Powered by Deep Web Technologies
Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Category:Baltimore, MD | Open Energy Information  

Open Energy Info (EERE)

MD MD Jump to: navigation, search Go Back to PV Economics By Location Media in category "Baltimore, MD" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Baltimore MD Baltimore Gas & Electric Co.png SVFullServiceRestauran... 69 KB SVQuickServiceRestaurant Baltimore MD Baltimore Gas & Electric Co.png SVQuickServiceRestaura... 67 KB SVHospital Baltimore MD Baltimore Gas & Electric Co.png SVHospital Baltimore M... 69 KB SVLargeHotel Baltimore MD Baltimore Gas & Electric Co.png SVLargeHotel Baltimore... 69 KB SVLargeOffice Baltimore MD Baltimore Gas & Electric Co.png SVLargeOffice Baltimor... 69 KB SVMediumOffice Baltimore MD Baltimore Gas & Electric Co.png SVMediumOffice Baltimo... 68 KB SVMidriseApartment Baltimore MD Baltimore Gas & Electric Co.png



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0 0 Recipient. County of Baltimore, MD ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM Activities Determination/ Categorical Exclusion Reviewer's Specific Instructions and Rationale (Restrictions and Allowable Activity) Renovation for the Green Resource Center B5.1 All administrative activities, audits, outreach, and technical advice should be CX'd. All EE activities are subject to the Waste Stream Clause, Historic Preservation clause, and Engineering clause. Energy Audits for Business & Government Structures A9, All, B5.1 None Revolving Loan Fund A9, All, B5.1 All administrative activities, audits, outreach, and technical advice should be CX'd. All EE activities are subject to the Waste Stream Clause, Historic Preservation clause, and Engineering clause.


Archive Reference Buildings by Climate Zone: 4A Baltimore, Maryland |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

A Baltimore, Maryland A Baltimore, Maryland Archive Reference Buildings by Climate Zone: 4A Baltimore, Maryland Here you will find past versions of the reference buildings for new construction commercial buildings, organized by building type and location. A summary of building types and climate zones is available for reference. Current versions are also available. You can download ZIP files that contain the following: An EnergyPlus software input file (.idf) An html file showing the results from the EnergyPlus simulation (.html) A spreadsheet that summarizes the inputs and results for each location (.xls) The EnergyPlus TMY2 weather file (.epw). benchmark-v1.0_3.0-4a_md_baltimore.zip benchmark-v1.1_3.1-4a_usa_md_baltimore.zip benchmark-new-v1.2_4.0-4a_usa_md_baltimore.zip More Documents & Publications


Baltimore Boy's Asthma Improved Through Retrofit | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Baltimore Boy's Asthma Improved Through Retrofit Baltimore Boy's Asthma Improved Through Retrofit Baltimore Boy's Asthma Improved Through Retrofit October 31, 2009 - 11:32am Addthis Joshua DeLung What does this mean for me? The Baltimore Green and Healthy Homes Initiative program, made possible with Recovery Act dollars, provides comprehensive health, safety, and energy efficiency upgrades to low-income families around the city. Lekquan Young rushed her 8-month-old son to the hospital when she noticed his chest looked sunken as he breathed. The doctor told her that her baby son had asthma. Today, her son is 8 years old and has suffered frequent asthma attacks at home. "There was mold within the home and the air quality wasn't good," says Lekquan, a single mom living in Baltimore, Md. The roof over the


Baltimore County- Property Tax Credit for High Performance Buildings and Homes  

Energy.gov (U.S. Department of Energy (DOE))

The state of Maryland permits local governments (Md Code: Property Tax § 9-242) to offer property tax credits for high performance buildings if they choose to do so. Baltimore County exercised this...


DOE - Office of Legacy Management -- Armco-Rustless Iron and Steel - MD 03  

Office of Legacy Management (LM)

Armco-Rustless Iron and Steel - MD Armco-Rustless Iron and Steel - MD 03 FUSRAP Considered Sites Site: Armco-Rustless Iron & Steel (MD.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: ARMCO Baltimore Works MD.03-1 Location: Baltimore , Maryland MD.03-2 Evaluation Year: 1987 MD.03-1 Site Operations: Test rolling of uranium billets. MD.03-2 MD.03-3 Site Disposition: Eliminated - Potential for contamination remote due to limited quantity of material and duration of test MD.03-1 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MD.03-2 Radiological Survey(s): Health and safety monitoring conducted during operations MD.03-2 Site Status: Eliminated from consideration under FUSRAP MD.03-1 Also see


DOE - Office of Legacy Management -- Max Zuckerman and Sons Inc - MD 04  

Office of Legacy Management (LM)

Inc - MD 04 Inc - MD 04 FUSRAP Considered Sites Site: MAX ZUCKERMAN & SONS, INC. (MD.04 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Maryland Alloys Corporation MD.04-1 Location: 5245 Fairlawn Avenue , Baltimore , Maryland MD.04-2 Evaluation Year: 1994 MD.04-1 MD.04-3 Site Operations: Scrap metals broker that arranged purchases of materials for third party buyers. MD.04-2 MD.04-4 Site Disposition: Eliminated - Potential for contamination remote MD.04-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium (Q-11) Oxide/Residue MD.04-2 MD.04-4 Radiological Survey(s): Yes MD.04-1 Site Status: Eliminated from consideration under FUSRAP MD.04-3 Also see Documents Related to MAX ZUCKERMAN & SONS, INC.


DOE - Office of Legacy Management -- Johns Hopkins University - MD 02  

Office of Legacy Management (LM)

Johns Hopkins University - MD 02 Johns Hopkins University - MD 02 FUSRAP Considered Sites Site: JOHNS HOPKINS UNIVERSITY (MD.02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Baltimore , Maryland MD.02-1 Evaluation Year: 1987 MD.02-2 Site Operations: Conducted spectroscopic studies under contract number AT(49-1)-309. MD.02-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantities of material used in a controlled environment MD.02-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Tritium MD.02-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to JOHNS HOPKINS UNIVERSITY


Proceedings: 2002 Radiation Protection Technology Conference: Baltimore, MD, October 2002  

Science Conference Proceedings (OSTI)

In response to program pressures resulting from shorter outages, combined with a diminishing group of contract health physics (HP) technicians, HP professionals must continuously upgrade their programs. Demanding emergent work also requires HP technicians in the nuclear industry to use new methods and technologies. The EPRI Radiation Protection Technology Conference was directed at highlighting a number of key health physics issues and developments.



Proceedings: 2002 Radiation Protection Technology Conference: Baltimore, MD, October 2002  

Science Conference Proceedings (OSTI)

In response to program pressures resulting from shorter outages, combined with a diminishing group of contract health physics (HP) technicians, HP professionals must continuously upgrade their programs. Demanding emergent work also requires HP technicians in the nuclear industry to use new methods and technologies. The EPRI Radiation Protection Technology Conference was directed at highlighting a number of key health physics issues and developments.




DOE - Office of Legacy Management -- Maryland Disposal Site - MD 05  

Office of Legacy Management (LM)

Maryland Disposal Site - MD 05 Maryland Disposal Site - MD 05 FUSRAP Considered Sites Site: MARYLAND DISPOSAL SITE (MD.05 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Baltimore - Vicinity , Maryland MD.05-1 Evaluation Year: 1989 MD.05-1 Site Operations: Proposed disposal site - never developed. MD.05-1 Site Disposition: Eliminated Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Indicated Radiological Survey(s): None Indicated Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MARYLAND DISPOSAL SITE MD.05-1 - Report (DOE/OR/20722-131 Revision 0); Site Plan for the Maryland Disposal Site; April 1989 Historical documents may contain links which are no longer valid or to


Baltimore County - Wind Ordinance | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Baltimore County - Wind Ordinance Eligibility Agricultural Residential Savings For Wind Buying & Making Electricity Program Information Maryland Program Type Siting and...


DOE - Office of Legacy Management -- Bendix Corp Frieze Division - MD 0-01  

Office of Legacy Management (LM)

Bendix Corp Frieze Division - MD Bendix Corp Frieze Division - MD 0-01 FUSRAP Considered Sites Site: BENDIX CORP., FRIEZE DIVISION (MD.0-01 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Baltimore , Maryland MD.0-01-1 Evaluation Year: 1987 MD.0-01-3 Site Operations: Produced "classified units" believed to be electronics components - no radioactive materials involved. MD.0-01-1 MD.0-01-3 Site Disposition: Eliminated - No radioactive materials handled at this site MD.0-01-3 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MD.0-01-3 Radiological Survey(s): No Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to BENDIX CORP., FRIEZE DIVISION


Md. Saifur Rahaman Md. Saifur Rahaman  

E-Print Network (OSTI)

of Chemical and Environmental Engineering "Environmental Applications of Nanotechnology" Advisor: ProfMd. Saifur Rahaman Resume 1 Md. Saifur Rahaman Department of Chemical and Environmental Engineering from Wastewater through Struvite Crystallization in a Fluidized Bed Reactor: Kinetics, Hydrodynamics

Elimelech, Menachem


Local Restaurants - Gaithersburg, MD  

Science Conference Proceedings (OSTI)

... Subway 16 Bureau Dr. Gaithersburg, MD (301) 527-8988. Thai Tanium 657 Center Point Way Gaithersburg, MD (301) 990-3699. ...



Baltimore County - Property Tax Credit for Solar and Geothermal...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

You are here Home Savings Baltimore County - Property Tax Credit for Solar and Geothermal Devices (Maryland) Baltimore County - Property Tax Credit for Solar and Geothermal...


Baltimore County, Maryland ASHRAE 169-2006 Climate Zone | Open...  

Open Energy Info (EERE)

Baltimore County, Maryland ASHRAE 169-2006 Climate Zone Jump to: navigation, search County Climate Zone Place Baltimore County, Maryland ASHRAE Standard ASHRAE 169-2006 Climate...


Baltimore City County, Maryland ASHRAE 169-2006 Climate Zone...  

Open Energy Info (EERE)

Baltimore City County, Maryland ASHRAE 169-2006 Climate Zone Jump to: navigation, search County Climate Zone Place Baltimore City County, Maryland ASHRAE Standard ASHRAE 169-2006...


Energy Challenge Four: The Baltimore Neighborhood Energy Challenge |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Challenge Four: The Baltimore Neighborhood Energy Challenge Challenge Four: The Baltimore Neighborhood Energy Challenge Energy Challenge Four: The Baltimore Neighborhood Energy Challenge June 28, 2010 - 10:00am Addthis John Lippert We've already seen over the past three Mondays how cooperation among the public sector, nonprofit organizations, and for-profit private sector firms can produce some real benefits. We've also seen how the success of a project or program can depend on the ability to mobilize the local community. Let's look at another case where these elements successfully converge: The Baltimore Neighborhood Energy Challenge (BNEC). BNEC is a pilot program of the Baltimore Office of Sustainability (part of the Baltimore City Department of Planning) and the Baltimore Community Foundation, a tax-exempt, publicly supported organization serving the Greater Baltimore


Baltimore Vet Cuts Energy Bills With Solar | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Baltimore Vet Cuts Energy Bills With Solar Baltimore Vet Cuts Energy Bills With Solar Baltimore Vet Cuts Energy Bills With Solar October 28, 2010 - 5:09pm Addthis Baltimore resident Paul Bennett installed 14 solar panels such as these on his historic row home with the help of a state solar grant and federal tax credit through the Recovery Act. | Energy Department Photo | Baltimore resident Paul Bennett installed 14 solar panels such as these on his historic row home with the help of a state solar grant and federal tax credit through the Recovery Act. | Energy Department Photo | Stephen Graff Former Writer & editor for Energy Empowers, EERE On a 'green' mission last spring, a 62 year-old retiree living on a modest income in Baltimore found himself at the Solar and Wind Expo at the Timonium Fairgrounds in Maryland.

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Urban Community Forestry in Washington, DC and Baltimore, MD: The Role of Nonprofit Organizations.  

E-Print Network (OSTI)

??Since the 1980s environmental service delivery funding at both the state and city government level has been in decline, limiting urban community forestry programs. This… (more)

Rodier, Meghan L.



Baltimore Gas & Electric Company (Gas)- Residential Energy Efficiency Rebate Program  

Energy.gov (U.S. Department of Energy (DOE))

The Baltimore Gas & Electric Company (BGE) offers the Smart Energy Savers Program for residential natural gas customers to improve the energy efficiency of eligible homes. Rebates are available...


Baltimore Gas & Electric Company (Electric)- Residential Energy Efficiency Rebate Program  

Energy.gov (U.S. Department of Energy (DOE))

The Baltimore Gas & Electric Company (BGE) offers rebates for residential customers to improve the energy efficiency of eligible homes. Rebates are available for Energy Star clothes washers,...


Baltimore Gas & Electric Company (Electric)- Commercial Energy Efficiency Program  

Energy.gov (U.S. Department of Energy (DOE))

Baltimore Gas and Electric (BGE) provides incentives for technical assistance, retrofitting inefficient equipment, starting a new construction project, launching a major renovation, purchasing new...


Baltimore Gas and Electric Company (Gas) - Residential Energy...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Gas) - Residential Energy Efficiency Rebate Program Baltimore Gas and Electric Company (Gas) - Residential Energy Efficiency Rebate Program Eligibility Residential Savings For...


Baltimore Gas & Electric Company- Home Performance with Energy Star Rebates  

Energy.gov (U.S. Department of Energy (DOE))

The Baltimore Gas & Electric Company (BG&E) offers the Home Performance with Energy Star Program that provides incentives for residential customers who have audits performed by...


Baltimore County - Property Tax Credit for Solar and Geothermal...  

Open Energy Info (EERE)

Maximum Incentive Heating System: 5,000 Hot Water Supply System: 1,500 Electricity Generation, Cooling: Not specified Program Administrator Baltimore County Office of Budget and...


NNSA to Conduct Aerial Radiation Monitoring Survey over Baltimore...  

NLE Websites -- All DOE Office Websites (Extended Search)

Conduct Aerial Radiation Monitoring Survey over Baltimore Jan. 15-16 | National Nuclear Security Administration Our Mission Managing the Stockpile Preventing Proliferation Powering...



U.S. Energy Information Administration (EIA)

... is through August, the latest data available",,,,, ,"Norfolk, VA","Baltimore, MD","Mobile, AL","New Orleans, LA","Detroit, MI","Seattle, ...


Baltimore Gas & Electric Co | Open Energy Information  

Open Energy Info (EERE)

Baltimore Gas and Electric Company) Baltimore Gas and Electric Company) Jump to: navigation, search Name Baltimore Gas & Electric Co Place Baltimore, Maryland Service Territory Maryland Website www.bge.com/Pages/default Green Button Committed Yes Utility Id 1167 Utility Location Yes Ownership I NERC Location RFC NERC RFC Yes Activity Transmission Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] SGIC[3] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! Baltimore Gas and Electric Company Smart Grid Project was awarded $200,000,000 Recovery Act Funding with a total project value of $451,814,234. Utility Rate Schedules Grid-background.png


Baltimore Gas & Electric Co | Open Energy Information  

Open Energy Info (EERE)

Baltimore Gas & Electric Co Baltimore Gas & Electric Co (Redirected from BGE) Jump to: navigation, search Name Baltimore Gas & Electric Co Place Baltimore, Maryland Service Territory Maryland Website www.bge.com/Pages/default Green Button Landing Page www.bge.com/Pages/default Green Button Reference Page www.businesswire.com/news Green Button Implemented Yes Utility Id 1167 Utility Location Yes Ownership I NERC Location RFC NERC RFC Yes Activity Transmission Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] SGIC[3] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! Baltimore Gas and Electric Company Smart Grid Project was awarded


Multiscale FEM-MD schema  

Science Conference Proceedings (OSTI)

... coupling finite element modeling (FEM) to atomistic Molecular Dynamics (MD) 1 ... for using extremely high (very unrealistic) indentation rates that are ...



Baltimore Gas & Electric Co | Open Energy Information  

Open Energy Info (EERE)

Baltimore Gas & Electric Co Baltimore Gas & Electric Co Place Baltimore, Maryland Service Territory Maryland Website www.bge.com/Pages/default Green Button Committed Yes Utility Id 1167 Utility Location Yes Ownership I NERC Location RFC NERC RFC Yes Activity Transmission Yes Activity Distribution Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] SGIC[3] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! Baltimore Gas and Electric Company Smart Grid Project was awarded $200,000,000 Recovery Act Funding with a total project value of $451,814,234. Utility Rate Schedules Grid-background.png 100 watt Incandescent Lighting 100000 Lumen 1090 Watt MHR Lighting


Baltimore Vet Cuts Energy Bills With Solar | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

October 28, 2010 - 5:09pm Addthis Baltimore resident Paul Bennett installed 14 solar panels such as these on his historic row home with the help of a state solar grant and...


Baltimore County - Property Tax Credit for Solar and Geothermal Devices  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Baltimore County - Property Tax Credit for Solar and Geothermal Baltimore County - Property Tax Credit for Solar and Geothermal Devices (Maryland) Baltimore County - Property Tax Credit for Solar and Geothermal Devices (Maryland) < Back Eligibility Multi-Family Residential Residential Savings Category Solar Buying & Making Electricity Heating & Cooling Commercial Heating & Cooling Heating Water Heating Maximum Rebate Heating System: $5,000 Hot Water Supply System: $1,500 Electricity Generation, Cooling: Not specified Program Info State Maryland Program Type Property Tax Incentive Rebate Amount Allocated budget for these credits has been met. New applications will be placed on a wait list. 50% of eligible costs Provider Office of Budget and Finance The total volume of credits awarded through this program has exceeded the


Baltimore Gas and Electric Company - Home Performance with Energy Star  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Baltimore Gas and Electric Company - Home Performance with Energy Baltimore Gas and Electric Company - Home Performance with Energy Star Rebates Baltimore Gas and Electric Company - Home Performance with Energy Star Rebates < Back Eligibility Installer/Contractor Residential Savings Category Home Weatherization Commercial Weatherization Heating & Cooling Commercial Heating & Cooling Cooling Construction Design & Remodeling Sealing Your Home Ventilation Manufacturing Heating Heat Pumps Appliances & Electronics Commercial Lighting Lighting Water Heating Maximum Rebate HVAC (Equipment Installation/Duct Sealing/Tune-up): $1,150 Air Sealing/Insulation/Gas Tankless Water Heater: $2,000 Total: $3,150 Program Info Funding Source Maryland Energy Administration State Maryland Program Type Utility Rebate Program Rebate Amount Comprehensive Home Energy Audit: Reduced cost of $100


Baltimore Gas and Electric Company (Electric) - Commercial Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Baltimore Gas and Electric Company (Electric) - Commercial Energy Baltimore Gas and Electric Company (Electric) - Commercial Energy Efficiency Program Baltimore Gas and Electric Company (Electric) - Commercial Energy Efficiency Program < Back Eligibility Commercial Fed. Government Industrial Local Government Nonprofit State Government Savings Category Heating & Cooling Commercial Heating & Cooling Cooling Other Heat Pumps Appliances & Electronics Commercial Lighting Lighting Manufacturing Maximum Rebate $1,000,000/corporate tax ID/year Commercial Rebates: Contact BGE Retro-Commissioning, Operations, and Maintenance: $15,000 Program Info State Maryland Program Type Utility Rebate Program Rebate Amount New Construction Performance Lighting: $0.40 - $0.80/watt reduced New Construction Green Building Incentive: $0.25 - $0.40/kWh saved first


Baltimore Gas and Electric Company (Electric) - Residential Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Baltimore Gas and Electric Company (Electric) - Residential Energy Baltimore Gas and Electric Company (Electric) - Residential Energy Efficiency Rebate Program Baltimore Gas and Electric Company (Electric) - Residential Energy Efficiency Rebate Program < Back Eligibility Residential Savings Category Home Weatherization Commercial Weatherization Heating & Cooling Commercial Heating & Cooling Cooling Appliances & Electronics Sealing Your Home Ventilation Manufacturing Heat Pumps Commercial Lighting Lighting Water Heating Maximum Rebate Contact BGE Program Info State Maryland Program Type Utility Rebate Program Rebate Amount Central A/C: $150 - $500 Air Source Heat Pump: $200 - $500 Ductless Mini-Split Heat Pump: $300 Geothermal Heat Pump (Closed Loop): $500 Duct Sealing: $250 Tune-ups: $100 Heat Pump Water Heater: $350 Room A/C: $25


Baltimore Gas and Electric Company (Gas) - Residential Energy Efficiency  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Gas) - Residential Energy (Gas) - Residential Energy Efficiency Rebate Program Baltimore Gas and Electric Company (Gas) - Residential Energy Efficiency Rebate Program < Back Eligibility Residential Savings Category Home Weatherization Commercial Weatherization Sealing Your Home Ventilation Manufacturing Heating & Cooling Commercial Heating & Cooling Heating Program Info State Maryland Program Type Utility Rebate Program Rebate Amount Gas Furnace: $300 or $400 Duct Sealing: $200 Tune-ups: $100 Installation Rebates: Contact BGE The Baltimore Gas and Electric Company (BGE) offers the Smart Energy Savers Program for residential natural gas customers to improve the energy efficiency of eligible homes. Rebates are available for furnaces, HVAC system tune-ups, and insulation measures. All equipment and installation


Presented at the Low Impact Development Roundtable Conference, Baltimore, MD, July 2001. Infiltration Through Compacted Urban Soils and  

E-Print Network (OSTI)

. Infiltration Through Compacted Urban Soils and Effects on Biofiltration Design Robert Pitt,1 Shen-En Chen,2.................................................................................................................................................4 Soil Modifications to Enhance Infiltration...........................................6 Disturbed Urban Soil Field Infiltration Measurements

Pitt, Robert E.

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Baltimore County, Maryland: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Baltimore County, Maryland: Energy Resources Baltimore County, Maryland: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 39.4647665°, -76.7336521° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.4647665,"lon":-76.7336521,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


North Baltimore, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Baltimore, Ohio: Energy Resources Baltimore, Ohio: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 41.1828302°, -83.6782668° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":41.1828302,"lon":-83.6782668,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Baltimore Gas and Electric Company Smart Grid Project | Open Energy  

Open Energy Info (EERE)

Company Company Country United States Headquarters Location Baltimore, Maryland Recovery Act Funding $200,000,000.00 Total Project Value $451,814,234.00 Coverage Area Coverage Map: Baltimore Gas and Electric Company Smart Grid Project Coordinates 39.2903848°, -76.6121893° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}


High Energy-Efficiency Retrofits to Baltimore's Row Homes  

SciTech Connect

The purpose of the research project is to develop high-perfommnce, energy-eflicient retrofits of existing row homes in Baltimore, Maryland. These efficiency enhancements are to optimize building envelope improvements, mechanical equipment improvements and operational improvements to the highest cost-effective level. Furthermore, this project is to investigate and demonstrate the impact of high-performance energy-efficiency retrofit improvements on row homes in the Historic East area of Baltimore. Three homes awaiting renovation are planned to receive building envelope, mechanical system, and electrical system improvements that will improve their energy petiormance. An incremental additional cost ceiling of $4000 for the energy eftlciency improvements, beyond those normally installed, has been set by the project.

Chalk, J.; Johnson, A.L.; Lipscomb, L.; Wendt, R.



Determining Plutonium Mass in Spent Fuel with Nondestructive Assay Techniques NGSI Research Overview and Update on NDA Techniques  

E-Print Network (OSTI)

the Institute of Nuclear Material Management, Baltimore, MD,the Institute of Nuclear Material Management, Baltimore MD (the Institute of Nuclear Material Management, Baltimore MD (

A., V. Mozin, S.J. Tobin, L.W. Cambell, J.R. Cheatham, C.R. Freeman, C.J. Gesh,



Harvesting graphics power for MD simulations  

E-Print Network (OSTI)

We discuss an implementation of molecular dynamics (MD) simulations on a graphic processing unit (GPU) in the NVIDIA CUDA language. We tested our code on a modern GPU, the NVIDIA GeForce 8800 GTX. Results for two MD algorithms suitable for short-ranged and long-ranged interactions, and a congruential shift random number generator are presented. The performance of the GPU's is compared to their main processor counterpart. We achieve speedups of up to 80, 40 and 150 fold, respectively. With newest generation of GPU's one can run standard MD simulations at 10^7 flops/$.

J. A. van Meel; A. Arnold; D. Frenkel; S. F. Portegies Zwart; R. G. Belleman



Climatological Analyses of Thunderstorms and Flash Floods in the Baltimore Metropolitan Region  

Science Conference Proceedings (OSTI)

The climatology of thunderstorms and flash floods in the Baltimore, Maryland, metropolitan region is examined through analyses of cloud-to-ground (CG) lightning observations from the National Lightning Detection Network (NLDN) and discharge ...

Alexandros A. Ntelekos; James A. Smith; Witold F. Krajewski



Long range forecast of power demands on the Baltimore Gas and Electric Company system. Volume 1  

SciTech Connect

The report presents the results of an econometric forecast of peak and electric power demands for the Baltimore Gas and Electric Company (BGandE) through the year 2003. The report describes the methodology, the results of the econometric estimations and associated summary statistics, the forecast assumptions, and the calculated forecasts of energy usage and peak demand. Separate models were estimated for summer and winter residential electricity usage in both Baltimore city and the non-city portion of the BGandE service area. Equations were also estimated for commercial energy usage, industrial usage, streetlighting, and for losses plus Company use. Non-econometric techniques were used to estimate future energy use by Bethlehem Steel Corporation's Sparrows Point plant in Baltimore County, Conrail, and the Baltimore Mass Transit Administration underground rail system. Models of peak demand for summer and winter were also estimated.

Estomin, S.L.; Kahal, M.I.



Spontaneous fission of /sup 259/Md  

SciTech Connect

The mass and kinetic energy distributions of fission fragments from the spontaneous fission of th newly discovered nuclide /sup 259/Md were obtained. /sup 259/Md was identified as the E. C. daughter of /sup 259/No, and was found to decay entirely (> 95%) by spontaneous fission with a 95-min half-life. From the kinetic energies measured for 397 pairs of coincident fragments, a mass distribution was derived that is symmetric with sigma = 13 amu. /sup 259/Md, together with /sup 258/Fm and /sup 259/Fm, form a select group of three nuclides whose mass division in spontaneous fission is highly symmetric. Unlike the total-kinetic-energy (TKE) distributions of /sup 258/Fm and /sup 259/Fm, which peak at approx. = to 240 MeV, this distribution for /sup 259/Md is broad and is 50 MeV lower in energy. Analysis of the mass and energy distributions shows that events near mass symmetry also exhibit a broad TKE distribution, with one-third of the symmetric events having TKEs less than 200 MeV. The associated of low TKEs with symmetric mass division in the fission of very heavy actinides is anomalous and inconsistent with theories based upon the emergence of fragment shells near the scission point. Either three-body fragmentation or peculiar fragment shapes are assumed as the cause for the large consumption of Coulomb energy observed for a significant fraction of symmetric fissions in /sup 259/Md. 6 figures.

Hulet, E.K.; Wild, J.F.; Lougheed, R.W.; Baisden, P.A.; Landrum, J.H.; Dougan, R.J.; Mustafa, M.; Ghiorso, A.; Nitschke, J.M.



Baltimore Aircoil Company (BAC) ice storage test report  

DOE Green Energy (OSTI)

The Ice Storage Test Facility (ISTF) is designed to test commercial ice storage systems. Baltimore Aircoil Company (BAC) provided a storage tank equipped with coils designed for use with a liquid overfeed refrigeration system. Separate coils were also supplied for use with a secondary fluid system. The BAC ice storage system was tested over a wide range of operating conditions. System performance was satisfactory under both charging and discharging conditions. During the liquid-overfeed ice build cycle, the evaporator temperature closely matched the manufacturer's literature. The measured average brine temperatures were slightly higher than those given in the BAC literature (i.e., the BAC report is conservative). During discharge cycles, the storage tank outlet temperature remains nearly constant below 35{degree}F, rising only after most of the ice has been melted. The discharge performance was relatively unaffected by discharge rates or tank inlet temperatures. Based on these tests, a storage tank sized solely according to the latent ice storage capacity is capable of providing a relatively constant temperature to the load throughout most of the discharge cycle. This report describes BAC system performance fully under both charging and discharging conditions. Companion reports describe ISTF test procedures and ice-making efficiency test results that are common to many of the units tested. 10 refs., 30 figs., 7 tabs.

Stovall, T.K.



Compute Node MD3000 Storage Array  

E-Print Network (OSTI)

Compute Node MD3000 Storage Array Dell 2950 Head Node 24-Port Switch Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node Compute Node 24-Port Switch Dell 2950

Weber, David J.


Heart Failure Jason Ryan, MD, MPH  

E-Print Network (OSTI)

1 Heart Failure Jason Ryan, MD, MPH Director, UCONN Heart Failure Center University of Connecticut,084,000 $34.8 billion Background on Heart Failure Heart failure (HF) is a major public health problem resulting in substantial morbidity and mortality 1American Heart Association.2008 Heart and Stroke

Oliver, Douglas L.


Free Energy Calculation in MD Simulation  

E-Print Network (OSTI)

Free Energy Calculation in MD Simulation #12;Basic Thermodynamics Helmoholtz free energy A = U ­ TS + i Ni dA = wrev (reversible, const N V T) eq (22.9) McQuarrie & Simon Gibbs free energy G = U;Implication of Free Energy A B Keq = [A]/[B] Keq = exp (-G0 /RT) G0 = -RT ln Keq G = G0 + RT ln Q G > 0

Nielsen, Steven O.


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


Physiological functions for brain NF-kB Mollie K. Meffert and David Baltimore  

E-Print Network (OSTI)

Physiological functions for brain NF-kB Mollie K. Meffert and David Baltimore Division of BiologyB (NF-kB) family of transcription factors are activated within the CNS in pathological settings of the mechanisms of Ca2C -responsive activation and synaptic signaling to the nucleus by NF-kB transcription

Baltimore, David


CHE MIDDLE STATES COMMISSION ON HIGHER EDUCATION 3624 Market Street, Philadelphia, PA 19104-2630. Tel: 267-284-S000. Fax: 215-662-5501  

E-Print Network (OSTI)

), Century City II, Crystal City, VA; Ner Israel Rabbinical College, Baltimore, MD; Northrop Grumman Corp Raven Academy, Baltimore, MD; Lockheed Martin Corporation, Middle River, MD; Lockheed Martin


Oral Histories: Pathologist Clarence Lushbaugh, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

3 HUMAN RADIATION STUDIES: REMEMBERING THE EARLY YEARS Oral History of Pathologist Clarence Lushbaugh, M.D. Conducted October 5, 1994 United States Department of Energy Office of...

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Allocation of petroleum feedstock: Baltimore Gas and Electric Company, Sollers Point SNG Plant, Sollers Point, Baltimore County, Maryland. Final environmental impact statement  

DOE Green Energy (OSTI)

An allocation of naphtha feedstock up to 2,186,000 barrels per year to Baltimore Gas and Electric Company (BG and E) to operate its synthetic natural gas (SNG) facility is being considered. The allocation would enable BG and E to produce 10,800,000 mcf of SNG during a 180 day period. Operation of the plant at design capacity is expected to result in annual pollution emissions as follows: 626.4 tons of sulfur oxides, 168.5 tons of nitrogen oxides and 21.6 tons of particulate matter. Incremental emissions due to plant operations relative to existing emissions in Baltimore County are less than 1%. All Federal and State air quality standards should be met. Treated effluent is to be discharged into the Patapasco River where the environmental impacts are not expected to be significant. The SNG facility has been designed to be in compliance with all applicable Federal, State and local effluent standards. Water consumption requirements of 335,000 gallons per day are not expected to significantly tax the area's water resources. Sound generated by the SNG facility will be inaudible or imperceptible. All other operational impacts on land use, population, visual quality, roadways, community facilities and services and ecological systems were judged to be minimal. Environmental impacts resulting from various alternatives ranging from full allocation through denial of an allocation are discussed.

Not Available



Net Zero Residential Test Facility Gaithersburg, MD Solar Photovoltaic Panels  

E-Print Network (OSTI)

1 Net Zero Residential Test Facility Gaithersburg, MD Solar Photovoltaic Panels Solar Thermal R-35 Rim Joist Area 5" open cell spray foam 2" mineral wool insulation blanket R-10 Basement Slab electric WH #12;NZERTF Gaithersburg, MD Solar Photovoltaic Array Roof Mounted South half of main roof

Oak Ridge National Laboratory


MD. SAIFUR RAHAMAN 9 Hillhouse Ave., Environmental Engineering Program  

E-Print Network (OSTI)

of Chemical Engineering, Yale University Project: "Environmental implications and applications of engineeredMD. SAIFUR RAHAMAN 9 Hillhouse Ave., Environmental Engineering Program Department of Chemical Crystallization in a Fluidized Bed Reactor: Kinetics, Hydrodynamics and Performance" Supervisor: Professor Donald

Elimelech, Menachem


Cove Point, MD Natural Gas Liquefied Natural Gas Imports from...  

Gasoline and Diesel Fuel Update (EIA)

Trinidad and Tobago (Million Cubic Feet) Cove Point, MD Natural Gas Liquefied Natural Gas Imports from Trinidad and Tobago (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug...


Cove Point, MD Natural Gas Liquefied Natural Gas Imports from...  

Annual Energy Outlook 2012 (EIA)

Norway (Million Cubic Feet) Cove Point, MD Natural Gas Liquefied Natural Gas Imports from Norway (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011...


Cove Point, MD Natural Gas Liquefied Natural Gas Imports from...  

Annual Energy Outlook 2012 (EIA)

Nigeria (Million Cubic Feet) Cove Point, MD Natural Gas Liquefied Natural Gas Imports from Nigeria (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011...


Cove Point, MD Natural Gas Liquefied Natural Gas Imports from...  

U.S. Energy Information Administration (EIA) Indexed Site

Algeria (Million Cubic Feet) Cove Point, MD Natural Gas Liquefied Natural Gas Imports from Algeria (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6...


Cove Point, MD Natural Gas Liquefied Natural Gas Imports from...  

U.S. Energy Information Administration (EIA) Indexed Site

Egypt (Million Cubic Feet) Cove Point, MD Natural Gas Liquefied Natural Gas Imports from Egypt (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7...


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


An experiment in contingent valuation: Willingness to pay for stormwater management. [Homeowners in Baltimore County  

SciTech Connect

The contingent valuation (CV) method is a technique used frequently in benefit-cost analysis to estimate the economic value of non-market goods such as environmental quality. In CV, surveys are used to ask people about their willingness to pay for a good in a hypothetical market situation. In this application, homeowners in Baltimore County were asked about their willingness to pay (WTP) for programs to control pollutants in urban stormwater runoff designed to achieve, respectively, 4% and 1% reductions in nutrient loadings to the Chesapeake Bay. The main variation comprised alternate descriptions of the payment vehicle. Tests show that the mean WTP by means of property taxes does not differ significantly from mean WTP via user charges. This result was somewhat surprising because of other evidence that the respondents believe strongly that user charges are fairer than property taxes. A best estimate of the benefits to homeowners in Baltimore County of controlling nutrient loads for urban stormwater is from $1.2 to $4.2 million annually, depending on the reduction objective.

Lindsey, G.H.



If you reside in WASHINGTON, DC - MD -VA - WV your salary will...  

National Nuclear Security Administration (NNSA)

If you are employed in the WASHINGTON, DC Metropolitan Area (D.C., Baltimore, Northern VA, Eastern WV, and Southern PA) your salary will range from: Pay Band Pay Plan(s) Minimum...


Security Standards for the Global Information Grid Gary Buda, Booz Allen & Hamilton, Linthicum, MD 21090  

E-Print Network (OSTI)

, Telcordia Technologies, Morristown, NJ 07960 Chris Kubic, Department of Defense, Ft. Meade, MD, 20755

Lee, Ruby B.



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)



Office of Legacy Management (LM)

J. A. QuigUy, M.D. J. A. QuigUy, M.D. NATIONALLPADCW~ OF oliI0 Cincbnati 39, Ohio September 23, 1960 TRIP RBPCRT TO PIONRBR DIVISION, BENDIX AVI4TIONC~ ION, DAVBNPQRT, SOWA,oNSEPTEMBR6-9,196O F. J. Klein CENTRAL FILE The purpose of this trip was tot (1) determine if a Bendix ronic energy cleaning system can clean uranium-contaminated drums to the extent of rcduciug the @ha ccmtazuinatiou level belav that required for sale as %oa-contaminatecl** by AEC Manual Chapter 5182-0s UOOO a dMlOO& average and at peak not more than 25,OOO a d~lOOcm2, and (2) observe . the health and safety aspects of the wotk and insure the adequate decontauimtiou of the machinery, tools, equi~t, aud teat area. This waa a wet operation Md the tauk waa not ventilated; hawever, should


Spatial Analysis of Residential Development and Urban-Rural Zoning in Baltimore County, Maryland  

E-Print Network (OSTI)

Over the past half-century, Baltimore County, Maryland has experienced various policy measures that have shaped development patterns. This thesis analyzes three spatially explicit parcel-level models of residential development in Baltimore County to examine the effects of land-use regulations on multiple density classes from 1996 to 2008. The first model analyzes the entire county, while the second analyzes areas outside the county urban growth boundary, while the third model studied areas inside the boundary. While this region has been previously analyzed, prior studies have generally ignored policy affects upon the density of new residential subdivisions. The use of a binary dependent variable, i.e. develop or not develop, represents a critical oversight as this assumes policy measures exert a uniform impact across all development types. This study addressed this issue with the literature by using a multinomial logit model to differentiate the effects of various development policies to better understand residential growth. The objective of this research is to determine what factors influence individual landowner's decision to convert an undeveloped property to residential use. The impacts of rural conservation (RC) zoning and urban growth boundaries (UGB) comprise the prominent land-use regulations analyzed in this study. The empirical estimates provided significant evidence that maximum density zoning effectively limits the density of new residential development in almost every model. Other policy measures, mainly rural legacy areas and critical areas, were generally found to be ineffective at limiting growth. This research concludes that maximum density zoning comprises the strongest tool for limiting development to a density mandated by the county government. Finally, maps depicting the predicted probability of development at two densities are included and discussed to indicate the areas most likely to be subdivided for residential land use.

Griffin, Alexander C.



Medical Scholars (BS/MD) Program Expectations and Requirements  

E-Print Network (OSTI)

Medical Scholars (BS/MD) Program Expectations and Requirements Undergraduate portion semester GPAs lower than 3.5 will trigger an automatic review by the Medical Scholars Committee of the Medical Scholars Committee, to delay their entry to medical school by one year to broaden their education

Fernandez, Eduardo


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


DOE - Office of Legacy Management -- Naval Ordnance Laboratory - MD 0-03  

Office of Legacy Management (LM)

Ordnance Laboratory - MD 0-03 Ordnance Laboratory - MD 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE LABORATORY (MD.0-03 ) Eliminated from further consideration under FUSRAP - Referred to DOD Designated Name: Not Designated Alternate Name: Naval Ordnance Laboratory - White Oak Location: White Oak Area , Silver Spring , Maryland MD.0-03-1 MD.0-03-2 Evaluation Year: 1987 MD.0-03-2 Site Operations: Research and development - may have involved radioactive materials because the site was identified on a 1955 Accountability Station List. MD.0-03-1 Site Disposition: Eliminated - NRC licensed MD.0-03-2 Radioactive Materials Handled: None Specifically Identified Primary Radioactive Materials Handled: None specifically indicated Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DOD MD.0-03-2

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Spectroscopic studies beyond N = 152 neutron gap : decay of {sup 255 ovr sub 101}Md and {sup 256 ovr sub 101}Md.  

Science Conference Proceedings (OSTI)

The isotopes {sup 255}Md and {sup 256}Md were produced by the irradiation of {sup 253}Es with 35-45 MeV {alpha} particles by ({alpha},n) and ({alpha},2n) reactions and were removed from the target by a helium jet system. {alpha}, {gamma}, and {alpha}-{gamma} coincidence spectra were measured with Si and Ge(Li) detectors. From the EC decays of {sup 255}Md and {sup 256}Md, levels in {sup 255}Fm and {sup 256}Fm were deduced. Favored {alpha} decay of {sup 255}Md was found to populate the 7/2{sup -}[514] single-particle state in {sup 251}Es, thus establishing the 7/2{sup -}[514] as the {sup 255}Md ground state. Several {gamma} rays were observed in the {sub 256}Md {alpha}-{gamma} coincidence spectrum. {sup 256}Fm is the heaviest nucleus in which excited intrinsic states have been identified.

Ahmad, I.; Chasman, R. R.; Fields, P. R.



Spectroscopic studies beyond the N=152 neutron gap: Decay of {sub 101}{sup 255}Md and {sub 101}{sup 256}Md  

Science Conference Proceedings (OSTI)

The isotopes {sup 255}Md and {sup 256}Md were produced by the irradiation of {sup 253}Es with 35-45 MeV {alpha} particles by ({alpha},n) and ({alpha},2n) reactions and were removed from the target by a helium jet system. {alpha}, {gamma}, and {alpha}-{gamma} coincidence spectra were measured with Si and Ge(Li) detectors. From the EC decays of {sup 255}Md and {sup 256}Md, levels in {sup 255}Fm and {sup 256}Fm were deduced. Favored {alpha} decay of {sup 255}Md was found to populate the 7/2{sup -}[514] single-particle state in {sup 251}Es, thus establishing the 7/2{sup -}[514] as the {sup 255}Md ground state. Several {gamma} rays were observed in the {sup 256}Md {alpha}-{gamma} coincidence spectrum. {sup 256}Fm is the heaviest nucleus in which excited intrinsic states have been identified. (c) 2000 The American Physical Society.

Ahmad, I. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Chasman, R. R. [Argonne National Laboratory, Argonne, Illinois 60439 (United States); Fields, P. R. [Argonne National Laboratory, Argonne, Illinois 60439 (United States)



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


SPLH 764: Seminar in: Communication in Autism Introduction  

E-Print Network (OSTI)

: Innovations in public-private partnerships (pp. 57-85). Baltimore, MD: Brookes. Dalrymple, N. (1995

Peterson, Blake R.



E-Print Network (OSTI)

. of Washington, Seattle, Wash. j Hiroshima Univ., Hiroshima, Japan k Johns Hopkins University, Baltimore, Md. l


Hille Ris Lambers 1 Curriculum vitae  

E-Print Network (OSTI)

Forest, Petersham, MA 1998: Ecological Society of America Annual Meeting. Baltimore, MD 1997: Ecological

Hille Ris Lambers, Janneke


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Oral Histories: Oncologist Helen Vodopick, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

2 2 HUMAN RADIATION STUDIES: REMEMBERING THE EARLY YEARS Oral History of Oncologist Helen Vodopick, M.D. Conducted December 28, 1994 United States Department of Energy Office of Human Radiation Experiments August 1995 CONTENTS Foreword Short Biography Academic Fellowship at Oak Ridge Institute for Nuclear Studies (ORINS), 1960 Appointment to the Staff at ORINS Medical Division The Medium-Exposure-Rate Total Body Irradiator (METBI) ORINS Radioisotope Tracer Studies Participation by Regional Universities at Oak Ridge Associated Universities (ORAU) Treatment of Cancer Patients with the METBI Introduction of Immunotherapy Radiation Treatment for Leukemia Patients Bone Marrow Treatment of Leukemia Low-Exposure-Rate Total Body Irradiator (LETBI) Treatment of Radiation Accident Victims at ORAU


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mäkinen; Jorma Tarhio



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Soham Al Snih Al Snih, MD., PhD. Curriculum Vitae CURRICULUM VITAE  

E-Print Network (OSTI)

Soham Al Snih Al Snih, MD., PhD. Curriculum Vitae 1 CURRICULUM VITAE NAME: Soham Al Snih Al Snih, M at the Sealy Center on Aging, University of Texas Medical Branch, Galveston, TX. #12;Soham Al Snih Al Snih, MD arthritis. B. Grant Support Current Grant Support: 1R03 AG029959-01A2 (Al Snih ­PI) Period: 06

Wood, James B.

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


EA-1942: Cove Point Liquefaction Project, Lusby, MD | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2: Cove Point Liquefaction Project, Lusby, MD 2: Cove Point Liquefaction Project, Lusby, MD EA-1942: Cove Point Liquefaction Project, Lusby, MD SUMMARY The Federal Energy Regulatory Commission (FERC) is preparing, with DOE as a cooperating agency, an EA, to analyze the potential environmental impacts of a proposal to add natural gas liquefaction and exportation capabilities to an existing Cove Point LNG Terminal located on the Chesapeake Bay in Lusby, Maryland. PUBLIC COMMENT OPPORTUNITIES None available at this time. DOCUMENTS AVAILABLE FOR DOWNLOAD September 28, 2012 EA-1942: Notice of Intent to Prepare an Environmental Assessment Cove Point Liquefaction Project, Lusby, MD September 24, 2012 EA-1942: Notice of Intent of to Prepare an Environmental Assessment Cove Point Liquefaction Project, Lusby, MD


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


BERAC Meeting, October 6-7, 2011, Rockville, MD| U.S. DOE Office of Science  

Office of Science (SC) Website

Meeting, October 6-7, 2011, Rockville, MD Meeting, October 6-7, 2011, Rockville, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting, October 6-7, 2011, Rockville, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting October 6-7, 2011 Rockville, MD Agenda .docx file (13KB) Presentations Sharlene Weatherwax, State of BER Report .pptx file (2.0MB) Gary Geernaert, Climate and Environmental Sciences Division Update .pptx file (24.0MB) Todd Anderson, Biological Systems Science Division Update .pptx file (8.0MB) Susan Hubbard, Science Talk - Geophysical Signatures of Subsurface Microbially-Mediated Processes: Toward Quantification of In-Situ Ecosystem


BERAC Meeting October 16, 2006 North Bethesda, MD | U.S. DOE Office of  

Office of Science (SC) Website

October 16, 2006 North Bethesda, MD October 16, 2006 North Bethesda, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting October 16, 2006 North Bethesda, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting October 16, 2006 North Bethesda, MD Agenda .pdf file (8KB) Presentations Jerry Elwood .ppt file (4.1MB), State of BER James Ehleringer .ppt file (6.7MB), Report on BERAC Review of FACE Experiments David Kingsbury .ppt file (10.4MB), CAMERA-Metagenomics meets the Cyberinfrastructure Chris Somerville .ppt file (59KB), Life Sciences PART Measure Progress Report Joyce Penner .ppt file (116KB), Climate Change Science PART Measure


BERAC Meeting February 18 - 19, 2009 North Bethesda, MD | U.S. DOE Office  

Office of Science (SC) Website

18 - 19, 2009 North Bethesda, MD 18 - 19, 2009 North Bethesda, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting February 18 - 19, 2009 North Bethesda, MD Print Text Size: A A A RSS Feeds FeedbackShare Page Biological and Environmental Research Advisory Committee Meeting February 18-19, 2009 North Bethesda, MD Meeting Agenda .pdf file (9KB) Presentations Anna Palmisano .ppt file (11.7MB), State of BER Sharlene Weatherwax .ppt file (8.7MB), Biological Systems Science Division Update Wanda Ferrell .ppt file (16.9MB), Climate and Environmental Sciences Division Update Jeff Amthor, Report on the Climate Change Research Strategic Plan


BERAC Meeting February 23-24, 2010 Gaithersburg, MD | U.S. DOE Office of  

Office of Science (SC) Website

February 23-24, 2010 Gaithersburg, MD February 23-24, 2010 Gaithersburg, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting February 23-24, 2010 Gaithersburg, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting February 23-24,2010 Gaithersburg MD Agenda .pdf file (8KB) Presentations Patricia Dehmer .ppt file (7.4MB), News from the Office of Science Anna Palmisano .ppt file (18.0MB), State of BER Jeff Marqusee .ppt file (5.0MB), SERDP & ESTCP Phil Robertson .pdf file (3.1MB), Bioenergy & Sustainability (pdf format) Wanda Ferrell .ppt file (5.1MB), Climate and Environmental Sciences Division Update


BERAC Meeting September 1-2, 2009 Gaithersburg, MD | U.S. DOE Office of  

Office of Science (SC) Website

-2, 2009 Gaithersburg, MD -2, 2009 Gaithersburg, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting September 1-2, 2009 Gaithersburg, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting September 1-2, 2009 Gaithersburg, MD Agenda .pdf file (8KB) Presentations Patricia Dehmer .ppt file (25.0MB), News from the Office of Science Anna Palmisano .pptx file (6.6MB), State of BER Barbara Alving, NIH .ppt file (6.6MB), Connecting the Nation's Researchers, Patients and Communities: Next Steps Horst Simon .pdf file (2.6MB), Future Trends in Computing Sharlene Weatherwax .pdf file (928KB), Biological Systems Science


BERAC Meeting May 19-20, 2008 Hilton Hotel Gaithersburg, MD | U.S. DOE  

Office of Science (SC) Website

9-20, 2008 Hilton Hotel Gaithersburg, MD 9-20, 2008 Hilton Hotel Gaithersburg, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting May 19-20, 2008 Hilton Hotel Gaithersburg, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting May 19-20, 2008 Hilton Hotel Gaithersburg, MD Agenda .pdf file (17KB) Presentations Mike Hochella .ppt file (388KB), Environmental Remediation Sciences Division Committee of Visitors Report Jim Adelstein .ppt file (1.1MB), Report on the Low Dose Radiation Research Program Himadri Pakrasi .ppt file (22.3MB), Science Talk, Membrane Biology Grand Challenge Jeff Amthor .ppt file (11.7MB), Update on BER Program for Ecosystems


BERAC Meeting, June 6-7, 2012 Gaithersburg, MD| U.S. DOE Office of Science  

Office of Science (SC) Website

June 6-7, 2012 Gaithersburg, MD June 6-7, 2012 Gaithersburg, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting, June 6-7, 2012 Gaithersburg, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting June 6-7, 2012 Gaithersburg, MD Agenda .pdf file (424KB) Presentations Sharlene Weatherwax, BER Associate Director State of BER Report .pdf file (482KB) Todd Anderson, Director, Biological Systems Science Division Biological Systems Science Division Update .pdf file (1.9MB) Gary Geernaert, Director, Climate and Environmental Sciences Division Climate and Environmental Sciences Division Update .pdf file (1.6MB) Jonathan Petters,


BERAC Meeting, February 21-22, 2013, Rockville, MD | U.S. DOE Office of  

Office of Science (SC) Website

February 21-22, 2013 BERAC Rockville, MD February 21-22, 2013 BERAC Rockville, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings February 21-22, 2013 BERAC Rockville, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting, February 21-22, 2013, Rockville, MD Agenda .pdf file (10KB) Presentations: Sharlene Weatherwax .pdf file (1.9MB) - Office of Biological and Environmental Research Update Todd Anderson .pdf file (1.7MB) - Biological Systems Science Division Update Gary Geernaert .pdf file (2.3MB) - Climate and Environmental Sciences Division Update Judy Wall .pdf file (3.5MB) - The Genetic Basis for Bacterial Mercury Methylation


BERAC Meeting May 14-15, 2007 North Bethesda, MD | U.S. DOE Office of  

Office of Science (SC) Website

4-15, 2007 North Bethesda, MD 4-15, 2007 North Bethesda, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting May 14-15, 2007 North Bethesda, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting May 14-15, 2007 North Bethesda, MD Agenda .pdf file (10KB) Presentations Joyce Penner .ppt file (74KB), Report on ARM Facilities Charge William Pizer .pdf file (292KB), Report on Integrated Assessment Charge John Ferrell .ppt file (2.7MB), Report on DOE Energy Efficiency and Renewable Energy Biomass Program Paul Vaska .ppt file (23.6MB), Science Talk, Advances in Instrumentation for Small-Animal PET Imaging Mike Viola .ppt file (2.3MB), State of BER


BERAC Meeting September 16-17, 2010 Gaithersburg, MD | U.S. DOE Office of  

Office of Science (SC) Website

6-17, 2010 Gaithersburg, MD 6-17, 2010 Gaithersburg, MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting September 16-17, 2010 Gaithersburg, MD Print Text Size: A A A RSS Feeds FeedbackShare Page BERAC Meeting September 16-17, 2010 Gaithersburg, MD Agenda .pdf file (8KB) Presentations Anna Palmisano .pptx file (6.5MB), State of BER Judy Wall .pptx file (904KB), CESD COV Report Gary Sayler .ppt file (65.0MB), Science Lecture, "From Microbes to Man: Environmental Biosensing with Bacterial Bioluminescence" Gary Geernaert .pptx file (4.5MB), Climate and Environmental Sciences Division Update Sharlene Weatherwax .pptx file (5.6MB), Biological Systems Science


Price of Cove Point, MD Natural Gas LNG Imports from Algeria...  

Gasoline and Diesel Fuel Update (EIA)

Algeria (Dollars per Thousand Cubic Feet) Price of Cove Point, MD Natural Gas LNG Imports from Algeria (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4...


Price of Cove Point, MD Natural Gas LNG Total Imports (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Total Imports (Dollars per Thousand Cubic Feet) Price of Cove Point, MD Natural Gas LNG Total Imports (Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4...


Price of Cove Point, MD Natural Gas LNG Imports from Egypt (Nominal...  

U.S. Energy Information Administration (EIA) Indexed Site

Egypt (Nominal Dollars per Thousand Cubic Feet) Price of Cove Point, MD Natural Gas LNG Imports from Egypt (Nominal Dollars per Thousand Cubic Feet) Decade Year-0 Year-1 Year-2...


Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Studying Altocumulus Plus Virga with Ground-based Active and Passive Remote Sensors Zhien Wang1, Kenneth Sassen2, David Whiteman3, and Belay Demoz3 1University of Maryland, Baltimore County, Catonsville, MD 21228 2University of Alaska, Fairbanks, Alaska 99775 3NASA Goddard Space Flight Center, Greenbelt, MD 20771 E-mail: zhien@agnes.gsfc.nasa.gov  

NLE Websites -- All DOE Office Websites (Extended Search)

Seasonal and Interannual Variations of Boundary-layer Mixed-phase Seasonal and Interannual Variations of Boundary-layer Mixed-phase Cloud Properties Observed at the ARCF NSA site Zhien Wang, Ming Zhao, and Min Deng University of Wyoming , Laramie, Wyoming, 82071, zwang@uwyo.edu References Curry, J. et al., 1996: Overview of Arctic cloud and radiation characteristics. J. Climate., 9, 1731-1764. Wang, Z. and K. Sassen, 2002: Cirrus cloud microphysical property retrieval using lidar and radar measurements, I: algorithm description and comparison with in situ data. J. Appl. Meteor., 41, 218-229. Wang, Z., K. Sassen, D. Whiteman, and B. Demoz, 2004: Studying altocumulus plus virga with ground-based active and passive remote sensors. J. Appl. Meteor.,43, 449-460. Wang, Z., 2007: Refined Two-channel Microwave Radiometer Liquid Water Path Retrieval at Cold Regions by Using Multiple-sensor Measurements. IEEE Geoscience and Remote


BERAC Meeting September 5 2008 Gaithersburg MD | U.S. DOE Office of Science  

Office of Science (SC) Website

September 5 2008 Gaithersburg MD September 5 2008 Gaithersburg MD Biological and Environmental Research Advisory Committee (BERAC) BERAC Home Meetings BERAC Minutes BERAC Minutes Archive Members Charges/Reports Charter .pdf file (40KB) BER Committees of Visitors BER Home Meetings BERAC Meeting September 5 2008 Gaithersburg MD Print Text Size: A A A RSS Feeds FeedbackShare Page BER September 5, 2008 Arlington, VA Agenda Presentations Peg Riley .ppt file (357KB), Life and Medical Sciences Division Committee of Visitors Report Patricia Dehmer .ppt file (2.6MB), Report from the Office of Science Todd Anderson .ppt file (1.2MB), Scientific Focus Area (SFA) Rollout & Discussion Robert Dickinson .ppt file (6.1MB), Report on Climate Research Grand Challenges Mike Kuperberg .ppt file (975KB), Climate & Environmental Sciences

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


1985 ACL MEMBERSHIPLIST Following is a listing of the 1985  

E-Print Network (OSTI)

University Baltimore, MD 21218 Norman I. Badler CIS-Moore School D2 University of Pennsylvania Philadelphia


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



Third International Symposium on Structural Intermetallics (ISSI-3)  

Science Conference Proceedings (OSTI)

Apr 30, 2002 ... 253 pp., illus., index, CD-ROM ..... Eng., Baltimore, MD 21218 USA ... Neuman Way, MD H85, Cincinnati, OH 45215-6301 USA; Mike Nathal,.


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


Lorin Stein and his young staff reinvigorate the Paris Review for the digital age. p.  

E-Print Network (OSTI)

. The excellence you expect. Courses offered in > Baltimore, MD > Rockville, MD > Washington, DC > Online Advanced Exploration of the various Chesapeake Bay eco-systems by kayak Baltimore Sailing Camp for boys and girls 11) by The Johns Hopkins University, 901 S. Bond Street, Suite 540, Baltimore, MD 21231. Periodicals postage paid

Niebur, Ernst


Mar. Drugs 2013, 11, 3350-3371; doi:10.3390/md11093350 marine drugs  

E-Print Network (OSTI)

Mar. Drugs 2013, 11, 3350-3371; doi:10.3390/md11093350 marine drugs ISSN 1660-3397 www% cytotoxicity was observed at the highest concentration tested (5 µg mL-1 ). However, OPEN ACCESS #12;Mar. Drugs Pinna had first been implicated in food poisoning in China in 1990 [1]. Pinnatoxin A (Pn

Recanati, Catherine


A coupled RISM/MD or MC simulation methodology for solvation free energies  

E-Print Network (OSTI)

A coupled RISM/MD or MC simulation methodology for solvation free energies Holly Freedman, Thanh N methods for determination of solvation free energies. We employ the RISM formulation of solvation free-netted chain equations. We apply this approach to determining free energies of solvation for several small

Truong, Thanh N.


MD Study of Phase Change of Water inside a Carbon Nanotube Tatsuto KIMURA and Shigeo MARUYAMA  

E-Print Network (OSTI)

into ice crystal at 220 K or 200 K. In the case of phase change at 220 K, octagonal ice nanotube MD Study of Phase Change of Water inside a Carbon Nanotube * Tatsuto KIMURA and Shigeo MARUYAMA Dept. of Mech. Eng., The University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113-8656 Phase change

Maruyama, Shigeo


Ira Helfand, MD International Physicians for the Prevention of Nuclear War  

E-Print Network (OSTI)

of studies have shown that a limited, regional nuclear war between India and Pakistan would cause significantIra Helfand, MD International Physicians for the Prevention of Nuclear War Physicians for Social Responsibility NUCLEAR FAMINE: A BILLION PEOPLE AT RISK Global Impacts of Limited Nuclear War on Agriculture

Robock, Alan


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Ceramic Composites, Inc. 1110 Benfield Blvd, Ste Q, Millersville, MD 21108  

NLE Websites -- All DOE Office Websites (Extended Search)

Composites, Inc. Composites, Inc. 1110 Benfield Blvd, Ste Q, Millersville, MD 21108 A subsidiary of Technology Assessment and Transfer, Inc. 410-987-3435 fax 410-987-7172 www.techassess.com AGENCY: DOE / NETL CONTRACT: DE-FG02-03ER83627 TITLE: Enhanced Performance Carbon Foam Heat Exchanger for Power Plant Cooling REPORT: Final Technical Report PERIOD: 21 July 2003 - 13 July 2007 TPOC: Barbara Carney carney@netl.doe.gov PHONE: 304-285-4671 PI: Steven Seghi steve@techassess.com PHONE: 410-987-3435 COMPANY: Ceramic Composites, Inc. 133 Defense Hwy, Ste 212 Annapolis, MD 21401 SBIR/STTR Rights Notice These SBIR/STTR data are furnished with SBIR/STTR rights under Grant No. DE-FG02- 03ER83627. For a period of 4 years after the acceptance of all items to be delivered under this


NAMD - The Engine for Large-Scale Classical MD Simulations of Biomolecular  

NLE Websites -- All DOE Office Websites (Extended Search)

NAMD NAMD NAMD - The Engine for Large-Scale Classical MD Simulations of Biomolecular Systems Based on a Polarizable Force Field PI Name: Benoit Roux PI Email: roux@uchicago.edu Institution: Argonne National Laboratory & University of Chicago Allocation Program: ESP Allocation Hours at ALCF: 80 Million Year: 2010 to 2013 Research Domain: Biological Sciences Biology, at the atomic and molecular level, is governed by complex interactions involving a large number of key constituents, including water, ions, proteins, nucleic acids, and lipid membranes. The goal of this project is to develop new technologies to simulate virtual models of biomolecular systems with an unprecedented accuracy. Large-scale molecular dynamics (MD) simulations based on atomic models play an increasingly



Office of Legacy Management (LM)

FINDING OF MD SIGNIFICANT IMPACT FINDING OF MD SIGNIFICANT IMPACT FORMERLY UTILIZED HED/AEC SITES REMEDIAL ACTION PROGRAM: BAY0 CANYONS, NEW MEXICO Under the Formerly Utilized Sites Remedial Action Program (FUSRAP), the U.S. Department of Energy (DOE) has proposed to carry out rcmedfrl action at a site located in Bayo Canyon, Los Alamos County, New Mexico. Although the site as partially decontaminated and decommissioned in the 196Os, there remain above-background amounts of radionuclides. DOE has determined that strontium-90 in excess of DDE's proposed remedial- action criterir exists in subsurface materials underlying an area of about 0.6 ha (1.5 acres) at the Bayo Canyon site. The proposed action is to demarcate this are8 and restrict its use to activities that will not disturb this sub-

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Medication Safety in Older Adults: Home-Based Practice Patterns Joshua P. Metlay, MD, PhD,wzz  

E-Print Network (OSTI)

Medication Safety in Older Adults: Home-Based Practice Patterns Joshua P. Metlay, MD, Ph-reported sources of in- formation on current medications as well as home-based practices for organizing medication

Hennessy, Sean


Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Co-combustion of refuse derived fuel and coal in a cyclone furnace at the Baltimore Gas and Electric Company, C. P. Crane Station  

DOE Green Energy (OSTI)

A co-combustion demonstration burn of coal and fluff refuse-derived fuel (RDF) was conducted by Teledyne National and Baltimore Gas and Electric Company. This utility has two B and W cyclone furnaces capable of generating 400 MW. The facility is under a prohibition order to convert from No. 6 oil to coal; as a result, it was desirable to demonstrate that RDF, which has a low sulfur content, can be burned in combination with coals containing up to 2% sulfur, thus reducing overall sulfur emissions without deleterious effects. Each furnace consists of four cyclones capable of generating 1,360,000 pounds per hour steam. The tertiary air inlet of one of the cyclones was modified with an adapter to permit fluff RDF to be pneumatically blown into the cyclone. At the same time, coal was fed into the cyclone furnace through the normal coal feeding duct, where it entered the burning chamber tangentially and mixed with the RDF during the burning process. Secondary shredded fluff RDF was prepared by the Baltimore County Resource Recovery Facility. The RDF was discharged into a receiving station consisting of a belt conveyor discharging into a lump breaker, which in turn, fed the RDF into a pneumatic line through an air-lock feeder. A total of 2316 tons were burned at an average rate of 5.6 tons per hour. The average heat replacement by RDF for the cyclone was 25%, based on Btu input for a period of forty days. The range of RDF burned was from 3 to 10 tons per hour, or 7 to 63% heat replacement. The average analysis of the RDF (39 samples) for moisture, ash, heat (HHV) and sulfur content were 18.9%, 13.4%, 6296 Btu/lb and 0.26% respectively. RDF used in the test was secondary shredded through 1-1/2 inch grates producing the particle size distribution of from 2 inches to .187 inches. Findings to date after inspection of the boiler and superheater indicate satisfactory results with no deleterious effects from the RDF.

Not Available




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MD Maryland Total Sum City, County, and SEO Allocations MD Maryland Total Sum City, County, and SEO Allocations All $ 52,295,100 MD Maryland State Energy Office $ 9,593,500 MD Annapolis City $ 171,700 MD Baltimore City $ 6,372,700 MD Bowie City $ 464,000 MD College Park City $ 133,700 MD Frederick City $ 614,700 MD Gaithersburg City $ 578,000 MD Hagerstown City $ 179,500 MD Laurel City $ 93,000 MD Rockville City $ 683,300 MD Salisbury City $ 147,300 MD Anne Arundel County $ 4,463,400 MD Baltimore County $ 7,403,600 MD Carroll County $ 684,100 MD Charles County $ 560,300 MD Frederick County $ 659,800 MD Harford County $ 2,189,400


ANL/ALCF/ESP-13/14 NAMD - The Engine for Large-Scale Classical MD  

NLE Websites -- All DOE Office Websites (Extended Search)

4 4 NAMD - The Engine for Large-Scale Classical MD Simulations of Biomolecular Systems Based on a Polarizable Force Field ALCF-2 Early Science Program Technical Report Argonne Leadership Computing Facility About Argonne National Laboratory Argonne is a U.S. Department of Energy laboratory managed by UChicago Argonne, LLC under contract DE-AC02-06CH11357. The Laboratory's main facility is outside Chicago, at 9700 South Cass Avenue, Argonne, Illinois 60439. For information about Argonne and its pioneering science and technology programs, see www.anl.gov. Availability of This Report This report is available, at no cost, at http://www.osti.gov/bridge. It is also available on paper to the U.S. Department of Energy and its contractors, for a processing fee, from:


DOE Challenge Home Case Study, Nexus EnergyHomes, Frederick, MD, Production  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Nexus Nexus EnergyHomes Frederick, MD BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.



Office of Legacy Management (LM)

,' ,...- ,' ,...- -., -.- . . we#lnty..: - DEPARTMENT OF HEALTH AN~~.N~dtAN, MD. Y.P.H. April 30, 1979 . _-- _' . U.S.E.P.A. Radiation Branch 26 Federal Plaz;a, Boom 9079 New York, N. Y. 10007 Attention: Miss Feldman:, Gentlemen: In accordance with your request to Calvin E. Weber, P.E., Assistant Commissioner of Health for Environmental Quality, I am forwarding a copy of a report prepared by him concerning a radiation survey conducted in the vicinity of the former Canadian Radium and Uranium Corpora+on plant on Railroad Avenue in the Village of Mount Kisco, Westchester County, New Yor Please transmit any comments you may have regarding this matter directly to Mr. Weber. Very truly Yours, Conmissioner of Health xc:rr cc: Sherwood Davies, P.E. lbm Cashman



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2 2 Recipient: County of Howard, MD ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM Activities Determination/ Categorical Exclusion Reviewer's Specific Instructions and Rationale (Restrictions and Allowable Activity) Electric Pick-up truck for on- site use at Alpha Ridge Landfill B5.1 None Landfill Forced Draft Heater A9 This CX applies to preliminary engineering and design tasks only. Additional information is required to make a NEPA determination for construction and operation tasks. Diesel Hybrid Truck B5.1 None Home Energy Audits A9 None Park Ballfield Lights Energy Efficiency B5.1 Waste Stream Clause Energy Efficiency Analysis via Monitoring of Sub-Meters Installation B5.1 None Energy Management Consultant A9 None High Efficiency Lighting - Rec & Parks B5.1


Oral Histories: Dr. John W. Gofman, M.D., Ph.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

7 7 HUMAN RADIATION STUDIES: REMEMBERING THE EARLY YEARS Oral History of Dr. John W. Gofman, M.D., Ph.D. Conducted December 20, 1994 United States Department of Energy Office of Human Radiation Experiments June 1995 CONTENTS Foreword Short Biography Oberlin College, Enrollment in Western Reserve Medical School To University of California, Berkeley to Study Physical Chemistry Assisting Seaborg's Research, Discovery of Uranium-233 The Manhattan Project From Research to Laboratory Production of Plutonium Joe Hamilton's Cavalier Approach to Radiation Medical Treatments With Radioactive Phosphorus (32P) Conflict Between University of California San Francisco and Berkeley Reflections on Ernest Lawrence Heart Disease Studies AEC Support for Heart Disease Studies Heparin and Lipoprotein Research With Human Subjects


Oral Histories: Oral History of Radiologist Henry I. Kohn, M.D., Ph.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

1 1 HUMAN RADIATION STUDIES: REMEMBERING THE EARLY YEARS Oral History of Radiologist Henry I. Kohn, M.D., Ph.D. Conducted September 13, 1994 United States Department of Energy Office of Human Radiation Experiments June 1995 CONTENTS Foreword Short Biography Studying the Effects of X Rays on Animal Blood Chemistry at Oak Ridge Work at UCSF's Radiological Laboratory Advantages of Yeast Cells for Studying Radiation Effects Reflections on Bert Low-Beer and Joseph Hamilton Radiation Genetics Experiments on Mice Reflections on Reynold Brown and Henry Kaplan Establishment of Harvard's Joint Center for Radiation Therapy (Mid '60s) Radiological Assessment for the National Academy of Science Survey of Nuclear and Alternative Energy (1975–79) Biologist and Physicist Perspectives on Radiological Effects


Felix F? Camacho Governor Michael W. Cruz, M.D. Lieutenant Governor  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

O. Box 2950 Haghiia, Guam 96932 O. Box 2950 Haghiia, Guam 96932 TEL: (671) 472-8931 FAX: (671) 477-4826 EMAIL: governo@mail.gov.gu Felix F? Camacho Governor Michael W. Cruz, M.D. Lieutenant Governor 0 6 MAW 2009 The Honorable Steven Chu Secretary U.S. Department of Energy 1000 Independence Avenue, S. W. Washington, D.C. 20585 Re: State Energy Program Assurances Dear Secretary Chu: As a condition of receiving Guam's share of the $3.1 billion funding for the State Energy Program (SEP) under the American Recovery and Renewal Act of 2009 (H.R. l)(ARRA), I am providing the following assurances. I have written to the Consolidated Commission on Utilities, Guam's public utility commission, and requested that they consider additional actions to promote energy efficiency, consistent with the Federal


Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



ThemagazineofTheJohnshopkinsWhiTingschoolofengineering WinTer2008 amidshiftingwinds  

E-Print Network (OSTI)

Whiting School of Engineering 3400 N. Charles Street Baltimore, MD 21218 Phone: (410) 516-6852 Fax: (410 structures. Here in Baltimore, the civil engineering major spends much of her time in the base- ment

Niebur, Ernst


California Health eQuality Advisory Committee Kenneth W. Kizer, M.D., M.P.H. -Chair  

E-Print Network (OSTI)

California Health eQuality Advisory Committee Kenneth W. Kizer, M.D., M.P.H. - Chair Distinguished Association (IHA) Ellen Wu, M.P.H. Executive Director California Pan-Ethnic Health Network Pamela L. Lane, M.S., RHIA, CPHIMS, Ex officio Deputy Secretary, HIE California Health & Human Services Agency Linette T

California at Davis, University of


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma


Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Oral Histories: Physician James S. Robertson, M.D., Ph.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

8 8 HUMAN RADIATION STUDIES: REMEMBERING THE EARLY YEARS Oral History of Physician James S. Robertson, M.D., Ph.D. Conducted January 20, 1995 United States Department of Energy Office of Human Radiation Experiments September 1995 CONTENTS Foreword Short Biography Education Research on Human Subjects at Berkeley Invited to Join the New Lab at Brookhaven (1950) Boron Neutron Capture Therapy Other AEC Biomedical Programs Brookhaven Human Use Committee Castle Bravo Atomic Weapon Test (March 1, 1954) Studies on Marshallese at Brookhaven Modern BNCT Treatment Leaves Brookhaven for the Mayo Clinic (1975) Joins the Department of Energy (1983) Work at the Naval Radiological Defense Laboratory (1953–55) Controversial Treatments and the "Crackpot File" FOREWORD I n December 1993, U.S. Secretary of Energy Hazel R. O'Leary announced her Openness Initiative. As part of this initiative, the Department of Energy undertook an effort to identify and catalog historical documents on radiation experiments that had used human subjects. The Office of Human Radiation Experiments coordinated the Department's search for records about these experiments. An enormous volume of historical records has been located. Many of these records were disorganized; often poorly cataloged, if at all; and scattered across the country in holding areas, archives, and records centers.


SANJOY K. MITTER Professor of Electrical Engineering  

E-Print Network (OSTI)

Rubber Baltimore MD Chemist Fleming Bates Sherwood BS CH 5/28/1912 Raleigh NC NC College of A&M Ar Marthaville LA Teacher Owens Hand Browne HandsomBS CHE 5/31/1921 Raleigh NC Johns Hopkins UniversBaltimore MD Emerson Atkinson BS CHE 6/12/1933 Winston-Salem NC American Oil Baltimore MD John Walter Culp Jr Piccolo

Mitter, Sanjoy K.


Kinetic energy deficit in the symmetric fission of /sup 259/Md. [Light particle emission in /sup 256/Fm fission  

Science Conference Proceedings (OSTI)

The fragment energies of about 725 coincidence events have now been observed in the spontaneous fission (SF) decay of 105-min /sup 259/Md since its discovery in 1977. The fission of /sup 259/Md is characterized by a symmetric mass distribution, similar to those of /sup 258/Fm and /sup 259/Fm, but with a broad total kinetic energy (anti TKE) distribution which peaks at about 195 MeV, in contrast to those of /sup 258/Fm and /sup 259/Fm, for which the anti TKE is about 240 MeV. This kinetic energy deficit, approx. 40 MeV, has been postulated to be due to the emission of hydrogen-like particles by /sup 259/Md at the scission point in a large fraction of the fissions, leaving the residual fissioning nucleus with 100 protons. The residual nucleus would then be able to divide into two ultrastable tin-like fission fragments, but with less kinetic energy than that observed in the SF of /sup 258/Fm and /sup 259/Fm, because of binding-energy losses and a reduction in the Coulomb repulsion of the major fragments. To test this hypothesis, counter-telescope experiments aimed at detecting and identifying these light particles were performed. In 439 SF events 3 + 3 protons of the appropriate energy were observed, too few to account for the kinetic energy deficit in the fission of /sup 259/Md. There seems to be no explanation for this problem within the framework of current fission theory. These results are discussed along with preliminary measurements of light-particle emission in the SF of /sup 256/Fm. 5 figures.

Hulet, E.K.; Wild, J.F.; Lougheed, R.W.; Baisden, P.A.; Dougan, R.J.; Mustafa, M.G.



Advance Mailer  

Science Conference Proceedings (OSTI)

May 2, 2002 ... Baltimore, MD 21218. Telephone: (410) 516-4489 .... 253, fax (724) 776-3770, or e-mail ckobert@tms.org. TECHNICAL PROGRESS POSTERS.


"Genetic Factors Affecting Susceptibility to Low-Dose Radiation...  

NLE Websites -- All DOE Office Websites (Extended Search)

Laboratory, University of Maryland, Baltimore, MD 2 Virginia Mason Cancer Center, Seattle, WA 3 Memorial Sloan Kettering Cancer Center, New York, NY Rationale: Risk estimates...


Microsoft Word - DOE-Morgan-1.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Laboratory, University of Maryland, Baltimore, MD 2 Virginia Mason Cancer Center, Seattle, WA 3 Memorial Sloan Kettering Cancer Center, New York, NY Rationale: Risk estimates...


Building and Fire Publications  

Science Conference Proceedings (OSTI)

... (ASHRAE). October 6-8, 1996, Baltimore, MD, ASHRAE, Atlanta, GA, Teichman, KY, Editor(s), 139-150 pp, 1996. Keywords: ...


Security and United States Immigration Policy  

E-Print Network (OSTI)

Change and European Security. London: Brassey's. Furer,1981]. American National Security, 6th ed. Baltimore, MD:J. Wheeler. 2008. The Security Dilemma: Fear, Cooperation

Totten, Robbie James



Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY


October 16-19, 2000 Baltimore Convention Center Baltimore ...  

Science Conference Proceedings (OSTI)

... Plenary Wednesday, October 18 7:00pm Conference Banquet Thursday, October 19 10:30am–12:00 noon Closing Plenary ...




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....


GATEWAY PRESS, INC. Baltimore 1981  

E-Print Network (OSTI)

. DOE relies on a team of contractors that work for them to carry out mission requirements at Hanford on the Hanford Site is minimal, as less than 15% of the work that PNNL performs is Hanford-related (PNNL 2009PNNL-18896 Prepared for the U.S. Department of Energy under Contract DE-AC05-76RL01830 Hanford

Wachter, Kenneth W.


The magazine of The Johns hopkins WhiTing school of engineering sUmmer/fall 2008 Real World Solutions  

E-Print Network (OSTI)

Whiting School of Engineering 3400 N. Charles Street Baltimore, MD 21218 Phone: (410) 516-6852 Fax: (410" Luanne green, a principal architect with the Baltimore based firm Ayers/Saint/gross, refers to the period was outgrowing its location in downtown Baltimore on Howard and Eutaw streets. The effort took some time

Niebur, Ernst


ThemagazineofTheJohnshopkinsWhiTingschoolofengineering sUmmer2007 Body Builders  

E-Print Network (OSTI)

of Engineering 3400 N. Charles Street Baltimore, MD 21218 Phone: (410) 516-6852 Fax: (410) 516-5130 WILLKIRK Billick, head coach of the Baltimore Ravens *From the Chronicle of Higher Education Commencement Database joined Osiris Therapeutics Inc., a Baltimore-based stem cell technology company. There, her research team

Niebur, Ernst


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



LDRD Final Report (08-ERD-037): Important Modes to Drive Protein MD Simulations to the Next Conformational Level  

SciTech Connect

Every action in biology is performed by dynamic proteins that convert between multiple states in order to engage their functions. Often binding to various ligands is essential for the rates of desired transitions to be enhanced. The goal of computational biology is to study these transitions and discover the different states to fully understand the protein's normal and diseased function, design drugs to target/bias specific states, and understand all of the interactions in between. We have developed a new methodology that is capable of calculating the absolute free energy of proteins while taking into account all the interactions with the solvent molecules. The efficiency of the new scheme is an order of magnitude greater than any existing technique. This method is now implemented in the massively parallel popular MD program package NAMD. This now makes it possible to calculate the relative stability of different conformational states of biological macromolecules as well as their binding free energies to various ligands.

Sadigh, B



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)


Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Near quantitative agreement of model free DFT- MD predictions with XAFS observations of the hydration structure of highly charged transition metal ions  

Science Conference Proceedings (OSTI)

DFT-MD simulations (PBE96 and PBE0) with MD-XAFS scattering calculations (FEFF9) show near quantitative agreement with new and existing XAFS measurements for a comprehensive series of transition metal ions which interact with their hydration shells via complex mechanisms (high spin, covalency, charge transfer, etc.). This work was supported by the U.S. Department of Energy (DOE), Office of Basic Energy Sciences, Division of Chemical Sciences, Geosciences and Biosciences. Pacific Northwest National Laboratory (PNNL) is operated for the U.S. DOE by Battelle. A portion of the research was performed using EMSL, a national scientific user facility sponsored by the U.S. DOE's Office of Biological and Environmental Research and located at Pacific Northwest National Laboratory.

Fulton, John L.; Bylaska, Eric J.; Bogatko, Stuart A.; Balasubramanian, Mahalingam; Cauet, Emilie L.; Schenter, Gregory K.; Weare, John H.



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Large Scale Computing Requirements for Basic Energy Sciences (An BES / ASCR / NERSC Workshop) Hilton Washington DC/Rockville Meeting Center, Rockville MD 3D Geophysical Imaging  

NLE Websites -- All DOE Office Websites (Extended Search)

Requirements Requirements for Basic Energy Sciences (An BES / ASCR / NERSC Workshop) Hilton Washington DC/Rockville Meeting Center, Rockville MD 3D Geophysical Modeling and Imaging G. A. Newman Lawrence Berkeley National Laboratory February 9 - 10 , 2010 Talk Outline * SEAM Geophysical Modeling Project - Its Really Big! * Geophysical Imaging (Seismic & EM) - Its 10 to 100x Bigger! - Reverse Time Migration - Full Waveform Inversion - 3D Imaging & Large Scale Considerations - Offshore Brazil Imaging Example (EM Data Set) * Computational Bottlenecks * Computing Alternatives - GPU's & FPGA's - Issues Why ? So that the resource industry can tackle grand geophysical challenges (Subsalt imaging, land acquisition, 4-D, CO2, carbonates ......) SEAM Mission Advance the science and technology of applied


Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


University of Maryland Baltimore Facilities Performance Indicators  

E-Print Network (OSTI)

UMB's administration costs per square foot decreased by $0.08/square foot , or 22%, in 2010. This was mostly the result of the vacant positions in administration during the period. The cost per square foot regional and the Special Medical Carnegie Classification average cost per square foot. #12;Are operating

Weber, David J.


Baltimore Gas & Electric Company (Electric) - Residential Energy...  

Open Energy Info (EERE)

Thermostats, Refrigerators, Water Heaters, Room Air Conditioners, Geothermal Heat Pumps, LED Lighting Active Incentive Yes Implementing Sector Utility Energy Category Energy...


Baltimore Gas & Electric Company (Electric) - Commercial Energy...  

Open Energy Info (EERE)

Vending Machine Controls, Commercial Refrigeration Equipment, Food Service Equipment, LED Lighting, Reach-In Door Closer, ECM Evaporator Fan MotorController, Refrigerated...


Baltimore, Vermont: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

351°, -72.5731478° 351°, -72.5731478° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":43.360351,"lon":-72.5731478,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Baltimore, Ohio: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

418°, -82.6007185° 418°, -82.6007185° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.8453418,"lon":-82.6007185,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Baltimore, Maryland: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

48°, -76.6121893° 48°, -76.6121893° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.2903848,"lon":-76.6121893,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Baltimore Gas & Electric Company (Electric) - Residential Energy...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

for Energy Star clothes washers, dehumidifiers, refrigerators, freezers, CFLs, HVAC systems, and Building Insulation. The Home Performance with Energy Star Incentive...

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Baltimore Gas & Electric Company (Electric) - Commercial Energy...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Industrial Local Government Nonprofit State Government Savings For Heating & Cooling Commercial Heating & Cooling Cooling Other Heat Pumps Appliances & Electronics...


Ac Ack Affirmative Baltimore Carol Casablanca Charles ...  

Science Conference Proceedings (OSTI)

... Roma Sail Sierra Suga Tango Tare Toc Uppsala Valencia Vic Victor Victoria Vincent Willie Xantippe Xavier Xerxes Xmas Yankee Yogi Yokohama ...



Baltimore Gas & Electric Company (Electric) - Residential Energy...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

freezers, CFLs, HVAC systems, and Building Insulation. The Home Performance with Energy Star Incentive Program also provides residential incentives including envelope and...


to Baltimore By SaulWilson  

E-Print Network (OSTI)

- heated Phoenix hotel room to find my mom departing for the air- port, and after a brief return, which we utilized to reach I-8 and Gila Bend through lush, roasting farmland. Proceeding westward, we

Wilson, W. Stephen


Baltimore Gas & Electric Company (Electric) - Commercial Energy...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Lamps: 25 - 30 Lighting Occupancy Sensors: 25-75unit T8T5 Fluorescent Lamp-Ballast: 15-65fixture Fluorescent High-Bay Fixtures: 40 - 85fixture Hard-Wired CFL:...


Selected Abstracts & Bibliography of International Oil Spill Research, through 1998  

E-Print Network (OSTI)

transformers, insulating oil, cost analysis, ground water,Baltimore, MD. Key words: costs, oil spill, cleanup. Moller,the savings in fuel oil and disposal costs brought about by

Louisiana Applied Oil Spill Research & Development Program Electronic Bibliography



Carbonate clumped isotope compositions of modern marine mollusk and brachiopod shells  

E-Print Network (OSTI)

, leaving the oxygen isotope paleother- mometer underdetermined in most geologic applicationsCarbonate clumped isotope compositions of modern marine mollusk and brachiopod shells Gregory A, Baltimore, MD 21218, USA b Department of Geological & Atmospheric Sciences, Iowa State University, Ames, IA

Grossman, Ethan L.


Marginalized-Literature-Market-Life: Black Writers, a Literature of Appeal, and the Rise of Street Lit  

E-Print Network (OSTI)

Print. The Darker Side of Black. Dir. Isaac Julien. Perf.the World. Baltimore, MD: Black Classic Press. 1993. Print.Print. Conley, Dalton. Being Black, Living in the Red: Race,

Norris, Keenan Franklin



Project Award Spreadsheets 2010 12 21 1232.xlsx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

City HQ State City HQ State Congressional District(s) Population Recovery Act Funding* Asheville ** NC NC-011 500,000 $209,940 Aspen CO CO-003 5,902 $59,193 Aurora CO CO-007 319,057 $151,800 Baltimore MD MD-002 636,919 $200,000 Baton Rouge LA LA-6 223,689 $200,000 Boston MA MA-009 609,023 $300,000 Casper WY WY-001 54,047 $130,000 Chicago IL IL-005 2,853,114 $300,000 Chula Vista CA CA-051 219,318 $200,000 City and County of Denver CO CO-001 598,707 $210,040 Columbia MO MO-009 100,733 $200,000 Davenport IA IA-001 100,827 $200,000 Delray Beach FL FL-022 64,092 $130,000 Durango CO CO-003 16,416 $58,500 Flint MI MI-005 112,900 $199,814 Fort Wayne IN IN-003 251,591 $195,700 Hailey ID ID-002 7,883 $83,202 Hamilton OH OH-008 62,477 $130,000 Heber** UT UT-002 13,988 $100,000 Hoffman Estates IL IL-008 53,641 $98,556 Lake Worth FL FL-022 35,513


Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Heart DiseaseHeart Disease--Learn to Love YourLearn to Love Your Michael McKee, M.D.Michael McKee, M.D.  

E-Print Network (OSTI)

Heart DiseaseHeart Disease-- Learn to Love YourLearn to Love Your HeartHeart Michael McKee, M.D.Michael McKee, M.D. March 19, 2010March 19, 2010 #12;GoalsGoals ·· Learn more about heart disease for yourself andLearn more about heart disease for yourself and for your studentsfor your students ·· Learn

Goldman, Steven A.


Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 – 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.




E-Print Network (OSTI)

DISASTER RESPONSES FOLLOWING HURRICANE KATRINA Michael G. Millin, MPH, Jennifer L. Jenkins, MD, MS, Thomas of Critical Event Prepared- ness and Response, Baltimore, MD (MGM, TK); and NJ-1 Disaster Medical Assistance;August 9, 2006 20:56 PEC TFJD757-10-188416 A COMPARATIVE ANALYSIS OF TWO EXTERNAL HEALTH CARE DISASTER

Scharfstein, Daniel


Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: © 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



LA-101( ' X I -E N V~ E N V I R O N M E N T A LS U R V E I L L AA -L O. A -L A -MD U R  

E-Print Network (OSTI)

LA-101( ' X I - E N V~ E N V I R O N M E N T A LS U R V E I L L AA - &.' L_ .---. L O. A - L A - MD U R ,. ,, .". ... , . 1 ` - : . , .i * ?. .& x ` "E!E7...';: s ---- --. -- - + 4. -- sA l a m oN a t i oL a b o r L oA l a m o sN eM e x8 7 `"'l~@fO,,J~@jj~~~~.F=~Of.f~n~~~Y. - w


A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.


Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



U.S. Energy Information Administration (EIA)

Pilgrim Nuclear Power Station Massachusetts Total MD Calvert Cliffs Nuclear Power Plant Maryland Total MI Fermi Donald C Cook Michigan Total MN Prairie Island ...


Support for the delisting of decontaminated liquid chemical surety materials as listed hazardous waste from specific sources (state) MD02 in COMAR 10. 51. 02. 16-1. Technical report, December 1987-February 1988  

SciTech Connect

Maryland recently enacted regulations that listed decontaminated residues of certain chemical warfare agents as hazardous wastes. The State would consider delisting if the Army document the effects of its decontamination procedures. Army specialists at U.S. Army Chemical Research, Development and Engineering Center (CRDEC), Aberdeen Proving Ground, MD, have had exhaustive experience in this area since 1918 when chemical agents were first used in combat in World War I. Competence accrued during this 70-year legacy includes destruction of laboratory and training wastes, combat decontamination, and largescale demilitarization of unserviceable and obsolete agent-filled munitions. The facts and circumstances enumerated in this document indicate that current decontamination practices are safe, scientifically valid, and result in the total destruction of agents in questions.

Durst, H.D.; Sarver, E.W.; Yurow, H.W.; Beaudry, W.T.; D'Eramo, P.A.



Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Baltimore City County, Maryland: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

2903848°, -76.6121893° 2903848°, -76.6121893° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.2903848,"lon":-76.6121893,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Tho Baltimore symposium NFPA panel session in New ...  

Science Conference Proceedings (OSTI)

... The need for some method of control cooling that is inde- pendent of all ... ifiations committees, and is an alter- nate on the Household Fire Warning ...



Baltimore Gas & Electric Company (Gas) - Residential Energy Efficiency...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to improve the energy efficiency of eligible homes. Rebates are available for furnaces, HVAC system tune-ups, and insulation measures. All equipment and installation requirements...


Baltimore Gas and Electric Company (Electric) - Residential Energy...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

for Energy Star clothes washers, dehumidifiers, refrigerators, freezers, CFLs, HVAC systems, and Building Insulation. The Home Performance with Energy Star Incentive...


NNSA to Conduct Aerial Radiation Monitoring Survey over Baltimore...  

National Nuclear Security Administration (NNSA)

occurring background radiation. A twin-engine Bell 412 helicopter, operated by the Remote Sensing Laboratory Aerial Measuring System from Joint Base Andrews, will be...


Urbanizing the American dream : symbiotic housing for Baltimore  

E-Print Network (OSTI)

In the 1950s, the American dream of owning a suburban single family home was directed at one demographic, the nuclear family. America's resources seemed limitless: industry marketing and government policies encouraged over ...

Gealy, Rachel (Rachel Katherine)



Baltimore Gas and Electric Company (Electric) - Commercial Energy...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Heating & Cooling Cooling Other Heat Pumps Appliances & Electronics Commercial Lighting Lighting Manufacturing Maximum Rebate 1,000,000corporate tax IDyear Commercial...


Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Nanotechnology in Thoracic Surgery Morgan D. Schulz, MD, Onkar Khullar, MD, John V. Frangioni, MD, PhD,  

E-Print Network (OSTI)

of the lung and the preva- lence of occult micrometastatic disease within thoracic nodes which may appear be due to an increased detection of nodal disease or increased re- moval of nodes harboring occult foci


Local Hotels/Motels - Gaithersburg, MD  

Science Conference Proceedings (OSTI)

... relationship with NIST. We provide this information as a convenience to NIST visitors and conference attendees. NIST does ...



Fissile Material Disposition (MD) - Nuclear Engineering Division...  

NLE Websites -- All DOE Office Websites (Extended Search)

a legacy of surplus fissile materials (primarily weapons-grade plutonium and highly enriched uranium) in the United States and the former Soviet Union. These materials pose a...


Community Academic Profile Jon D. Fuller, MD  

E-Print Network (OSTI)

, Gerontology, & Metabolism ACTIVITIES 2006 Member, VHA Capacity Management Advisory Council, VA HQ. 2005 Member, VHA Clinical Advisory Council to Chief Business Office, VA HQ. 2005 VA representative to the White Forum Steering Committee Member, "Standardizing Home Health Care Performance Measures" 2004 Organizer

Ford, James


Student Directory yea Larry S. Tobacman, MD  

E-Print Network (OSTI)

Genetics St Louis, 2007 Andrew Czysz (2007) aczysz2@uic.edu th Year PhD logy, U. Florida, 2007 Durst (2012

Alford, Simon


Status and outlook for shale gas and tight oil development in the U.S.  

Gasoline and Diesel Fuel Update (EIA)

Baltimore Chartered Financial Analyst Society Baltimore Chartered Financial Analyst Society April 08, 2013 | Baltimore, MD By Adam Sieminski, Administrator Annual Energy Outlook 2013 projections to 2040 2 * Growth in energy production outstrips consumption growth * Crude oil production rises sharply over the next decade * Motor gasoline consumption reflects more stringent fuel economy standards * The U.S. becomes a net exporter of natural gas in the early 2020s * U.S. energy-related carbon dioxide emissions remain below their 2005 level through 2040 Adam Sieminski, Baltimore CFA Society April 08, 2013 U.S. energy use grows slowly over the projection reflecting improving energy efficiency and slow, extended economic recovery 3 0 20 40 60 80 100 120 1980 1985 1990 1995 2000 2005 2010 2015 2020 2025 2030 2035 2040


Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Noname manuscript No. (will be inserted by the editor)  

E-Print Network (OSTI)

for conic cutting surface algorithms John E. Mitchell · Vasile L Basescu the date of receipt and acceptance, NY 12180, USA, E-mail: mitchj@rpi.edu V. L. Basescu Baltimore, MD, USA, E-mail: basesv@verizon.net #12;2 John E. Mitchell, Vasile L Basescu problem generate a point ¯y Y and determine whether

Mitchell, John E.


N o d'ordre : 410 I presentee par  

E-Print Network (OSTI)

for conic cutting surface algorithms John E. Mitchell · Vasile L Basescu the date of receipt and acceptance, NY 12180, USA, E-mail: mitchj@rpi.edu V. L. Basescu Baltimore, MD, USA, E-mail: basesv@verizon.net #12;2 John E. Mitchell, Vasile L Basescu problem generate a point ¯y Y and determine whether

Tannier, Xavier


Download PDF  

Science Conference Proceedings (OSTI)

West B-004, 10300 Baltimore Ave, Beltsville, MD 20705, USA ..... of protein except for the positive control, 0.5 ?g. 774. 37.1. 31.2. 17.1. 6.9. 83.4. ++bN05. 253. 3.


*Corresponding author. E-mail address: agagroup@olympus.ece.jhu.edu (A.G. Andreou).  

E-Print Network (OSTI)

*Corresponding author. E-mail address: agagroup@olympus.ece.jhu.edu (A.G. Andreou). This research and Computer Engineering, The Johns Hopkins University, 3400 N. Charles Street, Baltimore, MD 21211, USA contains eight photoreceptors which receive light through a facet lens and respond in graded fashion

Maryland at College Park, University of


Annual Report Department of Chemical & Biomolecular  

E-Print Network (OSTI)

Highway Tolling · Animal Tracking · Security Access & Control · Exxon Speedpass · Rail Car Tracking: Sensormatic and Checkpoint: EAS 1973: Cardullo Patent: Passive RFID 1975: LASL: RFID Research Released DIST. CENTER BALTIMORE, MD P & G FACTORY CAPEGIRADEAU , MO SAM'S STORE TULSA P & G DC IOWA CITY, IO SAM

Velev, Orlin D.


The Institute for Advanced Study Annual Report 1982/83  

E-Print Network (OSTI)

-1979 Master of Science in Civil Engineering, MIT 1973-1977 Bachelor of Science in Engineering, Princeton), Center of Excellence for Command, Control and Interoperability, $68,150, 9/1/2009-8/31/2010. Exxon: Is it all the same?" NSF Workshop on simulation optimization, Baltimore, Md, Dec 4, 2010. "Optimal Learning



E-Print Network (OSTI)

Highway Tolling · Animal Tracking · Security Access & Control · Exxon Speedpass · Rail Car Tracking Transmission Systems with Modulatable Passive Responder 1966: Sensormatic and Checkpoint: EAS 1973: Cardullo DIST. CENTER BALTIMORE, MD P & G FACTORY CAPEGIRADEAU , MO SAM'S STORE TULSA P & G DC IOWA CITY, IO SAM

US Army Corps of Engineers


Welcomealumniandfriendstothe2006editionoftheG-Hawker, andfirst,letmethankyouall.Withsomanyofyouworkingwithustohelp  

E-Print Network (OSTI)

Highway Tolling · Animal Tracking · Security Access & Control · Exxon Speedpass · Rail Car Tracking Transmission Systems with Modulatable Passive Responder 1966: Sensormatic and Checkpoint: EAS 1973: Cardullo DIST. CENTER BALTIMORE, MD P & G FACTORY CAPEGIRADEAU , MO SAM'S STORE TULSA P & G DC IOWA CITY, IO SAM

Peterson, Blake R.



E-Print Network (OSTI)

1973-1977 Bachelor of Science in Engineering, Princeton University, Summa Cum Laude; Phi Beta Kappa for Command, Control and Interoperability, $68,150, 9/1/2009-8/31/2010. ExxonMobil, Grant to support research Programming: Is it all the same?" NSF Workshop on simulation optimization, Baltimore, Md, Dec 4, 2010

District of Columbia, University of the


VALERIE B. BARR Professor and Chair of Computer Science  

E-Print Network (OSTI)

York University, 1977 ­ 1979. B.A. (Applied Mathematics) cum laude, Mount Holyoke College, 1973 ­ 1977 Computer Systems, Staff Consultant, 1980 ­ 1982; Exxon Corporation, Systems Analyst, 1979 ­ 1980.J. Gonzalez, R. Knauf, Foundations-02, October 2001, Baltimore, MD. "A Quagmire of Terminology: Verification

Barr, Valerie


Annual Report Department of Chemical & Biomolecular  

E-Print Network (OSTI)

-1979 Master of Science in Civil Engineering, MIT 1973-1977 Bachelor of Science in Engineering, Princeton), Center of Excellence for Command, Control and Interoperability, $68,150, 9/1/2009-8/31/2010. Exxon: Is it all the same?" NSF Workshop on simulation optimization, Baltimore, Md, Dec 4, 2010. "Optimal Learning

Velev, Orlin D.


January 22, 2000 CURRICULUM VITAE  

E-Print Network (OSTI)

1973-1977 Bachelor of Science in Engineering, Princeton University, Summa Cum Laude; Phi Beta Kappa/1/2009-8/31/2010. ExxonMobil, Grant to support research in energy, $50,000, 2009-2010. Netjets, Grant to support research, Baltimore, Md, Dec 4, 2010. "Optimal Learning: Efficient Data Collection for the Information Age," Plenary

Scott, David W.


Professional Interests and Honors 1 Curriculum Vita  

E-Print Network (OSTI)

of Science in Civil Engineering, MIT 1973-1977 Bachelor of Science in Engineering, Princeton University), Center of Excellence for Command, Control and Interoperability, $68,150, 9/1/2009-8/31/2010. Exxon Programming: Is it all the same?" NSF Workshop on simulation optimization, Baltimore, Md, Dec 4, 2010


Annual Report Department of Chemical & Biomolecular  

E-Print Network (OSTI)

1973-1977 Bachelor of Science in Engineering, Princeton University, Summa Cum Laude; Phi Beta Kappa and Interoperability, $68,150, 9/1/2009-8/31/2010. ExxonMobil, Grant to support research in energy, $50,000, 2009 Workshop, Morgan State, Baltimore, Md., March 7, 2010. "Opportunities for Machine Learning in Stochastic

Velev, Orlin D.


Dept. of Biomedical Engineering -Graduate Post Graduate Activities Detail & History  

E-Print Network (OSTI)

students from the Class of 2008. Historical data is provided to allow for comparison of activity and salary trends. Number Graduated: 43 Number Responded: 25 Response Rate: 58% (-N) denotes graduate self reported of Investigation Intelligence Analyst Baltimore MD MENG - N General Electric * Product Engineer Not Reported MENG

Lipson, Michal


Information Science, Systems & Technology -Undergraduate (College of Engineering ONLY)  

E-Print Network (OSTI)

by Information Science undergraduate students from the Class of 2011 in the College of Engineering. Historical Responded: 10 Response Rate: 100% 2011 Graduate and Professional Schools Cornell University MENG Civil Analyst Baltimore MD Factset Research Systems, Inc. Software Engineer Stanford CT General Electric

Lipson, Michal


9th Annual North American Waste to Energy Conference MERCURY CEMs: TECHNOLOGY UPDATE  

E-Print Network (OSTI)

in Baltimore, MD, Scrubber Dry Adsorber (SDA), SNCR and Mercury APC systems were added to the existing technology (Baghouse). Most large MWCs have to install a Mercury Control system to meet the Federal Emission Guidelines. New Jersey and Florida have developed more stringent mercury standards than the federal limits

Columbia University


Huber, Shocked, DRAFT for Env. Politics Workshop, 10/14/11, Berkeley, CA Page 1 Shocked: "Energy Crisis" and Neoliberal Transformation in the 1970s  

E-Print Network (OSTI)

, Daniel Yergin, 1991, 543-680. Also see, Karen R. Merrill, The Oil Crisis of 1973-1974: A Brief History Russell, Limiting Oil Imports: An Economic History and Analysis (Baltimore, MD: Resources for the Future of Crude Oil Cartelization in the United States, 1933­1972" The Journal of Economic History, Vol. 49, No. 4

Silver, Whendee


645Book reviews / Economics of Education Review 21 (2002) 641--648 ans migrate to the US and elsewhere because they  

E-Print Network (OSTI)

645Book reviews / Economics of Education Review 21 (2002) 641--648 ans migrate to the US workers in India with an acceptable infrastructure? Insofar as the book fails to address these critical. Baltimore, MD: The John Hopkins University Press, 2001. pp. ix+271. Price: $38.00 (cloth). This book

Heller, Don


Ab Initio Study of the SN1Ar and SN2Ar Reactions of Benzenediazonium Ion with Water. On the Conception of  

E-Print Network (OSTI)

the redundant internal coordinates and started with C1 symmetry. We indicate all the symmetry changes, e.g. C1 Compounds, 3rd ed.; Edward Arnold: Baltimore, MD, 1985. (10) (a) Lewis, E. S.; Insole, J. M. J. Am. Chem4 -).25 Structures of loosely coordinated phenyl cations have been characterized recently by solid

Glaser, Rainer

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Accidents, 101 Adams, John Quincy, 9  

E-Print Network (OSTI)

Washington, DC, 1, 2, 15, 111 See also Mall Washington, George, 1, 16, 39, 86, 87, 98 centennial of birth, 6 on the Construction of the Washington National Monument, 38, 41, 44, 46, 58, 63, 76, 93, 94, 95, 96, 97, 103, 105, 109 shutters, 85 windows, 85 capstone, 81-82 Quarries, 63, 76, 77 Baltimore County, MD, 62, 63 Potomac Valley

US Army Corps of Engineers


A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Logistics | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

Logistics Logistics Basic Energy Sciences Advisory Committee (BESAC) BESAC Home Meetings Meeting Presentations History Logistics Members Charges/Reports Charter .pdf file (41KB) BES Committees of Visitors BES Home Meetings Logistics Print Text Size: A A A RSS Feeds FeedbackShare Page Transportation Airport Directions and Services Ronald Reagan (National) Airport External link Baltimore-Washington International Airport (BWI) External link Dulles International Airport (Dulles) External link Ground Transportation Ronald Reagan (National) Airport External link Baltimore-Washington International Airport (BWI) External link Dulles International Airport (Dulles) External link Hotel North Bethesda Marriott and Conference Center External link 5701 Marinelli Road North Bethesda, MD 20852 Phone: 1-301-822-9200


General Information - 23rd NISS Conference  

Science Conference Proceedings (OSTI)

... Center; 1 W. Pratt Street, Baltimore, Maryland USA, easily accessed by Baltimore Washington International Airport and Amtrak Railroad, Baltimore ...



The National Nanotechnology Infrastructure Network's ...  

Science Conference Proceedings (OSTI)

SPIE Baltimore 4/26/2012. SPIE Baltimore 4/26/2012. ... Georgia Institute of Technology. SPIE Baltimore 4/26/2012. SPIE Baltimore 4/26/2012. ...



David Keavney  

NLE Websites -- All DOE Office Websites (Extended Search)

Publications Publications Contact Us Ring Status Current Schedule David Keavney Argonne National Laboratory 9700 S. Cass Ave 431/E002 Argonne, Il 60439 Phone: 252-7893 Fax: 252-7392 E-Mail: keavney@aps.anl.gov Education/Experience: 2006 - present: Physicist, X-ray ScienceDivision, Argonne National Laboratory, Argonne, Illinios 2001 - 2006: Assistant Physicist, Experimental Facilities Division, Argonne National Laboratory, Argonne, Illinios 1997-2001: Research Professor, University of Arizona, Tucson, Arizona 1994-1997: Postdoctoral Appointee, Materials Science Division, Argonne National Laboratory, Argonne, Illinois Ph.D., Physics, Johns Hopkins University, Baltimore, MD, June 1994 M.A., Physics, Johns Hopkins University, Baltimore, MD, May 1991 B.S., Engineering Physics, Stevens Institute of Technology, Hoboken,



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Utl Utl ) u.s. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERl\IIINATION Page 1 of2 RECIPIENT:City of Baltimore STATE: MD PROJEcr TITLE: EECBG Program/Bike Parking Racks/Stand· Baltimore City, MD funding Opportunity Announ«ment Number Pnxurement Instrument Number NEPA Control Number CID Number DE-FOA-OOOOO13 DE-EEOOOO738 GFo.oooo738-003 G0738 Based on my review ortbe inrormation concer ning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 4.5I.tA). I have made the rollowing determination: CX. EA, EIS APPENDIX AND NUMBER: Description: A9 Infomation gathering, analysis, and d isseminatio n InformatIOn gathenng (including, but not limited to, literature surveys, Inventories SIte VISitS, and audits), data analySIs (including, but not limited to, romputer modeling), document preparatIOn (including, but not limited


Social equity in urban sustainability initiatives : strategies and metrics for Baltimore and beyond  

E-Print Network (OSTI)

Almost all cities in the United States have initiated efforts to become more sustainable. Theoretically, sustainability encompasses social equity, as well as ecological and economic systems. In practice, many cities are ...

Martin, Amanda W. (Amanda Whittemore)



Impact of Upstream Urbanization on the Urban Heat Island Effects along the Washington–Baltimore Corridor  

Science Conference Proceedings (OSTI)

Although there has been considerable research on urban heat island (UHI) effects, most of the previous studies have attributed UHI effects to localized, surface processes. In this study, the impact of upstream urbanization on enhanced UHI effects ...

Da-Lin Zhang; Yi-Xuan Shou; Russell R. Dickerson; Fei Chen



Flash Flood Forecasting for Small Urban Watersheds in the Baltimore Metropolitan Region  

Science Conference Proceedings (OSTI)

The utility of distributed hydrologic models in combination with high-resolution Weather Surveillance Radar-1988 Doppler (WSR-88D) rainfall estimates for flash flood forecasting in urban drainage basins is examined through model simulations of 10 ...

Julie Rose N. Javier; James A. Smith; Katherine L. Meierdiercks; Mary Lynn Baeck; Andrew J. Miller



Microsoft Word - FY 2011 MD-715 Report.docx  

National Nuclear Security Administration (NNSA)

1 1 DOE NNSA December 14, 2011 i National Nuclear Security Administration U.S. Department of Energy ANNUAL EEO PROGRAM STATUS REPORT EEO PLAN TO ATTAIN THE ESSENTIAL ELEMENTS OF A MODEL EEO PROGRAM Table of Contents Page FORM 715-01 Part A Department or Agency Identifying Information......................1 FORM 715-01 Part B Total Employment....................................................................1 FORM 715-01 Part C Agency Official(s) Responsible for oversight of EEO Program(s)................................................................................................................1 FORM 715-01 Part D List of Subordinate Components Covered in this Report ........3 FORM 715-01 Part E Executive Summary.................................................................4


Oral Histories: Hematologist Karl F. Hubner, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

had experienced this type of accidental radiation exposure, aside from the atomic bomb in 1945; that's a different issue. Dealing with fissionable material, you take the risk...


Dawna M. Gilchrist MD FRCPC FCCMG DHMSA Before the University  

E-Print Network (OSTI)

by the round-about. The low-rise to the left is the Red Cross Pavilion. The building at the top left is now;New Space In the 50's and 60's more wings were added to University Hospital. This view is from

MacMillan, Andrew


100 Bureau Drive, Stop 1915 Gaithersburg, MD 20899 301 ...  

Science Conference Proceedings (OSTI)

... this employer? _____Yes _____No Start Salary: $_____ Final Salary $_____ Describe your duties ...



FIRE RESEARCH October 13-15, 1992 Rockville, MD  

Science Conference Proceedings (OSTI)

... Total Radiative Heat Loss in Jet Flames porn Singe Point Radiance Measuremen< I? Dutta, YR Sivathanu and JP Gore, Purdue University ..... ...



Microsoft Word - FY 2010 MD-715 Report.docx  

National Nuclear Security Administration (NNSA)

Prin. Asst. Dep. Admin. Kenneth Baker NA-20 Asst. Dep. Admin. for Science, Engineering & Production Programs W. Steven Goodrum NA-12 Asst. Dep. Admin. for Strategic Planning,...


Oral Histories: Dr. George Voelz, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

Worker Accident at Idaho's SL-1 Reactor (1961) Controlled Environmental Radioiodine Tests (19631968) Informed Consent at Idaho Tracer Studies on Human Volunteers at Los...


Accuracy in Powder Diffraction IV NIST, Gaithersburg MD ...  

Science Conference Proceedings (OSTI)

... iron) – Steel – Slag Page 5. Iron making - value chain Raw materials Coal Lumpy ore Mining Waste Slag Final product Steel (Retained Austenite) ...



CURRICULUM VITAE Joseph A. Califano, III, M.D.  

E-Print Network (OSTI)

, Kowalski LP. Trends in incidence and prognosis for head and neck cancer in the United States: A site. Mithani SK, Shao C, Tan M, Smith IM, Califano JA, El-Naggar AK, Ha PK. Mitochondrial mutations in adenoid, Sankaranarayanan R, Califano J, Kowalski L. Global oral health inequalities in incidence and outcomes for oral

May, Brad


Oral Histories: Radiologist Earl R. Miller, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

Therapy Research Relations Between UC Berkeley and UC San Francisco Working for the Manhattan Project and UC Medical Center Process for Obtaining Radioactive Isotopes Human...

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Nicolas Demanget, MSc1,2 , Ambroise Duprey, MD2  

E-Print Network (OSTI)

and fabric of current manufactured SGs. Methods Eight marketed SG limbs (Aorfix® , Anaconda® , Endurant

Recanati, Catherine


Radiation Resistance of Nickel, Iron, Chromium Spinels by MD ...  

Science Conference Proceedings (OSTI)

About this Abstract. Meeting, 2014 TMS Annual Meeting & Exhibition. Symposium , Radiation Effects in Oxide Ceramics and Novel LWR Fuels. Presentation Title ...


Modelling Heat Transfer in Nanofluids Based on Coupled MD ...  

Science Conference Proceedings (OSTI)

Simulations have shown that the additional heat transfer caused by the collision of the nanoparticles with the heat source contributes significantly to the ...


Oral Histories: Dr. Nadine Foreman, M.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

as to dosage-in other words, how many microcuries7 of radioiodine would actually enter the gland and have an effect upon it. Treatment of Hyperthyroidism BERGE: With respect...


Images in Neuroscience Carol A. Tamminga, M.D., Editor  

E-Print Network (OSTI)

is delivered to the brain region of interest using a fiberoptic-based system or a light-emitting diode (LED-sensitive, molecular, neu- ronal activity "switches." These "switches" are microbial, light- sensitive ion conductance-regulat- ing activity of these "switches" can be controlled externally with light pulses. ChR2 is a cation

Deisseroth, Karl


Materials Degradation and Detection (MD2): Deep Dive Final Report  

SciTech Connect

An effort is underway at Pacific Northwest National Laboratory (PNNL) to develop a fundamental and general framework to foster the science and technology needed to support real-time monitoring of early degradation in materials used in the production of nuclear power. The development of such a capability would represent a timely solution to the mounting issues operators face with materials degradation in nuclear power plants. The envisioned framework consists of three primary and interconnected “thrust” areas including 1) microstructural science, 2) behavior assessment, and 3) monitoring and predictive capabilities. A brief state-of-the-art assessment for each of these core technology areas is discussed in the paper.

McCloy, John S.; Montgomery, Robert O.; Ramuhalli, Pradeep; Meyer, Ryan M.; Hu, Shenyang Y.; Li, Yulan; Henager, Charles H.; Johnson, Bradley R.



Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The�¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Baltimore Baltimore PROJECT TITLE: EECBG - GHG Scrubbing System Page 1 of2 STATE: MD Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-EE0000738 GFO-0000738-002 0 Based all my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: All Technical advice and planning assistance to international, national, state, and local organizations. 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical


Low Dose Radiation Research Program: Research Program Workshop I Abstracts  

NLE Websites -- All DOE Office Websites (Extended Search)

Genetic Factors Affecting Susceptibility to Low-Dose Radiation Genetic Factors Affecting Susceptibility to Low-Dose Radiation William F. Morgan and John H.J. Petrini Radiation Oncology Research Laboratory, University of Maryland at Baltimore, Baltimore, MD Summary: The goal of our application is to improve the scientific basis for understanding potential risks to the population from low dose radiation exposure based on potential genetic differences that may modulate an individual's sensitivity to low doses of radiation. Abstract: The goal of this application is to improve the scientific basis for understanding potential risks to the population from low dose radiation exposure. We propose to address specific genetic factors that affect individual susceptibility to low dose radiation and ask the question do genetic differences exist that make some individuals more sensitive to


Category:QuickServiceRestaurant | Open Energy Information  

Open Energy Info (EERE)

QuickServiceRestaurant QuickServiceRestaurant Jump to: navigation, search Go Back to PV Economics By Building Type Media in category "QuickServiceRestaurant" The following 77 files are in this category, out of 77 total. SVQuickServiceRestaurant Albuquerque NM Public Service Co of NM.png SVQuickServiceRestaura... 65 KB SVQuickServiceRestaurant Atlantic City NJ Public Service Elec & Gas Co.png SVQuickServiceRestaura... 64 KB SVQuickServiceRestaurant Baltimore MD Baltimore Gas & Electric Co.png SVQuickServiceRestaura... 67 KB SVQuickServiceRestaurant Bismarck ND Montana-Dakota Utilities Co (North Dakota).png SVQuickServiceRestaura... 72 KB SVQuickServiceRestaurant Boulder CO Public Service Co of Colorado.png SVQuickServiceRestaura... 61 KB SVQuickServiceRestaurant Bridgeport CT Connecticut Light & Power Co.png


Category:FullServiceRestaurant | Open Energy Information  

Open Energy Info (EERE)

FullServiceRestaurant FullServiceRestaurant Jump to: navigation, search Go Back to PV Economics By Building Type Pages in category "FullServiceRestaurant" This category contains only the following page. O Openei test page Media in category "FullServiceRestaurant" The following 77 files are in this category, out of 77 total. SVFullServiceRestaurant Albuquerque NM Public Service Co of NM.png SVFullServiceRestauran... 66 KB SVFullServiceRestaurant Atlantic City NJ Public Service Elec & Gas Co.png SVFullServiceRestauran... 63 KB SVFullServiceRestaurant Baltimore MD Baltimore Gas & Electric Co.png SVFullServiceRestauran... 69 KB SVFullServiceRestaurant Bismarck ND Montana-Dakota Utilities Co (North Dakota).png SVFullServiceRestauran... 72 KB SVFullServiceRestaurant Boulder CO Public Service Co of Colorado.png



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DEPARTlIIENT OF ENERGY DEPARTlIIENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERJl.ilNATION Page 1 01'2 RECIPIENT:County of Baltimore STATE: MD PROJECT TITLE: County of Baltimore ARRA-EEC8G (5) funding Opportunity Announcement Number DE-FOA-OOOOO13 Procurement Instrument Number DE-EEOOOO740 NEPA Control Number em Numbn o Baud on my nview oftht information concerning the proposed action, as NEPA Compliance Offien (authoril:ed under DOE Order 45I.1A), I han made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 InfOm1ation gathering (including. but not limited to, literature surveys, inventories, audits), data analysis (induding computer modeling), document preparation (such as conceptual design or feasibi lity studies, analytical energy supply


U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA) Indexed Site

Energy Conferences Energy Conferences NOTE: The following information on energy conferences is provided solely as a service for interested persons. Except for EIA-sponsored conferences, inclusion on this web page should not be considered as endorsement by the U.S. Energy Information Administration. November, December 2013 North America Rest of the World November 4-6: Innovation Ecosystems for Energy Solutions Conference Argonne National Laboratory, Lemont, IL http://ncseonline.org/2013-cerel-annual-energy-innovation-conference November 5-6: Energy Forum: Environmental and Economic Challenges Baltimore Marriott Waterfront Hotel, Baltimore, MD http://energy.awma.org/ November 7: Executive Energy Club (Viewpoints) Petroleum Club of Houston, Houston, TX http://www.execenergyclub.com/



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Name of Awardee Recovery Act Funding Awarded Total Project Value Including Cost Share Headquarters Location for Lead Applicant Brief Project Description Map of Coverage Area CenterPoint Energy $200,000,000 $639,187,435 Houston, TX Complete the installation of 2.2 million smart meters and further strengthen the reliability and self-healing properties of the grid by installing more than 550 sensors and automated switches that will help protect against system disturbances like natural disasters. http://www.energy.gov/recovery/smartgrid_maps /CenterPointEnergy.JPG Baltimore Gas and Electric Company $200,000,000 $451,814,234 Baltimore, MD Deploy a smart meter network and advanced customer control system for 1.1 million residential customers that will enable dynamic electricity pricing. Expand the utility's

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CATEGORY CATEGORY Name of Awardee Recovery Act Funding Awarded Participant Cost Share Total Project Value Including Cost Share Headquarters Location for Lead Applicant Brief Project Description Map of Coverage Area CenterPoint Energy $200,000,000 $439,187,435 $639,187,435 Houston, TX Complete the installation of 2.2 million smart meters and further strengthen the reliability and self-healing properties of the grid by installing more than 550 sensors and automated switches that will help protect against system disturbances like natural disasters. http://www.smartgrid.gov/sites/default/files/cover age_maps/SmartGridMap- CenterPointEnergy.JPG Baltimore Gas and Electric Company $200,000,000 $251,814,234 $451,814,234 Baltimore, MD Deploy a smart meter network and advanced customer


Secretary Bodman Announces $2 Billion Federal Loan Guarantee Program as  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

$2 Billion Federal Loan Guarantee $2 Billion Federal Loan Guarantee Program as Part of First Anniversary Celebration of Energy Policy Act Secretary Bodman Announces $2 Billion Federal Loan Guarantee Program as Part of First Anniversary Celebration of Energy Policy Act August 7, 2006 - 8:43am Addthis Secretary joined Maryland Governor Ehrlich at ribbon-cutting for first State-owned E-85 fueling pump BALTIMORE, MD - U.S. Department of Energy (DOE) Secretary Samuel W. Bodman today unveiled DOE program guidelines for a total of $2 billion in loan guarantees to help spur investment in projects that employ new energy technologies. Secretary Bodman made the announcement in Baltimore while joining Maryland Governor Robert Ehrlich at a ribbon-cutting ceremony opening Maryland's first State-owned E-85 fueling facility.


W. E. Mott, Director, Division of Environmental Control Technology, HQ  

Office of Legacy Management (LM)

Eyergy Eyergy pak t??pEOperatlons dak Ridge, Tennessee 37830 December 12, 1977 W. E. Mott, Director, Division of Environmental Control Technology, HQ Germantown, M.S. E-201 REPORT OF FINDINGS: ALLIED CHEMICAL CORPORATION SITES AT NORTH CLAYMONT, DELAWARE; MARCUS HOOK, PENNSYLVANIA, AND BALTIMORE, MARYLAND The following information summarizes our findings and conclusions relative to the reassessment of the subject sites. Information supplied from files of the former Atomic Energy Commission, Division of Raw Materials, indicates the company was engaged during the 1950's in research and development and pilot scale operations on uranium recovery at North Claymont, Delaware, and possibly at other Allied Chemical sites at Marcus Hook, Pa., and Baltimore, Md. under


U.S. Energy Information Administration (EIA)  

Gasoline and Diesel Fuel Update (EIA)

Conferences Conferences NOTE: The following information on energy conferences is provided solely as a service for interested persons. Except for EIA-sponsored conferences, inclusion on this web page should not be considered as endorsement by the U.S. Energy Information Administration. November, December 2013 North America Rest of the World November 4-6: Innovation Ecosystems for Energy Solutions Conference Argonne National Laboratory, Lemont, IL http://ncseonline.org/2013-cerel-annual-energy-innovation-conference November 5-6: Energy Forum: Environmental and Economic Challenges Baltimore Marriott Waterfront Hotel, Baltimore, MD http://energy.awma.org/ November 7: Executive Energy Club (Viewpoints) Petroleum Club of Houston, Houston, TX http://www.execenergyclub.com/ November 12-13:


SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Imports by Customs District" Coal Imports by Customs District" "(short tons)" ,,,,"Year to Date" "Customs District","April - June","January - March","April - June",2013,2012,"Percent" ,2013,2013,2012,,,"Change" "Eastern Total",469878,331008,156004,800886,350124,128.7 " Baltimore, MD","-","-",106118,"-",154318,"-" " Boston, MA",373985,154438,"-",528423,51185,"NM" " Buffalo, NY",44,"-","-",44,"-","-" " New York City, NY",1373,1402,487,2775,507,447.3 " Norfolk, VA","-",68891,"-",68891,35856,92.1 " Ogdensburg, NY","-",1,12,1,12,-91.7


Biological Systems for Hydrogen Photoproduction - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

NLE Websites -- All DOE Office Websites (Extended Search)

3 3 FY 2012 Annual Progress Report DOE Hydrogen and Fuel Cells Program Maria L. Ghirardi (Primary Contact), Paul W. King, Kathleen Ratcliff and David Mulder National Renewable Energy Laboratory (NREL) 1617 Cole Blvd. Golden, CO 80401 Phone: (303) 384-6312 Email: maria.ghirardi@nrel.gov DOE Manager Eric Miller Phone: (202) 287-5829 Email: Eric.Miller@hq.doe.gov Subcontractors: * Dr. Sergey Kosourov, Institute of Basic Biological Problems, RAS, Pushchino, Russia * Dr. Eric Johnson, Johns Hopkins University, Baltimore, MD Project Start Date: October 1, 2000 Project End Date: Project continuation and direction determined annually by DOE Fiscal Year (FY) 2012 Primary Objectives


SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Metallurgical Coal Exports by Customs District" Metallurgical Coal Exports by Customs District" "(short tons)" ,,,,"Year to Date" "Customs District","April - June","January - March","April - June",2013,2012,"Percent" ,2013,2013,2012,,,"Change" "Eastern Total",11716074,14136513,15167377,25852587,27578514,-6.3 " Baltimore, MD",2736470,4225450,5123600,6961920,9037970,-23 " Boston, MA","-","-","-","-",28873,"-" " Buffalo, NY",247714,121347,524040,369061,725698,-49.1 " Norfolk, VA",8730257,9784866,9519119,18515123,17784479,4.1 " Ogdensburg, NY",1633,4850,618,6483,1494,333.9 "Southern Total",3551564,3824484,4264938,7376048,8976503,-17.8


U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...



Gasoline and Diesel Fuel Update (EIA)



Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...



Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...



Gasoline and Diesel Fuel Update (EIA)




Gasoline and Diesel Fuel Update (EIA)

176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY...



Annual Energy Outlook 2012 (EIA)



U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)



Tracking the Sun II: The Installed Cost of Photovoltaics in the U.S. from 1998-2008  

E-Print Network (OSTI)

kW >100 kW ?10 kW PA SDF Solar PV Grant Program 10-100 kW >Renewable DG Program CT CCEF Solar PV Program MA MD MI MTCProgram MW No. Systems SDF Solar PV Grant Program MW No.

Barbose, Galen L




Office of Legacy Management (LM)

Government. i ~"~ Government. i ~"~ t Departmknti of Energy,' me' tnorandu,m' .' ?' . .:. ,,' ,. cATE: APR 1 y ' 624 y;;J; EM-421,(W.'A.:Williams, 903-81'49)' ,I ' , c I v : ., -Elimination,o,f the Max,Zuckerman &,Sons'Company Sites, Il.l,inois and ~'SUSJECT: Mary, and .: '. I To The File I, 1 .' , ,,.I have reviewed the attached site summary and elimination recommendati,od ,;. _ 'for the Max Zuckerman ,& Sons Company sites'in Chicago (IL), .Owings I iills % I ,' (MD) @.Baltimore (MD). '.I have determined that th.ere 'is,l,ittle,. ', 1' .. ,! likelihood.of radioactive contamination at these sites: ,' 1,' ., .: .I / . . I' ,, , ., 1, Based on the,above, the Max Zuckerman' & Sons Company sites i,n~Baltiinore/ --, .! , I Dwings Mills, and Chicago are hereby eliminated from'further'considerat~n


SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012" Coal Consumers in the Manufacturing and Coke Sectors, 2012" "Company Name","Plant Location" "Top Ten Manufacturers" "American Crystal Sugar Co","MN, ND" "Archer Daniels Midland","IA, IL, MN, ND, NE" "Carmeuse Lime Stone Inc","AL, IL, IN, KY, MI, OH, PA, TN, VA, WI" "Cemex Inc","AL, CA, CO, FL, GA, KY, OH, TN, TX" "Dakota Gasification Company","ND" "Eastman Chemical Company","TN" "Georgia-Pacific LLC","AL, GA, OK, VA, WI" "Holcim (US) Inc","AL, CO, MD, MO, MT, OK, SC, TX, UT" "NewPage Corporation","MD, MI, WI" "U S Steel Corporation","AL, IN, MI, MN"


U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012 Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 25. Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Company Name Plant Location Top Ten Manufacturers American Crystal Sugar Co MN, ND Archer Daniels Midland IA, IL, MN, ND, NE Carmeuse Lime Stone Inc AL, IL, IN, KY, MI, OH, PA, TN, VA, WI Cemex Inc AL, CA, CO, FL, GA, KY, OH, TN, TX Dakota Gasification Company ND Eastman Chemical Company TN Georgia-Pacific LLC AL, GA, OK, VA, WI Holcim (US) Inc AL, CO, MD, MO, MT, OK, SC, TX, UT NewPage Corporation MD, MI, WI U S Steel Corporation AL, IN, MI, MN Other Major Manufacturers Ash Grove Cement Co


"SHA-1","MD5","CRC32","FileName","FileSize","ProductCode" ...  

Science Conference Proceedings (OSTI)

... 14F872083AF453BE3D7085AB95F1F08331617A08","B45E8E01A1DB8 B999F8F95C869E3AEF6","98AD536E","RoboHHRE.lng",3586,21755 ...


Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


"SHA-1","MD5","CRC32","FileName","FileSize","ProductCode" ...  

Science Conference Proceedings (OSTI)

... 0DCDC2A845258DD55C358A3FA5D4FC06461A1D84","07AFBC4774A E9B165DAF118432EA3DC0","A74F016F","english.lng",311852,19423 ...



Michael Cheung, MD Clopidogrel with or without Omeprazle in Coronary Artery Disease  

E-Print Network (OSTI)

with stent placement. Primary GI endpoint was first occurrence of upper GI bleeding, occult GI bleed, hgb and occult) was statistically reduced with ompprazole compared to placebo. Cardiovascular endpoints


A Hybrid MD-kMC Algorithm to Study Diffusion in the Presence of ...  

Science Conference Proceedings (OSTI)

Proceedings Inclusion? Planned: A CD-only volume ... Studies on Vibrational Entropy in Alloys Using Inelastic Neutron Scattering at ORNL · Surface Prefreezing ...


Biomedical data retrieval utilizing textual data in a gene expression database by Richard Lu, MD.  

E-Print Network (OSTI)

Background: The commoditization of high-throughput gene expression sequencing and microarrays has led to a proliferation in both the amount of genomic and clinical data that is available. Descriptive textual information ...

Lu, Richard, M.D




E-Print Network (OSTI)

appointment can be processed: 1. DESCRIPTION OF WORK You must submit your research information on-line through. VERTEBRATE ANIMALS Does your research involve live vertebrate animals or their tissues, for further details

Bhatia, Sangeeta


Event-Triggered Optimal Power Dispatch M.D. Lemmon, University of Notre Dame  

E-Print Network (OSTI)

done using renewable generation sources such as photovoltaic cells or wind turbines. Power generation can also be accomplished through small microturbines and gas/diesel generators. Storage devices

Lemmon, Michael


An, Yuehuei, Adjunct Associate Professor, Bioengineering. MD, Harbin Medical University (China), 1983; MM, Beijing  

E-Print Network (OSTI)

Weatherford Naval Postgraduate School Chair Ning Cheng Altera Vice-Chair/Treasurer Junqiao Wu UC Berkeley Past. Larry Muray Agilent 8:30 Welcome Remarks and Introduction Prof. Todd Weatherford, Naval Postgraduate

Bolding, M. Chad


NAMD - The Engine for Large-Scale Classical MD Simulations of...  

NLE Websites -- All DOE Office Websites (Extended Search)

Institution: Argonne National Laboratory & University of Chicago Allocation Program: ESP Allocation Hours at ALCF: 80 Million Year: 2010 to 2013 Research Domain: Biological...


Fundamental physics at the intensity frontier. Report of the workshop held December 2011 in Rockville, MD.  

SciTech Connect

Particle physics aims to understand the universe around us. The Standard Model of particle physics describes the basic structure of matter and forces, to the extent we have been able to probe thus far. However, it leaves some big questions unanswered. Some are within the Standard Model itself, such as why there are so many fundamental particles and why they have different masses. In other cases, the Standard Model simply fails to explain some phenomena, such as the observed matter-antimatter asymmetry in the universe, the existence of dark matter and dark energy, and the mechanism that reconciles gravity with quantum mechanics. These gaps lead us to conclude that the universe must contain new and unexplored elements of Nature. Most of particle and nuclear physics is directed towards discovering and understanding these new laws of physics. These questions are best pursued with a variety of approaches, rather than with a single experiment or technique. Particle physics uses three basic approaches, often characterized as exploration along the cosmic, energy, and intensity frontiers. Each employs different tools and techniques, but they ultimately address the same fundamental questions. This allows a multi-pronged approach where attacking basic questions from different angles furthers knowledge and provides deeper answers, so that the whole is more than a sum of the parts. A coherent picture or underlying theoretical model can more easily emerge, to be proven correct or not. The intensity frontier explores fundamental physics with intense sources and ultra-sensitive, sometimes massive detectors. It encompasses searches for extremely rare processes and for tiny deviations from Standard Model expectations. Intensity frontier experiments use precision measurements to probe quantum effects. They typically investigate very large energy scales, even higher than the kinematic reach of high energy particle accelerators. The science addresses basic questions, such as: Are there new sources of CP violation? Is there CP violation in the leptonic sector? Are neutrinos their own antiparticles? Do the forces unify? Is there a weakly coupled hidden sector that is related to dark matter? Do new symmetries exist at very high energy scales? To identify the most compelling science opportunities in this area, the workshop Fundamental Physics at the Intensity Frontier was held in December 2011, sponsored by the Office of High Energy Physics in the US Department of Energy Office of Science. Participants investigated the most promising experiments to exploit these opportunities and described the knowledge that can be gained from such a program. The workshop generated much interest in the community, as witnessed by the large and energetic participation by a broad spectrum of scientists. This document chronicles the activities of the workshop, with contributions by more than 450 authors. The workshop organized the intensity frontier science program along six topics that formed the basis for working groups: experiments that probe (i) heavy quarks, (ii) charged leptons, (iii) neutrinos, (iv) proton decay, (v) light, weakly interacting particles, and (vi) nucleons, nuclei, and atoms. The conveners for each working group included an experimenter and a theorist working in the field and an observer from the community at large. The working groups began their efforts well in advance of the workshop, holding regular meetings and soliciting written contributions. Specific avenues of exploration were identified by each working group. Experiments that study rare strange, charm, and bottom meson decays provide a broad program of measurements that are sensitive to new interactions. Charged leptons, particularly muons and taus, provide a precise probe for new physics because the Standard Model predictions for their properties are very accurate. Research at the intensity frontier can reveal CP violation in the lepton sector, and elucidate whether neutrinos are their own antiparticles. A very weakly coupled hidden-sector that may comprise the dark matter in the univ

Hewett, J.L.; Weerts, H.; Brock, R.; Butler, J.N.; Casey, B.C.K.; Lu, Z.T.; Wagner, C.E.M.; Dietrich, M.R.; Djurcic, Z.; Goodman, M.; Green, J.P.; Holt, R.J.; Mueller, P.; Paley, J.; Reimer, P.; Singh, J.; Upadhye, A. (High Energy Physics); ( PHY); (Stanford Linear Accelerator Center); (Univ. of Michigan); (Fermi National Accelerator Laboratory)



1 Kenneth C. Rogers, Ph.D. Bethesda, MD 20817-3348 July 2 ...  

Science Conference Proceedings (OSTI)

... Preliminary Recommendations • NIST must proceed apace with the decontamination and decommissioning (if advisable ...



MD PHEV/EV ARRA Project Data Collection and Reporting (Presentation)  

DOE Green Energy (OSTI)

This presentation describes a National Renewable Energy Laboratory project to collect and analyze commercial fleet deployment data from medium-duty plug-in hybrid electric and all-electric vehicles that were deployed using funds from the American Recovery and Reinvestment Act. This work supports the Department of Energy's Vehicle Technologies Program and its Advanced Vehicle Testing Activity.

Walkowicz, K.; Ramroth, L.; Duran, A.; Rosen, B.



Oral Histories: Radiologist Hymer L. Friedell, M.D., Ph.D.  

NLE Websites -- All DOE Office Websites (Extended Search)

to Patients Prominent Researchers Working at Berkeley The Army Medical Corps and the Manhattan Project Work at the Chicago Metallurgical Laboratory Inspection of Manhattan...


WPI centers on March 11, 2011 and aftermath Toshio Kuroki, MD, PhD  

E-Print Network (OSTI)

the third disaster; the nuclear power plants in Fukushima became out of control totally and nuclear fuel, the biggest tsunami barriers particularly in these areas and warning systems by catching primary (P) wave City Distance from Fukushima nuclear plants Environmental dose AIMR Sendai 94 km 0.07 Sv/h MANA Tsukuba

Takada, Shoji


Name Santiago Andrs Triana Address 613 Blossom Drive, Rockville, MD 20850, USA  

E-Print Network (OSTI)

software and hardware control systems for the 3-meter Sodium Geodynamo Experiment; conduct experimental runs, perform data analysis and write scientific reports. Organization Institute for Research Technical drawing, machining, gas metal arc welding, hazardous materials handling, heavy load rigging

Lathrop, Daniel P.


MD-Predicted Phase diagrams for Pattern Formation due to Ion Irradiation  

E-Print Network (OSTI)

Energetic particle irradiation of solids can cause surface ultra-smoothening, self-organized nanoscale pattern formation, or degradation of the structural integrity of nuclear reactor components. Periodic patterns including high-aspect ratio quantum dots, with occasional long-range order and characteristic spacing as small as 7 nm, have stimulated interest in this method as a means of sub-lithographic nanofabrication. Despite intensive research there is little fundamental understanding of the mechanisms governing the selection of smooth or patterned surfaces, and precisely which physical effects cause observed transitions between different regimes has remained a matter of speculation. Here we report the first prediction of the mechanism governing the transition from corrugated surfaces to flatness, using only parameter-free molecular dynamics simulations of single-ion impact induced crater formation as input into a multi-scale analysis, and showing good agreement with experiment. Our results overturn the paradigm attributing these phenomena to the removal of target atoms via sputter erosion. Instead, the mechanism dominating both stability and instability is shown to be the impact-induced redistribution of target atoms that are not sputtered away, with erosive effects being essentially irrelevant. The predictions are relevant in the context of tungsten plasma-facing fusion reactor walls which, despite a sputter erosion rate that is essentially zero, develop, under some conditions, a mysterious nanoscale topography leading to surface degradation. Our results suggest that degradation processes originating in impact-induced target atom redistribution effects may be important, and hence that an extremely low sputter erosion rate is an insufficient design criterion for morphologically stable solid surfaces under energetic particle irradiation.

Scott A. Norris; Juha Samela; Laura Bukonte; Marie Backman; Djurabekova Flyura; Kai Nordlund; Charbel S. Madi; Michael P. Brenner; Michael J. Aziz



"SHA-1","MD5","CRC32","FileName","FileSize","ProductCode" ...  

Science Conference Proceedings (OSTI)

... 002DEB677B50F13F6579B6DA7E133A28AE8B1023","9B26061D60AC 4E53EBF68B8A16DCEBBB","36A8963F","PRNKY003.CAT",16606,19423 ...



I The sat (Sl md.re#t IR) inpuFs OyaCIjdo  

E-Print Network (OSTI)

aH a * input cQhrd8&mr: bc;ch ktpm tyva the paeMitv in&rtor to vvhen"b ' is low, the activehDgh outpu? is forced high; when "R " is low, the active-high output is forced low. Although normally the aotive-low output is drs complement of DUAL DTYPE RIP-FLOP e J-K master/slave The duat D-type flip-flop shown in Figura I of two imht D-tr.pe flip-flops with inputs on the left and flipflops: W mn&h w?U sxta mfy for as long as both "8 ' and "R " wo brcl low. The flip-flop will return to some indeterminate state when both " S and "R " go high. FIGURE 2. Four-Bit Bistable Latch input. tion is derived as follows:- The "DC " input has an AND relationship with the "C " input w shown by the subswipted "C". Therefore, Data passas through "Dc" only when "6 ' is active trua- Input "C " is sensitive to transition, or sensitive as shown by:he ed % (dynamic indicator) symbol.- Absence of the polarity indicator on input "C " means that the MORE E level is true. Therefore, ive true on a low-to-hi& tramis# * and when "C " is active true as stated &over data is passed through and active low outputs are by the abseme/presence of tarritvindicator {-P 1. FOUR-BIT BISTABLE LATCH The fourbit bistable latch shown in Figure 2 consists of four independent D-type flip-flops. FFI and FF2 are controlled by the 61 dock input, and FF3 and FF4 are controlled by the C2 clock input. This is evident by the subscripted C1 and C2 on the input data lines. Information present at a data (Dc) input is transferred to the active-high and active-low outputs when the associated clock input is high: the outputs will follow the data as long as the clock remains high. When the clock goes low, the information that was present at the data input when t4e transition occurred is retained at the outputs until the dock returns high. WWW.HPARCHIVE.COM-flops. Inputs to the master section on the left side are controlled by the gate (G) pulse. The gate pulse also controls the state of the coupling transistors (not shown) wh connect the mmw aprd dm

unknown authors



NodeMD: diagnosing node-level faults in remote wireless sensor systems  

Science Conference Proceedings (OSTI)

Software failures in wireless sensor systems are notoriously difficult to debug. Resource constraints in wireless deployments substantially restrict visibility into the root causes of node-level system and application faults. At the same time, the high ... Keywords: deployment, diagnosis, software fault, wireless sensor networks

Veljko Krunic; Eric Trumpler; Richard Han



Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy’s National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION



Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and… (more)

Yun, Michael




E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...


ENERGY SURETY MI ROGRID™ - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment– assists in planning and analysis of potential risks


NBP RFI: Data Access, Third Party Use and Privacy- Comments of...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Third Party Use and Privacy- Comments of Baltimore Gas & Electric Company NBP RFI: Data Access, Third Party Use and Privacy- Comments of Baltimore Gas & Electric Company...


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Baltimore Pike, Glen Mills, PA 19342 PA E85 Corridor Project - Lehigh Gas, Concordville Exxon Station (Baltimore Pike) Retrofit of gasoline fuel storage and dispensers to...



NLE Websites -- All DOE Office Websites (Extended Search)

were both male and female teachers representing Baltimore City and non- Baltimore City schools, public and private schools, single sex and regular schools, secular and religious...


miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha



Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.


Comment submitted by Whirlpool Corporation regarding the Energy Star Verification Testing Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ADMINISTRATIVE CENTER * 2000 N. M63 - MD 3005 * BENTON HARBOR, MI 49022 * 269.923.4646 ADMINISTRATIVE CENTER * 2000 N. M63 - MD 3005 * BENTON HARBOR, MI 49022 * 269.923.4646 May 9, 2011 Via email Ashley Armstrong U.S. Department of Energy Building Technologies Program 1000 Independence Avenue, SW Washington, DC 20585-0121 ESTARVerificationTesting@ee.doe.gov Re: DOE ENERGY STAR Verification Testing Program Dear Ms. Armstrong: We appreciate the opportunity to comment on the DOE Verification Testing Program that was put forth on April 22, 2011 (DOE Testing Document). As a very active member of the Association of Home Appliance Manufacturers (AHAM), we have worked closely with them in the development of the comments they have submitted (under separate cover)


Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)



Proceedings of the ASME 2011 Pressure Vessels & Piping Division / K-PVP Conference July 17-221, 2011, Baltimore, Maryland, USA  

E-Print Network (OSTI)

. INTRODUCTION The mounting costs of maintaining our aging infrastructure and the associated safety issues- informed in-service inspection of critical infrastructure. PIEZOELECTRIC WAFER ACTIVE SENSORS Piezoelectric ( =0T ), and kijd represents the piezoelectric coupling effect. PWAS utilize the 31d coupling between

Giurgiutiu, Victor


Spin-trimer antiferromagnetism in La4Cu3MoO12 Department of Physics and Astronomy, Johns Hopkins University, Baltimore, Maryland 21218, USA  

E-Print Network (OSTI)

Research Council, Chalk River Laboratories, Chalk River, Ontario K0J 1J0, Canada Received 30 March 2005 clusters, which we shall denote trimers. Consider- ation of the crystal structure and the Goodenough rules

Broholm, Collin Leslie


(290), ra75. [DOI: 10.1126/scisignal.2004097]6Science Signaling Linda C. Hsieh-Wilson and David Baltimore (27 August 2013)  

E-Print Network (OSTI)

Function of the NF-kB Protein c-Rel by O-GlcNAc Glycosylation Parameswaran Ramakrishnan,1 * Peter M. Clark factor nuclear factor kB (NF-kB) rapidly reprograms gene expression in response to various stimuli stress. We report that the NF-kB subunit c-Rel is modified and acti- vated by O-GlcNAcylation. We

Gleeson, Joseph G.



NLE Websites -- All DOE Office Websites (Extended Search)

Aerosols and Aerosols and Surface Optical Properties from Airborne Spectral Measurements of Directional Reflectance C.K.Gatebe 1,2 & M.D. King, 2,3 Collaborators: O. Dubovik, 4 A.Sinyuk, 2,5 P. Russell, 6 J. Redemann 6 Acknowledgements: G.T. Arnold (SSAI & GSFC) Gala Wind (SSAI & GSFC) Rajesh Poudyal (SSAI & GSFC) Hal Maring & Andy Roberts (NASA HQ) 1 University of Maryland, Baltimore County 2 NASA Goddard Space Flight Center 3 University of Colorado 4 Laboratoire d'Optique Atmosphérique 5 Science Systems and Applications Inc. 6 NASA Ames Research Center Background: CAR Airborne Platforms 1998-2008 NASA P-3B Convair CV-580 Aerocommander 690A Jetstream-31 AATS SSFR/BBR SSFR CAR The NASA P-3B 2008 BBR CAR Time CAR Quicklook Image 2008 http://car.gsfc.nasa.gov/data/ BRDF Measurements



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Prepared by: Prepared by: Aon Consulting 111 Market Place Baltimore, MD 21202 www.aon.com Trends in Retirement Income and Retiree Medical Plans What's inside 1 Introduction 2 Defined Benefit Trends 5 Defined Contribution Plan Trends 7 Rationale Behind the Trends 9 Retiree Health Trends 11 Key Changes in Retiree Health Coverage 14 Appendix 1: DB Design Trends 16 Appendix 2: DC Design Trends 17 Appendix 3: Charts and Figures 29 Appendix 4: Recent Articles on DB Trends 30 Appendix 3: Recent Articles on Retiree Medical Trends Introduction Today, U.S. employers are finding it increasingly difficult to offer the level of retirement benefits provided to workers over the last half century. Factors impacting the changing landscape for retirement benefits include:

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE Hydrogen Analysis Repository: Second Generation Model (SGM)  

NLE Websites -- All DOE Office Websites (Extended Search)

Second Generation Model (SGM) Second Generation Model (SGM) Project Summary Full Title: Second Generation Model (SGM) Project ID: 166 Principal Investigator: Roland Sands Brief Description: The SGM projects economic activity, energy consumption and greenhouse gas emissions for each region in five-year time steps from 1990 through 2050. Purpose Project economic activity, energy consumption and greenhouse gas emissions for various regions. Performer Principal Investigator: Roland Sands Organization: Pacific Northwest National Laboratory (PNNL) Address: 8400 Baltimore Avenue, JGCRI College Park, MD 20740 Telephone: 301-314-6765 Email: roland.sands@pnl.gov Project Description Type of Project: Model Category: Energy Infrastructure, Environmental, Macro-Economic User Inputs: Factor productivity growth rates by sector (9 in SGM 98) and region; capital stocks by vintage, demographic determinants (endogenous demographics), fossil and non-fossil fuel resources


A study of the metal content of municipal solid waste. Final report  

DOE Green Energy (OSTI)

Knowledge of the content of toxic components, so called pollutant precursors, in the municipal solid waste (MSW) stream is essential to development of the strategies for source reduction and reuse, recycling, composting and disposal. Data are scarce; trends in composition for any locality even more so. In a previous study the total and water soluble chlorine content of the components of municipal solid waste were determined from sampling studies at two sites, Baltimore County, MD, and Brooklyn, NY, each for a five day period. The total sulfur content of the combined combustible components was also determined. Because of the scarcity of data and synergistic effects, it seemed appropriate to determine the heavy metal content of the preceding material prior to its disposal. The metals chosen were the so-called priority pollutant metals (PPM): antimony, arsenic, beryllium, cadmium, chromium, copper, lead, mercury, nickel, selenium, silver, thallium, and zinc.

Churney, K.L.; Domalski, E.S.



Maglev guideway cost and construction schedule assessment  

SciTech Connect

A summary of construction cost and scheduling information is presented for four maglev guideway designs on an example route from Baltimore, MD to Newark, NJ. This work results from the National Maglev Initiative (NMI), a government-industry effort from 1989 to 1994. The system design concepts used as a basis for developing cost and construction scheduling information, were submitted by four industry consortia solely for this analysis, and represent their own unpublished designs. The detailed cost and construction schedule analyses cover the main guideway only. A summary estimate was made for stations, power distribution systems, maintenance facilities, and other types of infrastructure. The results of the analyses indicate a number of design aspects which must receive further consideration by future designers. These aspects will affect the practical and economic construction and long-term maintenance of a high-speed maglev guideway.

Plotkin, D.; Kim, S. [Army Construction Engineering Research Lab., Champaign, IL (United States)



SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Steam Coal Exports by Customs District" Steam Coal Exports by Customs District" "(short tons)" ,,,,"Year to Date" "Customs District","April - June","January - March","April - June",2013,2012,"Percent" ,2013,2013,2012,,,"Change" "Eastern Total",4951041,5566950,6554494,10517991,11407664,-7.8 " Baltimore, MD",1275530,831976,1715016,2107506,2852092,-26.1 " Boston, MA",7,"-",12,7,24,-70.8 " Buffalo, NY",1180,1516,2826,2696,5257,-48.7 " New York City, NY",3088,2664,2168,5752,6106,-5.8 " Norfolk, VA",3578715,4697769,4760354,8276484,8443756,-2 " Ogdensburg, NY",36894,3610,3090,40504,6838,492.3 " Philadelphia, PA",55513,29255,34241,84768,56733,49.4


Microsoft Word - A-14-09-29169 Final DOE Peer Review Ltr.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SOCIAL SECURITY SOCIAL SECURITY SOCIAL SECURITY ADMINISTRATION BALTIMORE, MD 21235-0001 March 5, 2010 MEMORANDUM FOR THE HONORABLE GREGORY H. FRIEDMAN INSPECTOR GENERAL DEPARTMENT OF ENERGY SUBJECT: Department of Energy Peer Review for the Fiscal Year Ending September 30, 2009 The attached report presents the results of our external quality control review of the Department of Energy, Office of Inspector General, Office of Audit Services. Your response to the draft report is included as Appendix B. We thank you and your staff for the assistance and cooperation provided during our review. If you have any questions or would like to discuss the report, please call me, or have your staff contact Steven L. Schaeffer, Assistant Inspector General for Audit, at


NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

12054 12054 Southern Research Institute FE ThermoChem Recovery International SCC/Crosscutting Research Div. FY14/ 10/1/13 - 9/30/14 Darryl T. Shockley Baltimore, MD High Hydrogen, Low Methane Syngas from Low Ranked Coals for Coal-to-Liquids Production Provide technical support to SRI for coal/biomass characterization and TRI gasifier design, catalyst development/evaluation, system configuration assessment, modeling, and a techno-economic analysis. Darryl T. Shockley Digitally signed by Darryl T. Shockley DN: cn=Darryl T. Shockley, o=NETL-DOE, ou=Advanced Energy Systems Division, email=darryl.shockley@netl.doe.gov, c=US Date: 2013.09.09 15:16:03 -04'00' 09 09 2013 John Ganz Digitally signed by John Ganz DN: cn=John Ganz, o=NETL, ou=ECD, email=john.ganz@netl.doe.gov, c=US


Low Dose Radiation Research Program: DOE Lowdose Radiation Program Workshop  

NLE Websites -- All DOE Office Websites (Extended Search)

Using a Low LET Electron Microbeam to Investigate Non-Targeted Using a Low LET Electron Microbeam to Investigate Non-Targeted Effects of Low Dose Radiation. Authors: William F. Morgan1 and Marianne B. Sowa2 Institutions: 1Radiation Oncology Research Laboratory, University of Maryland, Baltimore MD 21201 2 Chemical Structure and Dynamics, Pacific Northwest National Laboratory, Richland WA 99352 We have recently installed a low LET electron microbeam that generates energetic electrons to mimic radiation damage from gamma and x-ray sources. It has been designed such that high-energy electrons deposit energy in a pre-selected subset of cells leaving neighboring cells unirradiated (Figure 1). In this way it is possible to examine non-targeted effects associated with low dose radiation exposure including induced genomic instability and



NLE Websites -- All DOE Office Websites (Extended Search)

WUFI WUFI WUFI - Oak Ridge National Laboratory (ORNL)/Fraunhofer IBP is a menu-driven PC program which allows realistic calculation of the transient coupled one-dimensional heat and moisture transport in multi-layer building components exposed to natural weather. It is based on the newest findings regarding vapor diffusion and liquid transport in building materials and has been validated by detailed comparison with measurements obtained in the laboratory and on outdoor testing fields. Design Tool Software / Download Workshop Schedule WUFI Computer Modeling Workshop for Wall Design and Peformance, Baltimore, MD, August 26-27, 2013 WUFI-ORNL/WUFI Pro Workshop, Chicago, IL, March 26-27, 2013 WUFI 2D, Napa, CA, February 4-5, 2013 WUFI Plus, Napa, CA, January 30-February 1, 2013


Galactic scale gas flows in colliding galaxies: 3-Dimensional, N-body/hydrodynamics experiments  

NLE Websites -- All DOE Office Websites (Extended Search)

Galactic Scale Gas Flows in Colliding Galaxies: Galactic Scale Gas Flows in Colliding Galaxies: a-Dimensional, N-bodyjHydrodynamics Experiments Susan A. Lamb* NORDITA and Neils Bohr Institute, Blegdamsvej 17, DK-2100, Kpbenhaven 0, Danmark. Richard A. Gerber University of Illinois at Urbana-Champaign, Departments of Physics and Astronomy, 1110 W. Green Street, Urbana, IL 61801, U.S.A. and Dinshaw S. Balsara t Johns Hopkins University, Department of Physics and Astronomy, Homewood Campu.s, Baltimore, MD 21218, U.S.A. Abstract. We present some result.s from three dimensional computer simulations of collisions between models of equal mass gaJaxies, one of which is a rotating, disk galaxy containing both gas and stars and the other is an elliptical contaiuing stars only. We use fully self consistent models in which the


Directions | U.S. DOE Office of Science (SC)  

NLE Websites -- All DOE Office Websites (Extended Search)

Directions Directions Nuclear Physics (NP) NP Home About Staff Organization Chart .pdf file (32KB) NP Budget NP Committees of Visitors Directions Local Map Jobs Labs & Universities Nuclear Physics Related Brochures Research Facilities Science Highlights Benefits of NP Funding Opportunities Nuclear Science Advisory Committee (NSAC) News & Resources Contact Information Nuclear Physics U.S. Department of Energy SC-26/Germantown Building 1000 Independence Ave., SW Washington, DC 20585 P: (301) 903-3613 F: (301) 903-3833 E: sc.np@science.doe.gov More Information » About Directions Print Text Size: A A A RSS Feeds FeedbackShare Page Related Links View local map The DOE office in Germantown, MD are located northwest of Washington, DC. The region is served by 3 airports: BWI - Baltimore-Washington External link


Prevention of Low Dose Radiation-Induced Genomic Instability with Clinically Relevant Non-Protein Thiols and Vitamin E.  

NLE Websites -- All DOE Office Websites (Extended Search)

Prevention of Low Dose Radiation-Induced Genomic Instability with Clinically Relevant Prevention of Low Dose Radiation-Induced Genomic Instability with Clinically Relevant Non-Protein Thiols and Vitamin E. J.S. Murley 1 , Y. Kataoka 1 , W.F. Morgan 2 , and D.J. Grdina 1 . The University of Chicago, Chicago, IL 1 , The University of Maryland Medical School, Baltimore, MD 2 Induced or delayed radioprotection is a novel phenomenon that shares many similarities with the low dose radiation-induced radiobiological phenomenon referred to as the adaptive response. Induced or delayed radioprotection is defined as an enhancement in the radiation resistance of cells at long times following their exposure to non-protein thiols (NPT) such as WR1065, the free thiol form of amifostine. This effect is the result of the induction of a cascade of intracellular


570 / Scholarships, Fellowships, Awards, and Prizes Need-Based Scholarships and Loans  

E-Print Network (OSTI)

a resident of Baltimore. Scholarships, Fellowships, Awards, and Prizes Provided through Gifts by Alumni, and Prizes / 571 Baltimore Orioles Scholarship. Established in 1978 by the Baltimore Orioles Foundation who has been employed by the Baltimore and Ohio Railroad or the Chesapeake and Ohio Railroad

Niebur, Ernst


printable maps and directions  

Science Conference Proceedings (OSTI)

Cleveland. Rochester. Buffalo. Pittsburgh. Charleston. Wheeling. Baltimore. Detroit. Louisville. Washington DC. New York. Columbus. Philadelphia. Richmond.


Sustainability Assessment of Workforce Well-Being and Mission Readiness  

Energy.gov (U.S. Department of Energy (DOE))

Presentation by Dr. Jodi Jacobsen, Associate Professor, University of Maryland, Baltimore 2008, September


Demonstration of Energy Savings of Cool Roofs  

E-Print Network (OSTI)

Philadelphia, Phoenix, and Washington DC/Baltimore. Sum totals for all 11 MSAs were: annual electricity

Konopacki, S.



The Instrument Development Group MACS Detector System ...  

Science Conference Proceedings (OSTI)

Page 1. The Instrument Development Group Bloomberg Center for Physics & Astronomy · Johns Hopkins University · Baltimore · Maryland ...



Double Crystal Analyzer System  

Science Conference Proceedings (OSTI)

... 2002 Page 2. Bloomberg Center for Physics & Astronomy • Johns Hopkins University • Baltimore • Maryland MACS Double ...



Human radiation studies: Remembering the early years. Oral history of Dr. Nadine Foreman, M.D., August 19, 1994  

SciTech Connect

Dr. Nadine Foreman was interviewed by representatives of the US DOE Office of Human Radiation Experiments (OHRE). Dr. Foreman was selected for interview because of the position she held at the University of California, San Francisco. Following a brief biographical sketch, Dr. Foreman describes her work with Dr. Mayo Soley using I-131 in treatment of hyperthyroidism, selection criteria for patients in the radioiodine project, work with Dr. Earl Miller, work at Highland Hospital, radioiodine treatment of diffuse toxic goiter (myxedema), the radiophosphorus and radioiodine programs with Dr. Bert Low-Beer, and treatment of polycythemia vera.



Human radiation studies: Remembering the early years. Oral history of Oncologist Helen Vodopick, M.D., December 28, 1994  

SciTech Connect

This report is a transcript of an interview with Dr. Helen Vodopick by representatives of the US DOE Office of Human Radiation Experiments. Dr. Vodopick was chosen for this interview because of her involvement with the Oak Ridge Institute of Nuclear Studies (ORINS) and Oak Ridge Associated Universities (ORAU) experimental cancer-therapy program involving total-body irradiation. After a short biographical sketch Dr. Vodopick relates her remembrances of the Medium-Exposure-Rate Total Body Irradiator (METBI), ORINS radioisotope tracer studies, treatment of cancer patients with the METBI, radiation treatment for leukemia patients, bone marrow treatment of leukemia, the Low-Exposure-Rate Total Body Irradiation (LETBI), treatment of radiation accident victims at ORAU, research with radioactive phosphorus and sulfur, and public opinion issues.



Curriculum Vitae Bengt B. Arnetz, M.D., Ph.D., M.P.H, M.Sc.Epi, FACOEM  

E-Print Network (OSTI)

and Safety and Organizational Health Psychology, respectively 08-ong: Part of committee proposing a major

Dasgupta, Dipankar

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Human radiation studies: Remembering the early years. Oral history of Dr. George Voelz, M.D., November 29, 1994  

SciTech Connect

Dr. George Voelz was interviewed by representatives of the US DOE Office of Human Radiation Experiments (OHRE). This oral history covers Dr. Voelz`s research on Manhattan Engineering District plutonium workers, the acute and long term effects of radiation, his inhalation studies, and his activities at the 1961 INL reactor accident (SL-1 Reactor). After a brief biographical sketch, Dr. Voelz his remembrances on tissue studies of plutonium workers, the plutonium injection studies of 1945-1946, the controlled environmental radioiodine tests of 1963-1968, and tracer studies with human volunteers at Los Alamos. Dr. Voelz states his opinions concerning misconceptions about the Los Alamos Human Radiation Experiments.



Human radiation studies: Remembering the early years. Oral history of hematologist Karl F. Hubner, M.D., December 30, 1994  

SciTech Connect

This report is a transcript of an interview of Dr. Karl F. Hubner by representatives of the US DOE Human Radiation Experiments. Dr. Hubner was selected for this interview because of his participation in the Oak Ridge Institute of Nuclear Studies(ORINS)/Oak Ridge Associated Universities(ORAU) Medical Division cancer therapy research program involving total body irradiation. After a short biographical sketch Dr. Hubner discusses his research in Bone Marrow Transplants, his participation in the development of Nuclear Medicine in Oak Ridge, use of the total body irradiation machine at the University of Tennessee School of Agriculture Animal Research Laboratory (later the Comparative Animal Research Laboratory or CARL) to deliver a high enough dose rate to destroy a patients immune system, the operation of a sterile environment for recovery of patients following bone- marrow transplantation, and the closing of the ORAU Medical Division`s Clinical Program following a negative review. Finally, Dr. Hubner describes his later research using PET.




E-Print Network (OSTI)

The license renewal application (LRA) was submitted pursuant to Title 10 of the Code of Federal Regulations Part 54, "Requirements for Renewal of Operating Licenses for Nuclear Power Plants. " The staff determined that the LRA was complete and acceptable for docketing on September 25,2008. The staff has reviewed the KPS LRA and has developed the enclosed "Safety Evaluation Report With Open Items related to the License Renewal of the Kewaunee Power Station," hereinafter referred to as the Safety Evaluation Report (SER). This SER reflects the status of the staff's review of the LRA, requests for additional information (RAts), the applicant's responses to the staff's RAls, and other questions related to the LRA through March 26, 2010, unless otherwise noted. Issuance of the enclosed SER is an important milestone for both the applicant and the staff. The staff has identified four open items in its review which must be resolved before it can make a final determination on the application. SER Section 1.5 includes a listing of the open items with a summary of the information required to satisfactorily resolve the issues. In order to resolve these items, the staff has requested additional information, as identified in the SER.

United States; Mr. David; A. Heacock; Dear Mr. Heacock



Fusion Simulation Project. Workshop sponsored by the U.S. Department of Energy Rockville, MD, May 16-18, 2007  

Science Conference Proceedings (OSTI)

The mission of the Fusion Simulation Project is to develop a predictive capability for the integrated modeling of magnetically confined plasmas. This FSP report adds to the previous activities that defined an approach to integrated modeling in magnetic fusion. These previous activities included a Fusion Energy Sciences Advisory Committee panel that was charged to study integrated simulation in 2002. The report of that panel [Journal of Fusion Energy 20, 135 (2001)] recommended the prompt initiation of a Fusion Simulation Project. In 2003, the Office of Fusion Energy Sciences formed a steering committee that developed a project vision, roadmap, and governance concepts [Journal of Fusion Energy 23, 1 (2004)]. The current FSP planning effort involved forty-six physicists, applied mathematicians and computer scientists, from twenty-one institutions, formed into four panels and a coordinating committee. These panels were constituted to consider: Status of Physics Components, Required Computational and Applied Mathematics Tools, Integration and Management of Code Components, and Project Structure and Management. The ideas, reported here, are the products of these panels, working together over several months and culminating in a three-day workshop in May 2007.




Fusion Simulation Project. Workshop Sponsored by the U.S. Department of Energy, Rockville, MD, May 16-18, 2007  

Science Conference Proceedings (OSTI)

The mission of the Fusion Simulation Project is to develop a predictive capability for the integrated modeling of magnetically confined plasmas. This FSP report adds to the previous activities that defined an approach to integrated modeling in magnetic fusion. These previous activities included a Fusion Energy Sciences Advisory Committee panel that was charged to study integrated simulation in 2002. The report of that panel [Journal of Fusion Energy 20, 135 (2001)] recommended the prompt initiation of a Fusion Simulation Project. In 2003, the Office of Fusion Energy Sciences formed a steering committee that developed a project vision, roadmap, and governance concepts [Journal of Fusion Energy 23, 1 (2004)]. The current FSP planning effort involved forty-six physicists, applied mathematicians and computer scientists, from twenty-one institutions, formed into four panels and a coordinating committee. These panels were constituted to consider: Status of Physics Components, Required Computational and Applied Mathematics Tools, Integration and Management of Code Components, and Project Structure and Management. The ideas, reported here, are the products of these panels, working together over several months and culminating in a three-day workshop in May 2007.

Kritz, A.; Keyes, D.



Journd of ExpnmenW R x h o l w H u m mqxm md worrmnc~  

E-Print Network (OSTI)

Bludworth Island (created marsh); d, Mesquite Bay; ANWR, Aransas National Wildlife Refuge. 459S.C. Zeug et and nonvegetated habitats in ANWR from 100 1-m2 drop samples and our sample size (18 per marsh) appeared ad- equate) 457e466 #12;(Grus americana) that over-winter at ANWR and forage for blue crabs in adjacent marsh

Cosmides, Leda


R terence Fila MD. -f--"'<-..:II~--+-150FORESTRY SC;E;~G[S !..I8;'~AP  

E-Print Network (OSTI)

, California 94701 Aerial Survey of Insect-Caused Mortality . .. ABSTRACT: An Aerial survey using an operation severa.! STEVEN L.WERT BRUCE ROETTGERING In fall 1966, we made a rapid and inexpensive aerial survey over useful in making aerial surveys over large, in- accessible areas in the Eastern United States. 1 Data

Standiford, Richard B.


Human radiation studies: Remembering the early years: Oral history of pathologist Clarence Lushbaugh, M.D., conducted October 5, 1994  

SciTech Connect

This report provides a transcript of an interview with Dr. Clarance Lushbaugh by representatives of the DOE Office of Human Radiation Experiments. Dr. Lushbaugh was chosen for this interview because of his research involving experimental use of irradiation with human beings at Los Alamos and at the Oak Ridge Institute of Nuclear Science (ORINS). After a brief biographical sketch Dr. Lushbaugh and his assistant Mrs. Ann Swipe defend their use of total body irradiation using the LETBI (Low Exposure Total Body Irradiation) and the LETBI (Medium Energy Total Body Irradiator). Dr. Lushbaugh also discusses his earlier experiments involving use of nitrogen mustards in chemotherapy application, his early interest in the LD50 for man, his early impressions of low-level spray radiation as introduced by Heubline, anedotal information for his duties a pathologist for Los Alamos, and his developing interest in establishing safer radiation limits for human exposure.



Argonne PowerPoint Presentation  

NLE Websites -- All DOE Office Websites (Extended Search)

Lr 256 No 255 Md 257 Fm 256 Md 258 Fm 257 Md 259 Md 260 Fm 258 Fm 259 Md 256 Fm 255 Md 253 Fm 252 Md 252 Fm 251 Md 255 Fm 254 Md 254 Fm 253 Es 255 Es 256 Es 254 Es 251 Es 250 Es...


Utility-Scale Smart Meter Deployments, Plans & Proposals  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

edisonfoundation.net/IEE edisonfoundation.net/IEE Utility-Scale Smart Meter Deployments, Plans & Proposals April 2010 Utility State Target Number of Meters Notes Resources AEP 1 IN, KY, MI, OH, OK, TX, VA, WV 5,000,000 AEP plans on deploying smart meters to all customers within their service territory and have deployed 10,000 meters to customers in South Bend, IN, and are presently deploying another 700,000 to AEP-Texas customers. Timing for the remaining deployments will depend on specific conditions in each of the seven operating company subsidiaries. AEP Corporate Sustainability Report 2009 2 Allegheny Power MD, PA, WV 700,000 Allegheny launched pilots in Morgantown, WV and Urbana, MD to test smart meters and thermostats (1,140 meters installed). In PA, Act 129 (2008)


Better Buildings Neighborhood Program: Communities Throughout Oregon  

NLE Websites -- All DOE Office Websites (Extended Search)

Communities Communities Throughout Oregon to someone by E-mail Share Better Buildings Neighborhood Program: Communities Throughout Oregon on Facebook Tweet about Better Buildings Neighborhood Program: Communities Throughout Oregon on Twitter Bookmark Better Buildings Neighborhood Program: Communities Throughout Oregon on Google Bookmark Better Buildings Neighborhood Program: Communities Throughout Oregon on Delicious Rank Better Buildings Neighborhood Program: Communities Throughout Oregon on Digg Find More places to share Better Buildings Neighborhood Program: Communities Throughout Oregon on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO


Better Buildings Neighborhood Program: Indianapolis, Indiana  

NLE Websites -- All DOE Office Websites (Extended Search)

Indianapolis, Indianapolis, Indiana to someone by E-mail Share Better Buildings Neighborhood Program: Indianapolis, Indiana on Facebook Tweet about Better Buildings Neighborhood Program: Indianapolis, Indiana on Twitter Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Google Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Delicious Rank Better Buildings Neighborhood Program: Indianapolis, Indiana on Digg Find More places to share Better Buildings Neighborhood Program: Indianapolis, Indiana on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC


Hydrogen Storage in Metal-Organic Frameworks - DOE Hydrogen and Fuel Cells Program FY 2012 Annual Progress Report  

NLE Websites -- All DOE Office Websites (Extended Search)

7 7 FY 2012 Annual Progress Report DOE Hydrogen and Fuel Cells Program Jeffrey Long (Primary Contact), Martin Head-Gordon Lawrence Berkeley National Laboratory 1 Cyclotron Road Berkeley, CA 95720 Phone: (510) 642-0860 Email: jrlong@berkeley.edu DOE Managers HQ: Ned Stetson Phone: (202) 586-9995 Email: Ned.Stetson@ee.doe.gov GO: Jesse Adams Phone: (720) 356-1421 Email: Jesse.Adams@go.doe.gov Subcontractors: * National Institute of Standards and Technology, Gaithersburg, MD (Craig Brown) * General Motors Corporation, Warren, MI (Anne Dailly) Project Start Date: April 1, 2012 Project End Date: March 31, 2015 Fiscal Year (FY) 2012 Objectives


Better Buildings Neighborhood Program: Fayette County, Pennsylvania  

NLE Websites -- All DOE Office Websites (Extended Search)

Fayette Fayette County, Pennsylvania to someone by E-mail Share Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Facebook Tweet about Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Twitter Bookmark Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Google Bookmark Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Delicious Rank Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Digg Find More places to share Better Buildings Neighborhood Program: Fayette County, Pennsylvania on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO


Better Buildings Neighborhood Program: Better Buildings Partners  

NLE Websites -- All DOE Office Websites (Extended Search)

Better Better Buildings Partners to someone by E-mail Share Better Buildings Neighborhood Program: Better Buildings Partners on Facebook Tweet about Better Buildings Neighborhood Program: Better Buildings Partners on Twitter Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Google Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Delicious Rank Better Buildings Neighborhood Program: Better Buildings Partners on Digg Find More places to share Better Buildings Neighborhood Program: Better Buildings Partners on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY


Better Buildings Neighborhood Program: Bainbridge Island, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Bainbridge Bainbridge Island, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Bainbridge Island, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Bainbridge Island, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Bainbridge Island, Washington on Google Bookmark Better Buildings Neighborhood Program: Bainbridge Island, Washington on Delicious Rank Better Buildings Neighborhood Program: Bainbridge Island, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Bainbridge Island, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO


Better Buildings Neighborhood Program: Jacksonville, Florida  

NLE Websites -- All DOE Office Websites (Extended Search)

Jacksonville, Jacksonville, Florida to someone by E-mail Share Better Buildings Neighborhood Program: Jacksonville, Florida on Facebook Tweet about Better Buildings Neighborhood Program: Jacksonville, Florida on Twitter Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Google Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Delicious Rank Better Buildings Neighborhood Program: Jacksonville, Florida on Digg Find More places to share Better Buildings Neighborhood Program: Jacksonville, Florida on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC


Megatons to Megawatts Final Shipment | National Nuclear Security...  

National Nuclear Security Administration (NNSA)

Megawatts Program, with this week's off-loading of the final shipment of low enriched uranium (LEU) at the Port of Baltimore in Baltimore, Maryland, from Russia. Facebook Twitter...


Under U.S.-Russia Partnership, Final Shipment of Fuel Converted...  

National Nuclear Security Administration (NNSA)

Megawatts Program, with this week's off-loading of the final shipment of low enriched uranium (LEU) at the Port of Baltimore in Baltimore, Maryland, from Russia. The shipment was...


Section 48  

NLE Websites -- All DOE Office Websites (Extended Search)

5 Raman Lidar Measurements of Aerosols and Water Vapor S.H. Melfi University of Maryland - Baltimore County Baltimore, Maryland R.A. Ferrare and K.D. Evans Hughes STX, Lanham,...

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



NLE Websites -- All DOE Office Websites (Extended Search)

Determination of Cloud Base Height Using the GSFC Raman Lidar B. B. Demoz, K. D. Evans, M. Cadirola, and S. H. Melfi University of Maryland, Baltimore County Baltimore, Maryland D....



Gasoline and Diesel Fuel Update (EIA)

2000 2000 Southern California Gas Co ..................... CA 251,452,001 8.32 Nicor Gas ................................................. IL 221,009,522 6.68 Pacific Gas and Elec Co........................... CA 211,181,852 7.98 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 184,692,129 7.53 Consumers Energy Co ............................. MI 176,663,600 4.76 Michigan Consol Gas Co.......................... MI 136,124,328 5.41 Keyspan Energy Del Co ........................... NY 134,055,940 10.75 Pub Svc Elec and Gas Co........................ NJ 132,611,115 6.32 East Ohio Gas Co .................................... OH 131,187,521 7.49 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 130,622,887 8.82 Peoples Gas Lt and Coke Co................... IL 103,856,141 8.60 Pub Svc Co of Colorado...........................



Gasoline and Diesel Fuel Update (EIA)

Energy Information Administration / Natural Gas Annual 1999 Southern California Gas Co ..................... CA 275,767,714 6.50 Pacific Gas and Elec Co........................... CA 234,195,449 6.61 Nicor Gas ................................................. IL 211,147,988 4.71 Consumers Energy Co ............................. MI 167,318,229 4.89 Michigan Consol Gas Co.......................... MI 134,432,032 5.42 Pub Svc Elec and Gas Co........................ NJ 133,426,119 6.86 East Ohio Gas Co .................................... OH 127,141,913 5.81 Keyspan Energy Del Co ........................... NY 125,709,092 9.79 Columbia Gas Dist Co.............................. KY,PA,MD,OH 121,011,064 7.32 Peoples Gas Lt and Coke Co................... IL 98,758,164 6.77 Pub Svc Co of Colorado........................... CO 84,115,032 5.28



Gasoline and Diesel Fuel Update (EIA)

3 3 Northern Illinois Gas Co ........................... IL 241,353,299 5.25 Southern California Gas Co ..................... CA 237,581,205 7.28 Pacific Gas and Elec Co........................... CA 191,919,171 6.12 Consumers Pwr Co .................................. MI 178,690,154 4.80 Columbia Gas Dist Co.............................. OH,KY,PA,MD 178,512,589 7.64 Michigan Consol Gas Co.......................... MI 152,111,213 5.59 East Ohio Gas Co .................................... OH 147,197,186 6.36 Pub Svc Elec and Gas Co........................ NJ 138,404,765 7.58 Peoples Gas Lt and Coke Co................... IL 113,561,765 6.96 Lone Star Gas Co..................................... TX 100,079,759 6.13 Atlanta Gas Lt Co ..................................... GA 96,381,162 7.41 Brooklyn Union Gas Co............................


Pub Svc Elec  

Gasoline and Diesel Fuel Update (EIA)

Pub Pub Svc Elec and Gas Co......................... NJ 81,712,678 5.82 Columbia Gas Dist Co............................... OH,KY,PA,MD 76,048,915 5.95 Con Edison Co. of New York Inc............... NY 69,809,658 5.99 Consumers Pwr Co ................................... MI 58,661,306 4.46 Pacific Gas and Elec Co............................ CA 57,793,522 5.67 Minnegasco ............................................... MN 57,154,912 4.57 Southern California Gas Co ...................... CA 54,772,058 6.16 Michigan Consol Gas Co........................... MI 53,635,433 5.16 Entex Div of Noram Energy Corp.............. LA,TX,MS 49,485,836 4.80 Northern Illinois Gas Co ............................ IL 48,165,624 4.62 Pub Svc Co. of Colorado........................... CO 47,339,959 3.51 Atlanta Gas Lt Co ......................................



Gasoline and Diesel Fuel Update (EIA)

8 8 Southern California Gas Co ..................... CA 269,739,909 7.31 Pacific Gas and Elec Co........................... CA 224,402,286 6.32 Northern Illinois Gas Co ........................... IL 196,608,329 4.63 Consumers Pwr Co .................................. MI 153,128,350 4.92 Columbia Gas Dist Co.............................. OH,KY,PA,MD 138,064,908 7.21 Pub Svc Elec and Gas Co........................ NJ 126,142,540 6.61 Michigan Consol Gas Co.......................... MI 125,456,377 5.35 East Ohio Gas Co .................................... OH 117,574,196 6.21 Peoples Gas Lt and Coke Co................... IL 89,685,006 6.81 Atlanta Gas Lt Co ..................................... GA 89,103,601 6.69 Lone Star Gas Co..................................... TX 84,559,915 5.95 Brooklyn Union Gas Co............................ NY


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office


Northern Illinois Gas Co IL  

Gasoline and Diesel Fuel Update (EIA)

Northern Northern Illinois Gas Co ............................ IL 254,574,988 4.60 Southern California Gas Co ...................... CA 233,632,354 6.89 Columbia Gas Dist Co............................... OH,KY,PA,MD 196,322,935 6.64 Pacific Gas and Elec Co............................ CA 190,864,262 5.83 Consumers Pwr Co ................................... MI 188,587,672 4.81 Michigan Consol Gas Co........................... MI 160,809,168 5.16 East Ohio Gas Co ..................................... OH 146,802,045 5.44 Pub Svc Elec and Gas Co......................... NJ 140,712,209 6.62 Peoples Gas Lt and Coke Co.................... IL 126,356,925 6.40 Brooklyn Union Gas Co............................. NY 106,349,594 9.43 Atlanta Gas Lt Co ...................................... GA 106,075,815 6.66 Lone Star Gas Co......................................



Gasoline and Diesel Fuel Update (EIA)

5 5 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 138,239,378 5.94 Pub Svc Elec and Gas Co........................ NJ 69,738,220 5.26 Southern California Gas Co ..................... CA 63,758,073 7.26 Pacific Gas and Elec Co........................... CA 58,646,965 7.84 Keyspan Energy Del Co ........................... NY 53,501,565 7.32 Consumers Energy Co ............................. MI 51,663,333 4.26 TXU Gas Distribution................................ TX 48,112,344 5.86 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 45,021,338 7.87 Con Edison Co of New York Inc............... NY 44,076,359 8.02 Michigan Consol Gas Co.......................... MI 40,342,797 5.39 Pub Svc Co of Colorado........................... CO 39,697,152 5.22 East Ohio Gas Co ....................................



Gasoline and Diesel Fuel Update (EIA)

4 4 Con Edison Co. of New York Inc.............. NY 88,830,005 5.25 Pub Svc Elec and Gas Co........................ NJ 70,705,783 5.28 Columbia Gas Dist Co.............................. OH,KY,PA,MD 63,746,659 7.11 Southern California Gas Co ..................... CA 57,000,043 6.63 Minnegasco .............................................. MN 55,213,151 4.69 Pacific Gas and Elec Co........................... CA 54,854,821 6.15 Entex Div of Noram Energy Corp ............. LA,MS,TX 51,551,370 5.31 Consumers Pwr Co .................................. MI 50,657,354 4.44 Michigan Consol Gas Co.......................... MI 50,589,626 5.55 Northern Illinois Gas Co ........................... IL 47,159,304 5.26 Pub Svc Co. of Colorado.......................... CO 46,479,502 3.88 East Ohio Gas Co .................................... OH 41,561,614 5.92



Gasoline and Diesel Fuel Update (EIA)

3 3 Con Edison Co of New York Inc............... NY 102,311,001 3.84 Pub Svc Elec and Gas Co........................ NJ 73,839,186 3.05 Southern California Gas Co ..................... CA 62,380,076 5.55 Pacific Gas and Elec Co........................... CA 58,692,831 6.82 Keyspan Energy Del Co ........................... NY 53,162,984 6.07 Minnegasco .............................................. MN 52,910,769 4.25 Entex Div of Noram Energy Corp ............. TX,LA,MS 47,337,378 4.81 Lone Star Gas Co..................................... TX 45,843,050 4.67 Consumers Energy Co ............................. MI 45,391,308 4.50 Michigan Consol Gas Co.......................... MI 41,336,416 5.38 Pub Svc Co of Colorado........................... CO 39,230,403 4.47 Columbia Gas Dist Co.............................. KY,PA,MD,OH 35,550,535 6.78


Brigham Young University Geology Studies Volume 30, Part 1  

E-Print Network (OSTI)

hear the Baltimore oriole saying "here, here, come right here, dear" and the yel- lowhammer saying "a

Seamons, Kent E.


Quest Hotel and Travel  

Science Conference Proceedings (OSTI)

... Waterfront. They serve BWI Airport/Amtrak, Penn Station Baltimore, Reagan National Airport and Dulles Airport. Airport ...



Journal of Research Volume 95  

Science Conference Proceedings (OSTI)

... at the US Environmental Protection Agency, p ... on Fifty Years With Nuclear Fission - Washington ... National Computer Security Conference - Baltimore ...



Energy Efficiency Improvement and Cost Saving Opportunities for the Petrochemical Industry - An ENERGY STAR(R) Guide for Energy and Plant Managers  

E-Print Network (OSTI)

of Baltimore by using landfill gas (methane) to co-generateIt involves using landfill gas (methane) currently being

Neelis, Maarten



MCSD Yearly Report -- FY 2000  

Science Conference Proceedings (OSTI)

... a Digital Mathematical Library for Science ... Technology Advances in Digital Libraries, Baltimore, May ... Editors, Proceedings of SPIE The International ...



EDITOR'S NOTE: In the Company of Broad Minds Jeremy Pope, JHU PhD Candidate in Egyptology, Dept. of Near Eastern Studies  

E-Print Network (OSTI)

Baltimore Oral History Project continues to produce some extraordinary student pa- pers, while Dr. Moira Hinderer continues to amaze with her cataloguing and selective digitizing of the archives of the Baltimore to the Johns Hopkins University Home- wood Campus and the wider Baltimore community. We remain extremely proud

Niebur, Ernst


Academic Catalog carey.jhu.edu 1  

E-Print Network (OSTI)

on the Homewood campus in northern Baltimore . The Carey Business School's faculty, administrative staff, and many of its programs are located in Baltimore . Programs are also offered at campus locations in Columbia campus in East Baltimore, along with The Johns Hopkins Hospital, a separate but closely allied

Niebur, Ernst


Bryant fall 2010 FC fall 2010a Bryant Unive rsity resoU rce fo r P ro fessional sUccess  

E-Print Network (OSTI)

the transportation routes for hazardous materials in the state of Alabama. The Baltimore train derailment and tunnel derailment and fire that occurred in Baltimore's Howard Street tunnel served as a powerful reminder of all major roads into Baltimore, necessitated the evacuation of the city's baseball stadium, forced

Blais, Brian


LCLS Operating Schedule  

NLE Websites -- All DOE Office Websites (Extended Search)

LCLS Operating Schedule LCLS Operating Schedule August - December 2009 Ver: 2 10/30/09 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 S Su M T W Th F S Su M T W Th F S Su M T W Th F S Su M T W Th F S Su M 0000-0800 MD MD MD MD MD 0800-1600 ROD MD AMO ROD MD AMO 1600-2400 MD MD Commissioning MD MD Comm. 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 T W Th F S Su M T W Th F S Su M T W Th F S Su M T W Th F S Su M T W 0000-0800 MD MD MD MD MD MD MD MD MD 0800-1600 MD ROD AMO MD ROD AMO MD ROD AMO MD ROD AMO ROD 1600-2400 MD MD Commissioning MD MD Commissioning MD MD Commissioning MD MD Commissioning MD 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 Th F S Su M T W Th F S Su M T W Th F S Su M T W Th F S Su M T W Th F S 0000-0800 MD MD MD MD MD MD MD MD MD 0800-1600 Young MD ROD DiMauro MD ROD Berrah MD ROD Coffee MD ROD Young-II 1600-2400 L018 MD MD L026 MD MD L015 MD MD L027 MD MD L017 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 Su

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energy’s National Nuclear ...


May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George


UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...


Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clément Jamin; Pierre-Marie Gandoin; Samir Akkouche



LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energy’s National Nuclear Security Administration. SAND # 2013-10084P


Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer


Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.



Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas



Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan



"Orgulloso de mi Caserío y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetón  

E-Print Network (OSTI)

Puertorriqueña. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel



"Orgulloso de mi Caserío y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetón.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetón. Based on ethnographic and archival research in San Juan, Puerto Rico,… (more)

Rivera, Petra Raquel



Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois


"Orgulloso de mi Caserío y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetón  

E-Print Network (OSTI)

May ________. “A vistas la pornografía. ” Primera Hora, 22la medida contra la pornografía. ” El Nuevo Día, 13 Junecomunicación contra la pornografía. ” El Nuevo Día, 16 May

Rivera, Petra Raquel



Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.


Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural



Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration


Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.



Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."



Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of


Superfund record of decision (EPA Region 3): Aberdeen Proving Ground, Carroll Island, Edgewood Area Operable Unit A, Aberdeen Proving Ground, MD, September 30, 1996  

SciTech Connect

This Record of Decision (ROD) document presents the selected remedial action to reduce the risks posed by the disposal pits/areas in 13 sites and Areas of Concern (AOCs) located at Carroll Island in the Edgewood Area of APG, Maryland. The major components of the selected remedy for Operable Unit A include hand excavation of the waste in the disposal pits/areas and segregation and disposal or treatment of excavated waste.




Human radiation studies: Remembering the early years: Oral history of radiologist Hymer L. Friedell, M.D., Ph.D., conducted January 28, 1995  

SciTech Connect

NThis report is a transcript of an interview with Hymer L. Friedell by representatives of the US DOE Office of Human Radiation Experiments. Dr. Friedell was selected for this interview because of his participation in the early stages of the medical use of radioisotopes, his important role in the Manhattan Engineer District Medical Division, and his distinguished medical career and his involvement in the distribution of isotopes and the approval for their use in humans. After a brief biographical sketch Dr. Friedell discusses his remembrances on a wide range of subjects. Topics discussed include pre-war radiation therapy, information provided to patients, the Army Medical Corps and the Manhattan Project, his work at the Chicago Metallurgical Laboratory, inspection visits of Manhattan Project facilities and proposed sites, Plutonium injection studies, and actions of the AEC Isotope Distribution Committee.

Fisher, D.; Melamed, E.



Heat Capacity Effects Associated with the Hydrophobic Hydration and Interaction of Simple Solutes: A Detailed Structural and Energetical Analysis Based on MD Simulations  

E-Print Network (OSTI)

We examine the SPCE and TIP5P water models to study heat capacity effects associated with the hydrophobic hydration and interaction of Xenon particles. We calculate the excess chemical potential for Xenon employing the Widom particle insertion technique. The solvation enthalpy and excess heat capacity is obtained from the temperature dependence of the chemical potentials and, alternatively, directly by Ewald summation, as well as a reaction field based method. All three different approaches provide consistent results. The reaction field method allows a separation of the individual components to the heat capacity of solvation into solute/solvent and solvent/solvent parts, revealing the solvent/solvent part as the dominating contribution. A detailed spacial analysis of the heat capacity of the water molecules around a pair of Xenon particles at different separations reveals that the enhanced heat capacity of the water molecules in the bisector plane between two Xenon atoms is responsible for the maximum of the heat capacity observed at the desolvation barrier, recently reported by Shimizu and Chan ({\\em J. Am. Chem. Soc.},{\\bf 123}, 2083--2084 (2001)). The about 60% enlarged heat capacity of water in the concave part of the joint Xenon-Xenon hydration shell is the result of a counterplay of strengthened hydrogen bonds and an enhanced breaking of hydrogen bonds with increasing temperature. Differences between the two models concerning the heat capacity in the Xenon-Xenon contact state are attributed to the different water model bulk heat capacities, and to the different spacial extension of the structure effect introduced by the hydrophobic particles. Similarities between the different states of water in the joint Xenon-Xenon hydration shell and the properties of stretched water are discussed.

Dietmar Paschek



Human radiation studies: Remembering the early years: Oral history of physician James S. Robertson, M.D., Ph.D., conducted January 20, 1995  

SciTech Connect

This report is a transcript of in interview of Dr. James S. Robertson by representatives of the DOE Office of Human Radiation Experiments. Dr. Robertson was chosen for this interview because of his research at Brookhaven National Laboratory, especially on Boron Neutron Capture Therapy (BNCT); his work at the United States Naval Defense Laboratory; and his work at the Atomic Energy Commission. After a brief biographical sketch Dr. Robertson discusses research on human subjects at Berkeley, his contributions to the beginnings of Neutron Capture Therapy at Brookhaven, his participation with the Brookhaven Human Use Committee, his involvement in the study of the effects of Castle Bravo event on the Marshallese, and his work with the Naval Radiological Defense Laboratory.



Human radiation studies: Remembering the early years. Oral history of Dr. John W. Gofman, M.D., Ph.D., December 20, 1994  

SciTech Connect

Dr. John W. Gofman was interviewed by representatives of US DOE Office of Human Radiation Experiments (OHRE) concerning his research at the University of California, Berkeley and his biomedical work at Lawrence Livermore Radiation Laboratory. Following a short biographical sketch, Dr. Gofman relates his remembrances with the discovery and chemistry of uranium-233, the Manhattan project, laboratory production of the first milligram of plutonium, pre-1945 medical use of high-dosage radiation, medical treatments with phosphorus 32, and fallout. Dr. Gofman also discusses his relationships with Professor Oppenheimer, Joe Hamilton, Ernest Lawrence, and other. Then Dr. Gofman describes his pioneering work on his true interests concerning heart disease, heparin, and lipoproteins. Finally intra-AEC political issues are discussed relating to testing of atomic weapons.



Human radiation studies: Remembering the early years: Oral history of radiologist Henry I. Kohn, M.D., Ph.D., conducted September 13, 1994  

SciTech Connect

This report is a transcript of an interview of Dr. Henry I. Kohn by representatives of the US DOE Office of Human Radiation Experiments. Dr. Kohn was selected for this interview because of the positions he held at Oak Ridge National Laboratory, University of California at San Francisco, and Harvard Medical School. Dr. Kohn discussed his remembrances of his experiences in blood chemistry of animals and patients exposed to radiation, and his remembrances of several radiobiologists.



DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256



Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EE0000097 EE0000097 Maryland Energy Administration EE PMC/IPOD 2009 Mr. George Darakos 2010 - 2012 4814 Seton Dr, Baltimore, MD 21215 Clean Energy Economic Development Initiative - BITHENERGY Inc - 4814 Seton Dr Project Involves 3 rooftop mounted units & 1 ground-mount system. Rooftop units will be located at 4814 Seton Dr. (132 kW),4815 Seton Dr. (105kW), and 4810 Seton Dr. (54kW). Ground-mount unit will provide 223 kW. 03 11 2011 George S. Darakos Digitally signed by George S. Darakos DN: cn=George S. Darakos, email=george.darakos@netl.doe.gov, o=U.S. Dept. Of Energy, NETL, l=Pittsburgh, PA Date: 2011.04.11 12:14:03 -04'00' 04 12 2011 Cliff Whyte Digitally signed by Cliff Whyte DN: cn=Cliff Whyte, o=US Dept of Energy, ou=NETL- OPFC, email=Cliff.Whyte@netl.doe.gov, c=US


Table 15. Metallurgical Coal Exports by Customs District  

U.S. Energy Information Administration (EIA) Indexed Site

Metallurgical Coal Exports by Customs District Metallurgical Coal Exports by Customs District (short tons) U.S. Energy Information Administration | Quarterly Coal Report, April - June 2013 Table 15. Metallurgical Coal Exports by Customs District (short tons) U.S. Energy Information Administration | Quarterly Coal Report, April - June 2013 Year to Date Customs District April - June 2013 January - March 2013 April - June 2012 2013 2012 Percent Change Eastern Total 11,716,074 14,136,513 15,167,377 25,852,587 27,578,514 -6.3 Baltimore, MD 2,736,470 4,225,450 5,123,600 6,961,920 9,037,970 -23.0 Boston, MA - - - - 28,873 - Buffalo, NY 247,714 121,347 524,040 369,061 725,698 -49.1 Norfolk, VA 8,730,257 9,784,866 9,519,119 18,515,123 17,784,479 4.1 Ogdensburg, NY 1,633 4,850 618 6,483 1,494 333.9 Southern Total 3,551,564 3,824,484

Note: This page contains sample records for the topic "md baltimore mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Table 20. Coal Imports by Customs District  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Imports by Customs District Coal Imports by Customs District (short tons) U.S. Energy Information Administration | Quarterly Coal Report, April - June 2013 Table 20. Coal Imports by Customs District (short tons) U.S. Energy Information Administration | Quarterly Coal Report, April - June 2013 Year to Date Customs District April - June 2013 January - March 2013 April - June 2012 2013 2012 Percent Change Eastern Total 469,878 331,008 156,004 800,886 350,124 128.7 Baltimore, MD - - 106,118 - 154,318 - Boston, MA 373,985 154,438 - 528,423 51,185 NM Buffalo, NY 44 - - 44 - - New York City, NY 1,373 1,402 487 2,775 507 447.3 Norfolk, VA - 68,891 - 68,891 35,856 92.1 Ogdensburg, NY - 1 12 1 12 -91.7 Portland, ME 42,428 44,547 - 86,975 - - Providence, RI 52,028 61,729 49,387 113,757 108,226 5.1 St. Albans, VT 20


Table 14. Steam Coal Exports by Customs District  

U.S. Energy Information Administration (EIA) Indexed Site

Steam Coal Exports by Customs District Steam Coal Exports by Customs District (short tons) U.S. Energy Information Administration | Quarterly Coal Report, April - June 2013 Table 14. Steam Coal Exports by Customs District (short tons) U.S. Energy Information Administration | Quarterly Coal Report, April - June 2013 Year to Date Customs District April - June 2013 January - March 2013 April - June 2012 2013 2012 Percent Change Eastern Total 4,951,041 5,566,950 6,554,494 10,517,991 11,407,664 -7.8 Baltimore, MD 1,275,530 831,976 1,715,016 2,107,506 2,852,092 -26.1 Boston, MA 7 - 12 7 24 -70.8 Buffalo, NY 1,180 1,516 2,826 2,696 5,257 -48.7 New York City, NY 3,088 2,664 2,168 5,752 6,106 -5.8 Norfolk, VA 3,578,715 4,697,769 4,760,354 8,276,484 8,443,756 -2.0 Ogdensburg, NY 36,894 3,610 3,090 40,504 6,838 492.3 Philadelphia, PA


Anthropogenic SO{sub 2}/NO{sub x} committee summary of current status--annual inventory  

SciTech Connect

At the First GEIA Workshop on Global Emissions Inventories, held in Baltimore, MD on December 1--2, 1991, data on anthropogenic emissions of sulfur and nitrogen developed by Dignon (1992) were selected to form the basis for the GEIA SO{sub 2} and NO{sub x} annual inventories. The Dignon data include emissions from fuel combustion only and currently extend to 1980. The methodology used was detailed in Dignon and Hameed (1985) and consists of statistical regression models based on available emissions data from the U.S and some other member countries of the Organization of Economic Cooperation and Development (OECD), which includes Australia, Canada, Japan and western European countries. Control regulations are incorporated via the use of different statistical parameter The grid definition from these inventories was also adopted for the GEIA grid: origin at 180{degree}W, 90{degree}S, 1{degree} {times} 1{degree} resolution (i.e., 360 cells in the longitude direction, 180 cells in the latitude direction). To upgrade the basic GEIA inventories, data for the different geographic regions being solicited from researchers located within these areas. This paper contains the upgrades which have been accomplished to date.

Benkovitz, C.M.



Integration of Molecular Networks in the Shoot Apical Meristem that Controls Floral Specification in Arabidopsis thaliana  

E-Print Network (OSTI)

lycopersicum_miR156b Solanum_lycopersicum_miR156c Sorghum_bicolor_miR156a Sorghum_bicolor_miR156b Sorghum_bicolor_miR156c Sorghum_

Lal, Shruti



Medical Facilities With Experience Evaluating CBD  

NLE Websites -- All DOE Office Websites (Extended Search)

Samantha Phone: 310-433-5342 Harborview Medical Center University of Washington Jordan Firestone, M.D.; Victor VanHee, M.D.; Szerre Vedal, M.D.; David Bonauto, M.D.; or June...


Diseases associated with hidranitis suppurativa: part 2 of a series on hidradenitis  

E-Print Network (OSTI)

2 of a series on hidradenitis Noah Scheinfeld MD DermatologyCorrespondence: Noah Scheinfeld MD: Scheinfeld@earthlink.net

Scheinfeld, Noah



Update on the treatment of genital warts  

E-Print Network (OSTI)

treatment of genital warts Noah Scheinfeld MD DermatologyCorrespondence: Noah Scheinfeld MD: Scheinfeld@earthlink.net

Scheinfeld, Noah




E-Print Network (OSTI)

Institute for Plasma Research, U. MD, College Park, MD 20742, USA c Plasma Science and Fusion Center, MIT


TREC-10 Video Track Proposal  

Science Conference Proceedings (OSTI)

... Systems Plus + Linguistic Data Consortium Rockville, MD # Dakota Consulting, Inc Silver Spring, MD ... Asia Europe North America South America ...



NIST Tech Beat - Feburary 2001  

Science Conference Proceedings (OSTI)

... an apparatus that shoots hot gases toward the device (convector heat). ... flames began spreading through the central business district, the Baltimore ...


CX-007027: Categorical Exclusion Determination | Department of...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Determination Pennsylvania 85% Ethanol Corridor Project - Lehigh Gas, Concordville Exxon Station (Baltimore Pike) CX(s) Applied: B5.1 Date: 09222011 Location(s): Glen Mills,...


Pennsylvania | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Determination Pennsylvania 85% Ethanol Corridor Project - Lehigh Gas, Concordville Exxon Station (Baltimore Pike) CX(s) Applied: B5.1 Date: 09222011 Location(s): Glen Mills,...


Property:Incentive/AddlPlaceCounty | Open Energy Information  

Open Energy Info (EERE)

AddlPlaceCounty AddlPlaceCounty Jump to: navigation, search Property Name Incentive/AddlPlaceCounty Property Type Page Pages using the property "Incentive/AddlPlaceCounty" Showing 25 pages using this property. (previous 25) (next 25) A Allegany County Wind Ordinance (Maryland) + Allegany County, Maryland + Anne Arundel County - Solar and Geothermal Equipment Property Tax Credit (Maryland) + Anne Arundel County, Maryland + Anne Arundel County - Wind Ordinance (Maryland) + Anne Arundel County, Maryland + B Baltimore County - Solar and Geothermal Equipment Property Tax Credit (Maryland) + Baltimore County, Maryland + Baltimore County - Wind Ordinance (Maryland) + Baltimore County, Maryland + Brownfield Development Tax Abatements (Alabama) + Alabama + C Calvert County - Wind Ordinance (Maryland) + Calvert County, Maryland +


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Russell-Story 10106 - 93009 1340 S. Baltimore St., Hanover, PA 17331 Pennsylvania E85 Corridor Project Conversion of existing gasoline pumps to E85 Ethanol. This includes...


Liberty but not License: Publicity, Academic Freedom, and the Professionalization of the Professoriate, 1890-1929  

E-Print Network (OSTI)

toward Unionization. ” Higher Education 6, no. 2 (1977):The Journal of Higher Education 59, no. 3 (1988): 241-History of American Higher Education. Baltimore and London:

Haberler, Zachary



The Waning of America's Higher Education Advantage: International Competitors Are No Longer Number Two and Have Big Plans in the Global Economy  

E-Print Network (OSTI)

is Local,” Higher Education Policy, forthcoming 2006. CSHEThe States and Public Higher Education Policy (Baltimore:Equity’ of American Higher Education,” The Review of Higher

Douglass, John Aubrey




Science Conference Proceedings (OSTI)

Oct 9, 2012... House3; Margaret Gillan1; Brad Arnold1; Lisa Kelly1; 1University of Maryland, Baltimore County; 2Northrop Grumman Corporation; 3URS


Rising From a Placid Lake: China's Three Gorges at the Intersection of History, Aesthetics and Politics  

E-Print Network (OSTI)

2005. Berry, Michael. A History of Pain: Trauma in ModernHo Revisited. Values and History in Chinese Painting, II:Dominick. Writing History, Writing Trauma. Baltimore: Johns

Byrnes, Corey J.



An assemblage of fragments : history, revolutionary aesthetics and global capitalism in Vietnamese/American literature, films and visual culture  

E-Print Network (OSTI)

Theses on the Philosophy of History,” Illuminations. Trans.Trauma, Narrative, and History. Baltimore and London: TheAsian American Art: A History, 1850-1970. Stanford: Stanford

Võ, Ch'o'ng-?ài H?òng



Optimal Real-time Dispatch for Integrated Energy Systems  

E-Print Network (OSTI)

62 Table 12. electricity rates for Baltimore,95 Table 13. electricity rates for Boston,95 Table 14. electricity rates for Houston,

Firestone, Ryan Michael
