Powered by Deep Web Technologies
Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Md. Saifur Rahaman Md. Saifur Rahaman  

E-Print Network (OSTI)

of Chemical and Environmental Engineering "Environmental Applications of Nanotechnology" Advisor: ProfMd. Saifur Rahaman Resume 1 Md. Saifur Rahaman Department of Chemical and Environmental Engineering from Wastewater through Struvite Crystallization in a Fluidized Bed Reactor: Kinetics, Hydrodynamics

Elimelech, Menachem


Local Restaurants - Gaithersburg, MD  

Science Conference Proceedings (OSTI)

... Subway 16 Bureau Dr. Gaithersburg, MD (301) 527-8988. Thai Tanium 657 Center Point Way Gaithersburg, MD (301) 990-3699. ...



US ENC WI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

120 120 US ENC WI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC WI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC WI Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 US ENC WI Expenditures dollars ELECTRICITY ONLY average per household * Wisconsin households use 103 million Btu of energy per home, 15% more than the U.S. average. * Lower electricity and natural gas rates compared to states with a similar climate, such as New York, result in households spending 5% less for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC WI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

120 120 US ENC WI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC WI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC WI Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 US ENC WI Expenditures dollars ELECTRICITY ONLY average per household * Wisconsin households use 103 million Btu of energy per home, 15% more than the U.S. average. * Lower electricity and natural gas rates compared to states with a similar climate, such as New York, result in households spending 5% less for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S.


WiFi-Nano: Reclaiming WiFi Efficiency Through 800 ns Eugenio Magistretti  

E-Print Network (OSTI)

WiFi-Nano: Reclaiming WiFi Efficiency Through 800 ns Slots Eugenio Magistretti Rice University of WiFi has deteriorated from over 80% at 1 Mbps to under 10% at 1 Gbps. In this paper, we propose WiFi-Nano, thereby reducing ack overhead. We validate the effectiveness of WiFi-Nano through im- plementation

Mellor-Crummey, John


WI Windinvest | Open Energy Information  

Open Energy Info (EERE)

WI Windinvest WI Windinvest Jump to: navigation, search Name WI Windinvest Place Westfalen, Germany Zip 48727 Sector Wind energy Product Westfalen based wind project developer Coordinates 43.992484°, -117.711985° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.992484,"lon":-117.711985,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Multiscale FEM-MD schema  

Science Conference Proceedings (OSTI)

... coupling finite element modeling (FEM) to atomistic Molecular Dynamics (MD) 1 ... for using extremely high (very unrealistic) indentation rates that are ...



Evansville WI (WWTP) | Open Energy Information  

Open Energy Info (EERE)

Evansville WI (WWTP) Evansville WI (WWTP) Jump to: navigation, search Name Evansville WI (WWTP) Facility Evansville WI (WWTP) Sector Wind energy Facility Type Small Scale Wind Facility Status In Service Owner Evansville WI (WWTP) Energy Purchaser Evansville WI (WWTP) Location Evansville WI Coordinates 42.77765315°, -89.28004146° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.77765315,"lon":-89.28004146,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Scheduling in multihop WiMAX networks  

Science Conference Proceedings (OSTI)

IEEE 802.16, popularly known as WiMAX, is at the forefront of the technology drive because of the growing demand for high-speed wireless broadband networks. Multihop WiMAX networks are particularly useful as they increase the coverage area without the ...

Debalina Ghosh; Ashima Gupta; Prasant Mohapatra



Category:Baltimore, MD | Open Energy Information  

Open Energy Info (EERE)

MD MD Jump to: navigation, search Go Back to PV Economics By Location Media in category "Baltimore, MD" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Baltimore MD Baltimore Gas & Electric Co.png SVFullServiceRestauran... 69 KB SVQuickServiceRestaurant Baltimore MD Baltimore Gas & Electric Co.png SVQuickServiceRestaura... 67 KB SVHospital Baltimore MD Baltimore Gas & Electric Co.png SVHospital Baltimore M... 69 KB SVLargeHotel Baltimore MD Baltimore Gas & Electric Co.png SVLargeHotel Baltimore... 69 KB SVLargeOffice Baltimore MD Baltimore Gas & Electric Co.png SVLargeOffice Baltimor... 69 KB SVMediumOffice Baltimore MD Baltimore Gas & Electric Co.png SVMediumOffice Baltimo... 68 KB SVMidriseApartment Baltimore MD Baltimore Gas & Electric Co.png


What is MoWiTT  

NLE Websites -- All DOE Office Websites (Extended Search)

the net energy flow through two window samples in side-by-side tests using ambient weather conditions. MoWiTT characterizes the net energy flow as a function of time and...


Category:Green Bay, WI | Open Energy Information  

Open Energy Info (EERE)

WI WI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Green Bay, WI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Green Bay WI Wisconsin Electric Power Co.png SVFullServiceRestauran... 79 KB SVQuickServiceRestaurant Green Bay WI Wisconsin Electric Power Co.png SVQuickServiceRestaura... 79 KB SVHospital Green Bay WI Wisconsin Electric Power Co.png SVHospital Green Bay W... 79 KB SVLargeHotel Green Bay WI Wisconsin Electric Power Co.png SVLargeHotel Green Bay... 78 KB SVLargeOffice Green Bay WI Wisconsin Electric Power Co.png SVLargeOffice Green Ba... 90 KB SVMediumOffice Green Bay WI Wisconsin Electric Power Co.png SVMediumOffice Green B... 78 KB SVMidriseApartment Green Bay WI Wisconsin Electric Power Co.png


MoWiTT: The Mobile Window Thermal Test Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

Airflow schematic MoWiTT: The Mobile Window Thermal Test Facility In the MoWiTT facility, efficient window-and-frame systems are measured to understand the flow of energy through...


An efficient security framework for mobile WiMAX  

Science Conference Proceedings (OSTI)

WiMAX is a technology that provides continuous high data throughput with low delays for various user types and modes of operation. The security protocols proposed for WiMAX impose a heavy performance overhead, especially on mobile subscribers running ... Keywords: PKMv2, WiMAX, handover, hierarcical identity based cryptography, security

Mete Rodoper; Arati Baliga; Edward Jung; Wade Trappe



Harvesting graphics power for MD simulations  

E-Print Network (OSTI)

We discuss an implementation of molecular dynamics (MD) simulations on a graphic processing unit (GPU) in the NVIDIA CUDA language. We tested our code on a modern GPU, the NVIDIA GeForce 8800 GTX. Results for two MD algorithms suitable for short-ranged and long-ranged interactions, and a congruential shift random number generator are presented. The performance of the GPU's is compared to their main processor counterpart. We achieve speedups of up to 80, 40 and 150 fold, respectively. With newest generation of GPU's one can run standard MD simulations at 10^7 flops/$.

J. A. van Meel; A. Arnold; D. Frenkel; S. F. Portegies Zwart; R. G. Belleman



Utilizing WiMAX mesh mode for efficient IPTV transmission  

Science Conference Proceedings (OSTI)

Providing high bit-rates, WiMAX enables IPTV multicasting for several simultaneous broadcasting channels. WiMAX base stations can offer higher capacity to users with better signal quality values, and more robust but lower capacity modulations to users ... Keywords: iptv, mesh mode, multicasting, wimax

Murat Ozyurt; Seckin Ulug; Tuna Tugcu



Detecting transmission power misbehaviour in wi-fi networks  

Science Conference Proceedings (OSTI)

In Wi-Fi networks, transmission (TX) power levels are constrained by regulatory limits. However, the emergence of flexible MAC drivers allows the easy modification of PHY and MAC layer parameters. This has enabled users to attempt to violate these limits. ... Keywords: EIRP, Wi-Fi, detection, misbehaviour, transmission power

Szymon Szott, Marek Sikora, Marek Natkaniec, Krzysztof Loziak



Spontaneous fission of /sup 259/Md  

SciTech Connect

The mass and kinetic energy distributions of fission fragments from the spontaneous fission of th newly discovered nuclide /sup 259/Md were obtained. /sup 259/Md was identified as the E. C. daughter of /sup 259/No, and was found to decay entirely (> 95%) by spontaneous fission with a 95-min half-life. From the kinetic energies measured for 397 pairs of coincident fragments, a mass distribution was derived that is symmetric with sigma = 13 amu. /sup 259/Md, together with /sup 258/Fm and /sup 259/Fm, form a select group of three nuclides whose mass division in spontaneous fission is highly symmetric. Unlike the total-kinetic-energy (TKE) distributions of /sup 258/Fm and /sup 259/Fm, which peak at approx. = to 240 MeV, this distribution for /sup 259/Md is broad and is 50 MeV lower in energy. Analysis of the mass and energy distributions shows that events near mass symmetry also exhibit a broad TKE distribution, with one-third of the symmetric events having TKEs less than 200 MeV. The associated of low TKEs with symmetric mass division in the fission of very heavy actinides is anomalous and inconsistent with theories based upon the emergence of fragment shells near the scission point. Either three-body fragmentation or peculiar fragment shapes are assumed as the cause for the large consumption of Coulomb energy observed for a significant fraction of symmetric fissions in /sup 259/Md. 6 figures.

Hulet, E.K.; Wild, J.F.; Lougheed, R.W.; Baisden, P.A.; Landrum, J.H.; Dougan, R.J.; Mustafa, M.; Ghiorso, A.; Nitschke, J.M.



DOE - Office of Legacy Management -- Besley-Wells - Wisconsin - WI 03  

Office of Legacy Management (LM)

Besley-Wells - Wisconsin - WI 03 Besley-Wells - Wisconsin - WI 03 FUSRAP Considered Sites Site: Besley-Wells - Wisconsin (WI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Besley Products Co. WI.03-3 Location: Beloit , Wisconsin WI.03-1 Evaluation Year: 1994 WI.03-1 Site Operations: 1953 proposal for a trial lot of 500 uranium slugs to be machined by Besley double spindle wet grinder in order to compare production rate with that of current process; no indication proposed activities were carried out. WI.03-2 WI.03-3 Site Disposition: Eliminated - Potential for contamination considered remote based on the indication that proposed activities were not carried out WI.03-1 WI.03-3 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None WI.03-3


Compute Node MD3000 Storage Array  

E-Print Network (OSTI)

Compute Node MD3000 Storage Array Dell 2950 Head Node 24-Port Switch Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node 24-Port Switch Dell 2950

Weber, David J.

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Heart Failure Jason Ryan, MD, MPH  

E-Print Network (OSTI)

1 Heart Failure Jason Ryan, MD, MPH Director, UCONN Heart Failure Center University of Connecticut,084,000 $34.8 billion Background on Heart Failure Heart failure (HF) is a major public health problem resulting in substantial morbidity and mortality 1American Heart Association.2008 Heart and Stroke

Oliver, Douglas L.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

WI-TRIBE-STOCKBRIDGE-MUNSEE BAND OF MOHICAN INDIANS WI-TRIBE-STOCKBRIDGE-MUNSEE BAND OF MOHICAN INDIANS Location: Tribe WI-TRIBE- STOCKBRIDGE- MUNSEE BAND OF MOHICAN INDIANS WI American Recovery and Reinvestment Act: Proposed Action or Project Description The Stockbridge-Munsee Band of Mohican Indians proposes to conduct energy efficient audits of residential and commerical buildings. Conditions: None Categorical Exclusion(s) Applied: A9, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21 This action would not: threaten a violation of applicable statutory, regulatory, or permit requirements for environment, safety, and health, including DOE and/or Executive Orders; require siting, construction, or major expansion of waste storage, disposal, recovery, or


On the Construction of WiMax Mesh Tree  

E-Print Network (OSTI)

Abstract The IEEE 802.16 protocol, also known as WiMAX, has been designed to support long-range communications with high bitrates, using two operation modes: Point-to-Multi-Point (PMP) and Mesh. In the mesh mode, Subscriber Stations (SSs) can directly communicate with each other, thus forming a tree, and can be used to forward others data packets in a multihop fashion. On the contrary, in the PMP mode only one hop communication toward the Base Station (BS) is allowed. In this paper, we investigate the performance of the mesh mode by proposing an algorithm for constructing the WiMAX mesh tree. Our algorithm increases routes effective throughput by splitting long links into multiple shorter ones. We show through simulations that this approach leads to improving the throughput capacity of WiMAX-based wireless mesh networks. Index Terms WiMAX, wireless mesh networks. I.

Salim Nahle; Luigi Iannone; Benoit Donnet; Naceur Malouch



DOE - Office of Legacy Management -- Allis-Chalmers Co - WI 01  

Office of Legacy Management (LM)

Allis-Chalmers Co - WI 01 Allis-Chalmers Co - WI 01 FUSRAP Considered Sites Site: Allis-Chalmers Co (WI.01 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Hawley Plant WI.01-1 Location: Milwaukee , Wisconsin WI.01-1 Evaluation Year: 1987 WI.01-1 Site Operations: Manufactured electrical equipment - pumps, motors, and switchgears for K-25 and Y-12. WI.01-1 Site Disposition: Eliminated - Scope of testing activities were limited - Very small amounts of Uranium metal were used for testing - Potential for residual radioactive material on the site considered remote. WI.01-1 WI.01-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Test Quantities of Uranium Metal WI.01-1 Radiological Survey(s): None Indicated


Free Energy Calculation in MD Simulation  

E-Print Network (OSTI)

Free Energy Calculation in MD Simulation #12;Basic Thermodynamics Helmoholtz free energy A = U ­ TS + i Ni dA = wrev (reversible, const N V T) eq (22.9) McQuarrie & Simon Gibbs free energy G = U;Implication of Free Energy A B Keq = [A]/[B] Keq = exp (-G0 /RT) G0 = -RT ln Keq G = G0 + RT ln Q G > 0

Nielsen, Steven O.


DOE - Office of Legacy Management -- Johns Hopkins University - MD 02  

Office of Legacy Management (LM)

Johns Hopkins University - MD 02 Johns Hopkins University - MD 02 FUSRAP Considered Sites Site: JOHNS HOPKINS UNIVERSITY (MD.02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Baltimore , Maryland MD.02-1 Evaluation Year: 1987 MD.02-2 Site Operations: Conducted spectroscopic studies under contract number AT(49-1)-309. MD.02-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantities of material used in a controlled environment MD.02-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Tritium MD.02-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to JOHNS HOPKINS UNIVERSITY


DOE - Office of Legacy Management -- Trane Co - WI 0-02  

Office of Legacy Management (LM)

Trane Co - WI 0-02 Trane Co - WI 0-02 FUSRAP Considered Sites Site: TRANE CO. (WI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: LaCross , Wisconsin WI.0-02-1 Evaluation Year: 1987 WI.0-02-1 Site Operations: Produced Aluminum cans for fuel rod experiments at Argonne Met Lab; Supplied construction materials to Oak Ridge. WI.0-02-1 Site Disposition: Eliminated - No radioactive materials used at this site WI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None WI.0-02-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to TRANE CO. WI.0-02-1 - Memorandum/Checklist; A. Wallo to the File; (Elimination


DOE - Office of Legacy Management -- Maryland Disposal Site - MD 05  

Office of Legacy Management (LM)

Maryland Disposal Site - MD 05 Maryland Disposal Site - MD 05 FUSRAP Considered Sites Site: MARYLAND DISPOSAL SITE (MD.05 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Baltimore - Vicinity , Maryland MD.05-1 Evaluation Year: 1989 MD.05-1 Site Operations: Proposed disposal site - never developed. MD.05-1 Site Disposition: Eliminated Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Indicated Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MARYLAND DISPOSAL SITE MD.05-1 - Report (DOE/OR/20722-131 Revision 0); Site Plan for the Maryland Disposal Site; April 1989 Historical documents may contain links which are no longer valid or to


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


MoWiTT:Mobile Window Thermal Test Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 MoWiTT: Mobile Window Thermal Test Facility The window has come a long way since the days when it was a single pane of glass in a wood frame. Low-emissivity windows were designed to help buildings retain some of the energy that would have leaked out of less efficient windows. Designing efficient window-and-frame systems requires accurate measurement of the flow of energy through windows in realistic conditions, a capability provided by the Mobile Window Thermal Test facility. Consisting of a pair of outdoor, room-sized calorimeters, MoWiTT measures the net energy flow through two window samples in side-by-side tests using ambient weather conditions. MoWiTT characterizes the net energy flow as a function of time and measures the temperatures, solar fluxes, and


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


Fundamentals of WiMAX: Understanding Broadband Wireless Networking  

Science Conference Proceedings (OSTI)

This is the eBook version of the printed book. Praise for Fundamentals of WiMAX "This book is one of the most comprehensive books I have reviewed ... it is a must-read for engineers and students planning to remain current or who plan to pursue a career ...

Jeffrey Andrews; Arunabha Ghosh; Rias Muhamed



Oral Histories: Pathologist Clarence Lushbaugh, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

3 HUMAN RADIATION STUDIES: REMEMBERING THE EARLY YEARS Oral History of Pathologist Clarence Lushbaugh, M.D. Conducted October 5, 1994 United States Department of Energy Office of...


A survey of MAC based QoS implementations for WiMAX networks  

Science Conference Proceedings (OSTI)

We present a comprehensive survey of proposed Quality of Service (QoS) mechanisms in the Media Access Control (MAC) sublayer of WiMAX based wireless networks. QoS support in WiMAX is a fundamental design requirement, and is considerably more difficult ... Keywords: MAC, Media Access Control, QoS, Quality of Service, WiMAX, Wireless networks

Y. Ahmet ?ekercio?lu; Milosh Ivanovich; Alper Ye?in



QoS differentiation for IEEE 802.16 WiMAX mesh networking  

Science Conference Proceedings (OSTI)

Recently IEEE 802.16 WiMAX has attracted a lot of attention in wireless networking research and applications. To enable a flexible and cost-effective deployment, mesh networking mode is defined in WiMAX standard. In this paper, we introduce a system ... Keywords: IEEE 802.16, QoS, WiMAX mesh, interference-aware design, scheduling

Yan Zhang; Honglin Hu; Hsiao-Hwa Chen



A joint centralized scheduling and channel assignment scheme in WiMax mesh networks  

Science Conference Proceedings (OSTI)

The IEEE 802.16 standard, also known as Worldwide Interoperability for Microwave Access (WiMax), which provides a mechanism for deploying high-speed wireless mesh networks in metropolitan areas. Thus, Quality of Service (QoS) is very important for WiMax ... Keywords: MDFS algorithm, WiMax mesh networks, centralized scheduling, channel assignment

Yuliang Tang; Yan Yao; Xinrong Lin



DOE - Office of Legacy Management -- Max Zuckerman and Sons Inc - MD 04  

Office of Legacy Management (LM)

Inc - MD 04 Inc - MD 04 FUSRAP Considered Sites Site: MAX ZUCKERMAN & SONS, INC. (MD.04 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Maryland Alloys Corporation MD.04-1 Location: 5245 Fairlawn Avenue , Baltimore , Maryland MD.04-2 Evaluation Year: 1994 MD.04-1 MD.04-3 Site Operations: Scrap metals broker that arranged purchases of materials for third party buyers. MD.04-2 MD.04-4 Site Disposition: Eliminated - Potential for contamination remote MD.04-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium (Q-11) Oxide/Residue MD.04-2 MD.04-4 Radiological Survey(s): Yes MD.04-1 Site Status: Eliminated from consideration under FUSRAP MD.04-3 Also see Documents Related to MAX ZUCKERMAN & SONS, INC.


Net Zero Residential Test Facility Gaithersburg, MD Solar Photovoltaic Panels  

E-Print Network (OSTI)

1 Net Zero Residential Test Facility Gaithersburg, MD Solar Photovoltaic Panels Solar Thermal R-35 Rim Joist Area 5" open cell spray foam 2" mineral wool insulation blanket R-10 Basement Slab electric WH #12;NZERTF Gaithersburg, MD Solar Photovoltaic Array Roof Mounted South half of main roof

Oak Ridge National Laboratory

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Armco-Rustless Iron and Steel - MD 03  

Office of Legacy Management (LM)

Armco-Rustless Iron and Steel - MD Armco-Rustless Iron and Steel - MD 03 FUSRAP Considered Sites Site: Armco-Rustless Iron & Steel (MD.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: ARMCO Baltimore Works MD.03-1 Location: Baltimore , Maryland MD.03-2 Evaluation Year: 1987 MD.03-1 Site Operations: Test rolling of uranium billets. MD.03-2 MD.03-3 Site Disposition: Eliminated - Potential for contamination remote due to limited quantity of material and duration of test MD.03-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MD.03-2 Radiological Survey(s): Health and safety monitoring conducted during operations MD.03-2 Site Status: Eliminated from consideration under FUSRAP MD.03-1 Also see


MD. SAIFUR RAHAMAN 9 Hillhouse Ave., Environmental Engineering Program  

E-Print Network (OSTI)

of Chemical Engineering, Yale University Project: "Environmental implications and applications of engineeredMD. SAIFUR RAHAMAN 9 Hillhouse Ave., Environmental Engineering Program Department of Chemical Crystallization in a Fluidized Bed Reactor: Kinetics, Hydrodynamics and Performance" Supervisor: Professor Donald

Elimelech, Menachem


Cove Point, MD Natural Gas Liquefied Natural Gas Imports from...  

Gasoline and Diesel Fuel Update (EIA)

Trinidad and Tobago (Million Cubic Feet) Cove Point, MD Natural Gas Liquefied Natural Gas Imports from Trinidad and Tobago (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug...


Cove Point, MD Natural Gas Liquefied Natural Gas Imports from...  

Annual Energy Outlook 2012 (EIA)

Norway (Million Cubic Feet) Cove Point, MD Natural Gas Liquefied Natural Gas Imports from Norway (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011...


Cove Point, MD Natural Gas Liquefied Natural Gas Imports from...  

Annual Energy Outlook 2012 (EIA)

Nigeria (Million Cubic Feet) Cove Point, MD Natural Gas Liquefied Natural Gas Imports from Nigeria (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011...


Cove Point, MD Natural Gas Liquefied Natural Gas Imports from...  

U.S. Energy Information Administration (EIA) Indexed Site

Algeria (Million Cubic Feet) Cove Point, MD Natural Gas Liquefied Natural Gas Imports from Algeria (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6...


Cove Point, MD Natural Gas Liquefied Natural Gas Imports from...  

U.S. Energy Information Administration (EIA) Indexed Site

Egypt (Million Cubic Feet) Cove Point, MD Natural Gas Liquefied Natural Gas Imports from Egypt (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7...


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


Security Standards for the Global Information Grid Gary Buda, Booz Allen & Hamilton, Linthicum, MD 21090  

E-Print Network (OSTI)

, Telcordia Technologies, Morristown, NJ 07960 Chris Kubic, Department of Defense, Ft. Meade, MD, 20755

Lee, Ruby B.



Office of Legacy Management (LM)

J. A. QuigUy, M.D. J. A. QuigUy, M.D. NATIONALLPADCW~ OF oliI0 Cincbnati 39, Ohio September 23, 1960 TRIP RBPCRT TO PIONRBR DIVISION, BENDIX AVI4TIONC~ ION, DAVBNPQRT, SOWA,oNSEPTEMBR6-9,196O F. J. Klein CENTRAL FILE The purpose of this trip was tot (1) determine if a Bendix ronic energy cleaning system can clean uranium-contaminated drums to the extent of rcduciug the @ha ccmtazuinatiou level belav that required for sale as %oa-contaminatecl** by AEC Manual Chapter 5182-0s UOOO a dMlOO& average and at peak not more than 25,OOO a d~lOOcm2, and (2) observe . the health and safety aspects of the wotk and insure the adequate decontauimtiou of the machinery, tools, equi~t, aud teat area. This waa a wet operation Md the tauk waa not ventilated; hawever, should


Wireless wakeups revisited: energy management for voip over wi-fi smartphones  

Science Conference Proceedings (OSTI)

IP based telephony is rapidly gaining acceptance over traditional means of voice communication. Wireless LANs are also becoming ubiquitous due to their inherent ease of deployment and decreasing costs. In enterpriseWi-Fi environments, VoIP is a compelling ... Keywords: VoIP, Wi-Fi, cellular networks, power management, smartphones

Yuvraj Agarwal; Ranveer Chandra; Alec Wolman; Paramvir Bahl; Kevin Chin; Rajesh Gupta



Applications of WiMAX-based wireless mesh network in monitoring wind farms  

Science Conference Proceedings (OSTI)

This paper has studied the feasibility of applying World Interoperability for Microwave Access (WiMAX) based Wireless Mesh Networks (WMNs) in monitoring wind farms. WMNs provide a dynamic topology which meets the requirements of communications ... Keywords: WMNs, WiMAX, World Interoperability for Microwave Access, communications, renewable energy, simulation, wind energy, wind farm monitoring, wind farms, wind power, wireless mesh networks, wireless networks

Gang Zheng; Hongbing Xu; Xinheng Wang; Jianxiao Zou



Blue-Fi: enhancing Wi-Fi performance using bluetooth signals  

Science Conference Proceedings (OSTI)

Mobile devices are increasingly equipped with multiple network interfaces with complementary characteristics. In particular, the Wi-Fi interface has high throughput and transfer power efficiency, but its idle power consumption is prohibitive. In this ... Keywords: bluetooth, context-awareness, energy-efficiency, location, mobile device, wi-fi

Ganesh Ananthanarayanan; Ion Stoica



Citywide mobile internet access using dense urban WiFi coverage  

Science Conference Proceedings (OSTI)

We investigate if it is feasible to use the WiFi coverage in urban areas for mobile Internet access and which type of applications can benefit from the Internet access provided by the already deployed WiFi Access Points (APs). Nowadays, most smartphones ... Keywords: mobile clients, mobile internet access, wifi, wireless networks

Maria Eugenia Berezin; Franck Rousseau; Andrzej Duda



WiMAX Double Movable Boundary Scheme in the Vehicle to Infrastructure Communication Scenario  

Science Conference Proceedings (OSTI)

WiMAX is an interesting technology that will be applied in vehicular networks due to the provisioning of high mobility, wide coverage, and different classes of service. In this paper, we investigate the problem of vehicular applications mapping in the ... Keywords: Intelligent Transportation System, Quality of service, Scheduling, WiMAX

Rola Naja; Melhem El Helou; Samir Tohm



Beyond deployments and testbeds: experiences with public usage on vehicular WiFi hotspots  

Science Conference Proceedings (OSTI)

We describe our experiences with deploying a vehicular Internet access service on public transit buses. Our system, called WiRover, has been running on these buses since April 2010 for about 18 months till date providing a WiFi hotspot to which bus passengers ... Keywords: network diversity, vehicular connectivity, wireless, wirover

Joshua Hare; Lance Hartung; Suman Banerjee



Fast-converging scheduling and routing algorithms for WiMAX mesh networks  

Science Conference Proceedings (OSTI)

In this paper, we present fast converging algorithms that fit well WiMAX mesh networks. First, a centralized scheduling algorithm is presented. It calculates schedules by transforming the multi-hop tree into a single hop, and then repartitioning the ... Keywords: WiMAX, mesh networks, routing, scheduling

Salim Nahle; Naceur Malouch



Energy Management for the "WiFi of Things"  

NLE Websites -- All DOE Office Websites (Extended Search)

Energy Management for the "WiFi of Things" Energy Management for the "WiFi of Things" Speaker(s): Janet Peterson Date: May 6, 2010 - 12:00pm Location: 90-3122 This seminar will present an overview of the WiFi enabled energy management technologies pioneered by Our Home Spaces. Our Home Spaces provides consumer facing energy management solutions. These energy management solutions are based on using the existing consumer infrastructure and devices - this allows a lower cost of entry for both the utilities and less complexity in the home. Working with low cost low power WiFi chips from GainSpan and Marvell allow WiFi solutions to range from communicating thermostat, to energy monitoring and controlling smart plugs thru irrigation controllers. The system takes advantage of ubiquitous nature


A-GPS Assisted Wi-Fi Access Point Discovery on Mobile Devices for Energy Saving  

E-Print Network (OSTI)

Mobile devices have been shipped with multiple wireless network interfaces in order to meet their diverse communication and networking demands. In this paper, we propose an A-GPS assisted scheme that discovers the nearest Wi-Fi network access points (APs) by using user's location information. This allows the user to switch to the Wi-Fi interface in an intelligent manner when she/he arrives at the nearest Wi-Fi network AP. Therefore, it avoids the long periods in idle state and greatly reduces the number of unnecessary Wi-Fi scans on the mobile device. The experimental results demonstrate that our scheme effectively saves energy for mobile devices integrated with Wi-Fi and cellular interfaces.

Xia, Feng; Ding, Fangwei; Hao, Ruonan


Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...


Medical Scholars (BS/MD) Program Expectations and Requirements  

E-Print Network (OSTI)

Medical Scholars (BS/MD) Program Expectations and Requirements Undergraduate portion semester GPAs lower than 3.5 will trigger an automatic review by the Medical Scholars Committee of the Medical Scholars Committee, to delay their entry to medical school by one year to broaden their education

Fernandez, Eduardo


DOE - Office of Legacy Management -- Bendix Corp Frieze Division - MD 0-01  

Office of Legacy Management (LM)

Bendix Corp Frieze Division - MD Bendix Corp Frieze Division - MD 0-01 FUSRAP Considered Sites Site: BENDIX CORP., FRIEZE DIVISION (MD.0-01 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Baltimore , Maryland MD.0-01-1 Evaluation Year: 1987 MD.0-01-3 Site Operations: Produced "classified units" believed to be electronics components - no radioactive materials involved. MD.0-01-1 MD.0-01-3 Site Disposition: Eliminated - No radioactive materials handled at this site MD.0-01-3 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MD.0-01-3 Radiological Survey(s): No Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to BENDIX CORP., FRIEZE DIVISION


DOE - Office of Legacy Management -- Naval Ordnance Laboratory - MD 0-03  

Office of Legacy Management (LM)

Ordnance Laboratory - MD 0-03 Ordnance Laboratory - MD 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE LABORATORY (MD.0-03 ) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: Naval Ordnance Laboratory - White Oak Location: White Oak Area , Silver Spring , Maryland MD.0-03-1 MD.0-03-2 Evaluation Year: 1987 MD.0-03-2 Site Operations: Research and development - may have involved radioactive materials because the site was identified on a 1955 Accountability Station List. MD.0-03-1 Site Disposition: Eliminated - NRC licensed MD.0-03-2 Radioactive Materials Handled: None Specifically Identified Primary Radioactive Materials Handled: None specifically indicated Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD MD.0-03-2


Spectroscopic studies beyond N = 152 neutron gap : decay of {sup 255 ovr sub 101}Md and {sup 256 ovr sub 101}Md.  

Science Conference Proceedings (OSTI)

The isotopes {sup 255}Md and {sup 256}Md were produced by the irradiation of {sup 253}Es with 35-45 MeV {alpha} particles by ({alpha},n) and ({alpha},2n) reactions and were removed from the target by a helium jet system. {alpha}, {gamma}, and {alpha}-{gamma} coincidence spectra were measured with Si and Ge(Li) detectors. From the EC decays of {sup 255}Md and {sup 256}Md, levels in {sup 255}Fm and {sup 256}Fm were deduced. Favored {alpha} decay of {sup 255}Md was found to populate the 7/2{sup -}[514] single-particle state in {sup 251}Es, thus establishing the 7/2{sup -}[514] as the {sup 255}Md ground state. Several {gamma} rays were observed in the {sub 256}Md {alpha}-{gamma} coincidence spectrum. {sup 256}Fm is the heaviest nucleus in which excited intrinsic states have been identified.

Ahmad, I.; Chasman, R. R.; Fields, P. R.



Spectroscopic studies beyond the N=152 neutron gap: Decay of {sub 101}{sup 255}Md and {sub 101}{sup 256}Md  

Science Conference Proceedings (OSTI)

The isotopes {sup 255}Md and {sup 256}Md were produced by the irradiation of {sup 253}Es with 35-45 MeV {alpha} particles by ({alpha},n) and ({alpha},2n) reactions and were removed from the target by a helium jet system. {alpha}, {gamma}, and {alpha}-{gamma} coincidence spectra were measured with Si and Ge(Li) detectors. From the EC decays of {sup 255}Md and {sup 256}Md, levels in {sup 255}Fm and {sup 256}Fm were deduced. Favored {alpha} decay of {sup 255}Md was found to populate the 7/2{sup -}[514] single-particle state in {sup 251}Es, thus establishing the 7/2{sup -}[514] as the {sup 255}Md ground state. Several {gamma} rays were observed in the {sup 256}Md {alpha}-{gamma} coincidence spectrum. {sup 256}Fm is the heaviest nucleus in which excited intrinsic states have been identified. (c) 2000 The American Physical Society.

Ahmad, I. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Chasman, R. R. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Fields, P. R. [Argonne National Laboratory, Argonne, Illinois 60439 (United States)



DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


Super Wi-Fi is Super for Energy Too | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Super Wi-Fi is Super for Energy Too Super Wi-Fi is Super for Energy Too Super Wi-Fi is Super for Energy Too September 24, 2010 - 11:45am Addthis Super Wi-Fi is Super for Energy Too Nick Sinai Senior Advisor to the U.S. Chief Technology Officer, White House Office of Science and Technology Policy What does this mean for me? By integrating broadband into the emerging Smart Grid, consumers will have revolutionized communication with their utility -- they will have detailed information on their energy use that will help inform them how they can save on their electric bills. Editor's Note: Cross-posted from the National Broadband Plan blog, which deals with how broadband technology will integrate into the smart grid. We at the FCC are very excited about yesterday's order to free up the unused "white spaces" spectrum between television channels, intended to


Using unlabeled Wi-Fi scan data to discover occupancy patterns of private households  

Science Conference Proceedings (OSTI)

This poster presents the homeset algorithm, a lightweight approach to estimate occupancy schedules of private households. The algorithm relies on the mobile phones of households' occupants to collect Wi-Fi scans. The scans are then used to determine ...

Wilhelm Kleiminger, Christian Beckel, Anind Dey, Silvia Santini



Identified Patent Waiver W(I)2012-003 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

3 Identified Patent Waiver W(I)2012-003 This document waives certain patent rights the Department of Energy (DOE) has to inventions conceived or first actually reduced to practice...


Identified Patent Waiver W(I)2012-004 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4 Identified Patent Waiver W(I)2012-004 This document waives certain patent rights the Department of Energy (DOE) has to inventions conceived or first actually reduced to practice...


Identified Patent Waiver W(I)2012-005 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5 Identified Patent Waiver W(I)2012-005 This document waives certain patent rights the Department of Energy (DOE) has to inventions conceived or first actually reduced to practice...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Oral Histories: Oncologist Helen Vodopick, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

2 2 HUMAN RADIATION STUDIES: REMEMBERING THE EARLY YEARS Oral History of Oncologist Helen Vodopick, M.D. Conducted December 28, 1994 United States Department of Energy Office of Human Radiation Experiments August 1995 CONTENTS Foreword Short Biography Academic Fellowship at Oak Ridge Institute for Nuclear Studies (ORINS), 1960 Appointment to the Staff at ORINS Medical Division The Medium-Exposure-Rate Total Body Irradiator (METBI) ORINS Radioisotope Tracer Studies Participation by Regional Universities at Oak Ridge Associated Universities (ORAU) Treatment of Cancer Patients with the METBI Introduction of Immunotherapy Radiation Treatment for Leukemia Patients Bone Marrow Treatment of Leukemia Low-Exposure-Rate Total Body Irradiator (LETBI) Treatment of Radiation Accident Victims at ORAU


FI St Po Crypto IPS 140 tanley ortal Ga ograph 0-2 Sec Wi-Q ...  

Science Conference Proceedings (OSTI)

... Q Portal Gat ey Wi-Q Port a wireless ga Wi-Q Comm ry 802.15.4 on tested: 3. on tested: 12 tion ... he s the nts. Page 11. ... The PG d lf Test ower-Up ...



A study on the security, the performance and the penetration of Wi-Fi networks in a Greek urban area  

Science Conference Proceedings (OSTI)

This paper presents a study on the expansion of urbanWi-Fi networks and the degree of users' awareness about their characteristics. It involves an experiment contacted at the area of Serres, a Greek city of around 70,000 inhabitants. The findings revealed ... Keywords: Wi-Fi networks usage, urban networks, war driving, wireless security

Savvas Mousionis; Alex Vakaloudis; Constantinos Hilas



A Silence Duration Based Uplink Scheduling Algorithm for Multiple VoIP Users in M-WiMAX  

Science Conference Proceedings (OSTI)

This paper proposes an efficient uplink scheduling algorithm that can perfectly support various VoIP CODECs with VAD/DTX/CNG in M-WiMAX considering the variants of silence duration between different voice users, solving the problems of uplink resources ... Keywords: G.729B, VAD/DTX/CNG, VoIP CODECs, WiMAX, ertPS, scheduling algorithm

Farouk Y. M. Alkadhi; Zheng Liu; Min Yang; Qiuhong Wang; Jufeng Dai



Quick GuideWindows 7 Wi-Fi set up POSTECH Wireless Network Connection Setup Guide for Windows 7  

E-Print Network (OSTI)

Quick GuideWindows 7 Wi-Fi set up POSTECH Wireless Network Connection Setup Guide for Windows 7 1 the box is unchecked. #12;Quick GuideWindows 7 Wi-Fi set up 7. Successfully added postech -> Change Connection Setup Guide for Windows 7 Make sure this box is unchecked. #12;

Kim, Yong Jung


A cross-layer framework for video-on-demand service in multi-hop WiMax mesh networks  

Science Conference Proceedings (OSTI)

In this work, we introduce a cross-layer framework to favor the video-on-demand service in multi-hop WiMax mesh networks. We first propose a joint solution of admission control and channel scheduling for video streams. The proposed approach guarantees ... Keywords: Cross-layer design, Simulation, Video-on-demand, WiMax, Wireless mesh network

Fei Xie; Kien A. Hua; Ning Jiang



Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP



E-Print Network (OSTI)

36 SEPTEMBER | 2012 WiNd TURbiNE CAPACiTY FRONTiER FROM SCAdA ThE WORld hAS SEEN A significant contributor to this growth. The wind turbine generated energy depends on the wind potential and the turbine of wind turbines. Supervi- sory control and data acquisition (SCADA) systems record wind turbine

Kusiak, Andrew


Experiences, challenges and lessons from rolling out a rural WiFi mesh network  

Science Conference Proceedings (OSTI)

The computing for development community knows that technology interventions involve consideration of social, technical and environmental factors. Research into WiFi solutions has fallen off as ubiquitous mobile solutions penetrate even the deepest rural ... Keywords: VoIP, baseline study, community co-design, inverse infrastructure, participatory and ethnographic methods, telecommunications

Carlos Rey-Moreno; Zukile Roro; William D. Tucker; Masbulele Jay Siya; Nicola J. Bidwell; Javier Simo-Reigadas



Improvement security for RuBee radio-WiMAX mesh networks  

Science Conference Proceedings (OSTI)

Next generation communication standard integrate various access networks technology to become mesh networks. One of air interface standard is metropolitan area wireless broadband service. IEEE 802.16 is the basis for Worldwide Interoperability for Microwave ... Keywords: AAA, RuBee (IEEE 1902.1), WiMAX, gateway access point, group identity key

Tin-Yu Wu; Jhong-Ci Wu; Wei-Fang Weng



Wi-Fi/ZigBee coexistence for fault-tolerant building automation system  

Science Conference Proceedings (OSTI)

The paper presents a case study where a building automation system is investigated using two wireless standards, ZigBee and Wi-Fi 802.11b. Since each standard has specific features and advantages, a network incorporating both manifests itself as an optimal ...

Tarek K. Refaat, Mohamed A. Saleh, Ramz M. Daoud, Hassanein H. Amer, Magdy S. El-Soudani, Magdi S. Moustafa



An experimental performance comparison of 3G and Wi-Fi  

Science Conference Proceedings (OSTI)

Mobile Internet users have two options for connectivity: pay premium fees to utilize 3G or wander around looking for open Wi-Fi access points. We perform an experimental evaluation of the amount of data that can be pushed to and pulled from the Internet ...

Richard Gass; Christophe Diot



Perspectives on quality of experience for video streaming over WiMAX  

Science Conference Proceedings (OSTI)

The advent of broadband wireless networks, such as WiMAX, is paving the way for the widespread deployment of high-bandwidth video streaming services for mobile users. To provide acceptable end-to-end performance in such a network, it is important to ...

Arun Vishwanath; Partha Dutta; Malolan Chetlu; Parul Gupta; Shivkumar Kalyanaraman; Amitabha Ghosh



WiMAX-RBDS-Sim: an OPNET simulation framework for IEEE 802.16 mesh networks  

Science Conference Proceedings (OSTI)

In this paper, a simulation model for IEEE 802.16 (WiMAX) wireless mesh networks with distributed scheduling is developed. It provides a framework for the evaluation of reservation-based distributed scheduling (RBDS) policies at the medium access control ... Keywords: IEEE 802.16, OPNET, distributed scheduling, simulation, wireless mesh networks

Gustavo Vejarano; Janise McNair



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



Soham Al Snih Al Snih, MD., PhD. Curriculum Vitae CURRICULUM VITAE  

E-Print Network (OSTI)

Soham Al Snih Al Snih, MD., PhD. Curriculum Vitae 1 CURRICULUM VITAE NAME: Soham Al Snih Al Snih, M at the Sealy Center on Aging, University of Texas Medical Branch, Galveston, TX. #12;Soham Al Snih Al Snih, MD arthritis. B. Grant Support Current Grant Support: 1R03 AG029959-01A2 (Al Snih ­PI) Period: 06

Wood, James B.

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


EA-1942: Cove Point Liquefaction Project, Lusby, MD | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2: Cove Point Liquefaction Project, Lusby, MD 2: Cove Point Liquefaction Project, Lusby, MD EA-1942: Cove Point Liquefaction Project, Lusby, MD SUMMARY The Federal Energy Regulatory Commission (FERC) is preparing, with DOE as a cooperating agency, an EA, to analyze the potential environmental impacts of a proposal to add natural gas liquefaction and exportation capabilities to an existing Cove Point LNG Terminal located on the Chesapeake Bay in Lusby, Maryland. PUBLIC COMMENT OPPORTUNITIES None available at this time. DOCUMENTS AVAILABLE FOR DOWNLOAD September 28, 2012 EA-1942: Notice of Intent to Prepare an Environmental Assessment Cove Point Liquefaction Project, Lusby, MD September 24, 2012 EA-1942: Notice of Intent of to Prepare an Environmental Assessment Cove Point Liquefaction Project, Lusby, MD


Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale


File:USDA-CE-Production-GIFmaps-WI.pdf | Open Energy Information  

Open Energy Info (EERE)

WI.pdf WI.pdf Jump to: navigation, search File File history File usage Wisconsin Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 326 KB, MIME type: application/pdf) Description Wisconsin Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Wisconsin External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:22, 27 December 2010 Thumbnail for version as of 16:22, 27 December 2010 1,650 × 1,275 (326 KB) MapBot (Talk | contribs) Automated bot upload


Multi-channel transmission with efficient delivery of routing information in maritime WiMAX mesh networks  

Science Conference Proceedings (OSTI)

There is a lack of broadband wireless network in sea to meet the increasing needs of modern maritime users and we have envisaged WiMAX mesh networks for high-speed and low-cost ship-to-ship/shore communications. In such a maritime WiMAX mesh network, ... Keywords: IEEE Std 802.16-2004, broadband wireless access, maritime communications, mesh network, multi-channel transmission

Ming-Tuo Zhou; Hiroshi Harada; Peng-Yong Kong; Chee-Wei Ang; Yu Ge; J. S. Pathmasuntharam



BERAC Meeting, October 6-7, 2011, Rockville, MD| U.S. DOE Office of Science  

Office of Science (SC) Website

Meeting, October 6-7, 2011, Rockville, MD Meeting, October 6-7, 2011, Rockville, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting, October 6-7, 2011, Rockville, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting October 6-7, 2011 Rockville, MD Agenda .docx file (13KB) Presentations Sharlene Weatherwax, State of BER Report .pptx file (2.0MB) Gary Geernaert, Climate and Environmental Sciences Division Update .pptx file (24.0MB) Todd Anderson, Biological Systems Science Division Update .pptx file (8.0MB) Susan Hubbard, Science Talk - Geophysical Signatures of Subsurface Microbially-Mediated Processes: Toward Quantification of In-Situ Ecosystem


BERAC Meeting October 16, 2006 North Bethesda, MD | U.S. DOE Office of  

Office of Science (SC) Website

October 16, 2006 North Bethesda, MD October 16, 2006 North Bethesda, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting October 16, 2006 North Bethesda, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting October 16, 2006 North Bethesda, MD Agenda .pdf file (8KB) Presentations Jerry Elwood .ppt file (4.1MB), State of BER James Ehleringer .ppt file (6.7MB), Report on BERAC Review of FACE Experiments David Kingsbury .ppt file (10.4MB), CAMERA-Metagenomics meets the Cyberinfrastructure Chris Somerville .ppt file (59KB), Life Sciences PART Measure Progress Report Joyce Penner .ppt file (116KB), Climate Change Science PART Measure


BERAC Meeting February 18 - 19, 2009 North Bethesda, MD | U.S. DOE Office  

Office of Science (SC) Website

18 - 19, 2009 North Bethesda, MD 18 - 19, 2009 North Bethesda, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting February 18 - 19, 2009 North Bethesda, MD Print Text Size: A A A RSS Feeds FeedbackShare Page Biological and Environmental Research Advisory Committee Meeting February 18-19, 2009 North Bethesda, MD Meeting Agenda .pdf file (9KB) Presentations Anna Palmisano .ppt file (11.7MB), State of BER Sharlene Weatherwax .ppt file (8.7MB), Biological Systems Science Division Update Wanda Ferrell .ppt file (16.9MB), Climate and Environmental Sciences Division Update Jeff Amthor, Report on the Climate Change Research Strategic Plan


BERAC Meeting February 23-24, 2010 Gaithersburg, MD | U.S. DOE Office of  

Office of Science (SC) Website

February 23-24, 2010 Gaithersburg, MD February 23-24, 2010 Gaithersburg, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting February 23-24, 2010 Gaithersburg, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting February 23-24,2010 Gaithersburg MD Agenda .pdf file (8KB) Presentations Patricia Dehmer .ppt file (7.4MB), News from the Office of Science Anna Palmisano .ppt file (18.0MB), State of BER Jeff Marqusee .ppt file (5.0MB), SERDP & ESTCP Phil Robertson .pdf file (3.1MB), Bioenergy & Sustainability (pdf format) Wanda Ferrell .ppt file (5.1MB), Climate and Environmental Sciences Division Update


BERAC Meeting September 1-2, 2009 Gaithersburg, MD | U.S. DOE Office of  

Office of Science (SC) Website

-2, 2009 Gaithersburg, MD -2, 2009 Gaithersburg, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting September 1-2, 2009 Gaithersburg, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting September 1-2, 2009 Gaithersburg, MD Agenda .pdf file (8KB) Presentations Patricia Dehmer .ppt file (25.0MB), News from the Office of Science Anna Palmisano .pptx file (6.6MB), State of BER Barbara Alving, NIH .ppt file (6.6MB), Connecting the Nation's Researchers, Patients and Communities: Next Steps Horst Simon .pdf file (2.6MB), Future Trends in Computing Sharlene Weatherwax .pdf file (928KB), Biological Systems Science


BERAC Meeting May 19-20, 2008 Hilton Hotel Gaithersburg, MD | U.S. DOE  

Office of Science (SC) Website

9-20, 2008 Hilton Hotel Gaithersburg, MD 9-20, 2008 Hilton Hotel Gaithersburg, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting May 19-20, 2008 Hilton Hotel Gaithersburg, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting May 19-20, 2008 Hilton Hotel Gaithersburg, MD Agenda .pdf file (17KB) Presentations Mike Hochella .ppt file (388KB), Environmental Remediation Sciences Division Committee of Visitors Report Jim Adelstein .ppt file (1.1MB), Report on the Low Dose Radiation Research Program Himadri Pakrasi .ppt file (22.3MB), Science Talk, Membrane Biology Grand Challenge Jeff Amthor .ppt file (11.7MB), Update on BER Program for Ecosystems


BERAC Meeting, June 6-7, 2012 Gaithersburg, MD| U.S. DOE Office of Science  

Office of Science (SC) Website

June 6-7, 2012 Gaithersburg, MD June 6-7, 2012 Gaithersburg, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting, June 6-7, 2012 Gaithersburg, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting June 6-7, 2012 Gaithersburg, MD Agenda .pdf file (424KB) Presentations Sharlene Weatherwax, BER Associate Director State of BER Report .pdf file (482KB) Todd Anderson, Director, Biological Systems Science Division Biological Systems Science Division Update .pdf file (1.9MB) Gary Geernaert, Director, Climate and Environmental Sciences Division Climate and Environmental Sciences Division Update .pdf file (1.6MB) Jonathan Petters,


BERAC Meeting, February 21-22, 2013, Rockville, MD | U.S. DOE Office of  

Office of Science (SC) Website

February 21-22, 2013 BERAC Rockville, MD February 21-22, 2013 BERAC Rockville, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings February 21-22, 2013 BERAC Rockville, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting, February 21-22, 2013, Rockville, MD Agenda .pdf file (10KB) Presentations: Sharlene Weatherwax .pdf file (1.9MB) - Office of Biological and Environmental Research Update Todd Anderson .pdf file (1.7MB) - Biological Systems Science Division Update Gary Geernaert .pdf file (2.3MB) - Climate and Environmental Sciences Division Update Judy Wall .pdf file (3.5MB) - The Genetic Basis for Bacterial Mercury Methylation


BERAC Meeting May 14-15, 2007 North Bethesda, MD | U.S. DOE Office of  

Office of Science (SC) Website

4-15, 2007 North Bethesda, MD 4-15, 2007 North Bethesda, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting May 14-15, 2007 North Bethesda, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting May 14-15, 2007 North Bethesda, MD Agenda .pdf file (10KB) Presentations Joyce Penner .ppt file (74KB), Report on ARM Facilities Charge William Pizer .pdf file (292KB), Report on Integrated Assessment Charge John Ferrell .ppt file (2.7MB), Report on DOE Energy Efficiency and Renewable Energy Biomass Program Paul Vaska .ppt file (23.6MB), Science Talk, Advances in Instrumentation for Small-Animal PET Imaging Mike Viola .ppt file (2.3MB), State of BER


BERAC Meeting September 16-17, 2010 Gaithersburg, MD | U.S. DOE Office of  

Office of Science (SC) Website

6-17, 2010 Gaithersburg, MD 6-17, 2010 Gaithersburg, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting September 16-17, 2010 Gaithersburg, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting September 16-17, 2010 Gaithersburg, MD Agenda .pdf file (8KB) Presentations Anna Palmisano .pptx file (6.5MB), State of BER Judy Wall .pptx file (904KB), CESD COV Report Gary Sayler .ppt file (65.0MB), Science Lecture, "From Microbes to Man: Environmental Biosensing with Bacterial Bioluminescence" Gary Geernaert .pptx file (4.5MB), Climate and Environmental Sciences Division Update Sharlene Weatherwax .pptx file (5.6MB), Biological Systems Science


Price of Cove Point, MD Natural Gas LNG Imports from Algeria...  

Gasoline and Diesel Fuel Update (EIA)

Algeria (Dollars per Thousand Cubic Feet) Price of Cove Point, MD Natural Gas LNG Imports from Algeria (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4...


Price of Cove Point, MD Natural Gas LNG Total Imports (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Total Imports (Dollars per Thousand Cubic Feet) Price of Cove Point, MD Natural Gas LNG Total Imports (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4...


Price of Cove Point, MD Natural Gas LNG Imports from Egypt (Nominal...  

U.S. Energy Information Administration (EIA) Indexed Site

Egypt (Nominal Dollars per Thousand Cubic Feet) Price of Cove Point, MD Natural Gas LNG Imports from Egypt (Nominal Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2...


SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012" Coal Consumers in the Manufacturing and Coke Sectors, 2012" "Company Name","Plant Location" "Top Ten Manufacturers" "American Crystal Sugar Co","MN, ND" "Archer Daniels Midland","IA, IL, MN, ND, NE" "Carmeuse Lime Stone Inc","AL, IL, IN, KY, MI, OH, PA, TN, VA, WI" "Cemex Inc","AL, CA, CO, FL, GA, KY, OH, TN, TX" "Dakota Gasification Company","ND" "Eastman Chemical Company","TN" "Georgia-Pacific LLC","AL, GA, OK, VA, WI" "Holcim (US) Inc","AL, CO, MD, MO, MT, OK, SC, TX, UT" "NewPage Corporation","MD, MI, WI" "U S Steel Corporation","AL, IN, MI, MN"

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012 Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 25. Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Company Name Plant Location Top Ten Manufacturers American Crystal Sugar Co MN, ND Archer Daniels Midland IA, IL, MN, ND, NE Carmeuse Lime Stone Inc AL, IL, IN, KY, MI, OH, PA, TN, VA, WI Cemex Inc AL, CA, CO, FL, GA, KY, OH, TN, TX Dakota Gasification Company ND Eastman Chemical Company TN Georgia-Pacific LLC AL, GA, OK, VA, WI Holcim (US) Inc AL, CO, MD, MO, MT, OK, SC, TX, UT NewPage Corporation MD, MI, WI U S Steel Corporation AL, IN, MI, MN Other Major Manufacturers Ash Grove Cement Co


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...



Gasoline and Diesel Fuel Update (EIA)




Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...



Gasoline and Diesel Fuel Update (EIA)




Annual Energy Outlook 2012 (EIA)



U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


BERAC Meeting September 5 2008 Gaithersburg MD | U.S. DOE Office of Science  

Office of Science (SC) Website

September 5 2008 Gaithersburg MD September 5 2008 Gaithersburg MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting September 5 2008 Gaithersburg MD Print Text Size: A A A RSS Feeds FeedbackShare Page BER September 5, 2008 Arlington, VA Agenda Presentations Peg Riley .ppt file (357KB), Life and Medical Sciences Division Committee of Visitors Report Patricia Dehmer .ppt file (2.6MB), Report from the Office of Science Todd Anderson .ppt file (1.2MB), Scientific Focus Area (SFA) Rollout & Discussion Robert Dickinson .ppt file (6.1MB), Report on Climate Research Grand Challenges Mike Kuperberg .ppt file (975KB), Climate & Environmental Sciences


The University of Texas at Austin July 11, 2012 Data Communications Wi-Fi Access Points 27 21 33-1  

E-Print Network (OSTI)

The University of Texas at Austin July 11, 2012 Data Communications Wi-Fi Access Points 27 21 33 of WAPs Up to 125 1 WAP / 25 people #12;The University of Texas at Austin July 11, 2012 Data of Texas at Austin July 11, 2012 Data Communications Wi-Fi Access Points 27 21 33-3 5. Distance limitation

Texas at Austin, University of


Human activity recognition in indoor environments by means of fusing information extracted from intensity of WiFi signal and accelerations  

Science Conference Proceedings (OSTI)

In this work, we propose an activity recognition system based on the use of a topology-based WiFi localization system combined with accelerometers for body posture recognition. The WiFi localization system is developed using a fuzzy rule-based classifier ... Keywords: Fuzzy logic, Human activity recognition, Interpretability-accuracy trade-off

Alberto Alvarez-Alvarez; Jose M. Alonso; Gracian Trivino



Mar. Drugs 2013, 11, 3350-3371; doi:10.3390/md11093350 marine drugs  

E-Print Network (OSTI)

Mar. Drugs 2013, 11, 3350-3371; doi:10.3390/md11093350 marine drugs ISSN 1660-3397 www% cytotoxicity was observed at the highest concentration tested (5 µg mL-1 ). However, OPEN ACCESS #12;Mar. Drugs Pinna had first been implicated in food poisoning in China in 1990 [1]. Pinnatoxin A (Pn

Recanati, Catherine


A coupled RISM/MD or MC simulation methodology for solvation free energies  

E-Print Network (OSTI)

A coupled RISM/MD or MC simulation methodology for solvation free energies Holly Freedman, Thanh N methods for determination of solvation free energies. We employ the RISM formulation of solvation free-netted chain equations. We apply this approach to determining free energies of solvation for several small

Truong, Thanh N.


MD Study of Phase Change of Water inside a Carbon Nanotube Tatsuto KIMURA and Shigeo MARUYAMA  

E-Print Network (OSTI)

into ice crystal at 220 K or 200 K. In the case of phase change at 220 K, octagonal ice nanotube MD Study of Phase Change of Water inside a Carbon Nanotube * Tatsuto KIMURA and Shigeo MARUYAMA Dept. of Mech. Eng., The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 Phase change

Maruyama, Shigeo


Ira Helfand, MD International Physicians for the Prevention of Nuclear War  

E-Print Network (OSTI)

of studies have shown that a limited, regional nuclear war between India and Pakistan would cause significantIra Helfand, MD International Physicians for the Prevention of Nuclear War Physicians for Social Responsibility NUCLEAR FAMINE: A BILLION PEOPLE AT RISK Global Impacts of Limited Nuclear War on Agriculture

Robock, Alan


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



Radiometric and Engineering Performance of the SeaWiFS Quality Monitor (SQM): A Portable Light Source for Field Radiometers  

Science Conference Proceedings (OSTI)

A portable and stable source of radiant flux, the Sea-viewing Wide Field-of-view Sensor (SeaWiFS) Quality Monitor (SQM), was developed as a field instrument for use in experiments away from the calibration laboratory such as those encountered ...

B. Carol Johnson; Ping-Shine Shaw; Stanford B. Hooker; Don Lynch


Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


Ceramic Composites, Inc. 1110 Benfield Blvd, Ste Q, Millersville, MD 21108  

NLE Websites -- All DOE Office Websites (Extended Search)

Composites, Inc. Composites, Inc. 1110 Benfield Blvd, Ste Q, Millersville, MD 21108 A subsidiary of Technology Assessment and Transfer, Inc. 410-987-3435 fax 410-987-7172 www.techassess.com AGENCY: DOE / NETL CONTRACT: DE-FG02-03ER83627 TITLE: Enhanced Performance Carbon Foam Heat Exchanger for Power Plant Cooling REPORT: Final Technical Report PERIOD: 21 July 2003 - 13 July 2007 TPOC: Barbara Carney carney@netl.doe.gov PHONE: 304-285-4671 PI: Steven Seghi steve@techassess.com PHONE: 410-987-3435 COMPANY: Ceramic Composites, Inc. 133 Defense Hwy, Ste 212 Annapolis, MD 21401 SBIR/STTR Rights Notice These SBIR/STTR data are furnished with SBIR/STTR rights under Grant No. DE-FG02- 03ER83627. For a period of 4 years after the acceptance of all items to be delivered under this


NAMD - The Engine for Large-Scale Classical MD Simulations of Biomolecular  

NLE Websites -- All DOE Office Websites (Extended Search)

NAMD NAMD NAMD - The Engine for Large-Scale Classical MD Simulations of Biomolecular Systems Based on a Polarizable Force Field PI Name: Benoit Roux PI Email: roux@uchicago.edu Institution: Argonne National Laboratory & University of Chicago Allocation Program: ESP Allocation Hours at ALCF: 80 Million Year: 2010 to 2013 Research Domain: Biological Sciences Biology, at the atomic and molecular level, is governed by complex interactions involving a large number of key constituents, including water, ions, proteins, nucleic acids, and lipid membranes. The goal of this project is to develop new technologies to simulate virtual models of biomolecular systems with an unprecedented accuracy. Large-scale molecular dynamics (MD) simulations based on atomic models play an increasingly



Office of Legacy Management (LM)

FINDING OF MD SIGNIFICANT IMPACT FINDING OF MD SIGNIFICANT IMPACT FORMERLY UTILIZED HED/AEC SITES REMEDIAL ACTION PROGRAM: BAY0 CANYONS, NEW MEXICO Under the Formerly Utilized Sites Remedial Action Program (FUSRAP), the U.S. Department of Energy (DOE) has proposed to carry out rcmedfrl action at a site located in Bayo Canyon, Los Alamos County, New Mexico. Although the site as partially decontaminated and decommissioned in the 196Os, there remain above-background amounts of radionuclides. DOE has determined that strontium-90 in excess of DDE's proposed remedial- action criterir exists in subsurface materials underlying an area of about 0.6 ha (1.5 acres) at the Bayo Canyon site. The proposed action is to demarcate this are8 and restrict its use to activities that will not disturb this sub-


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Window nighttime U-values: A comparison between computer calculations and MoWiTT measurements  

SciTech Connect

The proper specification of window U-values has been a controversial area for many years, and current attempts to incorporate more careful treatment of windows into building standards and utility conservation programs and to define window energy labels has heightened the controversy. In a previous paper (Klems 1979) it was argued that current calculation techniques, as embodied in the computer program WINDOW, accurately represented field-measured window U-values, provided frame corrections and surface heat transfer coefficients were correctly estimated, and that in most cases the calculations were also consistent with test laboratory measurements on the same windows. This means that the calculation could serve both as a standard for deriving calculated U-values and as a method of comparing measurements made under different conditions to determine their consistency. This work has now been extended to form a joint US/Canadian collaborative effort to test current computer programs. For six windows the U-values measured with the MoWiTT under field conditions are compared with detailed U-value calculations for the same conditions using the programs WINDOW and ANSYS. There is good agreement between measurements and calculations. 7 refs., 3 figs., 4 tabs.

Klems, J.H.; Reilly, S.



EIA Sh tEIA Short-T d Wi t F l O tl kTerm and Winter Fuels Outlook  

U.S. Energy Information Administration (EIA)

EIA Sh tEIA Short-T d Wi t F l O tl kTerm and Winter Fuels Outlook for Winter Fuels Outlook Conference National Association of State Energy Officials (NASEO)


Medication Safety in Older Adults: Home-Based Practice Patterns Joshua P. Metlay, MD, PhD,wzz  

E-Print Network (OSTI)

Medication Safety in Older Adults: Home-Based Practice Patterns Joshua P. Metlay, MD, Ph-reported sources of in- formation on current medications as well as home-based practices for organizing medication

Hennessy, Sean


Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



ANL/ALCF/ESP-13/14 NAMD - The Engine for Large-Scale Classical MD  

NLE Websites -- All DOE Office Websites (Extended Search)

4 4 NAMD - The Engine for Large-Scale Classical MD Simulations of Biomolecular Systems Based on a Polarizable Force Field ALCF-2 Early Science Program Technical Report Argonne Leadership Computing Facility About Argonne National Laboratory Argonne is a U.S. Department of Energy laboratory managed by UChicago Argonne, LLC under contract DE-AC02-06CH11357. The Laboratory's main facility is outside Chicago, at 9700 South Cass Avenue, Argonne, Illinois 60439. For information about Argonne and its pioneering science and technology programs, see www.anl.gov. Availability of This Report This report is available, at no cost, at http://www.osti.gov/bridge. It is also available on paper to the U.S. Department of Energy and its contractors, for a processing fee, from:

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE Challenge Home Case Study, Nexus EnergyHomes, Frederick, MD, Production  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Nexus Nexus EnergyHomes Frederick, MD BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.



Office of Legacy Management (LM)

,' ,...- ,' ,...- -., -.- . . we#lnty..: - DEPARTMENT OF HEALTH AN~~.N~dtAN, MD. Y.P.H. April 30, 1979 . _-- _' . U.S.E.P.A. Radiation Branch 26 Federal Plaz;a, Boom 9079 New York, N. Y. 10007 Attention: Miss Feldman:, Gentlemen: In accordance with your request to Calvin E. Weber, P.E., Assistant Commissioner of Health for Environmental Quality, I am forwarding a copy of a report prepared by him concerning a radiation survey conducted in the vicinity of the former Canadian Radium and Uranium Corpora+on plant on Railroad Avenue in the Village of Mount Kisco, Westchester County, New Yor Please transmit any comments you may have regarding this matter directly to Mr. Weber. Very truly Yours, Conmissioner of Health xc:rr cc: Sherwood Davies, P.E. lbm Cashman



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2 2 Recipient: County of Howard, MD ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM Activities Determination/ Categorical Exclusion Reviewer's Specific Instructions and Rationale (Restrictions and Allowable Activity) Electric Pick-up truck for on- site use at Alpha Ridge Landfill B5.1 None Landfill Forced Draft Heater A9 This CX applies to preliminary engineering and design tasks only. Additional information is required to make a NEPA determination for construction and operation tasks. Diesel Hybrid Truck B5.1 None Home Energy Audits A9 None Park Ballfield Lights Energy Efficiency B5.1 Waste Stream Clause Energy Efficiency Analysis via Monitoring of Sub-Meters Installation B5.1 None Energy Management Consultant A9 None High Efficiency Lighting - Rec & Parks B5.1



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0 0 Recipient. County of Baltimore, MD ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM Activities Determination/ Categorical Exclusion Reviewer's Specific Instructions and Rationale (Restrictions and Allowable Activity) Renovation for the Green Resource Center B5.1 All administrative activities, audits, outreach, and technical advice should be CX'd. All EE activities are subject to the Waste Stream Clause, Historic Preservation clause, and Engineering clause. Energy Audits for Business & Government Structures A9, All, B5.1 None Revolving Loan Fund A9, All, B5.1 All administrative activities, audits, outreach, and technical advice should be CX'd. All EE activities are subject to the Waste Stream Clause, Historic Preservation clause, and Engineering clause.


Oral Histories: Dr. John W. Gofman, M.D., Ph.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

7 7 HUMAN RADIATION STUDIES: REMEMBERING THE EARLY YEARS Oral History of Dr. John W. Gofman, M.D., Ph.D. Conducted December 20, 1994 United States Department of Energy Office of Human Radiation Experiments June 1995 CONTENTS Foreword Short Biography Oberlin College, Enrollment in Western Reserve Medical School To University of California, Berkeley to Study Physical Chemistry Assisting Seaborg's Research, Discovery of Uranium-233 The Manhattan Project From Research to Laboratory Production of Plutonium Joe Hamilton's Cavalier Approach to Radiation Medical Treatments With Radioactive Phosphorus (32P) Conflict Between University of California San Francisco and Berkeley Reflections on Ernest Lawrence Heart Disease Studies AEC Support for Heart Disease Studies Heparin and Lipoprotein Research With Human Subjects


Oral Histories: Oral History of Radiologist Henry I. Kohn, M.D., Ph.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

1 1 HUMAN RADIATION STUDIES: REMEMBERING THE EARLY YEARS Oral History of Radiologist Henry I. Kohn, M.D., Ph.D. Conducted September 13, 1994 United States Department of Energy Office of Human Radiation Experiments June 1995 CONTENTS Foreword Short Biography Studying the Effects of X Rays on Animal Blood Chemistry at Oak Ridge Work at UCSF's Radiological Laboratory Advantages of Yeast Cells for Studying Radiation Effects Reflections on Bert Low-Beer and Joseph Hamilton Radiation Genetics Experiments on Mice Reflections on Reynold Brown and Henry Kaplan Establishment of Harvard's Joint Center for Radiation Therapy (Mid '60s) Radiological Assessment for the National Academy of Science Survey of Nuclear and Alternative Energy (1975–79) Biologist and Physicist Perspectives on Radiological Effects


Felix F? Camacho Governor Michael W. Cruz, M.D. Lieutenant Governor  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

O. Box 2950 Haghiia, Guam 96932 O. Box 2950 Haghiia, Guam 96932 TEL: (671) 472-8931 FAX: (671) 477-4826 EMAIL: governo@mail.gov.gu Felix F? Camacho Governor Michael W. Cruz, M.D. Lieutenant Governor 0 6 MAW 2009 The Honorable Steven Chu Secretary U.S. Department of Energy 1000 Independence Avenue, S. W. Washington, D.C. 20585 Re: State Energy Program Assurances Dear Secretary Chu: As a condition of receiving Guam's share of the $3.1 billion funding for the State Energy Program (SEP) under the American Recovery and Renewal Act of 2009 (H.R. l)(ARRA), I am providing the following assurances. I have written to the Consolidated Commission on Utilities, Guam's public utility commission, and requested that they consider additional actions to promote energy efficiency, consistent with the Federal


Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)



California Health eQuality Advisory Committee Kenneth W. Kizer, M.D., M.P.H. -Chair  

E-Print Network (OSTI)

California Health eQuality Advisory Committee Kenneth W. Kizer, M.D., M.P.H. - Chair Distinguished Association (IHA) Ellen Wu, M.P.H. Executive Director California Pan-Ethnic Health Network Pamela L. Lane, M.S., RHIA, CPHIMS, Ex officio Deputy Secretary, HIE California Health & Human Services Agency Linette T

California at Davis, University of


Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



Oral Histories: Physician James S. Robertson, M.D., Ph.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

8 8 HUMAN RADIATION STUDIES: REMEMBERING THE EARLY YEARS Oral History of Physician James S. Robertson, M.D., Ph.D. Conducted January 20, 1995 United States Department of Energy Office of Human Radiation Experiments September 1995 CONTENTS Foreword Short Biography Education Research on Human Subjects at Berkeley Invited to Join the New Lab at Brookhaven (1950) Boron Neutron Capture Therapy Other AEC Biomedical Programs Brookhaven Human Use Committee Castle Bravo Atomic Weapon Test (March 1, 1954) Studies on Marshallese at Brookhaven Modern BNCT Treatment Leaves Brookhaven for the Mayo Clinic (1975) Joins the Department of Energy (1983) Work at the Naval Radiological Defense Laboratory (1953–55) Controversial Treatments and the "Crackpot File" FOREWORD I n December 1993, U.S. Secretary of Energy Hazel R. O'Leary announced her Openness Initiative. As part of this initiative, the Department of Energy undertook an effort to identify and catalog historical documents on radiation experiments that had used human subjects. The Office of Human Radiation Experiments coordinated the Department's search for records about these experiments. An enormous volume of historical records has been located. Many of these records were disorganized; often poorly cataloged, if at all; and scattered across the country in holding areas, archives, and records centers.


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Kinetic energy deficit in the symmetric fission of /sup 259/Md. [Light particle emission in /sup 256/Fm fission  

Science Conference Proceedings (OSTI)

The fragment energies of about 725 coincidence events have now been observed in the spontaneous fission (SF) decay of 105-min /sup 259/Md since its discovery in 1977. The fission of /sup 259/Md is characterized by a symmetric mass distribution, similar to those of /sup 258/Fm and /sup 259/Fm, but with a broad total kinetic energy (anti TKE) distribution which peaks at about 195 MeV, in contrast to those of /sup 258/Fm and /sup 259/Fm, for which the anti TKE is about 240 MeV. This kinetic energy deficit, approx. 40 MeV, has been postulated to be due to the emission of hydrogen-like particles by /sup 259/Md at the scission point in a large fraction of the fissions, leaving the residual fissioning nucleus with 100 protons. The residual nucleus would then be able to divide into two ultrastable tin-like fission fragments, but with less kinetic energy than that observed in the SF of /sup 258/Fm and /sup 259/Fm, because of binding-energy losses and a reduction in the Coulomb repulsion of the major fragments. To test this hypothesis, counter-telescope experiments aimed at detecting and identifying these light particles were performed. In 439 SF events 3 + 3 protons of the appropriate energy were observed, too few to account for the kinetic energy deficit in the fission of /sup 259/Md. There seems to be no explanation for this problem within the framework of current fission theory. These results are discussed along with preliminary measurements of light-particle emission in the SF of /sup 256/Fm. 5 figures.

Hulet, E.K.; Wild, J.F.; Lougheed, R.W.; Baisden, P.A.; Dougan, R.J.; Mustafa, M.G.



Cross-layer modeling of capacity in wireless networks: Application to UMTS/HSDPA, IEEE802.11 WLAN and IEEE802.16 WiMAX  

Science Conference Proceedings (OSTI)

We investigate in this work the cross-layer modeling of the capacity of wireless systems in the presence of two types of flows: streaming and elastic, under a dynamic configuration wherein users join the system and leave it after a finite duration. For ... Keywords: Capacity, Cross-layer design, Flow level, IEEE802.11 WLAN, IEEE802.16 WiMAX, Integrated services, MAC scheduling, UMTS/HSDPA

Mariana Dirani; Chadi Tarhini; Tijani Chahed




Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration


Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.



Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


WI Radiation Protection  

Energy.gov (U.S. Department of Energy (DOE))

This statute seeks to regulate radioactive materials, to encourage the constructive uses of radiation, and to prohibit and prevent exposure to radiation in amounts which are or may be detrimental...


Wi-Fi security  

Science Conference Proceedings (OSTI)

"ALL [wireless security] mechanisms are completely in-effective" was the conclusion of a study by the Department of Computer Science at the University of Maryland. This discussion will systematically shed light on the inherent insecurities involved with ...

Paul Williams



miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



LDRD Final Report (08-ERD-037): Important Modes to Drive Protein MD Simulations to the Next Conformational Level  

SciTech Connect

Every action in biology is performed by dynamic proteins that convert between multiple states in order to engage their functions. Often binding to various ligands is essential for the rates of desired transitions to be enhanced. The goal of computational biology is to study these transitions and discover the different states to fully understand the protein's normal and diseased function, design drugs to target/bias specific states, and understand all of the interactions in between. We have developed a new methodology that is capable of calculating the absolute free energy of proteins while taking into account all the interactions with the solvent molecules. The efficiency of the new scheme is an order of magnitude greater than any existing technique. This method is now implemented in the massively parallel popular MD program package NAMD. This now makes it possible to calculate the relative stability of different conformational states of biological macromolecules as well as their binding free energies to various ligands.

Sadigh, B



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Measurement of single and double glazing thermal performance under realistic conditions using the mobile window thermal test (MoWiTT) facility  

SciTech Connect

The thermal performance of single glazing, clear double glazing, and double glazing with a low-emissivity coating was measured in both south-facing and north-facing orientations under realistic field conditions using the new MoWiTT field test facility. The time-dependent net heat flow through each fenestration was found to be consistent with the predictions of the standard simplified heat transfer model, provided that an angle-dependent shading coefficient is used and diffuse solar gain is included in the calculation. Summer-condition average U-values were derived for each glazing type and were found to agree with the expected values for both types of double glazing. The measured U-value for single glazing was lower than predicted.

Klems, J.; Keller, H.



Near quantitative agreement of model free DFT- MD predictions with XAFS observations of the hydration structure of highly charged transition metal ions  

Science Conference Proceedings (OSTI)

DFT-MD simulations (PBE96 and PBE0) with MD-XAFS scattering calculations (FEFF9) show near quantitative agreement with new and existing XAFS measurements for a comprehensive series of transition metal ions which interact with their hydration shells via complex mechanisms (high spin, covalency, charge transfer, etc.). This work was supported by the U.S. Department of Energy (DOE), Office of Basic Energy Sciences, Division of Chemical Sciences, Geosciences and Biosciences. Pacific Northwest National Laboratory (PNNL) is operated for the U.S. DOE by Battelle. A portion of the research was performed using EMSL, a national scientific user facility sponsored by the U.S. DOE's Office of Biological and Environmental Research and located at Pacific Northwest National Laboratory.

Fulton, John L.; Bylaska, Eric J.; Bogatko, Stuart A.; Balasubramanian, Mahalingam; Cauet, Emilie L.; Schenter, Gregory K.; Weare, John H.




National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Large Scale Computing Requirements for Basic Energy Sciences (An BES / ASCR / NERSC Workshop) Hilton Washington DC/Rockville Meeting Center, Rockville MD 3D Geophysical Imaging  

NLE Websites -- All DOE Office Websites (Extended Search)

Requirements Requirements for Basic Energy Sciences (An BES / ASCR / NERSC Workshop) Hilton Washington DC/Rockville Meeting Center, Rockville MD 3D Geophysical Modeling and Imaging G. A. Newman Lawrence Berkeley National Laboratory February 9 - 10 , 2010 Talk Outline * SEAM Geophysical Modeling Project - Its Really Big! * Geophysical Imaging (Seismic & EM) - Its 10 to 100x Bigger! - Reverse Time Migration - Full Waveform Inversion - 3D Imaging & Large Scale Considerations - Offshore Brazil Imaging Example (EM Data Set) * Computational Bottlenecks * Computing Alternatives - GPU's & FPGA's - Issues Why ? So that the resource industry can tackle grand geophysical challenges (Subsalt imaging, land acquisition, 4-D, CO2, carbonates ......) SEAM Mission Advance the science and technology of applied

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure


PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



sqas wi9 final document  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SQAS96-001 SQAS96-001 Quality Report SQAS96-001 Preparation for a Software Quality Audit June 1996 Software Quality Assurance Subcommittee of the Nuclear Weapons Complex Quality Managers United States Department of Energy Albuquerque Operations Office Abstract This document will enable a site to prepare for a software quality audit by providing specific guidance. It will also provide guidance to a site that would enable it to perform a software quality audit. Preparation for a Software Quality Audit SQAS96-001 ACKNOWLEDGMENT This document was prepared for the Department of Energy (DOE) by a Working Group of the Nuclear Weapons Complex (NWC) Quality Managers' Software Quality Assurance Subcommittee (SQAS). The following contributed towards the creation of this document:


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Heart DiseaseHeart Disease--Learn to Love YourLearn to Love Your Michael McKee, M.D.Michael McKee, M.D.  

E-Print Network (OSTI)

Heart DiseaseHeart Disease-- Learn to Love YourLearn to Love Your HeartHeart Michael McKee, M.D.Michael McKee, M.D. March 19, 2010March 19, 2010 #12;GoalsGoals ·· Learn more about heart disease for yourself andLearn more about heart disease for yourself and for your studentsfor your students ·· Learn

Goldman, Steven A.


Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



LA-101( ' X I -E N V~ E N V I R O N M E N T A LS U R V E I L L AA -L O. A -L A -MD U R  

E-Print Network (OSTI)

LA-101( ' X I - E N V~ E N V I R O N M E N T A LS U R V E I L L AA - &.' L_ .---. L O. A - L A - MD U R ,. ,, .". ... , . 1 ` - : . , .i * ?. .& x ` "E!E7...';: s ---- --. -- - + 4. -- sA l a m oN a t i oL a b o r L oA l a m o sN eM e x8 7 `"'l~@fO,,J~@jj~~~~.F=~Of.f~n~~~Y. - w

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Better Buildings Neighborhood Program: San Jose  

NLE Websites -- All DOE Office Websites (Extended Search)

San Jose to San Jose to someone by E-mail Share Better Buildings Neighborhood Program: San Jose on Facebook Tweet about Better Buildings Neighborhood Program: San Jose on Twitter Bookmark Better Buildings Neighborhood Program: San Jose on Google Bookmark Better Buildings Neighborhood Program: San Jose on Delicious Rank Better Buildings Neighborhood Program: San Jose on Digg Find More places to share Better Buildings Neighborhood Program: San Jose on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Jose, California San Jose Leverages Partnerships to Improve Low-Income Households' Energy


Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects


Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012


Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.


Better Buildings Neighborhood Program: Maine - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- SEP to - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Maine - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Maine - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Maine - SEP on Google Bookmark Better Buildings Neighborhood Program: Maine - SEP on Delicious Rank Better Buildings Neighborhood Program: Maine - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Maine - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Maine - SEP Maine Makes Multifamily Units Energy-Efficient and Cost-Effective


Better Buildings Neighborhood Program: San Diego  

NLE Websites -- All DOE Office Websites (Extended Search)

Diego to Diego to someone by E-mail Share Better Buildings Neighborhood Program: San Diego on Facebook Tweet about Better Buildings Neighborhood Program: San Diego on Twitter Bookmark Better Buildings Neighborhood Program: San Diego on Google Bookmark Better Buildings Neighborhood Program: San Diego on Delicious Rank Better Buildings Neighborhood Program: San Diego on Digg Find More places to share Better Buildings Neighborhood Program: San Diego on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Diego County, California Energy Upgrade California Motivates Home Improvements in San Diego County


Better Buildings Neighborhood Program: Alabama - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Alabama - Alabama - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Alabama - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Alabama - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Google Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Delicious Rank Better Buildings Neighborhood Program: Alabama - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Alabama - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Alabama - SEP Alabama Program Takes a Dual Approach to Energy Efficiency Upgrades


Better Buildings Neighborhood Program: Virginia - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Virginia - Virginia - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Virginia - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Virginia - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Google Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Delicious Rank Better Buildings Neighborhood Program: Virginia - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Virginia - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Virginia - SEP Virginia's Regional Energy Alliances Help Forge a State Program for


Better Buildings Neighborhood Program: Austin, Texas  

NLE Websites -- All DOE Office Websites (Extended Search)

Austin, Texas Austin, Texas to someone by E-mail Share Better Buildings Neighborhood Program: Austin, Texas on Facebook Tweet about Better Buildings Neighborhood Program: Austin, Texas on Twitter Bookmark Better Buildings Neighborhood Program: Austin, Texas on Google Bookmark Better Buildings Neighborhood Program: Austin, Texas on Delicious Rank Better Buildings Neighborhood Program: Austin, Texas on Digg Find More places to share Better Buildings Neighborhood Program: Austin, Texas on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Austin, Texas Austin Energy Accelerates Residential and Multifamily Efficiency Upgrades


Better Buildings Neighborhood Program: Michigan - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Michigan - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Michigan - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Google Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Delicious Rank Better Buildings Neighborhood Program: Michigan - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Michigan - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Michigan - SEP Better Buildings Means Better Business for Michigan


Better Buildings Neighborhood Program: Toledo, Ohio  

NLE Websites -- All DOE Office Websites (Extended Search)

Toledo, Ohio Toledo, Ohio to someone by E-mail Share Better Buildings Neighborhood Program: Toledo, Ohio on Facebook Tweet about Better Buildings Neighborhood Program: Toledo, Ohio on Twitter Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Google Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Delicious Rank Better Buildings Neighborhood Program: Toledo, Ohio on Digg Find More places to share Better Buildings Neighborhood Program: Toledo, Ohio on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Toledo, Ohio A Broad Approach to Energy Efficiency in Northwest Ohio


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256



Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423


A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



Support for the delisting of decontaminated liquid chemical surety materials as listed hazardous waste from specific sources (state) MD02 in COMAR 10. 51. 02. 16-1. Technical report, December 1987-February 1988  

SciTech Connect

Maryland recently enacted regulations that listed decontaminated residues of certain chemical warfare agents as hazardous wastes. The State would consider delisting if the Army document the effects of its decontamination procedures. Army specialists at U.S. Army Chemical Research, Development and Engineering Center (CRDEC), Aberdeen Proving Ground, MD, have had exhaustive experience in this area since 1918 when chemical agents were first used in combat in World War I. Competence accrued during this 70-year legacy includes destruction of laboratory and training wastes, combat decontamination, and largescale demilitarization of unserviceable and obsolete agent-filled munitions. The facts and circumstances enumerated in this document indicate that current decontamination practices are safe, scientifically valid, and result in the total destruction of agents in questions.

Durst, H.D.; Sarver, E.W.; Yurow, H.W.; Beaudry, W.T.; D'Eramo, P.A.


Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



U.S. Energy Information Administration (EIA)

Pilgrim Nuclear Power Station Massachusetts Total MD Calvert Cliffs Nuclear Power Plant Maryland Total MI Fermi Donald C Cook Michigan Total MN Prairie Island ...



U.S. Energy Information Administration (EIA)

... is through August, the latest data available",,,,, ,"Norfolk, VA","Baltimore, MD","Mobile, AL","New Orleans, LA","Detroit, MI","Seattle, ...


WiH1950s poster  

Science Conference Proceedings (OSTI)

... definitive work on the thermochemical properties of ions: Gas-Phase Ion ... Despite working under a very tight deadline, she successfully designed a ...



a beneficial manner. The three projects wi  

NLE Websites -- All DOE Office Websites (Extended Search)

beneficial manner. The three projects will demonstrate technologies beneficial manner. The three projects will demonstrate technologies that: (1) make progress toward DOE's target CO 2 capture efficiency of 90 percent; (2) make progress toward DOE's capture and sequestration goal of less than 10 percent increase in the cost of electricity for gasification systems and less than 35 percent for combustion and oxy-combustion systems; and (3) capture and sequester, or put to


Microsoft Word - topic_B_WI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Western Interconnection on Electric Resource Western Interconnection on Electric Resource Planning and Priorities The awardee must complete the following at a minimum: 1. Continued development of the Western Renewable Energy Zone (WREZ) analysis, currently performed by the Western Governors' Association (WGA) under DOE Cooperative Agreement (DE-FC26-08NT01788) in order to identify those areas in the West with vast renewable resources to expedite the development and delivery of renewable energy to where it is needed. Specifically, the awardee must complete the following tasks. a. Coordinating Energy Purchasing from the WREZs Aggregating demand for renewable energy can stimulate the development of commercial renewable generation and supporting transmission projects. Many public power, cooperative, state, federal and provincial electric systems have


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor



Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type


Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product



Gasoline and Diesel Fuel Update (EIA)

18 18 Energy Information Administration / Natural Gas Annual 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 0 1 2 3 4 5 6 7 T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o A l a b a m a K a n s a s A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 1997 1998 1999 2000 2001 2001 16. Marketed Production of Natural Gas in Selected States, 1997-2001 Figure Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI


Nanotechnology in Thoracic Surgery Morgan D. Schulz, MD, Onkar Khullar, MD, John V. Frangioni, MD, PhD,  

E-Print Network (OSTI)

of the lung and the preva- lence of occult micrometastatic disease within thoracic nodes which may appear be due to an increased detection of nodal disease or increased re- moval of nodes harboring occult foci


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Local Hotels/Motels - Gaithersburg, MD  

Science Conference Proceedings (OSTI)

... relationship with NIST. We provide this information as a convenience to NIST visitors and conference attendees. NIST does ...



Fissile Material Disposition (MD) - Nuclear Engineering Division...  

NLE Websites -- All DOE Office Websites (Extended Search)

a legacy of surplus fissile materials (primarily weapons-grade plutonium and highly enriched uranium) in the United States and the former Soviet Union. These materials pose a...


Community Academic Profile Jon D. Fuller, MD  

E-Print Network (OSTI)

, Gerontology, & Metabolism ACTIVITIES 2006 Member, VHA Capacity Management Advisory Council, VA HQ. 2005 Member, VHA Clinical Advisory Council to Chief Business Office, VA HQ. 2005 VA representative to the White Forum Steering Committee Member, "Standardizing Home Health Care Performance Measures" 2004 Organizer

Ford, James


Student Directory yea Larry S. Tobacman, MD  

E-Print Network (OSTI)

Genetics St Louis, 2007 Andrew Czysz (2007) aczysz2@uic.edu th Year PhD logy, U. Florida, 2007 Durst (2012

Alford, Simon


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2008 (Million Cubic Feet) Norway Trinidad/ Tobago Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 45,772 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates.


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

,833 ,833 35 Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2009 (Million Cubic Feet) Norway Trinidad/ Tobago Trinidad/ Tobago Egypt Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 111,144 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 (Million Cubic Feet) Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 42,411 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2006 253,214 690,780 634,185 658,523 134,764 63,063 526,726 121,049 34,531 492,655 101,101 23,154 40,113 1,496,283 68,601

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - figure_14.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 14. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2010 (Million Cubic Feet) Norway India Trinidad/ Tobago Egypt Yemen Japan Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 53,122 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada Gulf of Mexico Canada Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates based on historical data. Energy Information


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 (Million Cubic Feet) 24,891 2,895 Nigeria WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico Algeria C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada N i g e r i a O m a n Qatar Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Malaysia 2,986 Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2005 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 335,380 634,982 664,318 612,297 125,202 33,223 531,868 103,624



Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming



Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana


Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Carbon Dioxide, Hydrographic, and Chemical Data Obtained During the Nine R/V Korr Cruises Comprising the Indian Ocean CO2Survey (WOCE Sections I8SI9S, I9N, I8NI5E, I3, I5WI4, I7N, I1, I10, and I2; December 1, 1994-January 19, 1996)  

SciTech Connect

This document describes the procedures and methods used to measure total carbon dioxide (TCO{sub 2}) and total alkalinity (TALK) at hydrographic stations taken during the R/V Knorr Indian Ocean cruises (Sections I8SI9S, I9N, I8NI5E, I3, I5WI4, I7N, I1, I10, and I2) in 1994-1996. The measurements were conducted as part of the World Ocean Circulation Experiment (WOCE). The expedition began in Fremantle, Australia, on December 1, 1994, and ended in Mombasa, Kenya, on January 22, 1996. During the nine cruises, 12 WOCE sections were occupied. Total carbon dioxide was extracted from water samples and measured using single-operator multiparameter metabolic analyzers (SOMMAs) coupled to coulometers. The overall precision and accuracy of the analyses was {+-} 1.20 {micro}mol/kg. The second carbonate system parameter, TALK, was determined by potentiometric titration. The precision of the measurements determined from 962 analyses of certified reference material was {+-} 4.2 {micro}mol/kg (REFERENCE). This work was supported by grants from the National Science Foundation, the U. S. Department of Energy, and the National Oceanographic and Atmospheric Administration. The R/V Knorr Indian Ocean data set is available as a numeric data package (NDP) from the Carbon Dioxide Information Analysis Center (CDIAC). The NDP consists of 18 oceanographic data files, two FORTRAN 77 data retrieval routine files, a readme file, and this printed documentation, which describes the contents and format of all files as well as the procedures and methods used to obtain the data. Instructions for accessing the data are provided.

Kozyr, A.V.



Carbon Dioxide, Hydrographic, and Chemical Data Obtained During the Nine R/V Korr Cruises Comprising the Indian Ocean CO2Survey (WOCE Sections I8SI9S, I9N, I8NI5E, I3, I5WI4, I7N, I1, I10, and I2; December 1, 1994-January 19, 1996)  

Science Conference Proceedings (OSTI)

This document describes the procedures and methods used to measure total carbon dioxide (TCO{sub 2}) and total alkalinity (TALK) at hydrographic stations taken during the R/V Knorr Indian Ocean cruises (Sections I8SI9S, I9N, I8NI5E, I3, I5WI4, I7N, I1, I10, and I2) in 1994-1996. The measurements were conducted as part of the World Ocean Circulation Experiment (WOCE). The expedition began in Fremantle, Australia, on December 1, 1994, and ended in Mombasa, Kenya, on January 22, 1996. During the nine cruises, 12 WOCE sections were occupied. Total carbon dioxide was extracted from water samples and measured using single-operator multiparameter metabolic analyzers (SOMMAs) coupled to coulometers. The overall precision and accuracy of the analyses was {+-} 1.20 {micro}mol/kg. The second carbonate system parameter, TALK, was determined by potentiometric titration. The precision of the measurements determined from 962 analyses of certified reference material was {+-} 4.2 {micro}mol/kg (REFERENCE). This work was supported by grants from the National Science Foundation, the U. S. Department of Energy, and the National Oceanographic and Atmospheric Administration. The R/V Knorr Indian Ocean data set is available as a numeric data package (NDP) from the Carbon Dioxide Information Analysis Center (CDIAC). The NDP consists of 18 oceanographic data files, two FORTRAN 77 data retrieval routine files, a readme file, and this printed documentation, which describes the contents and format of all files as well as the procedures and methods used to obtain the data. Instructions for accessing the data are provided.

Kozyr, A.V.



Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management



Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

INCINERATION AT THE INCINERATION AT THE IDAHO NATIONAL ENGINEERING AND ENVIRONMENTAL LABORATORY U.S. DEPARTMENT OF ENERGY OFFICE OF INSPECTOR GENERAL OFFICE OF AUDIT SERVICES DECEMBER 1999 DOE/IG-0454 AUDIT REPORT December 15, 1999 MEMORANDUM FOR THE SECRETARY FROM: Gregory H. Friedman (Signed) Inspector General SUBJECT: INFORMATION : Audit Report on "Waste Incineration at the Idaho National Engineering and Environmental Laboratory" BACKGROUND The Waste Experimental Reduction Facility (WERF) Incinerator is located at the Idaho National Engineering and Environmental Laboratory (INEEL) in Idaho Falls, Idaho. The primary mission of the incinerator is to provide mixed waste treatment until a demonstrated, more cost-effective commercial facility is available.


Harnessing frequency diversity in wi-fi networks  

Science Conference Proceedings (OSTI)

Wireless multicarrier communication systems transmit data by spreading it over multiple subcarriers and are widely used today owing to their robustness to multipath fading, high spectrum efficiency, and ease of implementation. In this paper, we use real ... Keywords: IEEE 802.11, cross layer design, forward error correction (FEC), orthorgonal frequency division multiplexing (OFDM), rate adaptation

Apurv Bhartia; Yi-Chao Chen; Swati Rallapalli; Lili Qiu



Identified Patent Waiver W(I)2008-011  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by ELTRON RESEARCH, INC. for a DOE waiver of domestic and foreign patent rights under agreement DE-FC26-05NT42469


Patent Waiver W(I)2011-013  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by ALSTOM POWER, INC. for a DOE waiver of domestic and foreign patent rights under agreement DE-FC26-01NT41223.


Identified Patent Waiver W(I)2011-011  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by ALSTOM POWER, INC. for a DOE waiver of domestic and foreign patent rights under agreement DE-FC26-01NT41223.


Identified Patent Waiver W(I)2011-012  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by ALSTOM POWER, INC. for a DOE waiver of domestic and foreign patent rights under agreement DE-FC26-01NT41223.


Identified Patent Waiver W(I)2012-002  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by BATTELLE MEMORIAL INSTITUTE for a DOE Identified patent waiver of domestic and foreign patent rights under agreement DE-AC07-05ID14517.


Identified Patent Waiver W(I)2012-009  

Energy.gov (U.S. Department of Energy (DOE))

This is a request by UNITED TECHNOLOGIES RESEARCH for a DOE Identified patent waiver of domestic and foreign patent rights under agreement DE-AC02-05CH11231.

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

December 3-5, 1979 THE MOBILE WINDOW THERMAL TEST FACILITY (Orlando, Florida. The Mobile Window Thermal Test Facility (Press, 197 . THE NOBILE WINDOW THERMAL TEST FACILITY (

Klems, J. H.



Why Wi-Fi wants to be free  

Science Conference Proceedings (OSTI)

As the telecommunications industry wavers, a global grassroots movement is building the next-generation wireless network.

Terry Schmidt; Anthony Townsend



Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8



Gasoline and Diesel Fuel Update (EIA)

1 1 55 0 2 4 6 8 10 Residential Onsystem Commercial Onsystem Industrial Onsystem Vehicle Fuel Electric Utilities Dollars per Thousand Cubic Feet 0 30 60 90 120 150 180 210 240 270 300 330 Dollars per Thousand Cubic Meters 1997 1998 1999 2000 2001 25. Average Price of Natural Gas Delivered to Consumers in the United States, 1997-2001 Figure Note: Prices are calculated from onsystem sales. Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition" and Federal Energy Regulatory Commission (FERC), Form FERC- 423, "Monthly Report of Cost and Quality of Fuels for Electric Plants." Energy Information Administration / Natural Gas Annual 2001 56 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA


Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006


AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)


Table 25  

Gasoline and Diesel Fuel Update (EIA)

89 89 Table 25 Created on: 1/3/2014 3:10:33 PM Table 25. Natural gas home customer-weighted heating degree days, New England Middle Atlantic East North Central West North Central South Atlantic Month/Year/Type of data CT, ME, MA, NH, RI, VT NJ, NY, PA IL, IN, MI, OH, WI IA, KS, MN, MO, ND, NE, SD DE, FL, GA, MD, DC, NC, SC, VA, WV November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0 November to November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0



Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use


Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC



Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity


Nation Weekly June 6, 2004, Volume 1, Number 7  

E-Print Network (OSTI)

ec ted c o- or din ate s yo u wi ll f ind u nli mi ted p os sib ilit y f or yo ur lim ite d bu dg et. Sp re ad y ou r n et at th e Te x-W or ld an d sp en d so me qu ite h ou rs fi sh ing th ro ug h ou r c oll ec tio n yo u wi ll...

Upadhyay, Akhilesh


Microsoft Word - FY 2011 MD-715 Report.docx  

National Nuclear Security Administration (NNSA)

1 1 DOE NNSA December 14, 2011 i National Nuclear Security Administration U.S. Department of Energy ANNUAL EEO PROGRAM STATUS REPORT EEO PLAN TO ATTAIN THE ESSENTIAL ELEMENTS OF A MODEL EEO PROGRAM Table of Contents Page FORM 715-01 Part A Department or Agency Identifying Information......................1 FORM 715-01 Part B Total Employment....................................................................1 FORM 715-01 Part C Agency Official(s) Responsible for oversight of EEO Program(s)................................................................................................................1 FORM 715-01 Part D List of Subordinate Components Covered in this Report ........3 FORM 715-01 Part E Executive Summary.................................................................4


Oral Histories: Hematologist Karl F. Hubner, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

had experienced this type of accidental radiation exposure, aside from the atomic bomb in 1945; that's a different issue. Dealing with fissionable material, you take the risk...


Dawna M. Gilchrist MD FRCPC FCCMG DHMSA Before the University  

E-Print Network (OSTI)

by the round-about. The low-rise to the left is the Red Cross Pavilion. The building at the top left is now;New Space In the 50's and 60's more wings were added to University Hospital. This view is from

MacMillan, Andrew


Proceedings: 2002 Radiation Protection Technology Conference: Baltimore, MD, October 2002  

Science Conference Proceedings (OSTI)

In response to program pressures resulting from shorter outages, combined with a diminishing group of contract health physics (HP) technicians, HP professionals must continuously upgrade their programs. Demanding emergent work also requires HP technicians in the nuclear industry to use new methods and technologies. The EPRI Radiation Protection Technology Conference was directed at highlighting a number of key health physics issues and developments.



Proceedings: 2002 Radiation Protection Technology Conference: Baltimore, MD, October 2002  

Science Conference Proceedings (OSTI)

In response to program pressures resulting from shorter outages, combined with a diminishing group of contract health physics (HP) technicians, HP professionals must continuously upgrade their programs. Demanding emergent work also requires HP technicians in the nuclear industry to use new methods and technologies. The EPRI Radiation Protection Technology Conference was directed at highlighting a number of key health physics issues and developments.




100 Bureau Drive, Stop 1915 Gaithersburg, MD 20899 301 ...  

Science Conference Proceedings (OSTI)

... this employer? _____Yes _____No Start Salary: $_____ Final Salary $_____ Describe your duties ...


Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


FIRE RESEARCH October 13-15, 1992 Rockville, MD  

Science Conference Proceedings (OSTI)

... Total Radiative Heat Loss in Jet Flames porn Singe Point Radiance Measuremen< I? Dutta, YR Sivathanu and JP Gore, Purdue University ..... ...



Microsoft Word - FY 2010 MD-715 Report.docx  

National Nuclear Security Administration (NNSA)

Prin. Asst. Dep. Admin. Kenneth Baker NA-20 Asst. Dep. Admin. for Science, Engineering & Production Programs W. Steven Goodrum NA-12 Asst. Dep. Admin. for Strategic Planning,...


Oral Histories: Dr. George Voelz, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

Worker Accident at Idaho's SL-1 Reactor (1961) Controlled Environmental Radioiodine Tests (19631968) Informed Consent at Idaho Tracer Studies on Human Volunteers at Los...


Accuracy in Powder Diffraction IV NIST, Gaithersburg MD ...  

Science Conference Proceedings (OSTI)

... iron) Steel Slag Page 5. Iron making - value chain Raw materials Coal Lumpy ore Mining Waste Slag Final product Steel (Retained Austenite) ...



CURRICULUM VITAE Joseph A. Califano, III, M.D.  

E-Print Network (OSTI)

, Kowalski LP. Trends in incidence and prognosis for head and neck cancer in the United States: A site. Mithani SK, Shao C, Tan M, Smith IM, Califano JA, El-Naggar AK, Ha PK. Mitochondrial mutations in adenoid, Sankaranarayanan R, Califano J, Kowalski L. Global oral health inequalities in incidence and outcomes for oral

May, Brad


Oral Histories: Radiologist Earl R. Miller, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

Therapy Research Relations Between UC Berkeley and UC San Francisco Working for the Manhattan Project and UC Medical Center Process for Obtaining Radioactive Isotopes Human...


Nicolas Demanget, MSc1,2 , Ambroise Duprey, MD2  

E-Print Network (OSTI)

and fabric of current manufactured SGs. Methods Eight marketed SG limbs (Aorfix® , Anaconda® , Endurant

Recanati, Catherine


Radiation Resistance of Nickel, Iron, Chromium Spinels by MD ...  

Science Conference Proceedings (OSTI)

About this Abstract. Meeting, 2014 TMS Annual Meeting & Exhibition. Symposium , Radiation Effects in Oxide Ceramics and Novel LWR Fuels. Presentation Title...


Modelling Heat Transfer in Nanofluids Based on Coupled MD ...  

Science Conference Proceedings (OSTI)

Simulations have shown that the additional heat transfer caused by the collision of the nanoparticles with the heat source contributes significantly to the...


Oral Histories: Dr. Nadine Foreman, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

as to dosage-in other words, how many microcuries7 of radioiodine would actually enter the gland and have an effect upon it. Treatment of Hyperthyroidism BERGE: With respect...


Images in Neuroscience Carol A. Tamminga, M.D., Editor  

E-Print Network (OSTI)

is delivered to the brain region of interest using a fiberoptic-based system or a light-emitting diode (LED-sensitive, molecular, neu- ronal activity "switches." These "switches" are microbial, light- sensitive ion conductance-regulat- ing activity of these "switches" can be controlled externally with light pulses. ChR2 is a cation

Deisseroth, Karl


Materials Degradation and Detection (MD2): Deep Dive Final Report  

SciTech Connect

An effort is underway at Pacific Northwest National Laboratory (PNNL) to develop a fundamental and general framework to foster the science and technology needed to support real-time monitoring of early degradation in materials used in the production of nuclear power. The development of such a capability would represent a timely solution to the mounting issues operators face with materials degradation in nuclear power plants. The envisioned framework consists of three primary and interconnected thrust areas including 1) microstructural science, 2) behavior assessment, and 3) monitoring and predictive capabilities. A brief state-of-the-art assessment for each of these core technology areas is discussed in the paper.

McCloy, John S.; Montgomery, Robert O.; Ramuhalli, Pradeep; Meyer, Ryan M.; Hu, Shenyang Y.; Li, Yulan; Henager, Charles H.; Johnson, Bradley R.



Phase Locked Loop Control of Inverters in a Microgrid  

E-Print Network (OSTI)

Phase Locked Loop Control of Inverters in a Microgrid Matthew Surprenant Dept of ECE University Venkataramanan Dept of ECE University of Wisconsin Madison, WI, USA Abstract--Microgrids are small for inverter-based microsources within a mi- crogrid. The general control philosophy within a microgrid

Hiskens, Ian A.



Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...



Gasoline and Diesel Fuel Update (EIA)

176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY...


Tracking the Sun II: The Installed Cost of Photovoltaics in the U.S. from 1998-2008  

E-Print Network (OSTI)

kW >100 kW ?10 kW PA SDF Solar PV Grant Program 10-100 kW >Renewable DG Program CT CCEF Solar PV Program MA MD MI MTCProgram MW No. Systems SDF Solar PV Grant Program MW No.

Barbose, Galen L



SCOTT T. SANDERS 1500 Engineering Dr., Madison, WI, 53706 | 608 262 3540 | stsanders@wisc.edu  

E-Print Network (OSTI)

, S.T., and Okura, Y., "Design of System for Rugged, Low-noise Fiber-optic Access to High Study: Two-Step Water Splitting Cycle Using the Fe3O4/FeO Redox System," Solar Energy 65, 43-53, 1999} Walewski, J.W., Filipa, J.A., and Sanders, S.T., "Optical beating of polychromatic light and its impact

Van Veen, Barry D.


Identified Patent Waiver W(I)2012-012 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

has to inventions conceived or first actually reduced to practice by DR. F. JEFFREY MARTIN under agreement DE-AC52-06NA25396, as the DOE has determined that granting such a...


Centr um voor Wi skunde en I nf or mati ca Modelling, AnalysisandSimulation  

E-Print Network (OSTI)

. . . . . . . . . . . . . . . . . . . . . . . . . . 31 iii #12;Contents CAFE Final Report Volume II III Protocols 33 6 Notation and De nitions 35 6.1 and Simulation CAFE project _ Final report volume II Secure protocols and architecture Edited by A. Bosselaers, R;CAFE Project - Final Report Volume II Secure Protocols and Architecture Edited by A. Bosselaers, R

Schoenmakers, Berry


The Xirrus Wi-Fi Array XS4, XS8 Security Policy Xirrus, Inc.  

Science Conference Proceedings (OSTI)

... Production-grade components and production-grade opaque ... dirt, or oil. ... The security strap should be pulled tight to disallow turning of the mounting ...



The Xirrus Wi-Fi Array XN4, XN8, XN12, XN16 Security Policy ...  

Science Conference Proceedings (OSTI)

... Production?grade components and production?grade opaque ... the surface area of any grease, dirt, or oil. ... strap should be pulled tight to disallow ...



WiFi Meet FuFi: Research Topics in SCM and DSS  

E-Print Network (OSTI)

Disruptive innovation catalysed by energy (carbon footprint) may reshape supply chain and logistics. The continents of Europe, Asia and Africa may evolve as a connected value network through railroad logistics.

Datta, Shoumen



Evaluating next-cell predictors with extensive Wi-Fi mobility data  

E-Print Network (OSTI)

cycles or more. If an external fault happens, breaker B1 will shut down the fuel cell immediately and separate it from the system. The breaker B2 will then operate to isolate the fault. As a result, the user factor 1HK (7) where


WiGriMMA: A Wireless Grid Monitoring Model Using Agents  

Science Conference Proceedings (OSTI)

The complexity, heterogeneity, device mobility and the unpredictable user behavior demands proper automation of monitoring activity in the wireless Grid to enable the user needs. Since the wireless devices can dynamically join/leave the Grid, and its ... Keywords: Agent, Credit management, Device state control, Grid monitoring, Wireless Grid

Mahantesh N. Birje; Sunilkumar S. Manvi



North Brazil Current Ring Generation and Evolution Observed with SeaWiFS  

Science Conference Proceedings (OSTI)

The earth's largest oceanic rings are formed by the retroflecting North Brazil Current (NBC) near 8N in the western tropical Atlantic. The NBC flows northward across the equator and past the mouth of the Amazon River entraining river-influenced ...

David M. Fratantoni; Deborah A. Glickson



ARIEL: automatic wi-fi based room fingerprinting for indoor localization  

Science Conference Proceedings (OSTI)

People spend the majority of their time indoors, and human indoor activities are strongly correlated with the rooms they are in. Room localization, which identifies the room a person or mobile phone is in, provides a powerful tool for characterizing ...

Yifei Jiang; Xin Pan; Kun Li; Qin Lv; Robert P. Dick; Michael Hannigan; Li Shang



High School Visits (WI, IL, MN and other states) Arranged in alpha order  

E-Print Network (OSTI)

High School 10/5/12 8:15 a.m. Black River Falls High School 9/21/12 9:00 a.m. Bollingbrook High School High School 10/16/12 12:00 p.m. Crystal Lake Central High School 10/15/12 9:40 a.m. Cuba City High

Saldin, Dilano


Achieving True Video-on-Demand Service in Multi-Hop WiMax Mesh Networks  

E-Print Network (OSTI)

Mesh Network Configuration (MSH-NCFG) messages. Each MSH-NCFG message contains a Network Descriptor by listening to MSH-NCFG messages. From all the possible neighboring nodes that advertise MSH-NCFG messages

Hua, Kien A.


"SHA-1","MD5","CRC32","FileName","FileSize","ProductCode" ...  

Science Conference Proceedings (OSTI)

... 14F872083AF453BE3D7085AB95F1F08331617A08","B45E8E01A1DB8 B999F8F95C869E3AEF6","98AD536E","RoboHHRE.lng",3586,21755 ...



"SHA-1","MD5","CRC32","FileName","FileSize","ProductCode" ...  

Science Conference Proceedings (OSTI)

... 0DCDC2A845258DD55C358A3FA5D4FC06461A1D84","07AFBC4774A E9B165DAF118432EA3DC0","A74F016F","english.lng",311852,19423 ...



Michael Cheung, MD Clopidogrel with or without Omeprazle in Coronary Artery Disease  

E-Print Network (OSTI)

with stent placement. Primary GI endpoint was first occurrence of upper GI bleeding, occult GI bleed, hgb and occult) was statistically reduced with ompprazole compared to placebo. Cardiovascular endpoints


A Hybrid MD-kMC Algorithm to Study Diffusion in the Presence of ...  

Science Conference Proceedings (OSTI)

Proceedings Inclusion? Planned: A CD-only volume ... Studies on Vibrational Entropy in Alloys Using Inelastic Neutron Scattering at ORNL Surface Prefreezing...


Biomedical data retrieval utilizing textual data in a gene expression database by Richard Lu, MD.  

E-Print Network (OSTI)

Background: The commoditization of high-throughput gene expression sequencing and microarrays has led to a proliferation in both the amount of genomic and clinical data that is available. Descriptive textual information ...

Lu, Richard, M.D


Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



E-Print Network (OSTI)

appointment can be processed: 1. DESCRIPTION OF WORK You must submit your research information on-line through. VERTEBRATE ANIMALS Does your research involve live vertebrate animals or their tissues, for further details

Bhatia, Sangeeta


Event-Triggered Optimal Power Dispatch M.D. Lemmon, University of Notre Dame  

E-Print Network (OSTI)

done using renewable generation sources such as photovoltaic cells or wind turbines. Power generation can also be accomplished through small microturbines and gas/diesel generators. Storage devices

Lemmon, Michael


An, Yuehuei, Adjunct Associate Professor, Bioengineering. MD, Harbin Medical University (China), 1983; MM, Beijing  

E-Print Network (OSTI)

Weatherford Naval Postgraduate School Chair Ning Cheng Altera Vice-Chair/Treasurer Junqiao Wu UC Berkeley Past. Larry Muray Agilent 8:30 Welcome Remarks and Introduction Prof. Todd Weatherford, Naval Postgraduate

Bolding, M. Chad


If you reside in WASHINGTON, DC - MD -VA - WV your salary will...  

National Nuclear Security Administration (NNSA)

If you are employed in the WASHINGTON, DC Metropolitan Area (D.C., Baltimore, Northern VA, Eastern WV, and Southern PA) your salary will range from: Pay Band Pay Plan(s) Minimum...


Urban Community Forestry in Washington, DC and Baltimore, MD: The Role of Nonprofit Organizations.  

E-Print Network (OSTI)

??Since the 1980s environmental service delivery funding at both the state and city government level has been in decline, limiting urban community forestry programs. This (more)

Rodier, Meghan L.



NAMD - The Engine for Large-Scale Classical MD Simulations of...  

NLE Websites -- All DOE Office Websites (Extended Search)

Institution: Argonne National Laboratory & University of Chicago Allocation Program: ESP Allocation Hours at ALCF: 80 Million Year: 2010 to 2013 Research Domain: Biological...


Fundamental physics at the intensity frontier. Report of the workshop held December 2011 in Rockville, MD.  

SciTech Connect

Particle physics aims to understand the universe around us. The Standard Model of particle physics describes the basic structure of matter and forces, to the extent we have been able to probe thus far. However, it leaves some big questions unanswered. Some are within the Standard Model itself, such as why there are so many fundamental particles and why they have different masses. In other cases, the Standard Model simply fails to explain some phenomena, such as the observed matter-antimatter asymmetry in the universe, the existence of dark matter and dark energy, and the mechanism that reconciles gravity with quantum mechanics. These gaps lead us to conclude that the universe must contain new and unexplored elements of Nature. Most of particle and nuclear physics is directed towards discovering and understanding these new laws of physics. These questions are best pursued with a variety of approaches, rather than with a single experiment or technique. Particle physics uses three basic approaches, often characterized as exploration along the cosmic, energy, and intensity frontiers. Each employs different tools and techniques, but they ultimately address the same fundamental questions. This allows a multi-pronged approach where attacking basic questions from different angles furthers knowledge and provides deeper answers, so that the whole is more than a sum of the parts. A coherent picture or underlying theoretical model can more easily emerge, to be proven correct or not. The intensity frontier explores fundamental physics with intense sources and ultra-sensitive, sometimes massive detectors. It encompasses searches for extremely rare processes and for tiny deviations from Standard Model expectations. Intensity frontier experiments use precision measurements to probe quantum effects. They typically investigate very large energy scales, even higher than the kinematic reach of high energy particle accelerators. The science addresses basic questions, such as: Are there new sources of CP violation? Is there CP violation in the leptonic sector? Are neutrinos their own antiparticles? Do the forces unify? Is there a weakly coupled hidden sector that is related to dark matter? Do new symmetries exist at very high energy scales? To identify the most compelling science opportunities in this area, the workshop Fundamental Physics at the Intensity Frontier was held in December 2011, sponsored by the Office of High Energy Physics in the US Department of Energy Office of Science. Participants investigated the most promising experiments to exploit these opportunities and described the knowledge that can be gained from such a program. The workshop generated much interest in the community, as witnessed by the large and energetic participation by a broad spectrum of scientists. This document chronicles the activities of the workshop, with contributions by more than 450 authors. The workshop organized the intensity frontier science program along six topics that formed the basis for working groups: experiments that probe (i) heavy quarks, (ii) charged leptons, (iii) neutrinos, (iv) proton decay, (v) light, weakly interacting particles, and (vi) nucleons, nuclei, and atoms. The conveners for each working group included an experimenter and a theorist working in the field and an observer from the community at large. The working groups began their efforts well in advance of the workshop, holding regular meetings and soliciting written contributions. Specific avenues of exploration were identified by each working group. Experiments that study rare strange, charm, and bottom meson decays provide a broad program of measurements that are sensitive to new interactions. Charged leptons, particularly muons and taus, provide a precise probe for new physics because the Standard Model predictions for their properties are very accurate. Research at the intensity frontier can reveal CP violation in the lepton sector, and elucidate whether neutrinos are their own antiparticles. A very weakly coupled hidden-sector that may comprise the dark matter in the univ

Hewett, J.L.; Weerts, H.; Brock, R.; Butler, J.N.; Casey, B.C.K.; Lu, Z.T.; Wagner, C.E.M.; Dietrich, M.R.; Djurcic, Z.; Goodman, M.; Green, J.P.; Holt, R.J.; Mueller, P.; Paley, J.; Reimer, P.; Singh, J.; Upadhye, A. (High Energy Physics); ( PHY); (Stanford Linear Accelerator Center); (Univ. of Michigan); (Fermi National Accelerator Laboratory)



1 Kenneth C. Rogers, Ph.D. Bethesda, MD 20817-3348 July 2 ...  

Science Conference Proceedings (OSTI)

... Preliminary Recommendations NIST must proceed apace with the decontamination and decommissioning (if advisable ...



MD PHEV/EV ARRA Project Data Collection and Reporting (Presentation)  

DOE Green Energy (OSTI)

This presentation describes a National Renewable Energy Laboratory project to collect and analyze commercial fleet deployment data from medium-duty plug-in hybrid electric and all-electric vehicles that were deployed using funds from the American Recovery and Reinvestment Act. This work supports the Department of Energy's Vehicle Technologies Program and its Advanced Vehicle Testing Activity.

Walkowicz, K.; Ramroth, L.; Duran, A.; Rosen, B.



Oral Histories: Radiologist Hymer L. Friedell, M.D., Ph.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

to Patients Prominent Researchers Working at Berkeley The Army Medical Corps and the Manhattan Project Work at the Chicago Metallurgical Laboratory Inspection of Manhattan...


WPI centers on March 11, 2011 and aftermath Toshio Kuroki, MD, PhD  

E-Print Network (OSTI)

the third disaster; the nuclear power plants in Fukushima became out of control totally and nuclear fuel, the biggest tsunami barriers particularly in these areas and warning systems by catching primary (P) wave City Distance from Fukushima nuclear plants Environmental dose AIMR Sendai 94 km 0.07 Sv/h MANA Tsukuba

Takada, Shoji


Name Santiago Andrs Triana Address 613 Blossom Drive, Rockville, MD 20850, USA  

E-Print Network (OSTI)

software and hardware control systems for the 3-meter Sodium Geodynamo Experiment; conduct experimental runs, perform data analysis and write scientific reports. Organization Institute for Research Technical drawing, machining, gas metal arc welding, hazardous materials handling, heavy load rigging

Lathrop, Daniel P.


MD-Predicted Phase diagrams for Pattern Formation due to Ion Irradiation  

E-Print Network (OSTI)

Energetic particle irradiation of solids can cause surface ultra-smoothening, self-organized nanoscale pattern formation, or degradation of the structural integrity of nuclear reactor components. Periodic patterns including high-aspect ratio quantum dots, with occasional long-range order and characteristic spacing as small as 7 nm, have stimulated interest in this method as a means of sub-lithographic nanofabrication. Despite intensive research there is little fundamental understanding of the mechanisms governing the selection of smooth or patterned surfaces, and precisely which physical effects cause observed transitions between different regimes has remained a matter of speculation. Here we report the first prediction of the mechanism governing the transition from corrugated surfaces to flatness, using only parameter-free molecular dynamics simulations of single-ion impact induced crater formation as input into a multi-scale analysis, and showing good agreement with experiment. Our results overturn the paradigm attributing these phenomena to the removal of target atoms via sputter erosion. Instead, the mechanism dominating both stability and instability is shown to be the impact-induced redistribution of target atoms that are not sputtered away, with erosive effects being essentially irrelevant. The predictions are relevant in the context of tungsten plasma-facing fusion reactor walls which, despite a sputter erosion rate that is essentially zero, develop, under some conditions, a mysterious nanoscale topography leading to surface degradation. Our results suggest that degradation processes originating in impact-induced target atom redistribution effects may be important, and hence that an extremely low sputter erosion rate is an insufficient design criterion for morphologically stable solid surfaces under energetic particle irradiation.

Scott A. Norris; Juha Samela; Laura Bukonte; Marie Backman; Djurabekova Flyura; Kai Nordlund; Charbel S. Madi; Michael P. Brenner; Michael J. Aziz



"SHA-1","MD5","CRC32","FileName","FileSize","ProductCode" ...  

Science Conference Proceedings (OSTI)

... 002DEB677B50F13F6579B6DA7E133A28AE8B1023","9B26061D60AC 4E53EBF68B8A16DCEBBB","36A8963F","PRNKY003.CAT",16606,19423 ...



I The sat (Sl md.re#t IR) inpuFs OyaCIjdo  

E-Print Network (OSTI)

aH a * input cQhrd8&mr: bc;ch ktpm tyva the paeMitv in&rtor to vvhen"b ' is low, the activehDgh outpu? is forced high; when "R " is low, the active-high output is forced low. Although normally the aotive-low output is drs complement of DUAL DTYPE RIP-FLOP e J-K master/slave The duat D-type flip-flop shown in Figura I of two imht D-tr.pe flip-flops with inputs on the left and flipflops: W mn&h w?U sxta mfy for as long as both "8 ' and "R " wo brcl low. The flip-flop will return to some indeterminate state when both " S and "R " go high. FIGURE 2. Four-Bit Bistable Latch input. tion is derived as follows:- The "DC " input has an AND relationship with the "C " input w shown by the subswipted "C". Therefore, Data passas through "Dc" only when "6 ' is active trua- Input "C " is sensitive to transition, or sensitive as shown by:he ed % (dynamic indicator) symbol.- Absence of the polarity indicator on input "C " means that the MORE E level is true. Therefore, ive true on a low-to-hi& tramis# * and when "C " is active true as stated &over data is passed through and active low outputs are by the abseme/presence of tarritvindicator {-P 1. FOUR-BIT BISTABLE LATCH The fourbit bistable latch shown in Figure 2 consists of four independent D-type flip-flops. FFI and FF2 are controlled by the 61 dock input, and FF3 and FF4 are controlled by the C2 clock input. This is evident by the subscripted C1 and C2 on the input data lines. Information present at a data (Dc) input is transferred to the active-high and active-low outputs when the associated clock input is high: the outputs will follow the data as long as the clock remains high. When the clock goes low, the information that was present at the data input when t4e transition occurred is retained at the outputs until the dock returns high. WWW.HPARCHIVE.COM-flops. Inputs to the master section on the left side are controlled by the gate (G) pulse. The gate pulse also controls the state of the coupling transistors (not shown) wh connect the mmw aprd dm

unknown authors



NodeMD: diagnosing node-level faults in remote wireless sensor systems  

Science Conference Proceedings (OSTI)

Software failures in wireless sensor systems are notoriously difficult to debug. Resource constraints in wireless deployments substantially restrict visibility into the root causes of node-level system and application faults. At the same time, the high ... Keywords: deployment, diagnosis, software fault, wireless sensor networks

Veljko Krunic; Eric Trumpler; Richard Han



,"Wisconsin Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050WI3","N3010WI3","N3020WI3","N3035WI3","N3045WI3" "Date","Natural Gas Citygate Price in Wisconsin (Dollars per Thousand Cubic Feet)","Wisconsin...


bersicht ber die Durchfhrung der Fachpraktika Master Gym Bachelor BEU / Master GH / R  

E-Print Network (OSTI)

) WiSe od. SoSe 2) WiSe 1) 4) WiSe od. SoSe 2) Chemie SoSe SoSe 5) ______ SoSe 5) _____ _____ _____ _____ Deutsch WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. SoSe WiSe od. So

Kallenrode, May-Britt


Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION



Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael




E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...


ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks


miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha



Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.


Comment submitted by Whirlpool Corporation regarding the Energy Star Verification Testing Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ADMINISTRATIVE CENTER * 2000 N. M63 - MD 3005 * BENTON HARBOR, MI 49022 * 269.923.4646 ADMINISTRATIVE CENTER * 2000 N. M63 - MD 3005 * BENTON HARBOR, MI 49022 * 269.923.4646 May 9, 2011 Via email Ashley Armstrong U.S. Department of Energy Building Technologies Program 1000 Independence Avenue, SW Washington, DC 20585-0121 ESTARVerificationTesting@ee.doe.gov Re: DOE ENERGY STAR Verification Testing Program Dear Ms. Armstrong: We appreciate the opportunity to comment on the DOE Verification Testing Program that was put forth on April 22, 2011 (DOE Testing Document). As a very active member of the Association of Home Appliance Manufacturers (AHAM), we have worked closely with them in the development of the comments they have submitted (under separate cover)


EIA - Natural Gas Pipeline Network - Largest Natural Gas Pipeline Systems  

U.S. Energy Information Administration (EIA) Indexed Site

Interstate Pipelines Table Interstate Pipelines Table About U.S. Natural Gas Pipelines - Transporting Natural Gas based on data through 2007/2008 with selected updates Thirty Largest U.S. Interstate Natural Gas Pipeline Systems, 2008 (Ranked by system capacity) Pipeline Name Market Regions Served Primary Supply Regions States in Which Pipeline Operates Transported in 2007 (million dekatherm)1 System Capacity (MMcf/d) 2 System Mileage Columbia Gas Transmission Co. Northeast Southwest, Appalachia DE, PA, MD, KY, NC, NJ, NY, OH, VA, WV 1,849 9,350 10,365 Transcontinental Gas Pipeline Co. Northeast, Southeast Southwest AL, GA, LA, MD, MS, NC, NY, SC, TX, VA, GM 2,670 8,466 10,450 Northern Natural Gas Co. Central, Midwest Southwest IA, IL, KS, NE, NM, OK, SD, TX, WI, GM 1,055 7,442 15,874 Texas Eastern Transmission Corp.


A Model Of Pedestal Structure J.D. Callen, University of Wisconsin, Madison, WI 53706-1609  

E-Print Network (OSTI)

paleoclassical ones, i.e., for Dan > Dpc eff fDD where fD ( 0.1 in 988892 ) is degree of diffusion reduction

Princeton Plasma Physics Laboratory



E-Print Network (OSTI)

??The Medicaid Home and Community Based Services Waiver (HCBS) funds services for people with developmental disabilities in community based group homes. The purpose of the (more)

Cook, Craig



a h|^w[!"????????x?x?Wi8]4!xb0??*ܼ |uY ...  

Science Conference Proceedings (OSTI)

... sG?? w?A?????9???*vv*?_*?g*'??^? 8DXit7=5???*r?*L??*ATS????\\?2??*`*m ...



Calibration Evaluation and Radiometric Testing of Field Radiometers with the SeaWiFS Quality Monitor (SQM)  

Science Conference Proceedings (OSTI)

One of the goals of calibration and validation programs supporting ocean color satellites is to produce water-leaving radiances with an uncertainty of 5% in clear-water regions. This objective requires field instruments with a calibration and ...

Stanford B. Hooker; James Aiken



WiMsh: a simple and efficient tool for simulating IEEE 802.16 wireless mesh networks in ns-2  

Science Conference Proceedings (OSTI)

Wireless mesh networks (WMNs) are two-tier wireless multihop networks. The top tier is made of wireless routers, which provide access to the wireless clients in the bottom tier. One technology for enabling multi-hop communication in the top tier is IEEE ... Keywords: IEEE 802.16, network simulator 2, simulation, wireless mesh networks

Claudio Cicconetti; Ian F. Akyildiz; Luciano Lenzini



" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" 9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Appliances",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Cooking Appliances" "Stoves (Units With Both" "an Oven and a Cooktop)"


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1-07 0 1-07 0 USS Honolulu (SSN 718) and Locals 280 miles from North Pole PROGRAM RECORD * Program founded in 1948 * 5,800 reactor- years of safe operations * 136,000,000 miles safely steamed * 103 operating naval reactors * Welcomed in over 150 ports worldwide and 50 countries BROAD RESPONSIBILITIES * Research, Development, Design * Acquisition, Specification, Construction, Testing * Operation, Training, Maintenance * Overhaul, Refueling, Disposal * Reactor Safety, Radiological Controls, Environmental Safety, Occupational Health * Security, Nuclear Safeguards, Transportation * Administration (Public Information) NAVAL NUCLEAR PROPULSION PROGRAM TEC 1-07 1 WA OR ID MT ND SD WY NE MN WI IA IL MI IN OH KY


Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Human radiation studies: Remembering the early years. Oral history of Dr. Nadine Foreman, M.D., August 19, 1994  

SciTech Connect

Dr. Nadine Foreman was interviewed by representatives of the US DOE Office of Human Radiation Experiments (OHRE). Dr. Foreman was selected for interview because of the position she held at the University of California, San Francisco. Following a brief biographical sketch, Dr. Foreman describes her work with Dr. Mayo Soley using I-131 in treatment of hyperthyroidism, selection criteria for patients in the radioiodine project, work with Dr. Earl Miller, work at Highland Hospital, radioiodine treatment of diffuse toxic goiter (myxedema), the radiophosphorus and radioiodine programs with Dr. Bert Low-Beer, and treatment of polycythemia vera.



Human radiation studies: Remembering the early years. Oral history of Oncologist Helen Vodopick, M.D., December 28, 1994  

SciTech Connect

This report is a transcript of an interview with Dr. Helen Vodopick by representatives of the US DOE Office of Human Radiation Experiments. Dr. Vodopick was chosen for this interview because of her involvement with the Oak Ridge Institute of Nuclear Studies (ORINS) and Oak Ridge Associated Universities (ORAU) experimental cancer-therapy program involving total-body irradiation. After a short biographical sketch Dr. Vodopick relates her remembrances of the Medium-Exposure-Rate Total Body Irradiator (METBI), ORINS radioisotope tracer studies, treatment of cancer patients with the METBI, radiation treatment for leukemia patients, bone marrow treatment of leukemia, the Low-Exposure-Rate Total Body Irradiation (LETBI), treatment of radiation accident victims at ORAU, research with radioactive phosphorus and sulfur, and public opinion issues.



Curriculum Vitae Bengt B. Arnetz, M.D., Ph.D., M.P.H, M.Sc.Epi, FACOEM  

E-Print Network (OSTI)

and Safety and Organizational Health Psychology, respectively 08-ong: Part of committee proposing a major

Dasgupta, Dipankar


Presented at the Low Impact Development Roundtable Conference, Baltimore, MD, July 2001. Infiltration Through Compacted Urban Soils and  

E-Print Network (OSTI)

. Infiltration Through Compacted Urban Soils and Effects on Biofiltration Design Robert Pitt,1 Shen-En Chen,2.................................................................................................................................................4 Soil Modifications to Enhance Infiltration...........................................6 Disturbed Urban Soil Field Infiltration Measurements

Pitt, Robert E.


Human radiation studies: Remembering the early years. Oral history of Dr. George Voelz, M.D., November 29, 1994  

SciTech Connect

Dr. George Voelz was interviewed by representatives of the US DOE Office of Human Radiation Experiments (OHRE). This oral history covers Dr. Voelz`s research on Manhattan Engineering District plutonium workers, the acute and long term effects of radiation, his inhalation studies, and his activities at the 1961 INL reactor accident (SL-1 Reactor). After a brief biographical sketch, Dr. Voelz his remembrances on tissue studies of plutonium workers, the plutonium injection studies of 1945-1946, the controlled environmental radioiodine tests of 1963-1968, and tracer studies with human volunteers at Los Alamos. Dr. Voelz states his opinions concerning misconceptions about the Los Alamos Human Radiation Experiments.



Human radiation studies: Remembering the early years. Oral history of hematologist Karl F. Hubner, M.D., December 30, 1994  

SciTech Connect

This report is a transcript of an interview of Dr. Karl F. Hubner by representatives of the US DOE Human Radiation Experiments. Dr. Hubner was selected for this interview because of his participation in the Oak Ridge Institute of Nuclear Studies(ORINS)/Oak Ridge Associated Universities(ORAU) Medical Division cancer therapy research program involving total body irradiation. After a short biographical sketch Dr. Hubner discusses his research in Bone Marrow Transplants, his participation in the development of Nuclear Medicine in Oak Ridge, use of the total body irradiation machine at the University of Tennessee School of Agriculture Animal Research Laboratory (later the Comparative Animal Research Laboratory or CARL) to deliver a high enough dose rate to destroy a patients immune system, the operation of a sterile environment for recovery of patients following bone- marrow transplantation, and the closing of the ORAU Medical Division`s Clinical Program following a negative review. Finally, Dr. Hubner describes his later research using PET.




E-Print Network (OSTI)

The license renewal application (LRA) was submitted pursuant to Title 10 of the Code of Federal Regulations Part 54, "Requirements for Renewal of Operating Licenses for Nuclear Power Plants. " The staff determined that the LRA was complete and acceptable for docketing on September 25,2008. The staff has reviewed the KPS LRA and has developed the enclosed "Safety Evaluation Report With Open Items related to the License Renewal of the Kewaunee Power Station," hereinafter referred to as the Safety Evaluation Report (SER). This SER reflects the status of the staff's review of the LRA, requests for additional information (RAts), the applicant's responses to the staff's RAls, and other questions related to the LRA through March 26, 2010, unless otherwise noted. Issuance of the enclosed SER is an important milestone for both the applicant and the staff. The staff has identified four open items in its review which must be resolved before it can make a final determination on the application. SER Section 1.5 includes a listing of the open items with a summary of the information required to satisfactorily resolve the issues. In order to resolve these items, the staff has requested additional information, as identified in the SER.

United States; Mr. David; A. Heacock; Dear Mr. Heacock



Fusion Simulation Project. Workshop sponsored by the U.S. Department of Energy Rockville, MD, May 16-18, 2007  

Science Conference Proceedings (OSTI)

The mission of the Fusion Simulation Project is to develop a predictive capability for the integrated modeling of magnetically confined plasmas. This FSP report adds to the previous activities that defined an approach to integrated modeling in magnetic fusion. These previous activities included a Fusion Energy Sciences Advisory Committee panel that was charged to study integrated simulation in 2002. The report of that panel [Journal of Fusion Energy 20, 135 (2001)] recommended the prompt initiation of a Fusion Simulation Project. In 2003, the Office of Fusion Energy Sciences formed a steering committee that developed a project vision, roadmap, and governance concepts [Journal of Fusion Energy 23, 1 (2004)]. The current FSP planning effort involved forty-six physicists, applied mathematicians and computer scientists, from twenty-one institutions, formed into four panels and a coordinating committee. These panels were constituted to consider: Status of Physics Components, Required Computational and Applied Mathematics Tools, Integration and Management of Code Components, and Project Structure and Management. The ideas, reported here, are the products of these panels, working together over several months and culminating in a three-day workshop in May 2007.




Fusion Simulation Project. Workshop Sponsored by the U.S. Department of Energy, Rockville, MD, May 16-18, 2007  

Science Conference Proceedings (OSTI)

The mission of the Fusion Simulation Project is to develop a predictive capability for the integrated modeling of magnetically confined plasmas. This FSP report adds to the previous activities that defined an approach to integrated modeling in magnetic fusion. These previous activities included a Fusion Energy Sciences Advisory Committee panel that was charged to study integrated simulation in 2002. The report of that panel [Journal of Fusion Energy 20, 135 (2001)] recommended the prompt initiation of a Fusion Simulation Project. In 2003, the Office of Fusion Energy Sciences formed a steering committee that developed a project vision, roadmap, and governance concepts [Journal of Fusion Energy 23, 1 (2004)]. The current FSP planning effort involved forty-six physicists, applied mathematicians and computer scientists, from twenty-one institutions, formed into four panels and a coordinating committee. These panels were constituted to consider: Status of Physics Components, Required Computational and Applied Mathematics Tools, Integration and Management of Code Components, and Project Structure and Management. The ideas, reported here, are the products of these panels, working together over several months and culminating in a three-day workshop in May 2007.

Kritz, A.; Keyes, D.



Journd of ExpnmenW R x h o l w H u m mqxm md worrmnc~  

E-Print Network (OSTI)

Bludworth Island (created marsh); d, Mesquite Bay; ANWR, Aransas National Wildlife Refuge. 459S.C. Zeug et and nonvegetated habitats in ANWR from 100 1-m2 drop samples and our sample size (18 per marsh) appeared ad- equate) 457e466 #12;(Grus americana) that over-winter at ANWR and forage for blue crabs in adjacent marsh

Cosmides, Leda


R terence Fila MD. -f--"'<-..:II~--+-150FORESTRY SC;E;~G[S !..I8;'~AP  

E-Print Network (OSTI)

, California 94701 Aerial Survey of Insect-Caused Mortality . .. ABSTRACT: An Aerial survey using an operation severa.! STEVEN L.WERT BRUCE ROETTGERING In fall 1966, we made a rapid and inexpensive aerial survey over useful in making aerial surveys over large, in- accessible areas in the Eastern United States. 1 Data

Standiford, Richard B.


Human radiation studies: Remembering the early years: Oral history of pathologist Clarence Lushbaugh, M.D., conducted October 5, 1994  

SciTech Connect

This report provides a transcript of an interview with Dr. Clarance Lushbaugh by representatives of the DOE Office of Human Radiation Experiments. Dr. Lushbaugh was chosen for this interview because of his research involving experimental use of irradiation with human beings at Los Alamos and at the Oak Ridge Institute of Nuclear Science (ORINS). After a brief biographical sketch Dr. Lushbaugh and his assistant Mrs. Ann Swipe defend their use of total body irradiation using the LETBI (Low Exposure Total Body Irradiation) and the LETBI (Medium Energy Total Body Irradiator). Dr. Lushbaugh also discusses his earlier experiments involving use of nitrogen mustards in chemotherapy application, his early interest in the LD50 for man, his early impressions of low-level spray radiation as introduced by Heubline, anedotal information for his duties a pathologist for Los Alamos, and his developing interest in establishing safer radiation limits for human exposure.



Argonne PowerPoint Presentation  

NLE Websites -- All DOE Office Websites (Extended Search)

Lr 256 No 255 Md 257 Fm 256 Md 258 Fm 257 Md 259 Md 260 Fm 258 Fm 259 Md 256 Fm 255 Md 253 Fm 252 Md 252 Fm 251 Md 255 Fm 254 Md 254 Fm 253 Es 255 Es 256 Es 254 Es 251 Es 250 Es...


Utility-Scale Smart Meter Deployments, Plans & Proposals  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

edisonfoundation.net/IEE edisonfoundation.net/IEE Utility-Scale Smart Meter Deployments, Plans & Proposals April 2010 Utility State Target Number of Meters Notes Resources AEP 1 IN, KY, MI, OH, OK, TX, VA, WV 5,000,000 AEP plans on deploying smart meters to all customers within their service territory and have deployed 10,000 meters to customers in South Bend, IN, and are presently deploying another 700,000 to AEP-Texas customers. Timing for the remaining deployments will depend on specific conditions in each of the seven operating company subsidiaries. AEP Corporate Sustainability Report 2009 2 Allegheny Power MD, PA, WV 700,000 Allegheny launched pilots in Morgantown, WV and Urbana, MD to test smart meters and thermostats (1,140 meters installed). In PA, Act 129 (2008)


Better Buildings Neighborhood Program: Communities Throughout Oregon  

NLE Websites -- All DOE Office Websites (Extended Search)

Communities Communities Throughout Oregon to someone by E-mail Share Better Buildings Neighborhood Program: Communities Throughout Oregon on Facebook Tweet about Better Buildings Neighborhood Program: Communities Throughout Oregon on Twitter Bookmark Better Buildings Neighborhood Program: Communities Throughout Oregon on Google Bookmark Better Buildings Neighborhood Program: Communities Throughout Oregon on Delicious Rank Better Buildings Neighborhood Program: Communities Throughout Oregon on Digg Find More places to share Better Buildings Neighborhood Program: Communities Throughout Oregon on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO


Better Buildings Neighborhood Program: Indianapolis, Indiana  

NLE Websites -- All DOE Office Websites (Extended Search)

Indianapolis, Indianapolis, Indiana to someone by E-mail Share Better Buildings Neighborhood Program: Indianapolis, Indiana on Facebook Tweet about Better Buildings Neighborhood Program: Indianapolis, Indiana on Twitter Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Google Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Delicious Rank Better Buildings Neighborhood Program: Indianapolis, Indiana on Digg Find More places to share Better Buildings Neighborhood Program: Indianapolis, Indiana on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC


Better Buildings Neighborhood Program: Fayette County, Pennsylvania  

NLE Websites -- All DOE Office Websites (Extended Search)

Fayette Fayette County, Pennsylvania to someone by E-mail Share Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Facebook Tweet about Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Twitter Bookmark Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Google Bookmark Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Delicious Rank Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Digg Find More places to share Better Buildings Neighborhood Program: Fayette County, Pennsylvania on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO


Better Buildings Neighborhood Program: Better Buildings Partners  

NLE Websites -- All DOE Office Websites (Extended Search)

Better Better Buildings Partners to someone by E-mail Share Better Buildings Neighborhood Program: Better Buildings Partners on Facebook Tweet about Better Buildings Neighborhood Program: Better Buildings Partners on Twitter Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Google Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Delicious Rank Better Buildings Neighborhood Program: Better Buildings Partners on Digg Find More places to share Better Buildings Neighborhood Program: Better Buildings Partners on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY


Better Buildings Neighborhood Program: Bainbridge Island, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Bainbridge Bainbridge Island, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Bainbridge Island, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Bainbridge Island, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Bainbridge Island, Washington on Google Bookmark Better Buildings Neighborhood Program: Bainbridge Island, Washington on Delicious Rank Better Buildings Neighborhood Program: Bainbridge Island, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Bainbridge Island, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO


Better Buildings Neighborhood Program: Jacksonville, Florida  

NLE Websites -- All DOE Office Websites (Extended Search)

Jacksonville, Jacksonville, Florida to someone by E-mail Share Better Buildings Neighborhood Program: Jacksonville, Florida on Facebook Tweet about Better Buildings Neighborhood Program: Jacksonville, Florida on Twitter Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Google Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Delicious Rank Better Buildings Neighborhood Program: Jacksonville, Florida on Digg Find More places to share Better Buildings Neighborhood Program: Jacksonville, Florida on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Hydrogen Storage in Metal-Organic Frameworks - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

NLE Websites -- All DOE Office Websites (Extended Search)

7 7 FY 2012 Annual Progress Report DOE Hydrogen and Fuel Cells Program Jeffrey Long (Primary Contact), Martin Head-Gordon Lawrence Berkeley National Laboratory 1 Cyclotron Road Berkeley, CA 95720 Phone: (510) 642-0860 Email: jrlong@berkeley.edu DOE Managers HQ: Ned Stetson Phone: (202) 586-9995 Email: Ned.Stetson@ee.doe.gov GO: Jesse Adams Phone: (720) 356-1421 Email: Jesse.Adams@go.doe.gov Subcontractors: * National Institute of Standards and Technology, Gaithersburg, MD (Craig Brown) * General Motors Corporation, Warren, MI (Anne Dailly) Project Start Date: April 1, 2012 Project End Date: March 31, 2015 Fiscal Year (FY) 2012 Objectives



Gasoline and Diesel Fuel Update (EIA)

2000 2000 Southern California Gas Co ..................... CA 251,452,001 8.32 Nicor Gas ................................................. IL 221,009,522 6.68 Pacific Gas and Elec Co........................... CA 211,181,852 7.98 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 184,692,129 7.53 Consumers Energy Co ............................. MI 176,663,600 4.76 Michigan Consol Gas Co.......................... MI 136,124,328 5.41 Keyspan Energy Del Co ........................... NY 134,055,940 10.75 Pub Svc Elec and Gas Co........................ NJ 132,611,115 6.32 East Ohio Gas Co .................................... OH 131,187,521 7.49 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 130,622,887 8.82 Peoples Gas Lt and Coke Co................... IL 103,856,141 8.60 Pub Svc Co of Colorado...........................



Gasoline and Diesel Fuel Update (EIA)

Energy Information Administration / Natural Gas Annual 1999 Southern California Gas Co ..................... CA 275,767,714 6.50 Pacific Gas and Elec Co........................... CA 234,195,449 6.61 Nicor Gas ................................................. IL 211,147,988 4.71 Consumers Energy Co ............................. MI 167,318,229 4.89 Michigan Consol Gas Co.......................... MI 134,432,032 5.42 Pub Svc Elec and Gas Co........................ NJ 133,426,119 6.86 East Ohio Gas Co .................................... OH 127,141,913 5.81 Keyspan Energy Del Co ........................... NY 125,709,092 9.79 Columbia Gas Dist Co.............................. KY,PA,MD,OH 121,011,064 7.32 Peoples Gas Lt and Coke Co................... IL 98,758,164 6.77 Pub Svc Co of Colorado........................... CO 84,115,032 5.28



Gasoline and Diesel Fuel Update (EIA)

3 3 Northern Illinois Gas Co ........................... IL 241,353,299 5.25 Southern California Gas Co ..................... CA 237,581,205 7.28 Pacific Gas and Elec Co........................... CA 191,919,171 6.12 Consumers Pwr Co .................................. MI 178,690,154 4.80 Columbia Gas Dist Co.............................. OH,KY,PA,MD 178,512,589 7.64 Michigan Consol Gas Co.......................... MI 152,111,213 5.59 East Ohio Gas Co .................................... OH 147,197,186 6.36 Pub Svc Elec and Gas Co........................ NJ 138,404,765 7.58 Peoples Gas Lt and Coke Co................... IL 113,561,765 6.96 Lone Star Gas Co..................................... TX 100,079,759 6.13 Atlanta Gas Lt Co ..................................... GA 96,381,162 7.41 Brooklyn Union Gas Co............................


Pub Svc Elec  

Gasoline and Diesel Fuel Update (EIA)

Pub Pub Svc Elec and Gas Co......................... NJ 81,712,678 5.82 Columbia Gas Dist Co............................... OH,KY,PA,MD 76,048,915 5.95 Con Edison Co. of New York Inc............... NY 69,809,658 5.99 Consumers Pwr Co ................................... MI 58,661,306 4.46 Pacific Gas and Elec Co............................ CA 57,793,522 5.67 Minnegasco ............................................... MN 57,154,912 4.57 Southern California Gas Co ...................... CA 54,772,058 6.16 Michigan Consol Gas Co........................... MI 53,635,433 5.16 Entex Div of Noram Energy Corp.............. LA,TX,MS 49,485,836 4.80 Northern Illinois Gas Co ............................ IL 48,165,624 4.62 Pub Svc Co. of Colorado........................... CO 47,339,959 3.51 Atlanta Gas Lt Co ......................................



Gasoline and Diesel Fuel Update (EIA)

8 8 Southern California Gas Co ..................... CA 269,739,909 7.31 Pacific Gas and Elec Co........................... CA 224,402,286 6.32 Northern Illinois Gas Co ........................... IL 196,608,329 4.63 Consumers Pwr Co .................................. MI 153,128,350 4.92 Columbia Gas Dist Co.............................. OH,KY,PA,MD 138,064,908 7.21 Pub Svc Elec and Gas Co........................ NJ 126,142,540 6.61 Michigan Consol Gas Co.......................... MI 125,456,377 5.35 East Ohio Gas Co .................................... OH 117,574,196 6.21 Peoples Gas Lt and Coke Co................... IL 89,685,006 6.81 Atlanta Gas Lt Co ..................................... GA 89,103,601 6.69 Lone Star Gas Co..................................... TX 84,559,915 5.95 Brooklyn Union Gas Co............................ NY


Northern Illinois Gas Co IL  

Gasoline and Diesel Fuel Update (EIA)

Northern Northern Illinois Gas Co ............................ IL 254,574,988 4.60 Southern California Gas Co ...................... CA 233,632,354 6.89 Columbia Gas Dist Co............................... OH,KY,PA,MD 196,322,935 6.64 Pacific Gas and Elec Co............................ CA 190,864,262 5.83 Consumers Pwr Co ................................... MI 188,587,672 4.81 Michigan Consol Gas Co........................... MI 160,809,168 5.16 East Ohio Gas Co ..................................... OH 146,802,045 5.44 Pub Svc Elec and Gas Co......................... NJ 140,712,209 6.62 Peoples Gas Lt and Coke Co.................... IL 126,356,925 6.40 Brooklyn Union Gas Co............................. NY 106,349,594 9.43 Atlanta Gas Lt Co ...................................... GA 106,075,815 6.66 Lone Star Gas Co......................................



Gasoline and Diesel Fuel Update (EIA)

5 5 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 138,239,378 5.94 Pub Svc Elec and Gas Co........................ NJ 69,738,220 5.26 Southern California Gas Co ..................... CA 63,758,073 7.26 Pacific Gas and Elec Co........................... CA 58,646,965 7.84 Keyspan Energy Del Co ........................... NY 53,501,565 7.32 Consumers Energy Co ............................. MI 51,663,333 4.26 TXU Gas Distribution................................ TX 48,112,344 5.86 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 45,021,338 7.87 Con Edison Co of New York Inc............... NY 44,076,359 8.02 Michigan Consol Gas Co.......................... MI 40,342,797 5.39 Pub Svc Co of Colorado........................... CO 39,697,152 5.22 East Ohio Gas Co ....................................



Gasoline and Diesel Fuel Update (EIA)

4 4 Con Edison Co. of New York Inc.............. NY 88,830,005 5.25 Pub Svc Elec and Gas Co........................ NJ 70,705,783 5.28 Columbia Gas Dist Co.............................. OH,KY,PA,MD 63,746,659 7.11 Southern California Gas Co ..................... CA 57,000,043 6.63 Minnegasco .............................................. MN 55,213,151 4.69 Pacific Gas and Elec Co........................... CA 54,854,821 6.15 Entex Div of Noram Energy Corp ............. LA,MS,TX 51,551,370 5.31 Consumers Pwr Co .................................. MI 50,657,354 4.44 Michigan Consol Gas Co.......................... MI 50,589,626 5.55 Northern Illinois Gas Co ........................... IL 47,159,304 5.26 Pub Svc Co. of Colorado.......................... CO 46,479,502 3.88 East Ohio Gas Co .................................... OH 41,561,614 5.92



Gasoline and Diesel Fuel Update (EIA)

3 3 Con Edison Co of New York Inc............... NY 102,311,001 3.84 Pub Svc Elec and Gas Co........................ NJ 73,839,186 3.05 Southern California Gas Co ..................... CA 62,380,076 5.55 Pacific Gas and Elec Co........................... CA 58,692,831 6.82 Keyspan Energy Del Co ........................... NY 53,162,984 6.07 Minnegasco .............................................. MN 52,910,769 4.25 Entex Div of Noram Energy Corp ............. TX,LA,MS 47,337,378 4.81 Lone Star Gas Co..................................... TX 45,843,050 4.67 Consumers Energy Co ............................. MI 45,391,308 4.50 Michigan Consol Gas Co.......................... MI 41,336,416 5.38 Pub Svc Co of Colorado........................... CO 39,230,403 4.47 Columbia Gas Dist Co.............................. KY,PA,MD,OH 35,550,535 6.78


Presented at the 16th ANS Topical Meeting on the Technology of Fusion Energy, Madison WI, Sept. 14-16, 2004.  

E-Print Network (OSTI)

Stanford University . . . . . . . . #12;13 Solar Energy Ordered Bulk Heterojunction Photovoltaic Cells Inorganic Nanocomposite Solar Cells by Atomic Layer Deposition Nanostructured Metal-Organic Composite Solar Cells Nanostructured Silicon-Based Tandem Solar Cells Photosynthetic Bioelectricity Biomass Energy

Ghoniem, Nasr M.


Thermal performance measurements of sealed insulating glass units with low-E coatings using the MoWiTT (Mobile Window Thermal Test) field-test facility  

SciTech Connect

Using data obtained in a mobile field-test facility, measured performance of clear and low-emissivity double-glazing units is presented for south-facing and north-facing orientations. The changes in U-value and shading coefficient resulting from addition of the low-E coating are found to agree with theoretical expectations for the cold spring test conditions. Accurate nighttime U-values were derived from the data and found to agree with calculations. Expected correlation between U-value and wind speed was not observed in the data; a plausible experimental reason for this is advanced.

Klems, J.; Keller, H.



Mercury Measurements Characterizing the Impact of SCR on Mercury: Consol Test Site 5 - Eastern Bituminous Coal-Fired Power Plant wi th an SCR, ESP, and Wet FGD  

Science Conference Proceedings (OSTI)

CONSOL Energy Inc., Research & Development (CONSOL), with support from the U.S. Department of Energy, National Energy Technology Laboratory (DOE) and the Electric Power Research Institute (EPRI), is evaluating the effects of selective catalytic reduction (SCR) on mercury (Hg) capture in coal-fired plants equipped with an electrostatic precipitator (ESP) - wet flue gas desulfurization (FGD) combination or a spray dyer absorber 8212 fabric filter (SDA-FF) combination. In this program CONSOL is determining ...



Dept. of Sol Science, UW-Madison/UW-Extension, 1525 Observatory Dr., Madison, WI 53706/608-262-0485 November 2010 Issue #2 2010  

E-Print Network (OSTI)

plants burn low S coal and some have installed flue gas scrubbers to reduce sulfur emissions. Use is generated from burning coal. As a consequence of the 1990 Clean Air Act Amendment many coal-burning power power plants in the south- eastern part of the state producing FGD gypsum, with a third to come on

Balser, Teri C.


Installation Restoration Program. Remedial investigation report. Site 1. Fire Training Area. Volk Field Air National Guard Base, Camp Douglas, Wi. Volume 2. Final remedial investigation report  

SciTech Connect

Volume II of this report contains data tables and field notes of information gathered from the sampling of soils and ground water. Hydrocarbons and aromatic volatile organics are among the contaminants listed.

Not Available



Installation Restoration Program. Remedial investigation report. Site 1. Fire Training Area. Volk Field Air National Guard Base, Camp Douglas, Wi. Volume 1. Final remedial investigation report  

SciTech Connect

Volume 1 of this report covers the Remedial Investigation conducted on Site 1, Fire Training Area at Volk Field Air National Guard Base. The remedial work is described and the testing conducted after remediation to insure all contamination has been removed. The study as conducted under the Air National Guard's Installation Restoration Program. Partial contents include: Meteorology; Hydrology; Soils; Water wells; Groundwater; Borings; Samplings; Chemical contamination; Migration; Decontamination.

Not Available



Optimum Cycle Length and Discharge Burnup for Nuclear Fuel - A Comprehensive Study for BWRs and PWRs: Phase I: Results Achievable Wi thin the 5 Percent Enrichment Limit  

Science Conference Proceedings (OSTI)

Core reload design and economic analyses show that both pressurized water reactors (PWRs) and boiling water reactors (BWRs) can derive significant benefits by increasing the discharge burnup of their fuel above the currently licensed values. Optimum discharge burnup levels, however, may not be achievable without exceeding the current 5 wt percent limit on enrichment.



Matching renewal energy sources to rural development needs : a prototype design for a rural community development center for Jamaica, W.I.  

E-Print Network (OSTI)

The opportunities for utilizing Jamaica/s rich supply of renewable energy resources as a base for stead, environmentally sound rural development is tremendous. This thesis explores as way of tapping this potential. Jamaica's ...

Jackson, Michael Onaje



Anthropogenic impact on spring bloom dynamics in the Yangtze River Estuary based on SeaWiFS mission 19982010 and MODIS 20032010 observations  

Science Conference Proceedings (OSTI)

Nutrient output from the Yangtze River to the sea has increased dramatically since the 1960s, and over the past 50 years more than 50,000 reservoirs on the Yangtze River basin have had little impact on water discharge, but have drastically reduced the ...

Cheng Chen, Hong Jiang, Yu Zhang



~o,nnarrrs C/WI. Vol. 19.No. 2. no. 85-90. 1995I. Copyright f. 1995Els&er ScienceLrd  

E-Print Network (OSTI)

`A' to interpret it as a chemical element and searches its memory for the element that corresponds of the program can be secured by sending a disk to the author. Acknou,lrrlg~nle,lrs-The author would like

Campanario, Juan Miguel

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


wyang98@stanford.edu; phone 1 650 723-6213; fax 1 650 725-9755; http://eil.stanford.edu/WiMMS/  

E-Print Network (OSTI)

In this study, a new wireless sensing unit for operation within an automated Structural Health Monitoring (SHM) system is proposed, designed and validated. The design of the wireless sensing unit emphasizes minimization of its power consumption characteristics to ensure it is suited for long-term field deployment in civil structures. The wireless modem integrated with the unit has a long communication range that permits wireless sensors to be spaced over 100m apart. A multi-channel high-resolution analog-to-digital converter is included within each sensing unit to provide flexibility for high-fidelity data collection. A key feature of the wireless sensing unit design is the inclusion of a sophisticated computing core that is capable of locally executing engineering algorithms in real-time. As part of the embedded software, a novel communication protocol is written that can accomplish low-latency communications for accurate time synchronization between spatially distributed wireless sensors. To illustrate the capabilities of the wireless monitoring platform, including the execution of extensive computational tasks, a prototype system is fabricated and tested in the laboratory and field. As part of validating the system performance in the field, the vertical acceleration response of the Geumdang Bridge under traffic loading is measured by 14 wireless sensing unit prototypes.

Design Of Low-Power; Wang Yang; Jerome P. Lynch; B Kincho H. Law



Docket EE-RM/STD-02-112  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Energy Conservation Standards for New Federal Commercial and Multi-Family High-Rise Residential Energy Conservation Standards for New Federal Commercial and Multi-Family High-Rise Residential Buildings and New Federal Low-Rise Residential Buildings DOCKET NUMBER: EE-RM/STD-02-112 CLOSING DATE: 02/02/2007 COMMENT NUMBER DATE RECEIVED /DATE OF LETTER NAME & TITLE OF COMMENTATOR AFFILIATION & ADDRESS OF COMMENTATOR 1 01/31/07 01/31/07 Thomas D. Culp, Ph.D Consultant Birch Point Consulting LLC W6025 Rim of the City Road La Cross, WI 54601 2 02/01/07 02/01/07 Renee LaMura Director of Member Services Polyisocyanurate Insulation Manufacturers Association (PIMA) 7315 Wisconsin Ave., Suite 400E Bethesda, MD, 20814 3 02/01/07 02/01/07 Rick L. Landers Business Manager Office of the Chief Engineer Capital Improvements Business Links Naval Facilities Engineering Command



co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...


May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George


UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...


Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clment Jamin; Pierre-Marie Gandoin; Samir Akkouche



LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2013-10084P


Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer


Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.



Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas



Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

Puertorriquea. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetn. Based on ethnographic and archival research in San Juan, Puerto Rico, (more)

Rivera, Petra Raquel



Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois


"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

May ________. A vistas la pornografa. Primera Hora, 22la medida contra la pornografa. El Nuevo Da, 13 Junecomunicacin contra la pornografa. El Nuevo Da, 16 May

Rivera, Petra Raquel



Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.


Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela


LCLS Operating Schedule  

NLE Websites -- All DOE Office Websites (Extended Search)

LCLS Operating Schedule LCLS Operating Schedule August - December 2009 Ver: 2 10/30/09 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 S Su M T W Th F S Su M T W Th F S Su M T W Th F S Su M T W Th F S Su M 0000-0800 MD MD MD MD MD 0800-1600 ROD MD AMO ROD MD AMO 1600-2400 MD MD Commissioning MD MD Comm. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 T W Th F S Su M T W Th F S Su M T W Th F S Su M T W Th F S Su M T W 0000-0800 MD MD MD MD MD MD MD MD MD 0800-1600 MD ROD AMO MD ROD AMO MD ROD AMO MD ROD AMO ROD 1600-2400 MD MD Commissioning MD MD Commissioning MD MD Commissioning MD MD Commissioning MD 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Th F S Su M T W Th F S Su M T W Th F S Su M T W Th F S Su M T W Th F S 0000-0800 MD MD MD MD MD MD MD MD MD 0800-1600 Young MD ROD DiMauro MD ROD Berrah MD ROD Coffee MD ROD Young-II 1600-2400 L018 MD MD L026 MD MD L015 MD MD L027 MD MD L017 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Su

Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MD Maryland Total Sum City, County, and SEO Allocations MD Maryland Total Sum City, County, and SEO Allocations All $ 52,295,100 MD Maryland State Energy Office $ 9,593,500 MD Annapolis City $ 171,700 MD Baltimore City $ 6,372,700 MD Bowie City $ 464,000 MD College Park City $ 133,700 MD Frederick City $ 614,700 MD Gaithersburg City $ 578,000 MD Hagerstown City $ 179,500 MD Laurel City $ 93,000 MD Rockville City $ 683,300 MD Salisbury City $ 147,300 MD Anne Arundel County $ 4,463,400 MD Baltimore County $ 7,403,600 MD Carroll County $ 684,100 MD Charles County $ 560,300 MD Frederick County $ 659,800 MD Harford County $ 2,189,400


The Tension in Solidarity: Race, Gender, and National Identity in Katherine Dunhams Southland  

E-Print Network (OSTI)

WI: The University of Wisconsin Press, 2005. 345-363.WI: The University of Wisconsin Press, 2005. 364-381. ---. WI: The University of Wisconsin Press, 2005. Cole, Johnnetta

Timmons, Michele



100000241,1,1,1,1,20050516,"AL",10610,"Albertville Municipal...  

U.S. Energy Information Administration (EIA) Indexed Site

,1,229279,"WI",8026,"Sheboygan Falls City of",99 5500018312,1,1,1,1,18004899,"WI",10610,"Sun Prairie Water & Light Comm",99 5500018312,1,2,1,1,1961803,"WI",10620,"Sun Prairie Water...


Business Engineering (M.Sc.) Summer Term 2013  

E-Print Network (OSTI)

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 68 Automated Manufacturing Systems- WI4INGMBWBK1 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 79 Material Flow in Logistic Systems- WI4INGMB25 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 81 Material Flow in networked Logistics Systems- WI4INGMB26

Stein, Oliver


Project Award Spreadsheets 2010 12 21 1232.xlsx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City HQ State City HQ State Congressional District(s) Population Recovery Act Funding* Asheville ** NC NC-011 500,000 $209,940 Aspen CO CO-003 5,902 $59,193 Aurora CO CO-007 319,057 $151,800 Baltimore MD MD-002 636,919 $200,000 Baton Rouge LA LA-6 223,689 $200,000 Boston MA MA-009 609,023 $300,000 Casper WY WY-001 54,047 $130,000 Chicago IL IL-005 2,853,114 $300,000 Chula Vista CA CA-051 219,318 $200,000 City and County of Denver CO CO-001 598,707 $210,040 Columbia MO MO-009 100,733 $200,000 Davenport IA IA-001 100,827 $200,000 Delray Beach FL FL-022 64,092 $130,000 Durango CO CO-003 16,416 $58,500 Flint MI MI-005 112,900 $199,814 Fort Wayne IN IN-003 251,591 $195,700 Hailey ID ID-002 7,883 $83,202 Hamilton OH OH-008 62,477 $130,000 Heber** UT UT-002 13,988 $100,000 Hoffman Estates IL IL-008 53,641 $98,556 Lake Worth FL FL-022 35,513


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

As A As A Power Resource Steven Nadel, Executive Director American Council for an Energy-Efficient Economy October 2010 2 The American Council for an Energy- Efficient Economy (ACEEE) 30 year old, non-profit 501(c)(3) dedicated to advancing energy efficiency through research and education. 35+ staff in Washington DC, + field offices in DE, MI, WA and WI. Focus on End-Use Efficiency in Industry, Buildings, Utilities, and Transportation; Economic Analysis & Human Behavior; and State & National Policy Worked on utility-sector energy-efficiency programs and policies since 1980s Savings Potential from Jan. 2009 Electricity Advisory Committee Report Average Statewide Utility Cost of Saved Energy for Efficiency Programs 3.3 3.3 3.1 3.0 2.9 2.8 2.7 2.6 2.1 1.9 1.9 1.7


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" 9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" "Structural and Geographic Characteristics",,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" ,,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Urban and Rural2" "Urban",88.1,19.9,14.6,4.1,2.9,1.8,5.8,5.3,1.6,2.4,1.4



Office of Legacy Management (LM)

~ *-,-' .r_~, ~ *-,-' .r_~, VERIFICATION SURVEY OF THE BAKER AND WILLIAMS WAREHOUSES BUILDING 513-519 NEW YORK, NEW YORK Prepared by W. C. Adams Environmental Survey and Site Assessment Program Energy/Environment Systems Division Oak Ridge Institute for Science and Education Oak Ridge, Tennessee 37831-0117 Prepared for the Office of Environmental Restoration U.S. Department of Energy FINAL REPORT JUNE 1994 This report is based on work performed under contract number DE-AC05-760R00033 with the U.S. Department of Energy. Baker arId Wi,,iMI Wsrchouwl-Vcrification June 28, ,994 - ,I I_ ..I .- VERIFICATION SURVEY OF THE BAKER AND W ILLIAMS WAREHOUSES BUILDING 513-519 NEW YORK, NEW YORK Prepared by: ' J .,,,~ ' . W . C. Adams, Project Leader Date: Environmental Survey and Site Assessment Program


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" 9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Computers and Other Electronics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Computers" "Number of Computers" 0,27.4,6.7,4.7,1.1,1.1,0.6,2,2,0.6,1,0.5


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" 9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Fuels Used and End Uses",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Fuels Used for Any Use" "Electricity",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Televisions",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Televisions" "Number of Televisions" 0,1.5,0.3,0.2,"Q","Q","Q","Q",0.1,"Q","Q","Q"


EA-16-C TransAlta Energy Marketing (U.S) Inc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1 Federal Register 1 Federal Register / Vol. 76, No. 14 / Friday, January 21, 2011 / Notices Houghton, MI. NPA: Goodwill Industries of Northern Wisconsin & Upper Michigan, Inc., Marinette, WI Contracting Activity: Dept of the Interior, National Park Service, Midwest Region, Omaha, NE. Deletions On 10/22/2010 (FR 65305) and 11/19/ 2010 (75 FR 70909-70910), the Committee for Purchase From People Who Are Blind or Severely Disabled published notices of proposed deletions from the Procurement List. After consideration of the relevant matter presented, the Committee has determined that the products listed below are no longer suitable for procurement by the Federal Government under 41 U.S.C. 46-48c and 41 CFR 51- 2.4. Regulatory Flexibility Act Certification I certify that the following action will


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5500 5500 Johnson Controls, Inc. EE Multiple PMC/PVT 2011/ 10/1/2011 to 1/31/2015 Chris Johnson Multiple sites, CA, MI, WI, OR Significant Cost Improvement of Li-Ion Cells (SUMMARY CX) Reduce manufactured cost of large format Li-ion cells by 50% through use of coated separators, dry coated electrodes, and fast formation technologies. Christopher Johnson Digitally signed by Christopher Johnson DN: cn=Christopher Johnson, o=PMC, ou=PVT, email=cjohnson@netl.doe.gov, c=US Date: 2011.12.19 13:35:19 -05'00' 12 19 2011 john ganz Digitally signed by john ganz DN: cn=john ganz, o=netl, ou=environmental compliance division, email=john.ganz@netl.doe.gov, c=US Date: 2011.12.20 11:06:33 -05'00' 12 20 2011 Comprehensive list of subcontractors and five locations covered under this Summary CX has been


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,,,,,"IA, MN, ND, SD" "Water Heating",,,,"IL","MI","WI","IN, OH",,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Storage Tank Water Heaters" 0,2.9,0.4,0.3,"Q","Q","Q","Q",0.1,"Q","Q","Q"


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" 9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Air Conditioning",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Air Conditioning Equipment" "Use Air Conditioning Equipment",94,22.4,15,4.3,3.1,1.8,5.9,7.4,2.3,3.4,1.7


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" " ",,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Space Heating",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Space Heating Equipment" "Use Space Heating Equipment",110.1,25.8,17.8,4.7,3.8,2.3,7,8.1,2.3,3.9,1.8


Related Links | Building Energy Codes Program  

NLE Websites -- All DOE Office Websites (Extended Search)

Related Links Related Links Regional Energy Efficiency Organizations MEEA NEEP NEEA SEEA SWEEP SPEER Midwest Energy Efficiency Alliance (MEEA) IL, IN, IA, KS, KY, ND, NE, MI, MN, MO, OH, SD, WI The Midwest Energy Efficiency Alliance (MEEA) is a collaborative network advancing energy efficiency in the Midwest to support sustainable economic development and environmental preservation. MEEA raises awareness, facilitates energy efficiency programs and strengthens policy across the nine-state region. MEEA brings together a respected network of members, partners, board and staff, and inspires others to create new technologies, new products and new ways of thinking when it comes to energy efficiency. Codes Contact Isaac Elnecave Senior Policy Manager ielnecave@mwalliance.org phone: (312)784-7253


Categorical Exclusion Determination Form It Submit by E-_  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

It Submit by E-_ It Submit by E-_ I'llail - ] Proposed Action Title: (0672- 1610) Eaton Corporation - Highly Efficient, Nea r-Isothermal Liquid-Piston Compressor fo r Low Cost At-Home Natural Gas Refueli ng Program or Field Office: Advanced Research Projects Agency - Energy LocationCs) CCity/County/State): Southfield, MI ; Eden Prairie, MN; Minneapolis, MN; and Milwaukee, WI Proposed Action Description: Funding will support efforts to develop a highly efficient, near isothermal liquid piston compressor for low cost, at-home natu ral gas refueling Proposed work will consist of: (1) develop and optimize a concept compressor design to achieve established performance and cost targets; (2) characterize and verify the expected performance for the compressor design; and (3) develop a compressor system prototype to test proof of


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" 9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Household Demographics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Household Members" "1 Person",31.3,7.4,5.1,1.4,1,0.6,2.1,2.3,0.6,1.1,0.6


Superfund record of decision (EPA Region 3): Aberdeen Proving Ground, Carroll Island, Edgewood Area Operable Unit A, Aberdeen Proving Ground, MD, September 30, 1996  

SciTech Connect

This Record of Decision (ROD) document presents the selected remedial action to reduce the risks posed by the disposal pits/areas in 13 sites and Areas of Concern (AOCs) located at Carroll Island in the Edgewood Area of APG, Maryland. The major components of the selected remedy for Operable Unit A include hand excavation of the waste in the disposal pits/areas and segregation and disposal or treatment of excavated waste.



Note: This page contains sample records for the topic "md mi wi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Human radiation studies: Remembering the early years: Oral history of radiologist Hymer L. Friedell, M.D., Ph.D., conducted January 28, 1995  

SciTech Connect

NThis report is a transcript of an interview with Hymer L. Friedell by representatives of the US DOE Office of Human Radiation Experiments. Dr. Friedell was selected for this interview because of his participation in the early stages of the medical use of radioisotopes, his important role in the Manhattan Engineer District Medical Division, and his distinguished medical career and his involvement in the distribution of isotopes and the approval for their use in humans. After a brief biographical sketch Dr. Friedell discusses his remembrances on a wide range of subjects. Topics discussed include pre-war radiation therapy, information provided to patients, the Army Medical Corps and the Manhattan Project, his work at the Chicago Metallurgical Laboratory, inspection visits of Manhattan Project facilities and proposed sites, Plutonium injection studies, and actions of the AEC Isotope Distribution Committee.

Fisher, D.; Melamed, E.



Heat Capacity Effects Associated with the Hydrophobic Hydration and Interaction of Simple Solutes: A Detailed Structural and Energetical Analysis Based on MD Simulations  

E-Print Network (OSTI)

We examine the SPCE and TIP5P water models to study heat capacity effects associated with the hydrophobic hydration and interaction of Xenon particles. We calculate the excess chemical potential for Xenon employing the Widom particle insertion technique. The solvation enthalpy and excess heat capacity is obtained from the temperature dependence of the chemical potentials and, alternatively, directly by Ewald summation, as well as a reaction field based method. All three different approaches provide consistent results. The reaction field method allows a separation of the individual components to the heat capacity of solvation into solute/solvent and solvent/solvent parts, revealing the solvent/solvent part as the dominating contribution. A detailed spacial analysis of the heat capacity of the water molecules around a pair of Xenon particles at different separations reveals that the enhanced heat capacity of the water molecules in the bisector plane between two Xenon atoms is responsible for the maximum of the heat capacity observed at the desolvation barrier, recently reported by Shimizu and Chan ({\\em J. Am. Chem. Soc.},{\\bf 123}, 2083--2084 (2001)). The about 60% enlarged heat capacity of water in the concave part of the joint Xenon-Xenon hydration shell is the result of a counterplay of strengthened hydrogen bonds and an enhanced breaking of hydrogen bonds with increasing temperature. Differences between the two models concerning the heat capacity in the Xenon-Xenon contact state are attributed to the different water model bulk heat capacities, and to the different spacial extension of the structure effect introduced by the hydrophobic particles. Similarities between the different states of water in the joint Xenon-Xenon hydration shell and the properties of stretched water are discussed.

Dietmar Paschek



Human radiation studies: Remembering the early years: Oral history of physician James S. Robertson, M.D., Ph.D., conducted January 20, 1995  

SciTech Connect

This report is a transcript of in interview of Dr. James S. Robertson by representatives of the DOE Office of Human Radiation Experiments. Dr. Robertson was chosen for this interview because of his research at Brookhaven National Laboratory, especially on Boron Neutron Capture Therapy (BNCT); his work at the United States Naval Defense Laboratory; and his work at the Atomic Energy Commission. After a brief biographical sketch Dr. Robertson discusses research on human subjects at Berkeley, his contributions to the beginnings of Neutron Capture Therapy at Brookhaven, his participation with the Brookhaven Human Use Committee, his involvement in the study of the effects of Castle Bravo event on the Marshallese, and his work with the Naval Radiological Defense Laboratory.



Human radiation studies: Remembering the early years. Oral history of Dr. John W. Gofman, M.D., Ph.D., December 20, 1994  

SciTech Connect

Dr. John W. Gofman was interviewed by representatives of US DOE Office of Human Radiation Experiments (OHRE) concerning his research at the University of California, Berkeley and his biomedical work at Lawrence Livermore Radiation Laboratory. Following a short biographical sketch, Dr. Gofman relates his remembrances with the discovery and chemistry of uranium-233, the Manhattan project, laboratory production of the first milligram of plutonium, pre-1945 medical use of high-dosage radiation, medical treatments with phosphorus 32, and fallout. Dr. Gofman also discusses his relationships with Professor Oppenheimer, Joe Hamilton, Ernest Lawrence, and other. Then Dr. Gofman describes his pioneering work on his true interests concerning heart disease, heparin, and lipoproteins. Finally intra-AEC political issues are discussed relating to testing of atomic weapons.



Human radiation studies: Remembering the early years: Oral history of radiologist Henry I. Kohn, M.D., Ph.D., conducted September 13, 1994  

SciTech Connect

This report is a transcript of an interview of Dr. Henry I. Kohn by representatives of the US DOE Office of Human Radiation Experiments. Dr. Kohn was selected for this interview because of the positions he held at Oak Ridge National Laboratory, University of California at San Francisco, and Harvard Medical School. Dr. Kohn discussed his remembrances of his experiences in blood chemistry of animals and patients exposed to radiation, and his remembrances of several radiobiologists.



A Numerical Model for Combustion of Bubbling Thermoplastic ...  

Science Conference Proceedings (OSTI)

... where Wi = dri/dt and Wi+1 = dri+1/dt are velocities of inner and outer nodes respectively, the mass conservation equation can be rewritten as ...




E-Print Network (OSTI)

of noble gases in molten salts, which also provide a modeln Hexane B2 275C. Hydrogen-Molten Salt WI (dynes/em) WI PI

Joyce, Peter James



Determining Plutonium Mass in Spent Fuel with Nondestructive Assay Techniques NGSI Research Overview and Update on NDA Techniques  

E-Print Network (OSTI)

the Institute of Nuclear Material Management, Baltimore, MD,the Institute of Nuclear Material Management, Baltimore MD (the Institute of Nuclear Material Management, Baltimore MD (

A., V. Mozin, S.J. Tobin, L.W. Cambell, J.R. Cheatham, C.R. Freeman, C.J. Gesh,



CHE MIDDLE STATES COMMISSION ON HIGHER EDUCATION 3624 Market Street, Philadelphia, PA 19104-2630. Tel: 267-284-S000. Fax: 215-662-5501  

E-Print Network (OSTI)

), Century City II, Crystal City, VA; Ner Israel Rabbinical College, Baltimore, MD; Northrop Grumman Corp Raven Academy, Baltimore, MD; Lockheed Martin Corporation, Middle River, MD; Lockheed Martin


Integration of Molecular Networks in the Shoot Apical Meristem that Controls Floral Specification in Arabidopsis thaliana  

E-Print Network (OSTI)

lycopersicum_miR156b Solanum_lycopersicum_miR156c Sorghum_bicolor_miR156a Sorghum_bicolor_miR156b Sorghum_bicolor_miR156c Sorghum_

Lal, Shruti



Studying Altocumulus Plus Virga with Ground-based Active and Passive Remote Sensors Zhien Wang1, Kenneth Sassen2, David Whiteman3, and Belay Demoz3 1University of Maryland, Baltimore County, Catonsville, MD 21228 2University of Alaska, Fairbanks, Alaska 99775 3NASA Goddard Space Flight Center, Greenbelt, MD 20771 E-mail: zhien@agnes.gsfc.nasa.gov  

NLE Websites -- All DOE Office Websites (Extended Search)

Seasonal and Interannual Variations of Boundary-layer Mixed-phase Seasonal and Interannual Variations of Boundary-layer Mixed-phase Cloud Properties Observed at the ARCF NSA site Zhien Wang, Ming Zhao, and Min Deng University of Wyoming , Laramie, Wyoming, 82071, zwang@uwyo.edu References Curry, J. et al., 1996: Overview of Arctic cloud and radiation characteristics. J. Climate., 9, 1731-1764. Wang, Z. and K. Sassen, 2002: Cirrus cloud microphysical property retrieval using lidar and radar measurements, I: algorithm description and comparison with in situ data. J. Appl. Meteor., 41, 218-229. Wang, Z., K. Sassen, D. Whiteman, and B. Demoz, 2004: Studying altocumulus plus virga with ground-based active and passive remote sensors. J. Appl. Meteor.,43, 449-460. Wang, Z., 2007: Refined Two-channel Microwave Radiometer Liquid Water Path Retrieval at Cold Regions by Using Multiple-sensor Measurements. IEEE Geoscience and Remote


Medical Facilities With Experience Evaluating CBD  

NLE Websites -- All DOE Office Websites (Extended Search)

Samantha Phone: 310-433-5342 Harborview Medical Center University of Washington Jordan Firestone, M.D.; Victor VanHee, M.D.; Szerre Vedal, M.D.; David Bonauto, M.D.; or June...



E-Print Network (OSTI)

NJ, 07036. **Present address: ***Present address: Chemistry Department, Beloit College, Beloit, WI Solar Energy

Robbins, J.L.




E-Print Network (OSTI)

, University of Wisconsin, Madison, WI 53706 (3) Department of Theoretical Physics and Plasma Research

Redi, Martha H.


Diseases associated with hidranitis suppurativa: part 2 of a series on hidradenitis  

E-Print Network (OSTI)

2 of a series on hidradenitis Noah Scheinfeld MD DermatologyCorrespondence: Noah Scheinfeld MD: Scheinfeld@earthlink.net

Scheinfeld, Noah



Update on the treatment of genital warts  

E-Print Network (OSTI)

treatment of genital warts Noah Scheinfeld MD DermatologyCorrespondence: Noah Scheinfeld MD: Scheinfeld@earthlink.net

Scheinfeld, Noah




E-Print Network (OSTI)

Institute for Plasma Research, U. MD, College Park, MD 20742, USA c Plasma Science and Fusion Center, MIT


TREC-10 Video Track Proposal  

Science Conference Proceedings (OSTI)

... Systems Plus + Linguistic Data Consortium Rockville, MD # Dakota Consulting, Inc Silver Spring, MD ... Asia Europe North America South America ...



Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available



1996 Department of Energy pre-freshman enrichment program at GMI Engineering and Management Institute, Flint, MI  

SciTech Connect

This document reports on a summer program to encourage students to pursue scientific or engineering professions. The topics of the report include a description of the recruitment program, selection criteria for participants, workshops, nine follow up activities, research projects and student`s presentation, and field trips. Course descriptions and schedule are included as appendices.
