEM Education

  11. STEM Internships, Fellowships, and Mentoring | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram: Report AppendicesA TokenCommercial BuildingsSTARTInternships,

  12. STEM Mentoring Café | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram: Report AppendicesA TokenCommercial BuildingsSTARTInternships,STEM

  13. STEM Mentors Reach Nearly 300 Western Kentucky Sixth Graders | Department

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram: Report AppendicesA TokenCommercial BuildingsSTARTInternships,STEMof

  14. MENTOR QUESTIONNAIRE Name: Title: Email: Office Phone Number:

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACTThousandReport) | SciTech ConnectFuture3,

  15. Mentor Information and Responsibilities | Mickey Leland Energy Fellowship

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on dark matter By SarahMODELINGMeetingsMembranesMemorial

  16. Mentor Protege Frequently Asked Questions | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data CenterFinancialInvesting in Minority

  17. DOE Mentoring Guidance and Program Plan | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-in electric vehicle10nominate anDepartmentAss Fans is headquartered

  18. A comparison of polar cap ionospheric velocity determined from a digital ionosonde model and the DICM

    E-Print Network [OSTI]

    Michigan, University of

    , Tasmania 7050, Australia b Department of Physics, La Trobe University, Bundoora, Vic. 3086, Australia c

  19. Hydrological Sciences--Journal--des Sciences Hydrologiques, 43(1) February 1998143 Regional scale hydrology: II. Application of the

    E-Print Network [OSTI]

    Maurer,. Edwin P.

    of the two- layer Variable Infiltration Capacity (VIC-2L) macroscale hydrological model. The VIC-2L model'application du schéma de surface VIC-2L (Variable Infiltration Capacity). Le schéma de surface VIC-2L est, mensuelle, et annuelle. Une analyse de sensibilité a été faite. INTRODUCTION This study focuses

  20. International Human Rights Activism in the United States during the Cold War

    E-Print Network [OSTI]

    Ramirez, Zachary Steven

    2013-01-01

    desolate island of Buru. Morris used Desmond and Tur to showhighlighted by Morris were Reverend Cosmas Desmond of South

  1. Appendix B: Measuring the Cost of Climate Policy* Sergey Paltsev, John M. Reilly, Henry D. Jacoby and Jennifer F. Morris

    E-Print Network [OSTI]

    bmt scenario is provided in Table B1. Table B1. CO2-e Price. 2020 2030 2040 2050 CO2-E Price (2005$/t in our studies we stress emissions prices and welfare changes, here we illustrate the measures in most gas mitigation, e.g., through reduced urban air pollution. 1. Emissions Price A price on greenhouse

  2. Of Mice and Men: Evolution and the Socialist Utopia. William Morris, H.G. Wells, and George Bernard Shaw*

    E-Print Network [OSTI]

    Hale, Piers J.

    in the History of Science and Technology at the University of Minnesota, at the History Department colloquium Shaw* PIERS J. HALE Department of the History of Science University of Oklahoma 601 Elm Avenue, PHSC August Weismann to our understanding of heredity have earned him a significant place in the history

  3. Morris R. Flynn, Dept. of Mech. Eng., Univ. of Alberta Sanjay Bhattacharya, Dept. of Mech. Eng., Univ. of Alberta

    E-Print Network [OSTI]

    Flynn, Morris R.

    and filaments are ubiquitous in nature, medical physics and chemical processing · Of interest (e or along the interface between two other fluids · Latter case mimics, say, oil spreading on the surface of the sea (e.g. the Deepwater Horizon oil spill of April, 2010) IGW Photo credits: http

  4. The role of Ambassador Roland S. Morris in President Wilson's decision to send troops to Siberia in 1918 

    E-Print Network [OSTI]

    Whittlesey, Frederick Albert

    1988-01-01

    in eastern Siberia and northern Manchuria. Was Japan motivated by the need to protect Japanese subjects stationed or living in Vladivostok? Or did the Japanese act out of a sense of responsibility toward stabilizing war-tom Russia in the name... and his advisors saw as a much larger problem. The Lansing-Ishii Notes were not, however, the most significant international event of the fall of 1917. On 7 November the Bolsheviks overthrew the Provisional Government of Russia and drove Alexander...

  5. Radium Isotope Distributions during the US GEOTRACES North Atlantic Matthew A. Charette, Paul J. Morris, Paul B. Henderson, Willard S.

    E-Print Network [OSTI]

    Columbia, SC 29208 USA Now at: Environment Laboratories Department of Nuclear Sciences and Applications) significant continental inputs (e.g. submarine groundwater discharge-SGD) in the western Atlantic. Lastly, 228

  6. M. Kovari, R. Kemp, H. Lux, P. Knight, J. Morris, D.J. Ward CCFE-PR(14)12

    E-Print Network [OSTI]

    .kovari@ccfe.ac.uk Abstract PROCESS is a reactor systems code ­ it assesses the engineering and economic viability main aim is to combine engineering, physics and economics. A model is described which shows the main of a hypothetical fusion power station using simple models of all parts of a reactor system, from the basic plasma

  7. Bandwidth-efficient management of DHT routing tables Jinyang Li, Jeremy Stribling, Robert Morris, and M. Frans Kaashoek

    E-Print Network [OSTI]

    (log n) protocols [20­23,25,26]. O(1) protocols achieve low latency lookups on small or low-churn networks be- cause lookups take only a few hops, but incur high main- tenance traffic on large or high-churn networks. O(log n) protocols incur less maintenance traffic on large or high- churn networks but require

  8. A World Wide Web Without Walls Maxwell Krohn, Alex Yip, Micah Brodsky, Robert Morris, and Michael Walfish (MIT CSAIL)

    E-Print Network [OSTI]

    for users. Third, users cannot choose what Web applications actually do with their data: the much of the data consents. For example, users should be 1Facebook applications and "mashups" are steps in the right application anew (e.g., Flickr shouldn't expose what a user hides on Facebook). Ide- ally, a user could

  9. A World Wide Web Without Walls Maxwell Krohn, Alex Yip, Micah Brodsky, Robert Morris, and Michael Walfish (MIT CSAIL)

    E-Print Network [OSTI]

    of choices for users. Third, users cannot choose what Web applications actually do with their data: the much existing data easily, if the owner of the data consents. For example, users should be 1 Facebook a user hides on Facebook). Ide­ ally, a user could express her policies once, trust only one module

  10. THE AMORPHOUS COMPONENT IN MARTIAN BASALTIC SOIL IN GLOBAL PERSPECTIVE FROM MSL AND MER MISSIONS. R.V. Morris1

    E-Print Network [OSTI]

    Downs, Robert T.

    are the same within 2. These compositions exclude soils with a significant "local component" (high-SO3 and high. Using the MER correlation of Fe3+ /Fe with SO3 (Fig. 1) [5], the Rocknest SO3 abun- dance implies it has- line Hm and Mt components is represented by "Fe2O3- Crystalline". The concentrations of SO3 and Cl

  11. Functional models of growth for landmark data John T. Kent, Kanti V. Mardia, Richard J. Morris and Robert G. Aykroyd

    E-Print Network [OSTI]

    Kent, John T.

    and Robert G. Aykroyd Department of Statistics, University of Leeds, Leeds LS2 9JT, UK Abstract Growth models = 1;::: ;N labels different individuals, k = 1;::: ;K labels different landmarks, m = 1;::: ;M labels different coordinates, h = 1;::: ;H labels different times t1;::: ;tH. It is convenient to represent

  12. How Big Should Historians Think? A Review Essay on Why the West Rules—For Now by Ian Morris

    E-Print Network [OSTI]

    Pomerantz, Kenneth

    2011-01-01

    six percent East-West difference in energy consumption perEast versus West in 1800, the many intermediate steps between consuming energy and “East and West prior to 1800 hinges almost entirely on the energy

  13. QUT Digital Repository: http://eprints.qut.edu.au/

    E-Print Network [OSTI]

    Liang, Huizhi "Elly"

    process models driven by industry consortia, such as SCOR1 , VICS2 or ITIL3 , go a long way Inter-industry Commerce Solutions: www.vics.org 3 Information Technology Infrastructure Library: www.itil

  14. Swinburne University Library Fee-for-Service

    E-Print Network [OSTI]

    Liley, David

    Swinburne University Library Fee-for-Service Membership Application (This document will be a tax-50 Norton Road Croydon Vic. 3156 Wantirna Campus Library 369 Stud Road Wantirna Vic. 3152 The Library

  15. Network intervention: Assessing the effects of formal mentoring on workplace networks

    E-Print Network [OSTI]

    Srivastava, SB

    2015-01-01

    Effects and Social Inequality. ” Annual Review of SociologyRestructuring and Ascriptive Inequality at Work. ” Americanattainment and ameliorate inequality. About the Author

  16. Using Mentor-Coaching to Refine Instructional Supervision Skills of Developing Principals

    E-Print Network [OSTI]

    Kissane-Long, Akida Lesli

    2012-01-01

    learning in an ongoing process focused on improving the academic performance of each student.and focused on student outcomes (Peterson, 2002; Waters, Marzano, & McNulty, 2003) . Learning

  17. Mentor & Intern Teacher Boundary Practices: Integrating Theory and Practice in Effective Alternative Certification Programs

    E-Print Network [OSTI]

    Tompkins, R Page

    2011-01-01

    The programs design elements that shaped emergentthan compliance with design elements. Also, the tools theprogram buttressed these design elements with a strong and

  18. STEM Middle School Mentoring Cafes Take it on the Road | Department...

    Office of Environmental Management (EM)

    to serve 20 annually to inspire young minds in their communities From Anchorage to New York, The Energy Department's popular Science, Technology, Engineering, and Mathematics...

  19. Extending parental mentoring using an event-triggered video intervention in rural teen drivers

    E-Print Network [OSTI]

    Lee, John D.

    . During the initial phase of learning, adult or parental supervision often provides such guidance. However, once teens obtain their license, adult supervision is no longer mandated, and teens are left to teach their teens even after they begin driving independently. Twenty-six 16- to 17-year-old drivers

  20. REU MENTORS & THEIR RESEARCH PROJECTS JONATHAN ARNOLD (Genetics) systems biology of the biological clock

    E-Print Network [OSTI]

    Arnold, Jonathan

    , innate defense mechanisms, and genome stability. djgarf@bmb.uga.edu TONY GLYNN (USDA) ­ Fungal genomics). Evolutionary systems biology, comparative genomics, protein structure, function and evolution. kannan & Institute of Bioinformatics) Microbial comparative genomics, prokaryotic genome composition, structure

  1. Mentor & Intern Teacher Boundary Practices: Integrating Theory and Practice in Effective Alternative Certification Programs

    E-Print Network [OSTI]

    Tompkins, R Page

    2011-01-01

    It’s not like classroom management, which is something thatI took a course in classroom management where I failedto see any classroom management concepts, ideas, theories or

  2. a publication of the graduate student senate | case western reserve university A Mentoring Guidebook

    E-Print Network [OSTI]

    Yang, Sichun

    many long hours during the 2007-2008 academic year continually drafting, editing, and improving Student Lynn Singer ­ Deputy Provost and Vice President for Academic Programs Joseph Williams ­ Director stature of a university rests on the strength of its graduate programs. And the strength of those programs

  3. List of Accepted Summer Interns (2011) Program Mentor's Name Intern's name (Nationality or special condition)

    E-Print Network [OSTI]

    2011-01-01

    Muthusamy (India) PeiWen Hsiao Kind Leng Tong (Malaysia) SuMay Yu Ding Hua Lee (Malaysia) Paul siong Yeo (Malaysia) TehYing Chou Yvonne Fong Ling Yong (Malaysia) MST HuanCheng Chang nguyen

  4. How to Find Money for Graduate School: [5pt] A Guide for Mentors

    E-Print Network [OSTI]

    Edray Herber Goins

    2014-10-21

    Oct 21, 2014 ... Dr. Goins attended the California Institute of Technology, where he majored in ... http://blogs.ams.org/mathmentoringnetwork/2013/09/15/.

  5. C-CAMP BIRAC-BIG 1st CALL ENTREPRENEUR VALEDICTORY MENTORING PROGRAMME

    E-Print Network [OSTI]

    Bhalla, Upinder S.

    .05: Introductions 7.05 ­ 7.35: 5 minute Presentations by BIG Grantees o Achira Labs o Codon Biosciences o Pandorum.30 ­ 1.00 pm: Presentations by BIG Grantees 15 mins each followed by 15 mins of interactions Scientific.30: Vikas Mehra 12.30 ­ 1.00: Sea6 Energy 1.00 ­ 2.00: Lunch 2.00 ­ 3.30: Presentations by BIG Grantees (con

  6. By David Sullivan; Mentor: Beth Martin; Faculty Advisor: Jody Bourgeois Graphic representation of

    E-Print Network [OSTI]

    Winglee, Robert M.

    representation of tsunami deposit genesis Stage 1: An existing tide flat, such as at Sinclair Inlet Conclusions: The deposit at Sinclair Inlet (Gorst 2) Is most likely the result of a tsunami. The deposit at Dyes Inlet Sinclair inlet and Gorst Bremerton Bainbridge Is. Elliot Bay Sinclair inlet and Gorst Bremerton Bainbridge

  7. Oak Ridge National Laboratory Wins DOE Mentor of the Year Award...

    Office of Environmental Management (EM)

    to protgs, the goal of the program is to give them the tools to become better DOE suppliers. ORNL worked with: Ability Engineering Technology, Inc. - South Holland, Illinois -...

  8. CNS, Y-12 named DOE mentor of the year | Y-12 National Security...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    This summer, BEST was recognized for recycling 1 million gallons of radiological waste water through its laundry operations at the East Tennessee Technology Park. Suppliers...

  9. Using Mentor, an Expert System, to Perform Preventative Maintenance and Diagnostics on Centrifugal Chillers 

    E-Print Network [OSTI]

    Culp, C.; Mills, R.

    1990-01-01

    undergone several upgrades and enhancements since then. This paper will discuss the human interface needs for this application, the functional characteristics of the expert system, the development environment and a case history of maintenance on a chiller....

  10. STUDENT MENTOR DOLLARS AWARDED RESEARCH PROJECT Abbas, Aamir Michael Corneille, MD, Trauma $2,000

    E-Print Network [OSTI]

    Nicholson, Bruce J.

    Elizabeth Randolph Glickman, PhD; Ophthalmology $2,000 Can Resveratrol Protect Proteins in a Cellular Model

  11. Potential Mentors for Summer Interns 2015 Harbor Branch Scientific/Engineering Staff and Areas of Research

    E-Print Network [OSTI]

    Fernandez, Eduardo

    including bioenergetics, nutrient requirements and availability, and development of broodstock and larval

  12. Mentor-on-the-Lake, Ohio: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: Energy Resources Jump to:ElectricCoordinationMenomonie,

  13. CNS, Y-12 honored as DOE Mentor of the Year | Y-12 National Security

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits &Bradbury ScienceComplex earning FPEComplex CNS, Y-12

  14. DOE/SC-ARM-13-003 ARM Lead Mentor Selection Process DL Sisterson

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HAB Packet HanfordDOE ProjectREMOTE-HANDLED TRU764 The Arctic63 ARM

  15. Planning and Participation in a STEM Mentoring Cafe | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass mapSpeeding access| DepartmentPeerFederal FleetUpSmall Wind Electric SystemServices »

  16. CNS, Y-12 named DOE mentor of the year | National Nuclear Security

    National Nuclear Security Administration (NNSA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouthReporteeo | National Nucleara minNuclearAdministration CNS,

  17. Mentoring and Job Training in the Field for Newly Trained Contractors |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAand DOE Safetyof EnergyPresentation:DaisStatesEM BudgetDepartment of

  18. Checking in on Our Council on Women and Girls' Mentoring Program |

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i n c i p a lCaribElectricSouthApplying caulkChapter 9DesertVersion Sep

  19. Interagency Mentoring and STEM Open House a Success | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICE INDUSTRIAL TECHNICAL8-02Department ofInversionsInteractive

  20. SC FPD 360 Mentoring | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26thI D-NicholasReports andRobert N. Thorn, 1967RulonS&SS.SC

  1. New Mentor Program to Help Clean Energy Small Businesses | Department of

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -DepartmentAvailable for Public Comment

  2. Nominate Your Mentor for the Presidential Award in Science, Math, and

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergyInterested Parties -DepartmentAvailable forSite |n t e g r i t y - S e r v i c e

  3. Planning and Participation in a STEM Mentoring Cafe | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann JacksonDepartment ofOffice|inWest Kentucky RegionalAt Argonne…The DepartmentPlanning

  4. Join the STEM and Mentoring Interagency Open House Friday, January 18, in

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACT EVALUATIONIntroducingJobs Human ResourcesJohn@Energy forJoinWashington

  5. STEM Mentoring Café and Day at the Lab | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann JacksonDepartment ofOffice|inWestMay 13, 2015reports issued byFormsDecemberAerial<Here©

  6. STEM Mentoring Café at the Smithsonian National Museum of Natural History

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann JacksonDepartment ofOffice|inWestMay 13, 2015reports issued

  7. What Are You Doing for Others? National Mentoring Month at the Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann JacksonDepartment| Department of EnergyData compiled byPatricia A.

  8. Los Alamos National Laboratory, LANS develop new mentor-protégé

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse BergkampCentermillion to local United

  9. Los Alamos National Security creates mentor-protégé agreements with two

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse BergkampCentermillion to local Unitedto STEM education in Newveteran-owned

  10. Extending a hand: Argonne Hispanic Latino Club mentors Chicago-area

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would like submitKansasCommunitiesof Energy8)highlightsNew PhaseExposure

  11. Intrepid Museum Hosts STEM Mentoring Café | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuelsof EnergyApril 2014 | International Nuclear Energy PolicyIntrepid Museum

  12. Oak Ridge National Laboratory Wins DOE Mentor of the Year Award at Small

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuelsof EnergyApril 2014Department ofWindOPEN GOVERNMENT OPEN4OSDBU HostsBusiness

  13. Mentor Protégé Program | Y-12 National Security Complex

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on dark matter By SarahMODELINGMeetingsMembranesMemorialProgram

  14. STEM Middle School Mentoring Cafés Take it on the Road | Department of

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data CenterFinancialInvesting inServicesRecoveryRhode IslandSoftEnergy STEM

  15. This article was downloaded by: [University of Minnesota -Morris], [Jong-Min Kim] On: 13 April 2012, At: 12:37

    E-Print Network [OSTI]

    Kim, Jong-Min

    Communications in Statistics - Theory and Methods Publication details, including instructions for authors of Randomized Response Sum Score Variables, Communications in Statistics - Theory and Methods, 41:10, 1875 in Statistics--Theory and Methods, 41: 1875­1884, 2012 Copyright © Taylor & Francis Group, LLC ISSN: 0361

  16. Orientation Dependence of Photochemical Reactions on TiO2 Surfaces P. A. Morris Hotsenpiller,* J. D. Bolt, and W. E. Farneth

    E-Print Network [OSTI]

    Rohrer, Gregory S.

    . Bolt, and W. E. Farneth DuPont Company, Experimental Station, Wilmington, Delaware 19880-0356 J. B in these systems are present in the form of particulates,3-6,8 coatings on support materials,9,10,12 and films

  17. MORRIS R. FLYNN, PHD U. Alberta, Dept. of Mechanical Engineering, Edmonton, AB T6G 2G8 780.492.5593; mrflynn@ualberta.ca

    E-Print Network [OSTI]

    Flynn, Morris R.

    Sea (co-PI, $ 5,000,000, $ 22,000 ) NSERC Engage (2013-2014): Oilsand lump digestion in non mixing in an end-pit lake DS (Research engineer Nov. 2013 to Mar. 2014) ­ Oilsand lump digestion in non of bitumen from oilsand [present occupation: junior project engineer, Propak Systems] LR (Undergraduate, May

  18. Testing and Deployment of an Infrared Thermometer Network at the ARM Southern Great Plains Climate Research Facility Victor R. Morris and Charles N. Long Pacific Northwest National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking With U.S. CoalMexicoConference Tight09/2011a Cloud

  19. Reservoir Management in Mediterranean Climates through the European Water Framework Directive

    E-Print Network [OSTI]

    O'Reilly, Clare; Silberblatt, Rafael

    2009-01-01

    floods downstream of impoundments by storing water upstream,upstream spawning habitat (Morris & Fan, 1998). Downstream

  20. Ein Lederball rollt ber eine Linie. Zehntausende jubeln im

    E-Print Network [OSTI]

    Nejdl, Wolfgang

    - schers Desmond Morris nicht aus, dass Fußballspiel eine ri- 22 Ein Lederball, 22 Spieler, eine Torlinie

  1. ATTITUDES AND SOCIAL COGNITION The Effects of System-Justifying Motives on Endorsement of Essentialist

    E-Print Network [OSTI]

    Scholl, Brian

    Darwin to Desmond Morris, from Freud to Robin Fox, from animal behaviorists who consider themselves open

  2. Description The Louisiana Black Bear is one of

    E-Print Network [OSTI]

    , Harrison, Henderson, Hop- kins, Jasper, Lamar, Marion, Morris, Nacogdoches, Newton, Panola, Polk, San

  3. Response of photosynthesis to ocean acidification

    E-Print Network [OSTI]

    Mackey, KRM; Morris, JJ; Morris, JJ; Morel, FMM; Kranz, SA

    2015-01-01

    2013. Continuous hydrogen peroxide production by organicculture, including production of hydrogen perox- ide (Morris

  4. Before the Senate Energy and Natural Resources Committee | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Victor Der, Acting Assistant Secretary, Office of Fossil Energy Subject: Carbon Capture, Transportation and Storage 5-14-09FinalTestimony(VicDer).pdf More Documents &...

  5. Loads Providing Ancillary Services: Review of International Experience-- Technical Appendix: Market Descriptions

    E-Print Network [OSTI]

    Grayson Heffner, Charles Goldman, Kintner-Meyer, M; Kirby, Brendan

    2007-01-01

    Requirements Energy Spot trading Size/ Requirements (MW)trading as VicPower Trading Energy Response Pty Ltd Thetrading: Spot trading of energy through a commodities-type

  6. ABRY Patrice -Curriculum Vitae Personal Data

    E-Print Network [OSTI]

    Abry, Patrice

    , Research and Technology. Scientific Productions · Patent : Real-Time Estimation of Long Range Dependent- tralia Pty. Ltd, Royal Melbourne Institute of Technology limited Melbourne, VIC 3000 / AU, Centre

  7. First name Surname Programme Group Personal Tutor Inorganic Tutor Organic Tutor Physical Tutor PAL Mentors Katie Casson Medicinal Chemistry 1

    E-Print Network [OSTI]

    Rzepa, Henry S.

    Caitlin Davies Emma Gledhill Chemistry 4 Room 1.08 Room 1.08 Room G18b Room 2.91a Guy Gubbay Chemistry 4 t.j.whitaker@leeds.ac.uk Frances (Frankie) Roberts Chemistry 5 Liam Marjai Kirsten Whitaker Chemistry 5 Daniel Bell Chemistry 6

  8. Mentored Engagement of Secondary Science Students, Plant Scientists, and Teachers in an Inquiry-Based Online Learning Environment 

    E-Print Network [OSTI]

    Peterson, Cheryl

    2012-10-19

    ........................................................................................................... 198 APPENDIX B ........................................................................................................... 199 APPENDIX C... Page 2.1 Conceptual framework for organizing the literature on innovative learning systems ......................................................................................... 21 2.2 A framework for discussing the Innovative Planting...

  9. CMOP Undergraduate Intern Mentoring Opportunity Project Title: Nitrification Potential and Niche Diversification of Ammonia Oxidizing Archaea in

    E-Print Network [OSTI]

    . They are essential for recycling nutrients through global biogeochemical cycles, which ultimately impacts our lives environment factors. Proposed Outcomes/Broader Impact: This project, developed for a CMOP undergraduate summer with the changing environment. The proposed summer intern project will be a part of our ongoing research to study

  10. The Role Mentoring Plays in a White Female Novice Teacher's Perceptions of Her Enculturation into a Culturally Diverse Campus 

    E-Print Network [OSTI]

    Noble, Erica Michelle

    2012-07-16

    relationship struggles with her principal and other staff, but also some successes in forming friendly relationships; her desire to understand her Hispanic students and their culture, yet her inability to see her membership in the dominant culture, as well has...

  11. Abigail Golden, Dept. of Ecology, Evolution and Environmental Biology Mentor: Dr. Joshua Drew, Dept. of Ecology, Evolution and Environmental Biology

    E-Print Network [OSTI]

    such traditional management practices of local communities are more effective at preserving threatened populations, the Republic of Fiji possesses a unique system of traditional reef management by which local communities knowledge (TEK) might have bearing on the establishment of a conservation program. In addition, village

  12. B&W Y-12 signs two new Mentor-Protégé agreements | Y-12 National Security

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAudits & Inspections Audits &drivers todonates

  13. Abstract--LIVIC-IFSTTAR develops driving assistance services in order to improve the driving safety. These systems

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    of the research & development program (initial costs reduction). As SiVIC also integrates physical car models has initially been developed to provide simulated sensors data as noised and imperfect as those, and thanks to the modular architecture of the SiVIC platform, new features have been added to provide a set

  14. D n xut Khi phc Sm Giai on IV D n xut Khi phc loi ra bin sm s gip khi

    E-Print Network [OSTI]

    thc trong vùng Vnh tng lng cá th sng sót sau khi b choáng lnh và nhng ln mc cn nguy him. Gim bt nhm". Chng trình giám sát vic dùng li ánh bt tôm hin ti cn c m rng lng ngày giám sát mi nm i vi vic dùng li

  15. CHNG 5 CHNG TRNH KHI PHC SM XUT: PHT TRIN V NH GI CC GII PHP ...............................................................................................................................................................1

    E-Print Network [OSTI]

    ..............................17 5.3.5 Gii pháp 3: Góp phn vào Vic Cung cp và Tng cng C hi cho Dch v Gii trí....17 5.3.6 Gii pháp 3 Lng Môi Trng(CEQ) v vic thc hin Chính Sách Lut Môi Trng Quc Gia (NEPA) cng hng dn các t chc nghiên cu

  16. WESTERN U.S. STREAM FLOW METRIC DATASET Providing scientific knowledge and technology to sustain

    E-Print Network [OSTI]

    . These are based on daily simulations of the Variable Infiltration Capacity (VIC) macroscale hydrologic model, hydrologic modeling, variable infiltration capacity (VIC), flow metrics, aquatic communities Flow metrics metric da- taset makes it possible to study the effects of droughts, changes in snow- pack, water

  17. Biogeosciences, 6, 15771590, 2009 www.biogeosciences.net/6/1577/2009/

    E-Print Network [OSTI]

    Malhi, Yadvinder

    Federal de Vic¸osa ­ UFV, Av. P. H. Rolfs, S/N. Centro Vic¸osa, MG, 36570-000, Brasil **Conceived that there are many other intrinsic and ex- trinsic factors involved, such as the differential investment in support

  18. Los Alamos Dynamics Summer School-Past Programs

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Mentors-David Mascarenas (pdf) Students-Hannah Ross, Kyle Embry, Andrea Hengartner Drill Vibration Reduction through Active Absorption Part 2 (pdf) Mentors-Eric Schmierer, Alex...

  19. Research Projects

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Todd UCSD Instructor Charles Farrar Mentor Robert Gates Mentor Intelligent Wind Turbines Abraham Light-Marquez Student Ramon Silva Student Mark Mollineaux Stanford Student...

  20. This list does not imply DOE endorsement of the individuals or...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    416-969-6413 Ontario, CANADA Moran, Milton milton.moran@phifer.com 205-750-3068 AL Morris, Nick Nick.Morris@Xyleminc.com UNITED KINGDOM Morrison, Stuart stuart.morrison@clydeun...

  1. User Facilities | ORNL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    prior to granting access to a user facility. User Office User Program Manager Laura Morris Edwards 865.574.2966 Email User Office User Office User Program Manager Laura Morris...

  2. Stress-responsive biosensors for agricultural applications

    E-Print Network [OSTI]

    Hines, George

    2013-01-01

    Arabidopsis thaliana . . . 1.5 Biosensors . . . . . . . . .not . Stress biosensors . . . . . Real-time applications . .Morris. “Fluorescent biosensors of intracellular targets

  3. Ken Cheng was born in Hong Kong. His family emigrated to Toronto,

    E-Print Network [OSTI]

    Cheng, Ken

    interested in the study of behaviour? As barely a teenager, I picked up a paperback copy of Desmond Morris

  4. Kinetic and Thermodynamic Selectivity of Intermolecular C-H Activation at [TpRh(PMe3)]. How Does the Ancillary Ligand Affect

    E-Print Network [OSTI]

    Jones, William D.

    the Ancillary Ligand Affect the Metal-Carbon Bond Strength? Yunzhe Jiao, James Morris, William W. Brennessel

  5. Amygdala responses to averted vs direct gaze fear vary as a function of presentation speed

    E-Print Network [OSTI]

    Hadjikhani, Nouchine

    and structurally (Halgren and Marinkovic, 1995; LeDoux, 1995; Morris et al., 1998, 1999, 2001; Vuilleumier, 2002

  6. THEUNIVERSITYOFTOLEDO FALLCOMMENCEMENT

    E-Print Network [OSTI]

    Azad, Abdul-Majeed

    and retail customer choice in the New England states. Before joining Northeast Utilities, Morris Associates, where he prepared environmental impact statements for electrical utility transmission linesArena Michael G. Morris Chairman, American Electric Power Michael G. Morris, chairman of American Electric Power

  7. Developments in Human Communication

    E-Print Network [OSTI]

    Thompson, Michael

    CMST 1B03 Developments in Human Communication: Part & Present Amanda Etches-Johnson Mills Research in Human Communication Session Outline 1. Finding Books Using MORRIS 2. Finding Journal Articles using: Developments in Human Communication What is MORRIS anyway? · MORRIS is McMaster's library catalogue · Shows

  8. Congratulations to OUR Discovery Day 2008

    E-Print Network [OSTI]

    Morgan, Stephen L.

    'Ippolito, Marine Science Mentor: Dr. Thomas Lekan, History ­ Boulder, CO American Wilderness Legacies and Feral Hog

  9. Employee Spotlight: Ann Schlenker

    ScienceCinema (OSTI)

    Ann Schlenker

    2013-06-10

    Ann Schlenker, Director for the Center for Transportation Research, discusses mentoring and working at Argonne.

  10. Ashburn-Nardo CV March 24, 2015 1 Leslie Ashburn-Nardo

    E-Print Network [OSTI]

    for the Teaching of Psychology Honorary Membership for Infusing Diversity into Teaching 2009 Psychology Mentor

  11. New Polymer Coatings Prevent Corrosion, Even When Scratched http://www.innovations-report.de/html/berichte/verfahrenstechnologi... 1 of 3 2/6/09 10:26 AM

    E-Print Network [OSTI]

    Braun, Paul

    New Polymer Coatings Prevent Corrosion, Even When Scratched http RE S ER VIC E nächste Meldung Home Fachgebiete Verfahrenstechnologie Nachricht New Polymer Coatings with self-healing coatings being developed at the University of Illinois. The new coatings are designed

  12. RESEARCH ARTICLE Biological soil crust distribution is related to patterns

    E-Print Network [OSTI]

    Vesk, Peter

    relation- ships between crust abundance and environmental and landscape variables. We also investigated of Sustainability & Environment, Arthur Rylah Institute for Environmental Research, 123 Brown St, Heidelberg, VIC component (Department of Sustainability and Environment 2004); however, specific information on crusts

  13. The Supply Chain Management MBA is one of the strategic concentrations at Rutgers Business School. Simply put, Supply Chain Management is how business

    E-Print Network [OSTI]

    School is a driver in reversing this trend by its commitment to excellence and unique strength in world and the Voluntary Interindustry Commerce Solutions (VICS) Association held a joint Logistics Summit on the Rutgers

  14. Minnesota Voluntary Investigation and Clean-Up Program voids Superfund and provides assurance of no action

    SciTech Connect (OSTI)

    Tepley, W.B.; DeGroot, R.L.

    1994-12-31

    The Minnesota Land Recycling Act of 1992 provides statutory authority to quickly approve clean-up of contaminated properties and provides land owners and lenders assurances which minimize potential liability. The Minnesota Pollution Control Agency`s (MPCA) Voluntary Investigation and Clean-Up (VIC) Program avoids the time and expense of the ``Superfund`` process. This paper outlines the VIC Program and describes it`s application through a site history. The site was impacted with volatile organic compounds, diesel fuels, lead, and cadmium at hazardous waste concentrations. The investigation, clean-up and documentation was performed through the VIC Program. A ``Limited No Action`` letter was received within the time frame of the purchase agreement for the property transaction. The history shows the steps taken through the VIC Program, describes investigation and clean-up methods and associated costs. The result was a successful transfer of the property for a new medical complex.

  15. For more information about the UCSF Asian Health Program,

    E-Print Network [OSTI]

    Martin, Gail

    ARcH Disparities in Asian infertility population Vic Fugimoto, MD Risk of renal failure among Asians Chi-yuan Hsu, MD Pharmacogenetics in Chinese Americans Kathy Giacomini, PhD Diagnosis and treatment

  16. Thanks to my faculty advisor, Professor John Marzluff, my graduate mentors Carol Bogezi and Catherine Gowan, as well as McIntire-Stennis Program at USDA for

    E-Print Network [OSTI]

    Brown, Sally

    strategies to reduce livestock losses or risk going out of business. Range riding is viewed by many ranchers, but there are also those who believe it can work. Currently there are several range riders working in Washington who- Precautionary Range riding isn't viable but there might be ways that it could work Negative Range riding

  17. An Examination of Cultural Values and Employees' Perceptions of Support on Affective Reaction and the Desire to Participate in a Formal Mentoring Program in an Oilfield Services Corporation 

    E-Print Network [OSTI]

    Hayes, Hanna Bea

    2012-07-16

    of Perceived Organizational Support and Cultural Values ? Russia & Caspian???????????????????????? 126 11 Structural Model of Perceived Organizational Support and Cultural Values ? Eastern Hemisphere???????????????????????... 128 12 Structural...?????????????????????????????? 126 41 Model Fit Indices of Structural Model of Perceived Organizational Support and Cultural Values ? Russia & Caspian???????????????????. 127 42 Summary Table for Perceived Organizational Support and Cultural Values ? Russia & Caspian...

  18. Cursos del Programa Aula Mentor Reconeguts amb crdits de formaci permanent del professorat segons BOE de 12/01/95. Els

    E-Print Network [OSTI]

    Oro, Daniel

    h Agricultura ecològica 60 h Energia de la radiació solar 50 h Energies renovables 130 h Energia solar tèrmica 100 h Energia solar fotovoltaica 70 h Medi ambient Avaluació de l'impacte ambiental 80 h

  19. B.2. Research Activities. Each REU student will work with (at least) one faculty advisor and (at least) one IGERT PhD mentor.

    E-Print Network [OSTI]

    Mountziaris, T. J.

    interest in fieldwork Cumulative adverse effects of offshore wind energy development on wildlife Socio- Environmental Science Milman GIS experience Understanding public acceptance and rejection of offshore wind of mooring systems Mechanical Engineering Modarres Lab experience Bio-based Materials for Offshore Wind

  20. 1. Cover letter describing your research interests,why it would benefit you to attend,potential project ideas,and mentor requests

    E-Print Network [OSTI]

    of topics such as: · Ring current and radiation belts · Magnetosphere-ionosphere coupling · Solar wind wind and magnetosphere · Solar energetic particle events · Diffusion coefficients and radiation belt dynamics · Van Allen Probes data analysis and modeling · Scintillating and solid-state radiation detectors

  1. Middle Cambrian priapulids and other soft-bodied fossils from Utah and Spain

    E-Print Network [OSTI]

    Conway Morris, S.; Robison, Richard A.

    1986-01-09

    THE UNIVERSITY OF KANSAS PALEONTOLOGICAL CONTRIBUTIONS January 9, 1986 Paper 117 MIDDLE CAMBRIAN PRIAPULIDS AND OTHER SOFT-BODIED FOSSILS FROM UTAH AND SPAIN' S. CONWAY MORRIS and R. A. ROBISON Department of Earth Sciences, University of Cambridge...- tion rather than the original biotic assemblage (Conway Morris, 1981; Conway Morris and Robison, 1982). If this is correct then such soft- bodied faunas may provide a guide to original diversity and paleoecologic insights more reli- able than those...

  2. Taxonomy and paleobiology of some Middle Cambrian Scenella (Cnidaria) and Hyolithids (Mollusca) from western North America

    E-Print Network [OSTI]

    Babcock, Loren E.; Robison, Richard A.

    1988-12-29

    (1979), Robison and Richards (1981), Conway Morris and Robison (1982, 1986, 1988), Briggs and Robison (1984), Robison (1984b, 1985, 1986, 1987), Sprinkle (1985), and Ubaghs and Robison (1985, 1988). New specimens are described from the Spence Shale... for the Middle Cambrian in preservation only, not in general taxonomic content (e.g., Conway Morris, 1981, 1986; Conway Morris and Robison, 1982, 1986, 1988; Robison, 1986). The pres- ence of the same chondrophorine and hyolith genera in the Burgess shale...

  3. TITLE AUTHORS SUBJECT SUBJECT RELATED DESCRIPTION PUBLISHER AVAILABILI...

    Office of Scientific and Technical Information (OSTI)

    Packed bed thermal energy storage A simplified experimentally validated model Anderson Ryan Bates Liana Johnson Erick Morris Jeffrey F Elsevier None USDOE Netherlands English...

  4. Dr. Reuter-Lorenz Department of Psychology

    E-Print Network [OSTI]

    Cheatwood, Joseph L.

    .m. Morris Library Auditorium Refreshments served following the lecture Open to the Public Aging Mind of activation related to increased vulnerability and potentially for defining targets for neurocognitive

  5. United States Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    to conduct a search for responsive documents. Interim Response Letter from Alexander Morris, OIR, to Jillian Melchior, National Review (April 6, 2015) (Response Letter 1). In a...

  6. PowerPoint Presentation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Geosciences, and Biosciences Phil Britt Materials Science and Engineering James Morris CNMS User Programs Hans Christen Center for Nanophase Materials Sciences Hans...

  7. Slide 1

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Sciences and Engineering Center Georgia Tourassi Computational Data Analytics Thomas Potok Data Systems Sciences and Engineering Rick Lusk Modeling and Simulation Robert Morris...

  8. Neutrons, electrons and theory reveal secrets of natural gas...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Reactor. Melnichenko's broader work was emboldened by a collaboration with James Morris and Nidia Gallego, lead authors of a paper recently published in Journal of Materials...

  9. HFIR | High Flux Isotope Reactor | ORNL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    HFIR User Office User Program Manager Laura Morris Edwards 865.574.2966 Neutron imaging offers new tools for exploring artifacts and ancient technology Home | User Facilities |...

  10. Materials Sciences and Engineering Program | ORNL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and scanning probe microscopies, atom-probe tomography); neutron and x-ray scattering; theory and modeling; and controlled synthesis. For more information contact: Jamie Morris...

  11. United States Department of Energy

    Office of Environmental Management (EM)

    denying the request for expedited processing. Interim Response from Alexander C. Morris, FOIA Officer, OIR, to Jillian Melchior, National Review (May 6, 2015). On May 29,...

  12. Cooley joins Y-12's Global Security and Strategic Partnerships...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    to have someone with Jill's depth and breadth of expertise on our staff," said Morris Hassler of Global Security and Strategic Partnerships. "Her international experience...

  13. morhaley | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    morhaley Ames Laboratory Profile Haley Morris Office Assistant-X Human Resources Office Environmental, Safety, Health, and Assuarance 105 TASF Phone Number: 515-294-2153 Email...

  14. MA Org Chart, May 18, 2015

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Directives Program FOIA Program Information Technology Program Camille Beben Chris Morris, FOIA Officer Vacant Office of Acquisition Management Office of Policy Berta...

  15. mmorris | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    mmorris Ames Laboratory Profile Max Morris Associate Environmental & Protective Sciences 304A Snedecor Phone Number: 515-294-2775 Email Address: mmorris...

  16. Accounting for Corruption: Economic Structure, Democratic Norms, and Trade

    E-Print Network [OSTI]

    Sandholtz, Wayne; Koetzle, William

    1998-01-01

    D. 1991. Corruption and Politics in Mexico. Tuscaloosa, AL:corruption in France (Meny 1992), Ghana (Morris 1991) and Mexico (corruption scandals: France, Italy, Japan, Kenya, Mexico,

  17. NIF & PS People - 2014

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Marilyn Schneider, Raymond Smith, Jue Wang, Morris Wang, Klaus Widmann and Christoph Wild. Award-Winning EXUDE Team Improvements in grating performance and implementation in a...

  18. Extreme Star Formation

    E-Print Network [OSTI]

    Turner, JL

    2010-01-01

    ApJS, 167, 177-200 (2006) Dowell, C.D. , Astrophys. J. ,Kim & Morris 2003. Sgr B2: Dowell 1997, Gaume et al. 1995.

  19. Neutron Science | ORNL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    User Office User Program Manager Laura Morris Edwards 865.574.2966 ORNL study uses neutron scattering, supercomputing to demystify forces at play in biofuel production Full...

  20. Publications Received

    E-Print Network [OSTI]

    Mester, [No author

    1988-01-01

    Vol. xvii. No. 2 (Fali, Publications Received Anales de lafor Afro-American Studies Publications, 1987. Morris, C.Essays in Memory Publications Received of Federico García

  1. Breakout Session: Getting in the Loop: PV Hardware Recycling...

    Broader source: Energy.gov (indexed) [DOE]

    Morris E. Fine Junior Professor, Northwestern University Sukhwant Raju Director of Recycling, First Solar Garvin Heath Senior Scientist, NREL Strategic Energy Analysis Center...

  2. Tobacco Control in Transition: Public Support and Governmental Disarray in Arizona 1997-2007

    E-Print Network [OSTI]

    Hendlin M.Sc., Yogi H.; Barnes, Richard L JD; Glantz, Stanton A. Ph.D.

    2008-01-01

    2002. Morris D. "East & West Valley Voters Support Smokefreebecame the first city in the West Valley of the metropolitanTGen) Arizona Heart Institute West Valley Hospital Arizona

  3. Some Practical Considerations Regarding Horizontal Resolution in the First Generation of Operational Convection-Allowing NWP

    E-Print Network [OSTI]

    Droegemeier, Kelvin K.

    Some Practical Considerations Regarding Horizontal Resolution in the First Generation,# JASON J. LEVIT, GREGORY W. CARBIN, CRAIG S. SCHWARTZ,@ MORRIS L. WEISMAN,& KELVIN K. DROEGEMEIER

  4. Real-time characterization of particle-bound polycyclic aromatic hydrocarbons in ambient aerosols and from motor-vehicle exhaust

    E-Print Network [OSTI]

    Polidori, A.; Hu, S.; Biswas, S.; Delfino, R. J; Sioutas, C.

    2008-01-01

    of polycyclic aromatic hydrocarbons in coupled out- door/polycyclic aromatic hydrocarbon concentration in combustionbound polycyclic aromatic hydrocarbons K. A. , Morris, J. ,

  5. Supporting new special education teachers: How online resources and Web 2.0 technologies can help

    E-Print Network [OSTI]

    Billingsley, Bonnie; Israel, Maya; Smith, Sean J.

    2011-01-01

    The article explores online resources and Web 2.0 technologies that can be used to provide support services and aid in the mentoring process for first year special education teachers. It describes how traditional teacher mentors, professional...

  6. The mathematics connection : a curriculum promoting mathematical application through the home-school connection

    E-Print Network [OSTI]

    Komatsubara, Kristin Mie

    2008-01-01

    deepening student’s understanding of curricular mathematics.Educational students in Mathematics. 63(1) 89-112.National Council of Teachers of Mathematics, 2008b) Mentor’s

  7. Leadership and mentorship

    E-Print Network [OSTI]

    Taneja, Anishiya

    2007-01-01

    This thesis aims to learn more about mentoring relationships in organizations. Through detailed one on one interviews with mentors and mentees from a variety of different backgrounds, different age groups, genders, races, ...

  8. Academic Resources for Success in the Civil & Environmental Engineering Department

    E-Print Network [OSTI]

    Connors, Daniel A.

    Academic Resources for Success in the Civil & Environmental Engineering Department TUTORING & STUDY Monday: Civil and Environmental Engineering Tuesday: Chemical and Biological Engineering Wednesday AND ENVIRONMENTAL ENGINEERING PEER MENTORS COLLEGE OF ENGINEERING STUDENT ORGANIZATIONS Peer Mentors offer support

  9. Claire Rowcliffe

    Broader source: Energy.gov [DOE]

    Claire is a student representative from Hardin Valley Academy. She is the captain of the swim team and is a mentor in the HVA Talons, a group of students who mentor incoming 8th graders. She is a...

  10. Dr. Marta Szabo White, PhD Director, RCB Honors Program

    E-Print Network [OSTI]

    Frantz, Kyle J.

    and executives alike, but not just because I am a student here. From a pure business perspective, mentoring reflections about yourself and your work that may otherwise have never crystalized > THE MENTORING PROCESS

  11. JSHSENSURING A FUTURE FOR SCIENCE The Junior Science and Humanities Symposium, sponsored by the US Army/Navy/Air

    E-Print Network [OSTI]

    Kelly, John J.

    Army/Navy/Air Force and Loyola University Chicago is introducing an e-mentoring program for students

  12. ADR Lunchtime Program: WHERE DO YOU STAND IN THE FEEDBACK LOOP? MAKE FEEDBACK WORK FOR YOU

    Broader source: Energy.gov [DOE]

    Guest Speaker: John Settle, President, SETTLEment Associates, LLC, Mediator, Group Facilitator, Coach/Mentor, Trainer, and Consultant

  13. Making Buildings Better: Indie Energy & the Geothermal Breakthrough

    Broader source: Energy.gov [DOE]

    Read about Indie Energy -- one of several clean energy small businesses involved in the "Entrepreneurial Mentor Corps."

  14. ECOLE DOCTORALE SCIENCES ET INGIENERIE Dpartement Biologie, mdecine et sant -Sciences de la vie et de la sant

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    amené, pendant ces vingt années d'exercice infirmier. Un grand merci à mes mentors : Véronique Larreta

  15. Auslegung: a journal of philosophy, Volume 27, Number 2 (Summer/Fall, 2004): Front Matter

    E-Print Network [OSTI]

    Zenzinger Creighton University Saint Peter's College Purdue University, Calumet Campus St. Norbert College Utah Valley State College University of Minnesota, Morris St. Mary College West Virginia Wesleyan College University of Central Arkansas... Zenzinger Creighton University Saint Peter's College Purdue University, Calumet Campus St. Norbert College Utah Valley State College University of Minnesota, Morris St. Mary College West Virginia Wesleyan College University of Central Arkansas...

  16. Auslegung: a journal of philosophy, Volume 25, Number 2 (Summer/Fall, 2002): Front Matter

    E-Print Network [OSTI]

    Zenzinger, Andrew Ward, Darnell Wheeler, Creighton University Saint Peter's College Purdue University, Calumet Campus St. Norbert College Utah Valley State College University of Minnesota, Morris St. Mary College West Virginia Wesleyan College... Zenzinger, Andrew Ward, Darnell Wheeler, Creighton University Saint Peter's College Purdue University, Calumet Campus St. Norbert College Utah Valley State College University of Minnesota, Morris St. Mary College West Virginia Wesleyan College...

  17. Auslegung: a journal of philosophy, Volume 26, Number 2 (Summer/Fall, 2003): Front Matter

    E-Print Network [OSTI]

    Zenzinger, Creighton University Saint Peter's College Purdue University, Calumet Campus St. Norbert College Utah Valley State College University of Minnesota, Morris St. Mary College West Virginia Wesleyan College University of Central Arkansas... Zenzinger, Creighton University Saint Peter's College Purdue University, Calumet Campus St. Norbert College Utah Valley State College University of Minnesota, Morris St. Mary College West Virginia Wesleyan College University of Central Arkansas...

  18. In order to implement sustainable changes, it is important to understand how the University of Minnesota impacts the

    E-Print Network [OSTI]

    Minnesota, University of

    on campus creates a carbon footprint. Electricity and heating contribute over 80% of the University of Minnesota's system carbon footprint. AIR TRAVEL HEATING 8% 8% 27% 55% ELECTRICITY Implementing strategies Carbon Footprint Morris is powered 60% by wind ENVIRONMENTAL FOOTPRINT MORRIS 70% CLIMATE ACTION PLAN

  19. Finding New Candidate Genes for Learning Tarek A. Leil,1,2

    E-Print Network [OSTI]

    Smith, Desmond J.

    . Cortes,1,2 Richard M. Leahy,3 and Desmond J. Smith1,2* 1 Department of Molecular and Medical Pharmacology that perform well on the Morris water maze and two inbred strains that perform poorly. This resulted as in other mammals. In mice and rats, spatial learning on the Morris water maze task requires an intact

  20. Assessing Affordability of Fruits and Vegetables in the Brazos Valley-Texas 

    E-Print Network [OSTI]

    Lotade-Manje, Justus

    2012-02-14

    online or via third parties. These data tend to be targeted at only a subset of stores (Cassady et al. 2007 Morland and Filomena 2007; Morris et al. 1992;), locations (Block and Kouba 2006; Hendrickson et al. 2006; Jetter and Cassady 2006; Morris et al...

  1. CX-000933: Categorical Exclusion Determination

    Broader source: Energy.gov [DOE]

    Statement of Work for Morris County - SCX(s) Applied: A9, A11, B5.1Date: 02/19/2010Location(s): Morris County, New JerseyOffice(s): Energy Efficiency and Renewable Energy, Golden Field Office

  2. Genes Regulated by Learning in the Hippocampus

    E-Print Network [OSTI]

    Smith, Desmond J.

    Richard M. Leahy,2 and Desmond J. Smith1* 1 Department of Molecular and Medical Pharmacology and Crump hippocampal gene expression in mice undergoing training in the Morris water maze and control mice forced words: DNA microarrays; gene expression; hip- pocampus; mice; Morris water maze The hippocampus

  3. Natural Systems & Climate Change: Strategies for Our Future May 20, 2013

    E-Print Network [OSTI]

    California at Davis, University of

    Natural Systems & Climate Change: Strategies for Our Future May 20, 2013 Tsakopoulos Library of the Office of Planning and Research Chuck Bonham, Director, California Department of Fish and Wildlife Fadtke, Delta Conservancy Terry Collins, Collins Pine Company Joe Morris, Founder, Morris Grassfed Beef

  4. Natural Systems & Climate Change: Strategies for Our Future

    E-Print Network [OSTI]

    California at Davis, University of

    Natural Systems & Climate Change: Strategies for Our Future May 20,2013 #12;On the cover: Pendersen Ken Alex, Senior Policy Advisor to Gov. Jerry Brown and Director of the Office of Planning Collins, Collins Pine Company Joe Morris, Founder, Morris Grassfed Beef Misha Sarkovich, Sacramento

  5. Mineralogical and chemical characterization of lunar highland soils: Insights into the space weathering of soils on airless bodies

    E-Print Network [OSTI]

    Perfect, Ed

    , A. Patchen, D.-H. S. Taylor, R. V. Morris, L. P. Keller, and D. S. McKay (2010), Mineralogical weathering of soils on airless bodies Lawrence A. Taylor,1 Carle´ Pieters,2 Allan Patchen,1 Dong-Hwa S. Taylor,1 Richard V. Morris,3 Lindsay P. Keller,3 and David S. McKay3 Received 8 May 2009; revised 13

  6. 2011/2012 University of Delaware Library www.udel.edu/library WELCOME TO THE LIBRARY

    E-Print Network [OSTI]

    Gao, Guang R.

    2011/2012 University of Delaware Library www.udel.edu/library WELCOME TO THE LIBRARY New Library Home Page University of Delaware Library OFFICE OF THE VICE PROVOST & MAY MORRIS DIRECTOR OF LIBRARIES-831-2231 Fax: 302-831-1046 Greetings, Welcome to the University of Delaware Library which includes the Morris

  7. Biology/Marine Biology Prizes/Awards/Scholarships 2008/09 University Medal in Biology Alyssa Byers-Heinlein

    E-Print Network [OSTI]

    Gunawardena, Arunika

    Biology/Marine Biology Prizes/Awards/Scholarships 2008/09 University Medal in Biology Alyssa Byers-Heinlein University Medal in Marine Biology Matthew Morris Avery Prize Jessica Arbour Hugh P. Bell Scholarships, Elisabeth Oakham Vemco Scholarship in Marine Biology Matthew Morris #12;

  8. nh gi Tn tht Ti nguyn Thin nhin Trn du Deepwater Horizon D n Ci thin Tri nghim Ngi i B v Xe

    E-Print Network [OSTI]

    IVProposedEarlyRestorationProject MÔ T D ÁN D án ci thin vic s dng ng dành cho xe p và ngi i b ti Davis Bayou bao gm tng cng ci thin qua khi khong 10.000 c dân ã chuyn n các vùng lân cn. Ngi s dng tuyn ng giao thông công cng này bao gm sung c quy hoch và tng chn s c xây dng nhng ni có ng c nâng lên. D án cng bao gm vic xây dng bin báo

  9. In Discovery Science 99. Revised November 5, 1999, with correct accuracy results. CAEP: Classification by Aggregating Emerging

    E-Print Network [OSTI]

    Dong, Guozhu

    : Classification by Aggregating Emerging Patterns Guozhu Dong 1 and Xiuzhen Zhang 2 and Limsoon Wong 3 and Jinyan of CSSE, Univ of Melbourne, Vic 3052, Australia. fxzhang,jylig@cs.mu.oz.au 3 Kent Ridge Digital Labs the performance of classifiers. CAEP is also very good under this measure. 1 Introduction Classification

  10. 504 IEEE TRANSACTIONS ON ELECTROMAGNETIC COMPATIBILITY, VOL. 50, NO. 3, AUGUST 2008 Path Loss From a Transmitter Inside an Aircraft

    E-Print Network [OSTI]

    Ellingson, Steven W.

    for small aircraft has been reported [9]. An exam- ple of IPL analysis demonstrating the deleterious impact of a potential vic- tim system of the aircraft. Given this "interference path loss" (IPL) and an estimate to measure IPL directly have demonstrated that accurate and repeatable mea- surements are difficult to obtain

  11. University Valedictorians Bill Jennings 1923

    E-Print Network [OSTI]

    Velev, Orlin D.

    University Valedictorians Name Year Bill Jennings 1923 Lamar Moss 1933 Vic Shelburne 1945 Eustace Lithgo 2008 Lindsey Robinson 2008 Clay Wright 2008 William Barnes 2009 Henryk Orlik 2009 Peiwen Thor 2009 Elizabeth Butler 2010 Raleigh Davis 2010 Farshid Jafarpour 2010 Lara Jazmin 2010 Stephen Morton 2010 Scott

  12. Princeton University Assimilation of Satellite Remote Sensing Data

    E-Print Network [OSTI]

    Pan, Ming

    Assimilation System Randomizer (Ensemble/Particle Generator) VIC + LSMEM Ensemble/Particle Filter Water (Energy University Water Budget in the Land Surface (and Atmosphere) )( ETPC dt dS q a --= Knowledge of the water budgetKnowledge of the water budgetKnowledge of the water budgetKnowledge of the water budget components

  13. qPCR Workshop held at NFSTC Peter Vallone (NIST) and Cristin Orrego (CA DOJ)

    E-Print Network [OSTI]

    Not Water Designing an Experiment #12;qPCR Workshop held at NFSTC Peter Vallone (NIST) and Cristián Orrego Analysis - Instrument The spectra view allows us to see how fluorescence changes with each cycle Filter "A" FAM Filter "B" VIC Filter "D" ROX Note: clicking on well(s) below will select and show specific data

  14. Progress In Electromagnetics Research B, Vol. 12, 259295, 2009 AN ESTIMATION OF SENSOR ENERGY CONSUMP-

    E-Print Network [OSTI]

    Halgamuge, Malka N.

    University of Technology PO Box 218, Hawthorn, VIC 3122, Australia Abstract--A comprehensive energy model attempts to model sensor node energy consumption. We list below several such models and point out certainProgress In Electromagnetics Research B, Vol. 12, 259­295, 2009 AN ESTIMATION OF SENSOR ENERGY

  15. TROBEXIS / AMADEUS Travel Portal

    E-Print Network [OSTI]

    Fleming, Andrew J.

    TROBEXIS / AMADEUS Quick Reference Guides ­ Travel Portal University of Newcastle September 2014 #12;Available Quick Reference Guides - 1. Travel Portal Overview 3 2. Trobexis Overview 4 3 of Newcastle - Travel Portal Trobexis.com © 2010 Evolving Spaces (VIC) Pty Ltd and Amadeus IT Group S.A. P a g

  16. Winner Takes All: Competing Viruses or Ideas on fair-play Networks

    E-Print Network [OSTI]

    Faloutsos, Christos

    virus authors make sure that their code eliminates most other computer viruses from the vic- tim's diskWinner Takes All: Competing Viruses or Ideas on fair-play Networks B. Aditya Prakash, Alex Beutel, Roni Rosenfeld, and Christos Faloutsos Computer Science Department, Carnegie Mellon University

  17. Saliva samples are a viable alternative to blood samples as a source of DNA for high throughput genotyping

    E-Print Network [OSTI]

    Abraham, Jean E.; Maranian, Mel J.; Spiteri, Inmaculada; Russell, Roslin; Ingle, Susan; Luccarini, Craig; Earl, Helena M.; Pharoah, Paul P. D.; Dunning, Alison M.; Caldas, Carlos

    2012-05-30

    , reduce costs and logistical problems asso- ciated blood collection within multicentre studies.Additional file Additional file 1: Figure 1. Primers and probes for Taqman assays. Figure 2 Assessment of fragmentation of 3 matched blood and saliva derived DNA... Additional files Supplementary Figure 1 Primers and probes for Taqman assays rs12642938 Forward primer: ACTCCCAGTTATATACCCAACAGATATGTATAAAT Reverse primer: TGTCTTCATTTTATGATTAATAGATATTTGGGTTGCT VIC probe: CAATTTTTGGACAATATTGAT FAM probe...

  18. Special Focus on High-Confidence Software Technologies SCIENCE CHINA

    E-Print Network [OSTI]

    Yang, Yun

    , China; 3School of Software and Electrical Engineering, Swinburne University of Technology, Hawthorn VIC of high-level middleware services for different comput- ing paradigms such as cluster, grid, and cloud intensive e-science applications such as weather fore- cast earthquake modeling, and astrophysics [4

  19. Thesis

    E-Print Network [OSTI]

    Vic Reiner was my initial advisor, and turned out to be a phantastic source ...... F models order by Vd-degree, but is not a well order. ..... power of y1, say y i. 1 . ...... Let n = 3, and consider the left ideal J generated by the. system. (x3 y 2z2)@x.

  20. QoS-aware Deployment of Network of Virtual Appliances across Multiple Clouds Amir Vahid Dastjerdi, Saurabh Kumar Garg, and Rajkumar Buyya

    E-Print Network [OSTI]

    Buyya, Rajkumar

    , Department of Computer Science and Software Engineering, The University of Melbourne, Parkville, VIC 3010-based. They take into account Quality of Service (QoS) criteria such as reliability, data communication cost problems such as root privilege requirements and library dependencies, virtual appliance technology

  1. Vascular Biology, Atherosclerosis and Endothelium Biology Identification and Characterization of Aortic Valve

    E-Print Network [OSTI]

    Simmons, Craig A.

    of Aortic Valve Mesenchymal Progenitor Cells with Robust Osteogenic Calcification Potential Jan-Hung Chen by an unidentified multipotent progenitor subpopulation within the valve interstitium. The identity, frequency were to determine whether valve intersti- tial cells (VICs) contain a subpopulation of multipo- tent

  2. C:\\idrive\\web\\intro6e\\supplement\\Supplement6(d)JavaXML.doc Last printed Supplement VI.D: Java and XML

    E-Print Network [OSTI]

    Liang, Y. Daniel

    C:\\idrive\\web\\intro6e\\supplement\\Supplement6(d)JavaXML.doc Last printed Supplement VI.D: Java and XML For Introduction to Java Programming By Y. Daniel Liang This supplement introduces how to use Java is required for this supplement. To learn XML, please read Supplement VI.C, "XML." 0 Introduction

  3. PublicationsmailagreementNo.40014024 Bright minds and

    E-Print Network [OSTI]

    Victoria, University of

    of Canada (RSC), the country's senior national body of distinguished Canadian scholars. In the historyNt or former uVic faculty members who are fellows of the royal society of caNada SEPTEMBER 2010 The University person in three inVictoria is assisted by a UnitedWay-funded agency or program.Visit the website

  4. Hydrological consequences of Eucalyptus afforestation in the Argentine Pampas

    E-Print Network [OSTI]

    Jackson, Robert B.

    Hydrological consequences of Eucalyptus afforestation in the Argentine Pampas Vic Engel,1 Esteban G of Eucalyptus camaldulensis in the Pampas grasslands of Argentina were explored for 2 years using a novel. B. Jackson (2005), Hydrological consequences of Eucalyptus afforestation in the Argentine Pampas

  5. MEASURING LONGRANGE DEPENDENCE UNDER CHANGING TRAFFIC CONDITIONS Matthew Roughan Darryl Veitch

    E-Print Network [OSTI]

    Roughan, Matthew

    Software Engineering Research Centre, RMIT University 110 Victoria St, Carlton, Vic 3053, Australia email when a time­series is non­stationary. In particular the effect of polynomial trends in data may -- the long term correlations cause apparent trends, encouraging the erroneous conclusion that the data is non

  6. Nondestructive estimates of above-ground biomass using terrestrial laser scanning

    E-Print Network [OSTI]

    Jones, Peter JS

    , The Netherlands; 2 CSIRO Land and Water, Private Bag 10, Clayton South, Vic. 3169, Australia; 3 Department these estimates against destructively harvested AGB estimates and AGB derived from allometric equations. We also. Single trees are extracted from the TLS data and quantitative structure models are used to estimate

  7. Forces between a Rigid Probe Particle and a Liquid Interface: Comparison between Experiment and Theory

    E-Print Network [OSTI]

    Chan, Derek Y C

    of the surface forces acting between solid-water and oil-water interfaces is critical in order to control of Chemistry, Particulate Fluids Processing Centre, The University of Melbourne, VIC, 3010 Australia Received The measurement of surface forces has, for many years, been the focus of much interest in the field of colloid

  8. Embedded Smart Controller for an Industrial Reefer Refrigeration1

    E-Print Network [OSTI]

    Reznik, Leon

    Embedded Smart Controller for an Industrial Reefer Refrigeration1 Leon Reznik and Shane Spiteri School of Communications and Informatics Victoria University PO Box 14428, Melbourne City MC VIC 8001 2-5, 2001 Abstract. The paper describes the development of a smart embedded fuzzy system for reefer

  9. Drag Reduction by Leidenfrost Vapor Layers Ivan U. Vakarelski,1,2,* Jeremy O. Marston,1

    E-Print Network [OSTI]

    Chan, Derek Y C

    of Technology, Hawthorn VIC 3122, Australia 5 Clean Combustion Research Center, King Abdullah University a continuous and robust lubricating layer on the surface of fast moving solid sphere in fluids. The resulting and then immersed in a fluid, we can investigate the drag reduction effect of the associated Leidenfrost vapor layer

  10. Dr. Dale S. Rogers Professor, Logistics & Supply Chain Management

    E-Print Network [OSTI]

    Lin, Xiaodong

    Dr. Dale S. Rogers Professor, Logistics & Supply Chain Management Co-Director, Center for Supply Chain Management Rutgers University Rutgers VICS Logistics Summit September 27, 2011 New Brunswick, NJ The Future of Global Logistics #12;The Future of Global Logistics Future of Global Logistics · Introduction

  11. nh Gi Thit Hi Ti Nguyn Thin Nhin ca V Trn Du Deepwater Horizon Cc D n To S Sng Ven B

    E-Print Network [OSTI]

    s c s dng khong 0,3 dm ng b bin và s to ra khon mt dm Anh (acre) vùng môi trng sng Florida ang cng tác. Cu cng trung tâm Thành Ph Pensacola và s hoàn thành vic xây dng công trình ê chn sóng th ba ti ây

  12. ENSO diversity as a result of the recharge oscillator interacting with the slab ocean

    E-Print Network [OSTI]

    Dommenget, Dietmar

    of Mathematical Sciences Monash University, VIC 3800 Australia yanshan.yu@monash.edu Abstract1 El Nino of El Nino­Southern Oscillation (ENSO) (Wyrtki 1975; Wyrtki 1985;21 Jin 1997). It is a zero order fast, the diversity in the patterns29 of ENSO events, with more El Nino events occurring in the central Pacific (CP El

  13. Effects of land use changes on streamflow generation in the Rhine basin

    E-Print Network [OSTI]

    Troch, Peter

    , afforestation. In this study, we investigate the effect of projected land use change scenarios on river at various spatial scales. The variable infiltration capacity (VIC) (version 4.0.5) model is used, and infiltration capacity to decrease [Clark, 1987]. In addition, forests strongly affect snow accumulation

  14. Search results | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Usage Search results Search results Enter terms Search Showing 1 - 3 of 3 results. Download Monitoring and Mentoring These activities explore energy use and conservation using...

  15. Better Buildings Neighborhood Program Workforce Peer Exchange...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    or mentoring program for newly trained contractors? * Program Experience and Lessons: New Hampshire: Cimbria Badenhausen, NHCDFA Kansas City: Jensen Adams and Warren Adams...

  16. Energy Department Scientists and Engineers Honored with Presidential...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    the use of neutral pions to identify hot, dense nuclear matter and to study transverse proton spin asymmetries; and for mentoring of graduate students in building advanced...

  17. Search results | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy Usage Search results Search results Enter terms Search Showing 1 - 3 of 3 results. Download Monitoring and Mentoring These activities explore energy use and conservation...

  18. Report of the Secretary of Energy Task Force on DOE National...

    Broader source: Energy.gov (indexed) [DOE]

    NNSA laboratories and NNSA production facilities. 3. The morale, mentoring, and professional development of the technical workforce at the DOE National Laboratories,...

  19. Analysis of Cluster Management Tools

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Analysis of Configuration Management Tools Computer System, Cluster, and Networking Summer Institute Team: Evan Leeseberg, James Kang, Katherine Nystrom Mentors: Kevin Tegtmeier,...

  20. Before Senate Committee on Homeland Security and Governmental...

    Broader source: Energy.gov (indexed) [DOE]

    Operational Plan and Desktop Reference for the Disability Employment Program ITP Mining: Education Roadmap for Mining Professionals (December 2002) Mentoring to Increase...

  1. Perspective Transformation: Analyzing the Outcomes of International Education 

    E-Print Network [OSTI]

    Tacey, Krista Diane

    2012-10-19

    ............................................................................... 44 Demographics ................................................................................. 46 Prior Study Abroad ......................................................................... 48 The Fulbright ETA Experience... ...................................................... 52 Accommodations ...................................................................... 52 The Role of Mentors ...................................................................... 53 Impact of the Fulbright ETA...

  2. Donatella Danielli receives Butler Leadership in ... - West Lafayette

    E-Print Network [OSTI]

    $author.value

    From early in her career, she has devoted considerable time, energy, and resources (from her research funding) to recruiting and mentoring students and ...

  3. Technical Report Documentation Page 1. Report No.

    E-Print Network [OSTI]

    Dudek, Joseph Lam, Wayne Kittelson, Thomas Hicks; (back row) Leslie Jacobson, William Spreitzer. (Not: Conrad L. Dudek Mentors: Thomas Hicks, Patrick Irwin, Les Jacobson, Wayne Kittelson, Joseph Lam

  4. Inspiring Careers in Science Research

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and career paths. The lecturers and mentors include: Taghrid Samak, who talked about data-mining and anomaly detection for workflow scientific applications. Daniela Ushizima,...

  5. November 2014 1 Training Program in Technology Transfer Draws Managers from Fifteen Countries

    E-Print Network [OSTI]

    Ghosh, Joydeep

    November 2014 1 Training Program in Technology Transfer Draws Managers from Fifteen Countries IC) and individualized post-Austin mentoring (November). It prepares technology transfer specialists, incubator managers

  6. Auditing Focus Matthew Chambers (Michigan Technological University...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    (California State University, San Bernardino) Casey Mortensen (New Mexico Institute of Mining and Technology) Mentor: David Kennel (DCS-1) Instructor: Andree Jacobson (NMC) 2011...

  7. MONDAY 23 FEBRUARY KENSINGTON Vice-Chancellor's Welcome (Undergraduate)

    E-Print Network [OSTI]

    New South Wales, University of

    (including 3D Printing). Sign up online www.artdesign.unsw.edu.au 11am - 12.30pm Peer Mentoring Welcome F

  8. Search results | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Consumption Search results Search results Enter terms Search Showing 1 - 3 of 3 results. Download Monitoring and Mentoring These activities explore energy use and conservation...

  9. Search results | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Consumption Download Search results Search results Enter terms Search Showing 1 - 3 of 3 results. Download Monitoring and Mentoring These activities explore energy use and...

  10. Search results | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Consumption Energy Efficiency Search results Search results Enter terms Search Showing 1 - 3 of 3 results. Download Monitoring and Mentoring These activities explore energy...

  11. LA-UR-12-23586 Team Members: Matthew Broomfield (New Mexico Tech...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    3586 Team Members: Matthew Broomfield (New Mexico Tech) Eric Boyer (Michigan Tech) Terrell Perrotti (South Carolina State University) Mentors: David Kennel (DCS-1) Greg Lee (DCS-1)...

  12. Jefferson Lab Weekly Briefs September 16, 2015 | Jefferson Lab

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    About Science Jefferson Lab volunteers are needed to help students with a range of classroom activities and as mentors for role model visits as part of the Becoming...

  13. the DOE ISMS Review

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    tank farms access, supervisor fundamentals and facility systems training. Following their classroom training, they will spend up to several months being mentored by a qualified...

  14. Sandia National Laboratories: News: Publications: Lab News

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and his mentor Mark Gerling discuss Mobile Imager of Neutrons for Emergency Responders (MINER). While at Sandia last summer, Zach evaluated how the performance of MINER compares...

  15. Search results | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy Efficiency Homes Search results Search results Enter terms Search Showing 1 - 4 of 4 results. Download Monitoring and Mentoring These activities explore energy use and...

  16. Search results | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy Efficiency Search results Search results Enter terms Search Showing 1 - 3 of 3 results. Download Monitoring and Mentoring These activities explore energy use and...

  17. Search results | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Energy Efficiency Search results Search results Enter terms Search Showing 1 - 4 of 4 results. Download Monitoring and Mentoring These activities explore energy use and...

  18. U N C L A S S I F I E D U N C L A S S I F I E D

    E-Print Network [OSTI]

    Studies Erich Doll edoll@unm.edu, Ruben Salazar rsalaza2@unm.edu, Taylor Owen towen@nmsu.edu Mentors: HB

  19. Department of Energy Small Business Conference Starts Today in...

    Energy Savers [EERE]

    Recognition: Princeton Plasma Physics Laboratory (Princeton, NJ) DOE Mentor of the Year: IBM (Washington, DC) DOE Protg of the Year: Ingenium Professional Services, Inc....

  20. DOE Shares Funding Opportunities and Honors Small Business Award...

    Broader source: Energy.gov (indexed) [DOE]

    Recognition: Princeton Plasma Physics Laboratory (Princeton, NJ) DOE Mentor of the Year: IBM (Washington, DC) DOE Protg of the Year: Ingenium Professional Services, Inc....

  1. A Cooperative Approach to Work-based Learning and College Transitions...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and make presentations to industry partners. * Consortium and Bates activities and materials included learning guides, mentor handbook, career guide, and career fair. * The...

  2. NDIA_PMSC_SurveillanceGuide_Oct2004.doc

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    and the program's approach to it. Surveillance should be approached as a mentoring or problem-solving session rather than an audit because it not only identifies...

  3. Search results | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    results. Download Monitoring and Mentoring These activities explore energy use and conservation using the home and school as learning laboratories. (Upper elementary and...

  4. Search results | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Monitoring and Mentoring These activities explore energy use and conservation using the home and school as learning laboratories. (Upper elementary and intermediate students can...

  5. Search results | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    downloadsmonitoring-and-mentoring Download Great Energy Debate Students evaluate the advantages and disadvantages of the major energy sources in an innovative debate format....

  6. 2010 Department of Energy Council on Women and Girls First Annual...

    Energy Savers [EERE]

    Report More Documents & Publications Reports and Publications on Women and Girls in STEM Mentoring to Increase Diversity in Science, Tech, Engineering and Math C3E Connection...

  7. Department of Energy Research Opportunities for Historically...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    the Gap between Federal Agencies and MSIs Mentoring to Increase Diversity in Science, Tech, Engineering and Math Presentations from San Antonio, Texas Workshop - June 9, 2012...

  8. By Derrick Lee, Garrett Lord, Jesse Martinez, and Christopher...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and Christopher Moore Mentors: HB Chen, Parks Fields, Benjamin McClelland, Alfred Torrez Computer Systems, Cluster, and Networking Summer Institute 2011 Performance Studies of...

  9. Advanced Health Monitoring of Computer Cluster

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Health Monitoring of Computer Clusters Presenter: Caleb Morse Team: Dylan Merrigan, Sherry Salas Mentors: Susan Coulter, Andree Jacobson, Kevin Tegtmeier LANL ISTIIAS Cluster...

  10. Search results | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Homes Search results Search results Enter terms Search Showing 1 - 3 of 3 results. Download Monitoring and Mentoring These activities explore energy use and conservation using...

  11. Papers and Reports

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Non-U.S Citizens Mentors, Projects Papers, Reports Photos NSEC IGPPS Space Weather Summer School Papers, Reports Papers and Reports Bringing together top, space...

  12. Los Alamos Space Weather Summer School

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Non-U.S Citizens Mentors, Projects Papers, Reports Photos NSEC IGPPS Space Weather Summer School Los Alamos Space Weather Summer School June 1 - July 24, 2015 Contacts...

  13. Robotics

    ScienceCinema (OSTI)

    Buckner, Mark

    2014-06-23

    Mark Buckner wants to help machines see objects the way humans do, and he's also mentoring the next generation of scientists and engineers through FIRST Robotics.

  14. LANL Distinguished Postdoc Fellows

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    the mechanisms behind the molecular processes involved in somatic mutagenesis and aging. Bio: Ludmil is co-mentored by William Hlavacek and Thomas Leitner. He previously was...

  15. Evaluating low oxygen and pH variation and its effects on invertebrate early life stages on upwelling margins /

    E-Print Network [OSTI]

    Frieder, Christina A.

    2013-01-01

    R, Branica M (1993) Study of uranyl(VI) ion reduction atTait CD, Morris DE (2000) Uranyl incorporation into calciteis mostly present as the uranyl tricarbonate complex (

  16. Search for: All records | SciTech Connect

    Office of Scientific and Technical Information (OSTI)

    G. (5) Morris, Christopher L (5) Borozdin, Konstantin N. (4) Hogan, Gary E (3) Marr-Lyon, Mark (3) Merrill, Frank E. (3) Priedhorsky, William C. (3) Schultz, Larry J. (3)...

  17. A Variational Approach to Strand-Based Modeling of the Human Hand

    E-Print Network [OSTI]

    MacIver, Malcolm A.

    A Variational Approach to Strand-Based Modeling of the Human Hand Elliot R. Johnson2 , Karen Morris muscles and ac- tivation patterns in dynamic motions compared to static contractions, even #12;2 Elliot R

  18. "Title","Creator/Author","Publication Date","OSTI Identifier...

    Office of Scientific and Technical Information (OSTI)

    Packed bed thermal energy storage: A simplified experimentally validated model","Anderson, Ryan; Bates, Liana; Johnson, Erick; Morris, Jeffrey F.","2015-12-01T05:00:00Z",1222500,"1...

  19. Governing Bodies: Gender and the Politics of Corporeal Weaponization

    E-Print Network [OSTI]

    Lyness, Claire Frances

    2015-01-01

    zenko/2014/11/21/americas-500th-drone-strike/ Ziarek, Ewa2010. “I Worked on the US Drone Program. The Public ShouldKnopf. Morris, David. 2015. “Can Drone Operators Get PTSD? ”

  20. CaMn2Sb2: Spin waves on a frustrated antiferromagnetic honeycomb...

    Office of Scientific and Technical Information (OSTI)

    honeycomb lattice Authors: McNally, D. E. ; Simonson, J. W. ; Kistner-Morris, J. J. ; Smith, G. J. ; Hassinger, J. E. ; DeBeer-Schmidt, L. ; Kolesnikov, A. I. ; Zaliznyak, I. A....

  1. Y-12 Construction maintains 'superb' safety performance | Y-12...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Construction maintains 'superb' safety performance Posted: March 6, 2013 - 6:03pm Tom Morris, B&W Y-12 vice president of projects, presents Construction's safety awards to Monica...

  2. United States Department of Energy

    Office of Environmental Management (EM)

    Energy, Office of Legacy Management." Letter to Barbara McNeal Lloyd from Alexander C. Morris, FOIA Officer, OIR (April 30, 2015). On April 30, 2015, OIR issued a determination...

  3. United States Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    and to the NNSA, which has oversight responsibility for LANL. Letter from Alexander Morris, OIR, to Greg Marlowe (April 22, 2015). On May 1, 2015, the NNSA issued a...

  4. contacts-by-user-facility | ornl.gov

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Paul Langan Director 865.576.0666 langanpa@ornl.gov High Flux Isotope Reactor Laura Morris Edwards User Program Manager 865.574.2966 edwardslm@ornl.gov High Temperature...

  5. Marti Ayers

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Attorney for the District of New Jersey -1995-1998, when Christie was a member of the Morris County Board of Chosen Freeholders -1987-2002, when Christie was a lawyer at Dughi &...

  6. How do colloidal gels form and flow | ornl.gov

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and Office Building (8600), Iran Thomas Auditorium (Room A-103) CONTACT : Email: Laura Morris Edwards, NScD Phone:865.574.2966 Add to Calendar SHARE Large amplitude oscillatory...

  7. HFIR Plant Maintenance - August

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Topical Meeting on High Temperature Reactor Technology * C.A. Baldwin, J.D. Hunn, R.N. Morris, F.C. Montgomery, C.M. Silva, and P.A. Demkowicz, "First Elevated Temperature...

  8. Physics of the Earth and Planetary Interiors, 36 (1984) 163--177 163 Elsevier Science Publishers By., Amsterdam --Printed in The Netherlands

    E-Print Network [OSTI]

    Torsvik, Trond Helge

    1984-01-01

    with various geological and geophysical tion directions, and various authors (Morris, 1976; aspects SANDSTONE (MI DOLE DEVONIANI n E R C `r N FRONT PLUTONIC COMPLEX TONALITE, XRAr6OIJIXRITE AND AOAMELL!TE E

  9. CROSS-CONNECTIONS COLLEGE OF LAW

    E-Print Network [OSTI]

    McConnell, Terry

    , an African American man from Louisiana whose 1964 murder remains unsolved to this day. Although the civil's Office have now pledged to look into the murder of Frank Morris--justice delayed but no longer denied

  10. TREM2 in neurodegeneration: evidence for association of the p.R47H variant with frontotemporal dementia and Parkinson¿s disease

    E-Print Network [OSTI]

    2013-01-01

    SGY, RCP, NE-T, RJU, JFM, KBB , BFB, NRG-R, ZKW and DWD madeMayo ADRC RCP PI; to RR, BFB, NRG-R, DWD and NET), Morris K.

  11. PUBLICATIONS LIST Jean Elizabeth Jackson

    E-Print Network [OSTI]

    Jackson, Daniel

    pain? The politics of representation." In Daniel B. Carr, John D. Loeser, David B. Morris, eds: 172- 194. 2002: "Caught in the Crossfire: Colombia's indigenous peoples during the 1990s." In David

  12. Ex Parte Memo_September 26, 2014_PAC TP Comments (00031509).DOC

    Office of Environmental Management (EM)

    Tim Sutherland, Navigant Mike Prager, De'Longhi USA Paolo Rognini, De'Longhi USA Stefano Vit, De'Longhi Jennifer Cleary, AHAM Sriram Gopal, AHAM Steve Leybourn, AHAM Wayne Morris...

  13. Science & Technology - 2014

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    In addition, DIXI is shielded by 1,300 pounds of lead and high-density borated polyethylene. Researchers Load DIXI Film Pack (Left) Mike Morris and Ken Piston install a film...

  14. The Evolution of War

    E-Print Network [OSTI]

    Morris, Ian

    2012-01-01

    Viking. Keeley, Lawrence. 1996. War Before Civilization. NewSocieties and the Origins of War. Ann Arbor: University ofPress. Morris: Evolution of War. Cliodynamics (2012) Vol. 3,

  15. Describing the Use of Microsoft® Lync™ in the Texas A&M AgriLife Extension Service among County Extension Agents 

    E-Print Network [OSTI]

    Sandifeer, Aimee

    2014-12-03

    was modified from the Unified Theory of Acceptance and Use of Technology (UTAUT) model and found to be a reliable and valid instrument. The UTAUT scale was developed by Venkatesh, Morris, Davis & Davis (2003) to assess users’ technology preferences. Constructs...

  16. Judging a book by its cover and its contents: The representation of polysemous and homophonous meanings in four-year-old children

    E-Print Network [OSTI]

    Srinivasan, Mahesh; Snedeker, Jesse

    2011-01-01

    A. , Morris, R. K. , & Rayner, K. (1988). Lexical ambiguity29(2), 269–288. Frazier, L. , & Rayner, K. (1990). Taking onPoeppel, 2005; Frazier & Rayner, 1990; Klein & Murphy, 2001,

  17. Bilingual cognitive and sentence processing

    E-Print Network [OSTI]

    Gutiérrez, Roberto Santiago

    Binder, K. , Duffy, S. , & Rayner, K. (2001). The effects ofWilliams, R. , Morris, R. , & Rayner, K. (2003). The use ofClub. Frazier, L. , & Rayner, K. (1982). Making and

  18. SPECIAL REPORT Environmental Health specialists'

    E-Print Network [OSTI]

    with epidemiologists and laboratori ans in federal, state, and local public health agencies are typically involved during investigations (Bry an, 2002; Ehiri & Morris, 1994; Jones et al., 2004). The Environmental Health 45­54 38 55 or

  19. Annotated Bibliography to Accompany Anderson, Pollay, & Ling, "Taking Ad-Vantage of Lax Advertising Regulations: Reassuring and Distracting Health-Concerned Smokers" (Social Science & Medicine, 2006)

    E-Print Network [OSTI]

    Anderson, Stacey J Ph.D.

    2006-01-01

    tid/mhj34f00. Beane T. Pmusa PMU. Buffalo Market Check. 4Philip Morris. Pmusa PMU. 16 Sep 1981. Bates No.persuasion. Altenberg K. Pmusa PMU. Marlboro Research Plan -

  20. 2003 Participating Schools Academy of the Holy Names

    E-Print Network [OSTI]

    Morris Lindsay Norman Megan O'Brien Sarah Phelan Steve Pinchook Katie Sutliff Coxsackie-Athens Elementary. Anthony John Jesmain, Jr. Student: Christopher Desmond Forts Ferry Elementary School Teacher: Mrs. Lynn

  1. Status Characteristics and Expectation States 

    E-Print Network [OSTI]

    Berger, Joseph; Cohen, Bernard P.; Zelditch, Morris Jr.

    2015-07-19

    -Type text/plain; charset=UTF-8 STATUS CHARACTERISTICS AND EXPECTATION STATES* Joseph Berger Bernard P. Cohen Morris Zelditch, Jr. Research for this paper was conducted with the support of NSF grant #G23990? for investigation of authority...

  2. Rank Equilibration and Political Behavior 

    E-Print Network [OSTI]

    Anderson, Bo; Zelditch, Morris Jr

    2015-07-14

    /plain; charset=UTF-8 RANK EQUILIBRATION AND POLITICAL BEHAVIOR by Bo Anderson and Morris Zelditch, Jr0 TR #9 Rank Equilibration end Political Behavior* 1« Introduction The terra ,,status politics" refers to a way of conceptualizing some aspects o...

  3. newsletterof the UCSF Foundation

    E-Print Network [OSTI]

    Martin, Gail

    /502-2404 or kmcateer@support.ucsf.edu Chancellor Susan desmond-Hellmann, Md, MPH, bestowed the UCSF Medal in specific countries of Africa and Asia. Elizabeth Blackburn, PhD, nobel laureate and Morris Herzstein

  4. Functional Analysis of Genes Implicated in Down Syndrome: 1. Cognitive Abilities in Mice Transpolygenic for Down

    E-Print Network [OSTI]

    Smith, Desmond J.

    ,1 Vincent Duquenne,1 Desmond J. Smith3 , Edward Rubin,4 and Pierre L. Roubertoux1,2,6 Received 30 carried by these fragments with the Morris water-maze and fear-conditioning procedures. The 152F7

  5. Number Sec CRN Days Time Room Instructor Office 10800 001 ...

    E-Print Network [OSTI]

    ... MWF 10:30AM-11:20AM SMTH 201 Nicholas Morris MATH G136 15300 065 .... Jake Desmond MATH 701 16500 141 42956 R 02:30PM-03:20PM UNIV 219 ...

  6. CaMn2Sb2: Spin waves on a frustrated antiferromagnetic honeycomb...

    Office of Scientific and Technical Information (OSTI)

    point. Authors: McNally, D. E. 1 ; Simonson, J. W. 1 ; Kistner-Morris, J. J. 1 ; Smith, G. J. 1 ; Hassinger, J. E. 1 ; DeBeer-Schmidt, L. 2 ; Kolesnikov, A. I. 2 ;...

  7. CaMn 2 Sb 2 : Spin waves on a frustrated antiferromagnetic honeycomb...

    Office of Scientific and Technical Information (OSTI)

    honeycomb lattice Authors: McNally, D. E. ; Simonson, J. W. ; Kistner-Morris, J. J. ; Smith, G. J. ; Hassinger, J. E. ; DeBeer-Schmitt, L. ; Kolesnikov, A. I. ; Zaliznyak, I. A....

  8. Dependence of groundwater recharge in the Niles Cone Groundwater Basin on climate variability and inter-basin water transfers

    E-Print Network [OSTI]

    Balakrishnan, Krishnachandran

    2012-01-01

    Morris, B L, et al. 2003. Groundwater and its susceptibilityG. et al. 2007. Groundwater Use in a Global Perspective –management of the state’s Groundwater Resources, Report from

  9. Packed bed thermal energy storage: A simplified experimentally...

    Office of Scientific and Technical Information (OSTI)

    Anderson, Ryan ; Bates, Liana ; Johnson, Erick ; Morris, Jeffrey F. Publication Date: 2015-12-01 OSTI Identifier: 1222500 GrantContract Number: FC36-08GO18151 Type: Published...

  10. Protection and reliability : an examination of the quality and quantity of ant protection in the food-for- protection mutualism between Ferocactus viridescens, Crematogaster californica and the invasive Linepithema humile

    E-Print Network [OSTI]

    Ludka, John T.

    2009-01-01

    Biology 12 (1): 39- Ness, J. H. and J. Bronstein. 2004.Invasions 6: 445-461. Ness, J. H. 2006. A mutualism’spollinators. OIKOS 113: 506-514. Ness, J. , W.F. Morris, and

  11. Pollinator harassment in a protection mutualism: effects of the Argentine ant on coast barrel cactus reproductive success

    E-Print Network [OSTI]

    McCann, Kyle R.

    2012-01-01

    Biology 12 (1): 39? Ness, J. H. and J. Bronstein. 2004.Invasions 6: 445?461. Ness, J. H. 2006. A mutualism’spollinators. OIKOS 113: 506?514. Ness, J. , W.F. Morris, and

  12. What AreWetlands? Wetlands are areas of land that are

    E-Print Network [OSTI]

    George, Edward I.

    for farming and mining of iron ore and limestone. 1892 Floodplain purchased by John and Lydia Morris to add Physocarpus opulifolius common ninebark Vernonia novaboracensis iron weed Look and listen for these local

  13. Electricity Generation and Emissions Reduction Decisions

    E-Print Network [OSTI]

    Electricity Generation and Emissions Reduction Decisions under Policy Uncertainty: A General;1 Electricity Generation and Emissions Reduction Decisions under Policy Uncertainty: A General Equilibrium Analysis Jennifer Morris* , Mort Webster* and John Reilly* Abstract The electric power sector, which

  14. Psychological Science 24(9) 17631769

    E-Print Network [OSTI]

    Gross, James J.

    & Cheney, 2008). Medical-noncompliance rates in developed countries are as high as 50% (Morris & Schulz for an electric shock. When doing nothing was the status quo option, participants frequently did not select

  15. Rose F. Kennedy Center is located north of Van Etten, amid

    E-Print Network [OSTI]

    Bukauskas, Feliksas

    NORTH CAMPUS SOUTH CAMPUS Rose F. Kennedy Center is located north of Van Etten, amid Jacobi Medical Pavilion (1301 Morris Park Ave.) VE Van Etten Building (1225 Morris Park Ave.) KE Rose F. Kennedy Center RH E S H I V A U N I V E R S I T Y Albert Einstein College of Medicine P LE CC LW H To Kennedy Center

  16. Auslegung: a journal of philosophy, Volume 26, Number 1 (Winter/Spring, 2003): Front Matter

    E-Print Network [OSTI]

    University, Calumet Campus David A. Duquette, St. Norbert College Christopher N. Foster, Utah Valley State College Pieranna Garavaso, University of Minnesota, Morris Martin Heim, St. Mary College Rob Hull, West Virginia Wesleyan College Dawn Jakubowski... University, Calumet Campus David A. Duquette, St. Norbert College Christopher N. Foster, Utah Valley State College Pieranna Garavaso, University of Minnesota, Morris Martin Heim, St. Mary College Rob Hull, West Virginia Wesleyan College Dawn Jakubowski...

  17. Auslegung: a journal of philosophy, Volume 24, Number 1 (Winter/Spring, 2001): Front Matter

    E-Print Network [OSTI]

    , Andrew Ward, Darrell Creighton University Saint Peter's College Purdue University, Calumet Campus St. Norbert College Utah Valley State College University of Minnesota, Morris St. Mary College West Virginia Wesleyan College University of Central..., Andrew Ward, Darrell Creighton University Saint Peter's College Purdue University, Calumet Campus St. Norbert College Utah Valley State College University of Minnesota, Morris St. Mary College West Virginia Wesleyan College University of Central...

  18. Auslegung: a journal of philosophy, Volume 26, Number 1 (Winter/Spring, 2004): Front Matter

    E-Print Network [OSTI]

    Wheeler Ted Zenzinger Creighton University Saint Peter's College Purdue University, Calumet Campus St. Norbert College Utah Valley State College University of Minnesota, Morris St. Mary College West Virginia Wesleyan College University of Central... Wheeler Ted Zenzinger Creighton University Saint Peter's College Purdue University, Calumet Campus St. Norbert College Utah Valley State College University of Minnesota, Morris St. Mary College West Virginia Wesleyan College University of Central...

  19. Auslegung: a journal of philosophy, Volume 24, Number 2 (Summer/Fall 2001): Front Matter

    E-Print Network [OSTI]

    . Norbert College Utah Valley State College University of Minnesota, Morris St. Mary College West Virginia Wesleyan College University of Central Arkansas Middle Tennessee State University DePaul University Spelman College Iowa State University.... Norbert College Utah Valley State College University of Minnesota, Morris St. Mary College West Virginia Wesleyan College University of Central Arkansas Middle Tennessee State University DePaul University Spelman College Iowa State University...

  20. New Occurrences of the Unusual Trilobite Naraoia From the Cambrian of Idaho and Utah

    E-Print Network [OSTI]

    Robison, Richard A.

    1984-07-24

    arthropods and Anomalocaris from the Middle Cambrian of Utah. University of Kansas Paleontological Contributions, Paper 1 1 1 :1-24. Collins, Desmond, D. E. G. Briggs, and Simon Conway Morris. 1983. New Burgess shale fossil sites reveal Middle Cambrian faunal... arthropods and Anomalocaris from the Middle Cambrian of Utah. University of Kansas Paleontological Contributions, Paper 1 1 1 :1-24. Collins, Desmond, D. E. G. Briggs, and Simon Conway Morris. 1983. New Burgess shale fossil sites reveal Middle Cambrian faunal...