National Library of Energy BETA

Sample records for mapping field sampling

  1. Field Sampling | Open Energy Information

    Open Energy Info (EERE)

    Field Mapping Hand-held X-Ray Fluorescence (XRF) Macrophotography Portable X-Ray Diffraction (XRD) Field Sampling Gas Sampling Gas Flux Sampling Soil Gas Sampling Surface Gas...

  2. Field Mapping | Open Energy Information

    Open Energy Info (EERE)

    Mapping Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Technique: Field Mapping Details Activities (74) Areas (44) Regions (6) NEPA(0) Exploration...

  3. Field Mapping At Salt Wells Area (Coolbaugh, Et Al., 2006) |...

    Open Energy Info (EERE)

    Basis Geochemical water sampling, mineral distribution mapping, and shallow (30 cm) temperature probe measurements were conducted to expand on a previous field mapping study...

  4. Pulsed field sample neutralization

    DOE Patents [OSTI]

    Appelhans, Anthony D.; Dahl, David A.; Delmore, James E.

    1990-01-01

    An apparatus and method for alternating voltage and for varying the rate of extraction during the extraction of secondary particles, resulting in periods when either positive ions, or negative ions and electrons are extracted at varying rates. Using voltage with alternating charge during successive periods to extract particles from materials which accumulate charge opposite that being extracted causes accumulation of surface charge of opposite sign. Charge accumulation can then be adjusted to a ratio which maintains a balance of positive and negative charge emission, thus maintaining the charge neutrality of the sample.

  5. Field Mapping (Healy, 1970) | Open Energy Information

    Open Energy Info (EERE)

    to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping (Healy, 1970) Exploration Activity Details Location Unspecified Exploration Technique...

  6. Visual Sample Plan (VSP) - FIELDS Integration

    SciTech Connect (OSTI)

    Pulsipher, Brent A.; Wilson, John E.; Gilbert, Richard O.; Hassig, Nancy L.; Carlson, Deborah K.; Bing-Canar, John; Cooper, Brian; Roth, Chuck

    2003-04-19

    Two software packages, VSP 2.1 and FIELDS 3.5, are being used by environmental scientists to plan the number and type of samples required to meet project objectives, display those samples on maps, query a database of past sample results, produce spatial models of the data, and analyze the data in order to arrive at defensible decisions. VSP 2.0 is an interactive tool to calculate optimal sample size and optimal sample location based on user goals, risk tolerance, and variability in the environment and in lab methods. FIELDS 3.0 is a set of tools to explore the sample results in a variety of ways to make defensible decisions with quantified levels of risk and uncertainty. However, FIELDS 3.0 has a small sample design module. VSP 2.0, on the other hand, has over 20 sampling goals, allowing the user to input site-specific assumptions such as non-normality of sample results, separate variability between field and laboratory measurements, make two-sample comparisons, perform confidence interval estimation, use sequential search sampling methods, and much more. Over 1,000 copies of VSP are in use today. FIELDS is used in nine of the ten U.S. EPA regions, by state regulatory agencies, and most recently by several international countries. Both software packages have been peer-reviewed, enjoy broad usage, and have been accepted by regulatory agencies as well as site project managers as key tools to help collect data and make environmental cleanup decisions. Recently, the two software packages were integrated, allowing the user to take advantage of the many design options of VSP, and the analysis and modeling options of FIELDS. The transition between the two is simple for the user – VSP can be called from within FIELDS, automatically passing a map to VSP and automatically retrieving sample locations and design information when the user returns to FIELDS. This paper will describe the integration, give a demonstration of the integrated package, and give users download

  7. Field Mapping At San Francisco Volcanic Field Area (Warpinski...

    Open Energy Info (EERE)

    Francisco Volcanic Field Area (Warpinski, Et Al., 2004) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At San Francisco Volcanic...

  8. Appendix A, Field Sampling Data and Appendix B, Field Reduced...

    Energy Savers [EERE]

    A, Field Sampling Data and Appendix B, Field Reduced Data Appendix A, Field Sampling Data and Appendix B, Field Reduced Data Docket No. EO-05-01: Appendix A, Field Sampling Data ...

  9. Field Mapping (Monaster And Coolbaugh, 2007) | Open Energy Information

    Open Energy Info (EERE)

    Technique Field Mapping Activity Date Usefulness useful DOE-funding Unknown Notes Digital field mapping. References Francis C. Monastero, Mark F. Coolbaugh (2007) Advances In...

  10. Field Mapping At Olowalu-Ukumehame Canyon Area (Thomas, 1986...

    Open Energy Info (EERE)

    Mapping At Olowalu-Ukumehame Canyon Area (Thomas, 1986) Exploration Activity Details Location Olowalu-Ukumehame Canyon Area Exploration Technique Field Mapping Activity Date...

  11. Modular Automated Processing System (MAPS) for analysis of biological samples.

    SciTech Connect (OSTI)

    Gil, Geun-Cheol; Chirica, Gabriela S.; Fruetel, Julia A.; VanderNoot, Victoria A.; Branda, Steven S.; Schoeniger, Joseph S.; Throckmorton, Daniel J.; Brennan, James S.; Renzi, Ronald F.

    2010-10-01

    We have developed a novel modular automated processing system (MAPS) that enables reliable, high-throughput analysis as well as sample-customized processing. This system is comprised of a set of independent modules that carry out individual sample processing functions: cell lysis, protein concentration (based on hydrophobic, ion-exchange and affinity interactions), interferent depletion, buffer exchange, and enzymatic digestion of proteins of interest. Taking advantage of its unique capacity for enclosed processing of intact bioparticulates (viruses, spores) and complex serum samples, we have used MAPS for analysis of BSL1 and BSL2 samples to identify specific protein markers through integration with the portable microChemLab{trademark} and MALDI.

  12. Field Mapping At Truckhaven Area (Layman Energy Associates, 2008...

    Open Energy Info (EERE)

    geothermal prospect is shown in Figure 4. This map was prepared by modifying Dibblee's (1984) map using the results of LEA's detailed field mapping in the vicinity of the...

  13. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Salmon, Mississippi, Site, Water Sampling Location Map .........5 Water Sampling Field Activities Verification ...

  14. Field Mapping At Raft River Geothermal Area (1977) | Open Energy...

    Open Energy Info (EERE)

    search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Raft River Geothermal Area (1977) Exploration Activity Details Location Raft River...

  15. Field Mapping At Raft River Geothermal Area (1980) | Open Energy...

    Open Energy Info (EERE)

    search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Raft River Geothermal Area (1980) Exploration Activity Details Location Raft River...

  16. Field Mapping At Raft River Geothermal Area (1990) | Open Energy...

    Open Energy Info (EERE)

    search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Raft River Geothermal Area (1990) Exploration Activity Details Location Raft River...

  17. Field Mapping At Cascades Region (Ingebritsen & Mariner, 2010...

    Open Energy Info (EERE)

    to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Cascades Region (Ingebritsen & Mariner, 2010) Exploration Activity Details...

  18. Field Mapping At Lualualei Valley Area (Thomas, 1986) | Open...

    Open Energy Info (EERE)

    to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Lualualei Valley Area (Thomas, 1986) Exploration Activity Details Location...

  19. ARM - Field Campaign - Precision Gas Sampling (PGS) Validation Field

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Campaign govCampaignsPrecision Gas Sampling (PGS) Validation Field Campaign ARM Data Discovery Browse Data Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : Precision Gas Sampling (PGS) Validation Field Campaign 2001.07.11 - 2001.07.25 Lead Scientist : Marc Fischer Data Availability Data are being processed for inclusion in ARM Archive. For data sets, see below. Summary July, 2001: Three systems were deployed in four fields during a

  20. ARM - Field Campaign - Precision Gas Sampling (PGS) Validation Field

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Campaign govCampaignsPrecision Gas Sampling (PGS) Validation Field Campaign ARM Data Discovery Browse Data Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : Precision Gas Sampling (PGS) Validation Field Campaign 2004.04.15 - 2004.12.15 Lead Scientist : Marc Fischer For data sets, see below. Abstract Accurate prediction of the regional responses of CO2 flux to changing climate, land use, and management requires models that are

  1. ARM - Field Campaign - Precision Gas Sampling (PGS) Validation Field

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Campaign govCampaignsPrecision Gas Sampling (PGS) Validation Field Campaign ARM Data Discovery Browse Data Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : Precision Gas Sampling (PGS) Validation Field Campaign 2005.03.01 - 2006.01.08 Lead Scientist : Marc Fischer For data sets, see below. Abstract Accurate prediction of the regional responses of CO2 flux to changing climate, land use, and management requires models that are

  2. ARM - Field Campaign - Precision Gas Sampling (PGS) Validation Field

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Campaign govCampaignsPrecision Gas Sampling (PGS) Validation Field Campaign ARM Data Discovery Browse Data Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : Precision Gas Sampling (PGS) Validation Field Campaign 2007.01.01 - 2007.12.31 Lead Scientist : Marc Fischer For data sets, see below. Abstract Accurate prediction of the regional responses of CO2 flux to changing climate, land use, and management requires models that are

  3. ARM - Field Campaign - Precision Gas Sampling (PGS) Validation Field

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Campaign govCampaignsPrecision Gas Sampling (PGS) Validation Field Campaign ARM Data Discovery Browse Data Related Campaigns PGS Validation 2011-2013 2011.03.01, Fischer, SGP PGS Validatation 2010 2010.03.01, Fischer, SGP PGS Validatation 2009.03.01, Fischer, SGP Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : Precision Gas Sampling (PGS) Validation Field Campaign 2008.01.01 - 2008.12.31 Lead Scientist : Marc Fischer For data sets,

  4. Field Mapping At Valles Caldera - Redondo Geothermal Area (Goff...

    Open Energy Info (EERE)

    Goff, Et Al., 2011) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Valles Caldera - Redondo Geothermal Area (Goff, Et Al.,...

  5. Field Mapping At Valles Caldera - Sulphur Springs Geothermal...

    Open Energy Info (EERE)

    Goff, Et Al., 2011) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Valles Caldera - Sulphur Springs Geothermal Area (Goff, Et...

  6. Field Mapping At Neal Hot Springs Geothermal Area (Edwards &...

    Open Energy Info (EERE)

    Edwards & Faulds, 2012) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Neal Hot Springs Geothermal Area (Edwards & Faulds,...

  7. Field Mapping At Blue Mountain Geothermal Area (Fairbank Engineering...

    Open Energy Info (EERE)

    Blue Mountain Geothermal Area (Fairbank Engineering Ltd, 2003) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Blue Mountain...

  8. Field Mapping At Walker-Lane Transitional Zone Region (Shevenell...

    Open Energy Info (EERE)

    Region (Shevenell, Et Al., 2008) Exploration Activity Details Location Walker-Lane Transition Zone Geothermal Region Exploration Technique Field Mapping Activity Date Usefulness...

  9. Field Mapping At Walker-Lane Transitional Zone Region (Blewitt...

    Open Energy Info (EERE)

    Zone Region (Blewitt Et Al, 2005) Exploration Activity Details Location Walker-Lane Transition Zone Geothermal Region Exploration Technique Field Mapping Activity Date Usefulness...

  10. Field Mapping At Colrado Area (DOE GTP) | Open Energy Information

    Open Energy Info (EERE)

    Colrado Area (DOE GTP) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Colrado Area (DOE GTP) Exploration Activity Details...

  11. Field Mapping At Mccoy Geothermal Area (DOE GTP) | Open Energy...

    Open Energy Info (EERE)

    Mccoy Geothermal Area (DOE GTP) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Mccoy Geothermal Area (DOE GTP) Exploration...

  12. Field Mapping At Dixie Valley Geothermal Area (Smith, Et Al....

    Open Energy Info (EERE)

    Smith, Et Al., 2001) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Dixie Valley Geothermal Area (Smith, Et Al., 2001)...

  13. Field Mapping At Hot Sulphur Springs Area (Goranson, 2005) |...

    Open Energy Info (EERE)

    Technique Field Mapping Activity Date Usefulness useful DOE-funding Unknown References Colin Goranson (2005) Recent Drilling Activities At The Earth Power Resources Tuscarora...

  14. Field Mapping At Chena Geothermal Area (Waring, Et Al., 1917...

    Open Energy Info (EERE)

    Waring, Et Al., 1917) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Chena Geothermal Area (Waring, Et Al., 1917) Exploration...

  15. Field Mapping At Coso Geothermal Area (1999) | Open Energy Information

    Open Energy Info (EERE)

    to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Coso Geothermal Area (1999) Exploration Activity Details Location Coso Geothermal...

  16. Field Mapping At Mokapu Penninsula Area (Thomas, 1986) | Open...

    Open Energy Info (EERE)

    to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Mokapu Penninsula Area (Thomas, 1986) Exploration Activity Details Location Mokapu...

  17. Field Mapping At Beowawe Hot Springs Area (Wesnousky, Et Al....

    Open Energy Info (EERE)

    to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Beowawe Hot Springs Area (Wesnousky, Et Al., 2003) Exploration Activity Details...

  18. Field Mapping At Northern Basin & Range Region (Blewitt Et Al...

    Open Energy Info (EERE)

    to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Northern Basin & Range Region (Blewitt Et Al, 2005) Exploration Activity Details...

  19. Field Mapping At Central Nevada Seismic Zone Region (Blewitt...

    Open Energy Info (EERE)

    to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Central Nevada Seismic Zone Region (Blewitt Et Al, 2005) Exploration Activity...

  20. Field Mapping At Coso Geothermal Area (1978) | Open Energy Information

    Open Energy Info (EERE)

    8) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Coso Geothermal Area (1978) Exploration Activity Details Location Coso...

  1. Field Mapping At Neal Hot Springs Geothermal Area (Colwell, Et...

    Open Energy Info (EERE)

    of Neal Hot Springs and the surrounding areas. This study was conducted by a geophysics field camp from the Colorado School of Mines. Notes Geologic field mapping was done...

  2. Category:Field Sampling | Open Energy Information

    Open Energy Info (EERE)

    Technique Subcategories This category has the following 2 subcategories, out of 2 total. G + Gas Sampling (3 categories) 4 pages W + Water Sampling (2 categories) 3...

  3. Mapping the magnetic field vector in a fountain clock

    SciTech Connect (OSTI)

    Gertsvolf, Marina; Marmet, Louis

    2011-12-15

    We show how the mapping of the magnetic field vector components can be achieved in a fountain clock by measuring the Larmor transition frequency in atoms that are used as a spatial probe. We control two vector components of the magnetic field and apply audio frequency magnetic pulses to localize and measure the field vector through Zeeman spectroscopy.

  4. Total field aeromagnetic map of the Raft River known Geothermal...

    Open Energy Info (EERE)

    field aeromagnetic map of the Raft River known Geothermal Resource Area, Idaho by the US Geological Survey Jump to: navigation, search OpenEI Reference LibraryAdd to library...

  5. Attosecond nanoscale near-field sampling

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Forg, B.; Schotz, J.; SuBmann, F.; Forster, M.; Kruger, M.; Ahn, B.; Okell, W. A.; Wintersperger, K.; Zherebtsov, S.; Guggenmos, A.; et al

    2016-05-31

    The promise of ultrafast light-field-driven electronic nanocircuits has stimulated the development of the new research field of attosecond nanophysics. An essential prerequisite for advancing this new area is the ability to characterize optical near fields from light interaction with nanostructures, with sub-cycle resolution. Here we experimentally demonstrate attosecond near-field retrieval for a tapered gold nanowire. Furthermore, by comparison of the results to those obtained from noble gas experiments and trajectory simulations, the spectral response of the nanotaper near field arising from laser excitation can be extracted.

  6. Rock Sampling At San Francisco Volcanic Field Area (Warpinski...

    Open Energy Info (EERE)

    Francisco Volcanic Field Area (Warpinski, Et Al., 2004) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Rock Sampling At San Francisco Volcanic...

  7. Field Testing of a Portable Radiation Detector and Mapping System

    SciTech Connect (OSTI)

    Hofstetter, K.J.; Hayes, D.W.; Eakle, R.F.

    1998-03-01

    Researchers at the Savannah River Site (SRS) have developed a man- portable radiation detector and mapping system (RADMAPS) which integrates the accumulation of radiation information with precise ground locations. RADMAPS provides field personnel with the ability to detect, locate, and characterize nuclear material at a site or facility by analyzing the gamma or neutron spectra and correlating them with position. the man-portable field unit records gamma or neutron count rate information and its location, along with date and time, using an embedded Global Positioning System (GPS). RADMAPS is an advancement in data fusion, integrating several off-the-shelf technologies with new computer software resulting in a system that is simple to deploy and provides information useful to field personnel in an easily understandable form. Decisions on subsequent actions can be made in the field to efficiently use available field resources. The technologies employed in this system include: recording GPS, radiation detection (typically scintillation detectors), pulse height analysis, analog-to-digital converters, removable solid-state (Flash or SRAM) memory cards, Geographic Information System (GIS) software and personal computers with CD-ROM supporting digital base maps. RADMAPS includes several field deployable data acquisition systems designed to simultaneously record radiation and geographic positions. This paper summarizes the capabilities of RADMAPS and some of the results of field tests performed with the system.

  8. ARM - Field Campaign - Precision Gas Sampling (PGS) Validation...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Campaign : Precision Gas Sampling (PGS) Validation Field Campaign 2003.04.02 - 2003.09.02 Lead Scientist : Marc Fischer For data sets, see below. Abstract Ecosystem-atmosphere ...

  9. ARM - Field Campaign - Precision Gas Sampling (PGS) Validation...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Sampling (PGS) Validation Field Campaign 2002.01.01 - 2002.07.31 Lead Scientist : Marc Fischer For data sets, see below. Abstract The PGS validation will continue measuring the...

  10. Nanoscale magnetic field mapping with a single spin scanning probe magnetometer

    SciTech Connect (OSTI)

    Rondin, L.; Tetienne, J.-P.; Spinicelli, P.; Roch, J.-F.; Jacques, V.; Dal Savio, C.; Karrai, K.; Dantelle, G.; Thiaville, A.; Rohart, S.

    2012-04-09

    We demonstrate quantitative magnetic field mapping with nanoscale resolution, by applying a lock-in technique on the electron spin resonance frequency of a single nitrogen-vacancy defect placed at the apex of an atomic force microscope tip. In addition, we report an all-optical magnetic imaging technique which is sensitive to large off-axis magnetic fields, thus extending the operation range of diamond-based magnetometry. Both techniques are illustrated by using a magnetic hard disk as a test sample. Owing to the non-perturbing and quantitative nature of the magnetic probe, this work should open up numerous perspectives in nanomagnetism and spintronics.

  11. Precise mapping of the magnetic field in the CMS barrel yoke using cosmic rays

    SciTech Connect (OSTI)

    Chatrchyan, S.; et al.,

    2010-03-01

    The CMS detector is designed around a large 4 T superconducting solenoid, enclosed in a 12000-tonne steel return yoke. A detailed map of the magnetic field is required for the accurate simulation and reconstruction of physics events in the CMS detector, not only in the inner tracking region inside the solenoid but also in the large and complex structure of the steel yoke, which is instrumented with muon chambers. Using a large sample of cosmic muon events collected by CMS in 2008, the field in the steel of the barrel yoke has been determined with a precision of 3 to 8% depending on the location.

  12. Long-Term Ecological Monitoring Field Sampling Plan for 2007

    SciTech Connect (OSTI)

    T. Haney R. VanHorn

    2007-07-31

    This field sampling plan describes the field investigations planned for the Long-Term Ecological Monitoring Project at the Idaho National Laboratory Site in 2007. This plan and the Quality Assurance Project Plan for Waste Area Groups 1, 2, 3, 4, 5, 6, 7, 10, and Removal Actions constitute the sampling and analysis plan supporting long-term ecological monitoring sampling in 2007. The data collected under this plan will become part of the long-term ecological monitoring data set that is being collected annually. The data will be used t determine the requirements for the subsequent long-term ecological monitoring. This plan guides the 2007 investigations, including sampling, quality assurance, quality control, analytical procedures, and data management. As such, this plan will help to ensure that the resulting monitoring data will be scientifically valid, defensible, and of known and acceptable quality.

  13. Remedial investigation sampling and analysis plan for J-Field, Aberdeen Proving Ground, Maryland. Volume 1: Field Sampling Plan

    SciTech Connect (OSTI)

    Benioff, P.; Biang, R.; Dolak, D.; Dunn, C.; Martino, L.; Patton, T.; Wang, Y.; Yuen, C.

    1995-03-01

    The Environmental Management Division (EMD) of Aberdeen Proving Ground (APG), Maryland, is conducting a remedial investigation and feasibility study (RI/FS) of the J-Field area at APG pursuant to the Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA), as amended. J-Field is within the Edgewood Area of APG in Harford County, Maryland (Figure 1. 1). Since World War II activities in the Edgewood Area have included the development, manufacture, testing, and destruction of chemical agents and munitions. These materials were destroyed at J-Field by open burning and open detonation (OB/OD). Considerable archival information about J-Field exists as a result of efforts by APG staff to characterize the hazards associated with the site. Contamination of J-Field was first detected during an environmental survey of the Edgewood Area conducted in 1977 and 1978 by the US Army Toxic and Hazardous Materials Agency (USATHAMA) (predecessor to the US Army Environmental Center [AEC]). As part of a subsequent USATHAMA -environmental survey, 11 wells were installed and sampled at J-Field. Contamination at J-Field was also detected during a munitions disposal survey conducted by Princeton Aqua Science in 1983. The Princeton Aqua Science investigation involved the installation and sampling of nine wells and the collection and analysis of surficial and deep composite soil samples. In 1986, a Resource Conservation and Recovery Act (RCRA) permit (MD3-21-002-1355) requiring a basewide RCRA Facility Assessment (RFA) and a hydrogeologic assessment of J-Field was issued by the US Environmental Protection Agency (EPA). In 1987, the US Geological Survey (USGS) began a two-phased hydrogeologic assessment in data were collected to model, groundwater flow at J-Field. Soil gas investigations were conducted, several well clusters were installed, a groundwater flow model was developed, and groundwater and surface water monitoring programs were established that continue today.

  14. DESIGN, DEVELOPMENT AND FIELD DEPLOYMENT OF A TELEOPERATED SAMPLING SYSTEM

    SciTech Connect (OSTI)

    Dalmaso, M; Robert Fogle, R; Tony Hicks, T; Larry Harpring, L; Daniel Odell, D

    2007-11-09

    A teleoperated sampling system for the identification, collection and retrieval of samples following the detonation of an Improvised Nuclear Device (IND) or Radiological Dispersion Devise (RDD) has been developed and tested in numerous field exercises. The system has been developed as part of the Defense Threat Reduction Agency's (DTRA) National Technical Nuclear Forensic (NTNF) Program. The system is based on a Remotec ANDROS Mark V-A1 platform. Extensive modifications and additions have been incorporated into the platform to enable it to meet the mission requirements. The Defense Science Board Task Force on Unconventional Nuclear Warfare Defense, 2000 Summer Study Volume III report recommended the Department of Defense (DOD) improve nuclear forensics capabilities to achieve accurate and fast identification and attribution. One of the strongest elements of protection is deterrence through the threat of reprisal, but to accomplish this objective a more rapid and authoritative attribution system is needed. The NTNF program provides the capability for attribution. Early on in the NTNF program, it was recognized that there would be a desire to collect debris samples for analysis as soon as possible after a nuclear event. Based on nuclear test experience, it was recognized that mean radiation fields associated with even low yield events could be several thousand R/Hr near the detonation point for some time after the detonation. In anticipation of pressures to rapidly sample debris near the crater, considerable effort is being devoted to developing a remotely controlled vehicle that could enter the high radiation field area and collect one or more samples for subsequent analysis.

  15. Field Mapping At Coso Geothermal Area (1968-1971) | Open Energy...

    Open Energy Info (EERE)

    68-1971) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Coso Geothermal Area (1968-1971) Exploration Activity Details Location...

  16. Field Mapping At Jemez Pueblo Area (DOE GTP) | Open Energy Information

    Open Energy Info (EERE)

    Jemez Pueblo Area (DOE GTP) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Jemez Pueblo Area (DOE GTP) Exploration Activity...

  17. Field Mapping At Glass Buttes Area (DOE GTP) | Open Energy Information

    Open Energy Info (EERE)

    Glass Buttes Area (DOE GTP) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Glass Buttes Area (DOE GTP) Exploration Activity...

  18. Field Mapping At Coso Geothermal Area (1977-1978) | Open Energy...

    Open Energy Info (EERE)

    ENERGYGeothermal Home Exploration Activity: Field Mapping At Coso Geothermal Area (1977-1978) Exploration Activity Details Location Coso Geothermal Area Exploration Technique...

  19. Field Mapping At Brady Hot Springs Area (Wesnousky, Et Al., 2003...

    Open Energy Info (EERE)

    search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Brady Hot Springs Area (Wesnousky, Et Al., 2003) Exploration Activity Details Location Brady...

  20. Field Mapping At Brady Hot Springs Area (Coolbaugh, Et Al., 2004...

    Open Energy Info (EERE)

    Brady Hot Springs Area (Coolbaugh, Et Al., 2004) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Brady Hot Springs Area...

  1. Field Mapping At Fish Lake Valley Area (DOE GTP) | Open Energy...

    Open Energy Info (EERE)

    search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Fish Lake Valley Area (DOE GTP) Exploration Activity Details Location Fish Lake Valley Area...

  2. Field Mapping At Fish Lake Valley Area (Deymonaz, Et Al., 2008...

    Open Energy Info (EERE)

    search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Fish Lake Valley Area (Deymonaz, Et Al., 2008) Exploration Activity Details Location Fish...

  3. Field Mapping At San Emidio Desert Area (DOE GTP) | Open Energy...

    Open Energy Info (EERE)

    Emidio Desert Area (DOE GTP) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At San Emidio Desert Area (DOE GTP) Exploration...

  4. Field Mapping At The Needles Area (DOE GTP) | Open Energy Information

    Open Energy Info (EERE)

    to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At The Needles Area (DOE GTP) Exploration Activity Details Location The Needles Area...

  5. Field Mapping At Snake River Plain Region (DOE GTP) | Open Energy...

    Open Energy Info (EERE)

    to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Snake River Plain Region (DOE GTP) Exploration Activity Details Location Snake...

  6. Field Mapping At Nw Basin & Range Region (Blewitt Et Al, 2005...

    Open Energy Info (EERE)

    to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Nw Basin & Range Region (Blewitt Et Al, 2005) Exploration Activity Details...

  7. Field Mapping At Gabbs Valley Area (DOE GTP) | Open Energy Information

    Open Energy Info (EERE)

    to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Gabbs Valley Area (DOE GTP) Exploration Activity Details Location Gabbs Valley...

  8. Field Mapping At Seven Mile Hole Area (Larson, Et Al., 2009)...

    Open Energy Info (EERE)

    Seven Mile Hole Area (Larson, Et Al., 2009) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Field Mapping At Seven Mile Hole Area (Larson, Et...

  9. Field Mapping At Salt Wells Area (Coolbaugh, Et Al., 2004) |...

    Open Energy Info (EERE)

    Details regarding the complete hardware specifications of the device are included in the body of the article. A custom geologic mapping software applet developed by Gary Edmondo...

  10. Field Mapping At Valles Caldera - Redondo Geothermal Area (Bailey...

    Open Energy Info (EERE)

    based on surface mapping of the caldera. References Roy A. Bailey, Robert Leland Smith, Clarence Samuel Ross (1969) Stratigraphic Nomenclature of Volcanic Rocks in the Jemez...

  11. Field Mapping At Valles Caldera - Sulphur Springs Geothermal...

    Open Energy Info (EERE)

    based on surface mapping of the caldera. References Roy A. Bailey, Robert Leland Smith, Clarence Samuel Ross (1969) Stratigraphic Nomenclature of Volcanic Rocks in the Jemez...

  12. Field Mapping At Chena Geothermal Area (Kolker, 2008) | Open...

    Open Energy Info (EERE)

    1973 - 1974 Usefulness not indicated DOE-funding Unknown Exploration Basis Masters thesis Norma Biggar, Geophysical Institute University of Alaska Notes Geological mapping of...

  13. Field Mapping At Kilauea East Rift Geothermal Area (Thomas, 1986...

    Open Energy Info (EERE)

    along the East Rift Zone; detailed historic lava flows were mapped as well as developed structural models of the rift. Locations and progressions of recorded eruptive cycles and...

  14. Field Mapping At Coso Geothermal Area (2006) | Open Energy Information

    Open Energy Info (EERE)

    Basis Determine impact of brittle faulting and seismogenic deformation on permeability in geothermal reservoir Notes New mapping documents a series of late Quaternary...

  15. Raft River Geothermal Field Well Head Brine Sample

    SciTech Connect (OSTI)

    Tim Lanyk

    2015-12-18

    Raw data and data workup of assay for real-world brine sample. Brine sample was taken at the well head.

  16. Reservoir fracture mapping using microearthquakes: Austin chalk, Giddings field, TX and 76 field, Clinton Co., KY

    SciTech Connect (OSTI)

    Phillips, W.S.; Rutledge, J.T.; Gardner, T.L.; Fairbanks, T.D.; Miller, M.E.; Schuessler, B.K.

    1996-11-01

    Patterns of microearthquakes detected downhole defined fracture orientation and extent in the Austin chalk, Giddings field, TX and the 76 field, Clinton Co., KY. We collected over 480 and 770 microearthquakes during hydraulic stimulation at two sites in the Austin chalk, and over 3200 during primary production in Clinton Co. Data were of high enough quality that 20%, 31% and 53% of the events could be located, respectively. Reflected waves constrained microearthquakes to the stimulated depths at the base of the Austin chalk. In plan view, microearthquakes defined elongate fracture zones extending from the stimulation wells parallel to the regional fracture trend. However, widths of the stimulated zones differed by a factor of five between the two Austin chalk sites, indicating a large difference in the population of ancillary fractures. Post-stimulation production was much higher from the wider zone. At Clinton Co., microearthquakes defined low-angle, reverse-fault fracture zones above and below a producing zone. Associations with depleted production intervals indicated the mapped fractures had been previously drained. Drilling showed that the fractures currently contain brine. The seismic behavior was consistent with poroelastic models that predicted slight increases in compressive stress above and below the drained volume.

  17. Field Mapping At Hawthorne Area (Lazaro, Et Al., 2010) | Open...

    Open Energy Info (EERE)

    GPO has contracted the University of Nevada Reno Great Basin for Center for Geothermal Research to conduct additional field exploration at HAD. The tasks required by the Navy...

  18. Mapping Intra-Field Yield Variation Using High Resolution Satellite...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    future landscape patterns, hydrologic modeling, landscape design, predictive crop yield, red-edge, sub-field scale, SWAT, water quality Abstract Biofuels are important alternatives...

  19. Phased Array Ultrasonic Sound Field Mapping in Cast Austenitic Stainless Steel

    SciTech Connect (OSTI)

    Crawford, Susan L.; Prowant, Matthew S.; Cinson, Anthony D.; Larche, Michael R.; Diaz, Aaron A.; Anderson, Michael T.

    2014-05-31

    This study maps the phased array-generated acoustic sound fields through three types of CASS microstructure in four specimens to quantitatively assess the beam formation effectiveness in these materials.

  20. Rock Sampling At San Juan Volcanic Field Area (Larson & Jr, 1986...

    Open Energy Info (EERE)

    Juan Volcanic Field Area (Larson & Jr, 1986) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Exploration Activity: Rock Sampling At San Juan Volcanic Field Area...

  1. Wide-Field Lensing Mass Maps from DES Science Verification Data

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Chang, C.; Vikram, V.; Jain, B.

    2015-07-29

    We present a mass map reconstructed from weak gravitational lensing shear measurements over 139 deg2 from the Dark Energy Survey (DES) Science Verification data. The mass map probes both luminous and dark matter, thus providing a tool for studying cosmology. We find good agreement between the mass map and the distribution of massive galaxy clusters identified using a red-sequence cluster finder. Potential candidates for super-clusters and voids are identified using these maps. We measure the cross-correlation between the mass map and a magnitude-limited foreground galaxy sample and find a detection at the 6.8? level with 20 arcminute smoothing. These measurementsmoreare consistent with simulated galaxy catalogs based on ?CDM Nbody simulations, suggesting low systematics uncertainties in the map. We summarize our key findings in this letter; the detailed methodology and tests for systematics are presented in a companion paper.less

  2. Analytical results, statistical analyses, and sample-locality maps of rocks from the Anchorage Quadrangle, southern Alaska

    SciTech Connect (OSTI)

    Madden, D.J.; Arbogast, B.F.; O'Leary, R.M.; Van Trump, G. Jr.; Silberman, M.L.

    1989-01-01

    A U.S. Geological Survey report give the analytical results, statistical analyses, and sample-locality maps of rocks from the Anchorage Quadrangle in southern Alaska is presented.

  3. MAP

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    MAP MAP MAP from Allinea Software is a parallel profiler with a simple graphical user interface. It is installed on Edison and Cori. Note that the performance of the X Windows-based MAP Graphical User Interface can be greatly improved if used in conjunction with the free NX software. Introduction Allinea MAP is a parallel profiler with simple Graphical User Interface. MAP can be run with up to 512 processors, to profile serial, OpenMP and MPI codes. The Allinea MAP web page and 'Allinea Forge

  4. Mapping Diffuse Seismicity Using Empirical Matched Field Processing Techniques

    SciTech Connect (OSTI)

    Wang, J; Templeton, D C; Harris, D B

    2011-01-21

    The objective of this project is to detect and locate more microearthquakes using the empirical matched field processing (MFP) method than can be detected using only conventional earthquake detection techniques. We propose that empirical MFP can complement existing catalogs and techniques. We test our method on continuous seismic data collected at the Salton Sea Geothermal Field during November 2009 and January 2010. In the Southern California Earthquake Data Center (SCEDC) earthquake catalog, 619 events were identified in our study area during this time frame and our MFP technique identified 1094 events. Therefore, we believe that the empirical MFP method combined with conventional methods significantly improves the network detection ability in an efficient matter.

  5. BTA Magnet Field Map Archive and MAD Model

    SciTech Connect (OSTI)

    Glenn,J.W.

    2008-04-01

    This note publishes some and information that has resided in private files. The attached tables were provided by Joseph Skelly from his archives. They show magnetic field measurements versus excitation current for the Booster to AGS transfer line quadrupoles and dipoles based on field measurements [we believe] were done by the Magnet Division. Also given are Ed Blesser's fifth order fits of field versus current. The results are given in 'Tesla' or T-M/M. These tables are attached to provide an archive of this data. The MAD model of the BTA line does have the same values as shown in the attached fits so the transfer was correct. MAD uses as its 'gradient' for quads Tesla per meter normalized to rigidity [B-rho]. The model of the BTA line in use uses the T-M/M given in the tables divided by the length to give T M which is then normalized by Brho. Thus, the input to the model appears to be correct. The original model is also attached as part of a memo by Skelly describing it.

  6. Wide-Field Lensing Mass Maps from Dark Energy Survey Science Verification Data

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Chang, C.

    2015-07-29

    We present a mass map reconstructed from weak gravitational lensing shear measurements over 139 deg2 from the Dark Energy Survey science verification data. The mass map probes both luminous and dark matter, thus providing a tool for studying cosmology. We also find good agreement between the mass map and the distribution of massive galaxy clusters identified using a red-sequence cluster finder. Potential candidates for superclusters and voids are identified using these maps. We measure the cross-correlation between the mass map and a magnitude-limited foreground galaxy sample and find a detection at the 6.8σ level with 20 arc min smoothing. Thesemore » measurements are consistent with simulated galaxy catalogs based on N-body simulations from a cold dark matter model with a cosmological constant. This suggests low systematics uncertainties in the map. Finally, we summarize our key findings in this Letter; the detailed methodology and tests for systematics are presented in a companion paper.« less

  7. Wide-Field Lensing Mass Maps from Dark Energy Survey Science Verification Data

    SciTech Connect (OSTI)

    Chang, C.

    2015-07-29

    We present a mass map reconstructed from weak gravitational lensing shear measurements over 139 deg2 from the Dark Energy Survey science verification data. The mass map probes both luminous and dark matter, thus providing a tool for studying cosmology. We also find good agreement between the mass map and the distribution of massive galaxy clusters identified using a red-sequence cluster finder. Potential candidates for superclusters and voids are identified using these maps. We measure the cross-correlation between the mass map and a magnitude-limited foreground galaxy sample and find a detection at the 6.8σ level with 20 arc min smoothing. These measurements are consistent with simulated galaxy catalogs based on N-body simulations from a cold dark matter model with a cosmological constant. This suggests low systematics uncertainties in the map. Finally, we summarize our key findings in this Letter; the detailed methodology and tests for systematics are presented in a companion paper.

  8. Magnetic field mapping of the UCNTau magneto-gravitational trap: design study

    SciTech Connect (OSTI)

    Libersky, Matthew Murray

    2014-09-04

    The beta decay lifetime of the free neutron is an important input to the Standard Model of particle physics, but values measured using different methods have exhibited substantial disagreement. The UCN r experiment in development at Los Alamos National Laboratory (LANL) plans to explore better methods of measuring the neutron lifetime using ultracold neutrons (UCNs). In this experiment, UCNs are confined in a magneto-gravitational trap formed by a curved, asymmetric Halbach array placed inside a vacuum vessel and surrounded by holding field coils. If any defects present in the Halbach array are sufficient to reduce the local field near the surface below that needed to repel the desired energy level UCNs, loss by material interaction can occur at a rate similar to the loss by beta decay. A map of the magnetic field near the surface of the array is necessary to identify any such defects, but the array's curved geometry and placement in a vacuum vessel make conventional field mapping methods difficult. A system consisting of computer vision-based tracking and a rover holding a Hall probe has been designed to map the field near the surface of the array, and construction of an initial prototype has begun at LANL. The design of the system and initial results will be described here.

  9. Operable Unit 3-13, Group 3, Other Surface Soils (Phase II) Field Sampling Plan

    SciTech Connect (OSTI)

    G. L. Schwendiman

    2006-07-27

    This Field Sampling Plan describes the Operable Unit 3-13, Group 3, Other Surface Soils, Phase II remediation field sampling activities to be performed at the Idaho Nuclear Technology and Engineering Center located within the Idaho National Laboratory Site. Sampling activities described in this plan support characterization sampling of new sites, real-time soil spectroscopy during excavation, and confirmation sampling that verifies that the remedial action objectives and remediation goals presented in the Final Record of Decision for Idaho Nuclear Technology and Engineering Center, Operable Unit 3-13 have been met.

  10. Note: Dynamic strain field mapping with synchrotron X-ray digital image correlation

    SciTech Connect (OSTI)

    Lu, L.; Fan, D.; Luo, S. N.; Bie, B. X.; Ran, X. X.; Qi, M. L.; Parab, N.; Sun, J. Z.; Liao, H. J.; Hudspeth, M. C.; Claus, B.; Fezzaa, K.; Sun, T.; Chen, W.; Gong, X. L.

    2014-07-15

    We present a dynamic strain field mapping method based on synchrotron X-ray digital image correlation (XDIC). Synchrotron X-ray sources are advantageous for imaging with exceptional spatial and temporal resolutions, and X-ray speckles can be produced either from surface roughness or internal inhomogeneities. Combining speckled X-ray imaging with DIC allows one to map strain fields with high resolutions. Based on experiments on void growth in Al and deformation of a granular material during Kolsky bar/gas gun loading at the Advanced Photon Source beamline 32ID, we demonstrate the feasibility of dynamic XDIC. XDIC is particularly useful for dynamic, in-volume, measurements on opaque materials under high strain-rate, large, deformation.

  11. Fracture mapping in geothermal fields with long-offset induction logging

    SciTech Connect (OSTI)

    Wilt, M.; Takasugi, Shinji; Uchida, Toshihiro; Kasameyer, P.; Lee, Ki Ha; Lippmann, M.

    1997-01-01

    The mapping of producing fractures in a geothermal field is an important technical objective in field development. Locating, orientating, and assessing producing fractures can guide drilling programs and optimize the placement of production and injection wells. A long-offset multicomponent borehole induction resistivity tool capable of surviving the high temperatures encountered in geothermal wells has recently been developed and tested in a high temperature environment. Several characteristics of this device make it ideal for detecting producing fractures. Whereas commercial induction logging devices have strong source-receiver separations of 1 m, this device has multiple sensors with separation of 8 m, allowing for deeper penetrations and the ability to straddle fracture-induced washout zones in boreholes. The three-component measurements also make it possible to map the strike and inclination of nearby fractures and other three-dimensional structures. This in turn allows for accurate projection of these structures into the space between wells.

  12. D-zero rototrack: first stage of D-zero 2 Tesla solenoid field mapping device

    SciTech Connect (OSTI)

    Yamada, R.; Korienek, J.; Krider, J.; Lindenmeyer, C.; Miksa, D.; Miksa, R.

    1997-09-01

    A simple and portable field mapping device was developed at Fermilab and successfully used to test the D0 2 Tesla solenoid at Toshiba Works in Japan. A description of the mechanical structure, electric driving and control system, and software of the field mapping device is given. Four Hall probe elements of Group3 Digital Gaussmeters are mounted on the radial extension arm of a carriage, which is mounted on a central rotating beam. The system gives two dimensional motions (axial and rotational) to the Hall probes. To make the system compact and portable, we used a laptop computer with PCMCIA cards. For the control system we used commercially available software LabVIEW and Motion Toolbox, and for the data analysis we used Microsoft Excel.

  13. Ultrasonic Sound Field Mapping Through Coarse Grained Cast Austenitic Stainless Steel Components

    SciTech Connect (OSTI)

    Crawford, Susan L.; Prowant, Matthew S.; Cinson, Anthony D.; Larche, Michael R.; Diaz, Aaron A.

    2014-08-01

    The Pacific Northwest National Laboratory (PNNL) has been involved with nondestructive examination (NDE) of coarse-grained cast austenitic stainless steel (CASS) components for over 30 years. More recent work has focused on mapping the ultrasonic sound fields generated by low-frequency phased array probes that are typically used for the evaluation of CASS materials for flaw detection and characterization. The casting process results in the formation of large grained material microstructures that are nonhomogeneous and anisotropic. The propagation of ultrasonic energy for examination of these materials results in scattering, partitioning and redirection of these sound fields. The work reported here provides an assessment of sound field formation in these materials and provides recommendations on ultrasonic inspection parameters for flaw detection in CASS components.

  14. PPPL researcher maps magnetic fields in first physics experiment on W7-X |

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Princeton Plasma Physics Lab researcher maps magnetic fields in first physics experiment on W7-X By Jeanne Jackson DeVoe December 4, 2015 Tweet Widget Google Plus One Share on Facebook Sam Lazerson in front of a stellarator model at PPPL that was built for the 1958 "Atoms for Peace Conference" in Geneva. (Photo by Elle Starkman/PPPL Office of Communications). (Photo by Elle Starkman/PPPL Office of Communications) Sam Lazerson in front of a stellarator model at PPPL that was built

  15. Field sampling and selecting on-site analytical methods for explosives in soil

    SciTech Connect (OSTI)

    Crockett, A.B.; Craig, H.D.; Jenkins, T.F.; Sisk, W.E.

    1996-12-01

    A large number of defense-related sites are contaminated with elevated levels of secondary explosives. Levels of contamination range from barely detectable to levels above 10% that need special handling because of the detonation potential. Characterization of explosives-contaminated sites is particularly difficult because of the very heterogeneous distribution of contamination in the environment and within samples. To improve site characterization, several options exist including collecting more samples, providing on-site analytical data to help direct the investigation, compositing samples, improving homogenization of the samples, and extracting larger samples. This publication is intended to provide guidance to Remedial Project Managers regarding field sampling and on-site analytical methods for detecting and quantifying secondary explosive compounds in soils, and is not intended to include discussions of the safety issues associated with sites contaminated with explosive residues.

  16. Mapping residual stress fields from Vickers hardness indents using Raman microprobe spectroscopy

    SciTech Connect (OSTI)

    Sparks, R.G.; Enloe, W.S.; Paesler, M.A.

    1988-12-01

    Micro-Raman spectroscopy is used to map the residual stress fields in the vicinity of Vickers hardness indents. Both 514.5 and 488.0 nm, light is used to excite the effect and the resulting shifted and broadened Raman peaks are analyzed using computer deconvolution. Half-wave plates are used to vary the orientation of the incident later light`s polarization state with respect to crystal orientation. The Raman scattered light is then analyzed for polarization dependences which are indicative of the various components of the Raman scattering tensor. Such studies can yield valuable information about the orientation of stress components in a well known stress field. The results can then be applied to the determination of stress components in machined semiconductor materials.

  17. Analytical data and sample locality map for aqua-regia leachates of stream sediments analyzed by ICP from the Chignik and Sutwik Island quadrangles, Alaska

    SciTech Connect (OSTI)

    Van Trump, G. Jr.; Motooka, J.M.; Erlich, O.; Tompkins, M.L.

    1989-01-01

    A U.S. Geological report is presented detailing analytical data and sample locality map for aqua-regia leachates of stream sediments analyzed by ICP from the Chignik and Sutwik Island quadrangles, Alaska.

  18. Analytical data and sample locality map for aqua-regia leachates of stream sediments analyzed by ICP from the Iditarod Quadrangle, Alaska

    SciTech Connect (OSTI)

    Motooka, J.M.; Gray, J.E.; Erlich, O.; Van Trump, G. Jr.

    1989-01-01

    A U.S. Geological Survey report giving analytical data and sample locality maps for the aqua-regia leachates of stream sediments from the Iditarod Quadrangle in Alaska is presented.

  19. Acoustic Longitudinal Field NIF Optic Feature Detection Map Using Time-Reversal & MUSIC

    SciTech Connect (OSTI)

    Lehman, S K

    2006-02-09

    We developed an ultrasonic longitudinal field time-reversal and MUltiple SIgnal Classification (MUSIC) based detection algorithm for identifying and mapping flaws in fused silica NIF optics. The algorithm requires a fully multistatic data set, that is one with multiple, independently operated, spatially diverse transducers, each transmitter of which, in succession, launches a pulse into the optic and the scattered signal measured and recorded at every receiver. We have successfully localized engineered ''defects'' larger than 1 mm in an optic. We confirmed detection and localization of 3 mm and 5 mm features in experimental data, and a 0.5 mm in simulated data with sufficiently high signal-to-noise ratio. We present the theory, experimental results, and simulated results.

  20. A pulsed-field gel electrophoresis map in the ataxia-telangiectasia region of chromosome 11q22. 3

    SciTech Connect (OSTI)

    Uhrhammer, N.; Huo, Y.; Gatti, R.A. ); Concannon, P. ); Nakamura, Yusuke )

    1994-03-15

    The authors interest in isolating the gene(s) for ataxia-telangiectasia has prompted construction of a physical map of chromosome 11q22.3 using markers localized to this region by linkage analysis and/or hybrid cell panels. Twenty-two markers have been analyzed by pulsed-field gel electrophoresis. Nine of these markers form an [approximately]2-Mb long-range contiguous map. An average distance of 200 kb between probes in this map should facilitate the isolation of new cDNAs, anonymous probes, and YACs in an orderly way. 15 refs., 2 figs.

  1. Site Map | ScienceCinema

    Office of Scientific and Technical Information (OSTI)

    Site Map Site Map Home Audio Search Fielded Search About FAQ Site Map Contact Us Website PoliciesImportant Links

  2. Note: Versatile sample stick for neutron scattering experiments in high electric fields

    SciTech Connect (OSTI)

    Bartkowiak, M., E-mail: marek.bartkowiak@psi.ch [Laboratory for Developments and Methods, Paul Scherrer Institut, CH-5232 Villigen (Switzerland); White, J. S. [Laboratory for Neutron Scattering, Paul Scherrer Institut, CH-5232 Villigen (Switzerland) [Laboratory for Neutron Scattering, Paul Scherrer Institut, CH-5232 Villigen (Switzerland); Laboratory for Quantum Magnetism, Ecole Polytechnique Fdrale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland); Rnnow, H. M.; Pra, K. [Laboratory for Quantum Magnetism, Ecole Polytechnique Fdrale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland)] [Laboratory for Quantum Magnetism, Ecole Polytechnique Fdrale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland)

    2014-02-15

    We present a versatile high voltage sample stick that fits into all cryomagnets and standard cryostats at the Swiss Spallation Neutron Source, Paul Scherrer Institut, and which provides a low effort route to neutron scattering experiments that combine electric field with low temperature and magnetic field. The stick allows for voltages up to 5 kV and can be easily adapted for different scattering geometries. We discuss the design consideration and thermal behavior of the stick, and give one example to showcase the abilities of the device.

  3. Cropland Field Monitoring: MMV Page 1 Montana Cropland Enrolled Farm Fields Carbon Sequestration Field Sampling, Measurement, Monitoring, and Verification: Application of Visible-Near Infrared Diffuse Reflectance Spectroscopy (VNIR) and Laser-induced Breakdown Spectroscopy (LIBS)

    SciTech Connect (OSTI)

    Lee Spangler; Ross Bricklemyer; David Brown

    2012-03-15

    There is growing need for rapid, accurate, and inexpensive methods to measure, and verify soil organic carbon (SOC) change for national greenhouse gas accounting and the development of a soil carbon trading market. Laboratory based soil characterization typically requires significant soil processing, which is time and resource intensive. This severely limits application for large-region soil characterization. Thus, development of rapid and accurate methods for characterizing soils are needed to map soil properties for precision agriculture applications, improve regional and global soil carbon (C) stock and flux estimates and efficiently map sub-surface metal contamination, among others. The greatest gains for efficient soil characterization will come from collecting soil data in situ, thus minimizing soil sample transportation, processing, and lab-based measurement costs. Visible and near-infrared diffuse reflectance spectroscopy (VisNIR) and laser-induced breakdown spectroscopy (LIBS) are two complementary, yet fundamentally different spectroscopic techniques that have the potential to meet this need. These sensors have the potential to be mounted on a soil penetrometer and deployed for rapid soil profile characterization at field and landscape scales. Details of sensor interaction, efficient data management, and appropriate statistical analysis techniques for model calibrations are first needed. In situ or on-the-go VisNIR spectroscopy has been proposed as a rapid and inexpensive tool for intensively mapping soil texture and organic carbon (SOC). While lab-based VisNIR has been established as a viable technique for estimating various soil properties, few experiments have compared the predictive accuracy of on-the-go and lab-based VisNIR. Eight north central Montana wheat fields were intensively interrogated using on-the-go and lab-based VisNIR. Lab-based spectral data consistently provided more accurate predictions than on-the-go data. However, neither in situ

  4. New non-Doppler remote sensing technique for 3-D wind field mapping

    SciTech Connect (OSTI)

    Belen`kii, M.S.; Gimmestad, G.G.; Gurvich, A.S.

    1994-12-31

    A new approach to the statistical analysis of fluctuating, photon-limited signals which permits one to accumulate and process the lidar returns without averaging of the reflected energy fluctuations is developed. In contrast to the traditional approach which uses the summation of the photon counts from multiple pulses, which results in averaging of the backscattered energy fluctuations, the new approach requires recording the photocounts for each pulse in a series of pulses and then determining photocount statistics. Based on the semiclassical theory of photodetection and Mandel`s formula, a relationship has been obtained between the time-space cross correlation function and the cross spectrum of the lidar returns and corresponding photocount statistics. It is shown that the relative uncertainties of measuring the cross correlation or the cross spectrum of the lidar returns is determined by the general number of photocounts, but not by their mean value. A fast-scanning lidar system, which is based on a new photocounting analysis approach, is described for 3-D wind field mapping in the atmosphere at altitudes up to 5 km. A program for the experimental verification of the new approach is presented.

  5. Wide-field lensing mass maps from Dark Energy Survey science verification data: Methodology and detailed analysis

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Vikram, V.; Sheldon, E.; Chang, C.; Jain, B.; Bacon, D.; Amara, A.; Becker, M. R.; Bernstein, G.; Bonnett, C.; Bridle, S.; et al

    2015-07-29

    Weak gravitational lensing allows one to reconstruct the spatial distribution of the projected mass density across the sky. These mass maps provide a powerful tool for studying cosmology as they probe both luminous and dark matter. In this paper, we present a weak lensing mass map reconstructed from shear measurements in a 139 deg2 area from the Dark Energy Survey science verification data. We compare the distribution of mass with that of the foreground distribution of galaxies and clusters. The overdensities in the reconstructed map correlate well with the distribution of optically detected clusters. We demonstrate that candidate superclusters andmorevoids along the line of sight can be identified, exploiting the tight scatter of the cluster photometric redshifts. We cross-correlate the mass map with a foreground magnitude-limited galaxy sample from the same data. Our measurement gives results consistent with mock catalogs from N-body simulations that include the primary sources of statistical uncertainties in the galaxy, lensing, and photo-z catalogs. The statistical significance of the cross-correlation is at the 6.8? level with 20 arcminute smoothing. We find that the contribution of systematics to the lensing mass maps is generally within measurement uncertainties. We analyze less than 3% of the final area that will be mapped by the DES; the tools and analysis techniques developed in this paper can be applied to forthcoming larger data sets from the survey.less

  6. Wide-field lensing mass maps from Dark Energy Survey science verification data: Methodology and detailed analysis

    SciTech Connect (OSTI)

    Vikram, V.; Sheldon, E.; Chang, C.; Jain, B.; Bacon, D.; Amara, A.; Becker, M. R.; Bernstein, G.; Bonnett, C.; Bridle, S.; Brout, D.; Busha, M.; Frieman, J.; Gaztanaga, E.; Hartley, W.; Jarvis, M.; Kacprzak, T.; Kovacs, A.; Lahav, O.; Leistedt, B.; Lin, H.; Melchior, P.; Peiris, H.; Rozo, E.; Rykoff, E.; Sanchez, C.; Sheldon, E.; Troxel, M. A.; Wechsler, R.; Zuntz, J.; Abbott, T.; Abdalla, F. B.; Armstrong, R.; Banerji, M.; Bauer, A. H.; Benoit-Levy, A.; Bertin, E.; Brooks, D.; Buckley-Geer, E.; Burke, D. L.; Capozzi, D.; Carnero Rosell, A.; Kind, M. Carrasco; Castander, F. J.; Crocce, M.; Cunha, C. E.

    2015-07-29

    Weak gravitational lensing allows one to reconstruct the spatial distribution of the projected mass density across the sky. These mass maps provide a powerful tool for studying cosmology as they probe both luminous and dark matter. In this paper, we present a weak lensing mass map reconstructed from shear measurements in a 139 deg2 area from the Dark Energy Survey science verification data. We compare the distribution of mass with that of the foreground distribution of galaxies and clusters. The overdensities in the reconstructed map correlate well with the distribution of optically detected clusters. We demonstrate that candidate superclusters and voids along the line of sight can be identified, exploiting the tight scatter of the cluster photometric redshifts. We cross-correlate the mass map with a foreground magnitude-limited galaxy sample from the same data. Our measurement gives results consistent with mock catalogs from N-body simulations that include the primary sources of statistical uncertainties in the galaxy, lensing, and photo-z catalogs. The statistical significance of the cross-correlation is at the 6.8? level with 20 arcminute smoothing. We find that the contribution of systematics to the lensing mass maps is generally within measurement uncertainties. We analyze less than 3% of the final area that will be mapped by the DES; the tools and analysis techniques developed in this paper can be applied to forthcoming larger data sets from the survey.

  7. Wide-field lensing mass maps from Dark Energy Survey science verification data: Methodology and detailed analysis

    SciTech Connect (OSTI)

    Vikram, V.

    2015-07-29

    Weak gravitational lensing allows one to reconstruct the spatial distribution of the projected mass density across the sky. These mass maps provide a powerful tool for studying cosmology as they probe both luminous and dark matter. In this paper, we present a weak lensing mass map reconstructed from shear measurements in a 139 deg2 area from the Dark Energy Survey (DES) science verification data. We compare the distribution of mass with that of the foreground distribution of galaxies and clusters. The overdensities in the reconstructed map correlate well with the distribution of optically detected clusters. We demonstrate that candidate superclusters and voids along the line of sight can be identified, exploiting the tight scatter of the cluster photometric redshifts. We cross-correlate the mass map with a foreground magnitude-limited galaxy sample from the same data. Our measurement gives results consistent with mock catalogs from N-body simulations that include the primary sources of statistical uncertainties in the galaxy, lensing, and photo-z catalogs. The statistical significance of the cross-correlation is at the 6.8? level with 20 arcminute smoothing. We find that the contribution of systematics to the lensing mass maps is generally within measurement uncertainties. In this study, we analyze less than 3% of the final area that will be mapped by the DES; the tools and analysis techniques developed in this paper can be applied to forthcoming larger data sets from the survey.

  8. Simple method for highlighting the temperature distribution into a liquid sample heated by microwave power field

    SciTech Connect (OSTI)

    Surducan, V.; Surducan, E.; Dadarlat, D.

    2013-11-13

    Microwave induced heating is widely used in medical treatments, scientific and industrial applications. The temperature field inside a microwave heated sample is often inhomogenous, therefore multiple temperature sensors are required for an accurate result. Nowadays, non-contact (Infra Red thermography or microwave radiometry) or direct contact temperature measurement methods (expensive and sophisticated fiber optic temperature sensors transparent to microwave radiation) are mainly used. IR thermography gives only the surface temperature and can not be used for measuring temperature distributions in cross sections of a sample. In this paper we present a very simple experimental method for temperature distribution highlighting inside a cross section of a liquid sample, heated by a microwave radiation through a coaxial applicator. The method proposed is able to offer qualitative information about the heating distribution, using a temperature sensitive liquid crystal sheet. Inhomogeneities as smaller as 1°-2°C produced by the symmetry irregularities of the microwave applicator can be easily detected by visual inspection or by computer assisted color to temperature conversion. Therefore, the microwave applicator is tuned and verified with described method until the temperature inhomogeneities are solved.

  9. Quality assurance guidance for field sampling and measurement assessment plates in support of EM environmental sampling and analysis activities

    SciTech Connect (OSTI)

    Not Available

    1994-05-01

    This document is one of several guidance documents developed by the US Department of Energy (DOE) Office of Environmental Restoration and Waste Management (EM). These documents support the EM Analytical Services Program (ASP) and are based on applicable regulatory requirements and DOE Orders. They address requirements in DOE Orders by providing guidance that pertains specifically to environmental restoration and waste management sampling and analysis activities. DOE 5700.6C Quality Assurance (QA) defines policy and requirements to establish QA programs ensuring that risks and environmental impacts are minimized and that safety, reliability, and performance are maximized. This is accomplished through the application of effective management systems commensurate with the risks imposed by the facility and the project. Every organization supporting EM`s environmental sampling and analysis activities must develop and document a QA program. Management of each organization is responsible for appropriate QA program implementation, assessment, and improvement. The collection of credible and cost-effective environmental data is critical to the long-term success of remedial and waste management actions performed at DOE facilities. Only well established and management supported assessment programs within each EM-support organization will enable DOE to demonstrate data quality. The purpose of this series of documents is to offer specific guidance for establishing an effective assessment program for EM`s environmental sampling and analysis (ESA) activities.

  10. Develop a field grid system for yield mapping and machine control. Quarterly report, July 1, 1995--September 30, 1995

    SciTech Connect (OSTI)

    Hart, F.; Windish, J.

    1995-10-01

    Build and test the Field Grid Sense system for yield mapping and machine control during harvesting. Secondly, use Field Grid Sense with chemical application equipment to demonstrate a workable in-field system. More specifically, the operation of the patented hardware/software Field Grid Sense (FGS) system will be tested in crop harvesting to demonstrate the system`s utility and to analyze the flexibility of operation under true field conditions. Additionally, FGS will again be used with chemical application equipment - equipment that needs modification to correct one or two slight shortcomings. This action will create improved systems and establish the worthiness, efficiency and necessity of chemical application equipment that is controlled and directed via the FGS package.

  11. Wide-field lensing mass maps from Dark Energy Survey science verification data: Methodology and detailed analysis

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Vikram, V.

    2015-07-29

    Weak gravitational lensing allows one to reconstruct the spatial distribution of the projected mass density across the sky. These “mass maps” provide a powerful tool for studying cosmology as they probe both luminous and dark matter. In this paper, we present a weak lensing mass map reconstructed from shear measurements in a 139 deg2 area from the Dark Energy Survey (DES) science verification data. We compare the distribution of mass with that of the foreground distribution of galaxies and clusters. The overdensities in the reconstructed map correlate well with the distribution of optically detected clusters. We demonstrate that candidate superclustersmore » and voids along the line of sight can be identified, exploiting the tight scatter of the cluster photometric redshifts. We cross-correlate the mass map with a foreground magnitude-limited galaxy sample from the same data. Our measurement gives results consistent with mock catalogs from N-body simulations that include the primary sources of statistical uncertainties in the galaxy, lensing, and photo-z catalogs. The statistical significance of the cross-correlation is at the 6.8σ level with 20 arcminute smoothing. We find that the contribution of systematics to the lensing mass maps is generally within measurement uncertainties. In this study, we analyze less than 3% of the final area that will be mapped by the DES; the tools and analysis techniques developed in this paper can be applied to forthcoming larger data sets from the survey.« less

  12. Field Sampling Plan for the Distler Brickyard Superfund Site, Hardin County, Kentucky

    SciTech Connect (OSTI)

    J. P. Martin; L. N. Peterson; C. J. Taylor

    1999-08-01

    This plan describes the field and analytical activities to be conducted at the Distler Brickyard Superfund Site, Hardin County, Kentucky, in order to evaluate natural attenuation processes within the aquifer system. Sampling will consist of a single round to take place in October 1999. Analytes will consist of the contaminants of concern (chlorinated aliphatic hydrocarbons), electron donors (non-chlorinated organic compounds), oxidation-reduction indicators, and water quality parameters. These activities are conducted in order to evaluate the water quality parameters. These activities are conducted in order to evaluate the extent to which natural attenuation processes, in the form of anaerobic reductive dechlorination, may be taking place in the aquifer system. These data will then be used to select the appropriate remediation technology for this site.

  13. Field Mapping At Coso Geothermal Area (2001-2003) | Open Energy...

    Open Energy Info (EERE)

    Coso field primarily occurs in the hanging walls of the listric faults. References Unruh, J. (1 January 2001) NEW SEISMIC IMAGING OF THE COSO GEOTHERMAL FIELD, EASTERN CALIFORNIA...

  14. FIELD-DEPLOYABLE SAMPLING TOOLS FOR SPENT NUCLEAR FUEL INTERROGATION IN LIQUID STORAGE

    SciTech Connect (OSTI)

    Berry, T.; Milliken, C.; Martinez-Rodriguez, M.; Hathcock, D.; Heitkamp, M.

    2012-09-12

    Methodology and field deployable tools (test kits) to analyze the chemical and microbiological condition of aqueous spent fuel storage basins and determine the oxide thickness on the spent fuel basin materials were developed to assess the corrosion potential of a basin. this assessment can then be used to determine the amount of time fuel has spent in a storage basin to ascertain if the operation of the reactor and storage basin is consistent with safeguard declarations or expectations and assist in evaluating general storage basin operations. The test kit was developed based on the identification of key physical, chemical and microbiological parameters identified using a review of the scientific and basin operations literature. The parameters were used to design bench scale test cells for additional corrosion analyses, and then tools were purchased to analyze the key parameters. The tools were used to characterize an active spent fuel basin, the Savannah River Site (SRS) L-Area basin. The sampling kit consisted of a total organic carbon analyzer, an YSI multiprobe, and a thickness probe. The tools were field tested to determine their ease of use, reliability, and determine the quality of data that each tool could provide. Characterization confirmed that the L Area basin is a well operated facility with low corrosion potential.

  15. Hazard surveillance for workplace magnetic fields. 1: Walkaround sampling method for measuring ambient field magnitude; 2: Field characteristics from waveform measurements

    SciTech Connect (OSTI)

    Methner, M.M.; Bowman, J.D.

    1998-03-01

    Recent epidemiologic research has suggested that exposure to extremely low frequency (ELF) magnetic fields (MF) may be associated with leukemia, brain cancer, spontaneous abortions, and Alzheimer`s disease. A walkaround sampling method for measuring ambient ELF-MF levels was developed for use in conducting occupational hazard surveillance. This survey was designed to determine the range of MF levels at different industrial facilities so they could be categorized by MF levels and identified for possible subsequent personal exposure assessments. Industries were selected based on their annual electric power consumption in accordance with the hypothesis that large power consumers would have higher ambient MFs when compared with lower power consumers. Sixty-two facilities within thirteen 2-digit Standard Industrial Classifications (SIC) were selected based on their willingness to participate. A traditional industrial hygiene walkaround survey was conducted to identify MF sources, with a special emphasis on work stations.

  16. Mapping Diffuse Seismicity for Geothermal Reservoir Management with Matched Field Processing

    Broader source: Energy.gov [DOE]

    Project objective: to detect and locate more microearthquakes observed during EGS operations using the matched field processing (MFP) technique.

  17. DEVELOPMENT OF METHODOLOGY AND FIELD DEPLOYABLE SAMPLING TOOLS FOR SPENT NUCLEAR FUEL INTERROGATION IN LIQUID STORAGE

    SciTech Connect (OSTI)

    Berry, T.; Milliken, C.; Martinez-Rodriguez, M.; Hathcock, D.; Heitkamp, M.

    2012-06-04

    This project developed methodology and field deployable tools (test kits) to analyze the chemical and microbiological condition of the fuel storage medium and determine the oxide thickness on the spent fuel basin materials. The overall objective of this project was to determine the amount of time fuel has spent in a storage basin to determine if the operation of the reactor and storage basin is consistent with safeguard declarations or expectations. This project developed and validated forensic tools that can be used to predict the age and condition of spent nuclear fuels stored in liquid basins based on key physical, chemical and microbiological basin characteristics. Key parameters were identified based on a literature review, the parameters were used to design test cells for corrosion analyses, tools were purchased to analyze the key parameters, and these were used to characterize an active spent fuel basin, the Savannah River Site (SRS) L-Area basin. The key parameters identified in the literature review included chloride concentration, conductivity, and total organic carbon level. Focus was also placed on aluminum based cladding because of their application to weapons production. The literature review was helpful in identifying important parameters, but relationships between these parameters and corrosion rates were not available. Bench scale test systems were designed, operated, harvested, and analyzed to determine corrosion relationships between water parameters and water conditions, chemistry and microbiological conditions. The data from the bench scale system indicated that corrosion rates were dependent on total organic carbon levels and chloride concentrations. The highest corrosion rates were observed in test cells amended with sediment, a large microbial inoculum and an organic carbon source. A complete characterization test kit was field tested to characterize the SRS L-Area spent fuel basin. The sampling kit consisted of a TOC analyzer, a YSI

  18. Theoretically informed Monte Carlo simulation of liquid crystals by sampling of alignment-tensor fields.

    SciTech Connect (OSTI)

    Armas-Perez, Julio C.; Londono-Hurtado, Alejandro; Guzman, Orlando; Hernandez-Ortiz, Juan P.; de Pablo, Juan J.

    2015-07-27

    A theoretically informed coarse-grained Monte Carlo method is proposed for studying liquid crystals. The free energy functional of the system is described in the framework of the Landau-de Gennes formalism. The alignment field and its gradients are approximated by finite differences, and the free energy is minimized through a stochastic sampling technique. The validity of the proposed method is established by comparing the results of the proposed approach to those of traditional free energy minimization techniques. Its usefulness is illustrated in the context of three systems, namely, a nematic liquid crystal confined in a slit channel, a nematic liquid crystal droplet, and a chiral liquid crystal in the bulk. It is found that for systems that exhibit multiple metastable morphologies, the proposed Monte Carlo method is generally able to identify lower free energy states that are often missed by traditional approaches. Importantly, the Monte Carlo method identifies such states from random initial configurations, thereby obviating the need for educated initial guesses that can be difficult to formulate.

  19. Optimized Field Sampling and Monitoring of Airborne Hazardous Transport Plumes; A Geostatistical Simulation Approach

    SciTech Connect (OSTI)

    Chen, DI-WEN

    2001-11-21

    Airborne hazardous plumes inadvertently released during nuclear/chemical/biological incidents are mostly of unknown composition and concentration until measurements are taken of post-accident ground concentrations from plume-ground deposition of constituents. Unfortunately, measurements often are days post-incident and rely on hazardous manned air-vehicle measurements. Before this happens, computational plume migration models are the only source of information on the plume characteristics, constituents, concentrations, directions of travel, ground deposition, etc. A mobile ''lighter than air'' (LTA) system is being developed at Oak Ridge National Laboratory that will be part of the first response in emergency conditions. These interactive and remote unmanned air vehicles will carry light-weight detectors and weather instrumentation to measure the conditions during and after plume release. This requires a cooperative computationally organized, GPS-controlled set of LTA's that self-coordinate around the objectives in an emergency situation in restricted time frames. A critical step before an optimum and cost-effective field sampling and monitoring program proceeds is the collection of data that provides statistically significant information, collected in a reliable and expeditious manner. Efficient aerial arrangements of the detectors taking the data (for active airborne release conditions) are necessary for plume identification, computational 3-dimensional reconstruction, and source distribution functions. This report describes the application of stochastic or geostatistical simulations to delineate the plume for guiding subsequent sampling and monitoring designs. A case study is presented of building digital plume images, based on existing ''hard'' experimental data and ''soft'' preliminary transport modeling results of Prairie Grass Trials Site. Markov Bayes Simulation, a coupled Bayesian/geostatistical methodology, quantitatively combines soft information

  20. DEVELOPMENT AND FIELD IMPLEMENTATION OF AN IMPROVED METHOD FOR HEADSPACE GAS SAMPLING OF TRANSURANIC WASTE DRUMS

    SciTech Connect (OSTI)

    Polley, M.; Ankrom, J.; Wickland, T.; Warren, J.

    2003-02-27

    A fast, safe, and cost-effective method for obtaining headspace gas samples has been developed and implemented at Los Alamos National Laboratory (LANL). A sample port is installed directly into a drum lid using a pneumatic driver, allowing sampling with a side-port needle. Testing has shown that the sample port can be installed with no release of radioactive material. Use of this system at LANL has significantly reduced the time required for sampling, and eliminates the need for many safety precautions previously used. The system has significantly improved productivity and lowered radiation exposure and cost.

  1. Adsorptive Films in Support of In-field UF6 Destructive Assay Sample Collection and Analysis

    SciTech Connect (OSTI)

    Barrett, Christopher A.; Martinez, Alonzo; McNamara, Bruce K.; Cannon, Bret D.; Anheier, Norman C.

    2014-07-20

    International Atom Energy Agency (IAEA) safeguard verification measures in gaseous centrifuge enrichment plants (GCEPs) rely on environmental sampling, non-destructive assay (NDA), and destructive assay (DA) sampling and analysis to determine uranium enrichment. UF6 bias defect measurements are made by DA sampling and analysis to assure that enrichment is consistent with declarations. DA samples are collected from a limited number of cylinders for high precision, offsite mass spectrometer analysis. Samples are typically drawn from a sampling tap into a UF6 sample bottle, then packaged, sealed, and shipped under IAEA chain of custody to an offsite analytical laboratory. Future DA safeguard measures may require improvements in efficiency and effectiveness as GCEP capacities increase and UF6 shipping regulations become increasingly more restrictive. The Pacific Northwest National Laboratory (PNNL) DA sampler concept and Laser Ablation Absorption Ratio Spectrometry (LAARS) assay method are under development to potentially provide DA safeguard tools that increase inspection effectiveness and reduce sample shipping constraints. The PNNL DA sampler concept uses a handheld sampler to collect DA samples for either onsite LAARS assay or offsite laboratory analysis. The DA sampler design will use a small sampling planchet that is coated with an adsorptive film to collect controlled quantities of UF6 gas directly from a cylinder or process sampling tap. Development efforts are currently underway at PNNL to enhance LAARS assay performance to allow high-precision onsite bias defect measurements. In this paper, we report on the experimental investigation to develop adsorptive films for the PNNL DA sampler concept. These films are intended to efficiently capture UF6 and then stabilize the collected DA sample prior to onsite LAARS or offsite laboratory analysis. Several porous material composite films were investigated, including a film designed to maximize the chemical adsorption

  2. Method Evaluation And Field Sample Measurements For The Rate Of Movement Of The Oxidation Front In Saltstone

    SciTech Connect (OSTI)

    Almond, P. M.; Kaplan, D. I.; Langton, C. A.; Stefanko, D. B.; Spencer, W. A.; Hatfield, A.; Arai, Y.

    2012-08-23

    The objective of this work was to develop and evaluate a series of methods and validate their capability to measure differences in oxidized versus reduced saltstone. Validated methods were then applied to samples cured under field conditions to simulate Performance Assessment (PA) needs for the Saltstone Disposal Facility (SDF). Four analytical approaches were evaluated using laboratory-cured saltstone samples. These methods were X-ray absorption spectroscopy (XAS), diffuse reflectance spectroscopy (DRS), chemical redox indicators, and thin-section leaching methods. XAS and thin-section leaching methods were validated as viable methods for studying oxidation movement in saltstone. Each method used samples that were spiked with chromium (Cr) as a tracer for oxidation of the saltstone. The two methods were subsequently applied to field-cured samples containing chromium to characterize the oxidation state of chromium as a function of distance from the exposed air/cementitious material surface.

  3. Magnetic Field Mapping and Integral Transfer Function Matching of the Prototype Dipoles for the NSLS-II at BNL

    SciTech Connect (OSTI)

    He, P.; Jain, A., Gupta, R., Skaritka, J., Spataro, C., Joshi, P., Ganetis, G., Anerella, M., Wanderer, P.

    2011-03-28

    The National Synchrotron Light Source-II (NSLS-II) storage ring at Brookhaven National Laboratory (BNL) will be equipped with 54 dipole magnets having a gap of 35 mm, and 6 dipoles having a gap of 90 mm. Each dipole has a field of 0.4 T and provides 6 degrees of bending for a 3 GeV electron beam. The large aperture magnets are necessary to allow the extraction of long-wavelength light from the dipole magnet to serve a growing number of users of low energy radiation. The dipoles must not only have good field homogeneity (0.015% over a 40 mm x 20 mm region), but the integral transfer functions and integral end harmonics of the two types of magnets must also be matched. The 35 mm aperture dipole has a novel design where the yoke ends are extended up to the outside dimension of the coil using magnetic steel nose pieces. This design increases the effective length of the dipole without increasing the physical length. These nose pieces can be tailored to adjust the integral transfer function as well as the homogeneity of the integrated field. One prototype of each dipole type has been fabricated to validate the designs and to study matching of the two dipoles. A Hall probe mapping system has been built with three Group 3 Hall probes mounted on a 2-D translation stage. The probes are arranged with one probe in the midplane of the magnet and the others vertically offset by {+-}10 mm. The field is mapped around a nominal 25 m radius beam trajectory. The results of measurements in the as-received magnets, and with modifications made to the nose pieces are presented.

  4. ARM - Field Campaign - Full-column Greenhouse Gas Sampling 2012-2014

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    govCampaignsFull-column Greenhouse Gas Sampling 2012-2014 Campaign Links Final Campaign Report ARM Data Discovery Browse Data Related Campaigns Full-column Greenhouse Gas Sampling 2015-2017 2015.03.01, Fischer, SGP Balloon-Borne Full-column Greenhouse Gas Profiling 2014.03.01, Fischer, SGP Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : Full-column Greenhouse Gas Sampling 2012-2014 2012.01.13 - 2014.02.28 Lead Scientist : Marc Fischer

  5. CROSS SECTIONS AND FIELD MAPS: CHEROKEE AND BUG FIELDS, SAN JUAN COUNTY, UTAH, AND LITTLE UTE AND SLEEPING UTE FIELDS, MONTEZUMA COUNTY, COLORADO

    SciTech Connect (OSTI)

    Thomas C. Chidsey Jr; Craig D. Morgan; Kevin McClure; David E. Eby; Laura L. Wray

    2003-12-01

    Over 400 million barrels (64 million m{sup 3}) of oil have been produced from the shallow-shelf carbonate reservoirs in the Pennsylvanian (Desmoinesian) Paradox Formation in the Paradox Basin, Utah and Colorado. With the exception of the giant Greater Aneth field, the other 100 plus oil fields in the basin typically contain 2 to 10 million barrels (0.3-1.6 million m{sup 3}) of original oil in place. Most of these fields are characterized by high initial production rates followed by a very short productive life (primary), and hence premature abandonment. Only 15 to 25 percent of the original oil in place is recoverable during primary production from conventional vertical wells. An extensive and successful horizontal drilling program has been conducted in the giant Greater Aneth field. However, to date, only two horizontal wells have been drilled in small Ismay and Desert Creek fields. The results from these wells were disappointing due to poor understanding of the carbonate facies and diagenetic fabrics that create reservoir heterogeneity. These small fields, and similar fields in the basin, are at high risk of premature abandonment. At least 200 million barrels (31.8 million m{sup 3}) of oil will be left behind in these small fields because current development practices leave compartments of the heterogeneous reservoirs undrained. Through proper geological evaluation of the reservoirs, production may be increased by 20 to 50 percent through the drilling of low-cost single or multilateral horizontal legs from existing vertical development wells. In addition, horizontal drilling from existing wells minimizes surface disturbances and costs for field development, particularly in the environmentally sensitive areas of southeastern Utah and southwestern Colorado.

  6. Sediment and radionuclide transport in rivers. Summary report, field sampling program for Cattaraugus and Buttermilk Creeks, New York

    SciTech Connect (OSTI)

    Walters, W.H.; Ecker, R.M.; Onishi, Y.

    1982-11-01

    A three-phase field sampling program was conducted on the Buttermilk-Cattaraugus Creek system to investigate the transport of radionuclides in surface waters as part of a continuing program to provide data for application and verification of Pacific Northwest Laboratory's (PNL) sediment and radionuclide transport model, SERATRA. Phase 1 of the sampling program was conducted during November and December 1977; Phase 2 during September 1978; and Phase 3 during April 1979. Bed sediment, suspended sediment, and water samples were collected over a 45-mile reach of the creek system. Bed sediment samples were also collected at the mouth of Cattaraugus Creek in Lake Erie. A fourth sampling trip was conducted during May 1980 to obtain supplementary channel geometry data and flood plain sediment samples. Radiological analysis of these samples included gamma ray spectrometry analysis, and radiochemical separation and analysis of Sr-90, Pu-238, Pu-239,240, Am-241 and Cm-244. Tritium analysis was also performed on water samples. Based on the evaluation of radionuclide levels in Cattaraugus and Buttermilk Creeks, the Nuclear Fuel Services facility at West Valley, New York, may be the source of Cs-137, Sr-90, CS-134, Co-60, Pu-238, Pu-239,240, Am-241, Cm-244 and tritium found in the bed sediment, suspended sediment and water of Buttermilk and Cattaraugus Creeks.

  7. Reverberation mapping of the Kepler field AGN KA1858+4850

    SciTech Connect (OSTI)

    Pei, Liuyi; Barth, Aaron J.; Carson, Daniel J.; Aldering, Greg S.; Cucchiara, Antonino; Briley, Michael M.; Carroll, Carla J.; Cenko, S. Bradley; Edelson, Rick; Clubb, Kelsey I.; Cohen, Daniel P.; Filippenko, Alexei V.; Fox, Ori D.; Desjardins, Tyler D.; Fang, Jerome J.; Fedrow, Joseph M.; Furniss, Amy; Gates, Elinor L.; Gregg, Michael; Gustafson, Scott; and others

    2014-11-01

    KA1858+4850 is a narrow-line Seyfert 1 galaxy at redshift 0.078 and is among the brightest active galaxies monitored by the Kepler mission. We have carried out a reverberation mapping campaign designed to measure the broad-line region size and estimate the mass of the black hole in this galaxy. We obtained 74 epochs of spectroscopic data using the Kast Spectrograph at the Lick 3 m telescope from 2012 February to November, and obtained complementary V-band images from five other ground-based telescopes. We measured the H? light curve lag with respect to the V-band continuum light curve using both cross-correlation techniques (CCF) and continuum light curve variability modeling with the JAVELIN method and found rest-frame lags of ?{sub CCF}=13.53{sub ?2.32}{sup +2.03} days and ? {sub JAVELIN} =13.15{sub ?1.00}{sup +1.08} days. The H? rms line profile has a width of ?{sub line} = 770 49 km s{sup 1}. Combining these two results and assuming a virial scale factor of f = 5.13, we obtained a virial estimate of M{sub BH}=8.06{sub ?1.72}{sup +1.59}10{sup 6}M{sub ?} for the mass of the central black hole and an Eddington ratio of L/L {sub Edd} ? 0.2. We also obtained consistent but slightly shorter emission-line lags with respect to the Kepler light curve. Thanks to the Kepler mission, the light curve of KA1858+4850 has among the highest cadences and signal-to-noise ratios ever measured for an active galactic nucleus; thus, our black hole mass measurement will serve as a reference point for relations between black hole mass and continuum variability characteristics in active galactic nuclei.

  8. MAPPING INDUCED POLARIZATION WITH NATURAL ELECTROMAGNETIC FIELDS FOR EXPLORATION AND RESOURCES CHARACTERIZATION BY THE MINING INDUSTRY

    SciTech Connect (OSTI)

    Edward Nichols

    2001-10-20

    In this quarter we completed the field test of the first two prototypes of the MT-24/LF. Two prototypes were deployed in Japan as land remote reference systems during a marine MT survey. The two systems acquired data continuously for about two weeks. Data processing is in progress. The IP Target Test Area has been selected. The complete survey will be conducted in Arizona Safford-Sol prospect owned by Kennecott. This is a large porphyry copper with a significant IP response. Finally the Acquisition software has been completed.

  9. Groundwater Monitoring and Field Sampling Plan for Operable Unit 10-08

    SciTech Connect (OSTI)

    M. S. Roddy

    2007-05-01

    This plan describes the groundwater sampling and water level monitoring that will be conducted to evaluate contaminations in the Snake River Plain Aquifer entering and leaving the Idaho National Laboratory. The sampling and monitoring locations were selected to meet the data quality objectives detailed in this plan. Data for the Snake River Plain Aquifer obtained under this plan will be evaluated in the Operable Unit 10-08 Remedial Investigation/Feasibility Study report and will be used to support the Operable Unit 10-08 Sitewide groundwater model.

  10. Sediment and radionuclide transport in rivers. Phase 3. Field sampling program for Cattaraugus and Buttermilk Creeks, New York

    SciTech Connect (OSTI)

    Ecker, R.M.; Walters, W.H.; Onishi, Y.

    1982-08-01

    A field sampling program was conducted on Cattaraugus and Buttermilk Creeks, New York during April 1979 to investigate the transport of radionuclides in surface waters as part of a continuing program to provide data for application and verification of Pacific Northwest Laboratory's (PNL) sediment and radionuclide transport model, SERATRA. Bed sediment, suspended sediment and water samples were collected during unsteady flow conditions over a 45 mile reach of stream channel. Radiological analysis of these samples included gamma ray spectrometry analysis, and radiochemical separation and analysis of Sr-90, Pu-238, Pu-239, 240, Am-241 and Cm-244. Tritium analysis was also performed on water samples. Based on the evaluation of radionuclide levels in Cattaraugus and Buttermilk Creeks, the Nuclear Fuel Services facility at West Valley, New York, may be the source of Cs-137, Sr-90, Cs-134, Co-60, Pu-238, Pu-239, 240, Am-241, Cm-244 and tritium found in the bed sediment, suspended sediment and water of Buttermilk and Cattaraugus Creeks. This field sampling effort was the last of a three phase program to collect hydrologic and radiologic data at different flow conditions.

  11. Towards quantitative off-axis electron holographic mapping of the electric field around the tip of a sharp biased metallic needle

    SciTech Connect (OSTI)

    Beleggia, M.; Kasama, T.; Larson, D. J.; Kelly, T. F.; Dunin-Borkowski, R. E.; Pozzi, G.

    2014-07-14

    We apply off-axis electron holography and Lorentz microscopy in the transmission electron microscope to map the electric field generated by a sharp biased metallic tip. A combination of experimental data and modelling provides quantitative information about the potential and the field around the tip. Close to the tip apex, we measure a maximum field intensity of 82 MV/m, corresponding to a field k factor of 2.5, in excellent agreement with theory. In order to verify the validity of the measurements, we use the inferred charge density distribution in the tip region to generate simulated phase maps and Fresnel (out-of-focus) images for comparison with experimental measurements. While the overall agreement is excellent, the simulations also highlight the presence of an unexpected astigmatic contribution to the intensity in a highly defocused Fresnel image, which is thought to result from the geometry of the applied field.

  12. Order parameter re-mapping algorithm for 3D phase field model of grain growth using FEM

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Permann, Cody J.; Tonks, Michael R.; Fromm, Bradley; Gaston, Derek R.

    2016-01-14

    Phase field modeling (PFM) is a well-known technique for simulating microstructural evolution. To model grain growth using PFM, typically each grain is assigned a unique non-conserved order parameter and each order parameter field is evolved in time. Traditional approaches using a one-to-one mapping of grains to order parameters present a challenge when modeling large numbers of grains due to the computational expense of using many order parameters. This problem is exacerbated when using an implicit finite element method (FEM), as the global matrix size is proportional to the number of order parameters. While previous work has developed methods to reducemore » the number of required variables and thus computational complexity and run time, none of the existing approaches can be applied for an implicit FEM implementation of PFM. Here, we present a modular, dynamic, scalable reassignment algorithm suitable for use in such a system. Polycrystal modeling with grain growth and stress require careful tracking of each grain’s position and orientation which is lost when using a reduced order parameter set. In conclusion, the method presented in this paper maintains a unique ID for each grain even after reassignment, to allow the PFM to be tightly coupled to calculations of the stress throughout the polycrystal. Implementation details and comparative results of our approach are presented.« less

  13. Drilling, Sampling, and Well-Installation Plan for the IFC Well Field, 300 Area

    SciTech Connect (OSTI)

    Bjornstad, Bruce N.; Horner, Jacob A.

    2008-05-05

    The 300 Area was selected as a location for an IFC because it offers excellent opportunities for field research on the influence of mass-transfer processes on uranium in the vadose zone and groundwater. The 300 Area was the location of nuclear fuel fabrication facilities and has more than 100 waste sites. Two of these waste sites, the North and South Process Ponds received large volumes of process waste from 1943 to 1975 and are thought to represent a significant source of the groundwater uranium plume in the 300 Area. Geophysical surveys and other characterization efforts have led to selection of the South Process Pond for the IFC.

  14. Field Sampling Plan for the Operable Units 6-05 and 10-04 Remedial Action, Phase IV

    SciTech Connect (OSTI)

    R. Wells

    2006-11-14

    This Field Sampling Plan outlines the collection and analysis of samples in support of Phase IV of the Waste Area Group 10, Operable Units 6-05 and 10-04 remedial action. Phase IV addresses the remedial actions to areas with the potential for unexploded ordnance at the Idaho National Laboratory Site. These areas include portions of the Naval Proving Ground, the Arco High-Altitude Bombing Range, and the Twin Buttes Bombing Range. The remedial action consists of removal and disposal of ordnance by high-order detonation, followed by sampling to determine the extent, if any, of soil that might have been contaminated by the detonation activities associated with the disposal of ordnance during the Phase IV activities and explosives during the Phase II activities.

  15. Applying high resolution SyXRD analysis on sulfate attacked concrete field samples

    SciTech Connect (OSTI)

    Stroh, J.; Schlegel, M.-C.; Irassar, E.F.; Meng, B.; Emmerling, F.

    2014-12-15

    High resolution synchrotron X-ray diffraction (SyXRD) was applied for a microstructural profile analysis of concrete deterioration after sulfate attack. The cement matrices consist of ordinary Portland cement and different amounts of supplementary cementitious materials, such as fly ash, natural pozzolana and granulated blast furnace slag. The changes of the phase composition were determined along the direction of sulfate ingress. This approach allows the identification of reaction fronts and zones of different phase compositions and conclusions about the mechanisms of sulfate attack. Two reaction fronts were localized in the initial 4 mm from the sample surface. The mechanism of deterioration caused by the exposition in the sulfate-bearing soil is discussed. SyXRD is shown to be a reliable method for investigation of cementitious materials with aggregates embedded in natural environments.

  16. NGSI FY15 Final Report. Innovative Sample Preparation for in-Field Uranium Isotopic Determinations

    SciTech Connect (OSTI)

    Yoshida, Thomas M.; Meyers, Lisa

    2015-11-10

    Our FY14 Final Report included an introduction to the project, background, literature search of uranium dissolution methods, assessment of commercial off the shelf (COTS) automated sample preparation systems, as well as data and results for dissolution of bulk quantities of uranium oxides, and dissolution of uranium oxides from swipe filter materials using ammonium bifluoride (ABF). Also, discussed were reaction studies of solid ABF with uranium oxide that provided a basis for determining the ABF/uranium oxide dissolution mechanism. This report details the final experiments for optimizing dissolution of U3O8 and UO2 using ABF and steps leading to development of a Standard Operating Procedure (SOP) for dissolution of uranium oxides on swipe filters.

  17. Statistical techniques for detecting the intergalactic magnetic field from large samples of extragalactic Faraday rotation data

    SciTech Connect (OSTI)

    Akahori, Takuya; Gaensler, B. M.; Ryu, Dongsu E-mail: bryan.gaensler@sydney.edu.au

    2014-08-01

    Rotation measure (RM) grids of extragalactic radio sources have been widely used for studying cosmic magnetism. However, their potential for exploring the intergalactic magnetic field (IGMF) in filaments of galaxies is unclear, since other Faraday-rotation media such as the radio source itself, intervening galaxies, and the interstellar medium of our Galaxy are all significant contributors. We study statistical techniques for discriminating the Faraday rotation of filaments from other sources of Faraday rotation in future large-scale surveys of radio polarization. We consider a 30° × 30° field of view toward the south Galactic pole, while varying the number of sources detected in both present and future observations. We select sources located at high redshifts and toward which depolarization and optical absorption systems are not observed so as to reduce the RM contributions from the sources and intervening galaxies. It is found that a high-pass filter can satisfactorily reduce the RM contribution from the Galaxy since the angular scale of this component toward high Galactic latitudes would be much larger than that expected for the IGMF. Present observations do not yet provide a sufficient source density to be able to estimate the RM of filaments. However, from the proposed approach with forthcoming surveys, we predict significant residuals of RM that should be ascribable to filaments. The predicted structure of the IGMF down to scales of 0.°1 should be observable with data from the Square Kilometre Array, if we achieve selections of sources toward which sightlines do not contain intervening galaxies and RM errors are less than a few rad m{sup –2}.

  18. Extension of Studies with 3M Empore TM and Selentec MAG *SEP SM Technologies for Improved Radionuclide Field Sampling

    SciTech Connect (OSTI)

    Beals, D.M.; Bibler, J.P.; Brooks, D.A.

    1996-07-10

    The Savannah River Technology Center is evaluating new field sampling methodologies to more easily determine concentrations of radionuclides in aqueous systems. One methodology studied makes use of 3M EmporeTM disks. The disks are composed of selective resins embedded in a Teflon support. The disks remove the ion of interest from aqueous solutions when the solution is passed through the disk. The disk can then be counted directly to quantify the isotope of interest. Four types of disks were studied during this work: for the extraction of technetium (two types), cesium, plutonium, and strontium. A sampler has been developed for automated, unattended, in situ use of the EmporeTM disks.

  19. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........1 Water Sampling Locations at the Rulison, .........3 Water Sampling Field Activities Verification ...

  20. THE EFFECT OF LIMITED SPATIAL RESOLUTION OF STELLAR SURFACE MAGNETIC FIELD MAPS ON MAGNETOHYDRODYNAMIC WIND AND CORONAL X-RAY EMISSION MODELS

    SciTech Connect (OSTI)

    Garraffo, C.; Cohen, O.; Drake, J. J.; Downs, C.

    2013-02-10

    We study the influence of the spatial resolution on scales of 5 Degree-Sign and smaller of solar surface magnetic field maps on global magnetohydrodynamic solar wind models, and on a model of coronal heating and X-ray emission. We compare the solutions driven by a low-resolution Wilcox Solar Observatory magnetic map, the same map with spatial resolution artificially increased by a refinement algorithm, and a high-resolution Solar and Heliospheric Observatory Michelson Doppler Imager map. We find that both the wind structure and the X-ray morphology are affected by the fine-scale surface magnetic structure. Moreover, the X-ray morphology is dominated by the closed loop structure between mixed polarities on smaller scales and shows significant changes between high- and low-resolution maps. We conclude that three-dimensional modeling of coronal X-ray emission has greater surface magnetic field spatial resolution requirements than wind modeling, and can be unreliable unless the dominant mixed polarity magnetic flux is properly resolved.

  1. Sediment and radionuclide transport in rivers. Phase 2. Field sampling program for Cattaraugus and Buttermilk Creeks, New York

    SciTech Connect (OSTI)

    Walters, W.H.; Ecker, R.M.; Onishi, Y.

    1982-04-01

    As part of a study on sediment and radionuclide transport in rivers, Pacific Northwest Laboratory (PNL) is investigating the effect of sediment on the transport of radionuclides in Cattaraugus and Buttermilk Creeks, New York. A source of radioactivity in these creeks is the Western New York Nuclear Service Center which consists of a low-level waste disposal site and a nuclear fuel reprocessing plant. Other sources of radioactivity include fallout from worldwide weapons testing and natural background radioactivity. The major objective of the PNL Field Sampling Program is to provide data on sediment and radionuclide characteristics in Cattaraugus and Buttermilk Creeks to verify the use of the Sediment and Radionuclide Transport model, SERATRA, for nontidal rivers. This report covers the results of field data collection conducted during September 1978. Radiological analysis of sand, silt, and clay size fractions of suspended and bed sediment, and water were performed. Results of these analyses indicate that the principal radionuclides occurring in these two water courses, with levels significantly higher than background levels, during the Phase 2 sampling program were Cesium-137 and Strontium-90. These radionuclides had significantly higher activity levels above background in the bed sediment, suspended sediment, and water samples. Other radionuclides that are possibly being released into the surface water environment by the Nuclear Fuel Services facilities are Plutonium-238, 239, and 240, Americium-241, Curium-244, and Tritium. More radionuclides were consistently found in the bed sediment as compared to suspended sediment. The fewest radionuclides were found in the water of Buttermilk and Cattaraugus Creeks. The higher levels were found in the bed sediments for the gamma-emitters and in the suspended sediment for the alpha and beta-emitters (not including Tritium).

  2. X-ray fluorescence mapping

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    X-Ray Microscopy and Imaging: X-ray Fluorescence Mapping Of increasing scientific interest is the detection, quantification and mapping of elemental content of samples, often down...

  3. field

    National Nuclear Security Administration (NNSA)

    09%2A en Ten-Year Site Plans (TYSP) http:www.nnsa.energy.govaboutusouroperationsinfopsinfopstysp

    field field-type-text field-field-page-name">
  4. field

    National Nuclear Security Administration (NNSA)

    09%2A en Ten-Year Site Plans (TYSP) http:nnsa.energy.govaboutusouroperationsinfopsinfopstysp

    field field-type-text field-field-page-name">
  5. Atomically-resolved mapping of polarization and electric fields across ferroelectric-oxide interfaces by Z-contrast imaging

    SciTech Connect (OSTI)

    Chang, Hye Jung; Kalinin, Sergei; Morozovska, A. N.; Huijben, Mark; Chu, Ying-Hao; Yu, P; Ramesh, R.; Eliseev, E. A.; Svechnikov, S. V.; Pennycook, Stephen J; Borisevich, Albina Y

    2011-01-01

    Direct atomic displacement mapping at ferroelectric interfaces by aberration corrected scanning transmission electron microscopy(STEM) (a-STEM image, b-corresponding displacement profile) is combined with Landau-Ginsburg-Devonshire theory to obtain the complete interface electrostatics in real space, including separate estimates for the polarization and intrinsic interface charge contributions.

  6. Pulsed-field gel electrophoresis and radiation hybrid mapping analyses enable the ordering of eleven DNA loci in Xq22

    SciTech Connect (OSTI)

    O'Reilly, M.A.; Alterman, L.A.; Zijlstra, J.; Malcolm, S.; Levinsky, R.J.; Kinnon, C. )

    1993-02-01

    The Xq22 region of the human X chromosome encompasses the loci of several genes and random DNA markers whose relative positions have not been determined. By a combination of PFGE mapping and the analysis of a selected panel of X chromosome radiation hybrid cell lines, we have constructed physical maps of Xq22 that order a total of 11 polymorphic and nonpolymorphic DNA markers. Ten of these probes have been linked physically into three separate clusters, spanning nearly 6 Mb of DNA in total. The DXS94, DXS147, DXS211, DXS17, and DXS87 loci are all present on a 2.7-Mb MluI fragment; PLP, DXS54, DXS24, and DXS83 are present on MluI fragments spanning over 1.6 Mb; and DXS178 is present on a 1.5-Mb MluI fragment. Mapping with additional enzymes has allowed the further ordering of these loci with respect to each other. Together with these data, analysis of a small set of radiation hybrids has suggested the following overall order of loci with Xq22; centromere-DCS178-DXS94-DXS147-DXS211-DXS17-DXS87-PLP-DXS54-DXS24-DXS83-DOL4A5-telomere. The ordering of these random DNA markers, genes, and disease loci, including the genes responsible for Pelizaeus-Merzbacher disease and Alport syndrome, indicates DNA markers that could be of further use clinically for these diseases. Furthermore, this map should form a basis for the refinement of additional disease-associated loci in this region. 32 refs., 4 figs., 2 tabs.

  7. Denoising of B{sub 1}{sup +} field maps for noise-robust image reconstruction in electrical properties tomography

    SciTech Connect (OSTI)

    Michel, Eric; Hernandez, Daniel; Cho, Min Hyoung; Lee, Soo Yeol

    2014-10-15

    Purpose: To validate the use of adaptive nonlinear filters in reconstructing conductivity and permittivity images from the noisy B{sub 1}{sup +} maps in electrical properties tomography (EPT). Methods: In EPT, electrical property images are computed by taking Laplacian of the B{sub 1}{sup +} maps. To mitigate the noise amplification in computing the Laplacian, the authors applied adaptive nonlinear denoising filters to the measured complex B{sub 1}{sup +} maps. After the denoising process, they computed the Laplacian by central differences. They performed EPT experiments on phantoms and a human brain at 3 T along with corresponding EPT simulations on finite-difference time-domain models. They evaluated the EPT images comparing them with the ones obtained by previous EPT reconstruction methods. Results: In both the EPT simulations and experiments, the nonlinear filtering greatly improved the EPT image quality when evaluated in terms of the mean and standard deviation of the electrical property values at the regions of interest. The proposed method also improved the overall similarity between the reconstructed conductivity images and the true shapes of the conductivity distribution. Conclusions: The nonlinear denoising enabled us to obtain better-quality EPT images of the phantoms and the human brain at 3 T.

  8. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Old and New Rifle, Colorado, Processing Sites August 2013 LMS/RFN/RFO/S00613 This page intentionally left blank U.S. Department of Energy DVP-June 2013, Rifle, Colorado August 2013 RIN 13065380 Page i Contents Sampling Event Summary ...............................................................................................................1 Sample Location Map, New Rifle, Colorado, Processing Site ........................................................5 Sample Location Map, Old Rifle,

  9. Field Sampling Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System - 1997 Notice of Violation Consent Order

    SciTech Connect (OSTI)

    Evans, S.K.

    2002-01-31

    This Field Sampling Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System is one of two documents that comprise the Sampling and Analysis Plan for the HWMA/RCRA closure certification of the TRA-731 caustic and acid storage tank system at the Idaho National Engineering and Environmental Laboratory. This plan, which provides information about sampling design, required analyses, and sample collection and handling procedures, is to be used in conjunction with the Quality Assurance Project Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System.

  10. Field Sampling Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System - 1997 Notice of Violation Consent Order

    SciTech Connect (OSTI)

    Evans, Susan Kay; Orchard, B. J.

    2002-01-01

    This Field Sampling Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System is one of two documents that comprise the Sampling and Analysis Plan for the HWMA/RCRA closure certification of the TRA-731 caustic and acid storage tank system at the Idaho National Engineering and Environmental Laboratory. This plan, which provides information about sampling design, required analyses, and sample collection and handling procedures, is to be used in conjunction with the Quality Assurance Project Plan for the HWMA/RCRA Closure Certification of the TRA-731 Caustic and Acid Storage Tank System.

  11. September 2004 Water Sampling

    Office of Legacy Management (LM)

    4 Groundwater and Surface Water Sampling at the Slick Rock, Colorado, Processing Sites .........7 Water Sampling Field Activities Verification ...

  12. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Green River, Utah, Disposal Site August 2014 LMSGRN.........7 Water Sampling Field Activities Verification ...

  13. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and May 2014 Groundwater and Surface Water Sampling at the Shiprock, New Mexico, Disposal .........9 Water Sampling Field Activities Verification ...

  14. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Rio Blanco, Colorado, Site October 2014 LMSRBLS00514 .........5 Water Sampling Field Activities Verification ...

  15. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Natural Gas and Produced Water Sampling at the Rulison, Colorado, Site November 2014 LMS.........3 Water Sampling Field Activities Verification ...

  16. September 2004 Water Sampling

    Office of Legacy Management (LM)

    5 Groundwater and Surface Water Sampling at the Rulison, Colorado, Site October 2015 LMS.........5 Water Sampling Field Activities Verification ...

  17. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Monticello, Utah, Processing Site July 2015 LMSMNT.........7 Water Sampling Field Activities Verification ...

  18. September 2004 Water Sampling

    Office of Legacy Management (LM)

    2015 Groundwater and Surface Water Sampling at the Shiprock, New Mexico, Disposal Site .........9 Water Sampling Field Activities Verification ...

  19. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Rio Blanco, Colorado, Site October 2015 LMSRBLS00515 .........5 Water Sampling Field Activities Verification ...

  20. September 2004 Water Sampling

    Office of Legacy Management (LM)

    5 Produced Water Sampling at the Rulison, Colorado, Site May 2015 LMSRULS00115 Available .........3 Water Sampling Field Activities Verification ...

  1. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Natural Gas and Produced Water Sampling at the Gasbuggy, New Mexico, Site December 2013 .........5 Water Sampling Field Activities Verification ...

  2. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Produced Water Sampling at the Rulison, Colorado, Site January 2016 LMSRULS00915 .........3 Water Sampling Field Activities Verification ...

  3. September 2004 Water Sampling

    Office of Legacy Management (LM)

    3 Groundwater and Surface Water Sampling at the Monument Valley, Arizona, Processing Site .........7 Water Sampling Field Activities Verification ...

  4. September 2004 Water Sampling

    Office of Legacy Management (LM)

    July 2015 Groundwater and Surface Water Sampling at the Gunnison, Colorado, Processing .........5 Water Sampling Field Activities Verification ...

  5. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Monticello, Utah, Processing Site July 2014 LMSMNT.........7 Water Sampling Field Activities Verification ...

  6. September 2004 Water Sampling

    Office of Legacy Management (LM)

    3 Water Sampling at the Monticello, Utah, Processing Site January 2014 LMSMNTS01013 This .........7 Water Sampling Field Activities Verification ...

  7. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Naturita, Colorado Processing Site October 2013 LMSNAP.........5 Water Sampling Field Activities Verification ...

  8. September 2004 Water Sampling

    Office of Legacy Management (LM)

    4 Groundwater and Surface Water Sampling at the Gunnison, Colorado, Processing Site .........5 Water Sampling Field Activities Verification ...

  9. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Tuba City, Arizona, Disposal Site November 2013 LMSTUB.........9 Water Sampling Field Activities Verification ...

  10. September 2004 Water Sampling

    Office of Legacy Management (LM)

    5 Groundwater and Surface Water Sampling at the Monticello, Utah, Processing Site January .........7 Water Sampling Field Activities Verification ...

  11. Temperature dependent low-field measurements of the magnetocaloric ΔT with sub-mK resolution in small volume and thin film samples

    SciTech Connect (OSTI)

    Döntgen, J.; Rudolph, J.; Gottschall, T.; Gutfleisch, O.; Salomon, S.; Ludwig, A.; Hägele, D.

    2015-01-19

    We present temperature dependent ΔT measurements of the magnetocaloric effect in a thin film sample of Gd, employing magnetomodulation and detection of thermal radiation. A bulk sample of the metamagnetic material LaFe{sub 11.05}Co{sub 0.91}Si{sub 1.04} shows a strong broadening of the ΔT peak for increasing field amplitudes between 4 and 45 mT. Bulk Gd in comparison shows only a weak broadening. All investigated samples exhibit a clear quadratic dependence of ΔT on the external field H{sub ext} at the ΔT peak maximum, contrary to earlier predictions. An analytic expression is derived that interpolates between the H{sub ext}{sup 2}-behavior at low and the well-known H{sub ext}{sup 2/3}-behavior at high fields.

  12. Petrographic description of calcite/opal samples collected on field trip of December 5-9, 1992. Special report No. 7

    SciTech Connect (OSTI)

    Hill, C.A.; Schluter, C.M.

    1993-06-01

    This study is part of the research program of the Yucca Mountain Project intended to provide the State of Nevada with a detailed analysis and assessment of the water-deposited minerals of Yucca Mountain and adjacent regions. Forty-three separate stops were made and 203 samples were collected during the five days of the field trip. This report describes petrographic observations made on the calcite/opal samples.

  13. Network Maps

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Network Maps Engineering Services The Network Network Maps Network Traffic Volume Historical Network Maps Network Facts & Stats Connected Sites Peering Connections ESnet...

  14. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Equipment Blank Data ...

  15. Hot Pot Field Observations

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Lane, Michael

    Map of field observations including depressions, springs, evidence of former springs, travertine terraces and vegetation patterns. Map also contains interpretation of possible spring alignments.

  16. Hot Pot Field Observations

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Lane, Michael

    2013-06-28

    Map of field observations including depressions, springs, evidence of former springs, travertine terraces and vegetation patterns. Map also contains interpretation of possible spring alignments.

  17. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOE Patents [OSTI]

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  18. SU-E-J-246: A Deformation-Field Map Based Liver 4D CBCT Reconstruction Method Using Gold Nanoparticles as Constraints

    SciTech Connect (OSTI)

    Harris, W; Zhang, Y; Ren, L; Yin, F

    2014-06-01

    Purpose: To investigate the feasibility of using nanoparticle markers to validate liver tumor motion together with a deformation field map-based four dimensional (4D) cone-beam computed tomography (CBCT) reconstruction method. Methods: A technique for lung 4D-CBCT reconstruction has been previously developed using a deformation field map (DFM)-based strategy. In this method, each phase of the 4D-CBCT is considered as a deformation of a prior CT volume. The DFM is solved by a motion modeling and free-form deformation (MM-FD) technique, using a data fidelity constraint and the deformation energy minimization. For liver imaging, there is low contrast of a liver tumor in on-board projections. A validation of liver tumor motion using implanted gold nanoparticles, along with the MM-FD deformation technique is implemented to reconstruct onboard 4D CBCT liver radiotherapy images. These nanoparticles were placed around the liver tumor to reflect the tumor positions in both CT simulation and on-board image acquisition. When reconstructing each phase of the 4D-CBCT, the migrations of the gold nanoparticles act as a constraint to regularize the deformation field, along with the data fidelity and the energy minimization constraints. In this study, multiple tumor diameters and positions were simulated within the liver for on-board 4D-CBCT imaging. The on-board 4D-CBCT reconstructed by the proposed method was compared with the “ground truth” image. Results: The preliminary data, which uses reconstruction for lung radiotherapy suggests that the advanced reconstruction algorithm including the gold nanoparticle constraint will Resultin volume percentage differences (VPD) between lesions in reconstructed images by MM-FD and “ground truth” on-board images of 11.5% (± 9.4%) and a center of mass shift of 1.3 mm (± 1.3 mm) for liver radiotherapy. Conclusion: The advanced MM-FD technique enforcing the additional constraints from gold nanoparticles, results in improved accuracy

  19. Mapping intra-field yield variation using high resolution satellite imagery to integrate bioenergy and environmental stewardship in an agricultural watershed

    SciTech Connect (OSTI)

    Hamada, Yuki; Ssegane, Herbert; Negri, Maria Cristina

    2015-07-31

    Biofuels are important alternatives for meeting our future energy needs. Successful bioenergy crop production requires maintaining environmental sustainability and minimum impacts on current net annual food, feed, and fiber production. The objectives of this study were to: (1) determine under-productive areas within an agricultural field in a watershed using a single date; high resolution remote sensing and (2) examine impacts of growing bioenergy crops in the under-productive areas using hydrologic modeling in order to facilitate sustainable landscape design. Normalized difference indices (NDIs) were computed based on the ratio of all possible two-band combinations using the RapidEye and the National Agricultural Imagery Program images collected in summer 2011. A multiple regression analysis was performed using 10 NDIs and five RapidEye spectral bands. The regression analysis suggested that the red and near infrared bands and NDI using red-edge and near infrared that is known as the red-edge normalized difference vegetation index (RENDVI) had the highest correlation (R2 = 0.524) with the reference yield. Although predictive yield map showed striking similarity to the reference yield map, the model had modest correlation; thus, further research is needed to improve predictive capability for absolute yields. Forecasted impact using the Soil and Water Assessment Tool model of growing switchgrass (Panicum virgatum) on under-productive areas based on corn yield thresholds of 3.1, 4.7, and 6.3 Mg·ha-1 showed reduction of tile NO3-N and sediment exports by 15.9%–25.9% and 25%–39%, respectively. Corresponding reductions in water yields ranged from 0.9% to 2.5%. While further research is warranted, the study demonstrated the integration of remote sensing and hydrologic modeling to quantify the multifunctional value of projected future landscape patterns in a context of sustainable bioenergy crop production.

  20. Mapping intra-field yield variation using high resolution satellite imagery to integrate bioenergy and environmental stewardship in an agricultural watershed

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Hamada, Yuki; Ssegane, Herbert; Negri, Maria Cristina

    2015-07-31

    Biofuels are important alternatives for meeting our future energy needs. Successful bioenergy crop production requires maintaining environmental sustainability and minimum impacts on current net annual food, feed, and fiber production. The objectives of this study were to: (1) determine under-productive areas within an agricultural field in a watershed using a single date; high resolution remote sensing and (2) examine impacts of growing bioenergy crops in the under-productive areas using hydrologic modeling in order to facilitate sustainable landscape design. Normalized difference indices (NDIs) were computed based on the ratio of all possible two-band combinations using the RapidEye and the National Agriculturalmore » Imagery Program images collected in summer 2011. A multiple regression analysis was performed using 10 NDIs and five RapidEye spectral bands. The regression analysis suggested that the red and near infrared bands and NDI using red-edge and near infrared that is known as the red-edge normalized difference vegetation index (RENDVI) had the highest correlation (R2 = 0.524) with the reference yield. Although predictive yield map showed striking similarity to the reference yield map, the model had modest correlation; thus, further research is needed to improve predictive capability for absolute yields. Forecasted impact using the Soil and Water Assessment Tool model of growing switchgrass (Panicum virgatum) on under-productive areas based on corn yield thresholds of 3.1, 4.7, and 6.3 Mg·ha-1 showed reduction of tile NO3-N and sediment exports by 15.9%–25.9% and 25%–39%, respectively. Corresponding reductions in water yields ranged from 0.9% to 2.5%. While further research is warranted, the study demonstrated the integration of remote sensing and hydrologic modeling to quantify the multifunctional value of projected future landscape patterns in a context of sustainable bioenergy crop production.« less

  1. Location Map

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Lane, Michael

    Map file package containing shaded relief base with Hot Pot project area, major roads, railroads, and rivers. The inset map shows regional Paleozoic structural elements.

  2. Location Map

    SciTech Connect (OSTI)

    Lane, Michael

    2013-06-27

    Map file package containing shaded relief base with Hot Pot project area, major roads, railroads, and rivers. The inset map shows regional Paleozoic structural elements.

  3. September 2004 Water Sampling

    Office of Legacy Management (LM)

    5 Groundwater and Surface Water Sampling at the Tuba City, Arizona Disposal Site June 2015 .........7 Water Sampling Field Activities Verification ...

  4. Sample size requirements for estimating effective dose from computed tomography using solid-state metal-oxide-semiconductor field-effect transistor dosimetry

    SciTech Connect (OSTI)

    Trattner, Sigal; Cheng, Bin; Pieniazek, Radoslaw L.; Hoffmann, Udo; Douglas, Pamela S.; Einstein, Andrew J.

    2014-04-15

    Purpose: Effective dose (ED) is a widely used metric for comparing ionizing radiation burden between different imaging modalities, scanners, and scan protocols. In computed tomography (CT), ED can be estimated by performing scans on an anthropomorphic phantom in which metal-oxide-semiconductor field-effect transistor (MOSFET) solid-state dosimeters have been placed to enable organ dose measurements. Here a statistical framework is established to determine the sample size (number of scans) needed for estimating ED to a desired precision and confidence, for a particular scanner and scan protocol, subject to practical limitations. Methods: The statistical scheme involves solving equations which minimize the sample size required for estimating ED to desired precision and confidence. It is subject to a constrained variation of the estimated ED and solved using the Lagrange multiplier method. The scheme incorporates measurement variation introduced both by MOSFET calibration, and by variation in MOSFET readings between repeated CT scans. Sample size requirements are illustrated on cardiac, chest, and abdomenpelvis CT scans performed on a 320-row scanner and chest CT performed on a 16-row scanner. Results: Sample sizes for estimating ED vary considerably between scanners and protocols. Sample size increases as the required precision or confidence is higher and also as the anticipated ED is lower. For example, for a helical chest protocol, for 95% confidence and 5% precision for the ED, 30 measurements are required on the 320-row scanner and 11 on the 16-row scanner when the anticipated ED is 4 mSv; these sample sizes are 5 and 2, respectively, when the anticipated ED is 10 mSv. Conclusions: Applying the suggested scheme, it was found that even at modest sample sizes, it is feasible to estimate ED with high precision and a high degree of confidence. As CT technology develops enabling ED to be lowered, more MOSFET measurements are needed to estimate ED with the same

  5. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Water Sampling at the Ambrosia Lake, New Mexico, Disposal Site February 2015 LMS/AMB/S01114 This page intentionally left blank U.S. Department of Energy DVP-November 2014, Ambrosia Lake, New Mexico February 2015 RIN 14116607 Page i Contents Sampling Event Summary ...............................................................................................................1 Ambrosia Lake, NM, Disposal Site Planned Sampling Map...........................................................3 Data

  6. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Sampling at the Ambrosia Lake, New Mexico, Disposal Site March 2016 LMS/AMB/S01215 This page intentionally left blank U.S. Department of Energy DVP-December 2015, Ambrosia Lake, New Mexico March 2016 RIN 15117494 Page i Contents Sampling Event Summary ...............................................................................................................1 Ambrosia Lake, NM, Disposal Site Planned Sampling Map...........................................................3 Data Assessment

  7. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Monument Valley, Arizona, Processing Site February 2015 LMS/MON/S01214 This page intentionally left blank U.S. Department of Energy DVP-December 2014, Monument Valley, Arizona February 2015 RIN 14126645 Page i Contents Sampling Event Summary ...............................................................................................................1 Monument Valley, Arizona, Disposal Site Sample Location Map ..................................................5

  8. September 2004 Water Sampling

    Office of Legacy Management (LM)

    4 Alternate Water Supply System Sampling at the Riverton, Wyoming, Processing Site May 2014 LMS/RVT/S00314 This page intentionally left blank U.S. Department of Energy DVP-March 2014, Riverton, Wyoming May 2014 RIN 14035986 Page i Contents Sampling Event Summary ...............................................................................................................1 Riverton, WY, Processing Site, Sample Location Map ...................................................................3 Data

  9. September 2004 Water Sampling

    Office of Legacy Management (LM)

    February 2015 Groundwater and Surface Water Sampling at the Grand Junction, Colorado, Site April 2015 LMS/GJO/S00215 This page intentionally left blank U.S. Department of Energy DVP-February 2015, Grand Junction, Colorado, Site April 2015 RIN 15026795 Page i Contents Sampling Event Summary ...............................................................................................................1 Grand Junction, Colorado, Site Sample Location Map

  10. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Sampling at the Grand Junction, Colorado, Disposal Site November 2013 LMS/GRJ/S00813 This page intentionally left blank U.S. Department of Energy DVP-August 2013, Grand Junction, Colorado November 2013 RIN 13075515 Page i Contents Sampling Event Summary ...............................................................................................................1 Grand Junction, Colorado, Disposal Site Sample Location Map ....................................................3 Data Assessment

  11. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Groundwater and Surface Water Sampling at the Slick Rock East and West, Colorado, Processing Sites November 2013 LMS/SRE/SRW/S0913 This page intentionally left blank U.S. Department of Energy DVP-September 2013, Slick Rock, Colorado November 2013 RIN 13095593 Page i Contents Sampling Event Summary ...............................................................................................................1 Slick Rock East and West, Colorado, Processing Sites, Sample Location Map

  12. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........7 Water Sampling Field Activities Verification ... Groundwater Quality Data Static Water Level Data Time-Concentration Graphs ...

  13. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........9 Water Sampling Field Activities Verification ... Data Durango Processing Site Surface Water Quality Data Equipment Blank Data Static ...

  14. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........3 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Natural Gas Analysis Data ...

  15. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Static Water Level Data Hydrographs Time-Concentration ...

  16. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Static Water Level Data Hydrograph Time-Concentration ...

  17. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Time-Concentration Graph ...

  18. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Quality Data Equipment Blank Data Static Water Level Data Time-Concentration Graphs ...

  19. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Static Water Level Data Time-Concentration Graphs ...

  20. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........9 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Static Water Level Data ...

  1. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........3 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Time-Concentration Graphs ...

  2. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........7 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Equipment Blank Data Static ...

  3. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Equipment Blank Data Static ...

  4. Field sampling and analysis plan for the removal action at the former YS-860 Firing Ranges, Oak Ridge Y-12 Plant, Oak Ridge, Tennessee

    SciTech Connect (OSTI)

    1998-03-01

    The former YS-860 Firing Ranges are located at the eastern end of the Oak Ridge Y-12 Plant outside the primary facility fence line and west of Scarboro Road within the Upper East Fork Poplar Creek watershed in Oak Ridge, Tennessee. A decision has been made by the US Department of Energy to conduct a removal action of lead-contaminated soils at this site as part of early source actions within the Upper East Fork Poplar Creek watershed. This non-time critical removal action of bullets and lead-contaminated soil from the YS-860 Firing Ranges is being conducted as a Comprehensive Environmental Response, Compensation, and Liability Act of 1980 action. These actions are consistent with the Oak Ridge Reservation Environmental Restoration Program. The removal action will focus on the excavation of bullets and lead-contaminated soil from the shooting range berms, transportation of the material to a permitted treatment facility for disposal, demolition and land filling of a concrete trench and asphalt pathways at the site, and grading and revegetating of the entire site. This report is the field sampling and analysis plan for the removal action at the former YS-860 Firing Ranges. The field sampling and analysis plan addresses environmental sampling for lead after the removal of lead-contaminated soil from the target berm area. The objective of this sampling plan is to obtain sufficient analytical data to confirm that the removal action excavation has successfully reduced lead levels in soil to below the action level of 1,400 micrograms/g.

  5. Water Sampling | Open Energy Information

    Open Energy Info (EERE)

    Water Sampling Details Activities (63) Areas (51) Regions (5) NEPA(2) Exploration Technique Information Exploration Group: Field Techniques Exploration Sub Group: Field Sampling...

  6. [Environmental investigation of ground water contamination at Wright-Patterson Air Force Base, Ohio]. Volume 3, Sampling and analysis plan (SAP): Phase 1, Task 4, Field Investigation: Draft

    SciTech Connect (OSTI)

    Not Available

    1991-10-01

    In April 1990, Wright-Patterson Air Force Base (WPAFB), initiated an investigation to evaluate a potential Comprehensive Environmental Response, Compensation, and Liability Act (CERCLA) removal action to prevent, to the extent practicable, the offsite migration of contaminated ground water from WPAFB. WPAFB retained the services of the Environmental Management Operations (EMO) and its principle subcontractor, International Technology Corporation (IT) to complete Phase 1 of the environmental investigation of ground-water contamination at WPAFB. Phase 1 of the investigation involves the short-term evaluation and potential design for a program to remove ground-water contamination that appears to be migrating across the western boundary of Area C, and across the northern boundary of Area B along Springfield Pike. Primarily, Task 4 of Phase 1 focuses on collection of information at the Area C and Springfield Pike boundaries of WPAFB. This Sampling and Analysis Plan (SAP) has been prepared to assist in completion of the Task 4 field investigation and is comprised of the Quality Assurance Project Plan (QAPP) and the Field Sampling Plan (FSP).

  7. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Bluewater, New Mexico, Disposal Site February 2014 LMS/BLU/S01113 This page intentionally left blank U.S. Department of Energy DVP-November 2013, Bluewater, New Mexico February 2014 RIN 13115746 Page i Contents Sampling Event Summary ...............................................................................................................1 Bluewater, New Mexico, Disposal Site Sample Location Map.......................................................5 Data Assessment Summary

  8. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Burrell, Pennsylvania, Disposal Site January 2014 LMS/BUR/S01113 This page intentionally left blank U.S. Department of Energy DVP-November 2013, Burrell, Pennsylvania January 2014 RIN 13095638 Page i Contents Sampling Event Summary ...............................................................................................................1 Burrell, Pennsylvania, Disposal Site, Sample Location Map ..........................................................3 Data Assessment Summary

  9. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Canonsburg, Pennsylvania, Disposal Site February 2014 LMS/CAN/S01113 This page intentionally left blank U.S. Department of Energy DVP-November 2013, Canonsburg, Pennsylvania February 2014 RIN 13095639 Page i Contents Sampling Event Summary ...............................................................................................................1 Canonsburg, Pennsylvania, Disposal Site, Sample Location Map ..................................................3 Data Assessment Summary

  10. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Disposal Site August 2014 LMS/LKD/S00514 This page intentionally left blank U.S. Department of Energy DVP-May 2014, Lakeview, Oregon, Disposal August 2014 RIN 14056157 Page i Contents Sampling Event Summary ...............................................................................................................1 Lakeview, Oregon, Disposal Site, Sample Location Map ...............................................................3 Data Assessment Summary

  11. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Processing Site August 2014 LMS/LKP/S00514 This page intentionally left blank U.S. Department of Energy DVP-May 2014, Lakeview, Oregon, Processing August 2014 RIN 14056157 and 14056158 Page i Contents Sampling Event Summary ...............................................................................................................1 Lakeview, Oregon, Processing Site, Sample Location Map ............................................................3 Data Assessment Summary

  12. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Riverton, Wyoming, Processing Site September 2013 LMS/RVT/S00613 This page intentionally left blank U.S. Department of Energy DVP-June 2013, Riverton, Wyoming September 2013 RIN 13065379 Page i Contents Sampling Event Summary ...............................................................................................................1 Riverton, Wyoming, Processing Site, Sample Location Map .........................................................5 Data Assessment Summary

  13. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Riverton, Wyoming, Processing Site February 2016 LMS/RVT/S00915 This page intentionally left blank U.S. Department of Energy DVP-September 2015, Riverton, Wyoming February 2016 RINs 15097345, 15097346, and 15097347 Page i Contents Sampling Event Summary ...............................................................................................................1 Riverton, Wyoming, Processing Site Planned Sampling Location Map .........................................7 Data Assessment Summary

  14. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Rifle, Colorado, New and Old Processing Sites January 2014 LMS/RFN/RFO/S01113 This page intentionally left blank U.S. Department of Energy DVP-November 2013, Rifle, Colorado January 2014 RIN 13115731 Page i Contents Sampling Event Summary ...............................................................................................................1 New Rifle, Colorado, Processing Site, Sample Location Map ........................................................5 Old Rifle, Colorado, Processing

  15. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Old and New Rifle, Colorado, Processing Sites January 2015 LMS/RFN/RFO/S01114 This page intentionally left blank U.S. Department of Energy DVP-November 2014, Rifle, Colorado January 2015 RINs 14106568 and 14106569 Page i Contents Sampling Event Summary ...............................................................................................................1 New Rifle, Colorado, Processing Site, Planned Sampling Map ......................................................3 Old Rifle,

  16. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Slick Rock, Colorado, Processing Sites January 2016 LMS/SRE/SRW/S00915 This page intentionally left blank U.S. Department of Energy DVP-September 2015, Slick Rock, Colorado January 2016 RINs 15087319 and 15107424 Page i Contents Sampling Event Summary ...............................................................................................................1 Slick Rock, Colorado, Processing Sites, Sample Location Map .....................................................5 Data Assessment

  17. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and September 2013 Groundwater and Surface Water Sampling at the Durango, Colorado, Disposal and Processing Sites March 2014 LMS/DUD/DUP/S00613 This page intentionally left blank U.S. Department of Energy DVP-June and September 2013, Durango, Colorado March 2014 RIN 13055370 and 13085577 Page i Contents Sampling Event Summary ...............................................................................................................1 Durango, Colorado, Disposal Site Sample Location Map-June

  18. Site Map

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Access to the ALS Gate Access Guest House Lab Shuttles Maps and Directions Parking Safety Experiment Safety Safety for Staff In Case of Emergency Resources Acronyms Multimedia ...

  19. Near-Field Magneto-Optical Microscope

    SciTech Connect (OSTI)

    Vlasko-Vlasov, Vitalii; Welp, Ulrich; and Crabtree, George W.

    2005-12-06

    A device and method for mapping magnetic fields of a sample at a resolution less than the wavelength of light without altering the magnetic field of the sample is disclosed. A device having a tapered end portion with a magneto-optically active particle positioned at the distal end thereof in communication with a fiber optic for transferring incoming linearly polarized light from a source thereof to the particle and for transferring reflected light from the particle is provided. The fiber optic has a reflective material trapping light within the fiber optic and in communication with a light detector for determining the polarization of light reflected from the particle as a function of the strength and direction of the magnetic field of the sample. Linearly polarized light from the source thereof transferred to the particle positioned proximate the sample is affected by the magnetic field of the sample sensed by the particle such that the difference in polarization of light entering and leaving the particle is due to the magnetic field of the sample. Relative movement between the particle and sample enables mapping.

  20. Near Field Magneto-Optical Microscope

    DOE Patents [OSTI]

    Vlasko-Vlasov, Vitalii K.; Welp, Ulrich; Crabtree, George W.

    2005-12-06

    A device and method for mapping magnetic fields of a sample at a resolution less than the wavelength of light without altering the magnetic field of the sample is disclosed. A device having a tapered end portion with a magneto-optically active particle positioned at the distal end thereof in communication with a fiber optic for transferring incoming linearly polarized light from a source thereof to the particle and for transferring reflected light from the particle is provided. The fiber optic has a reflective material trapping light within the fiber optic and in communication with a light detector for determining the polarization of light reflected from the particle as a function of the strength and direction of the magnetic field of the sample. Linearly polarized light from the source thereof transferred to the particle positioned proximate the sample is affected by the magnetic field of the sample sensed by the particle such that the difference in polarization of light entering and leaving the particle is due to the magnetic field of the sample. Relative movement between the particle and sample enables mapping.

  1. ANL's Map and Data Browser

    Energy Science and Technology Software Center (OSTI)

    1998-07-13

    The MaD browser is a web browser Java applet developed to display and interact with vector graphic (map) objects, relational database tables, and other data sources. It was designed for use in remedial action projects to quickly and widely disseminate sampling results but is generally applicable to many other mapping situations. Its primary value is its simplicity and general availability.

  2. Simultaneous orientation and thickness mapping in transmission electron microscopy

    SciTech Connect (OSTI)

    Tyutyunnikov, Dmitry; Özdöl, V. Burak; Koch, Christoph T.

    2014-12-04

    In this paper we introduce an approach for simultaneous thickness and orientation mapping of crystalline samples by means of transmission electron microscopy. We show that local thickness and orientation values can be extracted from experimental dark-field (DF) image data acquired at different specimen tilts. The method has been implemented to automatically acquire the necessary data and then map thickness and crystal orientation for a given region of interest. We have applied this technique to a specimen prepared from a commercial semiconductor device, containing multiple 22 nm technology transistor structures. The performance and limitations of our method are discussed and compared to those of other techniques available.

  3. Analysis of acid precipitation samples collected by state agencies sampling period: January-December 1992. Annual project report

    SciTech Connect (OSTI)

    Shepard, L.S.

    1995-03-01

    The report presents analytical data from the 30 acid precipitation collection sites in the State-Operated Network. Samples are collected weekly in plastic bag bucket liners and shipped in 500 mL polyethylene bottles to Global Geochemistry Corporation, the central laboratory for the network. The report contains maps showing the location of each site, plots of analytical data, tables of all field and analytical data, plots comparing field and laboratory pH and conductivity, and information on data quality. Samples are analyzed for pH, strong acid, conductivity, fluoride, chloride, nitrite, phosphate, bromide, nitrate, sulfate, ammonium, sodium, potassium, calcium, and magnesium.

  4. Site Map

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Home » Site Map Site Map Home About Overview NERSC Mission Contact us Staff Center Leadership Sudip Dosanjh Sudip Dosanjh: Select Publications Jeff Broughton Katie Antypas Richard Gerber Publications Center Administration James Craw Norma Early Jeff Grounds Betsy MacGowan Zaida McCunney Kerri Peyovich Lynn Rippe David Tooker Center Communications Jon Bashor Kathy Kincade Linda Vu Margie Wylie Advanced Technologies Nicholas Wright Brian Austin Research Projects Christopher Daley Glenn K.

  5. DOE - NNSA/NFO -- Site Map

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    SiteMap NNSANFO Language Options U.S. DOENNSA - Nevada Field Office NATIONAL SECURITY ENVIRONMENTAL PROGRAMS National Security Stockpile Stewardship BEEF CEF DAF ...

  6. Digital Mapping Of Structurally Controlled Geothermal Features...

    Open Energy Info (EERE)

    : GRC; p. () Related Geothermal Exploration Activities Activities (1) Field Mapping At Brady Hot Springs Area (Coolbaugh, Et Al., 2004) Areas (1) Brady Hot Springs Area Regions...

  7. Energy Citations Database (ECD) - Site Map

    Office of Scientific and Technical Information (OSTI)

    Site Map Home Basic Search Fielded Search Document Availability About ECD Help FAQ Contact Us Website Policies and Important Links Alerts Log On Alerts Registration Alerts Help...

  8. Observation of multiple ionization pathways for OCS in an intense laser field resolved by three-dimensional covariance mapping and visualized by hierarchical ionization topology

    SciTech Connect (OSTI)

    Bryan, W. A.; Newell, W. R.; Sanderson, J. H.; Langley, A. J. [Department of Physics and Astronomy, University College London, Gower Street, London WC1E 6BT (United Kingdom); Department of Physics, University of Waterloo, Waterloo, Ontario, N2L 3G1 (Canada); Central Laser Facility, Rutherford Appleton Laboratory, Chilton, Didcot, Oxon OX11 0QX (United Kingdom)

    2006-11-15

    The two- and three-body Coulomb explosion of carbonyl sulfide (OCS) by 790 nm, 50 fs laser pulses focused to {approx_equal}10{sup 16} W cm{sup -2} has been investigated by the three-dimensional covariance mapping technique. In a triatomic molecule, a single charge state, in this case the trication, has been observed to dissociate into two distinct energy channels. With the aid of a three-dimensional visualization technique to reveal the ionization hierarchy, evidence is presented for the existence of two sets of ionization pathways resulting from these two initial states. While one group of ions can be modeled using a classical enhanced ionization model, the second group, consisting of mainly asymmetric channels, cannot. The results provide clear evidence that an enhanced ionization approach must also be accompanied by an appreciation of the effects of excited ionic states and multielectronic processes.

  9. Quantitative prediction of radio frequency induced local heating derived from measured magnetic field maps in magnetic resonance imaging: A phantom validation at 7 T

    SciTech Connect (OSTI)

    Zhang, Xiaotong; Liu, Jiaen; Van de Moortele, Pierre-Francois; Schmitter, Sebastian; He, Bin

    2014-12-15

    Electrical Properties Tomography (EPT) technique utilizes measurable radio frequency (RF) coil induced magnetic fields (B1 fields) in a Magnetic Resonance Imaging (MRI) system to quantitatively reconstruct the local electrical properties (EP) of biological tissues. Information derived from the same data set, e.g., complex numbers of B1 distribution towards electric field calculation, can be used to estimate, on a subject-specific basis, local Specific Absorption Rate (SAR). SAR plays a significant role in RF pulse design for high-field MRI applications, where maximum local tissue heating remains one of the most constraining limits. The purpose of the present work is to investigate the feasibility of such B1-based local SAR estimation, expanding on previously proposed EPT approaches. To this end, B1 calibration was obtained in a gelatin phantom at 7 T with a multi-channel transmit coil, under a particular multi-channel B1-shim setting (B1-shim I). Using this unique set of B1 calibration, local SAR distribution was subsequently predicted for B1-shim I, as well as for another B1-shim setting (B1-shim II), considering a specific set of parameter for a heating MRI protocol consisting of RF pulses plaid at 1% duty cycle. Local SAR results, which could not be directly measured with MRI, were subsequently converted into temperature change which in turn were validated against temperature changes measured by MRI Thermometry based on the proton chemical shift.

  10. Site Map

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Site Map Expand All | Collapse All Item Sir John Pople, Gaussian Code, and Complex Chemical Reactions Item DOE Research and Development Accomplishments Click to expand or collapse folder Folder DOE Research and Development Accomplishments About Item The Manhattan Project Click to expand or collapse folder Folder DOE Research and Development Accomplishments Alfred Nobel Laureates Associated with the DOE and Predecessors Item Abdus Salam and his International Influences Item Ahmed Zewail and

  11. Site Map | Geothermal

    Office of Scientific and Technical Information (OSTI)

    Site Map Site Map Home Basic Search Advanced Search Geothermal FAQ About Geothermal Site Map Geothermal Feedback Website PoliciesImportant Links

  12. Site Map | DOE Patents

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Site Map Site Map Home Basic Search Advanced Search DOEpatents FAQ About DOEpatents Site Map Contact Us Website Policies/Important Links

  13. Manhattan Project: Maps

    Office of Scientific and Technical Information (OSTI)

    Scroll down to view thumbnails of each map. Leslie Groves looks at a map of Japan. Manhattan Project: General Manhattan Project Facilities Places map "Signature Facilities of the ...

  14. Berkeley Lab Site Map

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    About Berkeley Lab | Laboratory Site Map Laboratory Organization Chart DivisionalDepartmental Organization Charts Laboratory Map Interactive Laboratory Map History of the...

  15. Site Map | Data Explorer

    Office of Scientific and Technical Information (OSTI)

    Data Explorer Site Map Site Map Home Basic Search Advanced Search Data Explorer FAQ About Data Explorer Site Map Data Explorer Feedback Website PoliciesImportant Links

  16. Research Portfolio Map

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Research Portfolio Map Welcome to the Strategic Center for Coal Project Portfolio Web Map assembled by NETL. The web map includes projects across all Coal & Power Systems ...

  17. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Green River, Utah, Disposal Site August 2013 LMS/GRN/S00613 This page intentionally left blank U.S. Department of Energy DVP-June 2013, Green River, Utah August 2013 RIN 13065402 Page i Contents Sampling Event Summary ...............................................................................................................1 Data Assessment Summary ..............................................................................................................7 Water Sampling Field Activities

  18. Protections: Sampling

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Protections: Sampling Protections: Sampling Protection #3: Sampling for known and unexpected contaminants August 1, 2013 Monitoring stormwater in Los Alamos Canyon Monitoring stormwater in Los Alamos Canyon The Environmental Sampling Board, a key piece of the Strategy, ensures that LANL collects relevant and appropriate data to answer questions about the protection of human and environmental health, and to satisfy regulatory requirements. LANL must demonstrate the data are technically justified

  19. Semivolatile organic (GC-MS) and inorganic analyses of groundwater samples during the hydrous pyrolysis/oxidation (HPO) field test in Visalia, CA, 1997

    SciTech Connect (OSTI)

    Chiarappa, M; Knauss, K G; Kumamoto, G; Leif, R N; Newmark, R L

    1998-02-05

    Hydrous pyrolysis/oxidation (HPO) is a novel, in situ, thermal-remediation technology that uses hot, oxygenated groundwater to completely oxidize a wide range of organic pollutants. A field demonstration of HPO was performed during the summer of 1997 at the Southern California Edison Pole Yard in Visalia, California, a site contaminated with creosote. The goal of the field experiment was to confirm the success of HPO under field remediation conditions. The groundwater was heated by steam injections, and oxygen was added by co-injection of compressed air. The progress of the HPO remediation process was evaluated by monitoring groundwater from multiple wells for dissolved oxygen, dissolved inorganic carbon, and dissolved organic contaminant levels. Analyses of groundwater chemistry allowed us to measure the concentrations of creosote components and to identify oxygenated intermediates produced by the HPO treatment. Dissolved organic carbon levels increased in response to steam injections because of the enhanced dissolution and mobilization of the creosote into the heated groundwater. Elevated concentrations of phenols and benzoic acid were measured in wells affected by the steam injections. Concentrations of other oxygenated compounds (i.e., fluorenone, anthrone, and 9,10-anthracenedione) increased in response to the steam injections. The production of these partially oxidized compounds is consistent with the aqueous-phase HPO reactions of creosote. Additional changes in the groundwater in response to steam injection were also consistent with the groundwater HPO chemistry. A drop in dissolved oxygen was observed in the aquifer targeted for the steam injections, and isotope shifts in the dissolved inorganic pool reflected the input of oxidized carbon derived from the creosote carbon.

  20. PPPL Area Map | Princeton Plasma Physics Lab

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    PPPL Area Map View Larger Map

  1. Digital Geologic Field Mapping Using Arcpad, In: Digital Mapping...

    Open Energy Info (EERE)

    and paper methods. The focus of the research was to minimize the size and weight of computer systems. Systems identified consist of a wearable PC or handheld computer (PDA) and...

  2. Protections: Sampling

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Protection 3: Sampling for known and unexpected contaminants August 1, 2013 Monitoring stormwater in Los Alamos Canyon Monitoring stormwater in Los Alamos Canyon The Environmental ...

  3. Protections: Sampling

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and unexpected contaminants August 1, 2013 Monitoring stormwater in Los Alamos Canyon Monitoring stormwater in Los Alamos Canyon The Environmental Sampling Board, a key piece...

  4. Field Techniques | Open Energy Information

    Open Energy Info (EERE)

    systems.3 In addition to the collection surface data, field mapping may be used to "ground truth" data collected by other methods, such as remote sensing. Shallow temperature...

  5. SAMPLING SYSTEM

    DOE Patents [OSTI]

    Hannaford, B.A.; Rosenberg, R.; Segaser, C.L.; Terry, C.L.

    1961-01-17

    An apparatus is given for the batch sampling of radioactive liquids such as slurries from a system by remote control, while providing shielding for protection of operating personnel from the harmful effects of radiation.

  6. Sampling box

    DOE Patents [OSTI]

    Phillips, Terrance D.; Johnson, Craig

    2000-01-01

    An air sampling box that uses a slidable filter tray and a removable filter cartridge to allow for the easy replacement of a filter which catches radioactive particles is disclosed.

  7. Creating Sample Plans

    Energy Science and Technology Software Center (OSTI)

    1999-03-24

    The program has been designed to increase the accuracy and reduce the preparation time for completing sampling plans. It consists of our files 1. Analyte/Combination (AnalCombo) A list of analytes and combinations of analytes that can be requested of the onsite and offsite labs. Whenever a specific combination of analytes or suite names appear on the same line as the code number, this indicates that one sample can be placed in one bottle to bemore » analyzed for these paremeters. A code number is assigned for each analyte and combination of analytes. 2. Sampling Plans Database (SPDb) A database that contains all of the analytes and combinations of analytes along with the basic information required for preparing a sample plan. That basic information includes the following fields; matrix, hold time, preservation, sample volume, container size, if the bottle caps are taped, acceptable choices. 3. Sampling plans create (SPcreate) a file that will lookup information from the Sampling Plans Database and the Job Log File (JLF98) A major database used by Sample Managemnet Services for recording more than 100 fields of information.« less

  8. Career Map: Environmental Scientist | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Scientist Career Map: Environmental Scientist Career-Map-Environmental-Scientist.jpg Environmental Scientist (Wildlife, Land and Culture) Position Title Environmental Scientist Alternate Title(s) Anthropologist, Archaeologist, Environmental Engineer, Geoscientist, Wildlife Biologist Education & Training Level Advanced, Bachelors required, prefer graduate degree Education & Training Level Description Environmental scientists need at least a bachelor's degree in a related field for most

  9. Maps of Selected State Subdivisions

    U.S. Energy Information Administration (EIA) Indexed Site

    Crude Oil, Natural Gas, and Natural Gas Liquids Proved Reserves Summary Maps of Selected State Subdivisions Map 1: Alaska Map 2: California Map 3: Louisiana Map 4: New Mexico Map ...

  10. Surface Water Sampling | Open Energy Information

    Open Energy Info (EERE)

    Surface Water Sampling Details Activities (3) Areas (2) Regions (0) NEPA(0) Exploration Technique Information Exploration Group: Field Techniques Exploration Sub Group: Field...