Sample records for members utilitymgmtcorp ads15

  1. Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighand Retrievals from aRod Eggert ImageMeetings Members Michael J.

  2. Elastomeric member

    DOE Patents [OSTI]

    Hoppie, L.O.


    An energy storage device is disclosed consisting of a stretched elongated elastomeric member disposed within a tubular housing, which elastomeric member is adapted to be torsionally stressed to store energy. The elastomeric member is configured in the relaxed state with a uniform diameter body section, and transition end sections, attached to rigid end piece assemblies of a lesser diameter. The profile and deflection characteristic of the transition sections are such that upon stretching of the elastomeric member, a substantially uniform diameter assembly results, to minimize the required volume of the surrounding housing. Each of the transition sections are received within and bonded to a woven wire mesh sleeve having helical windings at a particular helix angle to control the deflection of the transition section. Each sleeve also contracts with the contraction of the associated transition section to maintain the bond there between. During manufacture, the sleeves are forced against a forming surface and bonded to the associated transition section to provide the correct profile and helix angle. 12 figs.

  3. Elastomeric member

    DOE Patents [OSTI]

    Hoppie, Lyle O. (Birmingham, MI)


    An energy storage device (10) is disclosed consisting of a stretched elongated elastomeric member (16) disposed within a tubular housing (14), which elastomeric member (16) is adapted to be torsionally stressed to store energy. The elastomeric member (16) is configured in the relaxed state with a uniform diameter body section (74), and transition end sections (76, 78), attached to rigid end piece assemblies (22, 24) of a lesser diameter. The profile and deflection characteristic of the transition sections (76, 78) are such that upon stretching of the elastomeric member (16), a substantially uniform diameter assembly results, to minimize the required volume of the surrounding housing (14). Each of the transition sections (76, 78) are received within and bonded to a woven wire mesh sleeve (26, 28) having helical windings at a particular helix angle to control the deflection of the transition section. Each sleeve (26, 28) also contracts with the contraction of the associated transition section to maintain the bond therebetween. During manufacture, the sleeves (26, 28) are forced against a forming surface and bonded to the associated transition section (76, 78) to provide the correct profile and helix angle.

  4. ORSSAB Members | Department of Energy

    Office of Environmental Management (EM)

    Read Bio Claire RowcliffeRead Bio Mary Smalling Member Read Bio Wanda Smith Member Read Bio Coralie (Corkie) Staley Member Read Bio Scott Stout Member...

  5. Combustion Group Group members

    E-Print Network [OSTI]

    Wang, Wei

    Combustion Group Group members: Thierry Poinsot, Emilien Courtine, Luc Vervisch, Benjamin Farcy 2014 #12;Combustion Group Combustion Physics and Modeling Pollutants, Emissions, and Soot Formation Thermoacoustics and Combustion Dynamics Research focus § Examine mechanisms responsible for flame stabilization

  6. Combustion Group Group members

    E-Print Network [OSTI]

    Wang, Wei

    Combustion Group Group members: Thierry Poinsot, Emilien Courtine, Luc Vervisch, Benjamin Farcy § New combustion and energy-conversion concepts #12;Introduction Combustion research thrusts Combustion Dynamics and Flame-Stabilization Research objectives § Obtain fundamental understanding of combustion

  7. Members | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directed offOCHCO2:Introduction to EnergyDepartment ofMarginalPaul D. Jablonski National EnergyMemberMembers

  8. Environmental Management Advisory Board Members | Department...

    Energy Savers [EERE]

    Member Read Bio David W. Swindle, Jr. EMAB Board Member Read Bio Robert J. Thompson EMAB Board Member Read Bio Lenn Vincent EMAB Board Member Read Bio Waste...

  9. Cryogenic support member

    DOE Patents [OSTI]

    Niemann, Ralph C. (Downers Grove, IL); Gonczy, John D. (Oak Lawn, IL); Nicol, Thomas H. (Aurora, IL)


    A cryogenic support member is comprised of a non-metallic rod having a depression in at least one end and a metallic end connection assembled to the rod. The metallic end connection comprises a metallic plug which conforms to the shape and is disposed in the depression and a metallic sleeve is disposed over the rod and plug. The plug and the sleeve are shrink-fitted to the depression in the rod to form a connection good in compression, tension and bending.

  10. Academy Member Annual Update Report 1Academy Member Update Report

    E-Print Network [OSTI]

    Academy Member Annual Update Report 1Academy Member Update Report The annual update report is an important activity associated with active membership in the Academy. These reports are due or call 504-568-2140 if you have other questions. Why an annual report? As an Academy member

  11. Melt containment member

    DOE Patents [OSTI]

    Rieken, Joel R.; Heidloff, Andrew J.


    A tubular melt containment member for transient containment of molten metals and alloys, especially reactive metals and alloys, includes a melt-contacting layer or region that comprises an oxygen-deficient rare earth oxide material that is less reactive as compared to the counterpart stoichiometric rare earth oxide. The oxygen-deficient (sub-stoichiometric) rare earth oxide can comprise oxygen-deficient yttria represented by Y.sub.2O.sub.3-x wherein x is from 0.01 to 0.1. Use of the oxygen-deficient rare earth oxide as the melt-contacting layer or region material reduces reaction with the melt for a given melt temperature and melt contact time.

  12. Rediness Review Team Member Training

    Broader source: (indexed) [DOE]

    MEMBER TRAINING Idaho National Engineering Laboratory Michael Hillman DOE HQ - HSS Idaho National Engineering Laboratory Dan M. Stover, PE Technical And Professional Services, Inc....

  13. Members

    Broader source: [DOE]

    Membership in the Consortium is open to municipalities, utilities, and energy efficiency organizations, with participation at various levels from other interested parties.

  14. Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighand Retrievals from aRod Eggert ImageMeetings

  15. Joseph M. Juran Team Members

    E-Print Network [OSTI]

    Vardeman, Stephen B.

    Joseph M. Juran I E 361 Fall 2002 Team Members: Dragui Nestorovic Gonzalo Rodriguez Monica Kroh Jaroslav Sebek #12;Introduction Joseph M. Juran has led a life of success and accomplishments. Using his. Background Joseph M. Juran was born in Brailia, Romania, during December of 1904. When Joseph was five years

  16. Member Benefits | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onYouTube YouTube Note: Since the.pdfBreaking ofOil & GasTechnicalMeeting with EarthJustice RegardingMember Benefits

  17. Faculty Member Complete the Paid Parental Leave

    E-Print Network [OSTI]

    Meyers, Steven D.

    Faculty Member Complete the Paid Parental Leave (PPL) Request Form Human Resources Evaluate determination notice to the employee with copies to the department Enroll faculty member in the PPL Leave Plan and endorse the faculty member's PPL Request Form Review contingency planning and forward supporting rationale

  18. Interagency Energy Management Task Force Members

    Broader source: [DOE]

    The Interagency Energy Management Task Force is led by the Federal Energy Management Program director. Members include energy and sustainability managers from federal agencies.

  19. Optimize Storage Placement in Sensor Bo Sheng, Member, IEEE, Qun Li, Member, IEEE, and Weizhen Mao, Member, IEEE

    E-Print Network [OSTI]

    Mao, Weizhen

    nodes with much larger permanent storage (e.g., flash memory) and more battery power can be deployed-by-hop relay of other sensor nodes, the problem of limited storage, com- munication capacity, and battery power1 Optimize Storage Placement in Sensor Networks Bo Sheng, Member, IEEE, Qun Li, Member, IEEE


    SciTech Connect (OSTI)

    Braverman, J.I.; Miller, C.A.; Ellingwood, B.R.; Naus, D.J.; Hofmayer, C.H.; Bezler, P.; Chang, T.Y.


    This paper describes the results of a study to evaluate, in probabilistic terms, the effects of age-related degradation on the structural performance of reinforced concrete members at nuclear power plants. The paper focuses on degradation of reinforced concrete flexural members and shear walls due to the loss of steel reinforcing area and loss of concrete area (cracking/spalling). Loss of steel area is typically caused by corrosion while cracking and spalling can be caused by corrosion of reinforcing steel, freeze-thaw, or aggressive chemical attack. Structural performance in the presence of uncertainties is depicted by a fragility (or conditional probability of failure). The effects of degradation on the fragility of reinforced concrete members are calculated to assess the potential significance of various levels of degradation. The fragility modeling procedures applied to degraded concrete members can be used to assess the effects of degradation on plant risk and can lead to the development of probability-based degradation acceptance limits.

  1. Elastomeric member for energy storage device

    DOE Patents [OSTI]

    Hoppie, Lyle O. (Birmingham, MI); Chute, Richard (Birmingham, MI)


    An energy storage device (10) is disclosed consisting of a stretched elongated elastomeric member (16), disposed within a tubular housing (14), which elastomeric member (16) is adapted to be torsionally stressed to store energy. The elastomeric member (16) is configured in the relaxed state with a uniform diameter body section, transition end sections, and is attached to rigid end piece assemblies (22, 24) of a lesser diameter. The profile and deflection characteristic of the transition sections (76, 78) are such that upon stretching of the member, a substantially uniform diameter assembly results to minimize the required volume of the surrounding housing (14). During manufacture, woven wire mesh sleeves (26, 28) are forced against a forming surface and bonded to the associated transition section (76, 78) to provide the correct profile and helix angle. Each sleeve (26, 28) contracts with the contraction of the associated transition section to maintain the bond therebetween.

  2. Wireless Technology in Industrial Networks Andreas Willig, Member, IEEE, Kirsten Matheus, Member, IEEE, Adam Wolisz, Senior

    E-Print Network [OSTI]

    Wichmann, Felix

    of existing wireless technologies for this specific field of applications, and iii) the creation of hybrid1 Wireless Technology in Industrial Networks Andreas Willig, Member, IEEE, Kirsten Matheus, Member), pp. 1130-1151 Abstract With the success of wireless technologies in consumer electronics, standard

  3. E cient Retiming of Large Circuits Naresh Maheshwari, Student Member, IEEE, and Sachin Sapatnekar, Member, IEEE

    E-Print Network [OSTI]

    Sapatnekar, Sachin

    , Member, IEEE Abstract| Retiming, introduced by Leiserson and Saxe, is a powerful transformation1 E cient Retiming of Large Circuits Naresh Maheshwari, Student Member, IEEE, and Sachin Sapatnekar not capable of handling large circuits in a reasonable time. This work de nes the relationship be- tween


    E-Print Network [OSTI]

    Sharma, Gaurav

    Color Imaging for Multimedia GAURAV SHARMA, MEMBER, IEEE, MICHAEL J. VRHEL, MEMBER, IEEE, AND H. JOEL TRUSSELL, FELLOW, IEEE To a significant degree, multimedia applications derive their effectiveness-based multimedia systems have grown from their humble beginnings into systems that truly allow the integration

  5. Security Games for Vehicular Networks Tansu Alpcan, Member, IEEE, and Sonja Buchegger, Member, IEEE

    E-Print Network [OSTI]

    Chen, Ing-Ray

    . The effectiveness of the security game solutions is evaluated numerically using realistic simulation data obtainedSecurity Games for Vehicular Networks Tansu Alpcan, Member, IEEE, and Sonja Buchegger, Member, IEEE Abstract--Vehicular networks (VANETs) can be used to improve transportation security, reliability

  6. Residential Network Members Impact More Than 42,000 Households...

    Energy Savers [EERE]

    Members Impact More Than 42,000 Households Photo of a row of townhomes. Eligible Better Buildings Residential Network members reported completing 27,563 home energy upgrades...

  7. Texas 4-H Member Achievement Plan

    E-Print Network [OSTI]

    Lepley, Toby


    The Member Achievement Plan (M.A.P.) provides 4-Hers with forms and journal pages to help them plan their 4-H projects, set goals and evaluate their accomplishments. Using this will help teach record-keeping skills. It is part of the new "For...

  8. Elastomeric member and method of manufacture therefor

    DOE Patents [OSTI]

    Hoppie, L.O.


    An energy storage device is disclosed consisting of a stretched elongated elastomeric member disposed within a tubular housing, which elastomeric member is adapted to be torsionally stressed to store energy. The elastomeric member is configured in the relaxed state with a uniform diameter body section, and transition end sections, attached to rigid end piece assemblies of a lesser diameter. The profile and deflection characteristic of the transition sections are such that upon stretching of the elastomeric member, a substantially uniform diameter assembly results, to minimize the required volume of the surrounding housing. Each of the transition sections are received within and bonded to a woven wire mesh sleeve having helical windings at a particular helix angle to control the deflection of the transition section. Each sleeve also contracts with the contraction of the associated transition section to maintain the bond therebetween. During manufacture, the sleeves are forced against a forming surface and bonded to the associated transition section to provide the correct profile and helix angle. 12 figs.

  9. Who are the members of the

    E-Print Network [OSTI]

    Baker, Chris I.

    are the members of your research team? The outcomes of clinical research affect much of adult who may not be Opportunities for research volunteers The NIH Clinical Center Volunteers FirstNews and Information from the NIH Clinical Research Volunteer Program Winter 2011 Dr. John I. Gallin, CC director (second, from left

  10. Balfour Library Guide Members of other

    E-Print Network [OSTI]

    Balfour Library Guide for Members of other Departments in the University (e.g. postgraduate, post times 3 Out of hours access 3 Contact details 3 Library facilities 3 Computers 3 Use of laptops, using LibrarySearch 6 Classification of books in the Balfour Library 6 Loan periods 7 Registration

  11. Elastomeric member and method of manufacture therefor

    DOE Patents [OSTI]

    Hoppie, Lyle O. (Birmingham, MI)


    An energy storage device (10) is disclosed consisting of a stretched elongated elastomeric member (16) disposed within a tubular housing (14), which elastomeric member (16) is adapted to be torsionally stressed to store energy. The elastomeric member (16) is configured in the relaxed state with a uniform diameter body section (74), and transition end sections (76, 78), attached to rigid end piece assemblies (22, 24) of a lesser diameter. The profile and deflection characteristic of the transition sections (76, 78) are such that upon stretching of the elastomeric member (16), a substantially uniform diameter assembly results, to minimize the required volume of the surrounding housing (14). Each of the transition sections (76, 78) are received within and bonded to a woven wire mesh sleeve (26, 28) having helical windings at a particular helix angle to control the deflection of the transition section. Each sleeve (26, 28) also contracts with the contraction of the associated transition section to maintain the bond therebetween. During manufacture, the sleeves (26, 28) are forced against a forming surface and bonded to the associated transition section (76, 78) to provide the correct profile and helix angle.

  12. Service Members Aim High-- for Energy Savings

    Broader source: [DOE]

    Service members are helping reduce our dependency on oil, and saving taxpayers' money, with their energy-saving efforts. Operation Change Out has cut $26.3 million in total energy costs and helped prevent more than 396 lbs. of carbon dioxide.

  13. Managed Lane Choices by Carpools Comprised of Family Members Compared to Non-family Members

    E-Print Network [OSTI]

    Pannu, Mandeep S.


    Turnbull Head of Department, Mark Burris December 2009 Major Subject: Civil Engineering iii ABSTRACT Managed Lane Choices by Carpools Comprised of Family Members Compared to Non- Family Members. (December 2009) Mandeep Singh Pannu, B..., Maryland; Boston; Minneapolis; New Jersey Turnpike; New York City; Portland; Ottawa, Ontario; Memphis; Nashville; Dallas; Northern Virginia; Norfolk/Virginia Beach; Seattle; Houston; and numerous California counties (HOV Systems Manual, 1998; Stockton...

  14. Approaches to Creating and Controlling Motion in MRI Gregory S. Fischer, Member, IEEE, Gregory Cole, Student Member, IEEE and Hao Su, Student Member, IEEE

    E-Print Network [OSTI]

    Camesano, Terri

    Approaches to Creating and Controlling Motion in MRI Gregory S. Fischer, Member, IEEE, Gregory Cole, Student Member, IEEE and Hao Su, Student Member, IEEE Abstract-- Magnetic Resonance Imaging (MRI) can is complicated by factors including: the high magnetic field strength, the requirement that such devices should

  15. On the Capacity of k-MPR Wireless Networks Ming-Fei Guo, Member, IEEE, Xinbing Wang, Member, IEEE, Min-You Wu, Senior Member, IEEE

    E-Print Network [OSTI]

    Wang, Xinbing

    1 On the Capacity of k-MPR Wireless Networks Ming-Fei Guo, Member, IEEE, Xinbing Wang, Member, IEEE, Min-You Wu, Senior Member, IEEE Abstract--The capacity of wireless ad hoc networks is mainly the capacity of 2-D wireless networks wherein each node can decode at most k simultaneous transmis- sions

  16. University of California, Davis Institutional Review Board Committee Members IRB Number or

    E-Print Network [OSTI]

    Schladow, S. Geoffrey

    ; Alternate Member D Scientific A; D Brian Gallay PhD, MD Scientific Affiliated Member A; Alternate Member D

  17. Theme 1 Members | Photosynthetic Antenna Research Center

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron Spin Transition in the Earth'sConnect,LLCStartup America1 Members

  18. Theme 2 Members | Photosynthetic Antenna Research Center

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron Spin Transition in the Earth'sConnect,LLCStartup America1 Members2

  19. Theme 3 Members | Photosynthetic Antenna Research Center

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron Spin Transition in the Earth'sConnect,LLCStartup America1 Members23

  20. Cumberland Elec Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are beingZealand JumpConceptual Model, clickInformationNew|CoreCpWing County,Electric Coop,Cumberland Elec Member

  1. Multiple capillary biochemical analyzer with barrier member

    DOE Patents [OSTI]

    Dovichi, N.J.; Zhang, J.Z.


    A multiple capillary biochemical analyzer is disclosed for sequencing DNA and performing other analyses, in which a set of capillaries extends from wells in a microtiter plate into a cuvette. In the cuvette the capillaries are held on fixed closely spaced centers by passing through a sandwich construction having a pair of metal shims which squeeze between them a rubber gasket, forming a leak proof seal for an interior chamber in which the capillary ends are positioned. Sheath fluid enters the chamber and entrains filament sample streams from the capillaries. The filament sample streams, and sheath fluid, flow through aligned holes in a barrier member spaced close to the capillary ends, into a collection chamber having a lower glass window. The filament streams are illuminated above the barrier member by a laser, causing them to fluoresce. The fluorescence is viewed end-on by a CCD camera chip located below the glass window. The arrangement ensures an equal optical path length from all fluorescing spots to the CCD chip and also blocks scattered fluorescence illumination, providing more uniform results and an improved signal-to-noise ratio. 12 figs.

  2. Multiple capillary biochemical analyzer with barrier member

    DOE Patents [OSTI]

    Dovichi, Norman J. (Edmonton, CA); Zhang, Jian Z. (Edmonton, CA)


    A multiple capillary biochemical analyzer for sequencing DNA and performing other analyses, in which a set of capillaries extends from wells in a microtiter plate into a cuvette. In the cuvette the capillaries are held on fixed closely spaced centers by passing through a sandwich construction having a pair of metal shims which squeeze between them a rubber gasket, forming a leak proof seal for an interior chamber in which the capillary ends are positioned. Sheath fluid enters the chamber and entrains filament sample streams from the capillaries. The filament sample streams, and sheath fluid, flow through aligned holes in a barrier member spaced close to the capillary ends, into a collection chamber having a lower glass window. The filament streams are illuminated above the barrier member by a laser, causing them to fluoresce. The fluorescence is viewed end-on by a CCD camera chip located below the glass window. The arrangement ensures an equal optical path length from all fluorescing spots to the CCD chip and also blocks scattered fluorescence illumination, providing more uniform results and an improved signal to noise ratio.

  3. Networking Call for Residential Network Members Peer Exchange...

    Energy Savers [EERE]

    Networking Call for Residential Network Members Peer Exchange Call Networking Call for Residential Network Members Peer Exchange Call March 12, 2015 12:30PM to 2:0...

  4. NEJC Board Member Receives 2015 National Planning Excellence Award

    Broader source: [DOE]

    National Environmental Justice Conference, Inc. Board of Directors Member Receives American Planning Association 2015 National Planning Excellence Award

  5. NOAA Committee Memberships, 2004-2008 Eddie N. Bernard, Member, NOAA Tsunami Program Team, 2005-present

    E-Print Network [OSTI]

    . Koehn, Member, NOAA Science, Technology, and Infusion Program Team, 2003-2005 Mark P. Koehn, Member


    E-Print Network [OSTI]

    Hua, Yingbo

    Blind System Identification KARIM ABED-MERAIM, WANZHI QIU, MEMBER, IEEE, AND YINGBO HUA, SENIOR MEMBER, IEEE Blind system identification (BSI) is a fundamental signal processing technology aimed applications such as mobile communications, speech reverberation cancellation, and blind image restoration

  7. Dual mode fuel injector with one piece needle valve member

    DOE Patents [OSTI]

    Lawrence, Keith E. (Peoria, IL); Hinrichsen, Michael H. (Goodfield, IL); Buckman, Colby (Bellville, MI)


    A fuel injector includes a homogenous charge nozzle outlet set and a conventional nozzle outlet set controlled respectively by inner and outer needle value members. The homogenous charged nozzle outlet set is defined by an outer needle value member that is moveably positioned in an injector body, which defines the conventional nozzle outlet set. The inner needle valve member is positioned in the outer needle valve member. The outer needle valve member is a piece component that includes at least one external guide surface, an external value surface and an internal valve seat.

  8. Mixed mode fuel injector with individually moveable needle valve members

    DOE Patents [OSTI]

    Stewart, Chris; Chockley, Scott A.; Ibrahim, Daniel R.; Lawrence, Keith; Tomaseki, Jay; Azam, Junru H.; Tian, Steven Ye; Shafer, Scott F.


    A fuel injector includes a homogenous charge nozzle outlet set and a conventional nozzle outlet set controlled respectively, by first and second needle valve members. One of the needle valve members moves to an open position while the other needle valve member remains stationary for a homogeneous charge injection event. The former needle valve member stays stationary while the other needle valve member moves to an open position for a conventional injection event. One of the needle valve members is at least partially positioned in the other needle valve member. Thus, the injector can perform homogeneous charge injection events, conventional injection events, or even a mixed mode having both types of injection events in a single engine cycle.

  9. 1 Member Raoul Adamchak University of California Davis Agriculture Lecture 2 Member Jeffrey Amthor US DOE, Climate and Environmental Sceiences Div Agriculture Room A

    E-Print Network [OSTI]

    Corr Archer Daniels Midland Co. Energy Lecture 3 Member Matthew Frome Solazyme Energy Room B 4 Member

  10. Testing and evaluation of grout repaired tubular members 

    E-Print Network [OSTI]

    Nunn, John Mansfield


    of Failed Weld Seam page 64 65 66 69 73 74 80 82 31 Ideahzed Tubular Dented Member for the Taby, Zhou, and the Parsanejad Methods. . . . . . . . . . . . . . , . 92 32 Dent Geometry for the Elhnas Method 96 33 Experimental Ultimate Capamty vs P... commonly used to repiur damaged tubular members. These include 1 ) welding a sleeve around the outside of the member in the location of the damage, 2 ) applying an externally grouted clamp, and 3 ) applying internal grout Ideally, the repair method...

  11. adult family members: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and Ecology Websites Summary: APPLICATION PACKAGE for Family Members 1 ACICISStudy Indonesia These guidelines contain information ONLY: ARRIVAL DATES ARE INFLEXIBLE. YOU MAY NOT...

  12. acylase family members: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and Ecology Websites Summary: APPLICATION PACKAGE for Family Members 1 ACICISStudy Indonesia These guidelines contain information ONLY: ARRIVAL DATES ARE INFLEXIBLE. YOU MAY NOT...

  13. Approved Members of the Indian Country Energy And Infrastructure...

    Broader source: (indexed) [DOE]

    INDIAN COUNTRY ENERGY AND INFRASTRUCTURE WORKING GROUP ICEIWG APPROVED MEMBERS Blue Lake Rancheria Jana Ganion, BLR Energy Director Confederated Tribes of the Warm Springs...

  14. White House Meeting Honors New Superior Energy Performance Members...

    Broader source: (indexed) [DOE]

    New Superior Energy Performance (SEP) members 3M Company, Cummins Inc., General Dynamics OTS, Nissan, Schneider Electric, and Volvo Group North America from industry, and the...

  15. auxiliary unit members: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    auxiliary microphones. This paper presents two approaches to compensate 183 Joseph M. Juran Team Members Mathematics Websites Summary: old his father left Romania and came to...

  16. California Member Connects Solar Adoption With Upgrades | Department...

    Broader source: (indexed) [DOE]

    Residential Network member Center for Sustainable Energy (CSE) in California are helping solar companies realize that partnering with local energy efficiency programs can help...

  17. GreenTouch Consortium Passes 50-Member Milestone, Adds Seven...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    will define them. The new members are: CommScopeAndrew - United States Energy Sciences Network (ESnet)Lawrence Berkeley National Laboratory - United States Korea Advanced...

  18. Petrogenesis of Valle Grande Member Rhyolites, Valles Caldera...

    Open Energy Info (EERE)

    of Valle Grande Member Rhyolites, Valles Caldera, New Mexico- Implications for Evolution of the Jemez Mountains Magmatic System Jump to: navigation, search OpenEI Reference...

  19. Colorado Forestry Advisory Board Members: Don Ament Tom Stone

    E-Print Network [OSTI]

    #12;Colorado Forestry Advisory Board Members: Don Ament Tom Stone Commissioner of Agriculture desired benefits? The members of Colorado's Forestry Advisory Board have presented this question, Colorado Forestry Advisory Board #12;2003 Report on the Health of Colorado's Forests 1 2003 Report

  20. Colorado Forestry Advisory Board Members: April 6, 2005

    E-Print Network [OSTI]

    #12;Colorado Forestry Advisory Board Members: April 6, 2005 The 2004 Report on the Health types that characterize Colora- do's unique landscapes. As members of the Colorado Forestry Advisory will motivate and inform your involvement. Sincerely, Nancy M. Fishering Chairperson, Colorado Forestry Advisory

  1. The 2014 SPECTRA Program Employer, Coach, Mentor or Community Member

    E-Print Network [OSTI]

    Kasman, Alex

    1 The 2014 SPECTRA Program Employer, Coach, Mentor or Community Member Recommendation Form #2 To the applicant Please complete the top section of this form and submit it to your employer, coach, mentor: _________________________________________________________________ Name of Employer, Coach, Mentor or Community Member completing this form

  2. UC Davis Personnel Policies for Staff Members Introduction

    E-Print Network [OSTI]

    Leistikow, Bruce N.

    Resources & Risk Management. Note 6--Distribution. Personnel Policies for Staff Members is a public documentUC Davis Personnel Policies for Staff Members Introduction Date: 6/3/02 Supersedes: New Responsible Department: Human Resources Source Document: UC Introduction 1 of 1 Note 1--Employment by Statute. A public

  3. Survey of Reactive Power Planning Methods Wenjuan Zhang, Student Member, IEEE, Leon M. Tolbert, Senior Member, IEEE

    E-Print Network [OSTI]

    Tolbert, Leon M.

    Survey of Reactive Power Planning Methods Wenjuan Zhang, Student Member, IEEE, Leon M. Tolbert, Senior Member, IEEE Abstract Reactive power planning (RPP) involves optimal allocation and determination to solve the RPP problem. Index Terms -- reactive power planning, reactive power optimization, optimal

  4. Clinical Education Award This award will be given to a member or members of the graduating class who

    E-Print Network [OSTI]

    Chisholm, Rex L.

    Clinical Education Award This award will be given to a member or members of the graduating class who demonstrate(s) superior clinical abilities. More than one student may qualify for this award this award must show excellence in clinical education based on all of the following accomplishments

  5. Energy-Aware MPEG-4 FGS Streaming Kihwan Choi, Member IEEE, Kwanho Kim, Member IEEE, and Massoud Pedram, Fellow IEEE

    E-Print Network [OSTI]

    Pedram, Massoud

    Energy-Aware MPEG-4 FGS Streaming Kihwan Choi, Member IEEE, Kwanho Kim, Member IEEE, and Massoud Pedram, Fellow IEEE Abstract -- In this paper, we propose an energy-aware MPEG-4 FGS video streaming 20% communication energy reduction at the client by making the MPEG-4 FGS streamer energy-aware

  6. On-Road Vehicle Detection: A Review Zehang Sun, Member, IEEE, George Bebis, Member, IEEE, and Ronald Miller

    E-Print Network [OSTI]

    Bebis, George

    On-Road Vehicle Detection: A Review Zehang Sun, Member, IEEE, George Bebis, Member, IEEE about driving environments, and possible collision with other vehicles has attracted a lot of attention lately. In these systems, robust and reliable vehicle detection is a critical step. This paper presents

  7. Method for brazing together planar and nonplanar metal members

    DOE Patents [OSTI]

    Hammersand, Fred G. (East Petersburg, PA); Witkowski, Anthony J. (Lancaster, PA)


    The invention relates to a method and apparatus for brazing two metal members together, at least one of which is nonplanar, in a brazing furnace using a substantially pure brazing material. The method comprises the steps of utilizing a brazing fixture to hold the two metal members in tangential relation to one another along a portion of each member so that a cavity is formed adjacent to the contacting portions. A braze material is then positioned within the cavity. The braze fixture, the metal members, and the braze material are then placed in a brazing furnace. A heat shield is then placed over the braze fixture, the metal members, and the braze material to shield the braze material from direct furnace radiation. The furnace temperature is linearly increased at a rate of about C. per hour until a temperature of C. is achieved. Heat is transferred by conduction from the metal members to the braze material to cause the braze material to melt. Some material from the metal members slowly diffuses into the braze material forming a braze joint. The furnace is rapidly cooled to room temperature using nitrogen gas. The brazed assemblies made according to this method are superior to assemblies formed by heliarc welding.

  8. Means to flexibly attach lens frames to temple members

    DOE Patents [OSTI]

    Smith, Harry D. (Richland, WA)


    The invention is a band hinge for flexibly connecting the temple member to the lens frame thereby preventing damage from inadvertent pressure or cyclic wear. A distinguishing feature of the invention is the use of a band hinge that holds together the temple member and the lens frame without the use of a pin or screw hinging mechanism. The invention allows for a high degree of freedom of movement for the temple member with respect to the lens frame which will prevent most forms of damages to the glasses from these types of events.

  9. Colorado Forestry Advisory Board Members: Don Ament Tom Stone

    E-Print Network [OSTI]

    #12;Colorado Forestry Advisory Board Members: Don Ament Tom Stone Commissioner of Agriculture As Chairperson of Colorado's newly created Forestry Advisory Board, I would like to thank you for taking the time

  10. Team 2 Inspection Josh Goss Team chair member

    E-Print Network [OSTI]

    Team 2 Inspection Josh Goss ­ Team chair member Capasso, Golovchenko, and Stubbs Lab We were very intensity of these light sources while configured in a typical experimental setup? Many thanks! Team 2 #12;

  11. Agricultural Engineering and Socio-Economics Division Field Contents Member

    E-Print Network [OSTI]

    Banbara, Mutsunori

    Agricultural Engineering and Socio-Economics Division Field Contents Member Environmental, H. Professor TADA,A.Associate Professor Geotechnical and Environmental Engineering for Agricultural for agricultural land and rural areas including bountiful beautiful nature; Geotechnical and environmental

  12. DOE appoints four new members to advisory board

    Broader source: [DOE]

    DOE has appointed four new members to its Environmental Management advisory board in Oak Ridge. Leon Baker, Richard Burroughs, Terri Likens and Ed Trujillo were introduced during the Oak Ridge Site Specific Advisory Board’s February meeting.

  13. Actuator assembly including a single axis of rotation locking member

    DOE Patents [OSTI]

    Quitmeyer, James N.; Benson, Dwayne M.; Geck, Kellan P.


    An actuator assembly including an actuator housing assembly and a single axis of rotation locking member fixedly attached to a portion of the actuator housing assembly and an external mounting structure. The single axis of rotation locking member restricting rotational movement of the actuator housing assembly about at least one axis. The single axis of rotation locking member is coupled at a first end to the actuator housing assembly about a Y axis and at a angle to an X and Z axis providing rotation of the actuator housing assembly about the Y axis. The single axis of rotation locking member is coupled at a second end to a mounting structure, and more particularly a mounting pin, about an X axis and at a angle to a Y and Z axis providing rotation of the actuator housing assembly about the X axis. The actuator assembly is thereby restricted from rotation about the Z axis.

  14. Accessibility of Computer Science: A Reflection for Faculty Members

    E-Print Network [OSTI]

    O'Leary, Dianne P.

    Accessibility of Computer Science: A Reflection for Faculty Members Dianne P. O'Leary http O'Leary. Copyright Dianne P. O'Leary, 1999 Version 1: June 1999 1 Picture Yourself: You are male

  15. Members' attainment of National FFA leadership and personal growth precepts

    E-Print Network [OSTI]

    Ambrose, Misty Jean


    MEMBERS' ATTAINMENT OF NATIONAL FFA LEADERSHIP AND PERSONAL GROWTH PRECEPTS A Thesis by MISTY JEAN AMBROSE Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree... of MASTER OF SCIENCE May 2002 Major Subject: Agricultural Education MEMBERS% ATTAINMENT OF NATIONAL FFA LEADERSHIP AND PERSONAL GROWTH PRECEPTS A Thesis by MISTY JEAN AMBROSE Submitted to Texas ARM University in partial fulfillment...

  16. Cost-effective Resource Provisioning for MapReduce in a Balaji Palanisamy, Member, IEEE, Aameek Singh, Member, IEEE Ling Liu, Senior Member, IEEE

    E-Print Network [OSTI]

    Liu, Ling

    some slack. By effectively multiplexing the available cloud resources among the jobs based on the job1 Cost-effective Resource Provisioning for MapReduce in a Cloud Balaji Palanisamy, Member, IEEE, unlike existing services that require customers to decide the resources to be used for the jobs, Cura

  17. On Fast Transmission Topology Control Heuristics Pablo A. Ruiz, Member, IEEE, Justin M. Foster, Student Member, IEEE, Aleksandr Rudkevich, Member, IEEE,

    E-Print Network [OSTI]

    Caramanis, Michael

    flow, renewable integra- tion. I. INTRODUCTION TRADITIONALLY, power system operational decision making1 On Fast Transmission Topology Control Heuristics Pablo A. Ruiz, Member, IEEE, Justin M. Foster the OPF problem accordingly. This paper discusses the inclusion of tractable dynamic transmission topol

  18. On the Power Management of Simultaneous Multithreading Ahmed Youssef, Student Member, IEEE, Mohamed Zahran, Senior Member, IEEE, Mohab Anis, Member, IEEE,

    E-Print Network [OSTI]

    Zahran, Mohamed M.

    1 On the Power Management of Simultaneous Multithreading Processors Ahmed Youssef, Student Member various workloads to assess their effectiveness in leakage power management. Results show that the dynamic to be re-assessed. There has been a large body of work in power-management and temperature aware computing

  19. Master Gardener Advisory Committee Members Ed Thralls Advisor Extension Agent

    E-Print Network [OSTI]

    Jawitz, James W.

    Master Gardener Advisory Committee Members 2014 Ed Thralls Advisor Extension Agent Pam Paisley Member Master Gardener Dailey Smith Member Master Gardener Regina Dunay Member Master Gardener Jennifer Helvenston Member

  20. Vibration dampener for dampening vibration of a tubular member

    DOE Patents [OSTI]

    Obermeyer, F.D.; Middlebrooks, W.B.; DeMario, E.E.


    Vibration dampener for dampening vibration of a tubular member, such as an instrumentation tube of the type found in nuclear reactor pressure vessels is disclosed. The instrumentation tube is received in an outer tubular member, such as a guide thimble tube. The vibration dampener comprises an annular sleeve which is attachable to the inside surface of the guide thimble tube and which is sized to surround the instrumentation tube. Dimples are attached to the interior wall of the sleeve for radially supporting the instrumentation tube. The wall of the sleeve has a flexible spring member, which is formed from the wall, disposed opposite the dimples for biasing the instrumentation tube into abutment with the dimples. Flow-induced vibration of the instrumentation tube will cause it to move out of contact with the dimples and further engage the spring member, which will flex a predetermined amount and exert a reactive force against the instrumentation tube to restrain its movement. The amount by which the spring member will flex is less than the unrestrained amplitude of vibration of the instrumentation tube. The reactive force exerted against the instrumentation tube will be sufficient to return it to its original axial position within the thimble tube. In this manner, vibration of the instrumentation tube is dampened so that in-core physics measurements are accurate and so that the instrumentation tube will not wear against the inside surface of the guide thimble tube. 14 figs.

  1. Exotensioned structural members with energy-absorbing effects

    DOE Patents [OSTI]

    Brockwell, Michael Ian


    Structural members having enhanced load bearing capacity per unit mass include a skeleton structure formed from strips of material. Notches may be placed on the strips and a weave of tensile material placed in the notches and woven around the skeleton structure. At least one pair of structural members can be jointed together to provide very strong joints due to a weave patterns of tensile material, such as Kevlar, that distributes stress throughout the structure, preventing stress from concentrating in one area. Methods of manufacturing such structural members include molding material into skeletons of desired cross section using a matrix of molding segments. Total catastrophic failures in composite materials are substantially avoided and the strength to weight ratio of structures can be increased.

  2. Members | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighand Retrievals from aRod Eggert ImageMeetings Members Michael J.Members

  3. Members | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighand Retrievals from aRod Eggert ImageMeetings Members MichaelMembers

  4. Members | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighand Retrievals from aRod Eggert ImageMeetings MembersMembers Nuclear


    E-Print Network [OSTI]

    RadioAstronomie Millimétrique, Institut de (IRAM)


  6. Nuclear Waste Technical Review Board Members Appendix A 53

    E-Print Network [OSTI]

    51 Appendix A Nuclear Waste Technical Review Board Members #12;#12;Appendix A 53 B. John Garrick, Ph.D., P.E. Chairman Dr. B. John Garrick was appointed to the U.S. Nuclear Waste Technical Review, on the U.S. Nuclear Regula- tory Commission's Advisory Committee on Nuclear Waste. His areas of expertise

  7. U.S. Nuclear Waste Technical Review Board Members

    E-Print Network [OSTI]

    Appendix A Appendix A U.S. Nuclear Waste Technical Review Board Members Jared L. Cohon, Ph.D.; Chairman On June 29, 1995, President Bill Clinton appointed Jared Cohon to the Nuclear Waste Technical, and Asia and on energy facil ity siting, including nuclear waste shipping and storage. In addition to his

  8. Fully Affiliated Members Aero/Astro Austin DiOrio

    E-Print Network [OSTI]

    Williams, Brian C.

    Fully Affiliated Members Aero/Astro Austin DiOrio Alpha Phi OmegaAPO Nicole Gagnier ARA Richard) Daniel Chavas East Campus Juliana Wu Eastgate Elliot Greenblatt Economics Dept. Kyle Greenberg Edgerton Center Chaithanya Bandi Parsons Benzhang Zhao Phi Beta Epsilon Daniel Ronde Phi Kappa Sigma (Skullhouse


    E-Print Network [OSTI]

    Oliver, Douglas L.

    TEAM AWARDS TEAM SUBMITTED BY ENDORSEMENT DATE AWARDED # OF MEMBERS Neuromuscular Team Deborah Feigenbaum ALS Association & Patients 9/17/2007 9 Affirmative Action Production Team Carolyn Lyle Susan Whetstone & Brian Eaton 4/17/2007 4 Labor & Delivery Team Samtha Angelini & Gwyn Muscillo Ellen Leone & Joan

  10. Team Member Guide

    E-Print Network [OSTI]

    Team Member Guide #12;2 Updated September 2012. Educational will be appointed as the Site Manager for Walk Across Texas. The Site Manager will find Team Captains. The Team Captains then recruit seven people for their team. Once teams of eight are formed, a AKick-Off@ event marks

  11. THE UNIVERSITY OF BRITISH COLUMBIA Curriculum Vitae for Faculty Members

    E-Print Network [OSTI]

    Karczmarek, Joanna

    THE UNIVERSITY OF BRITISH COLUMBIA Curriculum Vitae for Faculty Members Date: May 5. 2009 Initials-1980 University of British Columbia M Sc Physics 1980-1982 University of British Columbia Ph D Physics 1982 The University of British Columbia Study Leave 07/2007-06/2008 8. TEACHING (a) Areas of special interest

  12. Hybrid FRP/Concrete Structural Members and Sami Rizkalla

    E-Print Network [OSTI]

    with differentfiber orientations partially and/or totallyfilled with concrete. Hollow FRP and steel tubes were testedHybrid FRP/Concrete Structural Members Amir Fam1 and Sami Rizkalla 2 Department of Civil, highway overhead sign structures and bridges. The experimental program included testing to failure tubes

  13. Independent Scientific Advisory Board: Member Resume David P. Philipp

    E-Print Network [OSTI]

    Independent Scientific Advisory Board: Member Resume David P. Philipp Appointed to Board: 1999. Claussen, and D. P. Philipp. Effect of population size structure on reproductive investment of male bluegill. North American Journal of Fisheries Management 17: 516-524. 1997 Philipp, D. P., C. A. Toline, D

  14. Modal Analysis of Continuous Structrual System with Tapered Cantilevered Members

    E-Print Network [OSTI]

    Kim, Yoon Mo


    OF CONVENTIONAL CONTINUOUS SYSTEM ............ 9 2.1. Transverse Vibration in Conventional Continuous System Model .................... 9 2.2. Equation of Motion for Flexural Member .......................................................... 9 2.3 Boundary.......................................... 19 2.6 Conclusion ........................................................................................................ 20 3. MODAL ANALYSIS OF DISCRETIZED CONTINUOUS SYSTEM ............... 21 3.1. Transverse Vibration in Discretized Continuous...

  15. Dean's Leadership Circle 2011-2012 Annual Member Pledge Form

    E-Print Network [OSTI]

    Stanford, Kyle

    Dean's Leadership Circle 2011-2012 Annual Member Pledge Form For more information, contact Sandra Findly, Senior Director of Development Dean's Leadership Circle Fund 3048 Appeal Code: B1S40 MPAA Building, Suite 210, Irvine, CA 92697-3130 ­ Phone 949-824-8865 ­ Secure Fax 949-824-8866 ­ Email DeansLeadership

  16. Dean's Leadership Circle 2010-2011 Member Pledge Form

    E-Print Network [OSTI]

    Loudon, Catherine

    Dean's Leadership Circle 2010-2011 Member Pledge Form For more information, contact: SECURE FAX LINE: 949-824-8866 MPAA Building, Suite 210 Sandra Findly, Director, Dean's Leadership Circle Irvine, CA 92697-3130 (949) 824-8865 ­ DLC Fund 3048

  17. AQU 04 Portable Algae Flow Cytometer Team Members

    E-Print Network [OSTI]

    California at Los Angeles, University of

    AQU 04 Portable Algae Flow Cytometer Team Members · David Caron, Faculty · Han-Chieh Chang · Yu-Chong Tai, Faculty, PI* * Primary Contact Overview The portable algae flow cytometer is a project that aims to expedite research in algae biology using microfluid-based and state-of-the-art detection

  18. Work and Energy Simulation Name_______________________ Lab Worksheet Group member names__________________________________

    E-Print Network [OSTI]

    Winokur, Michael

    Work and Energy Simulation Name_______________________ Lab Worksheet Group member names://, in a browser and click on the Go to the simulations button. Open Work, Energy, and Power on the left. This lab uses three of the simulations on this page, Masses and Springs, Energy Skate Park, and The Ramp. I

  19. Change of Dissertation Adviser or Reading Committee Member Stanford University

    E-Print Network [OSTI]

    Ford, James

    Change of Dissertation Adviser or Reading Committee Member Stanford University Please address approval for a change of dissertation adviser, the addition or deletion of a doctoral dissertation reading of the dissertation. Policy: The reading committee must conform to University regulations at the time of degree

  20. Prescription Drug List --To be used by members

    E-Print Network [OSTI]

    Mullins, Dyche

    Prescription Program Drug List -- To be used by members (both National Accounts and Local Group), who have a tiered drug plan. Anthem Blue Cross prescription drug benefits include medications available on the Anthem Drug List. Our prescription drug benefits can offer potential savings when your

  1. Accessibility of Computer Science: A Reflection for Faculty Members

    E-Print Network [OSTI]

    O'Leary, Dianne P.

    Accessibility of Computer Science: A Reflection for Faculty Members Dianne P. O'Leary \\Lambda June. This document benefitted from helpful advice and references from Nora Sleumer and Timothy O'Leary. Copyright Dianne P. O'Leary, 1999 Version 1: June 1999 1 Picture Yourself: You are male, almost 20 years old, naive

  2. Supplemental Material of "Collaborative Mobile Sheng Zhang, Student Member, IEEE, Jie Wu, Fellow, IEEE, and Sanglu Lu, Member, IEEE

    E-Print Network [OSTI]

    Wu, Jie

    by induction on M. When M = 1 or M = 2, we can prove SolelyCharge is optimal using a similar method1 Supplemental Material of "Collaborative Mobile Charging" Sheng Zhang, Student Member, IEEE, Jie a sufficiently large WSN (X, Y, B, T) and a charging model (P, c, v, 1, 2), which satisfy conditions K1K2K3

  3. Standards-enabled Smart Grid for the Future Valeriy Vyatkin, Senior Member, IEEE, Gulnara Zhabelova, non-member,

    E-Print Network [OSTI]

    Ulieru, Mihaela

    1 Standards-enabled Smart Grid for the Future EnergyWeb Valeriy Vyatkin, Senior Member, IEEE for the Smart Grid is proposed which combines two recently developed industrial standards. The utility network that can be created using interoperable Smart Grid devices. Using Matlab-based simulation environment we

  4. EXIT Charts for Turbo Trellis Coded Modulation Hangjun Chen, Student Member, IEEE, and Alexander Haimovich, Senior Member, IEEE

    E-Print Network [OSTI]

    Haimovich, Alexander

    EXIT Charts for Turbo Trellis Coded Modulation Hangjun Chen, Student Member, IEEE, and Alexander information transfer charts (EXIT) method to the analysis of the convergence of turbo codes to turbo trellis can be used as a tool in the design of TTCM. Index Terms-- Turbo trellis coded modulation, convergence

  5. Intentional Islanded Operation of Converter Fed Microgrids Charles K. Sao, Student Member, IEEE, and Peter W. Lehn, Member, IEEE

    E-Print Network [OSTI]

    Lehn, Peter W.

    . INTRODUCTION Many new distributed power sources, such as wind turbine generators and fuel cells, do is determined by the reactive power balance. Such steady state relations have been identified in the literature, and Peter W. Lehn, Member, IEEE Abstract-- This paper develops a dynamic model of a converter fed is- landed

  6. Committees (present) Member of the national Topteam on Energy, Ministry of Economic Affairs, Agriculture and Innovation

    E-Print Network [OSTI]

    ) Member of the review committee CAREM nuclear reactor design, National Atomic Energy Commission Argentina

  7. Finally, the Academy has ac-cepted eleven new members, for a

    E-Print Network [OSTI]

    Finally, the Academy has ac- cepted eleven new members, for a total of 73 members. Please see of educators. If you are not already an Academy member, please consider submitting your application. A review of member- ship categories is on page 2 of this Academy Bulletin. Complete de- tails are on the Academy

  8. Method for making an elastomeric member with end pieces

    DOE Patents [OSTI]

    Hoppie, Lyle O. (Birmingham, MI); McNinch, Jr., Joseph H. (Livonia, MI); Nowell, Gregory C. (Livonia, MI)


    A molding process for molding an elongated elastomeric member (60) with wire mesh sleeves (16) bonded to the ends (14). A molding preform (10) of elastomeric material is positioned within a seamless mold cylinder (26), and the open ends of the wire mesh sleeves (16) are mounted to end plug assemblies (30) slidably received into the mold cylinder (26) and positioned against the ends (14) of the preform (10). A specialized profile is formed into surfaces (44) of the respective end plug assemblies (30) and by heating of the mold (26), the ends (14) of the elastomeric preform (10) are molded to the profile, as well as bonded to the reinforcing wire mesh sleeves (16). Vacuum is applied to the interior of the mold to draw outgassing vapors through relief spaces therethrough. The completed elastomeric member (60) is removed from the mold cylinder (26) by stretching, the consequent reduction in diameter enabling ready separation from the mold cylinder (26) and removal thereof.

  9. Turbine blade squealer tip rail with fence members

    DOE Patents [OSTI]

    Little, David A


    A turbine blade includes an airfoil, a blade tip section, a squealer tip rail, and a plurality of chordally spaced fence members. The blade tip section includes a blade tip floor located at an end of the airfoil distal from the root. The blade tip floor includes a pressure side and a suction side joined together at chordally spaced apart leading and trailing edges of the airfoil. The squealer tip rail extends radially outwardly from the blade tip floor adjacent to the suction side and extends from a first location adjacent to the airfoil trailing edge to a second location adjacent to the airfoil leading edge. The fence members are located between the airfoil leading and trailing edges and extend radially outwardly from the blade tip floor and axially from the squealer tip rail toward the pressure side.

  10. Cyclooctanoid Natural Products Synthesis of eight-membered ring

    E-Print Network [OSTI]

    Stoltz, Brian M.

    Cyclooctanoid Natural Products Synthesis of eight-membered ring containing terpenoids Chris Henry Stoltz Group Literature Presentation June 15th, 2008 147 Noyes, 8:00 PM O O H H H plagiospirolide E Group Literature Group Meeting 2 April 2007 HO H OH O Br H O H O H OH OH H H O OH O O H O OH H OHH O O H

  11. Evaluation of compression members with non-ideal end conditions

    E-Print Network [OSTI]

    Marek, David Leslie


    f/ cr effective connection restraint (k-in/rad), modulus of elasticity (ksi), yield stress of steel (ksi), ratio of stiffness (non-dimensional), moment of inertia about axis of buckling (in4), effective length factor (non-dimensional), length... of compression member (in), plastic moment capacity of the column (k-in), critical buckling load (kips) rotational stiffness of connection (k-in/rad), end restraint parameter (non-dimensional), buckling load parameter (non-dimensional), approximate function...

  12. Energy conversion device with support member having pore channels

    DOE Patents [OSTI]

    Routkevitch, Dmitri [Longmont, CO; Wind, Rikard A [Johnstown, CO


    Energy devices such as energy conversion devices and energy storage devices and methods for the manufacture of such devices. The devices include a support member having an array of pore channels having a small average pore channel diameter and having a pore channel length. Material layers that may include energy conversion materials and conductive materials are coaxially disposed within the pore channels to form material rods having a relatively small cross-section and a relatively long length. By varying the structure of the materials in the pore channels, various energy devices can be fabricated, such as photovoltaic (PV) devices, radiation detectors, capacitors, batteries and the like.

  13. Central Georgia El Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnual Siteof EnergyInnovation inOpenadd: China DatangCentral El tricaCentral Georgia El Member

  14. Niobrara Valley El Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnual SiteofEvaluatingGroup |JilinLuOpen EnergyNelsoniX LtdNewNingguoNiobrara Valley El Member Corp

  15. South River Elec Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving YouKizildere IRaghuraji Agro Industries Pvt LtdShawangunk, NewSingaporeSonixInformation ParkRiver Elec Member Corp Jump

  16. Joe Wheeler Elec Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnual SiteofEvaluatingGroup |Jilin Zhongdiantou New Energy Co LtdJinzhouJoe Wheeler Elec Member Corp

  17. Members | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighand Retrievals from aRod Eggert ImageMeetings Members Michael

  18. Members | U.S. DOE Office of Science (SC)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville PowerCherries 82981-1cnHighand Retrievals from aRod Eggert ImageMeetings Members

  19. Members | ANSER Center | Argonne-Northwestern National Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your Home andDispositionMechanicalAboutMembers Home >

  20. United Rural Elec Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnualProperty Edit withTianlin BaxinUmwelt Management AG UMaAG JumpEuropeUnited Rural Elec Member

  1. Tri-State Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving YouKizildere IRaghuraji Agro IndustriesTown of Ladoga, Indiana (UtilityTri-State Electric Member Corp Jump to: navigation,

  2. New York Network Members Join Forces to Create Green Jobs | Department...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    York Network Members Join Forces to Create Green Jobs New York Network Members Join Forces to Create Green Jobs Photo of a group of five people standing, looking at the camera....

  3. ORSSAB Member Greg Paulus Served His Country, Helped People with Disabilities

    Broader source: [DOE]

    ORSSAB member Greg Paulus is a Top Gun. He earned that distinction flying F4 fighters for the Air Force.

  4. 31320-2014-EN Member states -Service contract -Prior Information Notice -Not applicable 1/2

    E-Print Network [OSTI]

    Crowther, Paul

    OJ/S S20 29/01/2014 31320-2014-EN Member states - Service contract - Prior Information Notice - Not applicable 1/2 29/01/2014 S20 Member states - Service contract - Prior Information/S S20 29/01/2014 31320-2014-EN Member states - Service contract - Prior Information Notice

  5. Certification of Health Care Provider for Family Member's Serious Health Condition

    E-Print Network [OSTI]

    Myers, Lawrence C.

    Certification of Health Care Provider for Family Member's Serious Health Condition Family FMLA protections because of a need for leave to care for a covered family member with a serious health condition to submit a medical certification issued by the health care provider of the covered family member

  6. An investigation of buckling of compression members having initial curvature

    E-Print Network [OSTI]

    Robertson, Raymond Coy


    be solved as p &2EI Por= AL2 ~ Eq. 4 This equation is Euler's equation as it is known today, and in this form 1t is used as the basis for many column design formula. A discussion of the various forms of this equation may be found in any good book... distribution procedure are tabulated below. Member P (klps) kL SL/EI EI/1" S Sb 8, Sd BC CD 234 4. 74 W. 8064 2. 50 - 2. 02 -2. 02 0 4 0000 3, 75 15 F 00 15 F 00 15. 00 0 0 4. 0000 3, 33 13, 33 13. 00 13, 33 CF 585 5. 30 -3. 769 5. 00 -18. S6 -18. 86...

  7. Section 8 Termination of a Tenured Faculty Member and Procedures for Termination of a Tenured Faculty Member for Adequate Cause4

    E-Print Network [OSTI]

    Cui, Yan

    The appointment of a tenured faculty member may be terminated because of: (a) resignation; (b) retirement; (c be made early enough to obviate embarrassment or inconvenience to UTHSC. Faculty members who wish's Appointment Due to Retirement Policies and procedures governing retirement, including disability retirement

  8. Worker Safety and Security Teams Team Member Handbook

    SciTech Connect (OSTI)

    Sievers, Cindy S. [Los Alamos National Laboratory


    Worker Safety and Security Teams (WSSTs) are an effective way to promote safe workplaces. While WSSTs have a variety of structures and roles, they have one thing in common - employees and management collaborate to find ways to prevent accidents, injuries, and illnesses on the job. The benefits for all concerned are obvious in that employees have a safe place to work, employers save money on lost work time and workers compensation costs, and everyone returns home safe and healthy each day. A successful WSST will have the support and wholehearted participation of management and employees. LANL has a WSST at the institutional level (IWSST) and at all directorates and many divisions. The WSSTs are part of LANL's Voluntary Protection Program (VPP). The WSSTs meet at least monthly and follow an agenda covering topics such as safety shares, behavior based safety (BBS) observations, upcoming events or activities, issues, etc. A WSST can effectively influence safety programs and provide recommendations to managers, who have the resources and authority to implement changes in the workplace. WSSTs are effective because they combine the knowledge, expertise, perspective, enthusiasm, and effort of a variety of employees with diverse backgrounds. Those with experience in a specific job or work area know what the hazards or potential hazards are, and generally have ideas how to go about controlling them. Those who are less familiar with a job or area play a vital role too, by seeing what others may have overlooked or taken for granted. This booklet will cover the structure and operations of WSSTs, what needs to be done in order to be effective and successful, and how you can help, whether you're a WSST member or not.

  9. Multimodal Vessel Visualization of Mouse Aorta PET/CT Scans Timo Ropinski, Member, IEEE, Sven Hermann, Rainer Reich, Michael Schafers, and Klaus Hinrichs, Member, IEEE

    E-Print Network [OSTI]

    Hinrichs, Klaus

    Multimodal Vessel Visualization of Mouse Aorta PET/CT Scans Timo Ropinski, Member, IEEE, Sven present a visualization system for the visual analysis of PET/CT scans of aortic arches of mice

  10. Text-Alternative Version: MSSLC Member Case Studies- LED Street Lighting Programs Webinar

    Broader source: [DOE]

    Below is the text-alternative version of the "MSSLC Member Case Studies - LED Street Lighting Programs" webcast, held May 8, 2013.

  11. Committees per September 1, 2014 Member of the national advisory council for science, technology and innovation (AWTI) (August 2014

    E-Print Network [OSTI]

    committee CAREM nuclear reactor design, National Atomic Energy Commission Argentina (2011) · Member

  12. Condom attitudes, perceived vulnerability, and sexual risk behaviors of young Latino male urban street gang members: Implications for HIV prevention

    E-Print Network [OSTI]

    Brooks, RA; Lee, S-J; Stover, GN; Barkley Jr, TW


    78, Esbensen, F. , & Huizinga, D. (1993). Gangs, drugs, andgang members (Esbensen & Huizinga, 1993; Harper & Robinson,


    E-Print Network [OSTI]

    Laughlin, Robert B.


  14. TEAM MEMBERS INSPECTED LAB Oct 2014 Suhare Adam Greg Silverberg Cruft Lab

    E-Print Network [OSTI]

    INSPECTION TEAM TEAM CHAIR MEMBER TEAM MEMBERS INSPECTED LAB LOCATIONS LAB SAFETY OFFICERS TEAM 1 Oct 2014 Suhare Adam Greg Silverberg Cruft Lab Hau (Eric Brandin) Electronics Shop (Al Takeda) TEAM 2/Tamas Szalay) Capasso (Alan She) Stubbs (Peter Doherty) TEAM 3 Nov 2014 Mike Gerhardt Zach Gault Paul Loschak

  15. 04/2013 J-1 Suspension and Termination of Faculty Members

    E-Print Network [OSTI]

    Heller, Barbara

    04/2013 J-1 Appendix J Suspension and Termination of Faculty Members I. Introduction From time to time, a faculty member may be accused of conduct that may warrant suspension or termination term of appointment has engaged in conduct that may warrant suspension or termination, the appropriate

  16. LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile

    E-Print Network [OSTI]

    LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile Maria Weimer, M.D. Academy Fellow Assistant Professor of Clinical Neurology Department of Neurology School of Medicine Email with another Academy member of interactive cases that can be used with a variety of learners in a small group

  17. TIP Proposal Preparation Kit Exhibit 4. The NIST-1022A Form, "Other Joint Venture Members".

    E-Print Network [OSTI]

    Magee, Joseph W.

    TIP Proposal Preparation Kit 2010 61 Exhibit 4. The NIST-1022A Form, "Other Joint Venture Members to identify specific information on each joint venture member (exclud- ing the organization submitting in the organization to be contacted regarding technical portion of the proposal), and Congressional District (home

  18. Combustor with two stage primary fuel tube with concentric members and flow regulating

    DOE Patents [OSTI]

    Parker, David Marchant (Oviedo, FL); Whidden, Graydon Lane (Orlando, FL); Zolyomi, Wendel (Lawrenceville, GA)


    A combustor for a gas turbine having a centrally located fuel nozzle and inner, middle and outer concentric cylindrical liners, the inner liner enclosing a primary combustion zone. The combustor has an air inlet that forms two passages for pre-mixing primary fuel and air to be supplied to the primary combustion zone. Each of the pre-mixing passages has a circumferential array of swirl vanes. A plurality of primary fuel tube assemblies extend through both pre-mixing passages, with each primary fuel tube assembly located between a pair of swirl vanes. Each primary fuel tube assembly is comprised of two tubular members. The first member supplies fuel to the first pre-mixing passage, while the second member, which extends through the first member, supplies fuel to the second pre-mixing passage. An annular fuel manifold is divided into first and second chambers by a circumferentially extending baffle. The proximal end of the first member is attached to the manifold itself while the proximal end of the second member is attached to the baffle. The distal end of the first member is attached directly to the second member at around its mid-point. The inlets of the first and second members are in flow communication with the first and second manifold chambers, respectively. Control valves separately regulate the flow of fuel to the two chambers and, therefore, to the two members of the fuel tube assemblies, thereby allowing the flow of fuel to the first and second pre-mixing passages to be separately controlled.


    SciTech Connect (OSTI)

    Schlieder, Joshua E. [Max-Planck-Institut fuer Astronomie, Koenigstuhl 17, D-69117 Heidelberg (Germany); Lepine, Sebastien [Department of Astrophysics, American Museum of Natural History, Central Park West at 79th Street, New York, NY 10024 (United States); Simon, Michal, E-mail:, E-mail:, E-mail: [Department of Physics and Astronomy, Stony Brook University, Stony Brook, NY 11794 (United States)


    We present first results from follow-up of targets in the northern hemisphere {beta} Pictoris and AB Doradus moving group candidate list of Schlieder et al. We obtained high-resolution, near-infrared spectra of 27 candidate members to measure their radial velocities and confirm consistent group kinematics. We identify 15 candidates with consistent predicted and measured radial velocities, perform analyses of their six-dimensional (UVWXYZ) Galactic kinematics, and compare to known group member distributions. Based on these analyses, we propose that seven {beta} Pic and eight AB Dor candidates are likely new group members. Four of the likely new {beta} Pic stars are binaries, one a double-lined spectroscopic system. Three of the proposed AB Dor stars are binaries. Counting all binary components, we propose 22 likely members of these young, moving groups. The majority of the proposed members are M2 to M5 dwarfs, the earliest being of type K2. We also present preliminary parameters for the two new spectroscopic binaries identified in the data, the proposed {beta} Pic member and a rejected {beta} Pic candidate. Our candidate selection and follow-up has thus far identified more than 40 low-mass, likely members of these two moving groups. These stars provide a new sample of nearby, young targets for studies of local star formation, disks and exoplanets via direct imaging, and astrophysics in the low-mass regime.

  20. PWM Regenerative Rectifiers: State of the Art J. Rodriguez, Senior Member, IEEE, J. Dixon, J. Espinoza, Member, IEEE, and P. Lezana.

    E-Print Network [OSTI]

    Catholic University of Chile (Universidad Católica de Chile)

    frequency. The simplest line-commutated converters use diodes to trans- form the electrical energy from AC. Espinoza, Member, IEEE, and P. Lezana. Abstract-- New regulations impose more stringent limits to current with low switching frequency (line commutated) and other circuits which operate with high switching

  1. Semi-Blind Cancellation of IQ-Imbalances Matthias Hesse, Student Member, IEEE, Marko Mailand, Student Member, IEEE, Hans-Joachim Jentschel,

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Semi-Blind Cancellation of IQ-Imbalances Matthias Hesse, Student Member, IEEE, Marko Mailand iterative blind source separation (IBSS) as well as information about the modulation scheme used (hence the term semi-blind). The novelty of our approach lies in the fact that we match the nonlinearity involved

  2. A Gas-Actuated Anthropomorphic Transhumeral Prosthesis Kevin B. Fite, Member, IEEE, Thomas J. Withrow, Keith W. Wait, and Michael Goldfarb, Member,

    E-Print Network [OSTI]

    A Gas-Actuated Anthropomorphic Transhumeral Prosthesis Kevin B. Fite, Member, IEEE, Thomas J of an anthropomorphic 21 degree-of-freedom, 9 degree-of-actuation arm prosthesis for use by transhumeral amputees to obtain a self-powered dexterous prosthesis in which all of the requisite power, actuation, and sensing

  3. Smart Grid The New and Improved Power Grid: A Survey Xi Fang, Student Member, IEEE, Satyajayant Misra, Member, IEEE, Guoliang Xue, Fellow, IEEE,

    E-Print Network [OSTI]

    Misra, Satyajayant

    Smart Grid ­ The New and Improved Power Grid: A Survey Xi Fang, Student Member, IEEE, Satyajayant--The Smart Grid, regarded as the next generation power grid, uses two-way flows of electricity the literature till 2011 on the enabling technologies for the Smart Grid. We explore three major systems, namely

  4. Nonlinear Observer Design for Interconnected Power Systems M. A. Mahmud, Student Member, IEEE, M. J. Hossain, Member, IEEE, and H. R. Pota

    E-Print Network [OSTI]

    Pota, Himanshu Roy

    Nonlinear Observer Design for Interconnected Power Systems M. A. Mahmud, Student Member, IEEE, M. J design method for interconnected power systems. The concepts of nonlinear coordinate transformation, Lie derivative, and relative degree are used to design the observer for power systems. In this proposed design

  5. CalCc CONCEPT ApPLIED TO COMPRESSION OF PEAT3 Discussion by G. Mesri,4 Member, ASCE, T. D. Stark,' Associate Member, ASCE,

    E-Print Network [OSTI]

    CalCc CONCEPT ApPLIED TO COMPRESSION OF PEAT3 Discussion by G. Mesri,4 Member, ASCE, T. D. Stark of natural materials, including peats. organic silts, highly sensitive clays, shales, as well as granular this statement and credit Mesri and Castro (1987) for reporting a C)Cc range of 0.02-0.10 for peats. Ac tually

  6. CASAS: A Smart Home in a Box Diane J. Cook, IEEE Fellow, Aaron S. Crandall, IEEE Member, Brian L. Thomas, IEEE Member,

    E-Print Network [OSTI]

    Cook, Diane J.

    CASAS: A Smart Home in a Box Diane J. Cook, IEEE Fellow, Aaron S. Crandall, IEEE Member, Brian L,acrandal,bthomas,ckn} Abstract. While the potential benefits of smart home technology are widely recognized, a lightweight design is needed for the benefits to be realized at a large scale. We introduce the CASAS "smart home in a box

  7. Member Case Studies: LED Street Lighting Programs in Algona (IA), Asheville (NC), and Boston (MA)

    Broader source: [DOE]

    This May 8, 2013 webcast featured presentations from DOE Municipal Solid-State Street Lighting Consortium member cities about their experiences with LED street lighting. Presenters John Bilsten of...

  8. Improved age control on early Homo fossils from the upper Burgi Member at Koobi Fora, Kenya

    E-Print Network [OSTI]

    Utrecht, Universiteit

    Improved age control on early Homo fossils from the upper Burgi Member at Koobi Fora, Kenya in Areas 105 and 131 on the Karari Ridge in the eastern Turkana Basin (Kenya). We identify the base

  9. Improved age control on early Homo fossils from the upper Burgi Member at Koobi Fora, Kenya

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1 Improved age control on early Homo fossils from the upper Burgi Member at Koobi Fora, Kenya in Areas 105 and 131 on the Karari Ridge in the eastern Turkana Basin (Kenya). We identify the base

  10. A fracture-based approach to understanding debonding in FRP bonded structural members

    E-Print Network [OSTI]

    GüneÅŸ , OÄŸ uz, 1971-


    (cont.) members. The experimental program for RC beams involves qualitative and quantitative observation of the changes in the debonding behavior and load capacity of the beams with various configurations of shear and/or ...

  11. A novel engineering tool for thermal analysis of structural members in natural fires 

    E-Print Network [OSTI]

    Liang, Hong; Welch, Stephen

    of semi-empirical methods and detailed numerical heat transfer approaches, in order to give solutions of sufficient accuracy for structural members in a generalised fashion, the novel methodology has been developed as an essentially 1D heat transfer model...

  12. Development of an engineering methodology for thermal analysis of protected structural members in fire 

    E-Print Network [OSTI]

    Liang, Hong; Welch, Stephen

    In order to overcome the limitations of existing methodologies for thermal analysis of protected structural members in fire, a novel CFD-based methodology has been developed. This is a generalised quasi- 3D approach with ...

  13. Chemistry Research Projects Available to Undergraduates Consult Individual Faculty Members' Web Sites for More Details

    E-Print Network [OSTI]

    Crawford, T. Daniel

    . · Applications to solar energy conversion or electrocatalysis. · Design and synthesis of mixedmetal and photochemical energy storage. · Particular emphasis is placed on probing the propertiesChemistry Research Projects Available to Undergraduates Consult Individual Faculty Members' Web

  14. Collective guilt for harming future ingroup members: The case of American identity and global warming

    E-Print Network [OSTI]

    Ferguson, Mark Allen


    members on willingness to engage in behaviors that mitigate global warming. An experimental study extended these results by showing similar effects for actual behavior and pro-environmental attitudes. A final experiment extended the other studies...

  15. Terry sandstone member of the Pierre Shale, Upper Cretaceous, Spindle field, Denver Basin, Colorado 

    E-Print Network [OSTI]

    Helsley, Robert James


    TERRY SANDSTONE MEMBER OF THE PIERRE SHALE, UPPER CRETACEOUS, SPINDLE FIELD, DENVER BASIN, COLORADO A Thesis by ROBERT JAMES HELSLEY Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirement... for the degree of MASTER OF SCIENCE August 1985 Major Subject: Geology TERRY SANDSTONE MEMBER OF THE PIERRE SHALE, UPPER CRETACEOUS, SPINDLE FIELD, DENVER BASIN, COLORADO A Thesis by ROBERT JAMES HELSLEY Approved as to style and content by: R. R. Berg...

  16. An investigation of torsional design procedures applied to lightweight concrete members

    E-Print Network [OSTI]

    Tanner, Richard Bertrand


    AN INVESTIGATION OF TORSIONAL DESIGN PROCEDURES APPLIED TO LIGHTWEIGHT CONCRETE MEMBERS A Thesis By Richard Bertrand Tanner Submitted to the Graduate School of the Agricultural and Mechanical College of Texas in partial fulfillment... of the requirements for the degree of MASTER OF SCIENCE January f96Z Major Subject: Civil Engineering AN INVESTIGATION OF TORSIONAL DESIGN PROCEDURES APPLIED TO LIGHTWEIGHT CONCRETE MEMBERS A Thesis By Richard Bertrand Tanner Approved as to style and content...

  17. The transfer of training and skills by Texas State 4-H Council members: A qualitative study

    E-Print Network [OSTI]

    Bruce, Jacklyn Antoinette


    THE TRANSFER OF TRAINING AND SKILLS BY TEXAS STATE 4-H COUNCIL MEMBERS: A QUALITATIVE STUDY A Dissertation by JACKLYN ANTOINETTE BRUCE Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment... of the requirements for the degree of DOCTOR OF PHILOSOPHY May 2003 Major Subject: Agricultural Education THE TRANSFER OF TRAINING AND SKILLS BY TEXAS STATE 4-H COUNCIL MEMBERS: A QUALITATIVE STUDY A Dissertation by JACKLYN ANTOINETTE BRUCE...

  18. Trace fossils of Fort Hays Limestone Member of Niobrara Chalk (Upper Cretaceous), west-central Kansas

    E-Print Network [OSTI]

    Frey, R. W.



  19. Abstract: With power market deregulation, member companies cooperate to share one whole grid system and try to achieve their

    E-Print Network [OSTI]

    1 Abstract: With power market deregulation, member companies cooperate to share one whole grid, in a deregulated environment, no single company owns the whole system. There are multiple member companies who must

  20. Council Resolution concerning the admission of the Islamic Republic of Pakistan as Associate Member State at CERN

    E-Print Network [OSTI]


    Council Resolution concerning the admission of the Islamic Republic of Pakistan as Associate Member State at CERN

  1. New MAFAC Member from Hawaii Appointed (April 22, 2013) Acting Secretary of Commerce Rebecca Blank has appointed John Corbin of

    E-Print Network [OSTI]

    is in tropical island and ocean thermal energy conversion (OTEC) aquaculture. He is a member of the American

  2. Sedimentary and faunal analysis of a marginal marine section, the Stone City Member (middle eocene), Crockett Formation, Burleson County, Texas

    E-Print Network [OSTI]

    Nelms, Katherine Currier


    partial fulf1llment of the requirement for the degree of MASTER OF SCIENCE December 1979 Major Subiect: Geology SEDIMENTARY AND FAUNAL ANALYSIS OF A MARGINAL MARINE SECTION, THE STONE CITY MEMBER (MIDDLE EOCENE), CROCKETT FORMATION, BURLESON COUNTY..., TEXAS A Thesis by KATHERINE CURRIER NELMS Approved as to style and content by: Chairman Cemmittek Head of par ment Member Member December 1979 ABSTRACT SEDIMENTARY AND FAUNAL ANALYSIS OF A MARGINAL MARINE SECTION, THE STONE CITY MEMBER (MIDDLE...

  3. Surface--micromachined rotatable member having a low-contact-area hub

    SciTech Connect (OSTI)

    Rodgers, M. Steven (Albuquerque, NM); Sniegowski, Jeffry J. (Edgewood, NM)


    A surface-micromachined rotatable member formed on a substrate and a method for manufacturing thereof are disclosed. The surface-micromachined rotatable member, which can be a gear or a rotary stage, has a central hub, and an annulus connected to the central hub by an overarching bridge. The hub includes a stationary axle support attached to the substrate and surrounding an axle. The axle is retained within the axle support with an air-gap spacing therebetween of generally 0.3 .mu.m or less. The rotatable member can be formed by alternately depositing and patterning layers of a semiconductor (e.g. polysilicon or a silicon-germanium alloy) and a sacrificial material and then removing the sacrificial material, at least in part. The present invention has applications for forming micromechanical or microelectromechanical devices requiring lower actuation forces, and providing improved reliability.

  4. Surface-micromachined rotatable member having a low-contact-area hub

    SciTech Connect (OSTI)

    Rodgers, M. Steven; Sniegowski, Jeffry J.; Krygowski, Thomas W.


    A surface-micromachined rotatable member formed on a substrate and a method for manufacturing thereof are disclosed. The surface-micromachined rotatable member, which can be a gear or a rotary stage, has a central hub, and an annulus connected to the central hub by an overarching bridge. The hub includes a stationary axle support attached to the substrate and surrounding an axle. The axle is retained within the axle support with an air-gap spacing therebetween of generally 0.3 .mu.m or less. The rotatable member can be formed by alternately depositing and patterning layers of a semiconductor (e.g. polysilicon or a silicon-germanium alloy) and a sacrificial material and then removing the sacrificial material, at least in part. The present invention has applications for forming micromechanical or microelectromechanical devices requiring lower actuation forces, and providing improved reliability.

  5. Ultrasonic thickness measurements on corroded steel members: a statistical analysis of error

    E-Print Network [OSTI]

    Konen, Keith Forman


    of the Journal of Structural Engineering, ASCE. This study is the first phase of a joint industry project (JIP) that is funded by the Mineral Management Service of the Department of the Interior, Shell Deepwater Development, Inc. , and Mobil Technology Company... to the numbering system used in the 1989 JIP. Note that not all members were used in this particular study. TABLE 5. 1. Description of specimens Member 10 15 16 Diameter (in) 12. 75 12. 50 12. 75 20. 00 16. 00 14. 00 14. 00 Wall Thickness (in) 0...

  6. Diagenesis of the Terry sandstone member of the Pierre Shale, Spindle field, Weld County, Colorado 

    E-Print Network [OSTI]

    Hays, Phillip Dean


    DIAGENESIS OF THE TERRY SANDSTONE MEMBER OF THE PIERRE SHALE, SPINDLE FIELD, WELD COUNTY, COLORADO A Thesis PHILLIP DEAN HAYS Submitted to the Gradute College of Texas A&M University in partial fulfillment of the requirements for the degree... of MASTER OF SCIENCE August 1986 Major Subject: Geology DIAGNESIS OF THE TERRY SANDSTONE MEMBER OF THE PIERRE SHALE ~ SP INDLE F I ELD ~ WELD COUNTY ~ COLORADO A Thesis by PHILLIP DEAN HAYS Approved as to style and content by: -, ~jD Thomas T...

  7. Diagenesis of the Terry sandstone member of the Pierre Shale, Spindle field, Weld County, Colorado

    E-Print Network [OSTI]

    Hays, Phillip Dean


    DIAGENESIS OF THE TERRY SANDSTONE MEMBER OF THE PIERRE SHALE, SPINDLE FIELD, WELD COUNTY, COLORADO A Thesis PHILLIP DEAN HAYS Submitted to the Gradute College of Texas A&M University in partial fulfillment of the requirements for the degree... of MASTER OF SCIENCE August 1986 Major Subject: Geology DIAGNESIS OF THE TERRY SANDSTONE MEMBER OF THE PIERRE SHALE ~ SP INDLE F I ELD ~ WELD COUNTY ~ COLORADO A Thesis by PHILLIP DEAN HAYS Approved as to style and content by: -, ~jD Thomas T...

  8. Automatically Identifying Groups Based on Content and Collective Behavioral Patterns of Group Members

    SciTech Connect (OSTI)

    Gregory, Michelle L.; Engel, David W.; Bell, Eric B.; Piatt, Andrew W.; Dowson, Scott T.; Cowell, Andrew J.


    Online communities, or groups, have largely been defined based on links, page rank, and eigenvalues. In this paper we explore identifying abstract groups, groups where member's interests and online footprints are similar but they are not necessarily connected to one another explicitly. We use a combination of structural information and content information from posts and their comments to build a footprint for groups. We find that these variables do a good job at identifying groups, placing members within a group, and help determine the appropriate granularity for group boundaries.

  9. Instrument effects in polarized infrared images Joseph A. Shaw, MEMBER SPIE

    E-Print Network [OSTI]

    Shaw, Joseph A.

    Instrument effects in polarized infrared images Joseph A. Shaw, MEMBER SPIE NOAA Environmental and fric- tional heating of the polarizer mount. Our model shows that the two surfaces of a wire uncertainties less than 1%. Subject terms: infrared polarization; thermal imaging; remote sensing. Optica

  10. A NonFunctional Approach to System Integrity Simon N. Foley, Member, IEEE

    E-Print Network [OSTI]

    Foley, Simon

    , Protocols, Reliability, Software verification and validation, System analysis and design. I. INTRODUCTION1 A Non­Functional Approach to System Integrity Simon N. Foley, Member, IEEE Abstract effectiveness is justified more on the basis of experience and ``best practice'', rather than on any common

  11. Poison hemlock, Conium maculatum, (Figure 1) is a member of the plant

    E-Print Network [OSTI]

    Ishida, Yuko

    Poison hemlock, Conium maculatum, (Figure 1) is a member of the plant family Apiaceae, which, cilantro, chervil, fen- nel, anise, dill, and caraway. It is a tall, invasive, highly poisonous weed that is sometimes mistaken for one of its crop relatives. Poison hemlock was introduced from Europe as an ornamental

  12. Incorporation of Multi-Member Substructure Capabilities in FAST for Analysis of Offshore Wind Turbines: Preprint

    SciTech Connect (OSTI)

    Song, H.; Robertson, A.; Jonkman, J.; Sewell, D.


    FAST, developed by the National Renewable Energy Laboratory (NREL), is an aero-hydro-servo-elastic tool widely used for analyzing onshore and offshore wind turbines. This paper discusses recent modifications made to FAST to enable the examination of offshore wind turbines with fixed-bottom, multi-member support structures (which are commonly used in transitional-depth waters).; This paper addresses the methods used for incorporating the hydrostatic and hydrodynamic loading on multi-member structures in FAST through its hydronamic loading module, HydroDyn. Modeling of the hydrodynamic loads was accomplished through the incorporation of Morison and buoyancy loads on the support structures. Issues addressed include how to model loads at the joints of intersecting members and on tapered and tilted members of the support structure. Three example structures are modeled to test and verify the solutions generated by the modifications to HydroDyn, including a monopile, tripod, and jacket structure. Verification is achieved through comparison of the results to a computational fluid dynamics (CFD)-derived solution using the commercial software tool STAR-CCM+.

  13. Eos,Vol. 85, No. 46, 16 November 2004 use among European Union (EU) member

    E-Print Network [OSTI]

    Wang, Chunzai

    Eos,Vol. 85, No. 46, 16 November 2004 use among European Union (EU) member states applications of the atlas contents should have no problem doing so. The price of the atlas is a hefty $310 the substantial amount of information contained within the atlas,the price represents a good value,and university

  14. Environmental Policy The Royal College of Art educates 850 students and employs 350 members of

    E-Print Network [OSTI]

    Subramanian, Sriram

    . It recognises responsibilities to reduce the environmental impact of its activities and is committed to improve! Environmental Policy The Royal College of Art educates 850 students and employs 350 members exceeding environmental legislative and other requirements. · Preventing pollution by managing and reducing

  15. Layers for Effective Volume Rendering Sundaresan Raman, Oleg Mishchenko, and Roger Crawfis, Member, IEEE Computer Society

    E-Print Network [OSTI]

    Crawfis, Roger

    Layers for Effective Volume Rendering Sundaresan Raman, Oleg Mishchenko, and Roger Crawfis, Member, IEEE Computer Society Abstract--A multi-layer volume rendering framework is presented. The final image is obtained by compositing a number of renderings, each being represented as a separate layer. This layer


    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    and energy policy; National Renewable Action Plans (NREAPs); environmental federalism; mitigation scenarios energies in the official National Renewable Energy Action Plans (NREAPs) (EEA, 2012). In 2011, the EuropeanTRANSFORMING THE EUROPEAN ENERGY SYSTEM: MEMBER STATES' PROSPECTS WITHIN THE EU FRAMEWORK BRIGITTE

  17. *Staff Member Last Update: 9/17/13 Art Education, Studio Foundations AEF

    E-Print Network [OSTI]

    Arnold, Jonathan

    *Staff Member Last Update: 9/17/13 KEY: Art Education, Studio Foundations AEF Art History AH;Last Updated 9/17/13 COMPUTER COMMITTEE/ VISUAL RESOURCE CTR Committee Elects Chair Thom Houser, Chair Geha Nell Andrew Alex Murawski #12;Last Updated 9/17/13 PORTFOLIO REVIEW Appointed by Area Chairs Asen


    SciTech Connect (OSTI)

    Rice, Emily L.; Faherty, Jacqueline K.; Cruz, Kelle L., E-mail: erice@amnh.or [Department of Astrophysics, American Museum of Natural History, New York, NY 10024 (United States)


    We present spectral and kinematic evidence that 2MASS J06085283-2753583 (M8.5{gamma}) is a member of the {beta} Pictoris Moving Group (BPMG, age {approx}12 Myr), making it the latest-type known member of this young, nearby association. We confirm low-gravity spectral morphology at both medium and high resolutions in the near-infrared. We present new radial velocity and proper motion measurements, and use these to calculate galactic location and space motion consistent with other high-probability members of the BPMG. The predicted mass range consistent with the object's effective temperature, surface gravity, spectral type, and age is 15-35 M {sub Jup}, placing 2MASS 0608-27 well within the brown dwarf mass regime. 2MASS J06085283-2753583 is thus confidently added to the short list of very low mass, intermediate age benchmark objects that inform ongoing searches for the lowest-mass members of nearby young associations.

  19. LEAF Outreach Team Members Needed! Description: The Office of Sustainability seeks an intern to support

    E-Print Network [OSTI]

    Hill, Wendell T.

    LEAF Outreach Team Members Needed! Description: The Office of Sustainability seeks an intern to support the implementation of the LEAF Outreach Team at the University of Maryland. LEAF is an acronym Outreach Team. You'll be working with a dedicated and knowledgeable team working to effect positive change

  20. MEMORANDUM 2013/14-17 To: Members of the Department of Materials Science and Engineering

    E-Print Network [OSTI]

    Prodiæ, Aleksandar

    MEMORANDUM 2013/14-17 To: Members of the Department of Materials Science and Engineering Chairs of the Department of Materials Science and Engineering (MSE) for a second five-year term beginning July 1, 2014. Jun of Materials Science and Engineering Professor Uwe Erb, Department of Materials Science and Engineering

  1. CONTAM 01 MultiScale Soil Sensor Network in Support of Groundwater Quality Team Members

    E-Print Network [OSTI]

    California at Los Angeles, University of

    CONTAM 01 MultiScale Soil Sensor Network in Support of Groundwater Quality Protection Team Members of the ongoing CENS investigation into reclaimed wastewater infiltration into shallow soils and groundwater recharge. Groundwater resources are typically over-drafted during dry periods in arid and semi

  2. Make your 24/7 resource for health plan information Anthem members

    E-Print Network [OSTI]

    health care -- from doctors to dollars You should have the power to select your doctors, find the best prices on what you pay for health care services and choose how you get your health care informationMake your 24/7 resource for health plan information Anthem members: Currently registered

  3. A Nominal Filter for Web Search Snippets: Using the Web to Identify Members of Latin

    E-Print Network [OSTI]

    Turner, William

    A Nominal Filter for Web Search Snippets: Using the Web to Identify Members of Latin America. This paper presents efforts aimed at using Natural Language Engineering (NLE) techniques to solve of three Latin American countries: Uruguay, Argentina and Colombia. An NLE system is under construction


    E-Print Network [OSTI]

    Toole, T. Michael

    page 1 INFORMATION TECHNOLOGY INNOVATION: A VIEW OF LARGE CONTRACTORS1 T. Michael Toole, Member of technological innovations is whether diffusion is driven more by technology-push than by demand-pull mechanisms is to broaden the perspective on information technology (IT) innovation presented here at the congress

  5. Sam Houston State University A Member of The Texas State University System

    E-Print Network [OSTI]

    Short, Jon W.

    Sam Houston State University A Member of The Texas State University System Information Resources FO-IR-02 SHSU Web Accessibility Sam Houston State University is committed to making all official, academic for images aiding users who listen to the content of the site by using a screen reader, rather than reading

  6. MEMORANDUM 2013/14-11 To: Members of the Department of Mechanical and Industrial Engineering

    E-Print Network [OSTI]

    Prodiæ, Aleksandar

    MEMORANDUM 2013/14-11 To: Members of the Department of Mechanical and Industrial Engineering Chairs and Industrial Engineering I am very pleased to announce the re-appointment of Professor Jean Zu as Chair of the Department of Mechanical and Industrial Engineering (MIE) for a second five-year term beginning July 1, 2014

  7. Date: April 18, 2011 To: All current and future members of the Retirement Plan

    E-Print Network [OSTI]

    Date: April 18, 2011 To: All current and future members of the Retirement Plan From: Betsy Springer of this month and in early May. The dates of these sessions will be provided soon. Summary Analysis of the Carleton University Retirement Plan ("the Plan") shows that Carleton University ("the University") faces

  8. Optimal Demand Bidding for Time-Shiftable Loads Hamed Mohsenian-Rad, Senior Member, IEEE

    E-Print Network [OSTI]

    Mohsenian-Rad, Hamed

    -ahead market, real-time market, demand side management, multi-stage stochastic optimization, closed1 Optimal Demand Bidding for Time-Shiftable Loads Hamed Mohsenian-Rad, Senior Member, IEEE Abstract and enhancing demand response and peak-load shaving programs. In this paper, we seek to answer the following


    E-Print Network [OSTI]

    Painter, Kevin

    appointments Other - Mitra Energy - Mitra Energy Mr Andrew Milligan Head of Global Strategy Standard Life - Pension trustee Director Molson Coors Brewing Company UK Executive team member to Wealth International TD-Principal Heriot-Watt University Occasional consulting work, mostly for the EPSRC and Technology Strategy Board

  10. Single-Electron Devices and Their Applications KONSTANTIN K. LIKHAREV, MEMBER, IEEE

    E-Print Network [OSTI]

    Single-Electron Devices and Their Applications KONSTANTIN K. LIKHAREV, MEMBER, IEEE Invited Paper The goal of this paper is to review in brief the basic physics of single-electron devices, as well. Several other applications of analog single-electron devices in unique scientific instrumentation

  11. Texas and Southwestern Cattle Raisers Association Members' Agricultral Vulnerability Perceptions and Preparedness

    E-Print Network [OSTI]

    Allen, Patrick


    (HSPD-9, 2004). Since it was determined that veterinarians are perceived to be the most reliable and trustworthy source of information by TSCRA members, local opinion leaders, such as veterinarians, should engage in train-the-trainer programs to ensure a...

  12. LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile

    E-Print Network [OSTI]

    LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile Erin M. Dugan, Ph.D., LPC-S, RPT/S Academy Fellow Assistant Professor Department of Rehabilitation Counseling School/9/10 Educational Domains Represented in Academy Portfolio Teaching Educational Leadership and Service Teaching

  13. LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile

    E-Print Network [OSTI]

    LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile Sylvia Davis, Ph.D. Academy Master Teacher Professor and Director Department of Communication Disorders School of Allied meetings. Last Update: 8/9/10 Educational Domains Represented in Academy Portfolio Teaching Curriculum

  14. LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile

    E-Print Network [OSTI]

    LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile Rachel Trommelen Academy Associate Assistant Professor Department of Physical Therapy School of Allied Health Email: rtromm also love to travel. Last Update: 6/12/12 Educational Domains Represented in Academy Portfolio

  15. LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile

    E-Print Network [OSTI]

    LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile Judith Gentry, A.P.R.N., M.S.N, O.C.N. C.N.E Academy Fellow Assistant Professor of Department of Baccalaureate Program School in Academy Portfolio Teaching Curriculum Development, Instructional Design and Assessment of Student

  16. LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile

    E-Print Network [OSTI]

    LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile John Paige, M.D. Academy Master Teacher Assistant Professor of Clinical Surgery Department of Surgery School of Medicine/education projects. Last Update: 5/12/10 Educational Domains Represented in Academy Portfolio Teaching Curriculum

  17. LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile

    E-Print Network [OSTI]

    LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile Murtuza Ali, M.D. Academy Fellow Assistant Professor of Clinical Medicine Department of Medicine School of Medicine Email from my involvement in the Academy. Last Update: 6/18/12 Educational Domains Represented in Academy

  18. LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile

    E-Print Network [OSTI]

    LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile Rachel Dawkins, M.D., FAAP Academy Fellow Assistant Professor Department of Pediatrics School of Medicine Email: rdawki-academic life, I serve as the chair of the American Academy of Pediatrics' Section on Young Physicians as well

  19. LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile

    E-Print Network [OSTI]

    LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile Rodolfo E. Begue, M.D. Academy Master Teacher Chief Department of Pediatrics School of Medicine Email: rbegue medicine. Last Update: 8/12/10 Educational Domains Represented in Academy Portfolio Teaching Advising

  20. LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile

    E-Print Network [OSTI]

    LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile Stacey L Holman, M.D. Academy Associate Associate Professor-Clinical Department of Obstetrics and Gynecology School of Medicine: 7/05/12 Educational Domains Represented in Academy Portfolio Teaching Curriculum Development

  1. LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile

    E-Print Network [OSTI]

    LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile T. Kirk Nelson, Ph.D. Academy Fellow Instructor Department of Physical Therapy School of Allied Health Professions Email: tnelso committee of the Academy for the SAHP and served on the original executive council when the Academy

  2. LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile

    E-Print Network [OSTI]

    LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile Kristopher Kaliebe, M.D. Academy Fellow Assistant Professor Department of Psychiatry School of Medicine Email: kkalie and will see what these tools become. Last Update: 10/22/08 Educational Domains Represented in Academy

  3. LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile

    E-Print Network [OSTI]

    LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile Guido DeJesus, M.D. Academy Fellow Associate Professor of Clinical Medicine Department of Medicine School of Medicine Email Represented in Academy Portfolio Teaching Advising and Mentoring Teaching/Education Expertise DxR review

  4. LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile

    E-Print Network [OSTI]

    LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile Kathryn E. Kerdolff, MLIS, AHIP Academy Master Teacher Reference Librarian Department of Library School of Medicine Email' conferences SGEA and IAMSE. Kathy was the principal investigator for one of the 2008-2009 Academy EEG grants

  5. LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile

    E-Print Network [OSTI]

    LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile Angela C. Johnson, M.D. Academy Fellow Assistant Professor of Clinical Medicine Department of Internal Medicine School incorporated into the practice of medicine. Last Update: 5/5/10 Educational Domains Represented in Academy

  6. LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile

    E-Print Network [OSTI]

    LSUHSC-NO Academy for the Advancement of Educational Scholarship Member Profile Najy Masri, M.D. Academy Fellow Assistant Professor Department of Internal Medicine School of Medicine Email: nmasri Domains Represented in Academy Portfolio Teaching Advising and Mentoring Educational Leadership

  7. Prototyping a Residential Gateway Using Xilinx ISE S. W. Song, senior member, IEEE

    E-Print Network [OSTI]

    Gardner, William

    Prototyping a Residential Gateway Using Xilinx ISE S. W. Song, senior member, IEEE Department, Abstract This paper presents a residential gateway (RG for broadband residential multiservices based on a SONET over DWDM (Dense Wavelength Division Multiplexing

  8. Osher at UC San Diego Affiliate Members How To Access the Osher Online Video Library

    E-Print Network [OSTI]

    Nemat-Nasser, Sia

    Osher at UC San Diego ­ Affiliate Members How To Access the Osher Online Video Library 1. Upon will look like: #12;NEXT: in order to access the Osher Video Library, you must create a password Online Video Library: 1. Visit On the left-hand side, CLICK ON "Videos": #12

  9. Original: June, 2008 Procedure for the Election Staff Senate Members Revision: June, 2013

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    Senate holds regular elections each spring to fill vacant seats. Details regarding eligibility, terms Senate will confirm with ITC the EEO categories (Classified Professional, Technical Members Revision: June, 2013 2.2. The timeframe will be developed in conjunction with ITC per

  10. Page 1 of 19 Modelling of Reinforced Concrete Flexural Members Strengthened with Near-1

    E-Print Network [OSTI]

    beams strengthened with various Near-Surface Mounted9 (NSM) Fibre-Reinforced Polymers (FRPPage 1 of 19 Modelling of Reinforced Concrete Flexural Members Strengthened with Near-1 Surface, flexure, glass,27 modeling, near-surface mounted, rebars, reinforced concrete beam, sheets, static,28

  11. Had my water gone bad? Family members have lived on our land

    E-Print Network [OSTI]

    Rhode Island, University of

    to find out. Hated to spend the money, but it gave me peace of mind. " " " We're protecting our family. We for more help. Some labs will do the sampling for you, right at your home. 4. After you collect your waterHad my water gone bad? Family members have lived on our land for generations. Never had a problem

  12. July 18, 2014 Dear members of the McMaster community,

    E-Print Network [OSTI]

    Haykin, Simon

    by Shahid Naeem, Energy Management and Sustainability Engineer, Facility Services. Shahid, reportingJuly 18, 2014 Dear members of the McMaster community, McMaster's Office of Sustainability has undergone reorganization and has been developed into two distinct areas: campus operational sustainability

  13. Vehicle Speed Estimation using Acoustic Wave Patterns Volkan Cevher, Member, IEEE, Rama Chellappa, Fellow, IEEE

    E-Print Network [OSTI]

    Cevher, Volkan

    1 Vehicle Speed Estimation using Acoustic Wave Patterns Volkan Cevher, Member, IEEE, Rama Chellappa, Fellow, IEEE James H. McClellan, Fellow, IEEE Abstract-- We estimate a vehicle's speed, its wheelbase acoustic sensor that records the vehicle's drive-by noise. The acoustic wave pattern is determined using

  14. To: All members of the Trinity College community From: Michael Ratcliffe, Interim Provost

    E-Print Network [OSTI]

    Sokolowski, Marla

    Memo To: All members of the Trinity College community From: Michael Ratcliffe, Interim Provost Re with Trinity College academically as teachers, may be appointed Associates of the College for a term of two to me by email via Cera Maugey ( and include the following information

  15. Smart Grid Communication and Co-Simulation Vincenzo Liberatore, Member, IEEE Computer, Ahmad Al-Hammouri

    E-Print Network [OSTI]

    Liberatore, Vincenzo

    , different media may be appropriate in different circumstances. For example, smart appliances in the home can1 Smart Grid Communication and Co-Simulation Vincenzo Liberatore, Member, IEEE Computer, Ahmad Al-Hammouri Abstract--The smart power grid will extensively rely on networked control to increase efficiency

  16. Guidelines for external PhD faculty opponents and examination committee members

    E-Print Network [OSTI]

    1 Guidelines for external PhD faculty opponents and examination committee members This document is a description of the procedures for PhD examinations at the Faculty of Engineering (LTH) at Lund University relevant to the thesis discipline and your contribution is of great value in the quality assurance of PhD

  17. Three Dact gene family members are expressed during embryonic development and in the adult brains of mice

    E-Print Network [OSTI]


    family member ISH on representative sections from E9-E10.5.mesoderm. D- F. ISH on representative sections at E9.0 and

  18. AE Work Team Short Roster EITDM v1.1 2012-03-15 dgk Project Member Team Role UW-Madison Role

    E-Print Network [OSTI]

    Sheridan, Jennifer

    AE Work Team Short Roster EITDM v1.1 2012-03-15 dgk Project Member Team Role UW-Madison Role Barbara McPherson Team Leader Associate Dean - College of Engineering Bruce Maas Team Member Vice Provost for IT and CIO John Krogman Team Member Chief Operating Officer - DoIT Bruno Browning Team Member Director

  19. AE Work Team Short Roster Strategic Purchasing-Scientific Supplies 2012-1-6 v1.1 dgk Project Member Team Role UW-Madison Role

    E-Print Network [OSTI]

    Sheridan, Jennifer

    AE Work Team Short Roster Strategic Purchasing- Scientific Supplies 2012-1-6 v1.1 dgk Project Member Team Role UW-Madison Role Mike Hardiman Team Leader Business Services Mike Matschull Team Member Business Services Janet Bresnahan Team Member Business Services Kathy Jaglin Team Member WI State

  20. AE Work Team Short Roster Strategic Purchasing-Office Supplies v 1.1 2012-01-06 dgk Project Member Team Role UW-Madison Role

    E-Print Network [OSTI]

    Sheridan, Jennifer

    AE Work Team Short Roster Strategic Purchasing- Office Supplies v 1.1 2012-01-06 dgk Project Member Team Role UW-Madison Role Tammy Starr Team Leader Office of Human Resources (OHR) Mike Marean Team Member Business Services Don Schwoerer Team Member University Housing Tammi Simpson Team Member College

  1. On the highly reddened members in 6 young galactic star clusters - a multiwavelength study

    E-Print Network [OSTI]

    Kumar, B; Sanwal, B B; Bessell, M S; Kumar, Brijesh; Sagar, Ram


    The spectral and reddening properties of 211 highly reddened proper motion members with $V $70%) of program stars in NGC 1976, NGC 2244, NGC 6530 and NGC 6611 show anomalous reddening with $R_{V}$ = $5.11\\pm0.11$, $3.60\\pm0.05$, $3.87\\pm0.05$ and $3.56\\pm 0.02$, respectively, indicating the presence of grain size dust larger than that typical to the diffuse medium. A small number of stars in NGC 1976, NGC 2244 and NGC 6611 also show normal behavior while the cluster NGC 6823 appears to have a normal reddening. Three highly luminous late type giants, one in NGC 2244 and two in NGC 6530, appears to be member and are in post-hydrogen-core-burning stages suggesting a prolonged duration ($\\sim$ 25 Myrs) of star formation.

  2. Flexural support member having a high ratio of lateral-to-axial stiffness

    DOE Patents [OSTI]

    Haas, W.M.B.


    A convoluted flexible support structure is provided which is capable of supplying a lateral to axial spring rate in excess of 1000 to 1. A support member in the form of a steel disc having a specified number of rather large radius, concentric convolutions and a thickness in the range of from about 0.01 to 0.02 inch has an axial stiffness of about 50 pounds/inch while the lateral stiffness is about 100,000 pounds/inch. The support member may be used to support a vibration device where the lateral motion of the vibrator must be highly restricted while providing relatively free axial displacement of about +-0.25 inch.

  3. Agribusiness Faculty Members’ Perceptions of Importance and Inclusion of Decision Science Topics in Undergraduate Agribusiness Curricula

    E-Print Network [OSTI]

    Wolfskill, Lawrence Arthur


    for the degree of DOCTOR OF PHILOSOPHY Approved by: Chair of Committee, Gary J. Wingenbach Committee Members, Timothy H. Murphy Theresa P. Murphrey James W. Mjelde Head of Department, Jack Elliot August 2011 Major Subject: Agricultural... committee, both in their committee roles and outside of that in class, the hallways, and in the office, have all done their part to mentor and guide me. To Dr. Tim Murphy, Dr. Theresa Murphrey, and Dr. Jim Mjelde: your support and direction have been...

  4. STAFF CLUB MEMBER LIST (as on February 2008) No. NAME DEPT

    E-Print Network [OSTI]

    Narayanan, H.


  5. Author's personal copy Magnetron sputter deposition of a 48-member cuprate superconductor

    E-Print Network [OSTI]

    Hewitt, Kevin

    Author's personal copy Magnetron sputter deposition of a 48-member cuprate superconductor library of the Bi2Sr2YxCa1ÀxCu2O8+d (0:5 x 1) cuprate superconducting system. The libraries of each system were: the antiferromagnetic insulator Bi2Sr2YCu2O8+d (P ¼ 98 W rf) and the hole doped superconductor Bi2Sr2CaCu2O8+d (P ¼ 44 W

  6. Overexpression of the gene for transmembrane 4 superfamily member 4 accelerates liver damage in rats treated with CCl4

    E-Print Network [OSTI]

    Tian, Weidong

    ; Carbon tetrachloride; Acute liver injury 1. Introduction Rat TM4SF4 (transmembrane 4 superfamily member 4). Abbreviations: TM4SF4, transmembrane 4 superfamily member 4; CCl4, carbon tetrachloride; ALT, alanine­13]. However, the in vivo function conferred by TM4SF4 is still largely unknown. Carbon tetrachloride (CCl4

  7. UCF-3.0124 Discipline and Termination for Cause of Non-unit Faculty and A&P Staff Members.

    E-Print Network [OSTI]

    Van Stryland, Eric

    UCF-3.0124 Discipline and Termination for Cause of Non-unit Faculty and A&P Staff Members. (1) Just cause shall be defined as: (a) Incompetence; or (b) Misconduct. (2) Termination and Suspension. (a) The appointment of a non-unit faculty or an A&P staff member may be terminated or suspended during its term

  8. CURAC Group Automobile and Property Insurance We are pleased to remind all MUNPA members that CURAC, the

    E-Print Network [OSTI]

    Warkentin, Ian G.

    CURAC Group Automobile and Property Insurance We are pleased to remind all MUNPA members that CURAC Insurance Company to make available Group Automobile and Property Insurance to all members residing to 60% on your automobile and property premiums PLUS a CURAC Discount. · No interest or service charges

  9. A subsurface study of the Denkman sandstone member, Norphlet Formation, hatters Pond field, Mobile County, Alabama

    SciTech Connect (OSTI)

    Young, L.M.; Anderson, E.G.; Baria, L.R. (Northeast Louisiana Univ., Monroe (USA)); Higginbotham, R.S.


    Hatters Pond field is in east-central Mobile County in southwestern Alabama and it produces from both the Norphlet and Smackover formations. The structural trap involves salt movement along the west side of the Mobile Fault System that resulted in a faulted salt anticline. The Norphlet Formation of southwestern Alabama consists of red to gray siltstone and pinkish to gray sandstone with conglomerate layers. Three facies have been distinguished within the Norphlet Formation: a lower shale, a red siltstone sequence, and an upper quartzose unit. The thickness of the formation ranges from a feather edge to more than 800 ft (234.8 m) in southwestern Alabama. The Upper Jurassic Denkman Sandstone Member of the Norphlet Formation at Hatters Pond field is a medium- to fine-grained, well-sorted arkosic sandstone between the underlying Norphlet redbed lithofacies and the carbonates of the overlying Smackover Formation. Here, the Denkman Member can be subdivided into a massive upper unit and a low- to high-angle cross-stratified lower unit. The sandstones are quartz-rich with a high percentage of feldspars. The majority of the feldspar grains observed are potassium feldspar. Microcline is usually less altered when compared with other types of feldspar grains. The major types of feldspar replacement include illitization, hematitization, dolomitization, chloritization, calcitization, vacuolization, and anhydritization. Carbonate replacement of feldspars is very abundant, mostly by ferroan dolomite. Rock fragments are not abundant in the Denkman Member, although there is good evidence of a metamorphic/volcanic source area. The sandstones are cemented by dolomite, calcite, anhydrite, and quartz and feldspar overgrowths. The lower Denkman unit is slightly more porous than the upper Denkman unit. The pore-lining authigenic clay, illite, greatly reduces permeability and porosity in these sandstones.

  10. Tri-State Electric Member Corp (North Carolina) | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnualProperty Edit withTianlin Baxin Hydropower StationTownTri-CountyTri-State Electric Member Corp

  11. The Aging-Associated Enzyme CLK-1 is a Member of the Carboxylate-Bridged Diiron Family of Proteins

    E-Print Network [OSTI]

    Behan, Rachel K.

    The aging-associated enzyme CLK-1 is proposed to be a member of the carboxylate-bridged diiron family of proteins. To evaluate this hypothesis and characterize the protein, we expressed soluble mouse CLK-1 (MCLK1) in ...

  12. A Bulky Biaryl Phosphine Ligand Allows for Palladium-Catalyzed Amidation of Five-Membered Heterocycles as Electrophiles

    E-Print Network [OSTI]

    Su, Mingjuan

    The incredible bulk: The first palladium-catalyzed amidation of five-membered heterocyclic bromides with multiple heteroatoms was achieved using the Pd/1 catalyst system. N-Arylated imidazoles, pyrazoles, thiazoles, pyrroles, ...

  13. The depositional environments, diagenetic history, and porosity development of the Upper Smackover Member at Eustace Field, Henderson County, Texas

    E-Print Network [OSTI]

    Sequeira, Jose J.



  14. A modern numerical evaluation of a conductive sheet analog investigation of an elastically loaded member in torsion

    E-Print Network [OSTI]

    McClaren, Sherwood W



  15. Faculty Tenure and Promotion, 2008 Nine ETSU College of Arts and Sciences faculty members were promoted and six were granted tenure by the

    E-Print Network [OSTI]

    Karsai, Istvan

    Faculty Tenure and Promotion, 2008 Nine ETSU College of Arts and Sciences faculty members were in 90 of Tennessee's 95 counties. The following ETSU faculty members attained the rank of full professor

  16. North American Reciprocal Museum List Members from the de Saisset Museum, who present a membership card validated with a gold North American Reciprocal

    E-Print Network [OSTI]

    Schwarz, Thomas

    North American Reciprocal Museum List Members from the de Saisset Museum, who present a membership at participating museums: Free/member admission during regular museum hours, member discounts at museum shops, and discounts. on concert/lecture tickets. Please note: Some museums restrict benefits. Please see notes

  17. AE Work Team Roster IT Email & Calendar Consolidation 2012-01-06 v1.3 dgk Project Member Team Role UW-Madison Role

    E-Print Network [OSTI]

    Sheridan, Jennifer

    AE Work Team Roster IT ­ Email & Calendar Consolidation 2012-01-06 v1.3 dgk Project Member Team Role UW-Madison Role Rhonda Davis Team Leader School of Veterinary Medicine (SVM) Roger Hanson Team Member Dept of Information Technology (DoIT) Bobby Burrow Team Member Administrative Information Mgmt

  18. AE Work Team Roster IT Data Center Aggregation 2011-12-14 v1.0 dgk Project Member Team Role UW-Madison Role

    E-Print Network [OSTI]

    Sheridan, Jennifer

    AE Work Team Roster IT ­ Data Center Aggregation 2011-12-14 v1.0 dgk Project Member Team Role UW-Madison Role Ed VanGemert Team Leader General Library Administration Steve Krogull Team Member Department of Information Technology (DoIT) Phil Barak Team Member College of Agriculture & Life Sciences (CALS) Rick

  19. Guidelines for Vocal Tract Development Lab (VT Lab) team members to access the VT Lab WebSpace via the VT Lab website

    E-Print Network [OSTI]

    Vorperian, Houri K.

    Guidelines for Vocal Tract Development Lab (VT Lab) team members to access the VT Lab WebSpace via the VT Lab website The VTLab WebSpace is a new and improved mechanism for VT lab team members to share files. We are replacing the former Member Login section of our website with MyWeb Space (developed by Do

  20. Metabolic Capabilities of the Members of the Order Halanaerobiales and Their Potential Biotechnological Applications

    SciTech Connect (OSTI)

    Roush, Daniel W [Missouri University of Science and Technology] [Missouri University of Science and Technology; Elias, Dwayne A [ORNL] [ORNL; Mormile, Dr. Melanie R. [Missouri University of Science and Technology] [Missouri University of Science and Technology


    The order Halanaerobiales contains a number of well-studied halophiles that possess great potential for biotechnological applications. The unique halophilic adaptations that these organisms utilize, such as salting-in mechanisms to increase their intercellular concentration of KCl, combined with their ability to ferment simple sugars, provides an excellent platform for biotechnological development over a wide range of salt levels and possible other extreme conditions, such as alkaline conditions. From fermented foods to oil reservoirs, members of Halanaerobiales are found in many environments. The environmental conditions many of these organisms grow are similar to industrially important processes, such as alkaline pre-treated biomass stocks, treatment of crude glycerol from biodiesel production, salty fermented foods, as well as bioremediation of contaminants under extreme conditions of salinity and in some cases, alkalinity. From salt stable enzymes to waste fermentations, bioremediation options, bioenergy, and microbially enhanced oil recovery (MEOR), Halanaerobiales can provide a wide spectrum of environmentally friendly solutions to current problems.

  1. New low-mass members of the Octans stellar association and an updated 30-40 Myr lithium age

    E-Print Network [OSTI]

    Murphy, Simon J


    The Octans association is one of several young stellar moving groups recently discovered in the Solar neighbourhood, and hence a valuable laboratory for studies of stellar, circumstellar disc and planetary evolution. However, a lack of low-mass members or any members with trigonometric parallaxes means the age, distance and space motion of the group are poorly constrained. To better determine its membership and age, we present the first spectroscopic survey for new K and M-type Octans members, resulting in the discovery of 29 UV-bright K5-M4 stars with kinematics, photometry and distances consistent with existing members. Nine new members possess strong Li I absorption, which allow us to estimate a lithium age of 30-40 Myr, similar to that of the Tucana-Horologium association and bracketed by the firm lithium depletion boundary ages of the Beta Pictoris (20 Myr) and Argus/IC 2391 (50 Myr) associations. Several stars also show hints in our medium-resolution spectra of fast rotation or spectroscopic binarity. M...

  2. Characteristics of wild turkey hunters in Texas: comparing turkey stamp buyers to members of the National Wild Turkey Federation

    E-Print Network [OSTI]

    Harmel-Garza, Karen D


    = 1, 901), members (n = 670) and nonmembers (a = 1, 231) indicating whether they thought turkey numbers had increased, stayed the same, or decreased m the county they hunted in fall 1996 and spring 1997 (7' = 28. 6, df = 3, P = 0. 001). . . . . 29... Table 16 Percent of 1996 Texas turkey hunters (n = 1, 865), members (n = 664) and nonmembers (n = 1, 201) indicating whether they thought turkey hunters had increased, stayed the same, or decreased in the county they hunted in fall 1996 and spring...

  3. Conceptual model for transport processes in the Culebra Dolomite Member, Rustler Formation

    SciTech Connect (OSTI)

    Holt, R.M. [Holt Hydrogeology, Placitas, NM (United States)] [Holt Hydrogeology, Placitas, NM (United States)


    The Culebra Dolomite Member of the Rustler Formation represents a possible pathway for contaminants from the Waste Isolation Pilot Plant underground repository to the accessible environment. The geologic character of the Culebra is consistent with a double-porosity, multiple-rate model for transport in which the medium is conceptualized as consisting of advective porosity, where solutes are carried by the groundwater flow, and fracture-bounded zones of diffusive porosity, where solutes move through slow advection or diffusion. As the advective travel length or travel time increases, the nature of transport within a double-porosity medium changes. This behavior is important for chemical sorption, because the specific surface area per unit mass of the diffusive porosity is much greater than in the advective porosity. Culebra transport experiments conducted at two different length scales show behavior consistent with a multiple-rate, double-porosity conceptual model for Culebra transport. Tracer tests conducted on intact core samples from the Culebra show no evidence of significant diffusion, suggesting that at the core scale the Culebra can be modeled as a single-porosity medium where only the advective porosity participates in transport. Field tracer tests conducted in the Culebra show strong double-porosity behavior that is best explained using a multiple-rate model.

  4. Low-drag electrical contact arrangement for maintaining continuity between horizontally movable members

    DOE Patents [OSTI]

    Brown, R. Jack (Clinton, TN); Gerth, Howard L. (Knoxville, TN); Robinson, Samuel C. (Clinton, TN)


    This invention is a low-drag electrical contact arrangement for establishing continuity between upper and lower spaced members which are subject to relative horizontal movement. In one aspect, the invention comprises an electrical commutating arrangement which includes a horizontally disposed linear electrical commutator. A horizontally movable electrically conductive pedestal is positioned below the commutator and defines a clearance therewith. The pedestal is formed with a cavity confronting the commutator. In the cavity is a bead of electrical conductive liquid, the bead being characterized by an upwardly convex meniscus portion which extends across the clearance and contacts the commutator. The surface tension of the bead is sufficient to maintain the bead intact when the commutator and pedestal are displaced horizontally at speeds from zero to at least twelve inches a minute. This arrangement provides a significant advance in highly precise machining processes, such as diamond-turning, where precision is limited by the drag imposed by conventional commutators of the carbon-brush type.

  5. Low-drag electrical-contact arrangement for maintaining continuity between horizontally movable members

    DOE Patents [OSTI]

    Brown, R.J.; Gerth, H.L.; Robinson, S.C.


    This invention is a low-drag electrical contact arrangement for establishing continuity between upper and lower spaced members which are subject to relative horizontal movement. In one aspect, the invention comprises an electrical commutating arrangement which includes a horizontally disposed linear electrical commutator. A horizontally movable electrically conductive pedestal is positioned below the commutator and defines a clearance therewith. The pedestal is formed with a cavity confronting the commutator. In the cavity is a bead of electrical conductive liquid, the bead being characterized by an upwardly convex meniscus portion which extends across the clearance and contacts the commutator. The surface tension of the bead is sufficient to maintain the bead intact when the commutator and pedestal are displaced horizontally at speeds from zero to at least twelve inches a minute. This arrangement provides a significant advance in highly precise machining processes, such as diamond-turning, where precision is limited by the drag imposed by conventional commutators of the carbon-brush type.

  6. Laboratory column experiments for radionuclide adsorption studies of the Culebra dolomite member of the Rustler Formation

    SciTech Connect (OSTI)

    Lucero, D.A.; Heath, C.E. [Sandia National Labs., Albuquerque, NM (United States); Brown, G.O. [Oklahoma State Univ., Stillwater, OK (United States). Biosystems and Agricultural Engineering Dept.


    Radionuclide transport experiments were carried out using intact cores obtained from the Culebra member of the Rustler Formation inside the Waste Isolation Pilot Plant, Air Intake Shaft. Twenty-seven separate tests are reported here and include experiments with {sup 3}H, {sup 22}Na, {sup 241}Am, {sup 239}Np, {sup 228}Th, {sup 232}U and {sup 241}Pu, and two brine types, AIS and ERDA 6. The {sup 3}H was bound as water and provides a measure of advection, dispersion, and water self-diffusion. The other tracers were injected as dissolved ions at concentrations below solubility limits, except for americium. The objective of the intact rock column flow experiments is to demonstrate and quantify transport retardation coefficients, (R) for the actinides Pu, Am, U, Th and Np, in intact core samples of the Culebra Dolomite. The measured R values are used to estimate partition coefficients, (kd) for the solute species. Those kd values may be compared to values obtained from empirical and mechanistic adsorption batch experiments, to provide predictions of actinide retardation in the Culebra. Three parameters that may influence actinide R values were varied in the experiments; core, brine and flow rate. Testing five separate core samples from four different core borings provided an indication of sample variability. While most testing was performed with Culebra brine, limited tests were carried out with a Salado brine to evaluate the effect of intrusion of those lower waters. Varying flow rate provided an indication of rate dependent solute interactions such as sorption kinetics.

  7. A New Approach of Modelling Power Systems for Robust Control M. J. Hossain Student Member, IEEE, H. R. Pota, M. A. Mahmud, and R. A. Ramos, Senior Member, IEEE

    E-Print Network [OSTI]

    Pota, Himanshu Roy

    A New Approach of Modelling Power Systems for Robust Control M. J. Hossain Student Member, IEEE, H algorithm to calculate this bound. I. INTRODUCTION Analysis and controller design for power system dynamic behaviour is largely model based. Actual power system behaviour is inferred from the simulated response

  8. 9/17/12 Jack Liu tracks our ecological footprint | AAAS MemberCentral 1/

    E-Print Network [OSTI]

    :// Take a Tour ( Cutting Edge (/cutting-edge) Benefits plans. AAAS MC: Much of your work takes a holistic approach, looking at many seemingly unrelated factors

  9. Facies and Reservoir Characterization of the Permian White Rim Sandstone, Black Box Dolomite, and Black Dragon Member of the Triassic

    E-Print Network [OSTI]

    Seamons, Kent E.

    of Geological Sciences, BYU Master of Science Geologic sequestration of anthropogenic carbon dioxide (CO2, and Black Dragon Member of the Triassic Moenkopi Formation for CO2 Storage and Sequestration at Woodside Formation, for CO2 Sequestration at Woodside Field, East-central Utah Walter Harston Department

  10. Family business Information Update Please list all members that would like to receive information about the Family Business Council events.

    E-Print Network [OSTI]

    de Lijser, Peter

    Family business Information Update Please list all members that would like to receive information about the Family Business Council events. Name Company Mailing Address City State/Province ZipPhone #12;Thank you for helping us update our records. Please send information about the Family Business

  11. This guidance on childhood lead screening was devel-oped by CDC in consultation with the members and

    E-Print Network [OSTI]

    preface This guidance on childhood lead screening was devel- oped by CDC in consultation with the members and consultants of the Advisory Committee on Childhood Lead poisoning prevention. The committee-care organizations, academia, and non-governmental agencies working on affordable hous- ing and public lead poisoning

  12. Expectation All students must be assigned a named member of academic staff as their academic mentor, whom they can

    E-Print Network [OSTI]

    Painter, Kevin

    Expectation All students must be assigned a named member of academic staff as their academic mentor MENTORING DATE AUGUST 2014 LEARNING AND TEACHING BRIEFING PAPER 15 References and Further Information Contact: Academic Mentoring Policy and Guidelines:

  13. Wave-swept rocky shores support a surprisingly diverse assemblage of organisms that includes members of virtually

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    Wave-swept rocky shores support a surprisingly diverse assemblage of organisms that includes members of virtually every animal phylum and both algae and vascular plants. In general, wave that hydrodynamic forces can play an important role in limiting the size of wave-swept plants and animals (Denny et

  14. B-F1012rev1 (5/14) 2014 Magellan Health Services, Inc.

    E-Print Network [OSTI]

    Meyers, Steven D. B-F1012rev1 (5/14) ©2014 Magellan Health Services, Inc. Finding the Right Care for Your Child Many children will spend part of their day in some form of child care setting and finding high quality, affordable child care is important. Resources and Referrals We understand no two

  15. Abstract The grey top-shell, Gibbula cineraria is a common member of temperate to cold water kelp forest

    E-Print Network [OSTI]

    Schöne, Bernd R.

    Abstract The grey top-shell, Gibbula cineraria is a common member of temperate to cold water kelp and potential paleoenvironmental proxy for kelp forest habitats, its longevity has been significantly) Introduction High-latitude kelp forests, dominated by the brown seaweed, Laminaria sp. (Lu¨ning 1990; Raven et

  16. Dear APUNSC Member, This sheet is to help get you started in ski waxing. As you become more proficient and

    E-Print Network [OSTI]

    Scheel, David

    Dear APUNSC Member, This sheet is to help get you started in ski waxing. As you become more will need. This sheet includes the Swix waxes and tools that we use the most in Anchorage and Alaska. My in any condition. By using this sheet and attending our program wax clinics waxing should become a more

  17. for Proton CT R. P. Johnson, Member, IEEE, V. Bashkirov, V. Giacometti, R. F. Hurley, P. Piersimoni,

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    for Proton CT R. P. Johnson, Member, IEEE, V. Bashkirov, V. Giacometti, R. F. Hurley, P. Piersimoni beam test results with our pre-clinical (Phase-II) head scanner developed for proton computed tomography (pCT). After extensive preclinical testing, pCT will be employed in support of proton therapy

  18. As the newest member of the Oklahoma State University system, OSU-Tulsa has been working hard to develop academic

    E-Print Network [OSTI]

    Veiga, Pedro Manuel Barbosa

    As the newest member of the Oklahoma State University system, OSU-Tulsa has been working hard to develop academic programs that Tulsa businesses need and residents want. The OSU campus in Tulsa of Tulsa. To reach its potential as a comprehensive university, the OSU-Tulsa campus needed a facility

  19. Optimal Power Flow Formulation in Market of Retail Wheeling Taiyou Yong, Student Member, IEEE Robert Lasseter, Fellow, IEEE

    E-Print Network [OSTI]

    power plants, nuclear power plants etc and selling power to consumers. The suppliers have contractsOptimal Power Flow Formulation in Market of Retail Wheeling Taiyou Yong, Student Member, IEEE at Madison, Madison, Wisconsin, USA Abstract: Power system deregulation along with retail wheeling

  20. XPOHHKA -NEWS On June 22, 1985, Prof. RNDr. Alois Zatopek, DrSc., member of the Czechoslovak Academy

    E-Print Network [OSTI]

    Cerveny, Vlastislav

    Academy of Sciences, died at the age of 78. Academician A. Zatopek was born at ZaSovh in Moravia on June Committee. In 1953, he was elected Corresponding Member of the Czechoslovak Academy of Sciences and in 1968, the Euler Medal by the Soviet Academy in 1960, the Gold Medal of the Charles University in 1968, the Gold

  1. Dear Applicant, Thank you for your interest in becoming a member of the 2011-2012 Residential

    E-Print Network [OSTI]

    Tufts University

    Dear Applicant, Thank you for your interest in becoming a member of the 2011-2012 Residential application by 5pm, Monday, March 28, 2011 to the Office of Residential Life and Learning in South Hall. Once Affairs Office Residential Life and Learning RJB 2011-12RESOLVE TO MAKE A DIFFERENCE ON YOUR CAMPUS

  2. June 24, 1981 Volume 27, Number 13 Happy birthday to w . . . . Members of the Student Health Sem'ces staff

    E-Print Network [OSTI]

    Farrell, Anthony P.

    June 24, 1981 Volume 27, Number 13 Happy birthday to w . . . . Members of the Student Health Sem to the Department of Mining and Mineral Process Engineering at UBC. Highland Valley mine and it was given tc UBC by Lorne H. Hunter, Lornex vice- president and general manager of the Highland Valley operation

  3. CFL Labeling Harmonization in the United States, China, Brazil andELI Member Countries: Specifications, Testing, and MutualRecognition

    SciTech Connect (OSTI)

    Fridley, David; Lin, Jiang; Denver, Andrea; Biermayer, Peter; Dillavou, Tyler


    This report examines critical differences among energy-efficient labeling programs for CFLs in Brazil, China, the United States, and the seven members of the international Efficient Lighting Initiative (ELI) in terms of technical specifications and test procedures, and review issues related to international harmonization of these standards.

  4. Code of Ethics for Engineers Engineering is an important and learned profession. As members of this profes-

    E-Print Network [OSTI]

    Plotkin, Joshua B.

    undertake assignments only when qualified by education or experience in the specific technical fields. As members of this profes- sion, engineers are expected to exhibit the highest standards of honesty project and sign and seal the engineering documents for the entire project, provided that each technical

  5. Report to the members of the SPSC on the FNAL physics advisory Committee (P.A.C.) held in Aspen in June 1979

    E-Print Network [OSTI]

    Musset, P


    Report to the members of the SPSC on the FNAL physics advisory Committee (P.A.C.) held in Aspen in June 1979

  6. AE Space Utilization Work Team Short Roster v 1.5 2012-02-21 dgk Project Member Team Role UW-Madison Role

    E-Print Network [OSTI]

    Sheridan, Jennifer

    AE Space Utilization Work Team Short Roster v 1.5 2012-02-21 dgk Project Member Team Role UW: Space Utilization - Classroom #12;


    SciTech Connect (OSTI)

    Kaplan, D.


    Migration of Np through the subsurface is expected to be primarily controlled by sorption to sediments. Therefore, understanding and quantifying Np sorption to sediments and sediments from the Savannah River Site (SRS) is vital to ensure safe disposal of Np bearing wastes. In this work, Np sorption to two sediments representing the geological extremes with respect to sorption properties expected in the SRS subsurface environment (named 'subsurface sandy sediment' and 'subsurface clayey sediment') was examined under a variety of conditions. First a series of baseline sorption tests at pH 5.5 under an oxic atmosphere was performed to understand Np sorption under typical subsurface conditions. These experiments indicated that the baseline K{sub d} values for the subsurface sandy and subsurface clayey sediments are 4.26 {+-} 0.24 L kg{sup -1} and 9.05 {+-} 0.61 L kg{sup -1}, respectively. These Np K{sub d} values of SRS sediments are the first to be reported since Sheppard et al. (1979). The previous values were 0.25 and 0.16 L kg{sup -1} for a low pH sandy sediment. To examine a possible range of K{sub d} values under various environmental scenarios, the effects of natural organic matter (NOM, also a surrogate for cellulose degradation products), the presence of various chemical reductants, and an anaerobic atmosphere on Np sorption were examined. The presence of NOM resulted in an increase in the Np K{sub d} values for both sediments. This behavior is hypothesized to be the result of formation of a ternary Np-NOM-sediment complex. Slight increases in the Np sorption (K{sub d} 13-24 L kg{sup -1}) were observed when performing experiments in the presence of chemical reductants (dithionite, ascorbic acid, zero-valent iron) or under anaerobic conditions. Presumably, the increased sorption can be attributed to a slight reduction of Np(V) to Np(IV), the stronger sorbing form of Np. The most significant result of this study is the finding that Np weakly sorbs to both end member sediments and that Np only has a slight tendency to reduce to its stronger sorbing form, even under the most strongly reducing conditions expected under natural SRS conditions. Also, it appears that pH has a profound effect on Np sorption. Based on the these new measurements and the revelations about Np redox chemistry, the following changes to 'Best K{sub d}' values, as defined in Kaplan (2006), for SRS performance assessment calculations are recommended.

  8. Energy-Smart Building Choices: How School Administrators and Board Members Are Improving Learning and Saving Money

    SciTech Connect (OSTI)

    Energy Smart Schools Team


    Most K-12 schools could save 25% of their energy costs by being smart about energy. Nationwide, the savings potential is $6 billion. While improving energy use in buildings and busses, schools are likely to create better places for teaching and learning, with better lighting, temperature control, acoustics, and air quality. This brochure, targeted to school administrators and board members, describes how schools can become more energy efficient.

  9. Perceived and reported occupational stressors and coping strategies of selected community college business faculty members in Texas

    E-Print Network [OSTI]

    Allison, Genevieve J.


    in understanding such stress. Another purpose of this study was to measure and to compare for possible relationships among stressors, coping strategies, and selected demographic characteristics. Participants who received a three-part survey questionnaire... experienced high levels of stress from issues involving reward and recognition, time constraints, college/departmental influence, professional identity, and student interaction. 2. Community college business faculty members responded by identifying...

  10. Energy-Smart Building Choices: How School Administrators and Board Members Are Improving Learning and Saving Money (Revision)

    SciTech Connect (OSTI)

    Not Available


    Most school administrators and board members today must perform a tough juggling act. You're challenged to fulfill increasingly complex educational missions, meet rising community expectations, and serve growing student populations all with constrained operating budgets. As districts consider renovating their facilities or building new schools, many have found that smart energy choices can have lasting benefits for their schools, their communities, and the environment.

  11. Diagenesis of sandstones from the Douglas Creek member of the Green River Formation (Eocene) at Red Wash field, Uintay County, Utah

    E-Print Network [OSTI]

    Ray, Earl Scott


    , sandstone and some limestone and dolomite beds. The Garden Creek Member at Red Wash Field is about 550 ft (168 m) thick. The Parachute Creek Member, overlying the Garden Creek, is largely oil shale, gray shale, and limestone and dolomite beds...

  12. 3/1/11 PSS Budget Telecon Committee Members Present: Jim Green (HQ), Sarah Noble (HQ), Ron Greeley (chair), Fran Bagenal

    E-Print Network [OSTI]

    Rathbun, Julie A.

    3/1/11 PSS Budget Telecon Committee Members Present: Jim Green (HQ), Sarah Noble (HQ), Ron Greeley the 2012 budget release in February. Several PSS members submitted questions in advance, which were to be executed in 2012 and is intended to be a budget neutral action. We have done this in the past and know

  13. Trinity College Sports Centre Terms and Conditions 1. As a member of Trinity College's Sports Centre you are agreeing to comply

    E-Print Network [OSTI]

    O'Mahony, Donal E.

    Trinity College Sports Centre Terms and Conditions 1. As a member of Trinity College's Sports Centre must cease 30 minutes before advertised closing times to allow for showers. 18. Trinity College. If a dispute arises between Trinity College Sports Centre and a member, the decision of the Head of Sport

  14. BANYAN. VII. A New Population of Young Substellar Candidate Members of Nearby Moving Groups from the BASS Survey

    E-Print Network [OSTI]

    Gagné, Jonathan; Cruz, Kelle L; Lafrenière, David; Doyon, René; Malo, Lison; Burgasser, Adam J; Naud, Marie-Eve; Artigau, Étienne; Bouchard, Sandie; Gizis, John E; Albert, Loïc


    [Abbreviated] We present the results of a near-infrared (NIR) spectroscopic follow-up survey of 182 M4-L7 low-mass stars and brown dwarfs (BDs) from the BANYAN All-Sky Survey (BASS) for candidate members of nearby, young moving groups (YMGs). We confirm signs of low-gravity for 42 new BD discoveries with estimated masses between 8-75 $M_{Jup}$ and identify previously unrecognized signs of low gravity for 24 known BDs. This allows us to refine the fraction of low-gravity dwarfs in the high-probability BASS sample to $\\sim$82%. We use this unique sample of 66 young BDs, supplemented with 22 young BDs from the literature, to construct new empirical NIR absolute magnitude and color sequences for low-gravity BDs. We obtain a spectroscopic confirmation of low-gravity for 2MASS J14252798-3650229, which is a new $\\sim$27 $M_{Jup}$, L4 $\\gamma$ bona fide member of AB Doradus. We identify a total of 19 new low-gravity candidate members of YMGs with estimated masses below 13 $M_{Jup}$, seven of which have kinematically ...

  15. Golden Chain Members Member Induction Graduation

    E-Print Network [OSTI]

    Velev, Orlin D.

    Lindsey Robinson 2007 2008 Marilynn Angell 2008 2009 Robert Bradley 2008 2009 Esmeralda Luna-Ramos 2008

  16. A study of the effects of initial curvature on the buckling strength of compression members with varying end conditions

    E-Print Network [OSTI]

    Harris, James Elliott


    Test Results For the Fixed End Members Using The Fixed Loading Head and the Swivel Loading Head 26 3. Relation of Stress at Center of Test Specimen to Stress One-Half Inch From Center For P = 400 Pounds. . . . Z8 4. Stress-Strain Relationships from... Machine Used in Testing 39 40 12. Tension Stress-Strain Curve Below the Proportional Limit 41 13. Theoretical Stress versus Measured Stress at X = L/Z for a Slenderness Ratio of 80 with Both Ends Pinned . . 4Z 14. Theoretical Stress versus Measured...

  17. Bulk, thermal, and mechanical properties of the Topopah Spring Member of the Paintbrush Tuff, Yucca Mountain, Nevada

    SciTech Connect (OSTI)

    Nimick, F.B.; Schwartz, B.M.


    Experimental data on matrix porosity, grain density, thermal expansion, compressive strength, Young`s modulus, Poisson`s ratio, and axial strain at failure for samples from the Topopah Spring Member of the Paintbrush Tuff are compiled. Heat capacity and emissivity also are discussed. Data have been analyzed for spatial variability; slight variability is observed for matrix porosity, grain density, and thermal expansion coefficient. Estimates of in situ values for some properties, such as bulk density and heat capacity, are presented. Vertical in situ stress as a function of horizontal and vertical location has been calculated. 96 refs., 37 figs., 27 tabs.

  18. Eruption and emplacement of flood basalt. An example from the large-volume Teepee Butte Member, Columbia River Basalt Group

    SciTech Connect (OSTI)

    Reidel, S.P. (Washington State Univ., Pullman (United States)); Tolan, T.L. (Portland State Univ., OR (United States))


    Flows of the Teepee Butte Member, Grande Ronde Basalt, issued from a vent system in southeastern Washington, northeastern Oregon, and western Idaho. Three distinct basalt flows were erupted: the Limekiln Rapids flow, the Joseph Creek flow, and the Pruitt Draw flow. Together these mappable flows cover more than 52,000 km[sup 2] and have a volume exceeding 5,000 km[sup 3]. A portion of the vent system for the Joseph Creek flow is exposed in cross section in Joseph Canyon, Washington; it is one of the best preserved Columbia River Basalt Group vent complexes known. The vent complex is about 1 km in cross section, 30 m high, and composed of deposits characteristic of Hawaiian-type volcanism. The vent is asymmetrical; the eastern rampart consists of intercalated pyroclastic deposits and thin pahoehoe flows; the western rampart is composed wholly of pahoehoe flows. Flows of the Teepee Butte Member are compositionally homogeneous and were emplaced as sheet flows, each having several local flow units. Our study supports the importance of linear vent systems and the westward Palouse Slope, along with the large-volume lava flows, in controlling the distribution of Columbia River Basalt Group flows. Other factors, including the number of active fissure segments and topography, modified the shape of the flows and the number of flow units. 45 refs., 19 figs., 2 tabs.

  19. Group Retirement Services are provided by Sun Life Assurance Company of Canada, a member of the Sun Life Financial group of Sun Life Assurance Company of Canada, 2011.

    E-Print Network [OSTI]

    Northern British Columbia, University of

    Group Retirement Services are provided by Sun Life Assurance Company of Canada, a member of the Sun Life Financial group of companies. © Sun Life Assurance Company of Canada, 2011. McLean Budden name

  20. Team Roster Policy on Policies v1.0 2012-04-09 dgk Project Member Team Role Email UW-Madison Role

    E-Print Network [OSTI]

    Sheridan, Jennifer

    Team Roster ­ Policy on Policies v1.0 2012-04-09 dgk Project Member Team Role Email UW-Madison Role of Human Resources Administrative Excellence Phase II Work Team Roster: Policy on Policies #12;

  1. * Also a member of the Consejo Nacional de Investigaciones Cientificas y Te cnicas, Argentina. JOURNAL OF MATERIALS SCIENCE 33 (1998) 167 171

    E-Print Network [OSTI]

    Serebrinsky, Santiago A.

    * Also a member of the Consejo Nacional de Investigaciones Cienti´ficas y Te´ cnicas, Argentina Nacional de Cuyo) 8400 Bariloche, Argentina In the present work a semiempirical method for characterizing

  2. A paleoenvironmental study of the Lower Mississippian Caballero Formation and Andrecito member of the Lake Valley Formation in the south-central Sacramento Mountains, Otero County, New Mexico

    E-Print Network [OSTI]

    George, Peter Gillham


    Formations. . . . . . . 3 Southern exposure of Muleshoe Mound and flank beds. . . Isopach of Mississippian strata in southwestern and south-central New Mexico (from Kottlowski . 1963). . . . . . . . . 14 Mountains and counties of southwestern and south... of section 12 in Deadman Canyon. 36 Photographs of bed types from the Andrecito member and large nodules from the Caballero Formation in San Andres Canyon. 39 12 Photographs of erosion of the lowermost Andrecito member in San Andres Canyon. 41 13 Photog...

  3. High Catalytic Rates for Hydrogen Production Using Nickel Electrocatalysts with Seven-Membered Diphosphine Ligands Containing One Pendent Amine

    SciTech Connect (OSTI)

    Stewart, Michael P.; Ho, Ming-Hsun; Wiese, Stefan; Lindstrom, Mary L.; Thogerson, Colleen E.; Raugei, Simone; Bullock, R. Morris; Helm, Monte L.


    A series of Ni-based electrocatalysts, [Ni(7PPh2NC6H4X)2](BF4)2, featuring seven-membered cyclic diphosphine ligands incorporating a single amine base, 1-para-X-phenyl-3,6-triphenyl-1-aza-3,6-diphosphacycloheptane (7PPh2NC6H4X where X = OMe, Me, Br, Cl or CF3), have been synthesized and characterized. X-ray diffraction studies have established that the [Ni(7PPh2NC6H4X)2]2+ complexes have a square planar geometry, with bonds to four phosphorus atoms of the two bidentate diphosphine ligands. Coordination of the bidentate phosphine ligands to Ni result in one six-membered ring containing a pendent amine, and one five membered ring. Each of the complexes is an efficient electrocatalyst for hydrogen production at the potential of the Ni(II/I) couple, with turnover frequencies ranging from 2,400 to 27,000 s-1 with [(DMF)H]+ in acetonitrile. Addition of water (up to 1.0 M) accelerates the catalysis, giving turnover frequencies ranging from 4,100 - 96,000 s-1. Computational studies carried out on the [Ni(7PPh2NC6H4X)2]2+ family indicate the catalytic rates reach a maximum when the electron-donating character of X results in the pKa of the pendent amine matching that of the acid used for proton delivery. Additionally, the fast catalytic rates for hydrogen production by the [Ni(7PPh2NC6H4X)2]2+ family relative to the analogous [Ni(PPh2NC6H4X2)2]2+ family are attributed to preferred formation of endo protonated isomers with respect to the metal center in the former, which is essential for the protons to attain suitable proximity to the reduced metal center to generate H2. The results of this work highlight the importance of the necessity for precise pKa matching with the acid for proton delivery to the metal center, and the mechanistic details described herein will be used to guide future catalyst design. This research was supported as part of the Center for Molecular Electrocatalysis, an Energy Frontier Research Center funded by the U.S. Department of Energy, Office of Science, Office of Basic Energy Sciences. A portion of the computing resources were provided at W. R. Wiley Environmental Molecular Science Laboratory (EMSL), a national scientific user facility sponsored by the Department of Energy’s Office of Biological and Environmental Research located at Pacific Northwest National Laboratory.

  4. 08.01.01.M1.02 Investigation and Resolution of Complaints Against Faculty Members for Illegal Discrimination, Sexual Harassment, or Related Retaliation Charges Page 1 of 5

    E-Print Network [OSTI]

    Behmer, Spencer T.

    08.01.01.M1.02 Investigation and Resolution of Complaints Against Faculty Members for Illegal 08.01.01.M1.02 Investigation and Resolution of Complaints Against Faculty Members for Illegal;08.01.01.M1.02 Investigation and Resolution of Complaints Against Faculty Members for Illegal Discrimination

  5. Detailed mineralogical characterization of the Bullfrog and Tram members USW-G1, with emphasis on clay mineralogy

    SciTech Connect (OSTI)

    Bish, D.L.


    The detailed mineralogy of the Bullfrog and Tram Members of the Crater Flat Tuff from drill hole USW-G1 has been examined, primarily to characterize fully the amounts and types of clay minerals in the tuffs and the possible effects clay minerals have on rock properties. Results of bulk sample x-ray diffraction analyses agree closely with previous determinations, although slightly higher clay mineral contents were found in this study. X-ray diffraction analysis of fine fractions revealed that the clay minerals in the tuffs are sodium-saturated montmorillonite-beidellites with typical layer charges and no high-charge layers. These smectites are found in virtually all samples of the Bullfrog and Tram, and there is no correlation between the amounts of smectites and the amounts of zeolite, quartz, and feldspar. Smectites are present in both welded and nonwelded horizons and are scarce in some zones with slight-to-absent welding.

  6. Rotary electrical contact device and method for providing current to and/or from a rotating member

    DOE Patents [OSTI]

    Koplow, Jeffrey P


    Examples of rotary electrical connectors include a first pair and a second pair of opposing sheaves coupled together by intersecting first shaft connecting the first pair of opposing sheaves and a second shaft connecting the second pair of opposing sheaves, and at least partially electrically conductive belt disposed about respective perimeters of the first pair and second pair of opposing sheaves and adapted to remain in contact with at least a portion of the respective perimeters of the sheaves during motion of said sheaves. In example devices, one of the plurality of sheaves may remain stationary during operation of the device while the remaining sheaves rotate and/or orbit around a center axis of the stationary sheave, the device being configured to couple current between a stationary power source and a rotating member through the electrically conductive belt.


    E-Print Network [OSTI]

    Heermann, Dieter W.

    coordinator > University of Tirana, Albania > University of Sarajevo, Bosnia & Herzegovina > South East Foundation, Belgium > University of Tuzla, Bosnia & Herzegovina > Roma Virtual Network, Israel > University

  8. 2014 FANREP Member Profile / New Member Application Status: NEW MEMBER EXISTING MEMBER

    E-Print Network [OSTI]

    Watson, Craig A.

    Development Natural Resources Range Management Energy Sustainability Florida-Friendly Landscaping BE RECEIVED BY MIDNIGHT DECEMBER 31, 2013. Soils & Land Use Fisheries/Marine Recreation/EcoTourism Forestry/Wood Products Pest Management Watershed Management Water Resources Wildlife Management Youth

  9. Advisory Board Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Mexico Tech George Fuller UC San Diego Brian McPherson University of Utah Mike Liemohn University of Michigan Greg Taylor University of New Mexico Carol Anne Clayson Woods Hole...


    E-Print Network [OSTI]

    Abolmaesumi, Purang

    neutrino telescope, the size of a ten-storey building, two kilometers underground in Inco's Creighton Mine their properties. For many years, the number of solar neutrinos measured by other underground detectors has been of the SNO detector to measure all three types of neutrinos to determine that solar neutrinos are changing

  11. Nilsson Group Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What's Possible for Renewable Energy:Nanowire Solar541,9337,2April 2013we have solarstanford top slac

  12. Philosophy 148 --Assignment #4 This assignment is due Thursday, April 17 at 3pm. If you work in a group, list your group members at the

    E-Print Network [OSTI]

    Fitelson, Branden

    work in a group, list your group members at the top of your submitted work. Hempel's Desiderata algebra B of propositions. Consider the following seven conditions that might be met by a confirmation restrict these seven principles to contingent E's and H's, then 6/7 of them can be satisfied by some

  13. Metal MEMS Tools for Beating-heart Tissue Removal Andrew H. Gosline, Member, IEEE, Nikolay V. Vasilyev, Arun Veeramani, MingTing Wu, Greg Schmitz,

    E-Print Network [OSTI]

    Dupont, Pierre

    Metal MEMS Tools for Beating-heart Tissue Removal Andrew H. Gosline, Member, IEEE, Nikolay V the surgical removal of tissue from inside the beating heart. The tool is manufactured using a unique metal that can enter the heart through the vasculature. Incorporating both irrigation and aspiration, the tissue

  14. Being a Member of the King's College London Council The College Council lies at the centre of King's system of governance. The energy and

    E-Print Network [OSTI]

    Applebaum, David

    's system of governance. The energy and commitment of its members are crucial to the Council's effectiveness by the College's Charter and Statutes and Ordinances, and by guidance issued by the Committee of University, Audit), and report their activities to the Council. The frequency of meetings varies from committee

  15. Lunar Rover Solar Panel MountTeam Members: Tian Le, Tudor Boiangiu, Jeremy Chan, James Haensel To develop a mechanized mount for a solar panel to

    E-Print Network [OSTI]

    Lunar Rover Solar Panel MountTeam Members: Tian Le, Tudor Boiangiu, Jeremy Chan, James Haensel To develop a mechanized mount for a solar panel to be mounted on a lunar rover. Must be: · capable of orienting panel towards sun · reside on mast extending vertically from rover · capable of unfurling solar


    E-Print Network [OSTI]

    help improve transportation not only for the West Texas region, but for cities all along the UA PUBLICATION OF THE TEXAS TRANSPORTATION INSTITUTE n MEMBER OF THE TEXAS A&M UNIVERSITY SYSTEM n VOL. 42 n NO. 2 n 2006 Inaugural Texas Transportation Forum PAGE 4 TTI Council convenes PAGE 8 Teens

  17. Energy-Harvesting System-in-Package (SiP) Micro-System1 Erick O. Torres, Student Member, IEEE2

    E-Print Network [OSTI]

    Rincon-Mora, Gabriel A.

    the stored energy available in state-of-the-art micro-battery technologies, such as thin-film lithium ion (Li:// #12;2 CE Database Subject Headings: energy harvesting, energy conversion, energy sources, energyEnergy-Harvesting System-in-Package (SiP) Micro-System1 Erick O. Torres, Student Member, IEEE2

  18. 2008 Publications by Global Change Primary Members Ahad, J. M. E., J. A. C. Barth, R. S. Ganeshram, R. G. M. Spencer, and G. Uher, 2008,

    E-Print Network [OSTI]

    Greenaway, Alan

    and Russia - Part 1: Numerical modelling and validation methods: Climate of the Past, v. 4, p. 235-248. Allen, Reconstructing glacier-based climates of LGM Europe and Russia - Part 3: Comparison with previous climate1 2008 Publications by Global Change Primary Members Ahad, J. M. E., J. A. C. Barth, R. S

  19. HOW TO DEVELOP LAB-SPECIFIC TRAINING University of Maryland Chemical Hygiene Plan requires that all lab members be trained on the specific

    E-Print Network [OSTI]

    Rubloff, Gary W.

    HOW TO DEVELOP LAB-SPECIFIC TRAINING SUMMARY University of Maryland Chemical Hygiene Plan requires for each new lab member. At minimum should include completion of: Chemical Hygiene Training for Laboratory OPERATIONS Know the Chemical Hygiene Plan SOP requirements and the lab's process for developing and reviewing

  20. Sun Life Assurance Company of Canada is a member of the Sun Life Financial group of companies. 2005 Sun Life Assurance Company of Canada. All rights reserved.

    E-Print Network [OSTI]

    Mullins, Dyche

    JL 5/26/09 Sun Life Assurance Company of Canada is a member of the Sun Life Financial group of companies. © 2005 Sun Life Assurance Company of Canada. All rights reserved. Sun Life Financial and the globe symbol are registered trademarks of Sun Life Assurance Company of Canada. SLPC 5302 07/02 H I G H

  1. A Publication of the Texas Transportation Institute Member of The Texas A&M University System Vol. 39 No. 1 2003 Transportation is critical

    E-Print Network [OSTI]

    A Publication of the Texas Transportation Institute · Member of The Texas A&M University System · Vol. 39 · No. 1 · 2003 #12;Transportation is critical to quality of life... and often, its preservation. TEXAS TRANSPORTATION RESEARCHER2 niversity transportation research has made significant

  2. THE MSU PRESIDENT'S AWARD FOR EXCELLENCE IN SERVICE LEARNING This award, open to an MSU faculty member (tenured, tenure track, assistant, associate or adjunct) and

    E-Print Network [OSTI]

    Dyer, Bill

    of the partnership, and will be heavily weighted around how well the service learning course meets the best practices of civic responsibility. The assessment of nominees will involve consideration of the quality course can demand. I. Nominee Information Nomination Form Name of Faculty Member Title Department Campus

  3. Library Rules and Information The Library is open to members of the College for the borrowing of books and other items,

    E-Print Network [OSTI]

    Capdeboscq, Yves

    Library Rules and Information · The Library is open to members of the College for the borrowing colleges, are not permitted to use the Library except by prior appointment with the Librarian. Please make on the shelves at the entrance to the Library. · No reader may smoke, eat or drink in the Library. Any food

  4. A Self-Configuring Communication Virtual Machine1 S. Masoud Sadjadi2, Selim Kalayci3, and Yi Deng4, Member, IEEE

    E-Print Network [OSTI]

    Sadjadi, S. Masoud

    , Member, IEEE School of Computing and Information Sciences Florida International University, Miami, FL, U by the National Science Foundation (grants HRD-0317692, OCI-0636031, and REU-0552555) and in part by IBM (SUR of Computing and Information Sciences, Florida International University, Miami, FL 33199 USA (phone: 305

  5. MEMBERS ONLY | Join | Renew | Shop | About | Contact Us | Home ASME.ORG > News & Public Policy > Press Releases > Research Begun on New Fuel Cell Type

    E-Print Network [OSTI]

    SEARCH ASME: MEMBERS ONLY | Join | Renew | Shop | About | Contact Us | Home ASME.ORG > News Type NEW YORK, June 25, 2004 - In the June 2004 issue of Mechanical Engineering, a publication of ASME the potential to generate 2.3 megawatts of electricity, or enough energy to power 1,500 homes. One of the fuel

  6. An unusual mono-substituted Keggin anion-chain based 3D framework with 24-membered macrocycles as linker units

    SciTech Connect (OSTI)

    Pang Haijun [Key Laboratory of Green Chemical Engineering and Technology College of Heilongjiang Province, College of Chemical and Environmental Engineering, Harbin University of Science and Technology, Harbin 150040 (China); Ma Huiyuan, E-mail: [Key Laboratory of Green Chemical Engineering and Technology College of Heilongjiang Province, College of Chemical and Environmental Engineering, Harbin University of Science and Technology, Harbin 150040 (China); Yu Yan; Yang Ming; Xun Ye [Key Laboratory of Green Chemical Engineering and Technology College of Heilongjiang Province, College of Chemical and Environmental Engineering, Harbin University of Science and Technology, Harbin 150040 (China); Liu Bo, E-mail: [Key Laboratory of Green Chemical Engineering and Technology College of Heilongjiang Province, College of Chemical and Environmental Engineering, Harbin University of Science and Technology, Harbin 150040 (China)


    A new compound, [Cu{sup I}(H{sub 2}O)(Hbpp){sub 2}] Subset-Of {l_brace}[Cu{sup I}(bpp)]{sub 2}[PW{sub 11}Cu{sup II}O{sub 39}]{r_brace} (1) (bpp=1,3-bis(4-pyridyl)propane), has been hydrothermally synthesized and structurally characterized by single crystal X-ray diffraction. In compound 1, the unusual -A-B-A-B- array mono-substituted Keggin anion-chains and 24-membered (Cubpp){sub 2} cation-macrocycles are linked together to form a (2, 4) connected 3D framework with channels of ca. 9.784 Multiplication-Sign 7.771 A{sup 2} along two directions, in which the [Cu(H{sub 2}O)(Hbpp){sub 2}] coordination fragments as guest components are trapped. The photocatalytic experiments of compound 1 were performed, which show a good catalytic activity of compound 1 for photodegradation of RhB. Furthermore, the IR, TGA and electrochemical properties of compound 1 were investigated. - Graphical abstract: An unusual example of mono-substituted Keggin anion-chain based hybrid compound that possesses a 3D structure has been synthesized, which offers a feasible route for synthesis of such compounds. Highlights: Black-Right-Pointing-Pointer The first example of -A-B-A-B- array mono-substituted Keggin chain is observed. Black-Right-Pointing-Pointer An unusual three dimensional structure based mono-substituted Keggin anion-chains. Black-Right-Pointing-Pointer The photocatalysis and electrochemical properties of the title compound were studied.

  7. Regional analysis of rhythmic bedding in the Fort Hays limestone member, Niobrara Formation (Upper Cretaceous), US western interior

    SciTech Connect (OSTI)

    Laferriere, A.P.


    Results of a regional stratigraphic investigation of the rhythmically bedded Fort Hays limestone member of Kansas, Colorado, and New Mexico indicate at least two levels of cyclicity. Regional development of these cycles strongly supports the hypothesis that they are climatic in origin. Departures from simple cyclical patterns resulted from sedimentary effects of Late Cretaceous orogenic activity, erosional events associated with eustatic sea level changes, diagenetic modification, and possibly from interference between orbital parameters having different periodicities. The vulnerability of Milankovitch-type cyclicity to overprinting by tectono-sedimentologic effects makes units such as the Fort Hays useful as indicators of subtle tectonic activity. Regional thickness changes in groups of shale-limestone couplets were identified, correlated, and mapped in the subsurface using geophysical well log information in order to locate subtle structural elements that influenced Fort Hays sedimentation. In the Denver-Julesburg Basin of Colorado and western Kansas, thinning of the section between Fort Hays marker horizons occurs dominantly along northeastwardly trending belts that resulted apparently from Late Cretaceous reactivation of the Transcontinental Arch. Isotopic and petrographic analyses were conducted on pelagic (carbonate matrix) and benthic (inoceramid bivalve) constituents of selected shale/limestone couplets. These data suggest that there was little difference in temperature or salinity between times of terrigenous detrital input and times of nearly pure carbonate deposition. Isotopic information from matrix samples suggests a westward decrease in salinity of surface water in the Western Interior Sea. Isotopic data from largely unaltered inoceramid bivalves indicate bottom-water conditions of near-normal marine salinity.

  8. Paleoenvironmental analysis of the lower Mississippian Caballero Formation and the Andrecito member of the Lake Valley Formation in the northern Sacramento Mountains Otero County, New Mexico

    E-Print Network [OSTI]

    Blount, William Markham


    . Missourian Beeman fm. Zm Oes IRoinesian Atoaan lice 0' ~ 40 Client art 0 0 Meramecian Cobbler fm. Helms fm. Rancheria and Las Cruces ? fm. Osagian Lake Yalley fm. Dona Aco mmneer Arcente masher Tierra Stance man ear ttcnn mmnear Ala oraa... Beeman fm. nm Des IRoinesian Atonan Morranan Ctt?t?iao Meramecian Cobbler lm, Helms fm. Rancheria and t. as Cruces ? fm. Bona Ana mon bar Osagian Lake Valley fm. lbonnta melober Tierra Blanco member Mann nmmber oroo DEVONIAN...

  9. Factors Associated with Recruitment and Retention Rates of Minority Youth 4-H Members as Perceived by Adult Club Leaders and County Extension Agents in Texas

    E-Print Network [OSTI]

    Gonzales, Nicole 1989-


    is needed to help increase the interests of minority youth. Among the recommendations for improvement, Alston and Crutchfield (2009) suggested increasing the number of adult minority role models in 4-H in order to help recruit minority membership. Newby... from the current and prospective youth members. To most youth, 4-H is viewed as an organization comprised of white youth from rural environments (Newby and Sallee, 2011). This belief could be the limiting factor resulting in a lack of recruitment...

  10. Entry Group Team Members Project name Advisor Major Concentration G/U 1 GB Patrick Edward Kraus Boyd Terror Management: Upward and Downward Mental Simulations of Mortality Dr. Charlotte Chuck Tate Social Psychology graduate

    E-Print Network [OSTI]

    Psychology Graduate #12;Entry Group Team Members Project name Advisor Major Concentration G/U Displa18 GLEntry Group Team Members Project name Advisor Major Concentration G/U 1 GB Patrick Edward Kraus Social Psychology graduate 2 GB Aggie Wong Social Interactions, Age and Aggression: Negative Behaviors

  11. Godiva Rim Member: A new stratigraphic unit of the Green River Formation in southwest Wyoming and northwest Colorado. Geology of the Eocene Wasatch, Green River, and Bridger (Washakie) Formations, Greater Green River Basin, Wyoming, Utah, and Colorado. Professional paper

    SciTech Connect (OSTI)

    Roehler, H.W.


    The report names and describes the Godiva Rim Member of the Green River Formation in the eastern part of the Washakie basin in southwest Wyoming and the central part of the Sand Wash basin in northwest Colorado. The Godiva Rim Member comprises lithofacies of mixed mudflat and lacustrine origin situated between the overlying lacustrine Laney Member of the Green River Formation and the underlying fluvial Cathedral Bluffs Tongue of the Wasatch Formation. The Godiva Rim Member is laterally equivalent to and grades westward into the LaClede Bed of the Laney Member. The Godiva Rim Member of the Green River Formation was deposited along the southeast margins of Lake Gosiute and is correlated to similar lithologic units that were deposited along the northeast margins of Lake Uinta in the Parachute Creek Member of the Green River Formation. The stratigraphic data presented provide significant evidence that the two lakes were periodically connected around the east end of the Uinta Mountains during the middle Eocene.

  12. Facies analysis of the Caballero Formation and the Andrecito Member of the Lake Valley Formation (Mississippian): implications for Waulsortian bioherm inception, Alamo Canyon area, Sacramento Mountains, New Mexico

    E-Print Network [OSTI]

    Byrd, Thomas Martin


    -500 0-350 0-850 0-500 0-1600 0-60 0-300 m Q. CL m te (h Ie Osagian Lake Valley Formation Dona Ana Mbr. Arcente Mbr. Tierra Blanca Mbr. Nunn Mbr. Alamogordo Mbr. Andrecito Mbr. 0-150 0-200 0-140 0-120 0-350 0-85 Devonian...) paleoenvironmental analysis of the Caballero Formation, and the Andrecito, Alamogordo, Nunn, and Tierra Blanca Members. Further studies by Blount (1985), George (1985), and Morey (1985) concentrated on Caballero and Andrecito facies in smaller outcrop areas...

  13. Geochemistry of V and NI in bitumen and the depositional environment of the Meade Peak phosphatic shale member of the Phosphoria formation in SE Idaho

    SciTech Connect (OSTI)

    Sharata, S.M. (Univ. of Idaho, Moscow (USA)); Filby, R.H. (Washington State Univ., Pullman (USA))


    Stratigraphic and geographic variation in V and Ni abundances and the (V/Ni + V) ration in bitumens from phosphorite and shale of the Meade Peak Member of SE Idaho reflect systematic vertical and lateral changes in environmental conditions during deposition of these rocks. These variations may have been preserved during generation, migration and accumulation of the Phosphoria oil. Thus, V/(Ni + V) ratios are useful geochemical parameters in reconstruction of the depositional environment, discrimination of genetic oil-types, and correlation of oil-source rock of the Phosphoria in the northern Rocky Mountains region.

  14. Sequence-Stratigraphic Analysis of the Rollins and the Cozzette Sandstone Members, the Upper Cretaceous Mount Garfield Formation of the Piceance Basin, Colorado.

    E-Print Network [OSTI]

    Ouaichouche, Fatma Zahra


    at the top. Both siltstone and mudstone are locally bioturbated. Siltstone beds (~20 cm) are sharp-based, light brown to gray in color, and are interbeded with mudstone beds. Coal with siltstone Trough-cross bedding Laminae/flaser beddin g/burrows 10 m10... it occurs at the top of the Rollins Sandstone Member. It is laterally continuous, distinctively white colored, and 22 capped with a coal bed (Figure 9). This unit is composed of six subunits arranged in an upward-coarsening trend and is described...

  15. SDSS J111010.01+011613.1: A New Planetary-Mass T Dwarf Member of the AB Doradus Moving Group

    E-Print Network [OSTI]

    Gagné, Jonathan; Faherty, Jacqueline K; Lafrenière, David; Doyon, René; Filippazzo, Joseph C; Bowsher, Emily; Nicholls, Christine P


    We present a new radial velocity measurement that, together with a trigonometric parallax, proper motion and signs of low gravity from the literature, confirms that SDSS J111010.01+011613.1 is a new T5.5 bona fide member of AB Doradus. Fitting $\\lambda/\\Delta\\lambda$ $\\approx$ 6000 FIRE spectroscopy in the 1.20-1.33 $\\mu$m region to BT-Settl atmosphere models yielded a radial velocity of $7.5 \\pm 3.8$ km s$^{-1}$. At such a young age (110-130 Myr), current evolution models predict a mass of $\\sim$ 10-12 $M_{\\mathrm{Jup}}$, thus placing SDSS J1110+0116 well into the planetary-mass regime. We compare the fundamental properties of SDSS J1110+0116 with a sequence of seven recently identified M8-T5 brown dwarf bona fide or high-confidence candidate members of AB Doradus. We also note that its near-infrared $J-K$ color is redder than field T5-T6 brown dwarfs, however its absolute $J$-band magnitude is similar to them. SDSS J1110+0116 is one of the few age-calibrated T dwarfs known to date, as well as one of the coo...

  16. The relationship between student performance and leadership practices as perceived by principals and selected site-based decision making (SBDM) committee members of middle schools in Region 5 Education Service Center (ESC), Texas: a cohort study

    E-Print Network [OSTI]

    Sheppard, Larry Scott


    This study, one of four cohort studies, was designed to determine the relationship between student performance and leadership practices as perceived by principals and selected site-based decision making committee members of middle schools...

  17. A case study of the perceptions of current and former school board members of a recently annexed, rural, impoverished, South Texas, Latino school district in a high stakes accountability system

    E-Print Network [OSTI]

    Rodriguez, Claudia G.


    This research study was a qualitative study involving eight current or former school board members of a recently annexed, rural, impoverished, Latino school district in South Texas. The purpose of this intrinsic case study was to highlight...

  18. Dr. Stirling A. Colgate has been a staff physicist at Lawrence Livermore National Lab. (1952-1965) and was a staff member at Los Alamos National Laboratory, [LANL] from 1976 to 1991 and from

    E-Print Network [OSTI]

    Dr. Stirling A. Colgate has been a staff physicist at Lawrence Livermore National Lab. (1952 in WW II in the US Merchant Marine. Dr. Stirling A. Colgate is an associate staff member at Los Alamos

  19. A case study of the perceptions of current and former school board members of a recently annexed, rural, impoverished, South Texas, Latino school district in a high stakes accountability system

    E-Print Network [OSTI]

    Rodriguez, Claudia G.




    E-Print Network [OSTI]

    Huang, Yanyi

    's heat content and making oceanographic data readily available to the scientific community. THE SVERDRUP. THE REMOTE SENSING PRIZE Pawan K. Bhartia For scientific advances in the remote sensing of global ozone of observations to clarify the vertical structure of latent heating and the geographical distribution

  1. National Advisory Council Member Biographies

    E-Print Network [OSTI]

    Sekhon, Jasjeet S.

    Shark Study in partnership with the University of California, Davis; and developed a Climate Change's Council on American Politics, Californians Building Bridges and the Green Music Center at Sonoma State new ventures to build upon the unique brand of California. He has spearheaded a series of innovative


    E-Print Network [OSTI]

    Karonis, Nicholas T.

    room - Weight lifting rooms - 3-Lane, 1/5 mile jogging and walking track - 8 Racquetball with saunas - Meeting room - Juice bar in lobby with televisions - Nutrition and personal training - Table bikes - Stair Masters climbers - Cybex 3 & 5 Station weight selector strength trainer - 6 Televisions

  3. Current members Jeff Easley, MIT

    E-Print Network [OSTI]

    Lightsey, Glenn

    to macroscopic function for designing next generation materials. #12;Nanostructured Polymers: Technological for future devices · Nanocomposites ­ Vaia and Giannelis (MRS Bulletin 2001) · Low loading levels (~several. Project 2: Silicon-containing Block Copolymers for High Density Magnetic Data Storage PS-b-PMMA A S S C CL

  4. October 29, 2004 Council Members

    E-Print Network [OSTI]

    the acquisition model. That is, acquiring energy efficiency by winning over one energy customer, one project will and sufficient resources. For example, the Alliance recently developed a 5-year Business Case and even with our;2 As a ratepayer myself, I'd like to see this energy efficiency resource developed in the most effective manner

  5. Instrumentation Team US Team Members

    E-Print Network [OSTI]

    Grether, Gregory

    3769 4240 4711 5182 5653 6124 6595 7066 7537 8008 8479 8950 9421 9892 0363 0834 1305 1776 2247 2718 3769 4240 4711 5182 5653 6124 6595 7066 7537 8008 8479 8950 9421 9892 10363 10834 11305 11776 12247

  6. T. F. Smith Member ASME

    E-Print Network [OSTI]

    Beckermann, Christoph

    -generating electronic components. Heat transfer processes at both small (i.e., inside a component) and large (i demand for the design of more complex, compact, and reliable electronic packages has resulted in a need to examine in greater detail the heat transfer processes that allow electronic components to be maintained

  7. ACADEMIC BOARD Information for members

    E-Print Network [OSTI]

    University of Technology, Sydney

    Principles and Quality Management Framework........................... 7 Self......................................................... 31 Attachment 2 -- Academic Board Quality Management Framework............. 32 http

  8. FTCP Members | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011AT&T,OfficeEnd of YearFLASH2011-17-OPAM FLASH2011-17-OPAMFTCPFace to Face MeetingFTCP

  9. FTCP Members | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 1112011 Strategic Plan| Department of.pdf6-OPAM FLASH2011-16-OPAMYoung,02,ConferenceMeetings

  10. ORSSAB Members | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33 111 1,613 122Commercial602 1,39732onMake YourDepartment ofC T O B E R 2 0OREMServices »Meeting


    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWPSuccess Stories Siteandscience, and8 FY0Link

  12. Relation of vanadium and nickel in bitumen to the depositional environment of the Meade-Peak Member, Phosphoria Formation, southeastern Idaho

    SciTech Connect (OSTI)

    Sharata, S.M.


    Forty six siltstone, phosphorite, and shale samples from different stratigraphic and geographic positions from the Meade Peak Member of the Phosphoria Formation in southeastern Idaho were extracted for bitumen content. Subsequently, contents were analyzed by instrumental neutron activation analysis for trace elements in order to relate the abundance and ratio of V and Ni to the depositional environments of the Meade Peak Member in the study area. High V and low Ni concentration (V/Ni+V > 0.90) may be found in bitumen extracted from organic matter from shale. The low Ni concentration in bitumen samples might be related to precipitation as NiS in the mineral phase. A large amount of H[sub 2]S may have been produced during oxidation of organic matter by the sulfate-reducing bacteria under anoxic conditions, where only vanadyl cations were available for metallation with organic matter. Organic matter would be preserved under these conditions, and its remaining amount in shale would be high and hydrogen-rich, resulting in high V/Ni+V ratio (close to unity). Varied Ni and V concentration (V/Ni+V range from 0.10-0.90) was found in bitumen extracted from organic matter from phosphorite. The variation in the concentrations might be related, in part, to precipitation of V and Ni in the mineral phase under suboxic conditions, where both vanadyl and nickelous cation proportions were available for metallation with organic matter. Organic matter would have been partially preserved during deposition under these conditions. Its remaining amount in phosphorite would be low to moderately high and would be intermediate in composition, resulting in variation in the V/Ni+V ratio from 0.10 to 0.90. High Ni and low V concentration (V/Ni+V < 0.10) was found in bitumen extracted from siltstone. The low V concentration might be related to nearly complete precipitation as vanadate under oxic conditions, where only nickelous cations were available for metallation with organic matter.

  13. Comparative analysis of Nigerian international oil marketing model (NIOMM) and the models of four selected OPEC members; and a proposed new model for Nigeria

    SciTech Connect (OSTI)

    Udeke, O.O.


    This study demonstrates that NIOMM has deficiencies and, as a result, has affected the progress of Nigeria's political and socio-economic development. One finding is that Nigeria is beset with ineffective planning, lack of marketing expertise, and inadequate marketing strategies. Other findings show that: (1) the Nigerian oil industry (HOI) is suffering from mismanagement stemming from corruption, tribalism, Federal Character Policy, and lack of dedication and patriotism by the Nigerian workers; (2) there is inefficiency in the Nigerian national petroleum corporation (NNPC) but, at the same time, the inefficiency is partly because of the government policies, conflicts, interference by high government officials and politicians, and the enormous size of the oil industry; (3) oil revenues are improperly utilized; (4) neither the multinational oil corporations (MNOCs) nor multinational corporations (MNCs) are assisting the oil producing nations (OPNs) or developing countries (DCs) in their economic development, and MNOCs and MNCs are interested in profit maximization; and (5) MNCs do not transfer the type of technology that meets the needs of DCs, and sometimes the technology creates problems for DCs which ultimately results into conflicts between MNCs and DCs. The inverse of these problems has been a sine qua non for success in the IOMMs of the four OPEC member, especially in Saudi Arabia.

  14. Sedimentological, mineralogical and geochemical definition of oil-shale facies in the lower Parachute Creek Member of Green River Formation, Colorado

    SciTech Connect (OSTI)

    Cole, R.D.


    Sedimentological, mineralogical and geochemical studies of two drill cores penetrating the lower Saline zone of the Parachute Creek Member (middle L-4 oil-shale zone through upper R-2 zone) of the Green River Formation in north-central Piceance Creek basin, Colorado, indicate the presence of two distinct oil-shale facies. The most abundant facies has laminated stratification and frequently occurs in the L-4, L-3 and L-2 oil-shale zones. The second, and subordinate facies, has ''streaked and blebby'' stratification and is most abundant in the R-4, R-3 and R-2 zones. Laminated oil shale originated by slow, regular sedimentation during meromictic phases of ancient Lake Uinta, whereas streaked and blebby oil shale was deposited by episodic, non-channelized turbidity currents. Laminated oil shale has higher contents of nahcolite, dawsonite, quartz, K-feldspar and calcite, but less dolomite/ankerite and albite than streaked and blebby oil shale. Ca-Mg-Fe carbonate minerals in laminated oil shale have more variable compositions than those in streaked and blebby shales. Streaked and blebby oil shale has more kerogen and a greater diversity of kerogen particles than laminated oil shale. Such variations may produce different pyrolysis reactions when each shale type is retorted.

  15. Major heavy oil deposits are present in Lower Cretaceous strata of west-central Saskatchewan. The Winter Heavy Oil Pool (approximately 566 044 mmbl) consists of bitumen-rich sands from the AptianAlbian Dina and Cummings members of

    E-Print Network [OSTI]

    ABSTRACT Major heavy oil deposits are present in Lower Cretaceous strata of west-central Saskatchewan. The Winter Heavy Oil Pool (approximately 566 044 mmbl) consists of bitumen-rich sands from-level rise (Cummings Member). Exploitable heavy oil reservoirs are contained within these incised valley

  16. Please find the informal translation by Tomoko of the report given by Mr. Omi and the Knowledgeable Members of the Council of Science & Technology Policy which was submitted and discussed at the Council of Science & Technology

    E-Print Network [OSTI]

    Please find the informal translation by Tomoko of the report given by Mr. Omi and the Knowledgeable Members of the Council of Science & Technology Policy which was submitted and discussed at the Council of Science & Technology Policy chaired by Prime Minister on 25 December, 2001. Mr. Koizumi as well

  17. As a significant outcome of the SELECT program, Peer Mentors Team started to call out for all those SELECT members interested in being a Peer Mentor to join the team with the vision of a high

    E-Print Network [OSTI]

    Bone, Gary

    Page1 As a significant outcome of the SELECT program, Peer Mentors Team started to call out for all those SELECT members interested in being a Peer Mentor to join the team with the vision of a high performance team of student leaders who mentor Engineering undergraduate students. The Mission of the team

  18. Phase II - Procurement of State of the Art Research Equipment to Support Faculty Members with the RNA Therapeutics Institute, a component of the Advanced Therapeutics Cluster at the University of Massachusetts Medical School

    SciTech Connect (OSTI)

    Moore, Melissa


    This project supported the continued development of the RNA Therapeutics Institute at the UMass Medical School. This funding allows for the purchase of critical equipment that will enable faculty members to develop RNA technology in order to better understand the complexity that separates genome sequence from biological function, as well as to reduce the hyperactivity of harmful genes.

  19. TN Consolidated Retirement System (TCRS) Benefit Estimate Request If you are a member of TCRS and an employee at the University of Memphis, you may request an estimate of your

    E-Print Network [OSTI]

    Dasgupta, Dipankar

    years of service OR at least 30 years of service) o Early Retirement (age 55 with at least 5 years TN Consolidated Retirement System (TCRS) Benefit Estimate Request If you are a member of TCRS and an employee at the University of Memphis, you may request an estimate of your retirement benefit by providing


    E-Print Network [OSTI]

    Thompson, Jesse David


    there is no upward-climbing geometry at the top of the Mount Garfield Formation, and the Rollins Sandstone Member and the Cameo Wheeler coal zone (of the Williams Fork Formation) are not time-equivalent units. The marine- shoreface deposits within the Rollins...

  1. If you are actively employed by a CHEIBA Trust Member employer and have an accident while traveling for college-approved business, this Travel Accident Insurance Plan protects you with

    E-Print Network [OSTI]

    - 54 - CHUBB If you are actively employed by a CHEIBA Trust Member employer and have an accident while traveling for college-approved business, this Travel Accident Insurance Plan protects you in death or dismemberment within 365 days of the date of the accident, the policy will pay as follows

  2. Double-stranded RNA interferes in a sequence-specific manner with the infection of representative members of the two viroid families

    SciTech Connect (OSTI)

    Carbonell, Alberto; Martinez de Alba, Angel-Emilio [Instituto de Biologia Molecular y Celular de Plantas (UPV-CSIC), Campus Universidad Politecnica, Avenida de los Naranjos, s/n, 46022 Valencia (Spain); Flores, Ricardo [Instituto de Biologia Molecular y Celular de Plantas (UPV-CSIC), Campus Universidad Politecnica, Avenida de los Naranjos, s/n, 46022 Valencia (Spain)], E-mail:; Gago, Selma [Instituto de Biologia Molecular y Celular de Plantas (UPV-CSIC), Campus Universidad Politecnica, Avenida de los Naranjos, s/n, 46022 Valencia (Spain)


    Infection by viroids, non-protein-coding circular RNAs, occurs with the accumulation of 21-24 nt viroid-derived small RNAs (vd-sRNAs) with characteristic properties of small interfering RNAs (siRNAs) associated to RNA silencing. The vd-sRNAs most likely derive from dicer-like (DCL) enzymes acting on viroid-specific dsRNA, the key elicitor of RNA silencing, or on the highly structured genomic RNA. Previously, viral dsRNAs delivered mechanically or agroinoculated have been shown to interfere with virus infection in a sequence-specific manner. Here, we report similar results with members of the two families of nuclear- and chloroplast-replicating viroids. Moreover, homologous vd-sRNAs co-delivered mechanically also interfered with one of the viroids examined. The interference was sequence-specific, temperature-dependent and, in some cases, also dependent on the dose of the co-inoculated dsRNA or vd-sRNAs. The sequence-specific nature of these effects suggests the involvement of the RNA induced silencing complex (RISC), which provides sequence specificity to RNA silencing machinery. Therefore, viroid titer in natural infections might be regulated by the concerted action of DCL and RISC. Viroids could have evolved their secondary structure as a compromise between resistance to DCL and RISC, which act preferentially against RNAs with compact and relaxed secondary structures, respectively. In addition, compartmentation, association with proteins or active replication might also help viroids to elude their host RNA silencing machinery.

  3. Members of a workshop at the tenth IAYC Conference, July 7, 2006 1. ge -hak -te le -ber, ge -fil -te -fish: sha-bes iz a far -ge -ni -gn

    E-Print Network [OSTI]

    Finkel, Raphael

    A SUDE Members of a workshop at the tenth IAYC Conference, July 7, 2006 = 90 4 4 1. ge - hak - te le - ber, ge - fil - te - fish: sha- bes iz a far - ge - ni - gn 2. kha - le gri - vn, ku - gl yoykh: ku - men on di ma - khe - to - nem. 3. shtru - dl, tsi - mes, zi - se kalte: a su - de vos men vet ge

  4. 3-D sedimentological and geophysical studies of clastic reservoir analogs: Facies architecture, reservoir properties, and flow behavior within delta front facies elements of the Cretaceous Wall Creek Member, Frontier Formation, Wyoming

    SciTech Connect (OSTI)

    Janok P. Bhattacharya; George A. McMechan


    This project examined the internal architecture of delta front sandstones at two locations within the Turonian-age Wall Creek Member of the Frontier Formation, in Wyoming. The project involved traditional outcrop field work integrated with core-data, and 2D and 3D ground penetrating radar (GPR) imaging from behind the outcrops. The fluid-flow engineering work, handled through a collaborative grant given to PI Chris White at LSU, focused on effects on fluid flow of late-stage calcite cement nodules in 3D. In addition to the extensive field component, the work funded 2 PhD students (Gani and Lee) and resulted in publication of 10 technical papers, 17 abstracts, and 4 internal field guides. PI Bhattacharya also funded an additional 3 PhD students that worked on the Wall Creek sandstone funded separately through an industrial consortium, two of whom graduated in the fall 2006 ((Sadeque and Vakarelov). These additional funds provided significant leverage to expand the work to include a regional stratigraphic synthesis of the Wall Creek Member of the Frontier Formation, in addition to the reservoir-scale studies that DOE directly funded. Awards given to PI Bhattacharya included the prestigious AAPG Distinguished Lecture Award, which involved a tour of about 25 Universities and Geological Societies in the US and Canada in the fall of 2005 and Spring of 2006. Bhattacharya gave two talks, one entitled “Applying Deltaic and Shallow Marine Outcrop Analogs to the Subsurface”, which highlighted the DOE sponsored work and the other titled “Martian River Deltas and the Origin of Life”. The outcrop analog talk was given at about 1/2 of the venues visited.

  5. User-Driven Frequency Scaling Arindam Mallik, Student Member, IEEE, Bin Lin, Gokhan Memik, Member, IEEE, Peter Dinda, Member, IEEE,

    E-Print Network [OSTI]

    Kuzmanovic, Aleksandar

    Scaling (DVFS), e.g, those used in current laptop and desktop computers. UDFS dynamically adapts CPU techniques through user studies conducted on a Pentium M laptop running Windows applications. The UDFS scheme supported by Department of Energy Award DE-FG02-05ER25691 and NSF Grants IIS- 0613568, CNS-0551639, CNS

  6. On Energy Security of Server Systems Zhenyu Wu, Member, IEEE, Mengjun Xie, Member, IEEE, and Haining Wang, Senior Member, IEEE

    E-Print Network [OSTI]

    Humphrey, Marty

    on server systems. Targeted solely at abusing server power consumption, energy attacks exhibit very INTRODUCTION POWER management is one of the critical issues for server systems nowadays. To date energy cost of server system power management has not yet been paid attention to. In this paper, we investigate energy

  7. Wind Aggregation Via Risky Power Markets Yue Zhao, Member, IEEE, Junjie Qin, Student Member, IEEE, Ram Rajagopal, Member, IEEE,

    E-Print Network [OSTI]

    Zhao, Yue

    generation and locational marginal price data for ten WPPs in the PJM interconnection. Index Terms competitive equilibrium (CE), characterized in closed form. The marginal contribution and diversity when the wind penetration level is high. This is because, the cost of increased reserve margin

  8. Application-Bypass Reduction for Large-Scale Adam Wagner, Member, IEEE, Darius Buntinas, Member, IEEE, Ron Brightwell, Member, IEEE,

    E-Print Network [OSTI]

    Panda, Dhabaleswar K.

    of Energy's Grant #DE=FC02- 01ER25506, National Science Foundation's grant #EIA-9986052 increases with system size, indicating that the application-bypass implementation is more scalable and skew or skewed. This may happen for a variety of reasons including heterogeneous systems consisting of nodes

  9. Coverage control for mobile sensing networks Jorge Cortes, Member IEEE, Sonia Martinez, Member IEEE, Timur Karatas, Francesco Bullo, Member IEEE

    E-Print Network [OSTI]

    Bullo, Francesco

    monitoring for pollution detection and estimation. The potential advantages of employing teams of agents. The vehicles are equipped with sensors for vibrations, acoustic, magnetic, and IR signals as well as an active. The vehicles communicate via an acoustic local area Submitted on November 4, 2002, revised on June 16, 2003

  10. Load forecasting for active distribution networks Simone Paoletti, Member, IEEE, Marco Casini, Member, IEEE, Antonio Giannitrapani, Member, IEEE,

    E-Print Network [OSTI]

    Giannitrapani, Antonello

    opportunity for solving network constraints and supporting the development of renewable energy sources through- creased accessibility of renewable energy resources to end users have triggered new concepts Distribution network with full integration of Demand and distributed energy RESourceS and its target

  11. Frequent Item Computation on a Chip Jens Teubner, Member, IEEE, Rene Mueller, Member, IEEE, and Gustavo Alonso, Member, IEEE

    E-Print Network [OSTI]

    Teubner, Jens

    with modern CPU architectures are well known: high power consump- tion, heat dissipation, network bottlenecks (network- CPU, disk-CPU) to reduce the load and amount of data that hits the CPU [3]. What makes FPGAs operation, the calculation of frequent items in a data collection, and show how it can be implemented using

  12. IMS Member's Publications DOUGLAS J. ADAMS

    E-Print Network [OSTI]

    Lozano-Robledo, Alvaro

    -based Analysis of Bench-Scale Fixed-Bed Units for Chemical-Looping Combustion, Chem.Eng. J., 233, 331. Han, L Zhou, Z., Han, L., & Bollas, G.M., (2014), Overview of Chemical-Looping Reduction in Fixed Bed and Fluidized Bed Reactors Focused on Oxygen Carrier Utilization and Reactor Efficiency, Aerosol Air Qual. Res

  13. Theme 3 Members | Photosynthetic Antenna Research Center

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Research Associate E-mail: Phone: 215.898.5668 P. Leslie Dutton P. Leslie Dutton Principal Investigator E-mail: Phone:...

  14. Indian Institute of Technology, Faculty Members -Profiles

    E-Print Network [OSTI]

    Krishnapura, Nagendra

    based programs (M.Tech, Dual Degree and B.Tech). Back to top #12;Research Areas AERODYNAMICS: Subsonic for Numerical Methods in Gas Dynamics and Computational Fluid Dynamics Vortex Dynamics, Supersonic Mixing and Combustion Optical Flow Diagnostics AEROSPACE PROPULTION: Rocket Propulsion and Solid Propellant Combustion

  15. Charter Members History of Pi Mu Epsilon

    E-Print Network [OSTI]

    Feingold, Alex

    Daniel Frey Jacob P. Gagnon Brittany Marie Grenzig James M Grippe Risa Gul Matthew Joseph Hems Nicholas S Guzman Matthew E. Hassell Kevin A. Kass Adam A. Sasson Prof. Dmytro Savchuk Jessica M. Tchorowski Prof Joining in 2014 Daniel Irmihaev Taylor Rose Juran Garreth Joshua Kaplan Navdep Kaur Colleen Kearney


    E-Print Network [OSTI]

    Guiltinan, Mark



    E-Print Network [OSTI]

    Guiltinan, Mark


  18. Prof. Cha & lab members in Swiss Alps

    E-Print Network [OSTI]

    Kim, Taejeong

    Prof Cha) -- Financial support & access to research issues of SAP-internal project -- Early test-core-parallel memory DB in a blade -- 2TB DRAM & 4X8 cores (in 2009) 20 TB & 4X80 cores (by 2015) -- enabled by Intel Nehalem EX 8-core proc and Samsung's 32GB memory Cloud-scale (Google-like) data parallelism over 1K blades

  19. NNSA Staff Member Receives NNSA Recognition

    SciTech Connect (OSTI)

    Specht, Elaine S.


    This article is intended for publication in the NNSA Nonproliferation and International Security (NIS) Highlights, a quarterly newsletter available in print and e-form. It will be published on the NNSA website and is intended for public release.


    E-Print Network [OSTI]

    - No Lockout 30 Article 32 Paychecks 31 Article 33 Training 31 Article 34 Mediation Program 32 Article 35

  1. (Original Signature of Member) 109TH CONGRESS

    E-Print Network [OSTI]

    . 404. Solar. Sec. 405. Bioenergy programs. Sec. 406. Wind. Sec. 407. Geothermal. Sec. 408. Photovoltaic Plant Program Sec. 531. Definitions. Sec. 532. Next generation nuclear power plant. Sec. 533. Advisory

  2. Member, District #9 Board of Supervisors

    E-Print Network [OSTI]

    Kammen, Daniel M.

    and building 360 Megawatts of new solar photovoltaic installations, distributed generation such as fuel cells, wind turbines, hydrogen, and energy efficiency and conservation technologies as standard components

  3. Pamela H. Fleming Assistant Staff Member

    E-Print Network [OSTI]

    Pennycook, Steve

    Division, ORNL 1976­2005 Technical Associate, Semiconductor Physics & Photovoltaic Materials Group, Solid and Demonstrating a Simple Thick-film Hydrogen Sensor and Commercializing the Products to Manufacture It," ORNL 1992 Portable Hydrogen Detector R&D IR-100 Award Nomination, ORNL 1990 Technical Achievement Award, Co

  4. NNSA Staff Member Receives NNSA Recognition

    SciTech Connect (OSTI)

    Specht, Elaine S.


    This article is intended for publication in the NNSA Nonproliferation and International Security (NIS) Highlights, a quarterly newsletter available in print and e-form. It will be published on the NNSA website and is intended for public release.

  5. Designing Textiles 4-H member will

    E-Print Network [OSTI]

    . FIBERS AND FABRIC Fabrics are made from either natural or synthetic fibers. Wool, STRUCTURES cotton are just some of the synthetic (man-made) fibers derived from various sources. These man-made fibers can be created from minerals, metals, rubber, or polymers (chemicals). Throughout history, each culture has made

  6. Faculty members from many different departments identify

    E-Print Network [OSTI]

    from database records. Yet many companies can use anonymized data to build detailed records management system (routers) is forced to use more energy to forward and receive data between computer, a precursor of today's Internet forums. He wrote the first book on Internet security, and is now creating

  7. Student author Faculty member outside the College

    E-Print Network [OSTI]

    Mohaghegh, Shahab

    .B. Celik, R.S. Gemmen+ , and A.V. Smirnov. 2004. A numerical study of cell-to- cell variations in a SOFC

  8. Dean's Council Members John Sizer, DC Chairman

    E-Print Network [OSTI]

    Weatherup Retired Chairman & CEO Pepsi-Cola, Co. Jeffrey Wincel Senior Director and Chief Procurement

  9. Dean's Council Members John Sizer, DC Chairman

    E-Print Network [OSTI]

    Reisslein, Martin

    President Grayhawk Development Craig Weatherup Retired Chairman & CEO Pepsi-Cola, Co. Jeffrey Wincel Sr

  10. (Original Signature of Member) 109TH CONGRESS

    E-Print Network [OSTI]

    Knowles, David William

    scientific understanding of new, energy-efficient mate- rials, as well as analyze the behavior of materials

  11. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Quantum Dot Photovoltaic Strategies Hunter McDaniel Center for Advanced Solar Photophysics, LANL Wednesday, October 31st, 1:30pm Chemistry Division Auditorium, TA-46, Bld. 535, Rm....

  12. SSRLUO 2015 Executive Committee Members | Stanford Synchrotron...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    months has used SSRL to determine structures of molecular machines involved in protein folding. His research focuses on the mechanisms discriminating alternative nascent...

  13. Dean's Council Members John Sizer, DC Chairman

    E-Print Network [OSTI]

    Shumway, John

    Cookson President Sony Pictures Technologies Jeffrey Cunningham Professor of Practice in Business. Michelle Tinsley General Manager, Personal Solutions Division Intel Corporation Gregg Tryhus President

  14. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Multiple Exciton Generation Solar Cells Joseph M. Luther Center for Advanced Solar Photophysics, National Renewable Energy Laboratory, Golden, CO Wednesday, October 24th, 3:00pm...

  15. MEMBER'S CIRCLE $2,500 and above

    E-Print Network [OSTI]

    Sabatini, David M.

    The Paul LoGerfo Medical Research and Education Trust John C. McCormick Fred Meyer Skip and Lyerka Miller and Doreen Porush Drs. Stanley and Elise Rose Margaret Sand Stephen and Bessie Seiler L. Dennis and Susan R. Lynn Dr. and Mrs. Irwin R. Merkatz Albert Meyer and Irene Greif Alexandra and Matthew Murray Herbert

  16. MEMBER HANDBOOK Klotsche Center and Pavilion

    E-Print Network [OSTI]

    Saldin, Dilano

    Rooms 8. Loss or Theft 9. Lost and Found 10. Personal Property 11. Plastic Water Bottles 12 within the Division of Student Affairs and manages the facilities and the recreational sport programs VALUES 3 II. GENERAL 3 1. Facilities 2. Location 3. Phone Numbers 4. Hours 5. Programming 6. Reservation

  17. Group Members:

    E-Print Network [OSTI]

    Wood, Stephen L.

    Project Ocean Propelled turbine energy system The oceans account for almost three fourths of the earth's surface. Off shore wind energy, wave energy, offshore solar energy, and ocean current energy are all great renewable energy sources that can be harvested from the ocean. An ocean current system such as the Gulf

  18. Altamaha Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnualProperty EditCalifornia: Energy Resources Jump to:Almo, Idaho: Energy ResourcesAlta IIIV

  19. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWPSuccess StoriesFebruaryMetal nanoparticlesCenterFirst CASP EFRC

  20. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWPSuccess StoriesFebruaryMetal nanoparticlesCenterFirst CASP

  1. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWPSuccess StoriesFebruaryMetal nanoparticlesCenterFirst CASPC-Division

  2. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWPSuccess StoriesFebruaryMetal nanoparticlesCenterFirst

  3. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWPSuccess StoriesFebruaryMetal nanoparticlesCenterFirstLectures This

  4. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWPSuccess StoriesFebruaryMetal nanoparticlesCenterFirstLectures

  5. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWPSuccess StoriesFebruaryMetal nanoparticlesCenterFirstLecturesVictor I.

  6. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWPSuccess StoriesFebruaryMetal nanoparticlesCenterFirstLecturesVictor

  7. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisiting the TWPSuccess StoriesFebruaryMetal

  8. Critical Materials Institute Affiliates Program MEMBER AGREEMENT

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625govInstrumentstdmadapInactiveVisitingContract Management Fermi Site OfficeCourse Clusters CourseN NRev. 1 Page 1 of

  9. Walton Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving YouKizildere IRaghuraji Agro IndustriesTown ofNationwide Permit webpageWalthall County, Mississippi: EnergyWaltonWalton

  10. Canoochee Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are beingZealand Jump to:EzfeedflagBiomassSustainableCSL GasPermits ManualCanisteo, New York: Energy

  11. Carroll Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are beingZealand Jump to:EzfeedflagBiomassSustainableCSL GasPermitsGreenCarrizo Energy Solar17193°,

  12. Excelsior Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are beingZealand JumpConceptual Model,DOEHazelPennsylvania: Energy Resources(RECP)Coolers

  13. TEC Working Group Members | Department of Energy

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOn April 23, 2014,ZaleskiThis Decision considers an Appeal ofIn1097 -Through the

  14. LLNL Distinguished Members of Technical Staff

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |Is Your Home asLCLS Experimental Run Schedules Check-InLIQUID

  15. Planters Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnual SiteofEvaluatingGroupPerfectenergy InternationalInformationPlacer County WaterPlanters

  16. Rutherford Elec Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnualProperty Edit with form HistoryRistma AG Jump to: navigation,RollsElectricRussian-UNEP

  17. Microsoft Word - panel members bios.doc

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directed offOCHCO2:Introduction toManagement of the National 93-4 AcquisitionO 231.1B Chg 1CAROL BATTERSHELL

  18. Microsoft Word - panel members bios.doc

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directed offOCHCO2:Introduction toManagement of the National 93-4 AcquisitionO 231.1B Chg 1CAROL

  19. Microsoft Word - panel members bios.doc

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directed offOCHCO2:Introduction toManagement of the National 93-4 AcquisitionO 231.1B Chg 1CAROLMATTHEW

  20. Hydraulic Institute Member Benefits | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directed off OPAM Flash2011-37EnergySubmit a Freedom ofof

  1. LEDSGP/about/members | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving YouKizildere I Geothermal Pwer Plant Jump to: navigation, searchLEDSGP/Transportationguidingstructure

  2. URTAC Committee Members | Department of Energy

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directed offOCHCO Overview OCHCOSystems Analysis Success|Sustainable Energy FutureUNIVERSITY OF4, 2015URTAC

  3. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced. C o w l i t z C o .FornlA Series ofTransformingCement

  4. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced. C o w l i t z C o .FornlA Series ofTransformingCementAndrei

  5. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced. C o w l i t z C o .FornlA Series ofTransformingCementAndreiSergei

  6. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced. C o w l i t z C o .FornlA Series

  7. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced. C o w l i t z C o .FornlA SeriesNanocrystal Quantum Dots:

  8. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced. C o w l i t z C o .FornlA SeriesNanocrystal Quantum Dots:The

  9. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced. C o w l i t z C o .FornlA SeriesNanocrystal Quantum Dots:TheUnder

  10. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced. C o w l i t z C o .FornlA SeriesNanocrystal Quantum

  11. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced. C o w l i t z C o .FornlA SeriesNanocrystal QuantumOptical

  12. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced. C o w l i t z C o .FornlA SeriesNanocrystal QuantumOpticalAuger

  13. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office511041clothAdvanced Materials Advanced. C o w l i t z C o .FornlA SeriesNanocrystal

  14. Gibson Electric Members Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are8COaBulkTransmissionSitingProcess.pdfGetec AG Contracting Jump to: navigation, searchAccess,

  15. Fermilab | Users' Executive Committee | Current Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power AdministrationField8,Dist.New Mexico Feb. 13, 2013FocusreceivesTraffic SafetyKressTune

  16. Ocmulgee Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnual SiteofEvaluatingGroup |JilinLuOpenNorth AmericaNorthwestOakdale ElectricOcean FlowOcmulgee

  17. Oconee Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnual SiteofEvaluatingGroup |JilinLuOpenNorth AmericaNorthwestOakdale ElectricOcean

  18. Pataula Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnual SiteofEvaluatingGroup |JilinLuOpenNorthOlympiaAnalysis) JumpPalcanPassiv SystemsPataula

  19. Piedmont Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnual SiteofEvaluatingGroupPerfectenergy International LimitedPhoenixPhotovoltech NV JumpPiedmont

  20. CMI Affiliate Members | Critical Materials Institute

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem NotEnergy,ARMForms About Batteries BatteriesCAES Home Home

  1. CMI Team Members | Critical Materials Institute

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem NotEnergy,ARMForms About Batteries BatteriesCAES HomeMaterials InstituteTeam

  2. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem NotEnergy,ARMForms About Batteriesmetal-organic frameworks |A photoCASPCall

  3. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem NotEnergy,ARMForms About Batteriesmetal-organic frameworks |A photoCASPCallMaterials

  4. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem NotEnergy,ARMForms About Batteriesmetal-organic frameworks |A

  5. Center for Advanced Solar Photophysics | Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742EnergyOnItem NotEnergy,ARMForms About Batteriesmetal-organic frameworks |ALooking for

  6. Cumberland Elec Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are beingZealand JumpConceptual Model, clickInformationNew|CoreCpWing County,Electric Coop,Cumberland Elec

  7. Readiness Review Training - Member | Department of Energy

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently AskedEnergy Small TeamNOT MEASUREMENT SENSITIVE,Department ofDocuments |

  8. Jackson Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnual SiteofEvaluatingGroup | OpenHunanInformation sourceInvensysIsland

  9. Jefferson Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnual SiteofEvaluatingGroup | OpenHunanInformationJames Watkins Jump to:JapanJatropha

  10. Midwest Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnual SiteofEvaluatingGroup |JilinLu anMicrogreen Polymers Inc Jump to:Jump to:MiddleMidwest

  11. Mitchell Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnual SiteofEvaluatingGroup |JilinLu anMicrogreen Polymers IncMississippi: EnergyMitchell Electric

  12. Sumter Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnualProperty Edit with formSoutheastern IL ElecStrategicStories HomeSumcoSumter Electric Coop,

  13. Tideland Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnualProperty Edit withTianlin Baxin Hydropower Station Jump to: navigation,

  14. Albemarle Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are beingZealand Jump to:Ezfeedflag JumpID-fTriWildcat 1AMEEAisin Seikiand TelephoneAlbemarle County, Virginia:

  15. Amicalola Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are beingZealand Jump to:Ezfeedflag JumpID-fTriWildcat Place:Alvan Blanch GreenAmerenSamoa:Amesville,Amicalola Electric

  16. Member Institutions | Photosynthetic Antenna Research Center

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC)Integrated Codes |IsLove Your Home andDispositionMechanicalAbout

  17. Valley Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnualProperty Edit withTianlin BaxinUmwelt Management AGUserVHF Technologies SAValley ElectricValley

  18. Walton Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnualProperty Edit withTianlin BaxinUmweltVillageGraph Home Wzeng'sVortexWagonerWallulaWalton

  19. Washington Elec Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnualProperty Edit withTianlin BaxinUmweltVillageGraph HomeWarana Group of CooperativesDC HomeElec

  20. Randolph Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving YouKizildere IRaghuraji Agro Industries Pvt Ltd Jump to: navigation, search Name:Rancia 2 GeothermalNorth

  1. Roanoke Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving YouKizildere IRaghuraji Agro Industries Pvt Ltd Jump to: navigation,MazeOhio: Energy ResourcesMaryland: EnergyCityElectric

  2. Upson Elec Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving YouKizildere IRaghuraji Agro IndustriesTown of Ladoga, IndianaTurtleCooperativeCROSS-VALIDATION OFNyack,UpsalUpsolar

  3. Coastal Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are beingZealand JumpConceptual Model, clickInformationNew York: Energy Resources

  4. Halifax Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnual SiteofEvaluating AGeothermal/ExplorationGoodsGuangzhou,GuizhouGuyana:HaeHalcyon Energy Pty

  5. Hart Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnual SiteofEvaluatingGroup | Open Energy Information HanergyHarney Electric Coop,Hart Electric

  6. Haywood Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnual SiteofEvaluatingGroup | Open Energy Information HanergyHarneysource History

  7. Brunswick Electric Member Corp | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page onYou are now leaving You are now leaving You are being directedAnnual Siteof EnergyInnovation in CarbonofBiotinsBostonBridger Valley05411°,BrowseBrunswick

  8. Auriacusite, Fe[superscript 3+]Cu[superscript 2+]AsO[subscript 4]O, the first M[superscript 3+] member of the olivenite group, from the Black Pine mine, Montana, USA

    SciTech Connect (OSTI)

    Mills, Stuart J.; Kampf, Anthony R.; Poirier, Glenn; Raudsepp, Mati; Steele, Ian M. (CMN); (NHM-LA); (UC); (UBC)


    Auriacusite, ideally Fe{sup 3+}Cu{sup 2+}AsO{sub 4}O, is a new arsenate mineral (IMA2009-037) and the Fe{sup 3+} analogue of olivenite, from the Black Pine mine, 14.5 km NW of Philipsburg, Granite Co., Montana, USA. It occurs lining quartz vughs and coating quartz crystals and is associated with segnitite, brochantite, malachite, tetrahedrite and pyrite. Auriacusite forms fibrous crystals up to about 5 {micro}m in width and up to about 100 {micro}m in length, which are intergrown to form fibrous mats. Individual crystals are a brownish golden yellow, whilst the fibrous mats are ochreous yellow. The crystals have a silky lustre and a brownish yellow streak. Mohs hardness is about 3 (estimated). The fracture is irregular and the tenacity is brittle. Auriacusite crystals are biaxial (+), with {alpha} = 1.830(5), {beta} = 1.865(5) and {gamma} = 1.910(5), measured using white light, and with 2V{sub meas.} = 83(3){sup o} and 2V{sub calc.} = 84.6{sup o}. Orientation: X = a, Y = c, Z = b. Crystals are nonpleochroic or too weakly so to be observed. The empirical formula (based on 5 O atoms) is (Fe{sub 1.33}{sup 3+}Cu{sub 0.85}Zn{sub 0.03}){sub {Sigma}2.21}(As{sub 0.51}Sb{sub 0.27}Si{sub 0.04}S{sub 0.02}Te{sub 0.01}){sub {Sigma}0.85}O{sub 5}. Auriacusite is orthorhombic, space group Pnnm, a = 8.6235(7), b = 8.2757(7), c = 5.9501(5) {angstrom}, V = 424.63(6) {angstrom}{sup 3}, Z = 4. The five strongest lines in the powder X-ray diffraction pattern are [d{sub obs} in {angstrom}/(I)/hkl]: 4.884/(100)/101, 001; 2.991/(92)/220; 2.476/(85)/311; 2.416/(83)/022; 2.669/(74)/221. The crystal structure was solved from single-crystal X-ray diffraction data utilising synchrotron radiation and refined to R{sub 1} = 0.1010 on the basis of 951 unique reflections with F {alpha} > 4{sigma}F. Auriacusite is identified as a member of the olivenite group with Fe{sup 3+} replacing Zn{sup 2+} or Cu{sup 2+} in trigonal bipyramidal coordination. Evidence suggests that auriacusite is an intermediate member between olivenite and an as yet undescribed Fe{sup 3+}Fe{sup 3+}-dominant member. The name is derived from the Latin auri (golden yellow) and acus (needle), in reference to its colour and crystal morphology.

  9. Ascofuranone stimulates expression of adiponectin and peroxisome proliferator activated receptor through the modulation of mitogen activated protein kinase family members in 3T3-L1, murine pre-adipocyte cell line

    SciTech Connect (OSTI)

    Chang, Young-Chae, E-mail: [Research Institute of Biomedical Engineering and Department of Medicine, Catholic University of Daegu School of Medicine, Daegu 705-718 (Korea, Republic of)] [Research Institute of Biomedical Engineering and Department of Medicine, Catholic University of Daegu School of Medicine, Daegu 705-718 (Korea, Republic of); Cho, Hyun-Ji, E-mail: [Research Institute of Biomedical Engineering and Department of Medicine, Catholic University of Daegu School of Medicine, Daegu 705-718 (Korea, Republic of)] [Research Institute of Biomedical Engineering and Department of Medicine, Catholic University of Daegu School of Medicine, Daegu 705-718 (Korea, Republic of)


    Highlights: Black-Right-Pointing-Pointer Ascofuranone increases expression of adiponectin and PPAR{gamma}. Black-Right-Pointing-Pointer Inhibitors for MEK and JNK increased the expression of adiponectin and PPAR{gamma}. Black-Right-Pointing-Pointer Ascofuranone significantly suppressed phosho-ERK, while increasing phospho-p38. -- Abstract: Ascofuranone, an isoprenoid antibiotic, was originally isolated as a hypolipidemic substance from a culture broth of the phytopathogenic fungus, Ascochyta visiae. Adiponectin is mainly synthesized by adipocytes. It relieves insulin resistance by decreasing the plasma triglycerides and improving glucose uptake, and has anti-atherogenic properties. Here, we found that ascofuranone increases expression of adiponectin and PPAR{gamma}, a major transcription factor for adiponectin, in 3T3-L1, murine pre-adipocytes cell line, without promoting accumulation of lipid droplets. Ascofuranone induced expression of adiponectin, and increases the promoter activity of adiponectin and PPRE, PPAR response element, as comparably as a PPAR{gamma} agonist, rosiglitazone, that stimulates lipid accumulation in the preadipocyte cell line. Moreover, inhibitors for MEK and JNK, like ascofuranone, considerably increased the expression of adiponectin and PPAR{gamma}, while a p38 inhibitor significantly suppressed. Ascofuranone significantly suppressed ERK phosphorylation, while increasing p38 phosphorylation, during adipocyte differentiation program. These results suggest that ascofuranone regulates the expression of adiponectin and PPAR{gamma} through the modulation of MAP kinase family members.

  10. 2011 AT&T Intellectual Property. All rights reserved. AT&T and the AT&T logo are trademarks of AT&T Intellectual Property. Whether family members are at work or school, in the same home or geographically separated, AT&T

    E-Print Network [OSTI]

    Greenberg, Albert

    plan to recharge your battery in case of power outages (e.g., charging via your car charger, extra be reached quickly to dial for help. Create IDs. Create photo IDs for every family member using the template aren't getting through. Keep your wireless phone batteries charged at all times. Have an alternate

  11. Path Planning for Deformable Linear Objects Mark Moll, Member, IEEE and Lydia E. Kavraki, Member, IEEE

    E-Print Network [OSTI]

    Kavraki, Lydia E.

    -like robots. Index Terms-- path planning, deformation, minimal-energy curves, modeling, differential geometry of a wire subject to manipulation constraints. These configurations correspond to minimal-energy curves. By restricting the planner to minimal-energy curves, the execution of a path becomes easier. Our curve

  12. Joint Manifolds for Data Fusion Mark A. Davenport, Student Member, IEEE, Chinmay Hegde, Student Member, IEEE

    E-Print Network [OSTI]

    . One way to cope with such a data deluge is to develop low-dimensional data models. Manifold models points and using multiple modalities. This can lead to a veritable data deluge, fueling the need

  13. GHECon Member Profile Grid Updated November 2013 (incl 26 of 34 current members)

    E-Print Network [OSTI]

    Derisi, Joseph

    - Policy, financing, and management of health care systems - Public private partnerships - Implementation of health reforms Africa, India, Latin America Diana Greene Foster, PhD Ob-Gyn, Health Policy (School of Medicine) - Family planning policy - Cost

  14. Modeling and Simulation of Power Electronic DRAGAN MAKSIMOVIC , MEMBER, IEEE, ALEKSANDAR M. STANKOVIC , MEMBER, IEEE,

    E-Print Network [OSTI]

    Stankoviæ, Aleksandar

    composed of semiconductor switches such as thyristors, MOSFETs, and diodes, along with passive elements, Mesquite, TX 75149 USA. G. C. Verghese is with the Massachusetts Institute of Technology, Cam- bridge, MA

  15. Molecular mechanics calculations of five-membered and pseudo-four-membered rings 

    E-Print Network [OSTI]

    Cooper, Carol Rae


    TO MODIFY EXiSTING MM2" FORCE FIELD VITA 76 92 ]01 109 122 128 132 134 134 138 146 163 166 LIST OF TABLES TABLE Page IH-1 Calculated components of steric energy for planar, C, and Cs conformations of cyclopentane. 20 III-2 Barriers... xolane. 42 III-13 Comparison of calculated structural parameters for planar, Csy 1, 3-dioxolane. III-14 Calculated components of steric energy for planar, C, and Cs conformations of silacyclopentane. 45 LIST OF TABLES (CONTINUED) TABLE Page Hl-15...

  16. Molecular mechanics calculations of five-membered and pseudo-four-membered rings

    E-Print Network [OSTI]

    Cooper, Carol Rae


    . 0]hept-6-ene. . . . . . 96 IV-6 Newman projection drawings of chair and boat conformations of bicyclic molecules. 107 IV-7 Boat, chair and half-planar conformations of tricyclo[3. 2. 1. 0' ]octane. 110 IV-8 Dihedral angles, c, p and r define... and C, ) 1. 2 1637 this work MM1 14 Ab-initio 3. 5 1644 1977 force field. 10 2225 1967 force field. 9 1669 6-31G basis set. 11 1808 2-D PE surface used. 8 MIRC, R 0 1824(50) Free pseudorot- 5 ation assumed. 2-D PE surface used. 1932 Free...


    E-Print Network [OSTI]

    Priestley, Jennifer Lewis

    statement of what they are trying to accomplish. As a result, the response data is at best meaningless not represent the views of the majority of the membership. And, reacting to the demands of a minority may to increased product/service usage and greater revenues. "Customer" surveys should also be common practice

  18. Metastable Walking Machines Katie Byl, Member, IEEE and Russ Tedrake, Member, IEEE

    E-Print Network [OSTI]

    Tedrake, Russ

    of stochastic stability - the mean first-passage-time - and compare its performance to a deterministic technically incorrect) to apply deterministic limit cycle stability analyses to our experimental walking mathematical tools from stochastic analysis to quantify and optimize stability. We examine two classic models

  19. Hierarchical Discriminant Regression Wey-Shiuan Hwang, Member, IEEE, and Juyang Weng, Member, IEEE

    E-Print Network [OSTI]

    library technology. A central task of a multimedia information system is to efficiently store, quickly features become useless when a car image database is presented. The designer has to find another set

  20. Appendix 2. Task Force Members Biographies Cherry A. Murray (SEAB Member and Task Force Chair)

    Broader source: (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently20,000 RussianBy:Whether you're a16-17,2-13) AllDepartmentof EnergyMarch 25,for athe

  1. GreenTouch Consortium Passes 50-Member Milestone, Adds Seven New Members

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOE Office of Science (SC) Environmental AssessmentsGeoffrey(SC)Graphite Reactor 'InGreenTouch Consortium

  2. 3D Sedimentological and geophysical studies of clastic reservoir analogs: Facies architecture, reservoir properties, and flow behavior within delta front facies elements of the Cretaceous Wall Creek Member, Frontier Formation, Wyoming

    SciTech Connect (OSTI)

    Christopher D. White


    Significant volumes of oil and gas occur in reservoirs formed by ancient river deltas. This has implications for the spatial distribution of rock types and the variation of transport properties. A between mudstones and sandstones may form baffles that influence productivity and recovery efficiency. Diagenetic processes such as compaction, dissolution, and cementation can also alter flow properties. A better understanding of these properties and improved methods will allow improved reservoir development planning and increased recovery of oil and gas from deltaic reservoirs. Surface exposures of ancient deltaic rocks provide a high-resolution view of variability. Insights gleaned from these exposures can be used to model analogous reservoirs, for which data is sparser. The Frontier Formation in central Wyoming provides an opportunity for high-resolution models. The same rocks exposed in the Tisdale anticline are productive in nearby oil fields. Kilometers of exposure are accessible, and bedding-plane exposures allow use of high-resolution ground-penetrating radar. This study combined geologic interpretations, maps, vertical sections, core data, and ground-penetrating radar to construct geostatistical and flow models. Strata-conforming grids were use to reproduce the observed geometries. A new Bayesian method integrates outcrop, core, and radar amplitude and phase data. The proposed method propagates measurement uncertainty and yields an ensemble of plausible models for calcite concretions. These concretions affect flow significantly. Models which integrate more have different flow responses from simpler models, as demonstrated an exhaustive two-dimensional reference image and in three dimensions. This method is simple to implement within widely available geostatistics packages. Significant volumes of oil and gas occur in reservoirs that are inferred to have been formed by ancient river deltas. This geologic setting has implications for the spatial distribution of rock types (\\Eg sandstones and mudstones) and the variation of transport properties (\\Eg permeability and porosity) within bodies of a particular rock type. Both basin-wide processes such as sea-level change and the autocyclicity of deltaic processes commonly cause deltaic reservoirs to have large variability in rock properties; in particular, alternations between mudstones and sandstones may form baffles and trends in rock body permeability can influence productivity and recovery efficiency. In addition, diagenetic processes such as compaction, dissolution, and cementation can alter the spatial pattern of flow properties. A better understanding of these properties, and improved methods to model the properties and their effects, will allow improved reservoir development planning and increased recovery of oil and gas from deltaic reservoirs. Surface exposures of ancient deltaic rocks provide a high resolution, low uncertainty view of subsurface variability. Patterns and insights gleaned from these exposures can be used to model analogous reservoirs, for which data is much sparser. This approach is particularly attractive when reservoir formations are exposed at the surface. The Frontier Formation in central Wyoming provides an opportunity for high resolution characterization. The same rocks exposed in the vicinity of the Tisdale anticline are productive in nearby oil fields, including Salt Creek. Many kilometers of good-quality exposure are accessible, and the common bedding-plane exposures allow use of shallow-penetration, high-resolution electromagnetic methods known as ground-penetrating radar. This study combined geologic interpretations, maps, vertical sections, core data, and ground-penetrating radar to construct high-resolution geostatistical and flow models for the Wall Creek Member of the Frontier Formation. Stratal-conforming grids were use to reproduce the progradational and aggradational geometries observed in outcrop and radar data. A new, Bayesian method integrates outcrop--derived statistics, core observations of concretions, and radar amplitude and

  3. Flexible, Stretchable Tactile Arrays From MEMS Barometers Leif P. Jentoft Student Member, IEEE, Yaroslav Tenzer Member, IEEE, Daniel Vogt Member, IEEE, Jia Liu,

    E-Print Network [OSTI]

    fitted with a Wheatstone bridge, a temperature sensor for thermal compensation, a high-quality instrumen Semiconductor Inc., Austin, TX, USA) [23]. It is inexpensive and some models are available at 1.13 USD (at time

  4. Sr{sub 7}Ge{sub 6}, Ba{sub 7}Ge{sub 6} and Ba{sub 3}Sn{sub 2} -Three new binary compounds containing dumbbells and four-membered chains of tetrel atoms with considerable Ge-Ge {pi}-bonding character

    SciTech Connect (OSTI)

    Siggelkow, Lisa; Hlukhyy, Viktor [Department Chemie, Technische Universitaet Muenchen, Lichtenbergstr. 4, D-85747 Garching (Germany); Faessler, Thomas F., E-mail: [Department Chemie, Technische Universitaet Muenchen, Lichtenbergstr. 4, D-85747 Garching (Germany)


    The germanides Sr{sub 7}Ge{sub 6} and Ba{sub 7}Ge{sub 6} as well as the stannide Ba{sub 3}Sn{sub 2} were prepared by arc melting and annealing in welded tantalum ampoules using induction as well as resistance furnaces. The compounds were investigated by powder and single crystal X-ray diffraction. Sr{sub 7}Ge{sub 6} and Ba{sub 7}Ge{sub 6} crystallize in the Ca{sub 7}Sn{sub 6} structure type (space group Pmna, Z=4: a=7.777(2) A, b=23.595(4) A, c=8.563(2) A, wR{sub 2}=0.081 (all data), 2175 independent reflections, 64 variable parameters for Sr{sub 7}Ge{sub 6} and a=8.0853(6) A, b=24.545(2) A, c=8.9782(8) A, wR{sub 2}=0.085 (all data), 2307 independent reflections, 64 variable parameters for Ba{sub 7}Ge{sub 6}). Ba{sub 3}Sn{sub 2} crystallizes in an own structure type with the space group P4{sub 3}2{sub 1}2, Z=4, a=6.6854(2) A, c=17.842(2) A, wR{sub 2}=0.037 (all data), 1163 independent reflections, 25 variable parameters. In Sr{sub 7}Ge{sub 6} and Ba{sub 7}Ge{sub 6} the Ge atoms are arranged as Ge{sub 2} dumbbells and Ge{sub 4} four-membered atom chains. Their crystal structures cannot be rationalized according to the (8-N) rule. In contrast, Ba{sub 3}Sn{sub 2} presents Sn{sub 2} dumbbells as a main structural motif and thereby can be described as an electron precise Zintl phase. The chemical bonding situation in these structures is discussed on the basis of partial and total Density Of States (DOS) curves, band structures including fatbands, topological analysis of the Electron Localization Function (ELF) as well as Bader analysis of the bond critical points using the programs TB-LMTO-ASA and WIEN2K. While Ba{sub 3}Sn{sub 2} reveals semiconducting behaviour, all germanides Ae{sub 7}Ge{sub 6} (Ae=Ca, Sr, and Ba) show metallic properties and a considerable {pi}-bonding character between the Ge atoms of the four-membered chains and the dumbbells. The {pi}-bonding character of the germanides is best reflected by the resonance hybrid structures {l_brace}[Ge-Ge]{sup 6-}/[Ge-{sup ....}Ge-{sup ....}Ge-{sup ....}Ge]{sup 8-}{r_brace}{r_reversible}{l_brace}[Ge=Ge]{sup 4-}/[Ge-Ge-Ge-Ge]{sup 10-}{r_brace}. - Graphical abstract: The structure of Ba{sub 3}Sn{sub 2} contains Sn{sub 2} dumbbells as a main structural motif and thereby can be described as an electron precise Zintl phase. Ge{sub 2} dumbbells and Ge{sub 4} four-membered atom chains are the predominant features in Sr{sub 7}Ge{sub 6} and Ba{sub 7}Ge{sub 6}. Their crystal structures cannot be rationalized according to the (8-N) rule. While Ba{sub 3}Sn{sub 2} reveals semiconducting behaviour, the germanides Ae{sub 7}Ge{sub 6} (Ae=Ca, Sr, and Ba) show metallic properties and a considerable {pi}-bonding character between the Ge atoms of the four-membered chains and the dumbbells. Highlights: Black-Right-Pointing-Pointer The germanides Sr{sub 7}Ge{sub 6} and Ba{sub 7}Ge{sub 6} as well as the stannide Ba{sub 3}Sn{sub 2} have been synthesized. Black-Right-Pointing-Pointer In Sr{sub 7}Ge{sub 6} and Ba{sub 7}Ge{sub 6} the Ge atoms are arranged as dumbbells and four-membered atom chains. Black-Right-Pointing-Pointer Ba{sub 3}Sn{sub 2} presents Sn{sub 2} dumbbells as a main structural motif. Black-Right-Pointing-Pointer The chemical bonding situation within these structures is discussed.

  5. General student union at SU > 20,000 members

    E-Print Network [OSTI]

    all over on the Internet! > Weekly newsletter (sent out every Friday) > Official website: http, cruises to Tallinn/Riga/Lapland, traditional Swedish dinner, trips outside Stockholm, museum visits, Club

  6. DEMEC Member Utilities- Green Energy Program Incentives (8 utilities)

    Broader source: [DOE]

    '''''Note: The municipal electric utilities serving New Castle, Clayton, Lewes, Middletown, Smyrna, and Seaford do not offer any rebates for individual renewable energy systems. Please see the...

  7. Global Nuclear Energy Partnership Members Convene in Jordan For...

    Office of Environmental Management (EM)

    United Kingdom and United States, as well as nine observer nations, Argentina, Germany, Belgium, Egypt, Mexico, Netherlands, Slovak Republic, South Africa, and Spain and...

  8. Global Nuclear Energy Partnership Steering Group Members Approve...

    Office of Environmental Management (EM)

    Algeria, Argentina, Australia, Bulgaria, Canada, China, Czech Republic, Egypt, France, Germany, Ghana, Italy, Japan, Jordan, Republic of Korea, Morocco, Netherlands, Nigeria,...

  9. Graduate Council Meeting Agenda TO: Members of the Graduate Council

    E-Print Network [OSTI]

    Chen, Keh-Hsun

    -25-10: Establishment of a Specialty in Addictions Counseling c. MDSK 4-09-2010a: Revision of the Master of Arts in Teaching for Middle & Secondary Ed d. MDSK 4-09-2010b: Proposal to revise the MAT in Teaching English as a Second Language (TESL) e. MDSK 4-09-2010c: Proposal to revise the M.Ed. in Teaching English as a Second

  10. 80th Annual Meeting, Fall 2005 / Welcome New Members

    E-Print Network [OSTI]

    ... halfway between Los Angeles and Santa Barbara near the Pacific Ocean. Camarillo is situated in the middle of the Oxnard Plains, a major ...

  11. Nuclear Waste Technical Review Board Members: Curricula Vitae

    E-Print Network [OSTI]

    , and private organizations, including the White House, Department of Energy, National Academy of Sciences and societies. In particular, he has served as president of the Ecological Society of America; president ecology, micro-environments, Alaskan tundra vegetation, and academic administration and research related

  12. Energy Secretary Moniz, Senator Alexander, other Members of Congress...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    WASHINGTON-On Friday, November 13, Secretary of Energy Ernest Moniz will join Senator Lamar Alexander of Tennessee and Representatives Eric Swalwell, Dan Lipinski, Chuck...

  13. NNSA Hosts Cybersecurity Consortium Members Following White House...

    National Nuclear Security Administration (NNSA)

    Livermore National Laboratory and Sandia National Laboratory in California and New Mexico. Vice President Biden and Secretary of Energy Ernest Moniz highlighted DOENNSA's...

  14. CALIFORNIA ENERGY COMMISSION Advisory Committee Members for the

    E-Print Network [OSTI]

    Propane Gas Association Joe Gershen ­ California Biodiesel Alliance (courtesy of Crimson Renewable Energy

  15. Attitudes and Opinions of Texas Agricultural Cooperative Members.

    E-Print Network [OSTI]

    Black, William E.; Knutson, Ronald D.


    by the manager rather than by the Board of Directors. This feeling was reflected in the respondents' comments regarding the need for a "better manager"; a call for "1f'ss power in the general manager"; and the comment "a strong manager can have too much... in the principles of cooperation. Philosophically, farmers indicate a strong belief in cooperatives as a solution to the farm problem, but that feeling may be only skin deep for many producers when it comes to purchasing their supplies or marketing...

  16. asian gang members: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    ? ?Trends in domestic energy needs and supply prospects, including the status of fossil-fuel subsidies and energy access. ? ?The central role that coal is set to play in fuelling...

  17. Welcome to the Winter 2010 UWAMIC Newsletter! Dear Members

    E-Print Network [OSTI]

    Evans, Paul G.

    in the cells of all living organisms, DNA is composed of two intertwined strands and contains the genetic should provide the incentive to invest in technology to make fuels from plants or other organic materials's Problems with Microbes Bacteriology professor Katrina Forest once considered studying architecture

  18. Comparative studies of diverged members of the phosphotriesterase family

    E-Print Network [OSTI]

    Arriens, Cristina Gale


    was verified by sequencing using PON1 specific primers, and then cloned into a plasmid named pTYB1 from the IMPACT-CN expression system. Expression was obtained using the BL21-star bacterial strain. The enzyme was found within an inclusion body...

  19. from the members: The naked truth of postdocs in Spain

    E-Print Network [OSTI]

    Jimenez-Valverde, Alberto; Acevedo, Pelayo


    cuts will cause “exodus” from Spain. Science, 336, 139-140.naked truth of postdocs in Spain With this letter we intendfellowship to later return to Spain thanks to another (


    E-Print Network [OSTI]

    Karonis, Nicholas T.

    , volleyball, tennis, and badminton - Cardio and strength training room - Weight lifting rooms - 3-lane, 1 in lobby with televisions - Nutrition and personal training - Table tennis area CHICK EVANS FIELD HOUSE - 2 with vending machines and big screen television GABEL POOL - Men's and Women's locker rooms - 5-lane, 25-meter

  1. Comparative studies of diverged members of the phosphotriesterase family 

    E-Print Network [OSTI]

    Arriens, Cristina Gale


    -ndel ponl-sap pon I -Gsap pon1-sap* pon1-sap+ CGGCTTCCGCATATGGCGAAGCTGATTGCG GCTCTTCCGCATTAGAGCTCACAGTAAAGAGC GGTGGTTGCTCTTCCGCATTAGAGCTCACAGT AAAGAGC GCTCTTCTCTGTTAGAGACAGTAAAGAGC CGGCTTATGGCATGGGTGCGCTCTTCTCTGTTA GAGACAGTAAAGAGC Reactions were... Technologies Lab of the Institute of Developmental /k Molecular for analysis. The sequencing protocol was repeated using internal primers PON I-201a and PONI-201 to obtain the complete sequence of the gene. INTRODUCTION OF RESTRICTION SITES Primers PONI-sap...

  2. mer School of Law faculty member Sumner M.

    E-Print Network [OSTI]

    Goldberg, Bennett

    that will kick-start the construction of an addition to LAW's main tower on the Charles River Campus. "On behalf assistant at the time, went on to become general counsel of National Amusements, the theatrical exhibition

  3. 1 National Academy of Engineering member 1Internationalacademymembers

    E-Print Network [OSTI]

    CREDIT HOURS (WSCH) SCH WSCH FY09 15,642 84,692 FY10 16,888 91,800 FY11 19,273 100,375 FY12 21,076 96

  4. No time lost in UBC Board of Governors member Stanley

    E-Print Network [OSTI]

    Farrell, Anthony P.

    expects to call tenders before the end of the year for the new Home Economics Building to be built onthe


    E-Print Network [OSTI]

    THE INSURER, ITS AGENTS OR REPRESENTATIVES. AUTHORIZED REPRESENTATIVE INSURER A: INSURER B: INSURER C: INSURER between the issuing insurer(s), authorized representative or producer, and the certificate holder, nor

  6. Pultruded FRP Plank as Formwork and Reinforcement for Concrete Members

    E-Print Network [OSTI]

    Russell, Jeffrey S.

    and sand, were epoxy bonded to the planks. Concrete beams using the aggregate-coated FRP planks were plank specimens greater than the steel rebar reinforced control specimen. ACI 440 equations were found control in a new bridge deck that was constructed without any reinforcing bars in the concrete deck (also

  7. Public Meeting Commission Members TJ Glauthier, Co-Chair; Jared...

    Energy Savers [EERE]

    Director, National Renewable Energy Laboratory; Terry Michalske, Director, Savannah River National Laboratory Appropriations Staff: Douglas Clapp, Senate Appropriations...

  8. Nuclear Waste Technical Review Board Members: Curricula Vitae

    E-Print Network [OSTI]

    mines, and storage projects, primarily in the fields of engineering geology and rock mechanics as an international consultant in the planning, designing, and construction of shafts, tunnels, dams, underground and Scisson and the U.S. Atomic Energy Commission on the design of underground openings for nuclear tests

  9. Secretary of Energy Advisory Board Public Meeting Committee Members...

    Office of Environmental Management (EM)

    Co-Chair; Frances Beinecke, Rafael Bras, Albert Carnesale, Shirley Ann Jackson, Deborah Jin, Paul Joskow, Arun Majumdar, Michael McQuade, Richard Meserve, Cherry Murray, Carmichael...

  10. Norman Spinrad Your Majesty; members of the Swedish

    E-Print Network [OSTI]

    Cai, Long

    coop and zoo! The methane brewed out of it with simple solar collectors and panels heating the great

  11. Independent Scientific Advisory Board: Member Resume Charles C. Coutant

    E-Print Network [OSTI]

    and ecology. Thermal ecology. Fish passage. Striped bass ecology. Effects of power plants on aquatic life, Washington, DC. (C. Coutant, author) Coutant, C. C., and R. R. Whitney. 2000. Fish behavior in relation. Coutant, C. C. 1985. Striped bass, temperature, and dissolved oxygen: a speculative hypothesis

  12. 06/18/01 23 Members of Steering Committee

    E-Print Network [OSTI]

    savings will be squandered on cooling losses unless the refrigeration system is very small. Cables have Cryogenics Needs of Future HTS Electric Power Equipment July 22, 1998 This workshop addressed the question: Will practical cryogenic refrigerators be available to meet the needs of emerging superconducting power systems

  13. Group Members Synthesis of Nanostructured Materials Advanced Characterization Techniques

    E-Print Network [OSTI]

    of nanostructured materials. · Applications in nanophotonics, nanoelectronics, and energy. Experimental techniques, S. Gradecak,"Graphene cathode-based ZnO nanowire hybrid solar cells", Nano Letters 13, 233-239 (2013 particle composition to control structural and optical properties of GaN nanowires", Nanotechnology 23

  14. Appendix 4. Board Member Compensation PA State Board

    E-Print Network [OSTI]

    Sibille, Etienne

    Agricultural Advisory Board 1 Agricultural Land Preservation Board, State 1 Agricultural Lands Condemnation for Water and Wastewater Systems and Operators, State Board for 1 Certified Real Estate Appraisers, State

  15. Minnesota Member Lists the Twin Cities' First Energy Fit Certified...

    Broader source: (indexed) [DOE]

    upgraded the 1,774-square-foot house, built in 1952, with a high-efficiency furnace and water heater, attic insulation, and energy-efficient lighting to earn the program's Energy...

  16. apec member countries: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    all aspects of unknown authors 5 Energy Efficiency Potential for Distribution Transformers in the APEC Economies University of California eScholarship Repository Summary:...

  17. Arlington High School Team Members: Joanna Abouezzi, Eric Lei,

    E-Print Network [OSTI]

    Canham, Charles D.

    tend to thrive in high salinity areas. · Blue crabs, striped bass and banded killifish seem to prosper developed a fun and educational game for the festival day requiring children or adults to use the knowledge

  18. advisory committee members: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Combined Cycle Combustion Turbines, Simple Cycle Combustion Upcoming Resources - Energy Storage, Modular Nuclear 2 12;Role of GRAC Advisory committee established to assist...


    E-Print Network [OSTI]

    Oyet, Alwell

    , School of Graduate Studies Dr. Linda Hensman: Director, School of Pharmacy Ms. Karen Kennedy: Director. Christopher Kovacs: Faculty of Medicine Dr. Donald McKay: Faculty of Medicine Dr. Karen Mearow: Faculty of Medicine #12;Dr. Amin Ali Muhammad: Faculty of Medicine Dr. P. Peter Wang: Faculty of Medicine Dr. Robert

  20. alfarcito member santa: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Interface for Cryogenic Imaging Arrays for the initial support of this work under the Raytheon University Research program and subsequent joint funding under the UC MICRO program....