Sample records for mammalian cellular response

  1. Cellular responses to environmental DNA damage

    SciTech Connect (OSTI)

    Not Available

    1994-08-01T23:59:59.000Z

    This volume contains the proceedings of the conference entitled Cellular Responses to Environmental DNA Damage held in Banff,Alberta December 1--6, 1991. The conference addresses various aspects of DNA repair in sessions titled DNA repair; Basic Mechanisms; Lesions; Systems; Inducible Responses; Mutagenesis; Human Population Response Heterogeneity; Intragenomic DNA Repair Heterogeneity; DNA Repair Gene Cloning; Aging; Human Genetic Disease; and Carcinogenesis. Individual papers are represented as abstracts of about one page in length.

  2. Cellular responses against DNA damaged by platinum anticancer drugs

    E-Print Network [OSTI]

    Jung, Yongwon, 1977-

    2005-01-01T23:59:59.000Z

    The anticancer activity of platinum-based drugs such as cisplatin, carboplatin, and oxaliplatin is mediated by their ability to attack DNA such that generated adducts trigger numerous cellular responses. A better understanding ...

  3. Journal of Mammalogy, 84(2):354368, 2003 MAMMALIAN RESPONSE TO GLOBAL WARMING ON VARIED

    E-Print Network [OSTI]

    California at Berkeley, University of

    354 Journal of Mammalogy, 84(2):354­368, 2003 MAMMALIAN RESPONSE TO GLOBAL WARMING ON VARIED how Rocky Mountain mam- malian communities changed during past global warming events characterized not) in different ways. Nevertheless, examination of past global warming episodes suggested

  4. Mammalian Host Responses to Proinflammatory Stimuli by Microbial Pathogens

    E-Print Network [OSTI]

    Clark, Robin Teresa

    2010-01-01T23:59:59.000Z

    response in Helicobacter pylori gastritis. Ann Med, 2009.Y. , et al. , Helicobacter pylori potentiates epithelial:is highly produced in Helicobacter pylori-infected gastric

  5. DNA damage response to different surface chemistry of silver nanoparticles in mammalian cells

    SciTech Connect (OSTI)

    Ahamed, Maqusood; Karns, Michael; Goodson, Michael; Rowe, John [Department of Biology, Centre for Tissue Regeneration and Engineering, University of Dayton, Dayton-45469, OH (United States); Hussain, Saber M.; Schlager, John J. [Applied Biotechnology Branch, Human Effectiveness Directorate Air Force Research Laboratory/HEPB, Wright-Patterson Air Force Base-45433, OH (United States); Hong Yiling [Department of Biology, Centre for Tissue Regeneration and Engineering, University of Dayton, Dayton-45469, OH (United States)], E-mail: Yiling.Hong@notes.udayton.edu

    2008-12-15T23:59:59.000Z

    Silver nanoparticles (Ag NPs) have recently received much attention for their possible applications in biotechnology and life sciences. Ag NPs are of interest to defense and engineering programs for new material applications as well as for commercial purposes as an antimicrobial. However, little is known about the genotoxicity of Ag NPs following exposure to mammalian cells. This study was undertaken to examine the DNA damage response to polysaccharide surface functionalized (coated) and non-functionalized (uncoated) Ag NPs in two types of mammalian cells; mouse embryonic stem (mES) cells and mouse embryonic fibroblasts (MEF). Both types of Ag NPs up-regulated the cell cycle checkpoint protein p53 and DNA damage repair proteins Rad51 and phosphorylated-H2AX expression. Furthermore both of them induced cell death as measured by the annexin V protein expression and MTT assay. Our observations also suggested that the different surface chemistry of Ag NPs induce different DNA damage response: coated Ag NPs exhibited more severe damage than uncoated Ag NPs. The results suggest that polysaccharide coated particles are more individually distributed while agglomeration of the uncoated particles limits the surface area availability and access to membrane bound organelles.

  6. Growth hormone responsive neural precursor cells reside within the adult mammalian brain

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    within the adult mammalian brain. Sci. Rep. 2, 250; DOI:of neurons from adult brain stem cells during recovery afterin the adult mammalian brain. J Neurosci 17, 5046–5061 (

  7. In vivo imaging of C. elegans ASH neurons: cellular response and adaptation to chemical repellents

    E-Print Network [OSTI]

    Schafer, William R.

    Erratum In vivo imaging of C. elegans ASH neurons: cellular response and adaptation to chemical neurons highlighted. From the ASH cell body, the dendrite runs anteriorly until the tip of the head ending

  8. Molecular dissection of the roles of the SOD genes in mammalian response to low dose irradiation

    SciTech Connect (OSTI)

    Eric Y. Chuang

    2006-08-31T23:59:59.000Z

    It has been long recognized that a significant fraction of the radiation-induced genetic damage to cells are caused by secondary oxidative species. Internal cellular defense systems against oxidative stress play significant roles in countering genetic damage induced by ionizing radiation. The role of the detoxifying enzymes may be even more prominent in the case of low-dose, low-LET irradiation, as the majority of genetic damage may be caused by secondary oxidative species. In this study we have attempted to decipher the roles of the superoxide dismutase (SOD) genes, which are responsible for detoxifying the superoxide anions. We used adenovirus vectors to deliver RNA interference (RNAi or siRNA) technology to down-regulate the expression levels of the SOD genes. We have also over-expressed the SOD genes by use of recombinant adenovirus vectors. Cells infected with the vectors were then subjected to low dose ?-irradiation. Total RNA were extracted from the exposed cells and the expression of 9000 genes were profiled by use of cDNA microarrays. The result showed that low dose radiation had clear effects on gene expression in HCT116 cells. Both over-expression and down-regulation of the SOD1 gene can change the expression profiles of sub-groups of genes. Close to 200 of the 9000 genes examined showed over two-fold difference in expression under various conditions. Genes with changed expression pattern belong to many categories that include: early growth response, DNA-repair, ion transport, apoptosis, and cytokine response.

  9. alter cellular responses: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    34 Variable community responses to herbivory in fire-altered landscapes of northern Patagonia, Argentina Environmental Sciences and Ecology Websites Summary: relationships...

  10. Cellular Response to Ordered Collagen Layers on Mica

    E-Print Network [OSTI]

    Leow, Wee Wen

    2012-07-16T23:59:59.000Z

    matrix (ECM), whereby cells are constantly sensing and modifying their surroundings in response to physical stress or during processes like wound repair, cancer cell invasion, and morphogenesis, to create an environment which supports adaptation. To date...

  11. Chronic cellular responses of rat skin to 13 Mev proton irradiation

    E-Print Network [OSTI]

    Hinkle, Donald King

    1966-01-01T23:59:59.000Z

    CHRONIC CELLULAR RESPONSES OF RAT SKIN TO 13 MEV PROTON IRRADIATION A Thesis by DONALD KING HINKLE, D. V. M. Submitted to the Graduate College of the Texas AErM University in partial fulfillment of the requirements for the degree of MASTER... OF SCIENCE August 1966 Major Subject: Laboratory Animal Medicine CHRONIC CELLULAR RESPONSES OF RAT SKIN TO 13 MEV PROTON IRRADIATION A Thesis by DONALD KING HINKLE, D. V. M. Submitted to the Graduate College of the Texas ARM University in partial...

  12. Corrosion of, and cellular responses to MgZnCa bulk metallic glasses Xuenan Gu a

    E-Print Network [OSTI]

    Zheng, Yufeng

    Corrosion of, and cellular responses to Mg­Zn­Ca bulk metallic glasses Xuenan Gu a , Yufeng Zheng a: Magnesium alloy Bulk metallic glass Mechanical property Corrosion Cytotoxicity a b s t r a c t Mg­Zn­Ca bulk, mechanical testing, corrosion and cytotoxicity tests. It was found that the Mg66Zn30Ca4 sample presents

  13. 7th International Workshop on Microbeam Probes of Cellular Radiation Response

    SciTech Connect (OSTI)

    Brenner, David J.

    2009-07-21T23:59:59.000Z

    The extended abstracts that follow present a summary of the Proceedings of the 7th International Workshop: Microbeam Probes of Cellular Radiation Response, held at Columbia University’s Kellogg Center in New York City on March 15–17, 2006. These International Workshops on Microbeam Probes of Cellular Radiation Response have been held regularly since 1993 (1–5). Since the first workshop, there has been a rapid growth (see Fig. 1) in the number of centers developing microbeams for radiobiological research, and worldwide there are currently about 30 microbeams in operation or under development. Single-cell/single-particle microbeam systems can deliver beams of different ionizing radiations with a spatial resolution of a few micrometers down to a few tenths of a micrometer. Microbeams can be used to addressquestions relating to the effects of low doses of radiation (a single radiation track traversing a cell or group of cells), to probe subcellular targets (e.g. nucleus or cytoplasm), and to address questions regarding the propagation of information about DNA damage (for example, the radiation-induced bystander effect). Much of the recent research using microbeams has been to study low-dose effects and ‘‘non-targeted’’ responses such as bystander effects, genomic instability and adaptive responses. This Workshop provided a forum to assess the current state of microbeam technology and current biological applications and to discuss future directions for development, both technological and biological. Over 100 participants reviewed the current state of microbeam research worldwide and reported on new technological developments in the fields of both physics and biology.

  14. The Energy Sensor AMP-activated Protein Kinase Directly Regulates the Mammalian FOXO3 Transcription Factor*S

    E-Print Network [OSTI]

    Brunet, Anne

    The Energy Sensor AMP-activated Protein Kinase Directly Regulates the Mammalian FOXO3 Transcription of homeostasis throughout an organism's life span requires constant adaptation to changes in energy lev- els. The AMP-activated protein kinase (AMPK) plays a critical role in the cellular responses to low energy

  15. Restriction of Receptor Movement Alters Cellular Response: Physical Force Sensing by EphA2

    SciTech Connect (OSTI)

    Salaita, Khalid; Nair, Pradeep M; Petit, Rebecca S; Neve, Richard M; Das, Debopriya; Gray, Joe W; Groves, Jay T

    2009-09-09T23:59:59.000Z

    Activation of the EphA2 receptor tyrosine kinase by ephrin-A1 ligands presented on apposed cell surfaces plays important roles in development and exhibits poorly understood functional alterations in cancer. We reconstituted this intermembrane signaling geometry between live EphA2-expressing human breast cancer cells and supported membranes displaying laterally mobile ephrin-A1. Receptor-ligand binding, clustering, and subsequent lateral transport within this junction were observed. EphA2 transport can be blocked by physical barriers nanofabricated onto the underlying substrate. This physical reorganization of EphA2 alters the cellular response to ephrin-A1, as observed by changes in cytoskeleton morphology and recruitment of a disintegrin and metalloprotease 10. Quantitative analysis of receptor-ligand spatial organization across a library of 26 mammary epithelial cell lines reveals characteristic differences that strongly correlate with invasion potential. These observations reveal a mechanism for spatio-mechanical regulation of EphA2 signaling pathways.

  16. Transcriptome and Proteome Dynamics of the Cellular Response of Shewanella oneidensis to Chromium Stress

    SciTech Connect (OSTI)

    Thompson, D.K.

    2005-04-18T23:59:59.000Z

    The overall goal of this DOE NABIR project is to characterize the molecular basis and regulation of hexavalent chromium [Cr(VI)] stress response and reduction by Shewanella oneidensis strain MR-1. Temporal genomic profiling and mass spectrometry-based proteomic analysis were employed to characterize the dynamic molecular response of S. oneidensis MR-1 to both acute and chronic Cr(VI) exposure. The acute stress response of aerobic, mid-exponential phase cells shocked to a final concentration of 1 mM potassium chromate (K2CrO4) was examined at post-exposure time intervals of 5, 30, 60, and 90 min relative to untreated cells. The transcriptome of mid-exponential cultures was also analyzed 30 min after shock doses of 0.3, 0.5, or 1 mM K{sub 2}CrO{sub 4}. The tonB1-exbB1-exbD1 genes comprising the TonB1 iron transport system were some of the most highly induced coding sequences (CDSs) after 90 min (up to {approx}240 fold), followed by other genes involved in heme transport, sulfate transport, and sulfur assimilation pathways. In addition, transcript levels for CDSs with annotated functions in DNA repair (dinP, recX, recA, recN) and detoxification processes (so3585, so3586) were substantially increased in Cr(VI)-exposed cells compared to untreated cells. By contrast, genes predicted to encode hydrogenases (HydA, HydB), oxidoreductases (SO0902-03-04, SO1911), iron-sulfur cluster binding proteins (SO4404), decaheme cytochrome c proteins (MtrA, OmcA, OmcB), and a number of LysR or TetR family transcriptional regulators were some of the most highly repressed CDSs following the 90-min shock period. Transcriptome profiles generated from MR-1 cells adapted to 0.3 mM Cr(VI) differed significantly from those characterizing cells exposed to acute Cr(VI) stress without adaptation. Parallel proteomic characterization of soluble protein and membrane protein fractions extracted from Cr(VI)-shocked and Cr(VI)-adapted MR-1 cells was performed using multidimensional HPLC-ESI-MS/MS (both LCQ and LTQ instruments used). With LTQ, we were able to substantially increase proteome coverage by at least two-fold compared to LCQ analysis. These studies provide important insights into cellular chromium tolerance. Future research will focus on the structural and regulatory genes implicated in Cr(VI) reduction and detoxification.

  17. Comparison of cellular responses induced by low level light in different cell types

    E-Print Network [OSTI]

    Hamblin, Michael R.

    Discoveries are rapidly being made in multiple laboratories that shed "light" on the fundamental molecular and cellular mechanisms underlying the use of low level light therapy (LLLT) in vitro, in animal models and in ...

  18. Genomics Approaches to Study Molecular and Cellular Mechanisms of Host Response to Avian Influenza Virus in Chickens

    E-Print Network [OSTI]

    Wang, Ying

    2012-02-14T23:59:59.000Z

    tropism and the pathogenesis of viral diseases (Cullen, 2006a). On the other hand, viruses encode viral miRNAs to protect themselves against cellular antiviral responses (Gupta, et al., 2006). Host miRNAs play important roles in antiviral... direct negative effect on the replication of retrovirus primate foamy virus type 1 (PFV-1), which is mediated through the down- regulation of replication-essential viral proteins encoded by open reading frame 2 (ORF2) ( Lecellier, et al., 2005; Cullen...

  19. Advanced Computational Approaches for Characterizing Stochastic Cellular Responses to Low Dose, Low Dose Rate Exposures

    SciTech Connect (OSTI)

    Scott, Bobby, R., Ph.D.

    2003-06-27T23:59:59.000Z

    OAK - B135 This project final report summarizes modeling research conducted in the U.S. Department of Energy (DOE), Low Dose Radiation Research Program at the Lovelace Respiratory Research Institute from October 1998 through June 2003. The modeling research described involves critically evaluating the validity of the linear nonthreshold (LNT) risk model as it relates to stochastic effects induced in cells by low doses of ionizing radiation and genotoxic chemicals. The LNT model plays a central role in low-dose risk assessment for humans. With the LNT model, any radiation (or genotoxic chemical) exposure is assumed to increase one¡¯s risk of cancer. Based on the LNT model, others have predicted tens of thousands of cancer deaths related to environmental exposure to radioactive material from nuclear accidents (e.g., Chernobyl) and fallout from nuclear weapons testing. Our research has focused on developing biologically based models that explain the shape of dose-response curves for low-dose radiation and genotoxic chemical-induced stochastic effects in cells. Understanding the shape of the dose-response curve for radiation and genotoxic chemical-induced stochastic effects in cells helps to better understand the shape of the dose-response curve for cancer induction in humans. We have used a modeling approach that facilitated model revisions over time, allowing for timely incorporation of new knowledge gained related to the biological basis for low-dose-induced stochastic effects in cells. Both deleterious (e.g., genomic instability, mutations, and neoplastic transformation) and protective (e.g., DNA repair and apoptosis) effects have been included in our modeling. Our most advanced model, NEOTRANS2, involves differing levels of genomic instability. Persistent genomic instability is presumed to be associated with nonspecific, nonlethal mutations and to increase both the risk for neoplastic transformation and for cancer occurrence. Our research results, based on applications of NEOTRANS2, indicate that nonlinear threshold-type, dose-response relationships for excess stochastic effects (problematic nonlethal mutations, neoplastic transformation) should be expected after exposure to low linear energy transfer (LET) gamma rays or gamma rays in combination with high-LET alpha radiation. Similar thresholds are expected for low-dose-rate low-LET beta irradiation. We attribute the thresholds to low-dose, low-LET radiation induced protection against spontaneous mutations and neoplastic transformations. The protection is presumed mainly to involve selective elimination of problematic cells via apoptosis. Low-dose, low-LET radiation is presumed to trigger wide-area cell signaling, which in turn leads to problematic bystander cells (e.g., mutants, neoplastically transformed cells) selectively undergoing apoptosis. Thus, this protective bystander effect leads to selective elimination of problematic cells (a tissue cleansing process in vivo). However, this protective bystander effects is a different process from low-dose stimulation of the immune system. Low-dose, low-LET radiation stimulation of the immune system may explain why thresholds for inducing excess cancer appear much larger (possibly more than 100-fold larger) than thresholds for inducing excess mutations and neoplastic transformations, when the dose rate is low. For ionizing radiation, the current risk assessment paradigm is such that the relative risk (RR) is always ¡Ý 1, no matter how small the dose. Our research results indicate that for low-dose or low-dose-rate, low-LET irradiation, RR < 1 may be more the rule than the exception. Directly tied to the current RR paradigm are the billion-dollar cleanup costs for radionuclide-contaminated DOE sites. Our research results suggest that continued use of the current RR paradigm for which RR ¡Ý 1 could cause more harm than benefit to society (e.g., by spreading unwarranted fear about phantom excess risks associated with low-dose low-LET radiation). Such phantom risks also may arise from risk assessments conducted for com

  20. Mammalian DNA Repair. Final Report

    SciTech Connect (OSTI)

    None

    2003-01-24T23:59:59.000Z

    The Gordon Research Conference (GRC) on Mammalian DNA Repair was held at Harbortown Resort, Ventura Beach, CA. Emphasis was placed on current unpublished research and discussion of the future target areas in this field.

  1. Quantification of Cellular Poly(ADP-ribosyl)ation by Stable Isotope Dilution Mass Spectrometry Reveals Tissue- and Drug-Dependent Stress Response Dynamics

    E-Print Network [OSTI]

    Martello, Rita

    Poly(ADP-ribosyl)ation is an essential post-translational modification with the biopolymer poly(ADP-ribose) (PAR). The reaction is catalyzed by poly(ADP-ribose) polymerases (PARPs) and plays key roles in cellular physiology ...

  2. Integrated characterization of cellular physiology underlying hepatic metabolism

    E-Print Network [OSTI]

    Wong, Matthew Sing

    2006-01-01T23:59:59.000Z

    The macroscopic metabolic phenotype of a cellular system, such as insulin resistance, is the result of the integration of many hundreds or thousands of preceding cellular events, which culminates in the cell's final response ...

  3. The Gordon conference on mammalian DNA repair

    SciTech Connect (OSTI)

    Cleaver, J.E.; Smerdon, M.J.

    1993-12-31T23:59:59.000Z

    A brief overview of the Gordon Conference on Mammalian Repair held February 1-5, 1993 in Ventura, California is presented.

  4. Toxicology and cellular effect of manufactured nanomaterials

    DOE Patents [OSTI]

    Chen, Fanqing

    2014-07-22T23:59:59.000Z

    The increasing use of nanotechnology in consumer products and medical applications underlies the importance of understanding its potential toxic effects to people and the environment. Herein are described methods and assays to predict and evaluate the cellular effects of nanomaterial exposure. Exposing cells to nanomaterials at cytotoxic doses induces cell cycle arrest and increases apoptosis/necrosis, activates genes involved in cellular transport, metabolism, cell cycle regulation, and stress response. Certain nanomaterials induce genes indicative of a strong immune and inflammatory response within skin fibroblasts. Furthermore, the described multiwall carbon nanoonions (MWCNOs) can be used as a therapeutic in the treatment of cancer due to its cytotoxicity.

  5. Author's personal copy Cellular and physiological mechanisms underlying blood flow regulation in the

    E-Print Network [OSTI]

    Newman, Eric A.

    Author's personal copy Cellular and physiological mechanisms underlying blood flow regulation n f o Article history: Available online 3 May 2012 Keywords: Blood flow Retina Choroid Regulation review the cellular and physiological mechanisms responsible for the regulation of blood flow

  6. Noise removal at the rod synapse of mammalian retina 

    E-Print Network [OSTI]

    van Rossum, Mark; Smith, Robert

    1998-01-01T23:59:59.000Z

    Mammalian rods respond to single photons with a hyperpolarization of about 1 mV which is accompanied by continuous noise. Since the mammalian rod bipolar cell collects signals from 20-100 rods, the noise from the converging ...

  7. Erythropoietin binding protein from mammalian serum

    DOE Patents [OSTI]

    Clemons, Gisela K. (Berkeley, CA)

    1997-01-01T23:59:59.000Z

    Purified mammalian erythropoietin binding-protein is disclosed, and its isolation, identification, characterization, purification, and immunoassay are described. The erythropoietin binding protein can be used for regulation of erythropoiesis by regulating levels and half-life of erythropoietin. A diagnostic kit for determination of level of erythropoietin binding protein is also described.

  8. Erythropoietin binding protein from mammalian serum

    DOE Patents [OSTI]

    Clemons, G.K.

    1997-04-29T23:59:59.000Z

    Purified mammalian erythropoietin binding-protein is disclosed, and its isolation, identification, characterization, purification, and immunoassay are described. The erythropoietin binding protein can be used for regulation of erythropoiesis by regulating levels and half-life of erythropoietin. A diagnostic kit for determination of level of erythropoietin binding protein is also described. 11 figs.

  9. NetworKIN: a resource for exploring cellular phosphorylation networks

    E-Print Network [OSTI]

    Jensen, Lars Juhl

    Protein kinases control cellular responses by phosphorylating specific substrates. Recent proteome-wide mapping of protein phosphorylation sites by mass spectrometry has discovered thousands of in vivo sites. Systematically ...

  10. BE.450 Molecular and Cellular Pathophysiology, Spring 2005

    E-Print Network [OSTI]

    Schauer, David

    This courses focuses on the fundamentals of tissue and organ response to injury from a molecular and cellular perspective. There is a special emphasis on disease states that bridge infection, inflammation, immunity, and ...

  11. Symposium on molecular and cellular mechanisms of mutagenesis

    SciTech Connect (OSTI)

    Not Available

    1981-01-01T23:59:59.000Z

    These proceedings contain abstracts only of the 21 papers presented at the Sympsoium. The papers dealt with molecular mechanisms of mutagenesis and cellular responses to chemical and physical mutagenic agents. (ERB)

  12. Response

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn'tOrigin ofEnergy at Waste-to-Energy usingof Enhanced Dr. JuliaPOINTRespond to theResponse SEAB

  13. Cellular and molecular analysis of neuronal structure plasticity in the mammalian cortex

    E-Print Network [OSTI]

    Lee, Wei-Chung Allen

    2006-01-01T23:59:59.000Z

    Despite decades of evidence for functional plasticity in the adult brain, the role of structural plasticity in its manifestation remains unclear. cpg15 is an activity-regulated gene encoding a membrane-bound ligand that ...

  14. Captive Cellular Automata MFCS 2004, Praha

    E-Print Network [OSTI]

    Theyssier, Guillaume

    automata (CA) theory: local definition ? - global dynamics ? undecidability is everywhere #12;Introduction -- (1) 2 Captive Cellular Automata Central issue in cellular automata (CA) theory: local definition Cellular Automata Central issue in cellular automata (CA) theory: local definition ? - global dynamics

  15. adherent mammalian cells: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    bats) correlate with predictable chromosomal structural changes (KFTkaryotypic fission theory). Chromosome studies (more) Kolnicki, Robin Lee 2012-01-01 438 Mammalian Abp1, a...

  16. Engineering A new era is beginning in the mammalian

    E-Print Network [OSTI]

    concepts applicable to mammalian cells may also be applicable other systems including microalgae. Dr in Biodesign B105 School for Engineering of Matter, Transport & Energy #12;

  17. The functional microRNA landscape of mammalian development

    E-Print Network [OSTI]

    Ravi, Arvind

    2011-01-01T23:59:59.000Z

    MicroRNAs (miRNAs) constitute a class of ~22 nucleotide RNAs with broad regulatory roles in gene expression. Dependent largely on the enzyme Dicer for their generation from longer precursor transcripts, mammalian miRNAs ...

  18. Effect of Gas Sparging in Mammalian Cell Bioreactors

    E-Print Network [OSTI]

    Wang, Daniel I.C.

    One of the major problems in the operations of mammalian cell bioreactors is the detrimental effect of gas sparging. Since the most convenient way to oxygenate any bioreactor is by gas sparging, this adverse effect has ...

  19. Establishment of the epigenetic landscape in mammalian embryonic stem cells

    E-Print Network [OSTI]

    Koche, Richard Patrick

    2012-01-01T23:59:59.000Z

    Temporal and spatial variation of histone methylation is an important factor in mammalian development. Deciphering the details of such epigenetic phenomena has the potential to enrich both stem cell biology and therapeutics, ...

  20. Micropatterning of Proteins and Mammalian Cells on Indium Tin Oxide

    E-Print Network [OSTI]

    Revzin, Alexander

    Micropatterning of Proteins and Mammalian Cells on Indium Tin Oxide Sunny S. Shah, Michael C and electrochemical activation to create micropatterned cocultures on indium tin oxide (ITO) substrates applications in tissue engineering and biosensing. KEYWORDS: indium tin oxide · photolithography · switchable

  1. Rheotaxis facilitates upstream navigation of mammalian sperm cells

    E-Print Network [OSTI]

    Kantsler, Vasily

    A major puzzle in biology is how mammalian sperm maintain the correct swimming direction during various phases of the sexual reproduction process. Whilst chemotaxis may dominate near the ovum, it is unclear which cues guide ...

  2. Emergence of cellularity Friederike Mller

    E-Print Network [OSTI]

    Kersting, Roland

    Outlook #12;Osmosis Diffusion through a semipermeable membrane driven by a concentration gradient Solvent Further Experiments Evolution Outlook #12;· Energy Storage · Membrane growth induces pH-gradient advantage Driving the evolution of metabolism? Simple physicochemical properties Essential cellular

  3. Assays for mammalian tyrosinase: a comparative study

    SciTech Connect (OSTI)

    Jara, J.R.; Solano, F.; Lozano, J.A.

    1988-01-01T23:59:59.000Z

    This work describes a comparative study of the tyrosinase activity determined using three methods which are the most extensively employed; two radiometric assays using L-tyrosine as substrate (tyrosine hydroxylase and melanin formation activities) and one spectrophotometric assay using L-dopa (dopa oxidase activity). The three methods were simultaneously employed to measure the activities of the soluble, melanosomal, and microsomal tyrosinase isozymes from Harding-Passey mouse melanoma through their purification processes. The aim of this study was to find any correlation among the tyrosinase activities measured by the three different assays and to determine whether that correlation varied with the isozyme and its degree of purification. The results show that mammalian tyrosinase has a greater turnover number for L-dopa than for L-tyrosine. Thus, enzyme activity, expressed as mumol of substrate transformed per min, is higher in assays using L-dopa as substrate than those using L-tyrosine. Moreover, the percentage of hydroxylated L-tyrosine that is converted into melanin is low and is affected by several factors, apparently decreasing the tyrosinase activity measured by the melanin formation assay. Bearing these considerations in mind, average interassay factors are proposed. Their values are 10 to transform melanin formation into tyrosine hydroxylase activity, 100 to transform tyrosine hydroxylase into dopa oxidase activity, and 1,000 to transform melanin formation into dopa oxidase activity. Variations in these values due to the presence in the tyrosinase preparations of either inhibitors or regulatory factors in melanogenesis independent of tyrosinase are also discussed.

  4. Stress Response & Adaptation: A New Molecular Toolkit

    E-Print Network [OSTI]

    Storey, Kenneth B.

    · Covalent attachment of: Antibodies, Oligonucleotides · Capture of proteins, peptides, coding and non pathways that are responsible for responding to &/or repairing cellular damage. E.g. antioxidant enzymes

  5. Power Control in Wireless Cellular Networks

    E-Print Network [OSTI]

    Chiang, Mung

    Power Control in Wireless Cellular Networks #12;#12;Power Control in Wireless Cellular Networks R in Networking sample Vol. x, No y (2008) 1­156 c 2008 Power Control in Wireless Cellular Networks, and connectivity. Power control in both uplink and downlink of a cellular network has been extensively studied

  6. A constraint optimization framework for discovery of cellular signaling and regulatory networks

    E-Print Network [OSTI]

    Huang, Shao-shan Carol

    2011-01-01T23:59:59.000Z

    Cellular signaling and regulatory networks underlie fundamental biological processes such as growth, differentiation, and response to the environment. Although there are now various high-throughput methods for studying ...

  7. Theoretical Physics in Cellular Biology

    E-Print Network [OSTI]

    Theoretical Physics in Cellular Biology: Some Illustrative Case Studies Living matter obeys the laws of physics, and the principles and methods of theoretical physics ought to find useful application observation, I will describe a few specific instances where approaches inspired by theoretical physics allow

  8. INTRODUCTION The mammalian hair follicle is a representative but highly

    E-Print Network [OSTI]

    Chuong, Cheng-Ming

    INTRODUCTION The mammalian hair follicle is a representative but highly complex epithelial organ, hair follicle induction requires complex signaling between the two apposing tissue layers, which to the formation of the hair follicle, which contain the dermal papilla, proliferating matrix cells and slowly

  9. Nonlinear dynamics of the mammalian inner ear

    E-Print Network [OSTI]

    Szalai, Robert; Homer, Martin

    2015-01-01T23:59:59.000Z

    A simple nonlinear transmission-line model of the cochlea with longitudinal coupling is introduced that can reproduce Basilar membrane response and neural tuning in the chinchilla. It is found that the middle ear has little effect on cochlear resonances, and hence conclude that the theory of coherent reflections is not applicable to the model. The model also provides an explanation of the emergence of spontaneous otoacoustic emissions (SOAEs). It is argued that SOAEs arise from Hopf bifurcations of the transmission-line model and not from localized instabilities. The paper shows that emissions can become chaotic, intermittent and fragile to perturbations.

  10. Quantum Cellular Automata Without Particles

    E-Print Network [OSTI]

    David A. Meyer; Asif Shakeel

    2015-06-04T23:59:59.000Z

    Quantum Cellular Automata (QCA) constitute a natural discrete model for quantum field theory (QFT). Although QFTs are defined without reference to particles, computations are done in terms of Feynman diagrams, which are explicitly interpreted in terms of interacting particles. Similarly, the easiest QCA to construct are Quantum Lattice Gas Automata (QLGA). A natural question then is, "are all nontrivial QCA QLGA?". Here we show by construction that the answer is "no"; thus there are QCA, even in $1+1$ dimensions, that have no particle interpretation.

  11. Cellular Manipulation and Control by Electromagnetism | Argonne...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    phenomenon for sensors; however, one may also use intense electromagnetic radiation, such as pulsed power, plasmas, or lasers, to induce changes in cellular...

  12. Fundamental Limits to Cellular Sensing

    E-Print Network [OSTI]

    Pieter Rein ten Wolde; Nils B. Becker; Thomas E. Ouldridge; A. Mugler

    2015-05-25T23:59:59.000Z

    In recent years experiments have demonstrated that living cells can measure low chemical concentrations with high precision, and much progress has been made in understanding what sets the fundamental limit to the precision of chemical sensing. Chemical concentration measurements start with the binding of ligand molecules to receptor proteins, which is an inherently noisy process, especially at low concentrations. The signaling networks that transmit the information on the ligand concentration from the receptors into the cell have to filter this noise extrinsic to the cell as much as possible. These networks, however, are also stochastic in nature, which means that they will also add noise to the transmitted signal. In this review, we will first discuss how the diffusive transport and binding of ligand to the receptor sets the receptor correlation time, and then how downstream signaling pathways integrate the noise in the receptor state; we will discuss how the number of receptors, the receptor correlation time, and the effective integration time together set a fundamental limit on the precision of sensing. We then discuss how cells can remove the receptor noise while simultaneously suppressing the intrinsic noise in the signaling network. We describe why this mechanism of time integration requires three classes of resources---receptors and their integration time, readout molecules, energy---and how each resource class sets a fundamental sensing limit. We also briefly discuss the scheme of maximum-likelihood estimation, the role of receptor cooperativity, and how cellular copy protocols differ from canonical copy protocols typically considered in the computational literature, explaining why cellular sensing systems can never reach the Landauer limit on the optimal trade-off between accuracy and energetic cost.

  13. Steady State Control of the Cellular Response to Stress /

    E-Print Network [OSTI]

    Loriaux, Paul Michael

    2013-01-01T23:59:59.000Z

    Professor Professor Alexander Hoffmann, Chair Pavel Pevzner,M; Elkan, Charles; Hoffmann, Alexander. The dissertationBehar and Alexander Hoffmann. Understanding the temporal

  14. Effect of Gold Nanorod Surface Chemistry on Cellular Response

    E-Print Network [OSTI]

    Grabinski, Christin

    Gold nanorods (GNRs) stabilized with cetyltrimethylammonium bromide (CTAB) and GNR functionalized via a ligand exchange method with either thiolated polyethylene glycol (PEG5000) or mercaptohexadecanoic acid (MHDA) were ...

  15. Characterizing the Altered Cellular Proteome Induced by the Stress-Independent Activation of Heat Shock Factor 1

    E-Print Network [OSTI]

    Morimoto, Richard

    Characterizing the Altered Cellular Proteome Induced by the Stress- Independent Activation of Heat activation of heat shock factor 1 (HSF1), a stress-responsive transcription factor that induces-responsive signaling pathways such as the heat shock response (HSR).1,2 The HSR is an evolutionarily conserved, stress

  16. Empirical Multiscale Networks of Cellular Regulation

    E-Print Network [OSTI]

    de Bivort, Benjamin

    Empirical Multiscale Networks of Cellular Regulation Benjamin de Bivort1* , Sui Huang2,3,4 , Yaneer Bar-Yam5 1 Department of Molecular and Cellular Biology, Harvard University, Cambridge, Massachusetts, Boston, Massachusetts, United States of America, 3 Department of Pathology, Children's Hospital

  17. Distributed Online Frequency Assignment in Cellular Networks ?

    E-Print Network [OSTI]

    Devoto, Stephen H.

    Distributed Online Frequency Assignment in Cellular Networks ? (Extended Abstract) Jeannette a general framework for studying distributed online frequency assignment in cellular networks. The problem at the corresponding network cell. In this setting, we present several distributed online algorithms for this problem

  18. Methodologies for Continuous Cellular Tower Data Analysis

    E-Print Network [OSTI]

    Clauset, Aaron

    Methodologies for Continuous Cellular Tower Data Analysis Nathan Eagle1,2 , John A. Quinn3 cellular tower data from 215 randomly sampled subjects in a major urban city. We demonstrate the potential by tower transitions. The tower groupings from these unsupervised clustering techniques are subsequently

  19. Improving microbial fitness in the mammalian gut by in vivo temporal functional metagenomics

    E-Print Network [OSTI]

    Yaung, Stephanie J.

    Elucidating functions of commensal microbial genes in the mammalian gut is challenging because many commensals are recalcitrant to laboratory cultivation and genetic manipulation. We present Temporal FUnctional Metagenomics ...

  20. A novel method for mammalian large genetic circuit assembly and delivery

    E-Print Network [OSTI]

    Li, Yinqing, Ph. D. Massachusetts Institute of Technology

    2012-01-01T23:59:59.000Z

    Genetic manipulation of mammalian cells provides a foundation for contemporary biological research both basic and applied. Existing methods for construction and introduction of large scale exogenous genetic information ...

  1. Robust expression of a bioactive mammalian protein in chlamydomonas chloroplast

    DOE Patents [OSTI]

    Mayfield, Stephen P. (Cardiff, CA)

    2010-03-16T23:59:59.000Z

    Methods and compositions are disclosed to engineer chloroplast comprising heterologous mammalian genes via a direct replacement of chloroplast Photosystem II (PSII) reaction center protein coding regions to achieve expression of recombinant protein above 5% of total protein. When algae is used, algal expressed protein is produced predominantly as a soluble protein where the functional activity of the peptide is intact. As the host algae is edible, production of biologics in this organism for oral delivery or proteins/peptides, especially gut active proteins, without purification is disclosed.

  2. Efficiency of cellular information processing

    E-Print Network [OSTI]

    Andre C. Barato; David Hartich; Udo Seifert

    2014-11-06T23:59:59.000Z

    We show that a rate of conditional Shannon entropy reduction, characterizing the learning of an internal process about an external process, is bounded by the thermodynamic entropy production. This approach allows for the definition of an informational efficiency that can be used to study cellular information processing. We analyze three models of increasing complexity inspired by the E. coli sensory network, where the external process is an external ligand concentration jumping between two values. We start with a simple model for which ATP must be consumed so that a protein inside the cell can learn about the external concentration. With a second model for a single receptor we show that the rate at which the receptor learns about the external environment can be nonzero even without any dissipation inside the cell since chemical work done by the external process compensates for this learning rate. The third model is more complete, also containing adaptation. For this model we show inter alia that a bacterium in an environment that changes at a very slow time-scale is quite inefficient, dissipating much more than it learns. Using the concept of a coarse-grained learning rate, we show for the model with adaptation that while the activity learns about the external signal the option of changing the methylation level increases the concentration range for which the learning rate is substantial.

  3. Equilibrium Water Exchange Between the Intra-and Extracellular Spaces of Mammalian Brain

    E-Print Network [OSTI]

    Duong, Timothy Q.

    Equilibrium Water Exchange Between the Intra- and Extracellular Spaces of Mammalian Brain James D.H. Ackerman,1,2,5 and Jeffrey J. Neil2,6* This report describes the measurement of water preexchange lifetimes and intra/extracellular content in intact, functioning mammalian brain. Intra- and extracellular water

  4. Control of Formation and Cellular Detachment from Shewanella...

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and Cellular Detachment from Shewanella oneidensis MR-1 Biofilms by Cyclic di-GMP. Control of Formation and Cellular Detachment from Shewanella oneidensis MR-1 Biofilms by...

  5. Adaptive Evolution of a Stress Response Protein Tom J. Little1

    E-Print Network [OSTI]

    Obbard, Darren

    Stress responses classically involve heat shock proteins or molecular chaperones that maintain proteinAdaptive Evolution of a Stress Response Protein Tom J. Little1 *, Lenny Nelson2 , Ted Hupp2 1 of the mammalian stress response gene SEP53, a member of the epidermal differentiation complex fused-gene family

  6. Techniques for green radio cellular communications 

    E-Print Network [OSTI]

    Videv, Stefan

    2013-07-01T23:59:59.000Z

    This thesis proposes four novel techniques to solve the problem of growing energy consumption requirements in cellular communication networks. The first and second part of this work propose a novel energy efficient ...

  7. Carbon Fiber Composite Cellular A Dissertation

    E-Print Network [OSTI]

    Wadley, Haydn

    Carbon Fiber Composite Cellular Structures ____________________________________ A Dissertation and honeycombs. However, for weight sensitive, ambient temperature applications, carbon fiber composites have emerged as a promising material due to its high specific strength and low density. Carbon fiber reinforced

  8. JOURNAL OF CELLULAR PHYSIOLOGY 209:604610 (2006) Mornings With Art, Lessons Learned

    E-Print Network [OSTI]

    Gao, Jinming

    JOURNAL OF CELLULAR PHYSIOLOGY 209:604­610 (2006) Mornings With Art, Lessons Learned: Feedback of no return'' is achieved; (ii) feedback regulation; and (iii) redundancy. Lessons learned from the molecular cycle checkpoint responses after exposure to alkylating agents. We have learned these lessons and now

  9. Uptake and Cellular Compartmentalization of Metals from the Rhizosphere by Hyperaccumulating Plants: A Real Time

    E-Print Network [OSTI]

    Sparks, Donald L.

    Uptake and Cellular Compartmentalization of Metals from the Rhizosphere by Hyperaccumulating Plants in hyperaccumulating plants. Previous attempts to establish the path of metal ingress into plant tissues have suffered-vivo response of plants to heavy metals in the rhizosphere. We first focused on characterizing the species

  10. Cell-to-cell communication and cellular environment alter the somatostatin status of delta cells

    SciTech Connect (OSTI)

    Kelly, Catriona, E-mail: catriona.kelly@qub.ac.uk [SAAD Centre for Pharmacy and Diabetes, School of Biomedical Sciences, University of Ulster, Coleraine (United Kingdom)] [SAAD Centre for Pharmacy and Diabetes, School of Biomedical Sciences, University of Ulster, Coleraine (United Kingdom); Flatt, Peter R.; McClenaghan, Neville H. [SAAD Centre for Pharmacy and Diabetes, School of Biomedical Sciences, University of Ulster, Coleraine (United Kingdom)] [SAAD Centre for Pharmacy and Diabetes, School of Biomedical Sciences, University of Ulster, Coleraine (United Kingdom)

    2010-08-20T23:59:59.000Z

    Research highlights: {yields} TGP52 cells display enhanced functionality in pseudoislet form. {yields} Somatostatin content was reduced, but secretion increased in high glucose conditions. {yields} Cellular interactions and environment alter the somatostatin status of TGP52 cells. -- Abstract: Introduction: Somatostatin, released from pancreatic delta cells, is a potent paracrine inhibitor of insulin and glucagon secretion. Islet cellular interactions and glucose homeostasis are essential to maintain normal patterns of insulin secretion. However, the importance of cell-to-cell communication and cellular environment in the regulation of somatostatin release remains unclear. Methods: This study employed the somatostatin-secreting TGP52 cell line maintained in DMEM:F12 (17.5 mM glucose) or DMEM (25 mM glucose) culture media. The effect of pseudoislet formation and culture medium on somatostatin content and release in response to a variety of stimuli was measured by somatostatin EIA. In addition, the effect of pseudoislet formation on cellular viability (MTT and LDH assays) and proliferation (BrdU ELISA) was determined. Results: TGP52 cells readily formed pseudoislets and showed enhanced functionality in three-dimensional form with increased E-cadherin expression irrespective of the culture environment used. However, culture in DMEM decreased cellular somatostatin content (P < 0.01) and increased somatostatin secretion in response to a variety of stimuli including arginine, calcium and PMA (P < 0.001) when compared with cells grown in DMEM:F12. Configuration of TGP52 cells as pseudoislets reduced the proliferative rate and increased cellular cytotoxicity irrespective of culture medium used. Conclusions: Somatostatin secretion is greatly facilitated by cell-to-cell interactions and E-cadherin expression. Cellular environment and extracellular glucose also significantly influence the function of delta cells.

  11. Radiation-induced bystander effect and adaptive response in mammalian cells

    E-Print Network [OSTI]

    with cells whose nuclei have been traversed with a single alpha particle each. Pretreatment of cells-induced cancer has traditionally been estimated from cancer incidence among Japanese A-bomb survivors. These data in the absence of definitive data. Both the interna- tional commission on radiation protection (ICRP

  12. Growth hormone responsive neural precursor cells reside within the adult mammalian brain

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    quiescent stem cells in GH- infused mice, resulting in aas a neuroprotective agent when infused directly into theof-function data, we next infused GH (5 ng/hour) directly

  13. Mammalian Tissue Response to Low Dose Ionizing Radiation: The Role of Oxidative Metabolism and Intercellular Communication

    SciTech Connect (OSTI)

    Azzam, Edouard I

    2013-01-16T23:59:59.000Z

    The objective of the project was to elucidate the mechanisms underlying the biological effects of low dose/low dose rate ionizing radiation in organs/tissues of irradiated mice that differ in their susceptibility to ionizing radiation, and in human cells grown under conditions that mimic the natural in vivo environment. The focus was on the effects of sparsely ionizing cesium-137 gamma rays and the role of oxidative metabolism and intercellular communication in these effects. Four Specific Aims were proposed. The integrated outcome of the experiments performed to investigate these aims has been significant towards developing a scientific basis to more accurately estimate human health risks from exposures to low doses ionizing radiation. By understanding the biochemical and molecular changes induced by low dose radiation, several novel markers associated with mitochondrial functions were identified, which has opened new avenues to investigate metabolic processes that may be affected by such exposure. In particular, a sensitive biomarker that is differentially modulated by low and high dose gamma rays was discovered.

  14. Growth hormone responsive neural precursor cells reside within the adult mammalian brain

    E-Print Network [OSTI]

    2012-01-01T23:59:59.000Z

    in the adult olfactory bulb. J Neurosci 27, 8286–8296 (neurons of the olfactory bulb: a crucial role in regulatingin a decline in olfactory bulb neurogenesis. These results

  15. A unique regulatory phase of DNA methylation in the early mammalian embryo

    E-Print Network [OSTI]

    Chan, Michelle M.

    DNA methylation is highly dynamic during mammalian embryogenesis. It is broadly accepted that the paternal genome is actively depleted of 5-methylcytosine at fertilization, followed by passive loss that reaches a minimum ...

  16. A platform for rapid prototyping of synthetic gene networks in mammalian cells

    E-Print Network [OSTI]

    Wroblewska, Liliana

    Mammalian synthetic biology may provide novel therapeutic strategies, help decipher new paths for drug discovery and facilitate synthesis of valuable molecules. Yet, our capacity to genetically program cells is currently ...

  17. Transcription Inhibition by Platinum DNA Cross-links in Live Mammalian Cells

    E-Print Network [OSTI]

    Ang, Wee Han

    We have investigated the processing of site-specific Pt?DNA cross-links in live mammalian cells to enhance our understanding of the mechanism of action of platinum-based anticancer drugs. The activity of platinum drugs ...

  18. The functional role of the mammalian tectorial membrane in the cochlear mechanics

    E-Print Network [OSTI]

    Ghaffari, Roozbeh, 1979-

    2008-01-01T23:59:59.000Z

    Sound-evoked vibrations transmitted into the mammalian cochlea produce traveling waves that provide the mechanical tuning necessary for spectral decomposition of sound. These traveling waves of motion propagate along the ...

  19. Molecular analysis of mammalian adenylyl cyclases and edema factor, a bacterial adenylyly cyclase toxin

    E-Print Network [OSTI]

    Suryanarayana, Srividya

    2008-12-16T23:59:59.000Z

    Adenylyl cyclases (ACs) catalyze the conversion of ATP to cAMP, an important second messenger central to many signaling pathways. Nine different isoforms of mammalian ACs (mACs) are present, each with distinct localization, physiological function...

  20. Viability of mammalian embryos subjected to liposome interaction or centrifugation for gene transfer

    E-Print Network [OSTI]

    Loskutoff, Nadia Mikhail

    1985-01-01T23:59:59.000Z

    VIABILITY OF MAMMALIAN EMBRYOS SUBJECTED TO LIPOSOME INTERACTION OR CENTRIFUGATION FOR GENE TRANSFER A Thesis by NADIA MIKHAIL LOSKUTOFF Submitted to the Graduate College of Texas AAM University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December 1985 Major Subject: Veterinary Physiology VIABILITY OF MAMMALIAN EMBRYOS SUBJECTED TO LIPOSOME INTERACTION OR CENTRIFUGATION FOR GENE TRANSFER A Thesis by Nadia Mikhail Loskutoff Approved as to style...

  1. MULTIFUNCTIONALTOPOLOGY DESIGN OF CELLULAR MATERIAL STRUCTURES1

    E-Print Network [OSTI]

    Seepersad, Carolyn Conner

    apply the method to design stiff, actively cooled prismatic cellular materials for the combustor liners that require not only structural performance but also lightweight thermal management capabilities [1 structural and thermal properties [4,7,8]. Alternatively, topology design optimization techniques are used

  2. Dynamic Discrete Power Control in Cellular Networks

    E-Print Network [OSTI]

    Avrachenkov, Konstantin

    1 Dynamic Discrete Power Control in Cellular Networks Eitan Altman, Konstantin Avrachenkov, Ishai. In each of the two frameworks, we consider both cooperative as well as non-cooperative power control. We utilization. It is, therefore, in the interests of the users to control their transmit powers levels so

  3. Cellular Energy Efficiency Evaluation Framework (Invited Paper)

    E-Print Network [OSTI]

    Stevenson, Paul

    Cellular Energy Efficiency Evaluation Framework (Invited Paper) Gunther Auer, Vito Giannini, Istv, the power consumption of the entire system needs to be captured and an appropriate energy efficiency evaluation frameworks are discussed, such that the energy efficiency of the entire network comprising

  4. Fuzzy cellular automata models in immunology

    SciTech Connect (OSTI)

    Ahmed, E. [Mansoura Univ. (Egypt)

    1996-10-01T23:59:59.000Z

    The self-nonself character of antigens is considered to be fuzzy. The Chowdhury et al. cellular automata model is generalized accordingly. New steady states are found. The first corresponds to a below-normal help and suppression and is proposed to be related to autoimmune diseases. The second corresponds to a below-normal B-cell level.

  5. Primary Cilia: Cellular Sensors for the Skeleton

    E-Print Network [OSTI]

    Stearns, Tim

    Primary Cilia: Cellular Sensors for the Skeleton CHARLES T. ANDERSON,1 * ALESHA B. CASTILLO,2 of microtubules and are thus called 910 cilia. The pri- mary cilium is enclosed in a specialized membrane (Vieira. Anderson, Department of Biological Sciences, Stanford University, Stanford, California. E-mail: ctanders

  6. Quality of service analysis for audio over cellular voice networks and cellular wireless wide area networks

    E-Print Network [OSTI]

    Malik, Omair S. (Omair Safwan)

    2007-01-01T23:59:59.000Z

    Cellular Wireless Wide Area Networks (WWANs) are most prevalent and offer high-bandwidth data transfer. We believe WWANs can be availed for voice communications employing Voice Over IP technologies. Such a communication ...

  7. AN APPROACH TO VISUAL MODELING OF CELLULAR AUTOMATA Sajjan Sarkar

    E-Print Network [OSTI]

    AN APPROACH TO VISUAL MODELING OF CELLULAR AUTOMATA by Sajjan Sarkar A Thesis Presented in Partial APPROACH TO VISUAL MODELING OF CELLULAR AUTOMATA by Sajjan Sarkar has been approved April 2009 Graduate

  8. Cellular membrane trafficking of mesoporous silica nanoparticles

    SciTech Connect (OSTI)

    Fang, I-Ju

    2012-06-21T23:59:59.000Z

    This dissertation mainly focuses on the investigation of the cellular membrane trafficking of mesoporous silica nanoparticles. We are interested in the study of endocytosis and exocytosis behaviors of mesoporous silica nanoparticles with desired surface functionality. The relationship between mesoporous silica nanoparticles and membrane trafficking of cells, either cancerous cells or normal cells was examined. Since mesoporous silica nanoparticles were applied in many drug delivery cases, the endocytotic efficiency of mesoporous silica nanoparticles needs to be investigated in more details in order to design the cellular drug delivery system in the controlled way. It is well known that cells can engulf some molecules outside of the cells through a receptor-ligand associated endocytosis. We are interested to determine if those biomolecules binding to cell surface receptors can be utilized on mesoporous silica nanoparticle materials to improve the uptake efficiency or govern the mechanism of endocytosis of mesoporous silica nanoparticles. Arginine-glycine-aspartate (RGD) is a small peptide recognized by cell integrin receptors and it was reported that avidin internalization was highly promoted by tumor lectin. Both RGD and avidin were linked to the surface of mesoporous silica nanoparticle materials to investigate the effect of receptor-associated biomolecule on cellular endocytosis efficiency. The effect of ligand types, ligand conformation and ligand density were discussed in Chapter 2 and 3. Furthermore, the exocytosis of mesoporous silica nanoparticles is very attractive for biological applications. The cellular protein sequestration study of mesoporous silica nanoparticles was examined for further information of the intracellular pathway of endocytosed mesoporous silica nanoparticle materials. The surface functionality of mesoporous silica nanoparticle materials demonstrated selectivity among the materials and cancer and normal cell lines. We aimed to determine the specific organelle that mesoporous silica nanoparticles could approach via the identification of harvested proteins from exocytosis process. Based on the study of endo- and exocytosis behavior of mesoporous silica nanoparticle materials, we can design smarter drug delivery vehicles for cancer therapy that can be effectively controlled. The destination, uptake efficiency and the cellular distribution of mesoporous silica nanoparticle materials can be programmable. As a result, release mechanism and release rate of drug delivery systems can be a well-controlled process. The deep investigation of an endo- and exocytosis study of mesoporous silica nanoparticle materials promotes the development of drug delivery applications.

  9. Genome sequence of the brown Norway rat yields insights into mammalian evolution

    SciTech Connect (OSTI)

    Gibbs, Richard A.; Weinstock, George M.; Metzker, Michael L.; Muzny, Donna M.; Sodergren, Erica J.; Scherer, Steven; Scott, Graham; Steffen, David; Worley, Kim C.; Burch, Paula E.; Okwuonu, Geoffrey; Hines, Sandra; Lewis, Lora; DeRamo, Christine; Delgado, Oliver; Dugan-Rocha, Shannon; Miner, George; Morgan, Margaret; Hawes, Alicia; Gill, Rachel; Holt, Robert A.; Adams, Mark D.; Amanatides, Peter G.; Baden-Tillson, Holly; Barnstead, Mary; Chin, Soo; Evans, Cheryl A.; Ferriera, Steven; Fosler, Carl; Glodek, Anna; Gu, Zhiping; Jennings, Don; Kraft, Cheryl L.; Nguyen, Trixie; Pfannkoch, Cynthia M.; Sitter, Cynthia; Sutton, Granger G.; Venter, J. Craig; Woodage, Trevor; Smith, Douglas; Lee, Hong-Maei; Gustafson, Erik; Cahill, Patrick; Kana, Arnold; Doucette-Stamm, Lynn; Weinstock, Keith; Fechtel, Kim; Weiss, Robert B.; Dunn, Diane M.; Green, Eric D.; Blakesley, Robert W.; Bouffard, Gerard G.; de Jong, Pieter J.; Osoegawa, Kazutoyo; Zhu, Baoli; Marra, Marco; Schein, Jacqueline; Bosdet, Ian; Fjell, Chris; Jones, Steven; Krzywinski, Martin; Mathewson, Carrie; Siddiqui, Asim; Wye, Natasja; McPherson, John; Zhao, Shaying; Fraser, Claire M.; Shetty, Jyoti; Shatsman, Sofiya; Geer, Keita; Chen, Yixin; Abramzon, Sofyia; Nierman, William C.; Havlak, Paul H.; Chen, Rui; Durbin, K. James; Egan, Amy; Ren, Yanru; Song, Xing-Zhi; Li, Bingshan; Liu, Yue; Qin, Xiang; Cawley, Simon; Cooney, A.J.; D'Souza, Lisa M.; Martin, Kirt; Wu, Jia Qian; Gonzalez-Garay, Manuel L.; Jackson, Andrew R.; Kalafus, Kenneth J.; McLeod, Michael P.; Milosavljevic, Aleksandar; Virk, Davinder; Volkov, Andrei; Wheeler, David A.; Zhang, Zhengdong; Bailey, Jeffrey A.; Eichler, Evan E.; Tuzun, Eray; Birney, Ewan; Mongin, Emmanuel; Ureta-Vidal, Abel; Woodwark, Cara; Zdobnov, Evgeny; Bork, Peer; Suyama, Mikita; Torrents, David; Alexandersson, Marina; Trask, Barbara J.; Young, Janet M.; et al.

    2004-02-02T23:59:59.000Z

    The laboratory rat (Rattus norvegicus) is an indispensable tool in experimental medicine and drug development, having made inestimable contributions to human health. We report here the genome sequence of the Brown Norway (BN) rat strain. The sequence represents a high-quality 'draft' covering over 90 percent of the genome. The BN rat sequence is the third complete mammalian genome to be deciphered, and three-way comparisons with the human and mouse genomes resolve details of mammalian evolution. This first comprehensive analysis includes genes and proteins and their relation to human disease, repeated sequences, comparative genome-wide studies of mammalian orthologous chromosomal regions and rearrangement breakpoints, reconstruction of ancestral karyotypes and the events leading to existing species, rates of variation, and lineage-specific and lineage-independent evolutionary events such as expansion of gene families, orthology relations and protein evolution.

  10. Quantumness of discrete Hamiltonian cellular automata

    E-Print Network [OSTI]

    Hans-Thomas Elze

    2014-07-08T23:59:59.000Z

    We summarize a recent study of discrete (integer-valued) Hamiltonian cellular automata (CA) showing that their dynamics can only be consistently defined, if it is linear in the same sense as unitary evolution described by the Schr\\"odinger equation. This allows to construct an invertible map between such CA and continuous quantum mechanical models, which incorporate a fundamental scale. Presently, we emphasize general aspects of these findings, the construction of admissible CA observables, and the existence of solutions of the modified dispersion relation for stationary states.

  11. New insights on the Dynamic Cellular Metabolism

    E-Print Network [OSTI]

    Ildefonso M. De la Fuente

    2015-01-09T23:59:59.000Z

    A large number of studies have shown the existence of metabolic covalent modifications in different molecular structures, able to store biochemical information that is not encoded by the DNA. Some of these covalent mark patterns can be transmitted across generations (epigenetic changes). Recently, the emergence of Hopfield-like attractor dynamics has been observed in the self-organized enzymatic networks, which have the capacity to store functional catalytic patterns that can be correctly recovered by the specific input stimuli. The Hopfield-like metabolic dynamics are stable and can be maintained as a long-term biochemical memory. In addition, specific molecular information can be transferred from the functional dynamics of the metabolic networks to the enzymatic activity involved in the covalent post-translational modulation so that determined functional memory can be embedded in multiple stable molecular marks. Both the metabolic dynamics governed by Hopfield-type attractors (functional processes) and the enzymatic covalent modifications of determined molecules (structural dynamic processes) seem to represent the two stages of the dynamical memory of cellular metabolism (metabolic memory). Epigenetic processes appear to be the structural manifestation of this cellular metabolic memory. Here, a new framework for molecular information storage in the cell is presented, which is characterized by two functionally and molecularly interrelated systems: a dynamic, flexible and adaptive system (metabolic memory) and an essentially conservative system (genetic memory). The molecular information of both systems seems to coordinate the physiological development of the whole cell.

  12. Power Control in Multi-Layer Cellular Networks

    E-Print Network [OSTI]

    Davaslioglu, Kemal

    2012-01-01T23:59:59.000Z

    We investigate the possible performance gains of power control in multi-layer cellular systems where microcells and picocells are distributed within macrocells. Although multilayers in cellular networks help increase system capacity and coverage, and can reduce total energy consumption; they cause interference, reducing the performance of the network. Therefore, downlink transmit power levels of multi-layer hierarchical cellular networks need to be controlled in order to fully exploit their benefits. In this work, we present an analytical derivation to determine optimum power levels for two-layer cellular networks and generalize our solution to multi-layer cellular networks. We also simulate our results in a typical multi-layer network setup and observe significant power savings compared to single-layer cellular networks.

  13. Cellular membrane collapse by atmospheric-pressure plasma jet

    SciTech Connect (OSTI)

    Kim, Kangil; Sik Yang, Sang, E-mail: jsjlee@ajou.ac.kr, E-mail: ssyang@ajou.ac.kr [Department of Electrical and Computer Engineering, Ajou University, Suwon 443-749 (Korea, Republic of); Jun Ahn, Hak; Lee, Jong-Soo, E-mail: jsjlee@ajou.ac.kr, E-mail: ssyang@ajou.ac.kr [Department of Biological Sciences, Ajou University, Suwon 443-749 (Korea, Republic of)] [Department of Biological Sciences, Ajou University, Suwon 443-749 (Korea, Republic of); Lee, Jae-Hyeok; Kim, Jae-Ho [Department of Molecular Science and Technology, Ajou University, Suwon 443-749 (Korea, Republic of)] [Department of Molecular Science and Technology, Ajou University, Suwon 443-749 (Korea, Republic of)

    2014-01-06T23:59:59.000Z

    Cellular membrane dysfunction caused by air plasma in cancer cells has been studied to exploit atmospheric-pressure plasma jets for cancer therapy. Here, we report that plasma jet treatment of cervical cancer HeLa cells increased electrical conductivity across the cellular lipid membrane and caused simultaneous lipid oxidation and cellular membrane collapse. We made this finding by employing a self-manufactured microelectrode chip. Furthermore, increased roughness of the cellular lipid membrane and sequential collapse of the membrane were observed by atomic force microscopy following plasma jet treatment. These results suggest that the cellular membrane catastrophe occurs via coincident altered electrical conductivity, lipid oxidation, and membrane roughening caused by an atmospheric-pressure plasma jet, possibly resulting in cellular vulnerability to reactive species generated from the plasma as well as cytotoxicity to cancer cells.

  14. A NEW LATE ORLEANIAN/EARLY ASTARACIAN MAMMALIAN FAUNA FROM KULTAK (MILAS-MUGLA), WESTERN TURKEY

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1 A NEW LATE ORLEANIAN/EARLY ASTARACIAN MAMMALIAN FAUNA FROM KULTAK (MILAS-MUGLA), WESTERN TURKEY Kultak (Milas-Mugla), western Turkey. Une nouvelle faune de Mammifères datant de la fin de l are common constituents of the Middle Miocene faunas of Turkey, but Ancylotherium (Metaschizotherium

  15. of CARNEGIE MUSEUM OF NATURAL HISTORY MAMMALIAN PALEONTOLOGY ON A GLOBAL STAGE

    E-Print Network [OSTI]

    California at Berkeley, University of

    BULLETIN of CARNEGIE MUSEUM OF NATURAL HISTORY MAMMALIAN PALEONTOLOGY ON A GLOBAL STAGE: PAPERS, USA 2007 #12;BULLETIN OF CARNEGIE MUSEUM OF NATURAL HISTORY Number 39, pages 1­234, 94 figures, 20. BULLETINs of CARNEGIE MUSEUM OF NATURAL HISTORY are published at irregular intervals by Carnegie Museum

  16. Fiber optic in vivo imaging in the mammalian nervous system Amit D Mehta1,2

    E-Print Network [OSTI]

    Schnitzer, Mark

    Fiber optic in vivo imaging in the mammalian nervous system Amit D Mehta1,2 , Juergen C Jung1 functionality of optical fiber and fiber optic devices are enabling several new modalities for imaging that uses assemblies of fiber optic emitters and detectors on the cranium for volumetric imaging of brain

  17. The late Miocene mammalian fauna of Chorora, Awash basin, Ethiopia: systematics, biochronology and 40

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    The late Miocene mammalian fauna of Chorora, Awash basin, Ethiopia: systematics, biochronology, 75014 PARIS, France Zeresenay ALEMSEGED - National Museum, P.O.Box 76, Addis Ababa, Ethiopia Hervé New whole-rock 40 K-40 Ar ages on lava flows bracketing the Chorora Fm, Ethiopia, confirm that its

  18. Obesity is defined as an excess accumulation of adipose tissue. It occurs in mammalian

    E-Print Network [OSTI]

    Cai, Long

    Obesity is defined as an excess accumulation of adipose tissue. It occurs in mammalian species when, obesity is now at epidemic proportions in the developed world1 , as well as in many developing countries2 . The links between obesity, type 2 diabetes and cardiovascular diseases have long been appreciated. However

  19. A yeast one-hybrid and microfluidics-based pipeline to map mammalian gene regulatory networks

    E-Print Network [OSTI]

    Diggavi, Suhas

    A yeast one-hybrid and microfluidics-based pipeline to map mammalian gene regulatory networks that this cross-platform pipeline characterizes known and uncovers many novel TF­DNA interactions. In addition, we an excellent model organism for studying metazoan gene regulation, especially mamma- lian-specific complex

  20. High Intron Sequence Conservation Across Three Mammalian Orders Suggests Functional Constraints

    E-Print Network [OSTI]

    Palumbi, Stephen

    High Intron Sequence Conservation Across Three Mammalian Orders Suggests Functional Constraints levels of sequence conservation in noncoding DNA compared between two species (e.g., human and mouse sequence conserved between two species may result from chance or from small-scale heterogeneity in mutation

  1. INTRODUCTION Mammalian hemoglobin (Hb) is composed of two -type and two

    E-Print Network [OSTI]

    Campbell, Kevin L.

    ), chloride ions (Cl­ ), protons (H+ ) and CO2 ­ thereby shifting the R}T equilibrium (Perutz, 1983; WeberR is the heat of the TrR transition and HEffector is the heat of effector (e.g. DPG, Cl­ , CO2 and H and evolutionary origins underlying the effect of temperature on the O2 binding properties of mammalian hemoglobins

  2. Tyrosinase maturation through the mammalian secretory pathway: bringing color to life

    E-Print Network [OSTI]

    Hebert, Daniel N.

    Tyrosinase maturation through the mammalian secretory pathway: bringing color to life Ning Wang-mail: dhebert@biochem.umass.edu Summary Tyrosinase has been extensively utilized as a model substrate to study in the matur- ation of tyrosinase from when it is first synthesized by cytosolic ribosomes until the mature

  3. Characterization of the frameshift signal of Edr, a mammalian example of programmed

    E-Print Network [OSTI]

    Bedwell, David M.

    Characterization of the frameshift signal of Edr, a mammalian example of programmed À1 ribosomal frameshifting signal of the mouse embryonal carcinoma differentiation regulated (Edr) gene represents the sole­4088]. Here, we have employed site-directed mutagenesis and RNA structure probing to characterize the Edr

  4. Cellular Decision Making and Biological Noise: From Microbes to Mammals

    E-Print Network [OSTI]

    Balázsi, Gábor

    Cellular decision making is the process whereby cells assume different, functionally important and heritable fates without an associated genetic or environmental difference. Such stochastic cell fate decisions generate ...

  5. Biological (molecular and cellular) markers of toxicity

    SciTech Connect (OSTI)

    Shugart, L.R.; D'Surney, S.J.; Gettys-Hull, C.; Greeley, M.S. Jr.

    1991-12-15T23:59:59.000Z

    Several molecular and cellular markers of genotoxicity were adapted for measurement in the Medaka (Oryzias latipes), and were used to describe the effects of treatment of the organism with diethylnitrosamine (DEN). NO{sup 6}-ethyl guanine adducts were detected, and a slight statistically significant, increase in DNA strand breaks was observed. These results are consistent with the hypothesis that prolonged exposure to high levels of DEN induced alkyltransferase activity which enzymatically removes any O{sup 6}-ethyl guanine adducts but does not result in strand breaks or hypomethylation of the DNA such as might be expected from excision repair of chemically modified DNA. Following a five week continuous DEN exposure with 100 percent renewal of DEN-water every third day, the F values (DNA double strandedness) increased considerably and to similar extent in fish exposed to 25, 50, and 100 ppM DEN. This has been observed also in medaka exposed to BaP.

  6. Cellular telephone-based radiation detection instrument

    DOE Patents [OSTI]

    Craig, William W. (Pittsburg, CA); Labov, Simon E. (Berkeley, CA)

    2011-06-14T23:59:59.000Z

    A network of radiation detection instruments, each having a small solid state radiation sensor module integrated into a cellular phone for providing radiation detection data and analysis directly to a user. The sensor module includes a solid-state crystal bonded to an ASIC readout providing a low cost, low power, light weight compact instrument to detect and measure radiation energies in the local ambient radiation field. In particular, the photon energy, time of event, and location of the detection instrument at the time of detection is recorded for real time transmission to a central data collection/analysis system. The collected data from the entire network of radiation detection instruments are combined by intelligent correlation/analysis algorithms which map the background radiation and detect, identify and track radiation anomalies in the region.

  7. PAS kinase is required for normal cellular energy balance

    E-Print Network [OSTI]

    Rutter, Jared

    PAS kinase is required for normal cellular energy balance Huai-Xiang Hao*, Caleb M. Cardon*, Wojtek, University of Utah School of Medicine, Salt Lake City, UT 84112 Edited by Steven L. McKnight, University in a cell-autonomous manner to maintain cellular energy homeostasis and is a potential therapeutic target

  8. Cellular-Internet Convergence: Evolving the Internet Architecture to

    E-Print Network [OSTI]

    Garfunkel, Eric

    protocols; standard mobility & service control API's Multiple radio access technologies simply plug: Industry Approach Towards Flat IP Architecture for Mobile Networks Cellular network standards (3GPP, LTE and cellular/mobile network standards ~1975... ~1990 ~2000 ~2010 ~2020 Basic IP Addressing & Routing BGP

  9. Cellular Algebras and Graph Invariants Based on Quantum Walks

    E-Print Network [OSTI]

    Jamie Smith

    2011-03-01T23:59:59.000Z

    We consider two graph invariants inspired by quantum walks- one in continuous time and one in discrete time. We will associate a matrix algebra called a cellular algebra with every graph. We show that, if the cellular algebras of two graphs have a similar structure, then they are not distinguished by either of the proposed invariants.

  10. On the Asymptotic Behaviour of Circular Fuzzy Cellular Automata

    E-Print Network [OSTI]

    Flocchini, Paola

    fuzzification) . Fuzzy cellular automata were first introduced in [5] as a model to describe the impact CA (e.g., see [11]). They have been shown to be useful tools for pattern recognition purposes (eOn the Asymptotic Behaviour of Circular Fuzzy Cellular Automata HEATHER BETEL AND PAOLA FLOCCHINI

  11. Modeling energy consumption in cellular networks L. Decreusefond

    E-Print Network [OSTI]

    Boyer, Edmond

    Modeling energy consumption in cellular networks L. Decreusefond Telecom Paristech, LTCI Paris Abstract--In this paper we present a new analysis of energy consumption in cellular networks. We focus on the distribution of energy consumed by a base station for one isolated cell. We first define the energy consumption

  12. A ratchet mechanism for amplification in low-frequency mammalian hearing

    E-Print Network [OSTI]

    Reichenbach, Tobias; 10.1073/pnas.0914345107

    2010-01-01T23:59:59.000Z

    The sensitivity and frequency selectivity of hearing result from tuned amplification by an active process in the mechanoreceptive hair cells. In most vertebrates the active process stems from the active motility of hair bundles. The mammalian cochlea exhibits an additional form of mechanical activity termed electromotility: its outer hair cells (OHCs) change length upon electrical stimulation. The relative contributions of these two mechanisms to the active process in the mammalian inner ear is the subject of intense current debate. Here we show that active hair-bundle motility and electromotility can together implement an efficient mechanism for amplification that functions like a ratchet: sound-evoked forces acting on the basilar membrane are transmitted to the hair bundles whereas electromotility decouples active hair-bundle forces from the basilar membrane. This unidirectional coupling can extend the hearing range well below the resonant frequency of the basilar membrane. It thereby provides a concept for...

  13. A novel high-throughput in-cell Western assay for the quantitative measurement of signaling dynamics in DNA damage signaling networks : cell decision processes in response to DNA double strand breaks

    E-Print Network [OSTI]

    Tentner, Andrea R. (Andrea Ruth)

    2006-01-01T23:59:59.000Z

    Following exposure to DNA damage, cells initiate a stress response involving multiple protein kinase signaling cascades. The DNA damage response results in one of several possible cell-fate decisions, or cellular responses: ...

  14. Global Analysis of Borrelia burgdorferi Genes Regulated by Mammalian Host-Specific Signals

    E-Print Network [OSTI]

    Brooks, Chad S.; Hefty, Scott; Jolliff, Sarah E.; Akins, Darrin R.

    2003-06-01T23:59:59.000Z

    , 23, 46, 47). In addition to OspA and OspC, recent studies have identified several borrelial mol- ecules that are differentially expressed during tick feeding and mammalian infection, including several OspE-related, OspF- related, Elp, and Mlp... TGTTTGGCAAGCAAATAAATCAATT/TTTACCTTTTCAAAAGGTTTAGACAGTTT 1.35 1.24 BB0248 TTTGCTTAAAAACGAAACCGATACTA/TCAGCAAACATTGTTTGTCTAAAGAAT 10.30 2.08 BB0362 TGCAGAACCATTTGACACAAATATAC/TTCTTGGAAGGTTGATTAGCAGGT 0.17 1.32 BB0469 AGCGCTAAAAGTAAGCAATATTTCAAT...

  15. Raman Spectroscopy and Microscopy of Individual Cells andCellular Components

    SciTech Connect (OSTI)

    Chan, J; Fore, S; Wachsmann-Hogiu, S; Huser, T

    2008-05-15T23:59:59.000Z

    Raman spectroscopy provides the unique opportunity to non-destructively analyze chemical concentrations on the submicron length scale in individual cells without the need for optical labels. This enables the rapid assessment of cellular biochemistry inside living cells, and it allows for their continuous analysis to determine cellular response to external events. Here, we review recent developments in the analysis of single cells, subcellular compartments, and chemical imaging based on Raman spectroscopic techniques. Spontaneous Raman spectroscopy provides for the full spectral assessment of cellular biochemistry, while coherent Raman techniques, such as coherent anti-Stokes Raman scattering is primarily used as an imaging tool comparable to confocal fluorescence microscopy. These techniques are complemented by surface-enhanced Raman spectroscopy, which provides higher sensitivity and local specificity, and also extends the techniques to chemical indicators, i.e. pH sensing. We review the strengths and weaknesses of each technique, demonstrate some of their applications and discuss their potential for future research in cell biology and biomedicine.

  16. RESEARCH PAPER www.landesbioscience.com Cellular Logistics e29191-1

    E-Print Network [OSTI]

    Ungermann, Christian

    RESEARCH PAPER www.landesbioscience.com Cellular Logistics e29191-1 Cellular Logistics 4, e29191-specific HOPS subunits reveal their distinct interaction with Ypt7 and vacuoles. Cellular Logistics 2014; 4:e

  17. Design principles of mammalian signaling networks : emergent properties at modular and global scales

    E-Print Network [OSTI]

    Locasale, Jason W

    2008-01-01T23:59:59.000Z

    This thesis utilizes modeling approaches rooted in statistical physics and physical chemistry to investigate several aspects of cellular signal transduction at both the modular and global levels. Design principles of ...

  18. Network signatures of cellular immortalization in human lymphoblastoid cell lines

    SciTech Connect (OSTI)

    Shim, Sung-Mi; Jung, So-Young; Nam, Hye-Young; Kim, Hye-Ryun; Lee, Mee-Hee; Kim, Jun-Woo; Han, Bok-Ghee [National Biobank of Korea, Center for Genome Science, Korea National Institute of Health, Osong 363-951 (Korea, Republic of)] [National Biobank of Korea, Center for Genome Science, Korea National Institute of Health, Osong 363-951 (Korea, Republic of); Jeon, Jae-Pil, E-mail: jaepiljeon@hanmail.net [Division of Brain Diseases, Center for Biomedical Science, Korea National Institute of Health, Osong 363-951 (Korea, Republic of)] [Division of Brain Diseases, Center for Biomedical Science, Korea National Institute of Health, Osong 363-951 (Korea, Republic of)

    2013-11-15T23:59:59.000Z

    Highlights: •We identified network signatures of LCL immortalization from transcriptomic profiles. •More than 41% of DEGs are possibly regulated by miRNAs in LCLs. •MicroRNA target genes in LCLs are involved in apoptosis and immune-related functions. •This approach is useful to find functional miRNA targets in specific cell conditions. -- Abstract: Human lymphoblastoid cell line (LCL) has been used as an in vitro cell model in genetic and pharmacogenomic studies, as well as a good model for studying gene expression regulatory machinery using integrated genomic analyses. In this study, we aimed to identify biological networks of LCL immortalization from transcriptomic profiles of microRNAs and their target genes in LCLs. We first selected differentially expressed genes (DEGs) and microRNAs (DEmiRs) between early passage LCLs (eLCLs) and terminally differentiated late passage LCLs (tLCLs). The in silico and correlation analysis of these DEGs and DEmiRs revealed that 1098 DEG–DEmiR pairs were found to be positively (n = 591 pairs) or negatively (n = 507 pairs) correlated with each other. More than 41% of DEGs are possibly regulated by miRNAs in LCL immortalizations. The target DEGs of DEmiRs were enriched for cellular functions associated with apoptosis, immune response, cell death, JAK–STAT cascade and lymphocyte activation while non-miRNA target DEGs were over-represented for basic cell metabolisms. The target DEGs correlated negatively with miR-548a-3p and miR-219-5p were significantly associated with protein kinase cascade, and the lymphocyte proliferation and apoptosis, respectively. In addition, the miR-106a and miR-424 clusters located in the X chromosome were enriched in DEmiR–mRNA pairs for LCL immortalization. In this study, the integrated transcriptomic analysis of LCLs could identify functional networks of biologically active microRNAs and their target genes involved in LCL immortalization.

  19. RESEARCH Open Access Cellular transcriptional profiling in human lung

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    RESEARCH Open Access Cellular transcriptional profiling in human lung epithelial cells infected expression profiles of human lung A549 cells infected by five different subtypes of human and avian influenza

  20. Neural network based design of cellular manufacturing systems

    E-Print Network [OSTI]

    Ramachandran, Satheesh

    1990-01-01T23:59:59.000Z

    NEURAL NETWORK BASED DESIGN OF CELLULAR MANUFACTURING SYSTEMS A Thesis by SATHEESH RAMACHANDRAN Submitted to the Office of Graduate Studies of' Texas ASM University in partial fulfilltnent of the requirements for the degree of MASTER... OF SCIENCE December 1990 Major Subject: Industrial Engineering NEURAL NETWORK BASED DESIGN OF CELLULAR MANUFACTURING SYSTEMS A Thesis by SATHEESH RAMACHAiVDRAN Approved as to style and content by: Ce r O. Malav (Chair of Committee) T. Hsing...

  1. A Nanocrystal Sensor for Luminescence Detection of Cellular Forces

    SciTech Connect (OSTI)

    Choi, Charina; Chou, Jonathan; Lutker, Katie; Werb, Zena; Alivisatos, Paul

    2011-09-29T23:59:59.000Z

    Quantum dots have been used as bright fluorescent tags with high photostability to probe numerous biological systems. In this work we present the tetrapod quantum dot as a dynamic, next-generation nanocrystal probe that fluorescently reports cellular forces with spatial and temporal resolution. Its small size and colloidal state suggest that the tetrapod may be further developed as a tool to measure cellular forces in vivo and with macromolecular spatial resolution.

  2. ResponseNet: revealing signaling and regulatory networks linking genetic and transcriptomic screening data

    E-Print Network [OSTI]

    Lan, Alex

    Cellular response to stimuli is typically complex and involves both regulatory and metabolic processes. Large-scale experimental efforts to identify components of these processes often comprise of genetic screening and ...

  3. ResponseNet: revealing signaling and regulatory networks linking genetic transcriptomic screening data

    E-Print Network [OSTI]

    Lan, Alex

    Cellular response to stimuli is typically complex and involves both regulatory and metabolic processes. Large-scale experimental efforts to identify components of these processes often comprise of genetic screening and ...

  4. Integration of the phosphorylation-dependent signaling in the DNA damage response network : implications for cancer

    E-Print Network [OSTI]

    Manke, Isaac Andrew

    2005-01-01T23:59:59.000Z

    The cellular response to DNA damage is an evolutionarily conserved process mediated by Ser/Thr kinases that results in the formation of multiple protein-protein complexes designed to control the cell cycle. The assembly ...

  5. Special Relativity Theory and Cellular Automata Light as a Cellular Automata Process

    E-Print Network [OSTI]

    Ostoma, T; Ostoma, Tom; Trushyk, Mike

    1999-01-01T23:59:59.000Z

    A new formulation of special relativity is described. It is based on a postulate that the universe is a vast Cellular Automata (CA). We show that any CA model automatically leads to a maximum speed limit for the transfer of information from place to place in CA space, and hence leads to strict physical locality of all physical interactions. Furthermore, we show that the Lorentz transformation follows mathematically from CA theory, where photon propagation is postulated to be the simply shifting of the photon information pattern from cell to adjacent cell in every CA 'clock cycle' (which incidently is simplest possible CA 'motion'). Minkowski 4D flat space-time of special relativity can be seen as the direct consequence of the low level universal CA processes, seen by inertial observers with ordinary measuring instruments, and who are not aware of, and cannot measure with the true absolute units of CA space and time.

  6. Cellular and molecular research to reduce uncertainties in estimates of health effects from low-level radiation

    SciTech Connect (OSTI)

    Elkind, M.M.; Bedford, J.; Benjamin, S.A.; Waldren, C.A. (Colorado State Univ., Fort Collins, CO (USA)); Gotchy, R.L. (Science Applications International Corp., McLean, VA (USA))

    1990-10-01T23:59:59.000Z

    A study was undertaken by five radiation scientists to examine the feasibility of reducing the uncertainties in the estimation of risk due to protracted low doses of ionizing radiation. In addressing the question of feasibility, a review was made by the study group: of the cellular, molecular, and mammalian radiation data that are available; of the way in which altered oncogene properties could be involved in the loss of growth control that culminates in tumorigenesis; and of the progress that had been made in the genetic characterizations of several human and animal neoplasms. On the basis of this analysis, the study group concluded that, at the present time, it is feasible to mount a program of radiation research directed at the mechanism(s) of radiation-induced cancer with special reference to risk of neoplasia due to protracted, low doses of sparsely ionizing radiation. To implement a program of research, a review was made of the methods, techniques, and instruments that would be needed. This review was followed by a survey of the laboratories and institutions where scientific personnel and facilities are known to be available. A research agenda of the principal and broad objectives of the program is also discussed. 489 refs., 21 figs., 14 tabs.

  7. Distinct changes of genomic biases in nucleotide substitution at the time of mammalian radiation

    E-Print Network [OSTI]

    Peter F. Arndt; Dmitri A. Petrov; Terence Hwa

    2003-07-01T23:59:59.000Z

    Differences in the regional substitution patterns in the human genome created patterns of large-scale variation of base composition known as genomic isochores. To gain insight into the origin of the genomic isochores we develop a maximum likelihood approach to determine the history of substitution patterns in the human genome. This approach utilizes the vast amount of repetitive sequence deposited in the human genome over the past ~250 MYR. Using this approach we estimate the frequencies of seven types of substitutions: the four transversions, two transitions, and the methyl-assisted transition of cytosine in CpG. Comparing substitutional patterns in repetitive elements of various ages, we reconstruct the history of the base-substitutional process in the different isochores for the past 250 Myr. At around 90 Myr ago (around the time of the mammalian radiation), we find an abrupt 4- to 8-fold increase of the cytosine transition rate in CpG pairs compared to that of the reptilian ancestor. Further analysis of nucleotide substitutions in regions with different GC-content reveals concurrent changes in the substitutional patterns. While the substitutional pattern was dependent on the regional GC-content in such ways that it preserved the regional GC-content before the mammalian radiation, it lost this dependence afterwards. The substitutional pattern changed from an isochore-preserving to an isochore-degrading one. We conclude that isochores have been established before the radiation of the eutherian mammals and have been subject to the process of homogenization since then.

  8. NF-{kappa}B suppresses HIF-1{alpha} response by competing for P300 binding

    SciTech Connect (OSTI)

    Mendonca, Daniela B.S., E-mail: daniela_mendonca@dentistry.unc.edu [Universidade Catolica de Brasilia, Pos-Graduacao em Ciencias Genomicas e Biotecnologia, SGAN Quadra 916, Av. W5 Norte, 70790-160 Brasilia, DF (Brazil); Bone Biology and Implant Therapy Laboratory, Department of Prosthodontics, University of North Carolina at Chapel Hill, 330 Brauer Hall, CB 7450, Chapel Hill, NC 27599 (United States); Mendonca, Gustavo [Universidade Catolica de Brasilia, Pos-Graduacao em Ciencias Genomicas e Biotecnologia, SGAN Quadra 916, Av. W5 Norte, 70790-160 Brasilia, DF (Brazil) [Universidade Catolica de Brasilia, Pos-Graduacao em Ciencias Genomicas e Biotecnologia, SGAN Quadra 916, Av. W5 Norte, 70790-160 Brasilia, DF (Brazil); Bone Biology and Implant Therapy Laboratory, Department of Prosthodontics, University of North Carolina at Chapel Hill, 330 Brauer Hall, CB 7450, Chapel Hill, NC 27599 (United States); Aragao, Francisco J.L. [Universidade Catolica de Brasilia, Pos-Graduacao em Ciencias Genomicas e Biotecnologia, SGAN Quadra 916, Av. W5 Norte, 70790-160 Brasilia, DF (Brazil) [Universidade Catolica de Brasilia, Pos-Graduacao em Ciencias Genomicas e Biotecnologia, SGAN Quadra 916, Av. W5 Norte, 70790-160 Brasilia, DF (Brazil); Embrapa Recursos Geneticos e Biotecnologia, Laboratorio de Introducao e Expressao de Genes, PqEB W5 Norte, 70770-900 Brasilia, DF (Brazil); Cooper, Lyndon F., E-mail: lyndon_cooper@dentistry.unc.edu [Bone Biology and Implant Therapy Laboratory, Department of Prosthodontics, University of North Carolina at Chapel Hill, 330 Brauer Hall, CB 7450, Chapel Hill, NC 27599 (United States)

    2011-01-28T23:59:59.000Z

    Research highlights: {yields} p65 completely blocked HIF-1{alpha} activity at the HRE on different cell lines. {yields} p65 caused minor changes in HIF-1{alpha} and HIF-1{alpha} target genes mRNA expression. {yields} p65 reduced transcription of VEGF promoter. {yields} p65 competes with HIF-1{alpha} for p300. -- Abstract: Hypoxia has emerged as a key determinant of osteogenesis. HIF-1{alpha} is the transcription factor mediating hypoxia responses that include induction of VEGF and related bone induction. Inflammatory signals antagonize bone repair via the NF-{kappa}B pathway. The present investigation explored the functional relationship of hypoxia (HIF-1{alpha} function) and inflammatory signaling (NF-{kappa}B) in stem like and osteoprogenitor cell lines. The potential interaction between HIF-1{alpha} and NF-{kappa}B signaling was explored by co-transfection studies in hFOB with p65, HIF-1{alpha} and 9x-HRE-luc or HIF-1{alpha} target genes reporter plasmids. Nuclear cross-talk was directly tested using the mammalian Gal4/VP16 two-hybrid, and confirmed by co-immunoprecipitation/western blotting assays. The results show that inflammatory stimulation (TNF-{alpha} treatment) causes a marked inhibition of HIF-1{alpha} function at the HRE in all cell lines studied. Also, co-transfection with p65 expression vector leads to reduced hVEGFp transcription after DFO-induced hypoxia. However, TNF-{alpha} treatment had little effect on HIF-1{alpha} mRNA levels. The functional interaction of Gal4-HIF-1{alpha} and VP16-p300 fusion proteins is effectively blocked by expression of p65 in a dose dependent manner. It was concluded that NF-{kappa}B-mediated inflammatory signaling is able to block HIF-1{alpha} transactivation at HRE-encoding genes by direct competition for p300 binding at the promoter. Inflammation may influence the stem cell niche and tissue regeneration by influencing cellular responses to hypoxia.

  9. Impulse Transfer during Sand Impact with a Cellular Structure

    E-Print Network [OSTI]

    Holloman, Ryan L.; Deshpande, Vikram; Wadley, Haydn N. G.

    2015-02-07T23:59:59.000Z

    Department 7 University of Cambridge, Trumpington Street, Cambridge, UK 8 9 Abstract 10 11 12 Compressible cellular metal sandwich structures made from a 3D assembly of square 13 cross section 6061 T6 aluminum alloy tubes, and face sheets of the same alloy... 10 used in the previous study of the soil – structure interaction is shown in Figure 1(a). The cellular 11 structures were manufactured by first laying down a co-linear layer of 6061 aluminum alloy 12 square tubes each spaced a tube width apart. A...

  10. Ratchet Cellular Automata for Colloids in Dynamic Traps

    E-Print Network [OSTI]

    C. J. Olson Reichhardt; C. Reichhardt

    2006-02-13T23:59:59.000Z

    We numerically investigate the transport of kinks in a ratchet cellular automata geometry for colloids interacting with dynamical traps. We find that thermal effects can enhance the transport efficiency in agreement with recent experiments. At high temperatures we observe the creation and annihilation of thermally induced kinks that degrade the signal transmission. We consider both the deterministic and stochastic cases and show how the trap geometry can be adjusted to switch between these two cases. The operation of the dynamical trap geometry can be achieved with the adjustment of fewer parameters than ratchet cellular automata constructed using static traps.

  11. UNCORRECTEDPROOF Please cite this article in press as: Ramos JW, The regulation of extracellular signal-regulated kinase (ERK) in mammalian cells, Int J Biochem Cell

    E-Print Network [OSTI]

    Ramos, Joe W.

    signal-regulated kinase (ERK) in mammalian cells, Int J Biochem Cell Biol (2008), doi:10.1016/j of extracellular signal-regulated kinase (ERK) in mammalian cells 2 3 Joe W. Ramos 2 Department of Natural Products Received in revised form 18 April 20089 Accepted 25 April 200810 Available online xxx11 12 Keywords:13 ERK

  12. Examination of mammalian microRNAs by high-throughput sequencing

    E-Print Network [OSTI]

    Chiang, HyoJin Rosaria

    2011-01-01T23:59:59.000Z

    Small non-coding RNAs play an important role in a wide range of cellular events. MicroRNAs (miRNAs) are an abundant class of small RNAs that post-transcriptionally repress expression of their target genes. Since miRNA ...

  13. Interactome Mapping of the Phosphatidylinositol 3-Kinase-Mammalian Target of Rapamycin

    E-Print Network [OSTI]

    -mTOR pathway. Identification of 67 new interactions was fol- lowed by validation by co-affinity purification annotated interactome of 802 interactions for the PI3K-mTOR pathway. Our screen revealed a predominant place of lithium and other GSK3 inhibitors used in bipolar disease and depression. Molecular & Cellular Proteomics

  14. Chemical biology of mutagenesis and DNA repair: cellular responses to DNA alkylation

    E-Print Network [OSTI]

    Shrivastav, Nidhi

    The reaction of DNA-damaging agents with the genome results in a plethora of lesions, commonly referred to as adducts. Adducts may cause DNA to mutate, they may represent the chemical precursors of lethal events and they ...

  15. Cellular response of the primate (M. mulatta) spleen to bone marrow transplantation in gamma irradiated recipients

    E-Print Network [OSTI]

    Fraunfelter, Frank Clare

    1966-01-01T23:59:59.000Z

    . This monkey reminded the author of an animal that was sensitized to a foreign protein. E. Histo atholo of the S leen. Many of the follicles were hyperplastic. The capsule was small and distended. The reticulo- endothelial cells lining the sinusoids were... higher than the radiation con- trols. E. Histo atholo of the S leen. Both spleens had a reduced number of lyrnphocytes and poorly defined follicles. The reticulo- endothelial-like cells were more prominent in the follicles than normal donors...

  16. Restriction of Receptor Movement Alters Cellular Response: Physical Force Sensing by EphA2

    E-Print Network [OSTI]

    Salaita, Khalid

    2010-01-01T23:59:59.000Z

    DPPC) lipids form a nonfluid bilayer in the gel phase at 37°plated onto fluid and nonfluid supported membranes dopedthe ephrin-A1 tethered to nonfluid DPPC membranes induced ~

  17. Anc1 : a new player in the cellular response to DNA damage

    E-Print Network [OSTI]

    Erlich, Rachel L

    2007-01-01T23:59:59.000Z

    The continuity of living organisms depends on their ability to protect their genomes from a constant assault by internal and external sources of damage. To this end, cells have developed a variety of mechanisms to avoid ...

  18. Restriction of Receptor Movement Alters Cellular Response: Physical Force Sensing by EphA2

    E-Print Network [OSTI]

    Salaita, Khalid

    2010-01-01T23:59:59.000Z

    EGFP-actin–expressing MDA-MB-231 cells, and A. Bershadskybreast cancer cell line, MDA-MB-231 (fig. S3). When theseand cells that express EphA2 (MDA-MB-231) were brought into

  19. Inhibition of Pyruvate Kinase M2 by Reactive Oxygen Species Contributes to Cellular Antioxidant Responses

    E-Print Network [OSTI]

    Vander Heiden, Matthew G.

    Control of intracellular reactive oxygen species (ROS) concentrations is critical for cancer cell survival. We show that, in human lung cancer cells, acute increases in intracellular concentrations of ROS caused inhibition ...

  20. A Boundary Operator for Computing the Homology of Cellular Structures

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    . Lienhardt S. Peltier Abstract The paper focuses on homology computation over cellular structures through the computation of incidence numbers. Roughly speaking, if two cells are incident, then their incidence number. Lienhardt, S. Peltier Universit´e de Poitiers, Laboratoire XLIM, D´epartement SIC, CNRS 6172; B^atiment SP2

  1. Stochastic Power Control for Cellular Radio Systems \\Lambda

    E-Print Network [OSTI]

    Yates, Roy

    Stochastic Power Control for Cellular Radio Systems \\Lambda Sennur Ulukus Roy D. Yates July 11, iterative power control algorithms have been proposed to minimize transmitter powers while maintaining power control algorithms that use readily available measurements. Two classes of power control

  2. Power Control in Cellular Networks: Taxonomy and Recent Results

    E-Print Network [OSTI]

    Chiang, Mung

    Power Control in Cellular Networks: Taxonomy and Recent Results Mung Chiang Electrical Engineering;Not Covered Other uses of power control: · Channel estimation · Connectivity management Other problem;Problem Tree I: Stationary or Opportunistic bb · Stationary: Channel gains are constants in power control

  3. RESEARCH ARTICLE Abundant Indispensable Redundancies in Cellular Metabolic Networks

    E-Print Network [OSTI]

    Zhang, Jianzhi

    , and translation to metabolism, cell cycle, and embry- onic development (de Visser et al. 2003; Wagner 2005c and Jianzhi Zhang Department of Ecology and Evolutionary Biology, University of Michigan Cellular life is a highly redundant complex system; yet, the evolutionary maintenance of the redundancy remains unexplained

  4. Radio Planning of Energy-Aware Cellular Networks

    E-Print Network [OSTI]

    2010-10-08T23:59:59.000Z

    Note that an important part of the presentation is to be able to test the model with ... portability nature of the network, being cellular, ad-hoc or sensor oriented, made it a real ... or energy-aware protocols (an excellent report on the issues affecting ..... switched off and enter in the stand-by mode in case of very low traffic profile.

  5. CRITICAL POINTS OF THREEDIMENSIONAL BOOTSTRAP PERCOLATIONLIKE CELLULAR AUTOMATA

    E-Print Network [OSTI]

    Chen, Rong-Rong

    CRITICAL POINTS OF THREE­DIMENSIONAL BOOTSTRAP PERCOLATION­LIKE CELLULAR AUTOMATA Rong-Rong Chen (University of Illinois) Abstract. This paper deals with the critical point of three-dimensional bootstrap of set A. Examples. (1) Bootstrap percolation. Take {0, · · · , 2d} and D = {A N : |A| }. In words

  6. Video Article Preparation of Complaint Matrices for Quantifying Cellular Contraction

    E-Print Network [OSTI]

    Gardel, Margaret

    solutions should be disposed as hazardous waste. 6. Dry coverslips in incubator at warm temperature (~37°C and remodeling with traction forces. Here we present a detailed experimental protocol for the preparation of two mechanical stiffness, which is suitable for measuring cellular contraction. These protocols include

  7. Cellular mechanisms of membrane protein folding William R Skach

    E-Print Network [OSTI]

    Cai, Long

    Cellular mechanisms of membrane protein folding William R Skach The membrane protein­folding. This Perspective will focus on emerging evidence that the RTC functions as a protein-folding machine that restricts. The process of polytopic (multispanning) membrane protein folding can be viewed as a series of sequential

  8. Evolving Cellular Automata for Location Management in Mobile Computing Networks

    E-Print Network [OSTI]

    Ha, Dong S.

    entering one of these reporting cells. To create such an evolving CA system, cells in the network for a number of test problems. Index Terms--Cellular automata, genetic algorithms, mobile computing, mobility to interferences. On the other hand, a miss on the location of a mobile terminal will necessitate a search

  9. Cellular/Molecular Detecting Activity in Olfactory Bulb Glomeruli with

    E-Print Network [OSTI]

    Newman, Eric A.

    Cellular/Molecular Detecting Activity in Olfactory Bulb Glomeruli with Astrocyte Recording Didier, Oregon 97239 In the olfactory bulb, axons of olfactory sensory neurons (OSNs) expressing the same to examine functional compartmentalization within and between olfactory bulb glomeruli. Key words: olfactory

  10. Quantifying Security in Hybrid Cellular Markus Jakobsson1

    E-Print Network [OSTI]

    Quantifying Security in Hybrid Cellular Networks Markus Jakobsson1 and Liu Yang2 1 School and recipients to provide auditing information. Our scheme is an exten- sion of [6], where the authors addressed be expected from the use of this approach. For one thing, the energy consumption of the mobile device can

  11. Network Decontamination with Temporal Immunity by Cellular Automata

    E-Print Network [OSTI]

    Flocchini, Paola

    Network Decontamination with Temporal Immunity by Cellular Automata Yassine Daadaa, Paola Flocchini,flocchin,zaguia}@site.uottawa.ca Abstract. Network decontamination (or disinfection) is a widely stud- ied problem in distributed computing to decontaminate the whole network. In the vast literature a variety of as- sumptions are made on the power

  12. NHLBI Workshop Summaries Resident Cellular Components of the Human Lung

    E-Print Network [OSTI]

    Engelhardt, John F.

    NHLBI Workshop Summaries Resident Cellular Components of the Human Lung Current Knowledge and Goals, Maryland; 5 Lung Diseases, National Heart, Lung and Blood Institute, National Institutes of Health and Cell Biology, The University of Iowa, Iowa City, Iowa; 11 Developmental Lung Biology Research

  13. MAMMALIAN SPECIES No. 706, pp. 19, 3 figs. Heterocephalus glaber. By Jennifer U. M. Jarvis and Paul W. Sherman

    E-Print Network [OSTI]

    Hayssen, Virginia

    MAMMALIAN SPECIES No. 706, pp. 1­9, 3 figs. Heterocephalus glaber. By Jennifer U. M. Jarvis the next day. Photograph by J. U. M. Jarvis. Heterocephalus Ru¨ppell, 1842 Heterocephalus Ru¨ppell, 1842 tail, no fur, 3 molars (sometimes 2), and digit 3 of forefoot markedly longer than digit 4. GENERAL

  14. A new Middle Miocene mammalian fauna from Mordoan (Western Turkey) TANJU KAYA, Izmir, DENIS GERAADS, Paris & VAHDET TUNA, Izmir *

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    A new Middle Miocene mammalian fauna from Mordoan (Western Turkey) TANJU KAYA, Izmir, DENIS GERAADS Peninsula of Western Turkey. Among its fauna, which is described here, the carnivores are especially. Their ungulates attest an open environment which must have been widespread in the Turko-Balkanic area

  15. MAMMALIAN SPECIES No. 642, pp. 16, 3 figs. Pteropus vampyrus. By Thomas H. Kunz and Deborah P. Jones

    E-Print Network [OSTI]

    Hayssen, Virginia

    MAMMALIAN SPECIES No. 642, pp. 1­6, 3 figs. Pteropus vampyrus. By Thomas H. Kunz and Deborah P in- cludes 58 species (Koopman, 1993). Andersen (1912) divided Pter- opus into 17 species groups; P. vampyrus is in the vampyrus group, which also includes P. giganteus, P. intermedius, and P. lylei (Corbet

  16. Anthrax pathogen evades the mammalian immune system through stealth siderophore Strong, B. Rowe Byers, and Kenneth N. Raymond

    E-Print Network [OSTI]

    Strong, Roland K.

    production Anthrax pathogen evades the mammalian immune system through stealth siderophore StrongMed and Google Scholar, Supplementary Material www.pnas.org/cgi/content/full/0607055103/DC1 Supplementary material can be found at: References www.pnas.org/cgi/content/full/103/49/18499#BIBL This article cites 24

  17. Stability of fast oscillations in mammalian olfactory bulb: experiment and modeling Nicolas Fourcaud-Trocmea,b,c,d,

    E-Print Network [OSTI]

    Voegtlin, Thomas

    Stability of fast oscillations in mammalian olfactory bulb: experiment and modeling Nicolas Cortex, Vandoeuvre-les-Nancy, F-54506, France Abstract In the rat olfactory bulb (OB), fast oscillations observed stability of the oscillatory regimes. Keywords: olfactory bulb, beta oscillations, gamma

  18. MAMMALIAN SPECIES No. 758, pp. 19, 3 figs. Chinchilla laniger. By Angel E. Spotorno, Carlos A. Zuleta, J. Pablo Valladares,

    E-Print Network [OSTI]

    Hayssen, Virginia

    MAMMALIAN SPECIES No. 758, pp. 1­9, 3 figs. Chinchilla laniger. By Angel E. Spotorno, Carlos A by the American Society of Mammalogists FIG. 1. Photograph of an adult male Chinchilla laniger from border of Reserva Nacional Las Chinchillas, Auco´, Illapel, IV Re- gio´n, Chile (specimen Coleccio´n del Laboratorio

  19. Photo-dissociation quantum yields of mammalian oxyhemoglobin investigated by a nanosecond laser technique

    SciTech Connect (OSTI)

    Yang Ningli [Laboratory of Modern Acoustics, Institute of Acoustics, Nanjing University, Nanjing 210093 (China); Zhang Shuyi [Laboratory of Modern Acoustics, Institute of Acoustics, Nanjing University, Nanjing 210093 (China)]. E-mail: zhangsy@nju.edu.cn; Kuo Paokuang [Laboratory of Modern Acoustics, Institute of Acoustics, Nanjing University, Nanjing 210093 (China); Qu Min [Laboratory of Modern Acoustics, Institute of Acoustics, Nanjing University, Nanjing 210093 (China); Fang Jianwen [Department of Physics, Zhejiang Normal University, Jinhua 321004 (China); Li Jiahuang [Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing 210093 (China); Hua Zichun [Laboratory of Pharmaceutical Biotechnology, Nanjing University, Nanjing 210093 (China)

    2007-02-23T23:59:59.000Z

    The photo-dissociations of oxyhemoglobin of several mammals, such as human, bovine, pig, horse, and rabbit, have been studied. By means of optical pump-probe technique, the quantum yields for photo-dissociation of these oxyhemoglobin have been determined at pH 7 and 20 {sup o}C. A nanosecond laser at 532 nm is used as the pumping source, and a xenon lamp through a monochrometer provides a probe light at 432 nm. The experimental results show that the quantum yields of these mammalian oxyhemoglobin are different from each other, especially for that of rabbit. By analyzing the amino acid sequences and tetramer structures as well as the flexibility and hydrophobicity of the different hemoglobin, possible explanations for the differences are proposed.

  20. Reprogramming of tRNA modifications controls the oxidative stress response by codon-biased translation of proteins

    E-Print Network [OSTI]

    Chan, Clement T. Y.

    Selective translation of survival proteins is an important facet of the cellular stress response. We recently demonstrated that this translational control involves a stress-specific reprogramming of modified ribonucleosides ...

  1. The fractal structure of cellular automata on Abelian groups

    E-Print Network [OSTI]

    Johannes Gütschow; Vincent Nesme; Reinhard F. Werner

    2010-11-01T23:59:59.000Z

    It is well-known that the spacetime diagrams of some cellular automata have a fractal structure: for instance Pascal's triangle modulo 2 generates a Sierpinski triangle. Explaining the fractal structure of the spacetime diagrams of cellular automata is a much explored topic, but virtually all of the results revolve around a special class of automata, whose typical features include irreversibility, an alphabet with a ring structure, a global evolution that is a ring homomorphism, and a property known as (weakly) p-Fermat. The class of automata that we study in this article has none of these properties. Their cell structure is weaker, as it does not come with a multiplication, and they are far from being p-Fermat, even weakly. However, they do produce fractal spacetime diagrams, and we explain why and how.

  2. Manipulation of cellular GSH biosynthetic capacity via TAT-mediated protein transduction of wild-type or a dominant-negative mutant of glutamate cysteine ligase alters cell sensitivity to oxidant-induced cytotoxicity

    SciTech Connect (OSTI)

    Backos, Donald S.; Brocker, Chad N. [Department of Pharmaceutical Sciences, Graduate Program in Toxicology, School of Pharmacy, University of Colorado Denver, Aurora, CO 80045 (United States); Franklin, Christopher C., E-mail: christopher.franklin@ucdenver.ed [Department of Pharmaceutical Sciences, Graduate Program in Toxicology, School of Pharmacy, University of Colorado Denver, Aurora, CO 80045 (United States); University of Colorado Cancer Center, University of Colorado Denver, Aurora, CO 80045 (United States)

    2010-02-15T23:59:59.000Z

    The glutathione (GSH) antioxidant defense system plays a central role in protecting mammalian cells against oxidative injury. Glutamate cysteine ligase (GCL) is the rate-limiting enzyme in GSH biosynthesis and is a heterodimeric holoenzyme composed of catalytic (GCLC) and modifier (GCLM) subunits. As a means of assessing the cytoprotective effects of enhanced GSH biosynthetic capacity, we have developed a protein transduction approach whereby recombinant GCL protein can be rapidly and directly transferred into cells when coupled to the HIV TAT protein transduction domain. Bacterial expression vectors encoding TAT fusion proteins of both GCL subunits were generated and recombinant fusion proteins were synthesized and purified to near homogeneity. The TAT-GCL fusion proteins were capable of heterodimerization and formation of functional GCL holoenzyme in vitro. Exposure of Hepa-1c1c7 cells to the TAT-GCL fusion proteins resulted in the time- and dose-dependent transduction of both GCL subunits and increased cellular GCL activity and GSH levels. A heterodimerization-competent, enzymatically deficient GCLC-TAT mutant was also generated in an attempt to create a dominant-negative suppressor of GCL. Transduction of cells with a catalytically inactive GCLC(E103A)-TAT mutant decreased cellular GCL activity in a dose-dependent manner. TAT-mediated manipulation of cellular GCL activity was also functionally relevant as transduction with wild-type GCLC(WT)-TAT or mutant GCLC(E103A)-TAT conferred protection or enhanced sensitivity to H{sub 2}O{sub 2}-induced cell death, respectively. These findings demonstrate that TAT-mediated transduction of wild-type or dominant-inhibitory mutants of the GCL subunits is a viable means of manipulating cellular GCL activity to assess the effects of altered GSH biosynthetic capacity.

  3. A new computational model for multi-cellular biological systems

    E-Print Network [OSTI]

    Jennings, Joel Nicholas

    2014-06-10T23:59:59.000Z

    create protein structures within the cell such as the cytoskeleton. The cell produces the fuel it needs to power its activities (ATP) in organelles contained in the cytoplasm called mitochondria. Mitochondria generate ATP through cellular respiration, i... highly complex sequence of interactions within and between cells to transform a fer- tilised egg into a functional embryo. A major challenge in the field of morphogenesis is explaining how coordinated cell shape change, growth and movement create...

  4. Effect of Soft Handoffs on the Downlink Admission Region for CDMA Multimedia Cellular Systems

    E-Print Network [OSTI]

    Kumar, Anurag

    Effect of Soft Handoffs on the Downlink Admission Region for CDMA Multimedia Cellular Systems normally expands for a cellular system using soft handoffs. We propose to look at how the soft handoff 560012 e­mail: munish, anurag@ece.iisc.ernet.in ABSTRACT We consider a CDMA based cellular system

  5. Modeling of Plate-Like Precipitates in Aluminum Alloys--Comparison between Phase Field and Cellular

    E-Print Network [OSTI]

    Chen, Long-Qing

    Modeling of Plate-Like Precipitates in Aluminum Alloys--Comparison between Phase Field and Cellular artificial ageing of aluminum alloys: the phase field and the cellular automaton methods. Although both and computationally effective for the application of precipitation modeling. Keywords Aluminum alloys, Cellular

  6. Administrative Policy: Cellular Communication Devices and Services Page 1 of 6

    E-Print Network [OSTI]

    Hardy, Christopher R.

    of their use of personal cellular telephones and related devices for University business purposes. Should thoseAdministrative Policy: Cellular Communication Devices and Services Page 1 of 6 Governance & Policies Effective: May 8, 2007 Administrative Policy CELLULAR COMMUNICATION DEVICES and SERVICES Approved

  7. DNA damage responses in the context of the cell division cycle

    E-Print Network [OSTI]

    Giunta, Simona

    2010-11-16T23:59:59.000Z

    During my PhD, I have investigated aspects of the DNA damage response (DDR) in the context of three different cellular scenarios: DNA damage signalling in response to double-strand breaks during mitosis, coordination of DNA replication with DNA...

  8. Electrocatalytic reduction of nitric oxide at electrodes modified with electropolymerized films of [Cr(v-tpy){sub 2}]{sup 3+} and their application to cellular NO determinations

    SciTech Connect (OSTI)

    Maskus, M.; Wu, Q.; Shapleigh, J.P.; Abruna, H.D. [Cornell Univ., Ithaca, NY (United States)] [Cornell Univ., Ithaca, NY (United States); Pariente, F. [Universidad Autonoma de Madrid (Spain)] [Universidad Autonoma de Madrid (Spain); Toffanin, A. [Ciudad Universitaria, Madrid (Spain)] [Ciudad Universitaria, Madrid (Spain)

    1996-09-15T23:59:59.000Z

    Nitric oxide can be electrocatalytically reduced at electrodes modified with electropolymerized films of [Cr(v-tpy){sub 2}]{sup 3+}. Upon further modification with a thin film of Nafion (to prevent interferences from anions, especially nitrite), these electrodes can be employed as NO sensors in solution with submicromolar detection limits and fast response. We have carried out preliminary studies of cellular NO release from Rhodobacter sphaeroides bacterial cells with excellent results. 21 refs., 7 figs., 1 tab.

  9. PI3K/AKT and ERK regulate retinoic acid-induced neuroblastoma cellular differentiation

    SciTech Connect (OSTI)

    Qiao, Jingbo [Department of Pediatric Surgery, Vanderbilt University Medical Center, Nashville, TN 37232 (United States)] [Department of Pediatric Surgery, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Paul, Pritha; Lee, Sora [Department of Pediatric Surgery, Vanderbilt University Medical Center, Nashville, TN 37232 (United States) [Department of Pediatric Surgery, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Qiao, Lan; Josifi, Erlena; Tiao, Joshua R. [Department of Pediatric Surgery, Vanderbilt University Medical Center, Nashville, TN 37232 (United States)] [Department of Pediatric Surgery, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Chung, Dai H., E-mail: dai.chung@vanderbilt.edu [Department of Pediatric Surgery, Vanderbilt University Medical Center, Nashville, TN 37232 (United States); Department of Cancer Biology, Vanderbilt University Medical Center, Nashville, TN 37232 (United States)

    2012-08-03T23:59:59.000Z

    Highlights: Black-Right-Pointing-Pointer Retinoic acid (RA) induces neuroblastoma cells differentiation, which is accompanied by G0/G1 cell cycle arrest. Black-Right-Pointing-Pointer RA resulted in neuroblastoma cell survival and inhibition of DNA fragmentation; this is regulated by PI3K pathway. Black-Right-Pointing-Pointer RA activates PI3K and ERK1/2 pathway; PI3K pathway mediates RA-induced neuroblastoma cell differentiation. Black-Right-Pointing-Pointer Upregulation of p21 is necessary for RA-induced neuroblastoma cell differentiation. -- Abstract: Neuroblastoma, the most common extra-cranial solid tumor in infants and children, is characterized by a high rate of spontaneous remissions in infancy. Retinoic acid (RA) has been known to induce neuroblastoma differentiation; however, the molecular mechanisms and signaling pathways that are responsible for RA-mediated neuroblastoma cell differentiation remain unclear. Here, we sought to determine the cell signaling processes involved in RA-induced cellular differentiation. Upon RA administration, human neuroblastoma cell lines, SK-N-SH and BE(2)-C, demonstrated neurite extensions, which is an indicator of neuronal cell differentiation. Moreover, cell cycle arrest occurred in G1/G0 phase. The protein levels of cyclin-dependent kinase inhibitors, p21 and p27{sup Kip}, which inhibit cell proliferation by blocking cell cycle progression at G1/S phase, increased after RA treatment. Interestingly, RA promoted cell survival during the differentiation process, hence suggesting a potential mechanism for neuroblastoma resistance to RA therapy. Importantly, we found that the PI3K/AKT pathway is required for RA-induced neuroblastoma cell differentiation. Our results elucidated the molecular mechanism of RA-induced neuroblastoma cellular differentiation, which may be important for developing novel therapeutic strategy against poorly differentiated neuroblastoma.

  10. Response Elements

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2007-07-11T23:59:59.000Z

    The Guide provides acceptable methods for meeting the requirement of DOE O 151.1C for response elements that respond or contribute to response as needed in an emergency. Cancels DOE G 151.1-1, Volume 3-1, DOE G 151.1-1, Volume 3-2, DOE G 151.1-1, Volume 3-3, DOE G 151.1-1, Volume 3-4, DOE G 151.1-1, Volume 4-1, DOE G 151.1-1, Volume 4-2, DOE G 151.1-1, Volume 4-3, DOE G 151.1-1, Volume 4-4, DOE G 151.1-1, Volume 4-5, and DOE G 151.1-1, Volume 4-6.

  11. Wireless Demand Response Controls for HVAC Systems

    SciTech Connect (OSTI)

    Federspiel, Clifford

    2009-06-30T23:59:59.000Z

    The objectives of this scoping study were to develop and test control software and wireless hardware that could enable closed-loop, zone-temperature-based demand response in buildings that have either pneumatic controls or legacy digital controls that cannot be used as part of a demand response automation system. We designed a SOAP client that is compatible with the Demand Response Automation Server (DRAS) being used by the IOUs in California for their CPP program, design the DR control software, investigated the use of cellular routers for connecting to the DRAS, and tested the wireless DR system with an emulator running a calibrated model of a working building. The results show that the wireless DR system can shed approximately 1.5 Watts per design CFM on the design day in a hot, inland climate in California while keeping temperatures within the limits of ASHRAE Standard 55: Thermal Environmental Conditions for Human Occupancy.

  12. Novel localization of OCTN1, an organic cation/carnitine transporter, to mammalian mitochondria

    SciTech Connect (OSTI)

    Lamhonwah, Anne-Marie [Division of Neurology, Department of Pediatrics, Hospital for Sick Children and Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ont., M5G 1X8 (Canada); Tein, Ingrid [Division of Neurology, Department of Pediatrics, Hospital for Sick Children and Department of Laboratory Medicine and Pathobiology, University of Toronto, Toronto, Ont., M5G 1X8 (Canada)]. E-mail: ingrid.tein@sickkids.ca

    2006-07-14T23:59:59.000Z

    Carnitine is a zwitterion essential for the {beta}-oxidation of fatty acids. We report novel localization of the organic cation/carnitine transporter, OCTN1, to mitochondria. We made GFP- and RFP-human OCTN1 cDNA constructs and showed expression of hOCTN1 in several transfected mammalian cell lines. Immunostaining of GFP-hOCTN1 transfected cells with different intracellular markers and confocal fluorescent microscopy demonstrated mitochondrial expression of OCTN1. There was striking co-localization of an RFP-hOCTN1 fusion protein and a mitochondrial-GFP marker construct in transfected MEF-3T3 and no co-localization of GFP-hOCTN1 in transfected human skin fibroblasts with other intracellular markers. L-[{sup 3}H]Carnitine uptake in freshly isolated mitochondria of GFP-hOCTN1 transfected HepG2 demonstrated a K {sub m} of 422 {mu}M and Western blot with an anti-GFP antibody identified the expected GFP-hOCTN1 fusion protein (90 kDa). We showed endogenous expression of native OCTN1 in HepG2 mitochondria with anti-GST-hOCTN1 antibody. Further, we definitively confirmed intact L-[{sup 3}H]carnitine uptake (K {sub m} 1324 {mu}M), solely attributable to OCTN1, in isolated mitochondria of mutant human skin fibroblasts having <1% of carnitine acylcarnitine translocase activity (alternate mitochondrial carnitine transporter). This mitochondrial localization was confirmed by TEM of murine heart incubated with highly specific rabbit anti-GST-hOCTN1 antibody and immunogold labeled goat anti-rabbit antibody. This suggests an important yet different role for OCTN1 from other OCTN family members in intracellular carnitine homeostasis.

  13. Demand Response and Open Automated Demand Response

    E-Print Network [OSTI]

    LBNL-3047E Demand Response and Open Automated Demand Response Opportunities for Data Centers G described in this report was coordinated by the Demand Response Research Center and funded by the California. Demand Response and Open Automated Demand Response Opportunities for Data Centers. California Energy

  14. Optimal channel allocation with dynamic power control in cellular networks

    E-Print Network [OSTI]

    Wu, Xin; Bari, Ataul; 10.5121/ijcnc.2011.3206

    2011-01-01T23:59:59.000Z

    Techniques for channel allocation in cellular networks have been an area of intense research interest for many years. An efficient channel allocation scheme can significantly reduce call-blocking and calldropping probabilities. Another important issue is to effectively manage the power requirements for communication. An efficient power control strategy leads to reduced power consumption and improved signal quality. In this paper, we present a novel integer linear program (ILP) formulation that jointly optimizes channel allocation and power control for incoming calls, based on the carrier-to-interference ratio (CIR). In our approach we use a hybrid channel assignment scheme, where an incoming call is admitted only if a suitable channel is found such that the CIR of all ongoing calls on that channel, as well as that of the new call, will be above a specified value. Our formulation also guarantees that the overall power requirement for the selected channel will be minimized as much as possible and that no ongoin...

  15. Cellular telephone-based wide-area radiation detection network

    DOE Patents [OSTI]

    Craig, William W. (Pittsburg, CA); Labov, Simon E. (Berkeley, CA)

    2009-06-09T23:59:59.000Z

    A network of radiation detection instruments, each having a small solid state radiation sensor module integrated into a cellular phone for providing radiation detection data and analysis directly to a user. The sensor module includes a solid-state crystal bonded to an ASIC readout providing a low cost, low power, light weight compact instrument to detect and measure radiation energies in the local ambient radiation field. In particular, the photon energy, time of event, and location of the detection instrument at the time of detection is recorded for real time transmission to a central data collection/analysis system. The collected data from the entire network of radiation detection instruments are combined by intelligent correlation/analysis algorithms which map the background radiation and detect, identify and track radiation anomalies in the region.

  16. Cellular glass insulation keeps liquefied gas from vaporizing

    SciTech Connect (OSTI)

    NONE

    1995-11-01T23:59:59.000Z

    The North West Shelf Project, located on the Burrup Peninsula in Western Australia, supplies much of that vast state with natural gas for domestic and industrial applications. Some of the gas is also exported to Japan as liquefied natural gas (LNG). While awaiting shipment to Japan, the LNG is stored at {minus}322 F in four storage tanks, each with a capacity of 2.5 million ft{sup 3}. When Woodside Offshore Petroleum Pty Ltd., operator of the LNG facility, selected insulation material for the storage tanks, it went in search of a material with more than just insulating value. Since the insulation is installed inside the tanks, it must be able to resist wicking or absorbing the LNG. Also, it had to have sufficient strength to withstand the weight of the 2.5 million ft{sup 3} of LNG without being crushed or losing its insulting properties. And, as a safety precaution, the selected materials should neither burn nor support combustion. Ultimately, Woodside selected a cellular glass insulation called Foamglas, from Pittsburgh Corning Corp., that met all the performance criteria and was cost competitive with the lesser-performing alternatives. Foamglas is produced from strong, inert borosilicate glass. Its insulating capability is provided by the tiny, closed cells of air encapsulated within the foam-like structure of the glass. Since the cells are closed,neither liquid nor vapor can enter the structure of the insulation. The inert glass itself will not absorb or react with LNG, nor will it burn or support a fire. The cellular structure provides effective insulation in both not and cold applications, and offers a fire barrier.

  17. MOLECULAR AND CELLULAR BIOLOGY, 0270-7306/97/$04.00 0

    E-Print Network [OSTI]

    Spang, Rainer

    for this parasite heat shock protein during the initial stages of a mammalian infection. Under environmental stress the stress-induced expression of Hsp104, a member of the ClpB family of heat shock proteins (7, 26), leads to increased tolerance to heat stress and various chemical stresses (25, 33, 34). Hsp104 forms a homohexamer

  18. A Molecular Model for Intercellular Synchronization in the Mammalian Circadian Clock

    E-Print Network [OSTI]

    Mountziaris, T. J.

    , Massachusetts Institute of Technology, Cambridge, Massachusetts; y Department of Chemical Engineering, University of Massachusetts, Amherst, Massachusetts; z Department of Biology, Washington University, St by maximizing VIP release. INTRODUCTION The circadian clock is responsible for the robust regulation

  19. Impact of Resolution on Simulation of Closed Mesoscale Cellular Convection Identified by Dynamically Guided Watershed Segmentation

    SciTech Connect (OSTI)

    Martini, Matus; Gustafson, William I.; Yang, Qing; Xiao, Heng

    2014-11-27T23:59:59.000Z

    Organized mesoscale cellular convection (MCC) is a common feature of marine stratocumulus that forms in response to a balance between mesoscale dynamics and smaller scale processes such as cloud radiative cooling and microphysics. We use the Weather Research and Forecasting model with chemistry (WRF-Chem) and fully coupled cloud-aerosol interactions to simulate marine low clouds during the VOCALS-REx campaign over the southeast Pacific. A suite of experiments with 3- and 9-km grid spacing indicates resolution-dependent behavior. The simulations with finer grid spacing have smaller liquid water paths and cloud fractions, while cloud tops are higher. The observed diurnal cycle is reasonably well simulated. To isolate organized MCC characteristics we develop a new automated method, which uses a variation of the watershed segmentation technique that combines the detection of cloud boundaries with a test for coincident vertical velocity characteristics. This ensures that the detected cloud fields are dynamically consistent for closed MCC, the most common MCC type over the VOCALS-REx region. We demonstrate that the 3-km simulation is able to reproduce the scaling between horizontal cell size and boundary layer height seen in satellite observations. However, the 9-km simulation is unable to resolve smaller circulations corresponding to shallower boundary layers, instead producing invariant MCC horizontal scale for all simulated boundary layers depths. The results imply that climate models with grid spacing of roughly 3 km or smaller may be needed to properly simulate the MCC structure in the marine stratocumulus regions.

  20. Cytotoxicological Response to Engineered Nanomaterials: A Pathway-Driven Process

    E-Print Network [OSTI]

    Romoser, Amelia Antonia

    2012-07-16T23:59:59.000Z

    to deal with the ?insult? of the nanoparticle exposure by activating Nrf-2, a key transcription 10 factor involved in upregulating antioxidant genes, or the exposure may trigger more of an inflammatory response, in which NF-?B plays a role. A... disturbance of the cellular redox equilibrium and subsequent oxidative stress has been shown to trigger multiple stress pathways and transcription factors of redox-sensitive nature, such as nuclear factor-erythroid 2-p45?related factor 2 (Nrf2), which...

  1. Implementing Per Bak's Sand Pile Model as a Two-Dimensional Cellular Automaton

    E-Print Network [OSTI]

    Tesfatsion, Leigh

    Implementing Per Bak's Sand Pile Model as a Two-Dimensional Cellular Automaton Leigh Tesfatsion 21 January 2009 Econ 308 Presentation Outline · Brief review: What is a Cellular Automaton? · Sand piles and "self-organized criticality" · Algorithmic description of Per Bak's sand pile model as a two

  2. Trigger-Wave Propagation in Arbitrary Metrics in Asynchronous Cellular Logic Arrays

    E-Print Network [OSTI]

    Dudek, Piotr

    Trigger-Wave Propagation in Arbitrary Metrics in Asynchronous Cellular Logic Arrays Przemyslaw image processing tasks using trigger-wave propagation in a medium with a hardware-controlled metric. The principles of wave propagation in cellular four-connected logic arrays emulating different distance measure

  3. EECE 595: SPREAD SPECTRUM COMMUNICATIONS 1 Distributed Power Control in CDMA Cellular

    E-Print Network [OSTI]

    EECE 595: SPREAD SPECTRUM COMMUNICATIONS 1 Distributed Power Control in CDMA Cellular System Aly El-Osery Abstract In wireless cellular communication, it is essential to #12;nd e#11;ective means of power control control will heavily impact the system capacity. Distributed power control (DPC) is a natural choice

  4. EECE 595: SPREAD SPECTRUM COMMUNICATIONS 1 Distributed Power Control in CDMA Cellular

    E-Print Network [OSTI]

    EECE 595: SPREAD SPECTRUM COMMUNICATIONS 1 Distributed Power Control in CDMA Cellular System Aly El-Osery Abstract In wireless cellular communication, it is essential to #12;nd e#11;ective means of power control power control will heavily impact the system capacity. Distributed power control (DPC) is a natural

  5. Characterizing Geospatial Dynamics of Application Usage in a 3G Cellular Data Network

    E-Print Network [OSTI]

    Fisher, Kathleen

    Characterizing Geospatial Dynamics of Application Usage in a 3G Cellular Data Network M. Zubair provided the evidence that significant geospatial correla- tions, in terms of traffic volume and application access, exist in cellular network usage. Such geospatial correlation patterns provide local

  6. CELLULAR FOAMS: A POTENTIAL INNOVATIVE SOLID BREEDER MATERIAL FOR FUSION APPLICATIONS

    E-Print Network [OSTI]

    Ghoniem, Nasr M.

    the development of ceramic foams or cellular ceramics for solid breeders in fusion reactor blankets. A cellular breeder material has a number of thermo-mechanical advantages over pebble beds, which can enhance blanket, and improved breeder-wall contact would result in a reduction of blanket multiplier and structure volume

  7. A Randomized Saturation Degree Heuristic for Channel Assignment in Cellular Radio Networks

    E-Print Network [OSTI]

    Battiti, Roberto

    in a mobile station setting is growing rapidly. The #12;rst cellular system, known as AMPS (Advanced Mobile Phone Service), appeared in Chicago in 1979. A cellular system was introduced in Europe in 1981 in the Scandinavian countries, and was called NMT (Nordic Mobile Tele- phone). The Channel Assignment Problem (CAP

  8. A Randomized Saturation Degree Heuristic for Channel Assignment in Cellular Radio Networks

    E-Print Network [OSTI]

    Battiti, Roberto

    rapidly. The first cellular system, known as AMPS (Advanced Mobile Phone Service), appeared in Chicago in 1979. A cellular system was introduced in Europe in 1981 in the Scandinavian countries, and was called NMT (Nordic Mobile Tele­ phone). The Channel Assignment Problem (CAP) is fairly well studied

  9. Exploiting Hidden Convexity For Flexible And Robust Resource Allocation In Cellular Networks

    E-Print Network [OSTI]

    Tan, Chee Wei

    Exploiting Hidden Convexity For Flexible And Robust Resource Allocation In Cellular Networks Chee transmission in a CDMA cellular network, we propose an optimal power control scheme with congestion Wei Tan1, Daniel P. Palomar2, and Mung Chiang1 1 Electrical Engineering Dept., Princeton University

  10. A Mobility Model for Cost Analysis in Integrated Cellular/WLANs

    E-Print Network [OSTI]

    Shenoy, Nirmala

    A Mobility Model for Cost Analysis in Integrated Cellular/WLANs Nirmala Shenoy, Bruce Hartpence, Information Technology Department, Rochester Institute of Technology, Rochester NY 14623, USA Rafael Mantilla that can be used to study the costs and benefits of integrating cellular and Wireless LANs, from a vendor

  11. Self-Optimization in Mobile Cellular Networks: Power Control and User Association

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Self-Optimization in Mobile Cellular Networks: Power Control and User Association Chung Shue Chen develop mathematical and algorith- mic tools for the self-optimization of mobile cellular networks the wireless devices are proposed. We focus on the optimization of transmit power and of user association

  12. Mining Call and Mobility Data to Improve Paging Efficiency in Cellular Networks

    E-Print Network [OSTI]

    , Data Mining, CDMA 1. INTRODUCTION Location management is a key component in the operation of cellularMining Call and Mobility Data to Improve Paging Efficiency in Cellular Networks Hui Zang Sprint a different, data-driven approach in how we design and evaluate our solution. Specifically, we mine more than

  13. Administrative Policy: Cellular Communication Devices and Services Page 1 of 6

    E-Print Network [OSTI]

    Hardy, Christopher R.

    to be sufficient to pay for the cost of their use of personal cellular telephones and related devices a qualified employee to use the same device for both personal and University business purposes. AppliesAdministrative Policy: Cellular Communication Devices and Services Page 1 of 6 Governance

  14. Energy consumption in cellular network: ON-OFF model and impact of mobility

    E-Print Network [OSTI]

    Energy consumption in cellular network: ON-OFF model and impact of mobility Thanh Tung Vu Telecom consumption in cellular network and we focus on the distribution of energy consumed by a base station. We first define the energy consumption model, in which the consumed energy is divided into two parts

  15. On the Interaction between Marine Boundary Layer Cellular Cloudiness and Surface Heat Fluxes

    SciTech Connect (OSTI)

    Kazil, J.; Feingold, G.; Wang, Hailong; Yamaguchi, T.

    2014-01-02T23:59:59.000Z

    The interaction between marine boundary layer cellular cloudiness and surface uxes of sensible and latent heat is investigated. The investigation focuses on the non-precipitating closed-cell state and the precipitating open-cell state at low geostrophic wind speed. The Advanced Research WRF model is used to conduct cloud-system-resolving simulations with interactive surface fluxes of sensible heat, latent heat, and of sea salt aerosol, and with a detailed representation of the interaction between aerosol particles and clouds. The mechanisms responsible for the temporal evolution and spatial distribution of the surface heat fluxes in the closed- and open-cell state are investigated and explained. It is found that the horizontal spatial structure of the closed-cell state determines, by entrainment of dry free tropospheric air, the spatial distribution of surface air temperature and water vapor, and, to a lesser degree, of the surface sensible and latent heat flux. The synchronized dynamics of the the open-cell state drives oscillations in surface air temperature, water vapor, and in the surface fluxes of sensible and latent heat, and of sea salt aerosol. Open-cell cloud formation, cloud optical depth and liquid water path, and cloud and rain water path are identified as good predictors of the spatial distribution of surface air temperature and sensible heat flux, but not of surface water vapor and latent heat flux. It is shown that by enhancing the surface sensible heat flux, the open-cell state creates conditions by which it is maintained. While the open-cell state under consideration is not depleted in aerosol, and is insensitive to variations in sea-salt fluxes, it also enhances the sea-salt flux relative to the closed-cell state. In aerosol-depleted conditions, this enhancement may replenish the aerosol needed for cloud formation, and hence contribute to the perpetuation of the open-cell state as well. Spatial homogenization of the surface fluxes is found to have only a small effect on cloud properties in the investigated cases. This indicates that sub-grid scale spatial variability in the surface flux of sensible and latent heat and of sea salt aerosol may not be required in large scale and global models to describe marine boundary layer cellular cloudiness.

  16. Discovery of a Novel Prolactin in Non-Mammalian Vertebrates: Evolutionary Perspectives and Its Involvement in Teleost Retina Development

    E-Print Network [OSTI]

    Xigui Huang; Michelle N. Y. Hui; Yun Liu; Don S. H. Yuen; Yong Zhang; Wood Yee Chan; Hao Ran; Shuk Han Cheng; Christopher H. K. Cheng

    Background: The three pituitary hormones, viz. prolactin (PRL), growth hormone (GH) and somatolactin (SL), together with the mammalian placental lactogen (PL), constitute a gene family of hormones with similar gene structure and encoded protein sequences. These hormones are believed to have evolved from a common ancestral gene through several rounds of gene duplication and subsequent divergence. Principal Findings: In this study, we have identified a new PRL-like gene in non-mammalian vertebrates through bioinformatics and molecular cloning means. Phylogenetic analyses showed that this novel protein is homologous to the previously identified PRL. A receptor transactivation assay further showed that this novel protein could bind to PRL receptor to trigger the downstream post-receptor event, indicating that it is biologically active. In view of its close phylogenetic relationship with PRL and also its ability to activate PRL receptor, we name it as PRL2 and the previously identified PRL as PRL1. All the newly discovered PRL2 sequences possess three conserved disulfide linkages with the exception of the shark PRL2 which has only two. In sharp contrast to the classical PRL1 which is predominantly expressed in the pituitary, PRL2 was found to be mainly expressed in the eye and brain of the zebrafish but not in the pituitary. A largely reduced inner nuclear layer of the retina was observed after morpholino knockdown of zebrafish PRL2, indicating its role on retina development in teleost.

  17. Cellular Networks as Models for Planck-Scale Physics

    E-Print Network [OSTI]

    Manfred Requardt

    1998-06-17T23:59:59.000Z

    Starting from the working hypothesis that both physics and the corresponding mathematics have to be described by means of discrete concepts on the Planck scale, one of the many problems one has to face in this enterprise is to find the discrete protoforms of the building blocks of our ordinary continuum physics and mathematics. We base our own approach on what we call `cellular networks', consisting of cells (nodes) interacting with each other via bonds (figuring as elementary interactions) according to a certain `local law'. Geometrically our dynamical networks are living on graphs. Hence a substantial amount of the investigation is devoted to the developement of various versions of discrete (functional) analysis and geometry on such (almost random) webs. Another important topic we address is a suitable concept of intrinsic (fractal) dimension on erratic structures of this kind. In the course of the investigation we make comments concerning both different and related approaches to quantum gravity as, say, the spin network framework. It may perhaps be said that certain parts of our programme seem to be a realisation of ideas sketched by Smolin some time ago (see the introduction).

  18. The size, shape, and dynamics of cellular blebs

    E-Print Network [OSTI]

    Lim, Fong Yin; Mahadevan, L

    2015-01-01T23:59:59.000Z

    A cellular bleb grows when a portion of the cell membrane detaches from the underlying cortex under the influence of a cytoplasmic pressure. We develop a quantitative model for the growth and dynamics of these objects in a simple two-dimensional setting. In particular, we first find the minimum cytoplasmic pressure and minimum unsupported membrane length for a stationary bleb to nucleate and grow as a function of the membrane-cortex adhesion. We next show how a bleb may travel around the periphery of the cell when the cytoplasmic pressure varies in space and time in a prescribed way and find that the traveling speed is governed by the speed of the pressure change induced by local cortical contraction while the shape of the traveling bleb is governed by the speed of cortical healing. Finally, we relax the assumption that the pressure change is prescribed and couple it hydrodynamically to the cortical contraction and membrane deformation. By quantifying the phase space of bleb formation and dynamics, our framew...

  19. Developmental Cell, Vol. 6, 791800, June, 2004, Copyright 2004 by Cell Press Major Molecular Differences between Mammalian Sexes

    E-Print Network [OSTI]

    into the documented sex-specific propensities2 Department of Molecular, Cellular and Developmental Biology to diseases and 3Most mammals exhibit obvious phenotypic differences between the male and female sexes, and many. replicate two cRNAs (technical replicates) were prepared and independently hybridized to Affymetrix MOE430

  20. IGF-I enhances cellular senescence via the reactive oxygen species-p53 pathway

    SciTech Connect (OSTI)

    Handayaningsih, Anastasia-Evi; Takahashi, Michiko; Fukuoka, Hidenori; Iguchi, Genzo; Nishizawa, Hitoshi; Yamamoto, Masaaki; Suda, Kentaro [Division of Diabetes and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of Medicine, Kobe (Japan)] [Division of Diabetes and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of Medicine, Kobe (Japan); Takahashi, Yutaka, E-mail: takahash@med.kobe-u.ac.jp [Division of Diabetes and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of Medicine, Kobe (Japan)] [Division of Diabetes and Endocrinology, Department of Internal Medicine, Kobe University Graduate School of Medicine, Kobe (Japan)

    2012-08-24T23:59:59.000Z

    Highlights: Black-Right-Pointing-Pointer Cellular senescence plays an important role in tumorigenesis and aging process. Black-Right-Pointing-Pointer We demonstrated IGF-I enhanced cellular senescence in primary confluent cells. Black-Right-Pointing-Pointer IGF-I enhanced cellular senescence in the ROS and p53-dependent manner. Black-Right-Pointing-Pointer These results may explain the underlying mechanisms of IGF-I involvement in tumorigenesis and in regulation of aging. -- Abstract: Cellular senescence is characterized by growth arrest, enlarged and flattened cell morphology, the expression of senescence-associated {beta}-galactosidase (SA-{beta}-gal), and by activation of tumor suppressor networks. Insulin-like growth factor-I (IGF-I) plays a critical role in cellular growth, proliferation, tumorigenesis, and regulation of aging. In the present study, we show that IGF-I enhances cellular senescence in mouse, rat, and human primary cells in the confluent state. IGF-I induced expression of a DNA damage marker, {gamma}H2AX, the increased levels of p53 and p21 proteins, and activated SA-{beta}-gal. In the confluent state, an altered downstream signaling of IGF-I receptor was observed. Treatment with a reactive oxygen species (ROS) scavenger, N-acetylcystein (NAC) significantly suppressed induction of these markers, indicating that ROS are involved in the induction of cellular senescence by IGF-I. In p53-null mouse embryonic fibroblasts, the IGF-I-induced augmentation of SA-{beta}-gal and p21 was inhibited, demonstrating that p53 is required for cellular senescence induced by IGF-I. Thus, these data reveal a novel pathway whereby IGF-I enhances cellular senescence in the ROS and p53-dependent manner and may explain the underlying mechanisms of IGF-I involvement in tumorigenesis and in regulation of aging.

  1. MAMMALIAN SPECIES No. 710, pp. 13, 3 figs. Chaerephon nigeriae. By Craig K. R. Willis, Jennifer M. Psyllakis, and Darren J. H. Sleep

    E-Print Network [OSTI]

    Hayssen, Virginia

    MAMMALIAN SPECIES No. 710, pp. 1­3, 3 figs. Chaerephon nigeriae. By Craig K. R. Willis, Jennifer M. Photographs of Chaerephon nigeriae, lateral view of adult from Sengwa, northwestern Zimbabwe and ventral view of adult female from Zimbabwe. Photographs by M. Brock Fenton. Used with permission. Chaerephon nigeriae

  2. Cellular Uptake and Biocompatibility of Bismuth Ferrite Harmonic Advanced Nanoparticles

    E-Print Network [OSTI]

    Staedler, Davide; Magouroux, Thibaud; Rogov, Andrii; Maguire, Ciaran Manus; Mohamed, Bashir M; Schwung, Sebastian; Rytz, Daniel; Jüstel, Thomas; Hwu, Stéphanie; Mugnier, Yannick; Dantec, Ronan Le; Volkov, Yuri; Gerber-Lemaire, Sandrine; Prina-Melloc, Adriele; Bonacina, Luigi; Wolf, Jean-Pierre

    2014-01-01T23:59:59.000Z

    Bismuth Ferrite (BFO) nanoparticles (BFO-NP) display interesting optical (nonlinear response) and magnetic properties which make them amenable for bio-oriented applications as intra- and extra membrane contrast agents. Due to the relatively recent availability of this material in well dispersed nanometric form, its biocompatibility was not known to date. In this study, we present a thorough assessment of the effects of in vitro exposure of human adenocarcinoma (A549), lung squamous carcinoma (NCI-H520), and acute monocytic leukemia (THP-1) cell lines to uncoated and poly(ethylene glycol)-coated BFO-NP in the form of cytotoxicity, haemolytic response and biocompatibility. Our results support the attractiveness of the functional-BFO towards biomedical applications focused on advanced diagnostic imaging.

  3. Stable control of distributed hysteretic systems using cellular broadcast stochastic feedback

    E-Print Network [OSTI]

    Wood, Levi Benjamin

    This work develops a provably stable broadcast feedback approach to regulating the aggregate output of a collection of stochastically behaving cellular units with pronounced hysteresis. Similar to skeletal muscle, comprised ...

  4. Design and analysis of active fluid-and-cellular solid composites for controllable stiffness robotic elements

    E-Print Network [OSTI]

    Cheng, Nadia G. (Nadia Gen San)

    2009-01-01T23:59:59.000Z

    The purpose of this thesis is to investigate the use of a new class of materials for realizing soft robots. Specifically, meso-scale composites--composed of cellular solids impregnated with active fluids-were be designed ...

  5. Compressive behavior of trabecular bone in the proximal tibia using a cellular solid model 

    E-Print Network [OSTI]

    Prommin, Danu

    2005-11-01T23:59:59.000Z

    In this study, trabecular architecture is considered as a cellular solid structure, including both intact and damaged bone models. ??Intact?? bone models were constructed based on ideal versions of 25, 60 and 80-year-old ...

  6. Simulation Methods for Estimation of Blocking Probabilities in Cellular Telecommunication Networks

    E-Print Network [OSTI]

    Vázquez-Abad, Felisa J.

    .2.1 Subsampling the ribs . . . . . . . . . . . . . . . . . . . . . . . . . . . 31 7.2.2 Choice of quasi/TDMA cellular mobile communication networks us- ing dynamic channel assignment are hard to compute for realistic

  7. Cellular Foams: A Potential Innovative Solid Breeder Material for Fusion Applications

    SciTech Connect (OSTI)

    Sharafat, S.; Ghoniem, N.; Williams, B.; Babcock, J. [University of California Los Angeles (United States)

    2005-05-15T23:59:59.000Z

    Ceramic foam and cellular materials are being used in a wide variety of industries and are finding ever growing number of applications. Over the past decade advances in manufacturing of cellular materials have resulted in ceramics with highly uniform interconnected porosities ranging in size from a few {mu}m to several mm. These relatively new ceramic foam materials have a unique set of thermo-mechanical properties, such as excellent thermal shock resistance and high surface to volume ratios. Based on new advances in processing ceramic foams, we suggest the development of ceramic foams or cellular ceramics for solid breeders in fusion reactor blankets. A cellular breeder material has a number of thermo-mechanical advantages over pebble beds, which can enhance blanket performance, improve operational stability, and reduce overall blanket costs.

  8. Engineered sensors and genetic regulatory networks for control of cellular metabolism

    E-Print Network [OSTI]

    Moser, Felix, Ph. D. Massachusetts Institute of Technology

    2013-01-01T23:59:59.000Z

    Complex synthetic genetic programs promise unprecedented control over cellular metabolism and behavior. In this thesis, I describe the design and development of a synthetic genetic program to detect conditions underlying ...

  9. Cellular resolution ex vivo imaging of gastrointestinal tissues with coherence microscopy

    E-Print Network [OSTI]

    Fujimoto, James G.

    Optical coherence microscopy (OCM) combines confocal microscopy and optical coherence tomography (OCT) to improve imaging depth and contrast, enabling cellular imaging in human tissues. We aim to investigate OCM for ex ...

  10. Optimizing cellular attachment and function in long-term hepatocyte cultures using polyelectrolyte multilayer surface modification

    E-Print Network [OSTI]

    Wu, Jonathan (Jonathan G.)

    2006-01-01T23:59:59.000Z

    Hepatocyte morphology is known to be closely linked to cellular functions. As a result, morphogenesis is extremely important to attain organ-equivalent levels of tissue function from in vitro cultures. Thus, a challenge ...

  11. On the Dimensioning of Cellular OFDMA Networks Jean-Marc Kelifa

    E-Print Network [OSTI]

    Boyer, Edmond

    On the Dimensioning of Cellular OFDMA Networks Jean-Marc Kelifa , Marceau Coupechoux,b , Philippe.kelif@orange-ftgroup.com (Jean-Marc Kelif), coupecho@enst.fr (Marceau Coupechoux), godlewsk@enst.fr (Philippe Godlewski) Preprint

  12. Design and application of a cellular, piezoelectric, artificial muscle actuator for biorobotic systems

    E-Print Network [OSTI]

    Secord, Thomas W. (Thomas William)

    2010-01-01T23:59:59.000Z

    One of the foremost challenges in robotics is the development of muscle-like actuators that have the capability to reproduce the smooth motions observed in animals. Biological muscles have a unique cellular structure that ...

  13. Cellular and genetic mechanisms of new tissue production in the regenerating planarian Schmidtea mediterranea

    E-Print Network [OSTI]

    Wagner, Daniel Elger

    2012-01-01T23:59:59.000Z

    Regeneration of missing body parts is biologically fascinating, yet poorly understood. Many instances of regeneration, such as the replacement of amphibian limbs or planarian heads, require both a source for new cellular ...

  14. Mapping textures on 3d terrains: a hybrid cellular automata approach

    E-Print Network [OSTI]

    Sinvhal, Swapnil

    2007-04-25T23:59:59.000Z

    ?. Benati [7] showed that cellular automata can be used to model phenomena typical of living communities like reproduction, self-organization and a complex evolution. An interesting relation between fractals and cellular automata has been discussed... automata approach to represent a model. This gives the advantage of direct texture simulation on the model. II.c Terrain Generation Fractals [57] have been used to generate terrains by many terrain generation engines like fracPlanet [1] and Frac...

  15. Coulter counter determination of bacterial growth and cellular size change following ??Co gamma irradiation

    E-Print Network [OSTI]

    Gaston, Gary W

    1976-01-01T23:59:59.000Z

    COULTER COUNTER DETERMINATION OF BACTERIAL GROWTH AND CELLULAR SIZE CHANGE FOLLOWING Co GAMMA IRRADIATION A Thesis by GARY W. GASTON Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirement... for the degree of MASTER OF SCIENCE December 1976 Ma)or Subject: Biophysics COULTER COUNTER DETERMINATION OF BACTERIAL GROWTH AND CELLULAR SIZE CHANGE FOLLOWING Co GAMMA IRRADIATION A Thesis by GARY W. GASTON APPROVED as to style and content by: ead...

  16. Coulter counter determination of bacterial growth and cellular size change following ??Co gamma irradiation 

    E-Print Network [OSTI]

    Gaston, Gary W

    1976-01-01T23:59:59.000Z

    COULTER COUNTER DETERMINATION OF BACTERIAL GROWTH AND CELLULAR SIZE CHANGE FOLLOWING Co GAMMA IRRADIATION A Thesis by GARY W. GASTON Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirement... for the degree of MASTER OF SCIENCE December 1976 Ma)or Subject: Biophysics COULTER COUNTER DETERMINATION OF BACTERIAL GROWTH AND CELLULAR SIZE CHANGE FOLLOWING Co GAMMA IRRADIATION A Thesis by GARY W. GASTON APPROVED as to style and content by: ead...

  17. Antibody responses in allogeneic radiation chimeras

    SciTech Connect (OSTI)

    Coico, R.F.

    1982-01-01T23:59:59.000Z

    The construction of long-lived allogeneic radiation chimeras, free of graft-versus-host disease, has been achieved using serologic elimination of Thy 1/sup +/ cells from donor bone marrow. Humoral immune function was not restored in these animals as evidenced by lack of primary antibody responses to a T cell-dependent antigen, namely, sheep erythrocytes (SRBC) both in vivo and in vitro. No evidence for a suppressor cell-mediated mechanism was found. Using separated chimera spleen cell populations and specific helper cell soluble mediators, the functional capabilities of chimera B cells, T cells, and macrophages were assessed. These findings suggested that the failure of chimeras to produce antibody is not the result of impaired B cell, T cell, or macrophage function, but rather, that it is due to ineffective cellular interactions. Physiologic cellular interactions depend upon the sharing of major histocompatibility complex (MHC) determinants between interacting cells. However, the self-recognition repertoire of developing T cells may be influenced by the environment which these cells differentiate such that they learn to recognize host MHC determinants as self. These findings support the interpretation that the immunologic hyporeactivity of allogeneic bone marrow chimeras reflects the role of the host environment in restricting the interactive capabilities of donor-derived cells.

  18. Advanced Demand Responsive Lighting

    E-Print Network [OSTI]

    Advanced Demand Responsive Lighting Host: Francis Rubinstein Demand Response Research Center demand responsive lighting systems ­ Importance of dimming ­ New wireless controls technologies · Advanced Demand Responsive Lighting (commenced March 2007) #12;Objectives · Provide up-to-date information

  19. HAZARDOUS MATERIALS EMERGENCY RESPONSE

    E-Print Network [OSTI]

    ANNEX Q HAZARDOUS MATERIALS EMERGENCY RESPONSE #12;ANNEX Q - HAZARDOUS MATERIALS EMERGENCY RESPONSE 03/10/2014 v.2.0 Page Q-1 PROMULGATION STATEMENT Annex Q: Hazardous Materials Emergency Response, and contents within, is a guide to how the University conducts a response specific to a hazardous materials

  20. Partial characterization of the antigen(s) from Listeria monocytogenes responsible for the induction of cellular immunity

    E-Print Network [OSTI]

    Smith, John Stephen

    1982-01-01T23:59:59.000Z

    . Percent migration inhibition was determined using the following formula: migration in experimental supernatants inhibition = 100 X 100 migration in media control supernatants 27 RESULTS i . Naintenance and Determinatioh of Virulence A culture of L...

  1. A systems-level analysis of dynamic reprogramming of RNA modifications in the translational control of cellular responses

    E-Print Network [OSTI]

    Chan, Tsz Yan Clement

    2011-01-01T23:59:59.000Z

    In addition to the four canonical ribonucleosides (adenosine, uridine, guanosine, cytosine), transfer RNAs (tRNA) and ribosomal RNAs (rRNA) are comprised of more than 100 enzyme-catalyzed modifications, with about 20-35 ...

  2. A System of RNA Modifications and Biased Codon Use Controls Cellular Stress Response at the Level of Translation

    E-Print Network [OSTI]

    Dedon, Peter C.

    Cells respond to environmental stressors and xenobiotic exposures using regulatory networks to control gene expression, and there is an emerging appreciation for the role of numerous postsynthetic chemical modifications ...

  3. Energy deposition in the body from external sources to chemically trigger cellular responses in desired localized regions

    E-Print Network [OSTI]

    Ibsen, Stuart Duncan

    2011-01-01T23:59:59.000Z

    blast region was not centered at the smaller microbubble because only the effectthe blast region measures at 49 µm in diameter. The effectblast region and measures at 12 µm in diameter. Discussion The effect

  4. Cellular response to 11[beta]-dichloro, a novel aniline mustard-estradienone, in various prostate cancer cell lines

    E-Print Network [OSTI]

    González, Francis Héber

    2009-01-01T23:59:59.000Z

    Cancer is a group of diseases characterized by uncontrolled cell growth and abnormal cell cycle and apoptosis regulation. Among the types of cancer, prostate cancer is the leading cause of death in men. Although many ...

  5. The role of mismatch repair and recombination in cellular responses to the DNA damaging anticancer drug Cisplatin

    E-Print Network [OSTI]

    Zdraveski, Zoran Z. (Zoran Zare), 1969-

    2002-01-01T23:59:59.000Z

    Cisplatin (cis-diamminedichloroplatinum(ll)) is a successful DNA-damaging anticancer drug used in the treatment of testicular, ovarian and other tumors. In the past decade, several mutually non-exclusive hypotheses have ...

  6. Chemical Spill Response Procedure Initial Response

    E-Print Network [OSTI]

    Chemical Spill Response Procedure Initial Response 1. Advise lab occupants of the spill-4500. If not, continue with step 4. Clean-Up 4. Ensure the spill area has adequate ventilation to clear gases is absorbed. If necessary, add more neutralizing powder. 9. If cleaning up a solvent, proceed to step 13. 10

  7. Keynote address: cellular reduction of nitroimidazole drugs: potential for selective chemotherapy and diagnosis of hypoxic cells

    SciTech Connect (OSTI)

    Chapman, J.D.; Lee, J.; Meeker, B.E.

    1989-04-01T23:59:59.000Z

    Nitroimidazole drugs were initially developed as selective radiosensitizers of hypoxic cells and, consequently, as adjuvants to improve the local control probabilities of current radiotherapies. Misonidazole (MISO), the prototype radiosensitizing drug, was found in Phase I clinical studies to cause dose-limiting neurotoxicities (mainly peripheral neuropathies). MISO was also found to be cytotoxic in the absence of radiation and to covalently bind to cellular molecules, both processes demonstrating rates much higher in hypoxic compared with oxygenated cells. It is likely that neurotoxicity, cellular cytotoxicity and adduct formation results from reactions between reduction intermediates of MISO and cellular target molecules. Spin-offs from radiosensitizer research include the synthesis and characterization of more potent hypoxic cytotoxins and the exploitation of sensitizer-adducts as probes for measuring cellular and tissue oxygen levels. Current developments in hypoxic cell cytotoxin and hypoxic cell marker research are reviewed with specific examples from studies which characterize the cellular reduction of TF-MISO, (1-(2-nitro-1-imidazolyl)-3(2,2,2-trifluoroethoxy)-2-propanol). 45 references.

  8. Self-referencing cellular automata: A model of the evolution of information control in biological systems

    E-Print Network [OSTI]

    Theodore P. Pavlic; Alyssa M. Adams; Paul C. W. Davies; Sara Imari Walker

    2014-05-16T23:59:59.000Z

    Cellular automata have been useful artificial models for exploring how relatively simple rules combined with spatial memory can give rise to complex emergent patterns. Moreover, studying the dynamics of how rules emerge under artificial selection for function has recently become a powerful tool for understanding how evolution can innovate within its genetic rule space. However, conventional cellular automata lack the kind of state feedback that is surely present in natural evolving systems. Each new generation of a population leaves an indelible mark on its environment and thus affects the selective pressures that shape future generations of that population. To model this phenomenon, we have augmented traditional cellular automata with state-dependent feedback. Rather than generating automata executions from an initial condition and a static rule, we introduce mappings which generate iteration rules from the cellular automaton itself. We show that these new automata contain disconnected regions which locally act like conventional automata, thus encapsulating multiple functions into one structure. Consequently, we have provided a new model for processes like cell differentiation. Finally, by studying the size of these regions, we provide additional evidence that the dynamics of self-reference may be critical to understanding the evolution of natural language. In particular, the rules of elementary cellular automata appear to be distributed in the same way as words in the corpus of a natural language.

  9. 2012 MICROBIAL STRESS RESPONSE GORDON RESEARCH CONFERENCE, JULY 20-25, 2012

    SciTech Connect (OSTI)

    Timothy Donohue

    2012-07-25T23:59:59.000Z

    The Gordon Research Conference on MICROBIAL STRESS RESPONSE was held at Mount Holyoke College, South Hadley, Massachusetts, July 15-20, 2012. The Conference was well-attended with 180 participants. The 2012 Microbial Stress Responses Gordon Research Conference will provide a forum for the open reporting of recent discoveries on the diverse mechanisms employed by microbes to respond to stress. Approaches range from analysis at the molecular level (how are signals perceived and transmitted to change gene expression or function) to cellular and microbial community responses. Gordon Research Conferences does not permit publication of meeting proceedings.

  10. 2012 CELLULAR & MOLECULAR FUNGAL BIOLOGY GORDON RESEARCH CONFERENCE, JUNE 17 - 22, 2012

    SciTech Connect (OSTI)

    Judith Berman

    2012-06-22T23:59:59.000Z

    The Gordon Research Conference on CELLULAR & MOLECULAR FUNGAL BIOLOGY was held at Holderness School, Holderness New Hampshire, June 17 - 22, 2012. The 2012 Gordon Conference on Cellular and Molecular Fungal Biology (CMFB) will present the latest, cutting-edge research on the exciting and growing field of molecular and cellular aspects of fungal biology. Topics will range from yeast to filamentous fungi, from model systems to economically important organisms, and from saprophytes and commensals to pathogens of plants and animals. The CMFB conference will feature a wide range of topics including systems biology, cell biology and morphogenesis, organismal interactions, genome organisation and regulation, pathogenesis, energy metabolism, biomass production and population genomics. The Conference was well-attended with 136 participants. Gordon Research Conferences does not permit publication of meeting proceedings.

  11. Method of forming a continuous polymeric skin on a cellular foam material

    DOE Patents [OSTI]

    Duchane, David V. (Los Alamos, NM); Barthell, Barry L. (Los Alamos, NM)

    1985-01-01T23:59:59.000Z

    Hydrophobic cellular material is coated with a thin hydrophilic polymer skin which stretches tightly over the outer surface of the foam but which does not fill the cells of the foam, thus resulting in a polymer-coated foam structure having a smoothness which was not possible in the prior art. In particular, when the hydrophobic cellular material is a specially chosen hydrophobic polymer foam and is formed into arbitrarily chosen shapes prior to the coating with hydrophilic polymer, inertial confinement fusion (ICF) targets of arbitrary shapes can be produced by subsequently coating the shapes with metal or with any other suitable material. New articles of manufacture are produced, including improved ICF targets, improved integrated circuits, and improved solar reflectors and solar collectors. In the coating method, the cell size of the hydrophobic cellular material, the viscosity of the polymer solution used to coat, and the surface tensin of the polymer solution used to coat are all very important to the coating.

  12. Tuning of the electro-mechanical behavior of the cellular carbon nanotube structures with nanoparticle dispersions

    SciTech Connect (OSTI)

    Gowda, Prarthana; Misra, Abha, E-mail: abha@isu.iisc.ernet.in [Departments of Instrumentation and Applied Physics, Indian Institute of Science, Bangalore 560012, Karnataka (India)] [Departments of Instrumentation and Applied Physics, Indian Institute of Science, Bangalore 560012, Karnataka (India); Ramamurty, Upadrasta [Departments of Materials Engineering, Indian Institute of Science, Bangalore 560012, Karnataka (India) [Departments of Materials Engineering, Indian Institute of Science, Bangalore 560012, Karnataka (India); Center of Excellence for Advanced Materials Research, King Abdulaziz University, Jeddah 21589 (Saudi Arabia)

    2014-03-10T23:59:59.000Z

    The mechanical and electrical characteristics of cellular network of the carbon nanotubes (CNT) impregnated with metallic and nonmetallic nanoparticles were examined simultaneously by employing the nanoindentation technique. Experimental results show that the nanoparticle dispersion not only enhances the mechanical strength of the cellular CNT by two orders of magnitude but also imparts variable nonlinear electrical characteristics; the latter depends on the contact resistance between nanoparticles and CNT, which is shown to depend on the applied load while indentation. Impregnation with silver nanoparticles enhances the electrical conductance, the dispersion with copper oxide and zinc oxide nanoparticles reduces the conductance of CNT network. In all cases, a power law behavior with suppression in the differential conductivity at zero bias was noted, indicating electron tunneling through the channels formed at the CNT-nanoparticle interfaces. These results open avenues for designing cellular CNT foams with desired electro-mechanical properties and coupling.

  13. Application of spectral hole burning to the study of in vitro cellular systems

    SciTech Connect (OSTI)

    Milanovich, Nebojsa

    1999-11-08T23:59:59.000Z

    Chapter 1 of this thesis describes the various stages of tumor development and a multitude of diagnostic techniques used to detect cancer. Chapter 2 gives an overview of the aspects of hole burning spectroscopy important for its application to the study of cellular systems. Chapter 3 gives general descriptions of cellular organelles, structures, and physical properties that can serve as possible markers for the differentiation of normal and cancerous cells. Also described in Chapter 3 are the principles of cryobiology important for low temperature spectroscopy of cells, characterization of MCF-10F (normal) and MCF-7 (cancer) cells lines which will serve as model systems, and cellular characteristics of aluminum phthalocyanine tetrasulfonate (APT), which was used as the test probe. Chapters 4 and 5 are previously published papers by the author pertaining to the results obtained from the application of hole burning to the study of cellular systems. Chapter 4 presents the first results obtained by spectral hole burning of cellular systems and Chapter 5 gives results for the differentiation of MCF-10F and MCF-7 cells stained with APT by an external applied electric (Stark) field. A general conclusion is presented in Chapter 6. Appendices A and B provide additional characterization of the cell/probe model systems. Appendix A describes the uptake and subcellular distribution of APT in MCF-10F and MCF-7 cells and Appendix B compares the hole burning characteristics of APT in cells when the cells are in suspension and when they are examined while adhering to a glass coverslip. Appendix C presents preliminary results for a novel probe molecule, referred to as a molecular thumbtack, designed by the authors for use in future hole burning applications to cellular systems.

  14. Cellular and Molecular BiologyTM 52, N6,47-52 ISSN 1165-158X

    E-Print Network [OSTI]

    Boyer, Edmond

    an impaired trafficking of Cx43 proteins in early carcinogenesis. In collaboration with biologists, we propose and the statistical validation of biological hypotheses about Cx43 expressions and configurations during tumorogenesis connexins (Cx), among which Cx43 is the most representative in mammalians. Recently, impaired GJC and Cx

  15. Significantly improved piezoelectric thermal stability of cellular polypropylene films by high pressure fluorination and post-treatments

    SciTech Connect (OSTI)

    An Zhenlian [Ministry of Education Key Laboratory of Advanced Microstructure Materials, Department of Physics, Tongji University, 1239 Siping Road, Shanghai 200092 (China); State Key Laboratory of Electrical Insulation and Power Equipment, Xi'an Jiaotong University, 28 Xianning West Road, Xi'an 710049 (China); Mao Mingjun; Cang Jun; Zhang Yewen; Zheng Feihu [Ministry of Education Key Laboratory of Advanced Microstructure Materials, Department of Physics, Tongji University, 1239 Siping Road, Shanghai 200092 (China)

    2012-01-15T23:59:59.000Z

    Cellular polypropylene (PP) films were fluorinated under a high pressure of 13 bar of the F{sub 2}/N{sub 2} mixture and were post-treated by nitrous oxide and isothermal crystallization. The fluorinated and post-treated PP films after being expanded and corona charged exhibit a significantly improved piezoelectric thermal stability. After annealing at 70 deg. C for 151 h or at 90 deg. C for 224 h, the piezoelectric d{sub 33} value of the fluorinated and post-treated piezoelectric sample still retains 58% or 45% of its initial d{sub 33} value, while the corresponding value of the virgin piezoelectric sample has decreased to 29% or 15% of the initial value. Chemical composition analysis of the cross section of the fluorinated and post-treated film by energy-dispersive x-ray spectroscopy indicates that the internal layers have been fluorinated, in spite of a lower degree of fluorination compared with the fluorinated surface layer. Short-circuit and open-circuit TSD current measurements reveal that the fluorinated internal layers, like the fluorinated surface layer, also have very deep charge traps, although there probably is a difference in density of the deep traps between them. The deeply trapped charge on the internal layers of the fluorinated and post-treated piezoelectric sample is responsible for its significantly improved piezoelectric thermal stability.

  16. Demand response enabling technology development

    E-Print Network [OSTI]

    Arens, Edward; Auslander, David; Huizenga, Charlie

    2008-01-01T23:59:59.000Z

    behavior in developing a demand response future. Phase_II_Demand Response Enabling Technology Development Phase IIYi Yuan The goal of the Demand Response Enabling Technology

  17. Demand Response Spinning Reserve Demonstration

    E-Print Network [OSTI]

    2007-01-01T23:59:59.000Z

    F) Enhanced ACP Date RAA ACP Demand Response – SpinningReserve Demonstration Demand Response – Spinning Reservesupply spinning reserve. Demand Response – Spinning Reserve

  18. Demand response enabling technology development

    E-Print Network [OSTI]

    2006-01-01T23:59:59.000Z

    Demand Response Enabling Technology Development Phase IEfficiency and Demand Response Programs for 2005/2006,Application to Demand Response Energy Pricing” SenSys 2003,

  19. Automated Demand Response and Commissioning

    E-Print Network [OSTI]

    Piette, Mary Ann; Watson, David S.; Motegi, Naoya; Bourassa, Norman

    2005-01-01T23:59:59.000Z

    and Demand Response in Commercial Buildings”, Lawrencesystems. Demand Response using HVAC in Commercial BuildingsDemand Response Test in Large Facilities13 National Conference on Building

  20. Reaction-Diffusion systems for the microscopic cellular model of the cardiac electric field

    E-Print Network [OSTI]

    Veneroni, Marco

    Reaction-Diffusion systems for the microscopic cellular model of the cardiac electric field Marco-diffusion systems arising from the math- ematical models of the electric activity of cardiac ventricular cells Veneroni Abstract. The paper deals with a mathematical model for the electric activity of the heart

  1. C H A P T E R 6 Modeling Cellular Networks

    E-Print Network [OSTI]

    You, Lingchong

    signal adaptation [23]. A more extensive modeling work investigates the emergent properties that arise151 C H A P T E R 6 Modeling Cellular Networks Tae Jun Lee, Dennis Tu, Chee Meng Tan, and Lingchong- logical principles and may serve as a critical foundation for developing therapeutic strategies. To date

  2. GreenCache: Augmenting Off-the-Grid Cellular Towers with Multimedia Caches

    E-Print Network [OSTI]

    Shenoy, Prashant

    or commercial advantage and that copies bear this notice and the full citation on the first page. To copy to run cellular towers "off the grid" [4]. Today's "off the grid" cellu- lar towers operate off diesel with expensive and "dirty" diesel fuel. S

  3. Autotransporters: The Cellular Environment Reshapes a Folding Mechanism to Promote Protein Transport

    E-Print Network [OSTI]

    Clark, Patricia L.

    the cellular environment affects protein folding mechanisms. Here, we focus on one unique aspect affect protein folding kinetics and the conformations of folding intermediates? We focus on recent have been made to understand the mechanisms by which proteins fold to their native conformations.3

  4. The relationships between metabolic rate and the respiratory, circulatory and cellular mechanisms governing oxygen

    E-Print Network [OSTI]

    Hawai'i at Manoa, University of

    The relationships between metabolic rate and the respiratory, circulatory and cellular mechanisms governing oxygen transport from the respiratory medium to the tissues in air- breathing vertebrates have for albacore (Thunnus alalunga, 82­197mlkg-1). Plasma volume within the primary circulatory system (calculated

  5. CHRONIC HEAT STRESS AND PRENATAL DEVELOPMENT IN SHEEP: II. PLACENTAL CELLULARITY AND METABOLISM'J

    E-Print Network [OSTI]

    Vatnick, Itzick

    CHRONIC HEAT STRESS AND PRENATAL DEVELOPMENT IN SHEEP: II. PLACENTAL CELLULARITY AND METABOLISM'J R (Mode, 1954, Shelton, 1964; Alexander and Williams,1971). The mechanism by which heat stress affects tissue metabolism and development during heat stress. Therefore, it was the intention of the present

  6. Dynamic Uplink Power Control for Cellular Radio Systems over Fast Fading Liang Dong and Guanghan Xu

    E-Print Network [OSTI]

    Dong, Liang

    Dynamic Uplink Power Control for Cellular Radio Systems over Fast Fading Channel Liang Dong varies drastically under fast fading, the power control signaling from the base station may not be appropriate for the current uplink. In the proposed power control scheme, the mobile transmits at variable

  7. Stable Distributed Power Control with High SIR Target for Cellular Wireless Communication Systems Jiayuan Chen1

    E-Print Network [OSTI]

    Haddadi, Hamed

    Stable Distributed Power Control with High SIR Target for Cellular Wireless Communication Systems power control (DPC) and propose an improved algorithm to overcome the weakness of DPC. The DPC algorithm of DPCH is slightly slower than that of DPC in the low SIR environment. Keywords - Power control, SIR

  8. Cellular burning in lean premixed turbulent hydrogen-air flames: coupling experimental and

    E-Print Network [OSTI]

    Cellular burning in lean premixed turbulent hydrogen-air flames: coupling experimental. Beckner1, M. J. Lijewski1 1 Center for Computational Science and Engineering, Lawrence Berkeley National for burning the fuel-lean mixtures of hydrogen or hydrogen-rich syngas fuels obtained from the gasification

  9. Cellular Microbiology (2001) 3(12), 795810 Role of tyrosine kinases and the tyrosine phosphatase

    E-Print Network [OSTI]

    Galan, Jorge E

    2001-01-01T23:59:59.000Z

    Cellular Microbiology (2001) 3(12), 795±810 Role of tyrosine kinases and the tyrosine phosphatase. Central to this interface is a battery of bacterial proteins delivered into host cells via a specialized). This organelle delivers into host cells a battery of bacterial proteins that have the capacity to modulate

  10. A new communication paradigm for mobile TV over cellular network Dr. Hongxiang Li

    E-Print Network [OSTI]

    A new communication paradigm for mobile TV over cellular network Dr. Hongxiang Li Electrical terrestrial TV network and propose a new mobile TV communication paradigm that is radically different from and communication theory (i.e., Network Coding and Dirty Paper Coding) in the new mobile TV system design. Despite

  11. Cellular/Molecular ERK1/ERK2 MAPK Signaling is Required to Increase Myelin

    E-Print Network [OSTI]

    Cellular/Molecular ERK1/ERK2 MAPK Signaling is Required to Increase Myelin Thickness Independent for two important signaling molecules, extracelluar signal-regulated protein kinases 1 and 2 (ERK1/ERK2 generated and analyzed two lines of mice lacking both ERK1/ERK2 function specifically in oligodendrocyte

  12. Deployment Algorithm for Femtocells in Multi-tiered Wireless Cellular Network

    E-Print Network [OSTI]

    Bahk, Saewoong

    by the existing macro-cellular network. To satisfy the interests of WSP and customers we propose an automated tool fibers or wireless last-mile technologies [1]. The short distance between a user and a femto base station [3] is about antenna placement problem which includes location and configuration of network

  13. IEEE COMMUNICATIONS LETTERS, ACCEPTED FOR PUBLICATION 1 Planning of Cellular Networks Enhanced by Energy Harvesting

    E-Print Network [OSTI]

    Kuzmanov, Georgi

    by Energy Harvesting Meng Zheng, Przemyslaw Pawelczak, Member, IEEE, Slawomir Sta´nczak, Senior Member, IEEE energy sources and a fundamentally new concept of energy balancing, and propose a novel algorithm be made by enriching cellular infrastructure with energy harvesting sources, in comparison to traditional

  14. Cellular/Molecular A Chimera Analysis of Prestin Knock-Out Mice

    E-Print Network [OSTI]

    Dallos, Peter

    Cellular/Molecular A Chimera Analysis of Prestin Knock-Out Mice Mary Ann Cheatham,1 Sharon Low, Northwestern University, Evanston, Illinois 60208, and 3MusWorks, Falls Church, Virginia 22042 A chimera. In this report, we describe a chimera analysis of prestin function. A chimera is a genetic composite. It contains

  15. Cellular/Molecular A Calcium-Induced Calcium Influx Factor, Nitric Oxide,

    E-Print Network [OSTI]

    Newman, Eric A.

    in astrocytes lead to the Ca2 -dependent synthesis of nitric oxide. This in turn stimulates a Ca2 influx pathwayCellular/Molecular A Calcium-Induced Calcium Influx Factor, Nitric Oxide, Modulates the Refilling in astrocytes, we imaged the formation of nitric oxide in cultured murine cortical astrocytes using DAF-FM (4

  16. Connection Admission Control for Multi-Service Integrated Cellular/WLAN System

    E-Print Network [OSTI]

    Mohsenian-Rad, Hamed

    , WLANs are usually deployed in densely populated areas, and wireless cellular net- works are used de Mejoramiento del Profesorado (PROMEP) from Mexico. Part of this paper was presented at the IEEE was coordinated by Prof. Qian Zhang. The authors are with the Department of Electrical and Computer Engi- neering

  17. A Pricing Based Algorithm for Cell Switching Off in Green Cellular Networks

    E-Print Network [OSTI]

    Yanikomeroglu, Halim

    A Pricing Based Algorithm for Cell Switching Off in Green Cellular Networks Ali Yildiz and Tolga--In this study, we propose a pricing based algorithm that assigns user terminals (UTs) to base stations (BSs) and optimizes the transmission powers in a way that minimizes the energy expenditure. The algorithm takes

  18. Adaptation of flexible polymer fabrication to cellular mechanics study Yi Zhao and Xin Zhanga

    E-Print Network [OSTI]

    Polymeric material has been utilized as mechanical sensors to measure microscopic cellular forces. Since a flexible fabrication process to manufacture polymeric mechanical sensors with various aspect ratios from. The results conform to the physiologic behavior. This approach has the potential for evaluation of mechanical

  19. Mechanisms of Cellular Avidity Regulation in CD2CD58-Mediated T Cell Adhesion

    E-Print Network [OSTI]

    Cairo, Christopher W.

    Mechanisms of Cellular Avidity Regulation in CD2­CD58-Mediated T Cell Adhesion De-Min Zhu, Massachusetts 02115, § Skirball Institute of Biomolecular Medicine and the Department of Pathology, NYU School Roxbury, Massachusetts 02132, and **Hematology Division, Brigham and Women's Hospital, Boston

  20. The Cellular Burning Regime in Type Ia Supernova Explosions - II. Flame Propagation into Vortical Fuel

    E-Print Network [OSTI]

    F. K. Roepke; W. Hillebrandt; J. C. Niemeyer

    2003-12-08T23:59:59.000Z

    We investigate the interaction of thermonuclear flames in Type Ia supernova explosions with vortical flows by means of numerical simulations. In our study, we focus on small scales, where the flame propagation is no longer dominated by the turbulent cascade originating from large-scale effects. Here, the flame propagation proceeds in the cellular burning regime, resulting from a balance between the Landau-Darrieus instability and its nonlinear stabilization. The interaction of a cellularly stabilized flame front with a vortical fuel flow is explored applying a variety of fuel densities and strengths of the velocity fluctuations. We find that the vortical flow can break up the cellular flame structure if it is sufficiently strong. In this case the flame structure adapts to the imprinted flow field. The transition from the cellularly stabilized front to the flame structure dominated by vortices of the flow proceeds in a smooth way. The implications of the results of our simulations for Type Ia Supernova explosion models are discussed.

  1. Deformation rate effects on failure modes of open-cell Al foams and textile cellular materials

    E-Print Network [OSTI]

    Barthelat, Francois

    September 2005 Abstract The compressive behavior of open-cell aluminum alloy foam and stainless steel woven: Metallic cellular materials; Dynamic compression; Aluminum foams; Woven textile lattice 0020-7683/$ - see are of attracting interest for a variety of automotive, locomotive, marine, and aerospace applications (Gibson

  2. DNA-Mediated Control of Metal Nanoparticle Shape: One-Pot Synthesis and Cellular Uptake

    E-Print Network [OSTI]

    Kenis, Paul J. A.

    DNA-Mediated Control of Metal Nanoparticle Shape: One-Pot Synthesis and Cellular Uptake of Highly, University of Illinois at Urbana-Champaign, Urbana, Illinois 61801 ABSTRACT The effects of different DNA that in the absence of DNA, 30-mer poly A or poly C induces formation of the flower-shaped gold nanoparticle (Au

  3. Alkaline phosphatase, a biochemical marker of cellular differentiation of BeWo choriocarcinoma cell line

    E-Print Network [OSTI]

    Lu, Wei

    1997-01-01T23:59:59.000Z

    Cellular copper homeostasis depends on a Cu-ATPase enzyme in the membrane. Surprisingly, flask-grown BeWo cells do not display ATPase. We found Cu-ATPase is only expressed in differentiated cells such as Caco-2 cells. Since BeWo cells...

  4. An Energy-Efficient Power Allocation Game with Selfish Channel State Reporting in Cellular Networks

    E-Print Network [OSTI]

    Boyer, Edmond

    An Energy-Efficient Power Allocation Game with Selfish Channel State Reporting in Cellular Networks With energy-efficient resource allocation, mobile users and base station have different objectives. While the base station strives for an energy-efficient operation of the complete cell, each user aims to maximize

  5. Power Control for Code Division Multiple Access Cellular Systems Bassam Hashem and Halim Yanikomeroglu

    E-Print Network [OSTI]

    Yanikomeroglu, Halim

    Power Control for Code Division Multiple Access Cellular Systems Bassam Hashem and Halim the interference results in a direct increase in the system capacity. Power control is the most important mobile velocities. Finally, we look at the power control algorithms from a system point of view. Power

  6. A Cellular Automata Model of the Spread of HIV in a Community of Injection Drug Users

    E-Print Network [OSTI]

    A Cellular Automata Model of the Spread of HIV in a Community of Injection Drug Users Vahid (CSMG), The IRMACS Centre Simon Fraser University Background Intravenous drug users (IDU) sharing needles for injecting illicit drugs are highly vulnerable to HIV infection because transmission

  7. A First Look at Cellular Machine-to-Machine Traffic Large Scale Measurement and Characterization

    E-Print Network [OSTI]

    Greenberg, Albert

    ABSTRACT Cellular network based Machine-to-Machine (M2M) commu- nication is fast becoming a market-changing force for a wide spectrum of businesses and applications such as telematics, smart metering, point-of-sale terminals, and home security and automation systems. In this paper, we aim to answer the following important

  8. Dynamic Computational Model Suggests That Cellular Citizenship Is Fundamental for Selective Tumor

    E-Print Network [OSTI]

    Siegelmann , Hava T

    , University of Massachusetts Amherst, Amherst, Massachusetts, United States of America, 2 Communi by proliferation rates, initial volumes, and apoptosis resistant phenotypes; they show high adaptability as at least 32% of cells obey extra-cellular commands and at least 28% of cancer cells report their deaths

  9. Cellular studies of auditory hair cell regeneration Jennifer S. Stone and Edwin W Rubel*

    E-Print Network [OSTI]

    Rubel, Edwin

    Colloquium Cellular studies of auditory hair cell regeneration in birds Jennifer S. Stone and Edwin that mature birds are able to regenerate hair cells, the receptors for auditory perception. This surprising finding generated hope in the field of auditory neuro- science that new hair cells someday may be coaxed

  10. Cellular/Molecular Nociceptor and Hair Cell Transducer Properties of TRPA1, a

    E-Print Network [OSTI]

    Alford, Simon

    Cellular/Molecular Nociceptor and Hair Cell Transducer Properties of TRPA1, a Channel for Pain)channelisactivatedbypain-producingchemicals,anditsinhibitionimpairshaircellmechanotrans- duction. As shown here and previously, TRPA1 is expressed by hair cells as well as by most nociceptors to mediate transduction in both hair cells and nociceptors. Accordingly, we find that heterologouslyexpressed

  11. Cellular/Molecular Vestibular Hair Bundles Control pH with (Na , K )/H

    E-Print Network [OSTI]

    Rao, Rajini

    Cellular/Molecular Vestibular Hair Bundles Control pH with (Na , K )/H Exchangers NHE6 and NHE9 21205, and 3Graduate School of Life Science, University of Hyogo, Ako, Hyogo 678-1297, Japan In hair acidify mechani- cally sensitive hair bundles without efficient removal of H . We found that, whereas

  12. 1Cellular Polymers, Vol. 26, No. 1, 2007 On the Bulk Modulus of Open Cell Foams

    E-Print Network [OSTI]

    Lakes, Roderic

    Hydrostaticcompressionoffoamisofinterestinavarietyofcontextsincluding under-sea applications. Syntactic foam, for instance, consists of hollow glass1Cellular Polymers, Vol. 26, No. 1, 2007 On the Bulk Modulus of Open Cell Foams © Rapra Technology, 2007 On the Bulk Modulus of Open Cell Foams B. Moore, T. Jaglinski, D.S. Stone§ and R.S. Lakes

  13. CRA Comments & Responses

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    - High-Level Liquid Waste (51105) 11 Response to CRA Comments (92005) Enclosure 1 - Computer Code VerificationTesting (92005) Inventory and Performance Assessment Reports...

  14. GADRAS Detector Response Function.

    SciTech Connect (OSTI)

    Mitchell, Dean J.; Harding, Lee; Thoreson, Gregory G; Horne, Steven M.

    2014-11-01T23:59:59.000Z

    The Gamma Detector Response and Analysis Software (GADRAS) applies a Detector Response Function (DRF) to compute the output of gamma-ray and neutron detectors when they are exposed to radiation sources. The DRF is fundamental to the ability to perform forward calculations (i.e., computation of the response of a detector to a known source), as well as the ability to analyze spectra to deduce the types and quantities of radioactive material to which the detectors are exposed. This document describes how gamma-ray spectra are computed and the significance of response function parameters that define characteristics of particular detectors.

  15. Climate Change Response

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    the Interior Climate Change Response "From the Everglades to the Great Lakes to Alaska and everywhere in between, climate change is a leading threat to natural and cultural...

  16. Demand Response In California

    Broader source: Energy.gov [DOE]

    Presentation covers the demand response in California and is given at the FUPWG 2006 Fall meeting, held on November 1-2, 2006 in San Francisco, California.

  17. EE 5141 Introduction to Cellular and Wireless Communications July-Nov. 2014 Contents Slot: G Room # ESB-350

    E-Print Network [OSTI]

    Giridhar, K.

    ) Network Performance ­ How to study network-wide performance? Evaluation Methodology for System level standard, User capacity of TDMA cellular, SINR in TDMA, soft-capacity of 2G DS- CDMA; Also see Chap.4 from reuse systems, role of antennas (sectoring, MIMO), quick look at 4G cellular OFDM standards (Wi

  18. The CPT1C 59UTR Contains a Repressing Upstream Open Reading Frame That Is Regulated by Cellular Energy

    E-Print Network [OSTI]

    Bedwell, David M.

    further evidence for a role of CPT1C in hypothalamic regulation of energy homeostasis. Citation: Lohse I That Is Regulated by Cellular Energy Availability and AMPK. PLoS ONE 6(9): e21486. doi:10.1371/journal.pone.0021486The CPT1C 59UTR Contains a Repressing Upstream Open Reading Frame That Is Regulated by Cellular

  19. Spectral dependencies of killing, mutation, and transformation in mammalian cells and their relevance to hazards caused by solar ultraviolet radiation

    SciTech Connect (OSTI)

    Suzuki, F.; Han, A.; Lankas, G.R.; Utsumi, H.; Elkind, M.M.

    1981-12-01T23:59:59.000Z

    Using germicidal lamps and Westinghouse sunlamps with and without filtration, the effectiveness of ultraviolet and near-ultraviolet light in inducing molecular and cellular changes was measured. Cell survival and the induction of resistance to 6-thioguanine or to ouabain were measured with V79 Chinese hamster cells, cell survival and neoplastic transformation were measured with C3H mouse 10 T 1/2 cells, and the induction of pyrimidine dimers containing thymine was measured in both cell lines. The short-wavelength cutoff of the sunlamp emission was shifted from approximately 290 nm (unfiltered) to approximately 300 and approximately 310 nm by appropriate filters. Although it was found that the efficiency with which all end points were induced progressively decreased as the short-wavelength cutoff was shifted to longer wavelengths, the rates of decrease differed appreciably. For example, doses of near-ultraviolet light longer than approximately 300 nm that were effective in mutating or in transforming cells were ineffective in killing them. In respect to pyrimidine dimer induction, several but not all cellular end points were induced by dose ratios of sunlamp light (short-wavelength cutoff, approximately 290 nm) to germicidal lamp light (254 nm) in fairly close accord with the doses required to produce equivalent proportions of dimers. However, for near-ultraviolet light having cutoffs at longer wavelengths, the biological action observed was appreciably greater than what would be predicted from the proportion of dimers induced. From the latter observation, it is inferred that increasing intensities of short-wavelength ultraviolet light, as would be expected from reductions in stratospheric ozone around the earth, would result in smaller increases in biological action, e.g., skin cancer, compared to current levels of action than would be predicted from an action spectrum completely corresponding to that of a pyrimidine dimer induction spectrum in DNA.

  20. Sensor response rate accelerator

    DOE Patents [OSTI]

    Vogt, Michael C. (Westmont, IL)

    2002-01-01T23:59:59.000Z

    An apparatus and method for sensor signal prediction and for improving sensor signal response time, is disclosed. An adaptive filter or an artificial neural network is utilized to provide predictive sensor signal output and is further used to reduce sensor response time delay.

  1. Eastern Frequency Response Study

    SciTech Connect (OSTI)

    Miller, N.W.; Shao, M.; Pajic, S.; D'Aquila, R.

    2013-05-01T23:59:59.000Z

    This study was specifically designed to investigate the frequency response of the Eastern Interconnection that results from large loss-of-generation events of the type targeted by the North American Electric Reliability Corp. Standard BAL-003 Frequency Response and Frequency Bias Setting (NERC 2012a), under possible future system conditions with high levels of wind generation.

  2. Mammalian Cell Culture | EMSL

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    from Cells to Cognition in Autism Pathophysiology: Biological Pathways to Defective Brain Function and Plasticity. We review evidence to support the model that autism may begin...

  3. Frequency Response Analysis Tool

    SciTech Connect (OSTI)

    Etingov, Pavel V.; Kosterev, Dmitry; Dai, T.

    2014-12-31T23:59:59.000Z

    Frequency response has received a lot of attention in recent years at the national level, which culminated in the development and approval of North American Electricity Reliability Corporation (NERC) BAL-003-1 Frequency Response and Frequency Bias Setting Reliability Standard. This report is prepared to describe the details of the work conducted by Pacific Northwest National Laboratory (PNNL) in collaboration with the Bonneville Power Administration and Western Electricity Coordinating Council (WECC) Joint Synchronized Information Subcommittee (JSIS) to develop a frequency response analysis tool (FRAT). The document provides the details on the methodology and main features of the FRAT. The tool manages the database of under-frequency events and calculates the frequency response baseline. Frequency response calculations are consistent with frequency response measure (FRM) in NERC BAL-003-1 for an interconnection and balancing authority. The FRAT can use both phasor measurement unit (PMU) data, where available, and supervisory control and data acquisition (SCADA) data. The tool is also capable of automatically generating NERC Frequency Response Survey (FRS) forms required by BAL-003-1 Standard.

  4. Dynamics of Cell Shape and Forces on Micropatterned Substrates Predicted by a Cellular Potts Model

    E-Print Network [OSTI]

    Philipp J. Albert; Ulrich S. Schwarz

    2014-05-19T23:59:59.000Z

    Micropatterned substrates are often used to standardize cell experiments and to quantitatively study the relation between cell shape and function. Moreover, they are increasingly used in combination with traction force microscopy on soft elastic substrates. To predict the dynamics and steady states of cell shape and forces without any a priori knowledge of how the cell will spread on a given micropattern, here we extend earlier formulations of the two-dimensional cellular Potts model. The third dimension is treated as an area reservoir for spreading. To account for local contour reinforcement by peripheral bundles, we augment the cellular Potts model by elements of the tension-elasticity model. We first parameterize our model and show that it accounts for momentum conservation. We then demonstrate that it is in good agreement with experimental data for shape, spreading dynamics, and traction force patterns of cells on micropatterned substrates. We finally predict shapes and forces for micropatterns that have not yet been experimentally studied.

  5. Accident Response Group

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1991-09-20T23:59:59.000Z

    To establish Department of Energy (DOE) policy for DOE response to accidents and significant incidents involving nuclear weapons or nuclear weapon components. Cancels DOE O 5530.1. Canceled by DOE O 153.1.

  6. The Cellular Burning Regime in Type Ia Supernova Explosions - I. Flame Propagation into Quiescent Fuel

    E-Print Network [OSTI]

    F. K. Roepke; W. Hillebrandt; J. C. Niemeyer

    2003-12-03T23:59:59.000Z

    We present a numerical investigation of the cellular burning regime in Type Ia supernova explosions. This regime holds at small scales (i.e. below the Gibson scale), which are unresolved in large-scale Type Ia supernova simulations. The fundamental effects that dominate the flame evolution here are the Landau-Darrieus instability and its nonlinear stabilization, leading to a stabilization of the flame in a cellular shape. The flame propagation into quiescent fuel is investigated addressing the dependence of the simulation results on the specific parameters of the numerical setup. Furthermore, we investigate the flame stability at a range of fuel densities. This is directly connected to the questions of active turbulent combustion (a mechanism of flame destabilization and subsequent self-turbulization) and a deflagration-to-detonation transition of the flame. In our simulations we find no substantial destabilization of the flame when propagating into quiescent fuels of densities down to ~10^7 g/cm^3, corroborating fundamental assumptions of large-scale SN Ia explosion models. For these models, however, we suggest an increased lower cutoff for the flame propagation velocity to take the cellular burning regime into account.

  7. Identification and characterization of tac5, a telomerase activation mutant, characterization of DNA damage responses and assessment of interactions between telomere-related proteins in Arabidopsis thaliana

    E-Print Network [OSTI]

    Jasti, Madhuri

    2009-05-15T23:59:59.000Z

    in the genetically tractable Arabidopsis model may provide insight into the cellular response to dysfunctional telomeres. As explained in chapter IV, the yeast two-hybrid screen was utilized to confirm the interactions of ATR with AtPOT2 and Ku80 and to identify...

  8. Demand Response Valuation Frameworks Paper

    E-Print Network [OSTI]

    Heffner, Grayson

    2010-01-01T23:59:59.000Z

    No. ER06-615-000 CAISO Demand Response Resource User Guide -8 2.1. Demand Response Provides a Range of Benefits to8 2.2. Demand Response Benefits can be Quantified in Several

  9. A Hybrid Geometric Modeling Method for Large Scale Conformal Cellular 3D Systems, 26081 Avenue Hall, Valencia, CA 91354

    E-Print Network [OSTI]

    Chen, Yong

    Structures, Conformal Structures, Additive Manufacturing, STL 1 INTRODUCTION Cellular material structures can distributions than stochastic metal foams [5]. With the development of additive manufacturing processes (also, 8, 9]. The manufacturing of mesoscopic truss structures utilizes the unique capability of additive

  10. The use of a simple cellular automata model as a testbed for kinetic theories of vehicular traffic flow

    E-Print Network [OSTI]

    Raney, Bryan Keith

    2000-01-01T23:59:59.000Z

    The broad objective of this thesis is to explore the potential for the use of Cellular Automata (CA) models to provide a testbed for comparison of different kinetic models of vehicular traffic. We intend to develop a quantitative technique...

  11. IEEE TRANSACTIONS ON WIRELESS COMMUNICATIONS, VOL. XX, NO. XX, MONTH 2013 1 Optimal Relay Placement in Cellular Networks

    E-Print Network [OSTI]

    Coupechoux, Marceau

    in Cellular Networks Mattia Minelli, Maode Ma, Marceau Coupechoux, Jean-Marc Kelif, Marc Sigelle, and Philippe, France (e- mail: {marceau.coupechoux, marc.sigelle, philippe.godlewski}@telecom- paristech.fr. ). J

  12. Identification of Tat-SF1 cellular targets by exon array analysis reveals dual roles in transcription and splicing

    E-Print Network [OSTI]

    Hartemink, Alexander

    acid metabolism; the insulin signaling pathway was enriched with Tat-SF1 transcript-level targets discovered over a decade ago as a cellular protein required for Tat-specific, TAR-dependent activation of HIV

  13. Structural building response review

    SciTech Connect (OSTI)

    Not Available

    1980-01-15T23:59:59.000Z

    The integrity of a nuclear power plant during a postulated seismic event is required to protect the public against radiation. Therefore, a detailed set of seismic analyses of various structures and equipment is performed while designing a nuclear power plant. This report describes the structural response analysis method, including the structural model, soil-structure interaction as it relates to structural models, methods for seismic structural analysis, numerical integration methods, methods for non-seismic response analysis approaches for various response combinations, structural damping values, nonlinear response, uncertainties in structural properties, and structural response analysis using random properties. The report describes the state-of-the-art in these areas for nuclear power plants. It also details the past studies made at Sargent and Lundy to evaluate different alternatives and the conclusions reached for the specific purposes that those studies were intended. These results were incorporated here because they fall into the general scope of this report. The scope of the present task does not include performing new calculations.

  14. Optimal Demand Response Libin Jiang

    E-Print Network [OSTI]

    Optimal Demand Response Libin Jiang Steven Low Computing + Math Sciences Electrical Engineering Caltech Oct 2011 #12;Outline Caltech smart grid research Optimal demand response #12;Global trends 1

  15. Logarithmic transformation of response Logarithmic transformation of response

    E-Print Network [OSTI]

    Komarek, Arnost

    Logarithmic transformation of response Logarithmic transformation of response Often, support S of Y is S = (0, ). Logarithm is then one of transformations to consider when trying to obtain a correct (wrong. Model Building 1. Transformation of response #12;Logarithmic transformation of response When does

  16. Responsibility, Moral and Otherwise

    E-Print Network [OSTI]

    Wolf, Susan

    2013-01-01T23:59:59.000Z

    the waters by blurring concerns about depth with debates about the nature and basis of moral demands. Thus, for example, one increasingly popular view understands moral responsibility as accountability for meeting standards we impose on each other... from what is needed for something to be properly attributed to one’s self, I don’t believe that the former kind builds upon the latter, or that it is necessarily deeper. What depth there might be to our status as responsible beings, a depth we...

  17. Mapping textures on 3d terrains: a hybrid cellular automata approach 

    E-Print Network [OSTI]

    Sinvhal, Swapnil

    2007-04-25T23:59:59.000Z

    generated by cellular automata has been studied by Crutchfield et al. [16] and Melanie et al. [60], [61]. A ?chaotic? system has been described [99] as one in which ?activity doesn't die down into a regular pattern, but yet it also doesn't explode all... volumetric data structure to simulate weathering of stone incorporating effects like flow of moisture and mineral dissolution. Jensen et al. [62] illustrate the rendering of wet materials by taking into account the water on the surface and a concentration...

  18. GIS-Based Cellular Automaton Model to allocate Kansas High Plains Irrigated Agriculture Land Use

    E-Print Network [OSTI]

    Chiu, Peiwen

    2014-04-08T23:59:59.000Z

    GIS-Based Cellular Automaton Model to Allocate Irrigated Agriculture Land Use Peiwen Chiu Kansas State University GIS Day 2013 November 20, 2013 University of Kansas High Plains/Ogallala Aquifer 8 States 186,000 mi2 480,000 km2 http... of Acreage From the Model Iterations What’s Next This work was supported in part by the National Science Foundation (grant GEO0909515) and the United States Department of Agriculture/Agricultural Research Service (Ogallala Aquifer Initiative). Any findings...

  19. Science and Cellular Stresses | U.S. DOE Office of Science (SC)

    Office of Science (SC) Website

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level:Energy: Grid Integration Redefining What'sis Taking Over OurThe Iron4(SC)Principal Investigators'RayScience and Cellular Stresses News

  20. General Responsibilities and Requirements

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1999-07-09T23:59:59.000Z

    The material presented in this guide provides suggestions and acceptable ways of implementing DOE M 435.1-1 and should not be viewed as additional or mandatory requirements. The objective of the guide is to ensure that responsible individuals understand what is necessary and acceptable for implementing the requirements of DOE M 435.1-1.

  1. Cellular Automata Theory and Physics A new Paradigm for the Unification of Physics

    E-Print Network [OSTI]

    Ostoma, T; Ostoma, Tom; Trushyk, Mike

    1999-01-01T23:59:59.000Z

    A new paradigm for the unification of physics is described. It is called Cellular Automata (CA) theory, which is the most massively parallel computer model currently known to science. We maintain that at the tiniest distance and time scales the universe is completely deterministic, and utterly simple. Our universe is a Cellular Automaton consisting of a huge array of cells capable of storing numeric information. These cells form a vast, 3D 'geometric' CA, where each cell has 26 surrounding neighboring cells that influence the state of a given cell. CA theory directly implies that all the laws of physics must result from interactions that are strictly local, therefore forbidding any form of action at a distance. CA theory suggests that space, time, matter, energy, and motion are all the same thing: the end result of information changing state in the CA. The CA model automatically contains an inherent maximum speed limit for which information can be moved from place to place.We propose that light (photon) motio...

  2. Efficiency of cellular uptake of nanoparticles via receptor-mediated endocytosis

    E-Print Network [OSTI]

    Anand Banerjee; Alexander Berzhkovskii; Ralph Nossal

    2014-10-27T23:59:59.000Z

    Experiments show that cellular uptake of nanoparticles, via receptor-mediated endocytosis, strongly depends on nanoparticle size. There is an optimal size, approximately 50 nm in diameter, at which cellular uptake is the highest. In addition, there is a maximum size, approximately 200 nm, beyond which uptake via receptor-mediated endocytosis does not occur. By comparing results from different experiments, we found that these sizes weakly depend on the type of cells, nanoparticles, and ligands used in the experiments. Here, we argue that these observations are consequences of the energetics and assembly dynamics of the protein coat that forms on the cytoplasmic side of the outer cell membrane during receptor-mediated endocytosis. Specifically, we show that the energetics of coat formation imposes an upper bound on the size of the nanoparticles that can be internalized, whereas the nanoparticle-size-dependent dynamics of coat assembly results in the optimal nanoparticle size. The weak dependence of the optimal and maximum sizes on cell-nanoparticle-ligand type also follows naturally from our analysis.

  3. Identification and analysis of cellular factors involved in v-Abl transformation of B lineage cells

    E-Print Network [OSTI]

    Yu, Jason

    2013-01-01T23:59:59.000Z

    children with acute lymphoblastic leukemia. Blood 97, 3925-B-cell lineage acute lymphoblastic leukemia. Cancer Res. 70,the response of acute lymphoblastic leukemia cells to

  4. Chk2 regulates transcription-independent p53-mediated apoptosis in response to DNA damage

    SciTech Connect (OSTI)

    Chen Chen [Department of Geriatric Research, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, Obu, Aichi 474-8522 (Japan); Shimizu, Shigeomi [Department of Post-Genomics Diseases, Osaka University Medical School, Suita, Osaka 565-0871 (Japan); Tsujimoto, Yoshihide [Department of Post-Genomics Diseases, Osaka University Medical School, Suita, Osaka 565-0871 (Japan); Motoyama, Noboru [Department of Geriatric Research, National Institute for Longevity Sciences, National Center for Geriatrics and Gerontology, Obu, Aichi 474-8522 (Japan)]. E-mail: motoyama@nils.go.jp

    2005-07-29T23:59:59.000Z

    The tumor suppressor protein p53 plays a central role in the induction of apoptosis in response to genotoxic stress. The protein kinase Chk2 is an important regulator of p53 function in mammalian cells exposed to ionizing radiation (IR). Cells derived from Chk2-deficient mice are resistant to the induction of apoptosis by IR, and this resistance has been thought to be a result of the defective transcriptional activation of p53 target genes. It was recently shown, however, that p53 itself and histone H1.2 translocate to mitochondria and thereby induces apoptosis in a transcription-independent manner in response to IR. We have now examined whether Chk2 also regulates the transcription-independent induction of apoptosis by p53 and histone H1.2. The reduced ability of IR to induce p53 stabilization in Chk2-deficient thymocytes was associated with a marked impairment of p53 and histone H1 translocation to mitochondria. These results suggest that Chk2 regulates the transcription-independent mechanism of p53-mediated apoptosis by inducing stabilization of p53 in response to IR.

  5. Oil spill response resources

    E-Print Network [OSTI]

    Muthukrishnan, Shankar

    1996-01-01T23:59:59.000Z

    and development program. Title VIII concerns the amendments to the Trans Alaska Pipeline System Act. Title I deals with probably the most important part of OPA-90 ? liability and compensation. Claim procedures, federal authority, financial responsibility... minimum. LITERATURE REVIEW From the time that oil was discovered, drilled and transported, oil spills have been occurring. As long as crude oils and petroleum products are transported across the seas by ships or pipelines, there is the risk of spillage...

  6. Structural response synthesis

    SciTech Connect (OSTI)

    Ozisik, H.; Keltie, R.F.

    1988-12-01T23:59:59.000Z

    The open loop control technique of predicting a conditioned input signal based on a specified output response for a second order system has been analyzed both analytically and numerically to gain a firm understanding of the method. Differences between this method of control and digital closed loop control using pole cancellation were investigated as a follow up to previous experimental work. Application of the technique to diamond turning using a fast tool is also discussed.

  7. Load responsive hydrodynamic bearing

    DOE Patents [OSTI]

    Kalsi, Manmohan S. (Houston, TX); Somogyi, Dezso (Sugar Land, TX); Dietle, Lannie L. (Stafford, TX)

    2002-01-01T23:59:59.000Z

    A load responsive hydrodynamic bearing is provided in the form of a thrust bearing or journal bearing for supporting, guiding and lubricating a relatively rotatable member to minimize wear thereof responsive to relative rotation under severe load. In the space between spaced relatively rotatable members and in the presence of a liquid or grease lubricant, one or more continuous ring shaped integral generally circular bearing bodies each define at least one dynamic surface and a plurality of support regions. Each of the support regions defines a static surface which is oriented in generally opposed relation with the dynamic surface for contact with one of the relatively rotatable members. A plurality of flexing regions are defined by the generally circular body of the bearing and are integral with and located between adjacent support regions. Each of the flexing regions has a first beam-like element being connected by an integral flexible hinge with one of the support regions and a second beam-like element having an integral flexible hinge connection with an adjacent support region. A least one local weakening geometry of the flexing region is located intermediate the first and second beam-like elements. In response to application of load from one of the relatively rotatable elements to the bearing, the beam-like elements and the local weakening geometry become flexed, causing the dynamic surface to deform and establish a hydrodynamic geometry for wedging lubricant into the dynamic interface.

  8. Technology Partnership Ombudsman - Roles, Responsibilities, Authoritie...

    Energy Savers [EERE]

    Technology Partnership Ombudsman - Roles, Responsibilities, Authorities and Accountabilities Technology Partnership Ombudsman - Roles, Responsibilities, Authorities and...

  9. CONSULTATION RESPONSE Wellcome Trust response to RCUK Large Facilities Roadmap

    E-Print Network [OSTI]

    Rambaut, Andrew

    CONSULTATION RESPONSE Wellcome Trust response to RCUK Large Facilities Roadmap December 2007 Page 1 of 4 RCUK Large Facilities Roadmap Response by the Wellcome Trust December 2007 1. The Wellcome Trust is pleased to have the opportunity to feed into the process of prioritising the RCUK Large Facilities Roadmap

  10. Demand Response: Load Management Programs 

    E-Print Network [OSTI]

    Simon, J.

    2012-01-01T23:59:59.000Z

    CenterPoint Load Management Programs CATEE Conference October, 2012 Agenda Outline I. General Demand Response Definition II. General Demand Response Program Rules III. CenterPoint Commercial Program IV. CenterPoint Residential Programs...

  11. Overview of Demand Side Response

    Broader source: Energy.gov [DOE]

    Presentation—given at the Federal Utility Partnership Working Group (FUPWG) Fall 2008 meeting—discusses the utility PJM's demand side response (DSR) capabilities, including emergency and economic responses.

  12. Response Resources Demonstration

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn'tOrigin ofEnergy at Waste-to-Energy usingof Enhanced Dr. JuliaPOINTRespond to theResponse

  13. Responses for Public Release

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels DataDepartment of Energy Your Density Isn'tOrigin ofEnergy at Waste-to-Energy usingof Enhanced Dr.ResponseEnergyfor Public Release

  14. Whole-brain calcium imaging with cellular resolution in freely behaving C. elegans

    E-Print Network [OSTI]

    Nguyen, Jeffrey P; Linder, Ashley N; Plummer, George S; Shaevitz, Joshua W; Leifer, Andrew M

    2015-01-01T23:59:59.000Z

    The ability to acquire large-scale recordings of neuronal activity in awake and unrestrained animals poses a major challenge for studying neural coding of animal behavior. We present a new instrument capable of recording intracellular calcium transients from every neuron in the head of a freely behaving C. elegans with cellular resolution while simultaneously recording the animal's position, posture and locomotion. We employ spinning-disk confocal microscopy to capture 3D volumetric fluorescent images of neurons expressing the calcium indicator GCaMP6s at 5 head-volumes per second. Two cameras simultaneously monitor the animal's position and orientation. Custom software tracks the 3D position of the animal's head in real-time and adjusts a motorized stage to keep it within the field of view as the animal roams freely. We observe calcium transients from 78 neurons and correlate this activity with the animal's behavior. Across worms, multiple neurons show significant correlations with modes of behavior correspo...

  15. Biological (molecular and cellular) markers of toxicity. Final report, September 15, 1988--September 14, 1991

    SciTech Connect (OSTI)

    Shugart, L.R.; D`Surney, S.J.; Gettys-Hull, C.; Greeley, M.S. Jr.

    1991-12-15T23:59:59.000Z

    Several molecular and cellular markers of genotoxicity were adapted for measurement in the Medaka (Oryzias latipes), and were used to describe the effects of treatment of the organism with diethylnitrosamine (DEN). NO{sup 6}-ethyl guanine adducts were detected, and a slight statistically significant, increase in DNA strand breaks was observed. These results are consistent with the hypothesis that prolonged exposure to high levels of DEN induced alkyltransferase activity which enzymatically removes any O{sup 6}-ethyl guanine adducts but does not result in strand breaks or hypomethylation of the DNA such as might be expected from excision repair of chemically modified DNA. Following a five week continuous DEN exposure with 100 percent renewal of DEN-water every third day, the F values (DNA double strandedness) increased considerably and to similar extent in fish exposed to 25, 50, and 100 ppM DEN. This has been observed also in medaka exposed to BaP.

  16. Combined Base Station Association and Power Control in Multi-channel Cellular Networks

    E-Print Network [OSTI]

    Singh, Chandramani; Sundaresan, Rajesh

    2011-01-01T23:59:59.000Z

    A combined base station association and power control problem is studied for the uplink of multichannel multicell cellular networks, in which each channel is used by exactly one cell (i.e., base station). A distributed association and power update algorithm is proposed and shown to converge to a Nash equilibrium of a noncooperative game. We consider network models with discrete mobiles (yielding an atomic congestion game), as well as a continuum of mobiles (yielding a population game). We find that the equilibria need not be Pareto efficient, nor need they be system optimal. To address the lack of system optimality, we propose pricing mechanisms. It is shown that these mechanisms can be implemented in a distributed fashion.

  17. Cancer Genesis and Progression as Dynamics in Functional Landscape of Endogenous Molecular-Cellular Network

    E-Print Network [OSTI]

    P. Ao; D. Galas; L. Hood; X. -M. Zhu

    2007-09-05T23:59:59.000Z

    An endogenous molecular-cellular network for both normal and abnormal functions is assumed to exist. This endogenous network forms a nonlinear stochastic dynamical system, with many stable attractors in its functional landscape. Normal or abnormal robust states can be decided by this network in a manner similar to the neural network. In this context cancer is hypothesized as one of its robust intrinsic states. This hypothesis implies that a nonlinear stochastic mathematical cancer model is constructible based on available experimental data and its quantitative prediction is directly testable. Within such model the genesis and progression of cancer may be viewed as stochastic transitions between different attractors. Thus it further suggests that progressions are not arbitrary. Other important issues on cancer, such as genetic vs epigenetics, double-edge effect, dormancy, are discussed in the light of present hypothesis. A different set of strategies for cancer prevention, cure, and care, is therefore suggested.

  18. Neuronal micro-culture engineering by microchannel devices of cellular scale dimensions

    E-Print Network [OSTI]

    Goyal, Gaurav

    2015-01-01T23:59:59.000Z

    Purpose: The purpose of the current study was to investigate the effect of microchannel geometry on neuronal cultures and to maintain these cultures for long period of time (over several weeks) inside the closed microchannels of cellular scale dimensions. Methods: The primary hippocampal neurons from E-18 rat were cultured inside the closed polydimethylsiloxane (PDMS) microchannels of varying sizes. The effect of the channel geometry on the spatial and the temporal variations in the neural microenvironment was investigated by studying neural maturation and variation in the media osmolality respectively. The cultures were maintained for longer time spans by PDMS device pretreatment, control on media evaporation (by using hydrophobic ethylene propylene membrane) and an effective culture maintenance protocol. Further, the devices were integrated with the planar microelectrode arrays (MEA) to record spontaneous electrical activity. Results: A direct influence of channel geometry on neuron maturation was observed ...

  19. Cellular telephone-based radiation sensor and wide-area detection network

    DOE Patents [OSTI]

    Craig, William W. (Pittsburg, CA); Labov, Simon E. (Berkeley, CA)

    2006-12-12T23:59:59.000Z

    A network of radiation detection instruments, each having a small solid state radiation sensor module integrated into a cellular phone for providing radiation detection data and analysis directly to a user. The sensor module includes a solid-state crystal bonded to an ASIC readout providing a low cost, low power, light weight compact instrument to detect and measure radiation energies in the local ambient radiation field. In particular, the photon energy, time of event, and location of the detection instrument at the time of detection is recorded for real time transmission to a central data collection/analysis system. The collected data from the entire network of radiation detection instruments are combined by intelligent correlation/analysis algorithms which map the background radiation and detect, identify and track radiation anomalies in the region.

  20. Assessment of Demand Response Resource

    E-Print Network [OSTI]

    Assessment of Demand Response Resource Potentials for PGE and Pacific Power Prepared for: Portland January 15, 2004 K:\\Projects\\2003-53 (PGE,PC) Assess Demand Response\\Report\\Revised Report_011504.doc #12;#12;quantec Assessment of Demand Response Resource Potentials for I-1 PGE and Pacific Power I. Introduction

  1. Quantum Field as a quantum cellular automaton: the Dirac free evolution in one dimension

    E-Print Network [OSTI]

    Alessandro Bisio; Giacomo Mauro D'Ariano; Alessandro Tosini

    2015-02-11T23:59:59.000Z

    We present a quantum cellular automaton model in one space-dimension which has the Dirac equation as emergent. This model, a discrete-time and causal unitary evolution of a lattice of quantum systems, is derived from the assumptions of homogeneity, parity and time-reversal invariance. The comparison between the automaton and the Dirac evolutions is rigorously set as a discrimination problem between unitary channels. We derive an exact lower bound for the probability of error in the discrimination as an explicit function of the mass, the number and the momentum of the particles, and the duration of the evolution. Computing this bound with experimentally achievable values, we see that in that regime the QCA model cannot be discriminated from the usual Dirac evolution. Finally, we show that the evolution of one-particle states with narrow-band in momentum can be effi- ciently simulated by a dispersive differential equation for any regime. This analysis allows for a comparison with the dynamics of wave-packets as it is described by the usual Dirac equation. This paper is a first step in exploring the idea that quantum field theory could be grounded on a more fundamental quantum cellular automaton model and that physical dynamics could emerge from quantum information processing. In this framework, the discretization is a central ingredient and not only a tool for performing non-perturbative calculation as in lattice gauge theory. The automaton model, endowed with a precise notion of local observables and a full probabilistic interpretation, could lead to a coherent unification of an hypothetical discrete Planck scale with the usual Fermi scale of high-energy physics.

  2. Pulsed laser microbeams for cellular manipulation : applications in cell biology and microfluidics

    E-Print Network [OSTI]

    Hellman, Amy Noel Stacy

    2008-01-01T23:59:59.000Z

    130 xiii Figure 7.4: Laser microbeam-induced axotomy of ratx’ marking the location of laser microbeam pulse delivery. (Biophysical Response to Laser Microbeam-Induced Cell Lysis

  3. Widespread Inhibition of Posttranscriptional Splicing Shapes the Cellular Transcriptome following Heat Shock

    E-Print Network [OSTI]

    Shalgi, Reut

    During heat shock and other proteotoxic stresses, cells regulate multiple steps in gene expression in order to globally repress protein synthesis and selectively upregulate stress response proteins. Splicing of several ...

  4. Paper Tracking Number: 689 System Design Tradeoff for Supporting Soft Handoff for Packet Data Calls using cdma2000 Cellular Simulator

    E-Print Network [OSTI]

    Paper Tracking Number: 689 1 System Design Tradeoff for Supporting Soft Handoff for Packet Data networks. In this paper, we perform system design trade-off study for supporting soft handoff for packet soft handoff based on system and user conditions. Index Terms--cdma2000, cellular simulator, soft

  5. BIOLOGY OF REPRODUCTION 64, 611618 (2001) Increased Proliferative Activity and Programmed Cellular Death in the Turkey Hen

    E-Print Network [OSTI]

    Ramachandran, Ramesh

    Cellular Death in the Turkey Hen Pituitary Gland Following Interruption of Incubation Behavior1 R. Ramesh,2 in turkey hens is charac- terized by ovarian regression, hyperprolactinemia, and persis- tent nesting. Nest-deprivation of incubating turkey hens results in disruption of broodiness accompanied by a precipitous de- cline in plasma

  6. MMA-WS12/13,R.Hoffmann,Rechnerarchitektur,TUDarmstadt 3. Cellular Automata (CA) Part 1

    E-Print Network [OSTI]

    Hoffmann, Rolf

    & Literature Cellular Automata Basics Formal Definition Grids Boundaries Neighborhoods Rule Types Speed Diffusion Hydrodynamics Sound Waves Wave Optics Ising Spin Systems Simulation of Digital Logic Numerical of a liquid, the interfacial tension between two liquids, or that between a liquid and a solid. Surfactants

  7. MMA-WS13/14,R.Hoffmann,Rechnerarchitektur,TUDarmstadt 3. Cellular Automata (CA) Part 1

    E-Print Network [OSTI]

    Hoffmann, Rolf

    & Literature Cellular Automata Basics Formal Definition Grids Boundaries Neighborhoods Rule Types Speed Diffusion Hydrodynamics Sound Waves Wave Optics Ising Spin Systems Simulation of Digital Logic Numerical of a liquid, the interfacial tension between two liquids, or that between a liquid and a solid. Surfactants

  8. Cellular Inhibition of Checkpoint Kinase 2 (Chk2) and Potentiation of Camptothecins and Radiation by the Novel

    E-Print Network [OSTI]

    Cellular Inhibition of Checkpoint Kinase 2 (Chk2) and Potentiation of Camptothecins and Radiation, Maryland; Laboratory of Functional Genomics (J.C., A.M.) and Molecular Radiation Therapeutics Branch (D Brunswick, New Jersey (G.Zh., C.S.); and Molecular Radiation Therapeutics Branch, Radiation Research Program

  9. Naturally occurring, optically driven, cellular rotor J. A. Dharmadhikari, S. Roy, A. K. Dharmadhikari, S. Sharma, and D. Mathura)

    E-Print Network [OSTI]

    Sharma, Shobhona

    Naturally occurring, optically driven, cellular rotor J. A. Dharmadhikari, S. Roy, A. K 005, India (Received 10 June 2004; accepted 20 October 2004) We report the conversion of optical energy into mechanical energy by naturally occurring red blood cells (RBCs) placed in an optical trap

  10. Holographic evaluation of warp in the torsion of a bar of cellular solid: effect of Cosserat elasticity

    E-Print Network [OSTI]

    Lakes, Roderic

    experimentally. This study is directed at the deformation field in the case of torsion of a square cross section1 Holographic evaluation of warp in the torsion of a bar of cellular solid: effect of Cosserat elasticity Anderson, W. B., Lakes, R. S., and Smith, M. C., "Holographic evaluation of warp in the torsion

  11. KELP VERSUS CORALLINE: CELLULAR BASIS FOR MECHANICAL STRENGTH IN THE WAVE-SWEPT SEAWEED CALLIARTHRON (CORALLINACEAE, RHODOPHYTA)1

    E-Print Network [OSTI]

    Martone, Patrick T.

    KELP VERSUS CORALLINE: CELLULAR BASIS FOR MECHANICAL STRENGTH IN THE WAVE-SWEPT SEAWEED- ing in girth versus growing strong tissues. Brown macroalgae, such as kelps, grow thick stipes an order of magnitude stronger than some kelp tissues, but genicula rarely exceed 1 mm in diameter

  12. Dr. Campbell's Bio111 Exam #1 Answer Key Fall 2003 Fall 2003 Biology 111 Exam #1 Answer Key -Cellular Communications

    E-Print Network [OSTI]

    Campbell, A. Malcolm

    - Cellular Communications There is no time limit on this test, though I have tried to design one that you to be labeled. Furthermore, I was looking for a diagram of an enzyme that had a shape complementary to the alpha activation energy. Energy needed to initiate an chemical reaction. b. List three different non

  13. Project #14: Shuming Nie and Peng Xi: Superresolution Imaging of Cellular Dynamics with Quantum Dots and STED

    E-Print Network [OSTI]

    Weber, Rodney

    , therefore opening up new possibilities in studying molecular dynamics in living cells. A major engineering of fluorescent labels for imaging applications. Compared to organic dyes and fluorescent proteins, QDs have to develop nextgeneration QDs for molecular and cellular imaging at ultrahigh resolution and sensitivity

  14. he building that houses the Donnelly Centre for Cellular and Biomolecular Research can be described as transparent,

    E-Print Network [OSTI]

    Zandstra, Peter W.

    T he building that houses the Donnelly Centre for Cellular and Biomolecular Research can faculty. Each of the new recruits, along with other researchers in the building, have started new towards the glass wall of the building to the expansive and unobstructed view of the skyline and the city

  15. Oxidative stress suppresses the cellular bioenergetic effect of the 3-mercaptopyruvate sulfurtransferase/hydrogen sulfide pathway

    SciTech Connect (OSTI)

    Módis, Katalin [Department of Anesthesiology, University of Texas Medical Branch and Shriners Burns Hospital for Children, Galveston, TX (United States)] [Department of Anesthesiology, University of Texas Medical Branch and Shriners Burns Hospital for Children, Galveston, TX (United States); Asimakopoulou, Antonia [Laboratory of Molecular Pharmacology, Department of Pharmacy, University of Patras, Patras (Greece)] [Laboratory of Molecular Pharmacology, Department of Pharmacy, University of Patras, Patras (Greece); Coletta, Ciro [Department of Anesthesiology, University of Texas Medical Branch and Shriners Burns Hospital for Children, Galveston, TX (United States)] [Department of Anesthesiology, University of Texas Medical Branch and Shriners Burns Hospital for Children, Galveston, TX (United States); Papapetropoulos, Andreas [Department of Anesthesiology, University of Texas Medical Branch and Shriners Burns Hospital for Children, Galveston, TX (United States) [Department of Anesthesiology, University of Texas Medical Branch and Shriners Burns Hospital for Children, Galveston, TX (United States); Laboratory of Molecular Pharmacology, Department of Pharmacy, University of Patras, Patras (Greece); Szabo, Csaba, E-mail: szabocsaba@aol.com [Department of Anesthesiology, University of Texas Medical Branch and Shriners Burns Hospital for Children, Galveston, TX (United States)] [Department of Anesthesiology, University of Texas Medical Branch and Shriners Burns Hospital for Children, Galveston, TX (United States)

    2013-04-19T23:59:59.000Z

    Highlights: •Oxidative stress impairs 3-MST-derived H{sub 2}S production in isolated enzyme and in isolated mitochondria. •This impairs the stimulatory bioenergetic effects of H{sub 2}S in hepatocytes. •This has implications for the pathophysiology of diseases with oxidative stress. -- Abstract: Recent data show that lower concentrations of hydrogen sulfide (H{sub 2}S), as well as endogenous, intramitochondrial production of H{sub 2}S by the 3-mercaptopyruvate (3-MP)/3-mercaptopyruvate sulfurtransferase (3-MST) pathway serves as an electron donor and inorganic source of energy to support mitochondrial electron transport and ATP generation in mammalian cells by donating electrons to Complex II. The aim of our study was to investigate the role of oxidative stress on the activity of the 3-MP/3-MST/H{sub 2}S pathway in vitro. Hydrogen peroxide (H{sub 2}O{sub 2}, 100–500 ?M) caused a concentration-dependent decrease in the activity of recombinant mouse 3-MST enzyme. In mitochondria isolated from murine hepatoma cells, H{sub 2}O{sub 2} (50–500 ?M) caused a concentration-dependent decrease in production of H{sub 2}S from 3-MP. In cultured murine hepatoma cells H{sub 2}O{sub 2}, (3–100 ?M), did not result in overall cytotoxicity, but caused a partial decrease in basal oxygen consumption and respiratory reserve rapacity. The positive bioenergetic effect of 3-MP (100–300 nM) was completely abolished by pre-treatment of the cells with H{sub 2}O{sub 2} (50 ?M). The current findings demonstrate that oxidative stress inhibits 3-MST activity and interferes with the positive bioenergetic role of the 3-MP/3-MST/H{sub 2}S pathway. These findings may have implications for the pathophysiology of various conditions associated with increased oxidative stress, such as various forms of critical illness, cardiovascular diseases, diabetes or physiological aging.

  16. Installation and Commissioning Automated Demand Response Systems

    E-Print Network [OSTI]

    Kiliccote, Sila; Global Energy Partners; Pacific Gas and Electric Company

    2008-01-01T23:59:59.000Z

    their partnership in demand response automation research andand Techniques for Demand Response. LBNL Report 59975. Mayof Fully Automated Demand Response in Large Facilities.

  17. Coordination of Energy Efficiency and Demand Response

    E-Print Network [OSTI]

    Goldman, Charles

    2010-01-01T23:59:59.000Z

    and D. Kathan (2009). Demand Response in U.S. ElectricityEnergy Financial Group. Demand Response Research Center [2008). Assessment of Demand Response and Advanced Metering.

  18. Strategies for Demand Response in Commercial Buildings

    E-Print Network [OSTI]

    Watson, David S.; Kiliccote, Sila; Motegi, Naoya; Piette, Mary Ann

    2006-01-01T23:59:59.000Z

    Fully Automated Demand Response Tests in Large Facilities”of Fully Automated Demand Response in Large Facilities”,was coordinated by the Demand Response Research Center and

  19. Retail Demand Response in Southwest Power Pool

    E-Print Network [OSTI]

    Bharvirkar, Ranjit

    2009-01-01T23:59:59.000Z

    23 ii Retail Demand Response in SPP List of Figures and10 Figure 3. Demand Response Resources by11 Figure 4. Existing Demand Response Resources by Type of

  20. Home Network Technologies and Automating Demand Response

    E-Print Network [OSTI]

    McParland, Charles

    2010-01-01T23:59:59.000Z

    and Automating Demand Response Charles McParland, Lawrenceand Automating Demand Response Charles McParland, LBNLCommercial and Residential Demand Response Overview of the

  1. Barrier Immune Radio Communications for Demand Response

    E-Print Network [OSTI]

    Rubinstein, Francis

    2010-01-01T23:59:59.000Z

    of Fully Automated Demand Response in Large Facilities,”Fully Automated Demand Response Tests in Large Facilities.for Automated Demand Response. Technical Document to

  2. Wireless Demand Response Controls for HVAC Systems

    E-Print Network [OSTI]

    Federspiel, Clifford

    2010-01-01T23:59:59.000Z

    Strategies Linking Demand Response and Energy Efficiency,”Fully Automated Demand Response Tests in Large Facilities,technical support from the Demand Response Research Center (

  3. Hawaiian Electric Company Demand Response Roadmap Project

    E-Print Network [OSTI]

    Levy, Roger

    2014-01-01T23:59:59.000Z

    integrating HECO and Hawaii Energy demand response relatedpotential. Energy efficiency and demand response efforts areBoth  energy  efficiency  and  demand  response  should  

  4. Demand Responsive Lighting: A Scoping Study

    E-Print Network [OSTI]

    Rubinstein, Francis; Kiliccote, Sila

    2007-01-01T23:59:59.000Z

    sector, the demand response potential of California buildinga demand response event prohibit a building’s participationdemand response strategies in California buildings are

  5. Strategies for Demand Response in Commercial Buildings

    E-Print Network [OSTI]

    Watson, David S.; Kiliccote, Sila; Motegi, Naoya; Piette, Mary Ann

    2006-01-01T23:59:59.000Z

    Strategies for Demand Response in Commercial Buildings DavidStrategies for Demand Response in Commercial Buildings Davidadjusted for demand response in commercial buildings. The

  6. Installation and Commissioning Automated Demand Response Systems

    E-Print Network [OSTI]

    Kiliccote, Sila; Global Energy Partners; Pacific Gas and Electric Company

    2008-01-01T23:59:59.000Z

    Demand Response Systems National Conference on BuildingDemand Response Systems National Conference on BuildingDemand Response Systems National Conference on Building

  7. Coordination of Energy Efficiency and Demand Response

    E-Print Network [OSTI]

    Goldman, Charles

    2010-01-01T23:59:59.000Z

    In terms of demand response capability, building operatorsautomated demand response and improve building energy andand demand response features directly into building design

  8. Texas AgriLife Research Procedure 25.99.09.A1 Cellular Communication Devices and Services Page 1 of 3

    E-Print Network [OSTI]

    a personal device. To receive reimbursement, the employee will submit an itemized bill documenting callsTexas AgriLife Research Procedure 25.99.09.A1 Cellular Communication Devices and Services Page 1 of 3 Texas AgriLife Research Procedure 25.99.09.A1.01 CELLULAR COMMUNICATION DEVICES AND SERVICES

  9. Insights into the regulation of NF-kappaB and mediation of the cellular stress response by NF-kappaB

    E-Print Network [OSTI]

    Ho, Jessica Q.

    2010-01-01T23:59:59.000Z

    Cancer Res 65, 4273-4281. Hoffmann, A. , Natoli, G. , andS.L. , Huang, C.S. , and Hoffmann, A. (2006). IkappaBepsilonK.I. , DiDonato, J.A. , Hoffmann, A. , Hardwick, J.M. , and

  10. Demand Response for Ancillary Services

    SciTech Connect (OSTI)

    Alkadi, Nasr E [ORNL; Starke, Michael R [ORNL

    2013-01-01T23:59:59.000Z

    Many demand response resources are technically capable of providing ancillary services. In some cases, they can provide superior response to generators, as the curtailment of load is typically much faster than ramping thermal and hydropower plants. Analysis and quantification of demand response resources providing ancillary services is necessary to understand the resources economic value and impact on the power system. Methodologies used to study grid integration of variable generation can be adapted to the study of demand response. In the present work, we describe and illustrate a methodology to construct detailed temporal and spatial representations of the demand response resource and to examine how to incorporate those resources into power system models. In addition, the paper outlines ways to evaluate barriers to implementation. We demonstrate how the combination of these three analyses can be used to translate the technical potential for demand response providing ancillary services into a realizable potential.

  11. Demand Response: Load Management Programs

    E-Print Network [OSTI]

    Simon, J.

    2012-01-01T23:59:59.000Z

    CenterPoint Load Management Programs CATEE Conference October, 2012 Agenda Outline I. General Demand Response Definition II. General Demand Response Program Rules III. CenterPoint Commercial Program IV. CenterPoint Residential Programs... V. Residential Discussion Points Demand Response Definition of load management per energy efficiency rule 25.181: ? Load control activities that result in a reduction in peak demand, or a shifting of energy usage from a peak to an off...

  12. Demand Response and Energy Efficiency

    E-Print Network [OSTI]

    Demand Response & Energy Efficiency International Conference for Enhanced Building Operations ESL-IC-09-11-05 Proceedings of the Ninth International Conference for Enhanced Building Operations, Austin, Texas, November 17 - 19, 2009 2 ?Less than 5... for Enhanced Building Operations, Austin, Texas, November 17 - 19, 2009 5 What is Demand Response? ?The temporary reduction of electricity demanded from the grid by an end-user in response to capacity shortages, system reliability events, or high wholesale...

  13. Emergency Response Health Physics

    SciTech Connect (OSTI)

    Mena, RaJah [National Security Technologies, LLC, Remote Sensing Laboratory–Nellis; Pemberton, Wendy [National Security Technologies, LLC, Remote Sensing Laboratory–Nellis; Beal, William [Remote Sensing Laboratory at Andrews

    2012-05-01T23:59:59.000Z

    Health physics is an important discipline with regard to understanding the effects of radiation on human health; however, there are major differences between health physics for research or occupational safety and health physics during a large-scale radiological emergency. The deployment of a U.S. Department of Energy/National Nuclear Security Administration (DOE/NNSA) monitoring and assessment team to Japan in the wake of the March 2011 accident at Fukushima Daiichi Nuclear Power Plant yielded a wealth of lessons on these difference. Critical teams (CMOC (Consequence Management Outside the Continental U.S.) and CMHT (Consequence Management Home Team) ) worked together to collect, compile, review, and analyze radiological data from Japan to support the response needs of and answer questions from the Government of Japan, the U.S. military in Japan, the U.S. Embassy and U.S. citizens in Japan, and U.S. citizens in America. This paper addresses the unique challenges presented to the health physicist or analyst of radiological data in a large-scale emergency. A key lesson learned was that public perception and the availability of technology with social media requires a diligent effort to keep the public informed of the science behind the decisions in a manner that is meaningful to them.

  14. Demand Response Valuation Frameworks Paper

    E-Print Network [OSTI]

    Heffner, Grayson

    2010-01-01T23:59:59.000Z

    37 3.8.1. Impacts of DR programs on Wholesale MarketPrice Response on Wholesale Markets.in Organized Wholesale Markets .19

  15. Demand Response Technology Roadmap A

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    workshop agendas, presentation materials, and transcripts. For the background to the Demand Response Technology Roadmap and to make use of individual roadmaps, the reader is...

  16. Demand Response Programs, 6. edition

    SciTech Connect (OSTI)

    NONE

    2007-10-15T23:59:59.000Z

    The report provides a look at the past, present, and future state of the market for demand/load response based upon market price signals. It is intended to provide significant value to individuals and companies who are considering participating in demand response programs, energy providers and ISOs interested in offering demand response programs, and consultants and analysts looking for detailed information on demand response technology, applications, and participants. The report offers a look at the current Demand Response environment in the energy industry by: defining what demand response programs are; detailing the evolution of program types over the last 30 years; discussing the key drivers of current initiatives; identifying barriers and keys to success for the programs; discussing the argument against subsidization of demand response; describing the different types of programs that exist including:direct load control, interruptible load, curtailable load, time-of-use, real time pricing, and demand bidding/buyback; providing examples of the different types of programs; examining the enablers of demand response programs; and, providing a look at major demand response programs.

  17. Demand Response Valuation Frameworks Paper

    E-Print Network [OSTI]

    Heffner, Grayson

    2010-01-01T23:59:59.000Z

    Pepco.6: Comparison of SCE, BGE and Pepco Maryland AMI Business3.6.2. Maryland: BGE and Pepco In response to the federal

  18. Demand Response Technology Roadmap M

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    between May 2014 and February 2015. The Bonneville Power Administration (BPA) Demand Response Executive Sponsor Team decided upon the scope of the project in May. Two subsequent...

  19. Cellular morphology of organic-inorganic hybrid foams based on alkali alumino-silicate matrix

    SciTech Connect (OSTI)

    Verdolotti, Letizia; Capasso, Ilaria; Lavorgna, Marino [Institute of Composite and Biomedical Materials, National Research Council, Naples (Italy); Liguori, Barbara; Caputo, Domenico [Department of Chemical, Materials and Industrial Engineering, University of Naples Federico II, Naples (Italy); Iannace, Salvatore [Institute of Composite and Biomedical Materials, National Research Council, Naples, Italy and IMAST SCRAL, Piazza Bovio 22 Napoli 80133 (Italy)

    2014-05-15T23:59:59.000Z

    Organic-inorganic hybrid foams based on an alkali alumino-silicate matrix were prepared by using different foaming methods. Initially, the synthesis of an inorganic matrix by using aluminosilicate particles, activated through a sodium silicate solution, was performed at room temperature. Subsequently the viscous paste was foamed by using three different methods. In the first method, gaseous hydrogen produced by the oxidization of Si powder in an alkaline media, was used as blowing agent to generate gas bubbles in the paste. In the second method, the porous structure was generated by mixing the paste with a “meringue” type of foam previously prepared by whipping, under vigorous stirring, a water solution containing vegetal proteins as surfactants. In the third method, a combination of these two methods was employed. The foamed systems were consolidated for 24 hours at 40°C and then characterized by FTIR, X-Ray diffraction, scanning electron microscopy (SEM) and compression tests. Low density foams (?500 Kg/m{sup 3}) with good cellular structure and mechanical properties were obtained by combining the “meringue” approach with the use of the chemical blowing agent based on Si.

  20. DOE contractors' workshop: Cellular and molecular aspects of radiation induced DNA damage and repair

    SciTech Connect (OSTI)

    Not Available

    1987-01-01T23:59:59.000Z

    For four decades the US Department of Energy and its predecessors have been the lead federal agency in supporting radiation biology research. Over the years emphasis in this program has gradually shifted from dose-effect studies on animals to research on the effects of radiations of various qualities on cells and molecules. Mechanistic studies on the action of radiation at the subcellular level are few in number and there is a need for more research in this area if we are to gain a better understanding of how radiation affects living cells. The intent of this workshop was to bring together DOE contractors and grantees who are investigating the effects of radiation at the cellular and molecular levels. The aims were to foster the exchange of information on research projects and experimental results, promote collaborative research efforts, and obtain an overview of research currently supported by the Health Effects Research Division of the Office of Health and Environmental Research. The latter is needed by the Office for program planning purposes. This report on the workshop which took place in Albuquerque, New Mexico on March 10-11, 1987, includes an overview with future research recommendations, extended abstracts of the plenary presentations, shorter abstracts of each poster presentation, a workshop agenda and the names and addresses of the attendees.

  1. Electrical substation service-area estimation using Cellular Automata: An initial report

    SciTech Connect (OSTI)

    Fenwick, J.W.; Dowell, L.J.

    1998-07-01T23:59:59.000Z

    The service areas for electric power substations can be estimated using a Cellular Automata (CA) model. The CA model is a discrete, iterative process whereby substations acquire service area by claiming neighboring cells. The service area expands from a substation until a neighboring substation service area is met or the substation`s total capacity or other constraints are reached. The CA-model output is dependent on the rule set that defines cell interactions. The rule set is based on a hierarchy of quantitative metrics that represent real-world factors such as land use and population density. Together, the metrics determine the rate of cell acquisition and the upper bound for service area size. Assessing the CA-model accuracy requires comparisons to actual service areas. These actual service areas can be extracted from distribution maps. Quantitative assessment of the CA-model accuracy can be accomplished by a number of methods. Some are as simple as finding the percentage of cells predicted correctly, while others assess a penalty based on the distance from an incorrectly predicted cell to its correct service area. This is an initial report of a work in progress.

  2. Periodic solution and chaotic strange attractor for shunting inhibitory cellular neural networks with impulses

    SciTech Connect (OSTI)

    Gu Zhanji; Ge Weigao [Department of Computer Science, Hainan Normal University, Haikou, HaiNan 571158 (China) and Department of Applied Mathematics, Beijing Institute of Technology, Beijing 100081 (China); Department of Applied Mathematics, Beijing Institute of Technology, Beijing 100081 (China)

    2006-09-15T23:59:59.000Z

    By using the continuation theorem of coincidence degree theory and constructing suitable Lyapunov functions, we study the existence, uniqueness, and global exponential stability of periodic solution for shunting inhibitory cellular neural networks with impulses, dx{sub ij}/dt=-a{sub ij}x{sub ij}-{sigma}{sub C{sub K}{sub 1}}{sub (set-membershipsign)=N{sub r}{sub (i,j)}C{sub ij}{sup kl}f{sub ij}[x{sub kl}(t)]x{sub ij}+L{sub ij}(t), t>0,t{ne}t{sub k}; {delta}x{sub ij}(t{sub k})=x{sub ij}(t{sub k}{sup +})-x{sub ij}(t{sub k}{sup -})=I{sub k}[x{sub ij}(t{sub k})], k=1,2,... . Furthermore, the numerical simulation shows that our system can occur in many forms of complexities, including periodic oscillation and chaotic strange attractor. To the best of our knowledge, these results have been obtained for the first time. Some researchers have introduced impulses into their models, but analogous results have never been found.

  3. Wireless Demand Response Controls for HVAC Systems

    E-Print Network [OSTI]

    Federspiel, Clifford

    2010-01-01T23:59:59.000Z

    temperature-based demand response in buildings that havedemand response advantages of global zone temperature setup in buildings

  4. The host immunological response to cancer therapy: An emerging concept in tumor biology

    SciTech Connect (OSTI)

    Voloshin, Tali [Department of Molecular Pharmacology, Rappaport Faculty of Medicine and the Rappaport Institute, Technion—Israel Institute of Technology, 1 Efron Street, Bat Galim, Haifa 31096 (Israel); Voest, Emile E. [Department of Medical Oncology, University Medical Center Utrecht, Utrecht (Netherlands); Shaked, Yuval, E-mail: yshaked@tx.technion.ac.il [Department of Molecular Pharmacology, Rappaport Faculty of Medicine and the Rappaport Institute, Technion—Israel Institute of Technology, 1 Efron Street, Bat Galim, Haifa 31096 (Israel)

    2013-07-01T23:59:59.000Z

    Almost any type of anti-cancer treatment including chemotherapy, radiation, surgery and targeted drugs can induce host molecular and cellular immunological effects which, in turn, can lead to tumor outgrowth and relapse despite an initial successful therapy outcome. Tumor relapse due to host immunological effects is attributed to angiogenesis, tumor cell dissemination from the primary tumors and seeding at metastatic sites. This short review will describe the types of host cells that participate in this process, the types of factors secreted from the host following therapy that can promote tumor re-growth, and the possible implications of this unique and yet only partially-known process. It is postulated that blocking these specific immunological effects in the reactive host in response to cancer therapy may aid in identifying new host-dependent targets for cancer, which in combination with conventional treatments can prolong therapy efficacy and extend survival. Additional studies investigating this specific research direction—both in preclinical models and in the clinical setting are essential in order to advance our understanding of how tumors relapse and evade therapy. -- Highlights: • Cancer therapy induces host molecular and cellular pro-tumorigenic effects. • Host effects in response to therapy may promote tumor relapse and metastasis. • The reactive host consists of immunological mediators promoting tumor re-growth. • Blocking therapy-induced host mediators may improve outcome.

  5. Departmental Radiological Emergency Response Assets

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2007-06-27T23:59:59.000Z

    The order establishes requirements and responsibilities for the DOE/NNSA national radiological emergency response assets and capabilities and Nuclear Emergency Support Team assets. Cancels DOE O 5530.1A, DOE O 5530.2, DOE O 5530.3, DOE O 5530.4, and DOE O 5530.5.

  6. ERCOT Demand Response Paul Wattles

    E-Print Network [OSTI]

    Mohsenian-Rad, Hamed

    changes or incentives.' (FERC) · `Changes in electric use by demand-side resources from their normalERCOT Demand Response Paul Wattles Senior Analyst, Market Design & Development, ERCOT Whitacre thermostats -- Other DLC Possible triggers: Real-time prices, congestion management, 4CP response paid

  7. Cellular stress stimulates nuclear localization signal (NLS) independent nuclear transport of MRJ

    SciTech Connect (OSTI)

    Andrews, Joel F.; Sykora, Landon J.; Barik Letostak, Tiasha; Menezes, Mitchell E.; Mitra, Aparna [Department of Oncologic Sciences, Mitchell Cancer Institute, University of South Alabama, Mobile, AL (United States)] [Department of Oncologic Sciences, Mitchell Cancer Institute, University of South Alabama, Mobile, AL (United States); Barik, Sailen [Center for Gene Regulation in Health and Disease, Department of Biological, Geological, and Environmental Sciences, College of Science, Cleveland State University, Cleveland, OH (United States)] [Center for Gene Regulation in Health and Disease, Department of Biological, Geological, and Environmental Sciences, College of Science, Cleveland State University, Cleveland, OH (United States); Shevde, Lalita A. [Department of Oncologic Sciences, Mitchell Cancer Institute, University of South Alabama, Mobile, AL (United States)] [Department of Oncologic Sciences, Mitchell Cancer Institute, University of South Alabama, Mobile, AL (United States); Samant, Rajeev S., E-mail: rsamant@usouthal.edu [Department of Oncologic Sciences, Mitchell Cancer Institute, University of South Alabama, Mobile, AL (United States)

    2012-06-10T23:59:59.000Z

    HSP40 family member MRJ (DNAJB6) has been in the spot light for its relevance to Huntington's, Parkinson's diseases, limb-girdle muscular dystrophy, placental development, neural stem cells, cell cycle and malignancies such as breast cancer and melanoma. This gene has two spliced variants coding for 2 distinct proteins with significant homology. However, MRJ(L) (large variant) is predominantly localized to the nucleus whereas MRJ(S) (small variant) is predominantly cytoplasmic. Interestingly MRJ(S) translocates to the nucleus in response to heat shock. The classical heat shock proteins respond to crises (stress) by increasing the number of molecules, usually by transcriptional up-regulation. Our studies imply that a quick increase in the molar concentration of MRJ in the nuclear compartment is a novel method by which MRJ responds to stress. We found that MRJ(S) shows NLS (nuclear localization signal) independent nuclear localization in response to heat shock and hypoxia. The specificity of this response is realized due to lack of such response by MRJ(S) when challenged by other stressors, such as some cytokines or UV light. Deletion analysis has allowed us to narrow down on a 20 amino acid stretch at the C-terminal region of MRJ(S) as a potential stress sensing region. Functional studies indicated that constitutive nuclear localization of MRJ(S) promoted attributes of malignancy such as proliferation and invasiveness overall indicating distinct phenotypic characteristics of nuclear MRJ(S).

  8. Accepted to appear in ACM/Baltzer Wireless Networks, 1999 Admission Control Algorithms for Cellular Systems

    E-Print Network [OSTI]

    Peha, Jon M.

    Page 1 Accepted to appear in ACM/Baltzer Wireless Networks, 1999 Admission Control Algorithms]), it is the network provider's responsibility to provide adequate Quality of Service (QoS) to all users. Two critical, the network may terminate the call prematurely when a handoff is attempted into a cell that has no capacity

  9. Automated Demand Response and Commissioning

    SciTech Connect (OSTI)

    Piette, Mary Ann; Watson, David S.; Motegi, Naoya; Bourassa, Norman

    2005-04-01T23:59:59.000Z

    This paper describes the results from the second season of research to develop and evaluate the performance of new Automated Demand Response (Auto-DR) hardware and software technology in large facilities. Demand Response (DR) is a set of activities to reduce or shift electricity use to improve the electric grid reliability and manage electricity costs. Fully-Automated Demand Response does not involve human intervention, but is initiated at a home, building, or facility through receipt of an external communications signal. We refer to this as Auto-DR. The evaluation of the control and communications must be properly configured and pass through a set of test stages: Readiness, Approval, Price Client/Price Server Communication, Internet Gateway/Internet Relay Communication, Control of Equipment, and DR Shed Effectiveness. New commissioning tests are needed for such systems to improve connecting demand responsive building systems to the electric grid demand response systems.

  10. The Effects of Resistance Exercise, Resistance Training, and a Multi-Ingredient High Caffeine Pre-Exercise Supplement on the p38 and ERK1/2 Cellular Signaling Proteins.

    E-Print Network [OSTI]

    Kudrna, Rebecca A.

    2014-08-31T23:59:59.000Z

    Mitogen Activated Protein Kinases (MAPKs) have been implicated in cellular signal transduction leading to cellular growth and differentiation in skeletal muscle following exercise. This dissertation provides a review of ...

  11. The novel orally bioavailable inhibitor of phosphoinositol-3-kinase and mammalian target of rapamycin, NVP-BEZ235, inhibits growth and proliferation in multiple myeloma

    SciTech Connect (OSTI)

    Baumann, Philipp [Department of Hematology and Oncology Medizinische Klinik Innenstadt, Klinikum der Universitaet Muenchen (Germany)], E-mail: Philipp.Baumann@med.uni-muenchen.de; Mandl-Weber, Sonja; Oduncu, Fuat; Schmidmaier, Ralf [Department of Hematology and Oncology Medizinische Klinik Innenstadt, Klinikum der Universitaet Muenchen (Germany)

    2009-02-01T23:59:59.000Z

    NVP-BEZ235 is a new inhibitor of phosphoinositol-3-kinase (PI3 kinase) and mammalian target of rapamycin (mTOR) whose efficacy in advanced solid tumours is currently being evaluated in a phase I/II clinical trial. Here we show that NVP-BEZ235 inhibits growth in common myeloma cell lines as well as primary myeloma cells at nanomolar concentrations in a time and dose dependent fashion. Further experiments revealed induction of apoptosis in three of four cell lines. Inhibition of cell growth was mainly due to inhibition of myeloma cell proliferation, as shown by the BrdU assay. Cell cycle analysis revealed induction of cell cycle arrest in the G1 phase, which was due to downregulation of cyclin D1, pRb and cdc25a. NVP-BEZ235 inhibited phosphorylation of protein kinase B (Akt), P70S6k and 4E-BP-1. Furthermore we show that the stimulatory effect of CD40-ligand (CD40L), insulin-like growth factor 1 (IGF-1), interleukin-6 (IL-6) and conditioned medium of HS-5 stromal cells on myeloma cell growth is completely abrogated by NVP-BEZ235. In addition, synergism studies revealed synergistic and additive activity of NVP-BEZ235 together with melphalan, doxorubicin and bortezomib. Taken together, inhibition of PI3 kinase/mTOR by NVP-BEZ235 is highly effective and NVP-BEZ235 represents a potential new candidate for targeted therapy in multiple myeloma.

  12. Improving the accuracy and efficiency of time-resolved electronic spectra calculations: Cellular dephasing representation with a prefactor

    E-Print Network [OSTI]

    Zambrano, Eduardo; Vanicek, Jiri

    2013-01-01T23:59:59.000Z

    Time-resolved electronic spectra can be obtained as the Fourier transform of a special type of time correlation function known as fidelity amplitude, which, in turn, can be evaluated approximately and efficiently with the dephasing representation. Here we improve both the accuracy of this approximation---with an amplitude correction derived from the phase-space propagator---and its efficiency---with an improved cellular scheme employing inverse Weierstrass transform and optimal scaling of the cell size. We demonstrate the advantages of the new methodology by computing dispersed time-resolved stimulated emission spectra in the harmonic potential, pyrazine, and the NCO molecule. In contrast, we show that in strongly chaotic systems such as the quartic oscillator the original dephasing representation is more appropriate than either the cellular or prefactor-corrected methods.

  13. Improving the accuracy and efficiency of time-resolved electronic spectra calculations: Cellular dephasing representation with a prefactor

    SciTech Connect (OSTI)

    Zambrano, Eduardo; Šulc, Miroslav; Vaní?ek, Ji?í [Laboratory of Theoretical Physical Chemistry, Institut des Sciences et Ingénierie Chimiques, École Polytechnique Fédérale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland)] [Laboratory of Theoretical Physical Chemistry, Institut des Sciences et Ingénierie Chimiques, École Polytechnique Fédérale de Lausanne (EPFL), CH-1015 Lausanne (Switzerland)

    2013-08-07T23:59:59.000Z

    Time-resolved electronic spectra can be obtained as the Fourier transform of a special type of time correlation function known as fidelity amplitude, which, in turn, can be evaluated approximately and efficiently with the dephasing representation. Here we improve both the accuracy of this approximation—with an amplitude correction derived from the phase-space propagator—and its efficiency—with an improved cellular scheme employing inverse Weierstrass transform and optimal scaling of the cell size. We demonstrate the advantages of the new methodology by computing dispersed time-resolved stimulated emission spectra in the harmonic potential, pyrazine, and the NCO molecule. In contrast, we show that in strongly chaotic systems such as the quartic oscillator the original dephasing representation is more appropriate than either the cellular or prefactor-corrected methods.

  14. Detailed Modeling and Response of Demand Response Enabled Appliances

    SciTech Connect (OSTI)

    Vyakaranam, Bharat; Fuller, Jason C.

    2014-04-14T23:59:59.000Z

    Proper modeling of end use loads is very important in order to predict their behavior, and how they interact with the power system, including voltage and temperature dependencies, power system and load control functions, and the complex interactions that occur between devices in such an interconnected system. This paper develops multi-state time variant residential appliance models with demand response enabled capabilities in the GridLAB-DTM simulation environment. These models represent not only the baseline instantaneous power demand and energy consumption, but the control systems developed by GE Appliances to enable response to demand response signals and the change in behavior of the appliance in response to the signal. These DR enabled appliances are simulated to estimate their capability to reduce peak demand and energy consumption.

  15. Receptor-independent, vacuolar ATPase-mediated cellular uptake of histamine receptor-1 ligands: Possible origin of pharmacological distortions and side effects

    SciTech Connect (OSTI)

    Morissette, Guillaume [Centre de Recherche en Rhumatologie et Immunologie, Centre Hospitalier Universitaire de Quebec, Quebec QC, G1V 4G2 (Canada)]|[Department of Medicine, Universite Laval (Canada); Lodge, Robert [Centre de Recherche en Infectiologie, Centre Hospitalier Universitaire de Quebec, Quebec QC, G1V 4G2 (Canada); Bouthillier, Johanne [Centre de Recherche en Rhumatologie et Immunologie, Centre Hospitalier Universitaire de Quebec, Quebec QC, G1V 4G2 (Canada)]|[Department of Medicine, Universite Laval (Canada); Marceau, Francois [Centre de Recherche en Rhumatologie et Immunologie, Centre Hospitalier Universitaire de Quebec, Quebec QC, G1V 4G2 (Canada)]|[Department of Medicine, Universite Laval (Canada)], E-mail: francois.marceau@crchul.ulaval.ca

    2008-06-15T23:59:59.000Z

    The aims of this study were to investigate whether several histamine receptor agonists and antagonists are subjected to receptor-independent ion trapping into acidic organelles, and whether this sequestration influences their pharmacological or toxicological properties. Vacuolar (V)-ATPase-dependent intracellular sequestration of agonists was recognized as morphological alterations (large fluid-filled vacuoles for betahistine and 1-methylhistamine, granular uptake for fluorescent BODIPY FL histamine) prevented by the specific V-ATPase inhibitor bafilomycin A1 in rabbit vascular smooth muscle cells. Lipophilicity was the major determinant of these cellular effects (order of potency: BODIPY FL histamine > betahistine > 1-methylhistamine > histamine) that occurred at high concentrations. This ranking was dissociable from the potency order for H{sub 1} receptor-mediated contraction of the rabbit aorta, a response uninfluenced by bafilomycin. Antihistamines are inherently more lipophilic and caused vacuolization of a proportion of cells at 5-500 {mu}M. Agonist or antagonist-induced vacuoles were of macroautophagic nature (labeled with GFP-conjugated LC3, Rab7 and CD63; detection of LC3 II). Further, the 2 most lipophilic antihistamines tested, astemizole and terfenadine, were potentiated by V-ATPase blockade in the aortic contractility assay (13- and 3.6-fold more potent, respectively, pA{sub 2} scale), suggesting that V-ATPase-mediated cation trapping sequesters these antagonists from the vicinity of H{sub 1} receptors in the therapeutic concentration range. This potentiation did not apply to less lipophilic antagonists (pyrilamine, diphenhydramine). While some agonists and all tested antagonists of the histamine H{sub 1} receptors induce the V-ATPase-dependent vacuolar and autophagic cytopathology, sequestration affects the pharmacology of only the most lipophilic antagonists, the ones prone to off-target arrhythmogenic side effects.

  16. Regulation and Synchronization of the Master Circadian Clock by Purinergic Signaling from Suprachiasmatic Nucleus Astrocytes

    E-Print Network [OSTI]

    Womac, Alisa Diane

    2012-10-19T23:59:59.000Z

    responses of SCN astrocytes to ATP and led to a dampening of clock gene expression rhythms as determined by PER2::LUC bioluminescence reporting in SCN astrocytes. v These data demonstrate that astrocytes of the mammalian SCN rhythmically release ATP... transmitter involved in local communication among astrocytes and between astrocytes and neurons, and its potential contribution in SCN cellular communication and synchrony was investigated. The data presented here implicate ATP as a synchronizing agent...

  17. Automated Demand Response and Commissioning

    E-Print Network [OSTI]

    Piette, Mary Ann; Watson, David S.; Motegi, Naoya; Bourassa, Norman

    2005-01-01T23:59:59.000Z

    Conference on Building Commissioning: May 4-6, 2005 Motegi,National Conference on Building Commissioning: May 4-6, 2005Demand Response and Commissioning Mary Ann Piette, David S.

  18. Demand Response Valuation Frameworks Paper

    E-Print Network [OSTI]

    Heffner, Grayson

    2010-01-01T23:59:59.000Z

    12: Market Impacts of Price Responsive Load in PJM and ISO-44 Figure 15: PJM Synchronized Reserve Scheduled MW:particularly those in PJM’s service territory, have begun

  19. Demand response enabling technology development

    E-Print Network [OSTI]

    2006-01-01T23:59:59.000Z

    Monitoring in an Agent-Based Smart Home, Proceedings of theConference on Smart Homes and Health Telematics, September,Smart Meter Motion sensors Figure 1: Schematic of the Demand Response Electrical Appliance Manager in a Home.

  20. Open Automated Demand Response Communications in Demand Response for Wholesale Ancillary Services

    E-Print Network [OSTI]

    Kiliccote, Sila

    2010-01-01T23:59:59.000Z

    A. Barat, D. Watson. 2006 Demand Response Spinning ReserveKueck, and B. Kirby 2008. Demand Response Spinning ReserveReport 2009. Open Automated Demand Response Communications

  1. Demand Response and Open Automated Demand Response Opportunities for Data Centers

    E-Print Network [OSTI]

    Mares, K.C.

    2010-01-01T23:59:59.000Z

    Standardized Automated Demand Response Signals. Presented atand Automated Demand Response in Industrial RefrigeratedActions for Industrial Demand Response in California. LBNL-

  2. Examining Uncertainty in Demand Response Baseline Models and Variability in Automated Response to Dynamic Pricing

    E-Print Network [OSTI]

    Mathieu, Johanna L.

    2012-01-01T23:59:59.000Z

    demand response and energy ef?ciency in commercial buildings,”building control strategies and techniques for demand response,”building electricity use with application to demand response,”

  3. Proteolytic processing of the cellular prion protein ? its importance in health and as a modulator of TSE disease susceptibility in sheep 

    E-Print Network [OSTI]

    Campbell, Lauren Smith

    2014-07-05T23:59:59.000Z

    Expression of the cellular prion protein (PrPC) from the PRNP gene is crucial for the development of a group of fatal neurodegenerative disorders called prion diseases. During prion infection ...

  4. adaptive metabolic response: Topics by E-print Network

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    appear to be the structural manifestation of this cellular metabolic memory. Here, a new framework for molecular information storage in the cell is presented, which is...

  5. The Dose-Response of Vitamin D on Cell Proliferation, Differentiation and Apoptosis in Human Osteosarcoma Cells

    E-Print Network [OSTI]

    Thompson, Lindsey M.

    2009-01-28T23:59:59.000Z

    , 1?,25-dihydroxyvitamin D3 (1,25D), is being increasingly recognized for its anti-cancer properties. The dose-response of 1,25D and 25-hydroxyvitamin D3 (25D) was examined on human osteosarcoma cell lines, SaOS-2 (tumorigenic, p53 null, metastatic... cell lines, SaOS-2 and 143B, were treated with 1,25D, 25D or an ethanol control respectively at concentrations ranging from 1-1000nM. Cellular proliferation was measured after 1,25D or 25D exposure using a cell viability assay (MTS), Ki67...

  6. Mammalian comparative genomics and epigenomics

    E-Print Network [OSTI]

    Mikkelsen, Tarjei Sigurd, 1978-

    2009-01-01T23:59:59.000Z

    The human genome sequence can be thought of as an instruction manual for our species, written and rewritten over more than a billion of years of evolution. Taking a complete inventory of our genome, dissecting its genes ...

  7. Complete Mammalian Proteome Extraction Kit

    E-Print Network [OSTI]

    Lebendiker, Mario

    0800 6931 000 Tel (800) 628-8470 Tel 0115 9430 840 email address for technical inquiries: technical................................................................................................................10 9. Technical Appendix components. Ideally, to avoid protein losses, one would achieve complete sample solubilization in a single

  8. Demand response-enabled residential thermostat controls.

    E-Print Network [OSTI]

    Chen, Xue; Jang, Jaehwi; Auslander, David M.; Peffer, Therese; Arens, Edward A

    2008-01-01T23:59:59.000Z

    human dimension of demand response technology from a caseArens, E. , et al. 2008. Demand Response Enabling TechnologyArens, E. , et al. 2006. Demand Response Enabling Technology

  9. Demand Response as a System Reliability Resource

    E-Print Network [OSTI]

    Joseph, Eto

    2014-01-01T23:59:59.000Z

    Barat, and D. Watson. 2007. Demand Response Spinning ReserveKueck, and B. Kirby. 2009. Demand Response Spinning ReserveFormat of 2009-2011 Demand Response Activity Applications.

  10. National Action Plan on Demand Response

    Broader source: Energy.gov [DOE]

    Presentation—given at the Federal Utility Partnership Working Group (FUPWG) Fall 2008 meeting—discusses the National Assessment of Demand Response study, the National Action Plan for Demand Response, and demand response as related to the energy outlook.

  11. Interdependence of tetrapyrrole metabolism, the generation of oxidative stress and the mitigative oxidative stress response

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Busch, Andrea W.U.; Montgomery, Beronda L.

    2015-04-01T23:59:59.000Z

    Tetrapyrroles are involved in light harvesting and light perception, electron-transfer reactions, and as co-factors for key enzymes and sensory proteins. Under conditions in which cells exhibit stress-induced imbalances of photosynthetic reactions, or light absorption exceeds the ability of the cell to use photoexcitation energy in synthesis reactions, redox imbalance can occur in photosynthetic cells. Such conditions can lead to the generation of reactive oxygen species (ROS) associated with alterations in tetrapyrrole homeostasis. ROS accumulation can result in cellular damage and detrimental effects on organismal fitness, or ROS molecules can serve as signals to induce a protective or damage-mitigating oxidative stressmore »signaling response in cells. Induced oxidative stress responses include tetrapyrrole-dependent and -independent mechanisms for mitigating ROS generation and/or accumulation. Thus, tetrapyrroles can be contributors to oxidative stress, but are also essential in the oxidative stress response to protect cells by contributing to detoxification of ROS. In this review, we highlight the interconnection and interdependence of tetrapyrrole metabolism with the occurrence of oxidative stress and protective oxidative stress signaling responses in photosynthetic organisms.« less

  12. Transcriptional Response of Desulfovibrio vulgaris Hildenborough to Oxidative Stress Mimicking Environmental Conditions

    SciTech Connect (OSTI)

    Pereira, Patricia M.; He, Qiang; Xavier, Antonio V.; Zhou, Jizhong; Pereira, Ines A.C.; Louro, Ricardo O.

    2008-03-12T23:59:59.000Z

    Sulphate-reducing bacteria are anaerobes readily found in oxic-anoxic interfaces. Multiple defence pathways against oxidative conditions were identified in these organisms and proposed to be differentially expressed under different concentrations of oxygen, contributing to their ability to survive oxic conditions. In this study, Desulfovibrio vulgaris Hildenborough cells were exposed to the highest concentration of oxygen that sulphate-reducing bacteria are likely to encounter in natural habitats, and the global transcriptomic response was determined. 307 genes were responsive, with cellular roles in energy metabolism, protein fate, cell envelope and regulatory functions, including multiple genes encoding heat shock proteins, peptidases and proteins with heat shock promoters. Of the oxygen reducing mechanisms of D. vulgaris only the periplasmic hydrogen-dependent mechanism is up-regulated, involving the [NiFeSe]hydrogenase, formate dehydrogenase(s) and the Hmc membrane complex. The oxidative defence response concentrates on damage repair by metal-free enzymes. These data, together with the down regulation of the Fur operon, which restricts the availability of iron, and the lack of response of the PerR operon, suggest that a major effect of this oxygen stress is the inactivation and/or degradation of multiple metalloproteins present in D. vulgaris as a consequence of oxidative damage to their metal clusters.

  13. Coordination of Energy Efficiency and Demand Response

    E-Print Network [OSTI]

    Goldman, Charles

    2010-01-01T23:59:59.000Z

    California Long-term Energy Efficiency Strategic Plan. B-2 Coordination of Energy Efficiency and Demand Response> B-4 Coordination of Energy Efficiency and Demand Response

  14. National Electrical Manufacturers Association (NEMA) Response...

    Energy Savers [EERE]

    Electrical Manufacturers Association (NEMA) Response to Smart Grid RFI National Electrical Manufacturers Association (NEMA) Response to Smart Grid RFI The National Electrical...

  15. Coordination of Energy Efficiency and Demand Response

    E-Print Network [OSTI]

    Goldman, Charles

    2010-01-01T23:59:59.000Z

    demand response: ? Distribution utility ? ISO ? Aggregator (demand response less obstructive and inconvenient for the customer (particularly if DR resources are aggregated by a load aggregator).

  16. Installation and Commissioning Automated Demand Response Systems

    E-Print Network [OSTI]

    Kiliccote, Sila; Global Energy Partners; Pacific Gas and Electric Company

    2008-01-01T23:59:59.000Z

    al: Installation and Commissioning Automated Demand ResponseConference on Building Commissioning: April 22 – 24, 2008al: Installation and Commissioning Automated Demand Response

  17. Hawaiian Electric Company Demand Response Roadmap Project

    E-Print Network [OSTI]

    Levy, Roger

    2014-01-01T23:59:59.000Z

    and best practices to guide HECO demand response developmentbest practices for DR renewable integration – Technically demand responseof best practices. This is partially because demand response

  18. Wireless Demand Response Controls for HVAC Systems

    E-Print Network [OSTI]

    Federspiel, Clifford

    2010-01-01T23:59:59.000Z

    Response Controls for HVAC Systems Clifford Federspiel,tests. Figure 5: Specific HVAC electric power consumptioncontrol, demand response, HVAC, wireless Executive Summary

  19. emergency response assets | National Nuclear Security Administration

    National Nuclear Security Administration (NNSA)

    by the Department of Homeland Security (DHS) and state and local agencies to respond Accident Response Group NNSA's Accident Response Group (ARG) provides technical guidance and...

  20. Sandia National Laboratories: demand response inverter

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    demand response inverter ECIS-Princeton Power Systems, Inc.: Demand Response Inverter On March 19, 2013, in DETL, Distribution Grid Integration, Energy, Energy Surety, Facilities,...

  1. Synthesis and Application of an Environmentally Insensitive Cy3-Based Arsenical Fluorescent Probe to Identify Adaptive Microbial Responses Involving Proximal Dithiol Oxidation

    SciTech Connect (OSTI)

    Fu, Na; Su, Dian; Cort, John R.; Chen, Baowei; Xiong, Yijia; Qian, Weijun; Konopka, Allan; Bigelow, Diana J.; Squier, Thomas C.

    2013-03-06T23:59:59.000Z

    Reversible disulfide oxidation between proximal cysteines in proteins represents a common regulatory control mechanism to modulate flux through metabolic pathways in response to changing environmental conditions. To enable in vivo measurements of cellular redox changes linked to disulfide bond formation, we have synthesized a cell-permeable monosubstituted cyanine dye derivatized with arsenic (i.e., TRAP_Cy3) to trap and visualize dithiols in cytosolic proteins. Alkylation of reactive thiols prior to displacement of the bound TRAP-Cy3 by ethanedithiol permits facile protein capture and mass spectrometric identification of proximal reduced dithiols to the exclusion of individual cysteines. Applying TRAP_Cy3 to evaluate cellular responses to increases in oxygen and light levels in the photosynthetic microbe Synechococcus sp. PCC 7002, we observe large decreases in the abundance of reduced dithiols in cellular proteins, which suggest redox-dependent mechanisms involving the oxidation of proximal disulfides. Under these same growth conditions that result in the oxidation of proximal thiols, there is a reduction in the abundance of post-translational oxidative modifications involving nitrotyrosine and methionine sulfoxide formation. These results suggest that the redox status of proximal cysteines respond to environmental conditions, acting to regulate metabolic flux and minimize the formation of reactive oxygen species to decrease oxidative protein damage.

  2. Wood Fuel Task Force Response 2 | Wood Fuel Task Force Response

    E-Print Network [OSTI]

    Wood Fuel Task Force Response #12;2 | Wood Fuel Task Force Response #12;Wood Fuel Task Force Response | 3 Wood Fuel Task Force Response Scottish Government response by Minister for Environment, Michael Russell I am pleased to present on behalf of the Scottish Government our response to the Wood Fuel

  3. Dipolar response of hydrated proteins

    E-Print Network [OSTI]

    Dmitry V. Matyushov

    2011-08-12T23:59:59.000Z

    The paper presents an analytical theory and numerical simulations of the dipolar response of hydrated proteins. The effective dielectric constant of the solvated protein, representing the average dipole moment induced at the protein by a uniform external field, shows a remarkable variation among the proteins studied by numerical simulations. It changes from 0.5 for ubiquitin to 640 for cytochrome c. The former value implies a negative dipolar susceptibility of ubiquitin, that is a dia-electric dipolar response and negative dielectrophoresis. It means that a protein carrying an average dipole of ~240 D is expected to repel from the region of a stronger electric field. This outcome is the result of a negative cross-correlation between the protein and water dipoles, compensating for the positive variance of the protein dipole in the overall dipolar susceptibility. This phenomenon can be characterized as overscreening of protein's dipole by the hydration shell. In contrast to the neutral ubiquitin, charged proteins studied here show para-electric dipolar response and positive dielectrophoresis. The protein-water dipolar cross-correlations are long-ranged, extending approximately 2 nm from the protein surface into the bulk. The analysis of numerical simulations suggests that the polarization of the protein-water interface is strongly affected by the distribution of the protein surface charge. This component of the protein dipolar response gains in importance for high frequencies, above the protein Debye peak, when the response of the protein dipole becomes dynamically arrested. The interface response found in simulations suggests a possibility of a positive increment of the high-frequency dielectric constant of the solution compared to the dielectric constant of the solvent, in support of the observed THz absorbance of protein solutions.

  4. Position and Velocity Tracking in Cellular Networks Using the Kalman Filter

    SciTech Connect (OSTI)

    Olama, Mohammed M [ORNL; Djouadi, Seddik M [ORNL; Kuruganti, Phani Teja [ORNL

    2009-01-01T23:59:59.000Z

    Access to the right information anytime, anywhere is becoming the new driving force for the information technology revolution. The 'right' information's relevance is based on the user's profile and his/her current geographical position and/or time. Location Based Service (LBS) is an innovative technology that provides information or makes information available based on the geographical location of the mobile user. Analysts predict that LBSs will lead to new applications, generating billions of US dollars worldwide (Leite, 2001; Searle, 2001). The need for an efficient and accurate mobile station (MS) positioning system is growing day by day. The ability to pinpoint the location of an individual has an obvious and vital value in the context of emergency services (Chan, 2003; Olama et al., 2008). Pinpointing the location of people and other valuable assets also opens the door to a new world of previously unimagined information services and m-commerce probabilities. For example, availability of services like 'Where is the nearest ATM?', 'Check traffic conditions on the highway on my route', 'Find a parking lot nearby', as well as answers to 'Where is my advisor?', and 'Where is my car?' will be an everyday rule in our lives (Charalambous & Panayiotou, 2004). A technology independent LBS architecture can be considered as comprised by three main parts (Girodon, 2002): A user requesting information, a mobile network operator and its partners, and several content providers (e.g. data, maps). The subscriber requests a personalized service dependant on his geographic location. The system will ask the Location Services Manager (which is in charge of handling requests, i.e., send/receive to the Location Calculator and the Content Providers) to pinpoint the location of the mobile. The Location Services Manager (LSM), using the Location Calculator, will ask the Content Provider (CP) to supply qualified information according to the mobile's geographical position. The LSM will eventually receive the answer from the CP and send it to the mobile, performing the essential data translations. Fig. 1 outlines the precedent concept. For effective provision of LBS, one has to provide an accurate location, as well as suitable information for users required by the corresponding service, with minimal expenditure. Thus, there are three main technology issues that have to be resolved for LBS: positioning technology, application technology, and location services (Dru & Saada, 2001). A very important technology is of course the positioning technology, the way to find out the location of a mobile device accurately. Due to the unique characteristics of the cellular environment, it is a great challenge to locate the user precisely. However, in many cases, application technology and location services are important consideration of LBS. Application technology manages the geographic information and delivers the customer requests to the appropriate service provider, thus it constitutes the communication system involved. LBS uses the geographic information to provide geographically sensitive information and services. Location-based applications and services are not sensitive to the type of location technology that is used - they merely rely on reasonably accurate geographic coordinates (Chan, 2003). This chapter is structured as follows: In Section 2, we describe the use and applications of LBSs. The current location determination technologies and standards are presented in Section 3. In Section 4 we describe the mathematical models used for the location and velocity estimation algorithms. An initial attempt for MS location estimation via received signal level using the maximum likelihood estimation (MLE) approach and triangulation is presented in Sections 5. Since the former approach lacks acceptable accuracy for demanding services as numerical results reveal, the extended Kalman filter (EKF) approach, which is the main topic in this chapter, is introduced in Sections 6. In Section 7 we present numerical results. Section 8 provides concluding remarks.

  5. Opportunities, Barriers and Actions for Industrial Demand Response in California

    E-Print Network [OSTI]

    McKane, Aimee T.

    2009-01-01T23:59:59.000Z

    and Techniques for Demand Response, report for theand Reliability Demand Response Programs: Final Report.Demand Response

  6. Automated Demand Response Opportunities in Wastewater Treatment Facilities

    E-Print Network [OSTI]

    Thompson, Lisa

    2008-01-01T23:59:59.000Z

    Interoperable Automated Demand Response Infrastructure,study of automated demand response in wastewater treatmentopportunities for demand response control strategies in

  7. Northwest Open Automated Demand Response Technology Demonstration Project

    E-Print Network [OSTI]

    Kiliccote, Sila

    2010-01-01T23:59:59.000Z

    Report 2009. Open Automated Demand Response Communicationsand Techniques for Demand Response. California Energyand S. Kiliccote. Estimating Demand Response Load Impacts:

  8. Response

    Office of Environmental Management (EM)

    year) to unify national lab efforts around a single high-impact technical problem of additive manufacturing and to coordinate that effort with industry and other governmental...

  9. Demand Response Programs for Oregon

    E-Print Network [OSTI]

    wholesale prices and looming shortages in Western power markets in 2000-01, Portland General Electric programs for large customers remain, though they are not active at current wholesale prices. Other programs demand response for the wholesale market -- by passing through real-time prices for usage above a set

  10. Presidential responsiveness to public opinion

    E-Print Network [OSTI]

    Vaughn, Justin Scott

    2009-05-15T23:59:59.000Z

    the project markedly, and Dr. Paul Kellstedt patiently indulged my persistent questions about elementary aspects of time-series analysis and the nuances of the public mood measure. Kurt Ritter, Ed Portis and Cary Nederman also demonstrated generous amounts... PRESIDENCY ................71 Presidential-Congressional Action: A Literature Review ..............71 Presidential Responsiveness and Congressional Roll Call Votes...75 Data...

  11. Designated Responsible Authority (DRA) Training

    E-Print Network [OSTI]

    Minnesota, University of

    · The role of Designated Responsible Authority (DRA) is defined in the Using Vehicles for University Business policy. · The head of each University department with permanently assigned vehicles must appoint. Be familiar with the policies and related documents governing the use of University vehicles, and direct

  12. Sam Swift is responsible for

    E-Print Network [OSTI]

    Trinkle-Mulcahy, Laura

    Sam Swift is responsible for managing the Light Micro- scopy Facility in the University of Dundee dimen- sional images (in x and y), or optical sections, are acquired at regular focus intervals dimensional object (see Figure 1). ArticleArticle Figure 1. Imaging in 3 dimensions ­ a stack of images

  13. The unfolded-protein-response

    E-Print Network [OSTI]

    Walter, Peter

    proteins in the ER. At the restrictive temperature, see53mutants lack phosphomannomutaseThe unfolded- protein-response pathway in yeast The accumulation of unfolded proteins in the endoplasmic reticulum (ER) triggers the increased production of several ER- resident proteins. This signalling

  14. Assessment of Demand Response and Advanced Metering

    E-Print Network [OSTI]

    Tesfatsion, Leigh

    #12;#12;2008 Assessment of Demand Response and Advanced Metering Staff Report Federal Energy metering penetration and potential peak load reduction from demand response have increased since 2006. Significant activity to promote demand response or to remove barriers to demand response occurred at the state

  15. LOCH: Open Access Implementation Responsibility Matrix 

    E-Print Network [OSTI]

    Krzak, Anna

    2015-02-05T23:59:59.000Z

    Draft Responsibility Matrix for College of Medicine and Veterinary Medicine for REF Open Access requirements implementation.

  16. Overexpression of HDAC1 induces cellular senescence by Sp1/PP2A/pRb pathway

    SciTech Connect (OSTI)

    Chuang, Jian-Ying [Department of Pharmacology, National Cheng-Kung University, Tainan 701, Taiwan (China)] [Department of Pharmacology, National Cheng-Kung University, Tainan 701, Taiwan (China); Hung, Jan-Jong, E-mail: petehung@mail.ncku.edu.tw [Department of Pharmacology, National Cheng-Kung University, Tainan 701, Taiwan (China) [Department of Pharmacology, National Cheng-Kung University, Tainan 701, Taiwan (China); Institute of Bioinformatics and Biosignal Transduction, National Cheng-Kung University, Tainan 701, Taiwan (China)

    2011-04-15T23:59:59.000Z

    Highlights: {yields} Overexpression of HDAC1 induces Sp1 deacetylation and raises Sp1/p300 complex formation to bind to PP2Ac promoter. {yields} Overexpression of HDAC1 strongly inhibits the phosphorylation of pRb through up-regulation of PP2A. {yields} Overexpressed HDAC1 restrains cell proliferaction and induces cell senescence though a novel Sp1/PP2A/pRb pathway. -- Abstract: Senescence is associated with decreased activities of DNA replication, protein synthesis, and cellular division, which can result in deterioration of cellular functions. Herein, we report that the growth and division of tumor cells were significantly repressed by overexpression of histone deacetylase (HDAC) 1 with the Tet-off induced system or transient transfection. In addition, HDAC1 overexpression led to senescence through both an accumulation of hypophosphorylated active retinoblastoma protein (pRb) and an increase in the protein level of protein phosphatase 2A catalytic subunit (PP2Ac). HDAC1 overexpression also increased the level of Sp1 deacetylation and elevated the interaction between Sp1 and p300, and subsequently that Sp1/p300 complex bound to the promoter of PP2Ac, thus leading to induction of PP2Ac expression. Similar results were obtained in the HDAC1-Tet-off stable clone. Taken together, these results indicate that HDAC1 overexpression restrained cell proliferation and induced premature senescence in cervical cancer cells through a novel Sp1/PP2A/pRb pathway.

  17. Addressing Energy Demand through Demand Response: International Experiences and Practices

    E-Print Network [OSTI]

    Shen, Bo

    2013-01-01T23:59:59.000Z

    of integrating demand response and energy efficiencyand D. Kathan (2009), Demand Response in U.S. ElectricityFRAMEWORKS THAT PROMOTE DEMAND RESPONSE 3.1. Demand Response

  18. MicroSCALE Screening Reveals Genetic Modifiers of Therapeutic Response in Melanoma

    E-Print Network [OSTI]

    Sabatini, David M.

    Cell microarrays are a promising tool for performing large-scale functional genomic screening in mammalian cells at reasonable cost, but owing to technical limitations they have been restricted for use with a narrow range ...

  19. The effects of emotional responsiveness in marriage

    E-Print Network [OSTI]

    Hass, Sally Duffin

    1987-01-01T23:59:59.000Z

    responsiveness on the quality of the marital interaction. Two kinds of mnotional responsiveness were evaluated: ezmtional linkage and asyzamtry in responsiveness. In terzm of exmtional linkage, it was proposed that being too emotionally linked may... be as dysfunctional for the relationship as those relationships low in ezmtional linkage. The second hypothesis involved an asyzmetry in emotional responsiveness: those couples in which one spouse is nnre responsive than the other spouse will display more...

  20. Functional gene screening in embryonic stem cell implicates Wnt antagonism in neural differentiation. 

    E-Print Network [OSTI]

    Aubert, Jerome; Dunstan, Hannah; Chambers, Ian; Smith, Austin G

    2002-01-01T23:59:59.000Z

    The multilineage differentiation capacity of mouse embryonic stem (ES) cells offers a potential testing platform for gene products that mediate mammalian lineage determination and cellular specialization. Identification ...

  1. Spatial and Temporal Measurements of Temperature and Cell Viability in Response to Nanoparticle Mediated Photothermal Therapy

    SciTech Connect (OSTI)

    Whitney, Jon R [ORNL; Rodgers, Amanda [Virginia Polytechnic Institute and State University; Harvie, Erica [Virginia Polytechnic Institute and State University; Carswell, William [Virginia Polytechnic Institute and State University; Torti, Suzy [Wake Forest University, Winston-Salem; Puretzky, Alexander A [ORNL; Rouleau, Christopher M [ORNL; Geohegan, David B [ORNL; Rylander, Christopher [Virginia Polytechnic Institute and State University; Rylander, Nichole M [Virginia Polytechnic Institute and State University

    2012-01-01T23:59:59.000Z

    Aim: Nanoparticle enhanced photothermal therapy is a promising alternative to tumor resection. However, quantitative measurements of cellular response to these treatments are limited. This paper introduces a Bimodal Enhanced Analysis of Spatiotemporal Temperature (BEAST) algorithm to rapidly determine the viability of cancer cells in vitro following photothermal therapy alone or in combination with nanoparticles. Materials & Methods: To illustrate the capability of the BEAST viability algorithm, single wall carbon nanohorns were added to renal cancer (RENCA) cells in vitro and time-dependent spatial temperature maps measured with an infrared camera during laser therapy were correlated with post-treatment cell viability distribution maps obtained by cell-staining fluorescent microscopy. Conclusion: The BEAST viability algorithm accurately and rapidly determined the cell viability as function of time, space, and temperature.

  2. Spinning Reserve From Responsive Loads

    SciTech Connect (OSTI)

    Kirby, B.J.

    2003-04-08T23:59:59.000Z

    Responsive load is the most underutilized reliability resource available to the power system today. It is currently not used at all to provide spinning reserve. Historically there were good reasons for this, but recent technological advances in communications and controls have provided new capabilities and eliminated many of the old obstacles. North American Electric Reliability Council (NERC), Federal Energy Regulatory Commission (FERC), Northeast Power Coordinating Council (NPCC), New York State Reliability Council (NYSRC), and New York Independent System Operator (NYISO) rules are beginning to recognize these changes and are starting to encourage responsive load provision of reliability services. The Carrier ComfortChoice responsive thermostats provide an example of these technological advances. This is a technology aimed at reducing summer peak demand through central control of residential and small commercial air-conditioning loads. It is being utilized by Long Island Power Authority (LIPA), Consolidated Edison (ConEd), Southern California Edison (SCE), and San Diego Gas and Electric (SDG&E). The technology is capable of delivering even greater response in the faster spinning reserve time frame (while still providing peak reduction). Analysis of demand reduction testing results from LIPA during the summer of 2002 provides evidence to back up this claim. It also demonstrates that loads are different from generators and that the conventional wisdom, which advocates for starting with large loads as better ancillary service providers, is flawed. The tempting approach of incrementally adapting ancillary service requirements, which were established when generators were the only available resources, will not work. While it is easier for most generators to provide replacement power and non-spinning reserve (the slower response services) than it is to supply spinning reserve (the fastest service), the opposite is true for many loads. Also, there is more financial reward for supplying spinning reserve than for supplying the other reserve services as a result of the higher spinning reserve prices. The LIPAedge program (LIPA's demand reduction program using Carrier ComfortChoice thermostats) provides an opportunity to test the use of responsive load for spinning reserve. With potentially 75 MW of spinning reserve capability already installed, this test program can also make an important contribution to the capacity needs of Long Island during the summer of 2003. Testing could also be done at ConEd ({approx}30 MW), SCE ({approx}15 MW), and/or SDG&E ({approx}15 MW). This paper is divided into six chapters. Chapter 2 discusses the contingency reserve ancillary services, their functions in supporting power system reliability, and their technical requirements. It also discusses the policy and tariff requirements and attempts to distinguish between ones that are genuinely necessary and ones that are artifacts of the technologies that were historically used to provide the services. Chapter 3 discusses how responsive load could provide contingency reserves (especially spinning reserve) for the power system. Chapter 4 specifically discusses the Carrier ComfortChoice responsive thermostat technology, the LIPAedge experience with that technology, and how the technology could be used to supply spinning reserve. Chapter 5 discusses a number of unresolved issues and suggests areas for further research. Chapter 6 offers conclusions and recommendations.

  3. Demand Response Spinning Reserve Demonstration

    SciTech Connect (OSTI)

    Eto, Joseph H.; Nelson-Hoffman, Janine; Torres, Carlos; Hirth,Scott; Yinger, Bob; Kueck, John; Kirby, Brendan; Bernier, Clark; Wright,Roger; Barat, A.; Watson, David S.

    2007-05-01T23:59:59.000Z

    The Demand Response Spinning Reserve project is a pioneeringdemonstration of how existing utility load-management assets can providean important electricity system reliability resource known as spinningreserve. Using aggregated demand-side resources to provide spinningreserve will give grid operators at the California Independent SystemOperator (CAISO) and Southern California Edison (SCE) a powerful, newtool to improve system reliability, prevent rolling blackouts, and lowersystem operating costs.

  4. Thermomechanical response of WIPP repositories

    SciTech Connect (OSTI)

    Maxwell, D.E.; Wahi, K.K.; Dial, B.

    1980-05-01T23:59:59.000Z

    Coarsely zoned STEALTH 2D calculations were used to investigate two candidate WIPP repositories. The grid was designed for one hundred thousand years of response with modest computing costs. As a result, the early time mechanical response was compromised by non-real oscillations that could not be damped completely before a few thousand years. In spite of these oscillations, it was possible to see that the dominant effects of stress and strain peaked between one and two thousand years, at the time of maximum heat in the site. This time corresponded to the condition that the surface heat loss rate balanced the heat generation rate. Though the creep strains were quite small, a large volume of salt was involved and the effects were significant. The peak surface uplift of 75HLW was increased by about 25% due to creep. However, the deviatoric stress relaxation due to creep produced large changes in the stress fields. The Rustler layer survived reasonable failure criterion for the 75HLW case with creep, and failed both in tension and shear, according to these same criterion, when the calculation was repeated without creep. The deviatoric stress fields, with and without salt creep, concentrated near the repository as expected and also in the Rustler layer due to its relatively high Young's modulus compared to the neighboring layers. Since the time of interest is so much smaller than the 100,000 years this calculation was designed to examine, it is possible to model the WIPP stratigraphy in much more detail and still be able to calculate the response for the time of interest. A finer zoned calculation of the response of the WIPP stratigraphy to a repository similar to the 75 K watt/acre repository is modeled in this report. In this calculation the Rustler formation is modeled as a five layered formation using material properties derived from data taken at the Nome site.

  5. Multipath Probabilistic Early Response TCP

    E-Print Network [OSTI]

    Singh, Ankit

    2012-10-19T23:59:59.000Z

    : Chair of Committee, A. L. Narasimha Reddy Committee Members, Riccardo Bettati Srinivas Shakottai Head of Department, Costas N. Georghiades August 2012 Major Subject: Computer Engineering iii ABSTRACT Multipath Probabilistic Early Response TCP.... (August 2012) Ankit Singh, B.Tech., Indian Institute of Technology, Guwahati Chair of Advisory Committee: Dr. A. L. Narasimha Reddy Many computers and devices such as smart phones, laptops and tablet devices are now equipped with multiple network...

  6. Commercial & Industrial Demand Response

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645U.S. DOEThe Bonneville Power Administration would like submit the following comments response NAESB

  7. Systems Biology Model of Interactions Between Tissue Growth Factors and DNA Damage Pathways: Low Dose Response and Cross-Talk in TGFbeta and ATM Signaling

    SciTech Connect (OSTI)

    O'Neill, Peter [University of Oxford; Anderson, Jennifer [University of Oxford

    2014-10-02T23:59:59.000Z

    The etiology of radiation carcinogenesis has been described in terms of aberrant changes that span several levels of biological organization. Growth factors regulate many important cellular and tissue functions including apoptosis, differentiation and proliferation. A variety of genetic and epigenetic changes of growth factors have been shown to contribute to cancer initiation and progression. It is known that cellular and tissue damage to ionizing radiation is in part initiated by the production of reactive oxygen species, which can activate cytokine signaling, and the DNA damage response pathways, most notably the ATM signaling pathway. Recently the transforming growth factor ? (TGF?) pathway has been shown to regulate or directly interact with the ATM pathway in the response to radiation. The relevance of this interaction with the ATM pathway is not known although p53 becomes phosphorylated and DNA damage responses are involved. However, growth factor interactions with DNA damage responses have not been elucidated particularly at low doses and further characterization of their relationship to cancer processes is warranted. Our goal will be to use a systems biology approach to mathematically and experimentally describe the low dose responses and cross-talk between the ATM and TGF? pathways initiated by low and high LET radiation. We will characterize ATM and TGF? signaling in epithelial and fibroblast cells using 2D models and ultimately extending to 3D organotypic cell culture models to begin to elucidate possible differences that may occur for different cell types and/or inter-cellular communication. We will investigate the roles of the Smad and Activating transcription factor 2 (ATF2) proteins as the potential major contributors to cross- talk between the TGF? and ATM pathways, and links to cell cycle control and/or the DNA damage response, and potential differences in their responses at low and high doses. We have developed various experimental approaches to apply to these problems using confocal microscopy and flow cytometry to detail changes at low dose/dose-rate in order to understand individual cell responses, and will establish our mathematical models based on the experimental findings resulting from changes in DNA repair, apoptosis and proliferation.

  8. Solar mechanics thermal response capabilities.

    SciTech Connect (OSTI)

    Dobranich, Dean D.

    2009-07-01T23:59:59.000Z

    In many applications, the thermal response of structures exposed to solar heat loads is of interest. Solar mechanics governing equations were developed and integrated with the Calore thermal response code via user subroutines to provide this computational simulation capability. Solar heat loads are estimated based on the latitude and day of the year. Vector algebra is used to determine the solar loading on each face of a finite element model based on its orientation relative to the sun as the earth rotates. Atmospheric attenuation is accounted for as the optical path length varies from sunrise to sunset. Both direct and diffuse components of solar flux are calculated. In addition, shadowing of structures by other structures can be accounted for. User subroutines were also developed to provide convective and radiative boundary conditions for the diurnal variations in air temperature and effective sky temperature. These temperature boundary conditions are based on available local weather data and depend on latitude and day of the year, consistent with the solar mechanics formulation. These user subroutines, coupled with the Calore three-dimensional thermal response code, provide a complete package for addressing complex thermal problems involving solar heating. The governing equations are documented in sufficient detail to facilitate implementation into other heat transfer codes. Suggestions for improvements to the approach are offered.

  9. Method for improving instrument response

    DOE Patents [OSTI]

    Hahn, David W. (7528 Oxford Cir., Dublin, Alameda County, CA 94568); Hencken, Kenneth R. (2665 Calle Alegre, Pleasanton, Alameda County, CA 94566); Johnsen, Howard A. (5443 Celeste Ave., Livermore, Alameda County, CA 94550); Flower, William L. (5447 Theresa Way, Livermore, Alameda County, CA 94550)

    2000-01-01T23:59:59.000Z

    This invention pertains generally to a method for improving the accuracy of particle analysis under conditions of discrete particle loading and particularly to a method for improving signal-to-noise ratio and instrument response in laser spark spectroscopic analysis of particulate emissions. Under conditions of low particle density loading (particles/m.sup.3) resulting from low overall metal concentrations and/or large particle size uniform sampling can not be guaranteed. The present invention discloses a technique for separating laser sparks that arise from sample particles from those that do not; that is, a process for systematically "gating" the instrument response arising from "sampled" particles from those responses which do not, is dislosed as a solution to his problem. The disclosed approach is based on random sampling combined with a conditional analysis of each pulse. A threshold value is determined for the ratio of the intensity of a spectral line for a given element to a baseline region. If the threshold value is exceeded, the pulse is classified as a "hit" and that data is collected and an average spectrum is generated from an arithmetic average of "hits". The true metal concentration is determined from the averaged spectrum.

  10. STRAP regulates c-Jun ubiquitin-mediated proteolysis and cellular proliferation

    SciTech Connect (OSTI)

    Reiner, Jennifer [Department of Cancer Biology, Vanderbilt University, School of Medicine, Nashville, TN (United States)] [Department of Cancer Biology, Vanderbilt University, School of Medicine, Nashville, TN (United States); Ye, Fei [Department of Biostatistics, Vanderbilt University, School of Medicine, Nashville, TN (United States)] [Department of Biostatistics, Vanderbilt University, School of Medicine, Nashville, TN (United States); Kashikar, Nilesh D. [Department of Cancer Biology, Vanderbilt University, School of Medicine, Nashville, TN (United States)] [Department of Cancer Biology, Vanderbilt University, School of Medicine, Nashville, TN (United States); Datta, Pran K., E-mail: pran.datta@vanderbilt.edu [Department of Cancer Biology, Vanderbilt University, School of Medicine, Nashville, TN (United States); Department of Surgery, Vanderbilt University, School of Medicine, Nashville, TN (United States)

    2011-04-08T23:59:59.000Z

    Highlights: {yields} STRAP is specifically correlated with c-Jun expression and activation in fibroblasts. {yields} STRAP inhibits c-Jun ubiquitylation in vivo and prolongs the half-life of c-Jun. {yields} STRAP expression increases expression of the AP-1 target gene, cyclin D1, and promotes cell autonomous growth. -- Abstract: STRAP is a ubiquitous WD40 protein that has been implicated in tumorigenesis. Previous studies suggest that STRAP imparts oncogenic characteristics to cells by promoting ERK and pRb phosphorylation. While these findings suggest that STRAP can activate mitogenic signaling pathways, the effects of STRAP on other MAPK pathways have not been investigated. Herein, we report that STRAP regulates the expression of the c-Jun proto-oncogene in mouse embryonic fibroblasts. Loss of STRAP expression results in reduced phospho-c-Jun and total c-Jun but does not significantly reduce the level of two other early response genes, c-Myc and c-Fos. STRAP knockout also decreases expression of the AP-1 target gene, cyclin D1, which is accompanied by a reduction in cell growth. No significant differences in JNK activity or basal c-Jun mRNA levels were observed between wild type and STRAP null fibroblasts. However, proteasomal inhibition markedly increases c-Jun expression in STRAP knockout MEFs and STRAP over-expression decreases the ubiquitylation of c-Jun in 293T cells. Loss of STRAP accelerates c-Jun turnover in fibroblasts and ectopic over-expression of STRAP in STRAP null fibroblasts increases c-Jun expression. Collectively, our findings indicate that STRAP regulates c-Jun stability by decreasing the ubiquitylation and proteosomal degradation of c-Jun.

  11. Cation trapping by cellular acidic compartments: Beyond the concept of lysosomotropic drugs

    SciTech Connect (OSTI)

    Marceau, François, E-mail: francois.marceau@crchul.ulaval.ca [Centre de recherche en rhumatologie et immunologie, Centre Hospitalier Universitaire de Québec, Québec QC, Canada G1V 4G2 (Canada)] [Centre de recherche en rhumatologie et immunologie, Centre Hospitalier Universitaire de Québec, Québec QC, Canada G1V 4G2 (Canada); Bawolak, Marie-Thérèse [Centre de recherche en rhumatologie et immunologie, Centre Hospitalier Universitaire de Québec, Québec QC, Canada G1V 4G2 (Canada)] [Centre de recherche en rhumatologie et immunologie, Centre Hospitalier Universitaire de Québec, Québec QC, Canada G1V 4G2 (Canada); Lodge, Robert [Centre de recherche en infectiologie, Centre Hospitalier Universitaire de Québec, Québec QC, Canada G1V 4G2 (Canada)] [Centre de recherche en infectiologie, Centre Hospitalier Universitaire de Québec, Québec QC, Canada G1V 4G2 (Canada); Bouthillier, Johanne; Gagné-Henley, Angélique [Centre de recherche en rhumatologie et immunologie, Centre Hospitalier Universitaire de Québec, Québec QC, Canada G1V 4G2 (Canada)] [Centre de recherche en rhumatologie et immunologie, Centre Hospitalier Universitaire de Québec, Québec QC, Canada G1V 4G2 (Canada); Gaudreault, René C. [Unité des Biotechnologies et de Bioingénierie, Centre Hospitalier Universitaire de Québec, Québec QC, Canada G1L 3L5 (Canada)] [Unité des Biotechnologies et de Bioingénierie, Centre Hospitalier Universitaire de Québec, Québec QC, Canada G1L 3L5 (Canada); Morissette, Guillaume [Centre de recherche en rhumatologie et immunologie, Centre Hospitalier Universitaire de Québec, Québec QC, Canada G1V 4G2 (Canada)] [Centre de recherche en rhumatologie et immunologie, Centre Hospitalier Universitaire de Québec, Québec QC, Canada G1V 4G2 (Canada)

    2012-02-15T23:59:59.000Z

    “Lysosomotropic” cationic drugs are known to concentrate in acidic cell compartments due to low retro-diffusion of the protonated molecule (ion trapping); they draw water by an osmotic mechanism, leading to a vacuolar response. Several aspects of this phenomenon were recently reexamined. (1) The proton pump vacuolar (V)-ATPase is the driving force of cationic drug uptake and ensuing vacuolization. In quantitative transport experiments, V-ATPase inhibitors, such as bafilomycin A1, greatly reduced the uptake of cationic drugs and released them in preloaded cells. (2) Pigmented or fluorescent amines are effectively present in a concentrated form in the large vacuoles. (3) Consistent with V-ATPase expression in trans-Golgi, lysosomes and endosomes, a fraction of the vacuoles is consistently labeled with trans-Golgi markers and protein secretion and endocytosis are often inhibited in vacuolar cells. (4) Macroautophagic signaling (accumulation of lipidated and membrane-bound LC3 II) and labeling of the large vacuoles by the autophagy effector LC3 were consistently observed in cells, precisely at incubation periods and amine concentrations that cause vacuolization. Vacuoles also exhibit late endosome/lysosome markers, because they may originate from such organelles or because macroautophagosomes fuse with lysosomes. Autophagosome persistence is likely due to the lack of resolution of autophagy, rather than to nutritional deprivation. (5) Increased lipophilicity decreases the threshold concentration for the vacuolar and autophagic cytopathology, because simple diffusion into cells is limiting. (6) A still unexplained mitotic arrest is consistently observed in cells loaded with amines. An extended recognition of relevant clinical situations is proposed for local or systemic drug administration.

  12. Microbial Protein-Protein Interactions (MiPPI) Data from the Genomics: GTL Center for Molecular and Cellular Systems (CMCS)

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    The Genomic Science Center for Molecular and Cellular Systems (CMCS), established in 2002, seeks to identify and characterize the complete set of protein complexes within a cell to provide a mechanistic basis for the understanding of biochemical functions. The CMCS is anchored at ORNL and PNNL. CMCS initially focused on the identification and characterization of protein complexes in two microbial systems,Rhodopseudomonas palustris (R. palustris) and Shewanella oneidensis (S. oneidensis). These two organisms have also been the focus of major DOE Genomic Science/Microbial Cell Program (MCP) projects. To develop an approach for identifying the diverse types of complexes present in microbial organisms, CMCS incorporates a number of molecular biology, microbiology, analytical and computational tools in an integrated pipeline.

  13. Systems biology analysis of Zymomonas mobilis ZM4 ethanol stress responses

    SciTech Connect (OSTI)

    Yang, Shihui [ORNL; Pan, Chongle [ORNL; Tschaplinski, Timothy J [ORNL; Hurst, Gregory {Greg} B [ORNL; Engle, Nancy L [ORNL; Zhou, Wen [University of Georgia, Athens, GA; Dam, Phuongan [ORNL; Xu, Ying [University of Georgia, Athens, GA; Dice, Lezlee T [ORNL; Davison, Brian H [ORNL; Brown, Steven D [ORNL

    2013-01-01T23:59:59.000Z

    Zymomonas mobilis ZM4 is a capable ethanogenic bacterium with high ethanol productivity and high level of ethanol tolerance. Previous studies indicated that several stress-related proteins and changes in the ZM4 membrane lipid composition may contribute to ethanol tolerance. However, the molecular mechanisms of ethanol stress response have not been elucidated fully. In this study, ethanol stress responses were investigated using systems biology tools. Medium supplementation with an initial 47.3 g/L (6% v/v) ethanol reduced Z. mobilis ZM4 glucose consumption, growth rate and ethanol productivity compared to that of untreated controls. Metabolomic profiling showed that ethanol-treated ZM4 cells accumulated greater amounts of glycerol during the entire fermentation process, which may indicate an important role for this metabolite. A proteomic analysis of early exponential growth identified about one thousand proteins, or approximately 56% of the predicted ZM4 proteome. Proteins related to metabolism and stress response such as chaperones and key regulators were more abundant in the early ethanol stress condition. Transcriptomic studies indicated the response of ZM4 to ethanol is dynamic, complex and involves many genes from all the different functional categories. There were fewer genes significantly differentially expressed in the exponential phase compared to that of stationary phase and early stationary phase. Most down-regulated genes were related to translation and ribosome biogenesis, while the ethanol-upregulated genes were mostly related to cellular processes and metabolism. Correlations among the transcriptomics, proteomics and metabolism were examined and among significantly expressed genes or proteins, we observe higher correlation coefficients when fold-change values are higher. This systems biology study elucidates key Z. mobilis ZM4 metabolites, genes and proteins that form the foundation of its distinctive physiology and its multifaceted response to ethanol stress.

  14. Response Predicting LTCC Firing Shrinkage: A Response Surface Analysis Study

    SciTech Connect (OSTI)

    Girardi, Michael; Barner, Gregg; Lopez, Cristie; Duncan, Brent; Zawicki, Larry

    2009-02-25T23:59:59.000Z

    The Low Temperature Cofired Ceramic (LTCC) technology is used in a variety of applications including military/space electronics, wireless communication, MEMS, medical and automotive electronics. The use of LTCC is growing due to the low cost of investment, short development time, good electrical and mechanical properties, high reliability, and flexibility in design integration (3 dimensional (3D) microstructures with cavities are possible)). The dimensional accuracy of the resulting x/y shrinkage of LTCC substrates is responsible for component assembly problems with the tolerance effect that increases in relation to the substrate size. Response Surface Analysis was used to predict product shrinkage based on specific process inputs (metal loading, layer count, lamination pressure, and tape thickness) with the ultimate goal to optimize manufacturing outputs (NC files, stencils, and screens) in achieving the final product design the first time. Three (3) regression models were developed for the DuPont 951 tape system with DuPont 5734 gold metallization based on green tape thickness.

  15. Regulation of mTOR complex 1 in response to growth factors and nutrients

    E-Print Network [OSTI]

    Sancak, Yasemin S. (Yasemin Shechner)

    2010-01-01T23:59:59.000Z

    In multicellular organisms, cells ensure the simultaneous availability of growth factors and nutrients before they invest in cellular processes that lead to growth. The TOR kinase is a master regulator of cellular growth ...

  16. Open Automated Demand Response Communications in Demand Response for Wholesale Ancillary Services

    E-Print Network [OSTI]

    Kiliccote, Sila

    2010-01-01T23:59:59.000Z

    in Demand Response for Wholesale Ancillary Services Silain Demand Response for Wholesale Ancillary Services Silasuccessfully in the wholesale non- spinning ancillary

  17. Recognizing and Assigning ESPC Risks and Responsibilities Using the Risk, Responsibility, and Performance Matrix

    Broader source: Energy.gov [DOE]

    Document offers guidance on how to recognize and assign energy savings performance contract (ESPC) risks and responsibilities using the risk, responsibility, and performance matrix, also known as RRPM.

  18. Safety Management Functions, Responsibilities, and Authorities Manual

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2003-12-31T23:59:59.000Z

    This Manual defines safety management functions, responsibilities, and authorities for DOE senior management with responsibilities for line, support, oversight, and enforcement actions. Cancels DOE M 411.1-1B. Canceled by DOE O 450.2.

  19. Safety Management Functions, Responsibilities, and Authorities Manual

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1997-10-08T23:59:59.000Z

    This Manual defines safety management functions, responsibilities, and authorities for DOE senior management with responsibilities for line, support, oversight, and enforcement actions. Canceled by DOE M 411.1-1A. Does not cancel other directives.

  20. Subject Responses to Electrochromic Windows

    SciTech Connect (OSTI)

    Clear, Robert; Inkarojrit, Vorapat; Lee, Eleanor

    2006-03-03T23:59:59.000Z

    Forty-three subjects worked in a private office with switchable electrochromic windows, manually-operated Venetian blinds, and dimmable fluorescent lights. The electrochromic window had a visible transmittance range of approximately 3-60%. Analysis of subject responses and physical data collected during the work sessions showed that the electrochromic windows reduced the incidence of glare compared to working under a fixed transmittance (60%) condition. Subjects used the Venetian blinds less often and preferred the variable transmittance condition, but used slightly more electric lighting with it than they did when window transmittance was fixed.

  1. Balancing oil and environment... responsibly.

    SciTech Connect (OSTI)

    Weimer, Walter C.; Teske, Lisa

    2007-01-25T23:59:59.000Z

    Balancing Oil and Environment…Responsibly As the price of oil continues to skyrocket and global oil production nears the brink, pursuing unconventional oil supplies, such as oil shale, oil sands, heavy oils, and oils from biomass and coal has become increasingly attractive. Of particular significance to the American way is that our continent has significant quantities of these resources. Tapping into these new resources, however, requires cutting-edge technologies for identification, production, processing and environmental management. This job needs a super hero or two for a job of this size and proportion…

  2. Response (6/14/2010)

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National5Sales for4,645 3,625 1,006 492 742 33Frequently AskedEnergy Small TeamNOTDeliveryDepartment|PresentationsRespondResponse SEAB4,2010

  3. Hawaiian Electric Company Demand Response Roadmap Project

    E-Print Network [OSTI]

    Levy, Roger

    2014-01-01T23:59:59.000Z

    renewable integration capability. Coordinating and integrating HECO and Hawaii Energy demand response related activities has the potential

  4. THE STATE OF DEMAND RESPONSE IN CALIFORNIA

    E-Print Network [OSTI]

    THE STATE OF DEMAND RESPONSE IN CALIFORNIA Prepared For: California Energy in this report. #12; ABSTRACT By reducing system loads during criticalpeak times, demand response (DR) can.S. and internationally and lay out ideas that could help move California forward. KEY WORDS demand response, peak

  5. THE STATE OF DEMAND RESPONSE IN CALIFORNIA

    E-Print Network [OSTI]

    THE STATE OF DEMAND RESPONSE IN CALIFORNIA Prepared For: California Energy in this report. #12; ABSTRACT By reducing system loads during criticalpeak times, demand response can help reduce the threat of planned rotational outages. Demand response is also widely regarded as having

  6. Demand Response Resources in Pacific Northwest

    E-Print Network [OSTI]

    Demand Response Resources in Pacific Northwest Chuck Goldman Lawrence Berkeley National Laboratory cagoldman@lbl.gov Pacific Northwest Demand Response Project Portland OR May 2, 2007 #12;Overview · Typology Annual Reports ­ Journal articles/Technical reports #12;Demand Response Resources · Incentive

  7. Barrier Immune Radio Communications for Demand Response

    E-Print Network [OSTI]

    LBNL-2294E Barrier Immune Radio Communications for Demand Response F. Rubinstein, G. Ghatikar, J Ann Piette of Lawrence Berkeley National Laboratory's (LBNL) Demand Response Research Center (DRRC and Environment's (CIEE) Demand Response Emerging Technologies Development (DRETD) Program, under Work for Others

  8. Demand Response and Ancillary Services September 2008

    E-Print Network [OSTI]

    Demand Response and Ancillary Services September 2008 #12;© 2008 EnerNOC, Inc. All Rights Reserved programs The purpose of this presentation is to offer insight into the mechanics of demand response and industrial demand response resources across North America in both regulated and restructured markets As of 6

  9. Demand Responsive Lighting: A Scoping Study

    E-Print Network [OSTI]

    LBNL-62226 Demand Responsive Lighting: A Scoping Study F. Rubinstein, S. Kiliccote Energy Environmental Technologies Division January 2007 #12;LBNL-62226 Demand Responsive Lighting: A Scoping Study in this report was coordinated by the Demand Response Research Center and funded by the California Energy

  10. [Anna Tien] Zebrafish Stress Responses to

    E-Print Network [OSTI]

    Kalueff, Allan V.

    response is displayed by many fish species. Alarm pheromone is also known as antipredator behavior in triggering the alarm pheromone responses. When a fish is injured, it releases a substance producing specific avoidance responses in zebrafish. Alarm pheromone is important to fish because when one fish releases

  11. GPU-based Responsive Grass Orthmann Jens

    E-Print Network [OSTI]

    Blanz, Volker

    takes dynamic en- vironments one step further by integrating responsive real-time simulation of ground. The collision detection with dynamic scene objects, the response and the re- covering are directly simulated simulation is given, followed by a overview of the responsive grass system in Section 3. Section 4 proposes

  12. Climate Engineering Responses to Climate Emergencies

    E-Print Network [OSTI]

    Battisti, David

    Novim Climate Engineering Responses to Climate Emergencies Jason J. Blackstock David S. Battisti Santa Barbara, California #12;Climate Engineering Responses to Climate Emergencies This report should, A. A. N. Patrinos, D. P. Schrag, R. H. Socolow and S. E. Koonin, Climate Engineering Responses

  13. BIOGRAPHIES Randolph Hall: Networks, Emergency Response,

    E-Print Network [OSTI]

    Southern California, University of

    BIOGRAPHIES Randolph Hall: Networks, Emergency Response, Mathematical Modeling Hall, the center: Emergency Response Larson, former co-director of the MIT Operations Research Center, was one of the youngest and more than 75 scientific articles, primarily in emergency response, queuing, logistics and workforce

  14. Species Interactions Reverse Grassland Responses to

    E-Print Network [OSTI]

    Wilmers, Chris

    droughts. Eco- logical responses to climate change in regions with Mediterranean climate regimes maySpecies Interactions Reverse Grassland Responses to Changing Climate K. B. Suttle,1 * Meredith A. Thomsen,2 Mary E. Power1 Predictions of ecological response to climate change are based largely on direct

  15. Demand Response Valuation Frameworks Paper

    SciTech Connect (OSTI)

    Heffner, Grayson

    2009-02-01T23:59:59.000Z

    While there is general agreement that demand response (DR) is a valued component in a utility resource plan, there is a lack of consensus regarding how to value DR. Establishing the value of DR is a prerequisite to determining how much and what types of DR should be implemented, to which customers DR should be targeted, and a key determinant that drives the development of economically viable DR consumer technology. Most approaches for quantifying the value of DR focus on changes in utility system revenue requirements based on resource plans with and without DR. This ''utility centric'' approach does not assign any value to DR impacts that lower energy and capacity prices, improve reliability, lower system and network operating costs, produce better air quality, and provide improved customer choice and control. Proper valuation of these benefits requires a different basis for monetization. The review concludes that no single methodology today adequately captures the wide range of benefits and value potentially attributed to DR. To provide a more comprehensive valuation approach, current methods such as the Standard Practice Method (SPM) will most likely have to be supplemented with one or more alternative benefit-valuation approaches. This report provides an updated perspective on the DR valuation framework. It includes an introduction and four chapters that address the key elements of demand response valuation, a comprehensive literature review, and specific research recommendations.

  16. MOLECULAR AND CELLULAR BIOLOGY, 0270-7306/01/$04.00 0 DOI: 10.1128/MCB.21.20.68206832.2001

    E-Print Network [OSTI]

    MOLECULAR AND CELLULAR BIOLOGY, 0270-7306/01/$04.00 0 DOI: 10.1128/MCB.21.20.6820­6832.2001 Oct. 2001, p. 6820­6832 Vol. 21, No. 20 Copyright © 2001, American Society for Microbiology. All Rights Laboratory, Cold Spring Harbor, New York2 Received 9 May 2001/Returned for modification 25 June 2001/Accepted

  17. CELLULAR TRACTION AS AN INVERSE PROBLEM Abstract. The evaluation of the traction exerted by a cell on a planar substrate is here con-

    E-Print Network [OSTI]

    Ambrosi, Davide

    . The resulting coupled systems of elliptic partial differential equations (the direct and the adjoint problem methodology has been proposed in 1996 by Dembo et al [3], using pre- stressed silicone rubber, an approach of the gel. The gel is soft enough to remain in a linear elasticity regime and no wrinkles form. The cellular

  18. Environmental effects of dredging: Methods for the assessment of the genotoxic effects of environmental contaminants; cellular and organ/organism effects. Technical Notes

    SciTech Connect (OSTI)

    Honeycutt, M.E.; Jarvis, A.S.; McFarland, V.A.

    1995-07-01T23:59:59.000Z

    This technical note is the second in a series of three that outline and describe the principal methods that have been developed to test the potential of environmental contaminants for causing mutagenic, carcinogenic, and teratogenic effects. This technical note describes methods used to discern genotoxic effects at the cellular and organ/ organism level.

  19. Stimulation of CD107 affects LPS-induced cytokine secretion and cellular adhesion through the ERK signaling pathway in the human macrophage-like

    E-Print Network [OSTI]

    Lee, Won-Ha

    Stimulation of CD107 affects LPS-induced cytokine secretion and cellular adhesion through the ERK107 ERK Inflammation Signal transduction a b s t r a c t Lysosome-associated membrane proteins (LAMPs that extracellular signal-regulated kinase (ERK) mediates the regulatory action of CD107. These results suggest

  20. MOLECULAR AND CELLULAR BIOLOGY, Oct. 2007, p. 70287040 Vol. 27, No. 20 0270-7306/07/$08.00 0 doi:10.1128/MCB.00579-07

    E-Print Network [OSTI]

    Ikura, Mitsuhiko

    ; Molecular Virology, Immunology and Medical Genetics, Human Cancer Genetics, The Ohio State University School 2-1, Aobaku Sendai 980-8575, Japan1 ; Department of Cellular Biology,2 Department of Human Genetics,3 and Department of Experimental Oncology,4 RIRBM, Hiroshima University, Hiroshima 734-8553, Japan

  1. Texas A&M Veterinary Medical Diagnostic Lab Procedures 25.99.09.V0.01 Cellular Communication Devices and Services

    E-Print Network [OSTI]

    by the Director or designee, be reimbursed for business calls made using a personal device. To receive Devices and Services Approved: December 28, 2012 Next Scheduled Review: December 28, 2014 Texas A&M Veterinary Medical Diagnostic Laboratory Procedures 25.99.09.V0.01 Cellular Communication Devices

  2. Advertiser retains sole responsibility for content ADVERTISEMENT FEATURE

    E-Print Network [OSTI]

    Cai, Long

    techniques similar to 3D printing to ex- trude cellular material between layers of gel. By delivering as innovative medical devices. It's also where we use our strengths in 3D printing and additive manufacturing

  3. CONSULTATION RESPONSE Wellcome Trust response to Copyright in the Knowledge Economy

    E-Print Network [OSTI]

    Rambaut, Andrew

    CONSULTATION RESPONSE Wellcome Trust response to Copyright in the Knowledge Economy Wellcome Trust response to Copyright in the Knowledge Economy November 2008 Page 1 of 8 European Commission: Copyright in the Knowledge Economy Response by the Wellcome Trust November 2008 1. The Wellcome Trust is pleased to have

  4. Market Response ModelsMarket Response Models Demand CreationDemand Creation

    E-Print Network [OSTI]

    Brock, David

    Market Response ModelsMarket Response Models andand Demand CreationDemand Creation Dominique MImportance of Marketing Investments Need for a Market Response focusNeed for a Market Response focus Digital data enriched acquisition and retention costsasymmetry between acquisition and retention costs In both cases, longIn both

  5. WELLCOME TRUST CONSULTATION RESPONSE Wellcome Trust response to the Reform of the National Curriculum in England

    E-Print Network [OSTI]

    Rambaut, Andrew

    WELLCOME TRUST CONSULTATION RESPONSE Wellcome Trust response to the Reform of the National Curriculum in England April 2013 1 Department for Education: Reform of the National Curriculum in England CONSULTATION RESPONSE Wellcome Trust response to the Reform of the National Curriculum in England April 2013 2

  6. No Effect of the Transforming Growth Factor {beta}1 Promoter Polymorphism C-509T on TGFB1 Gene Expression, Protein Secretion, or Cellular Radiosensitivity

    SciTech Connect (OSTI)

    Reuther, Sebastian; Metzke, Elisabeth [Laboratory of Radiobiology and Experimental Radiooncology, University Hospital Hamburg-Eppendorf, Hamburg (Germany)] [Laboratory of Radiobiology and Experimental Radiooncology, University Hospital Hamburg-Eppendorf, Hamburg (Germany); Bonin, Michael [Department of Medical Genetics, University of Tuebingen (Germany)] [Department of Medical Genetics, University of Tuebingen (Germany); Petersen, Cordula [Clinic of Radiotherapy and Radiooncology, University Hospital Hamburg-Eppendorf, Hamburg (Germany)] [Clinic of Radiotherapy and Radiooncology, University Hospital Hamburg-Eppendorf, Hamburg (Germany); Dikomey, Ekkehard, E-mail: dikomey@uke.de [Laboratory of Radiobiology and Experimental Radiooncology, University Hospital Hamburg-Eppendorf, Hamburg (Germany)] [Laboratory of Radiobiology and Experimental Radiooncology, University Hospital Hamburg-Eppendorf, Hamburg (Germany); Raabe, Annette [Laboratory of Radiobiology and Experimental Radiooncology, University Hospital Hamburg-Eppendorf, Hamburg (Germany)] [Laboratory of Radiobiology and Experimental Radiooncology, University Hospital Hamburg-Eppendorf, Hamburg (Germany)

    2013-02-01T23:59:59.000Z

    Purpose: To study whether the promoter polymorphism (C-509T) affects transforming growth factor {beta}1 gene (TGFB1) expression, protein secretion, and/or cellular radiosensitivity for both human lymphocytes and fibroblasts. Methods and Materials: Experiments were performed with lymphocytes taken either from 124 breast cancer patients or 59 pairs of normal monozygotic twins. We used 15 normal human primary fibroblast strains as controls. The C-509T genotype was determined by polymerase chain reaction-restriction fragment length polymorphism or TaqMan single nucleotide polymorphism (SNP) genotyping assay. The cellular radiosensitivity of lymphocytes was measured by G0/1 assay and that of fibroblasts by colony assay. The amount of extracellular TGFB1 protein was determined by enzyme-linked immunosorbent assay, and TGFB1 expression was assessed via microarray analysis or reverse transcription-polymerase chain reaction. Results: The C-509T genotype was found not to be associated with cellular radiosensitivity, neither for lymphocytes (breast cancer patients, P=.811; healthy donors, P=.181) nor for fibroblasts (P=.589). Both TGFB1 expression and TGFB1 protein secretion showed considerable variation, which, however, did not depend on the C-509T genotype (protein secretion: P=.879; gene expression: lymphocytes, P=.134, fibroblasts, P=.605). There was also no general correlation between TGFB1 expression and cellular radiosensitivity (lymphocytes, P=.632; fibroblasts, P=.573). Conclusion: Our data indicate that any association between the SNP C-509T of TGFB1 and risk of normal tissue toxicity cannot be ascribed to a functional consequence of this SNP, either on the level of gene expression, protein secretion, or cellular radiosensitivity.

  7. MNK1 expression increases during cellular senescence and modulates the subcellular localization of hnRNP A1

    SciTech Connect (OSTI)

    Ziaei, Samira, E-mail: ziaeisamira@gmail.com [City College of New York, City University of New York, New York, NY (United States) [City College of New York, City University of New York, New York, NY (United States); The Graduate School and University Center of CUNY, New York, NY (United States); Shimada, Naoko, E-mail: lensdev@yahoo.co.jp [City College of New York, City University of New York, New York, NY (United States)] [City College of New York, City University of New York, New York, NY (United States); Kucharavy, Herman, E-mail: veterduy@yahoo.com [City College of New York, City University of New York, New York, NY (United States)] [City College of New York, City University of New York, New York, NY (United States); Hubbard, Karen, E-mail: khubbard@sci.ccny.cuny.edu [City College of New York, City University of New York, New York, NY (United States) [City College of New York, City University of New York, New York, NY (United States); The Graduate School and University Center of CUNY, New York, NY (United States)

    2012-03-10T23:59:59.000Z

    Heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) is an RNA-binding protein that modulates splice site usage, polyadenylation, and cleavage efficiency. This protein has also been implicated in mRNA stability and transport from the nucleus. We have previously demonstrated that hnRNP A1 had diminished protein levels and showed cytoplasmic accumulation in senescent human diploid fibroblasts. Furthermore, we have shown that inhibition of p38 MAPK, a key regulator of cellular senescence, elevated hnRNP A1 protein levels and inhibited hnRNP A1 cytoplasmic localization. In this study, we have explored the possible involvement of MNK1, one of the downstream effector of p38 MAPK, in the regulation of hnRNP A1. We have demonstrated that pharmacological inhibition of MNK1 by CGP 57380 decreased the phosphorylation levels of hnRNP A1 in young and senescent fibroblast cells and blocked the cytoplasmic accumulation of hnRNP A1 in senescent cells. In addition, MNK1 formed a complex with hnRNP A1 in vivo. The expression levels of MNK1, phospho-MNK1, and phospho-eIF4E proteins were found to be elevated in senescent cells. These data suggest that MNK1 regulates the phosphorylation and the subcellular distribution of hnRNP A1 and that MNK1 may play a role in the induction of senescence. -- Highlights: Black-Right-Pointing-Pointer MNK1 and not MAPKAPK2 phosphorylates hnRNP A1. Black-Right-Pointing-Pointer MNK1 has elevated levels in senescent cells, this has not been reported previously. Black-Right-Pointing-Pointer MNK1 activity induces cytoplasmic accumulation of hnRNP A1 in senescent cells. Black-Right-Pointing-Pointer Altered cytoplasmic localization of hnRNP A1 may alter gene expression patterns. Black-Right-Pointing-Pointer Our studies may increase our understanding of RNA metabolism during cellular aging.

  8. Distinctive Oxidative Stress Responses to Hydrogen Peroxide in Sulfate Reducing Bacteria Desulfovibrio vulgaris Hildenborough

    SciTech Connect (OSTI)

    Zhou, Aifen; He, Zhili; Redding, A.M.; Mukhopadhyay, Aindrila; Hemme, Christopher L.; Joachimiak, Marcin P.; Bender, Kelly S.; Keasling, Jay D.; Stahl, David A.; Fields, Matthew W.; Hazen, Terry C.; Arkin, Adam P.; Wall, Judy D.; Zhou, Jizhong

    2009-01-01T23:59:59.000Z

    Response of Desulfovibrio vulgaris Hildenborough to hydrogen peroxide (H2O2, 1 mM) was investigated with transcriptomic, proteomic and genetic approaches. Microarray data demonstrated that gene expression was extensively affected by H2O2 with the response peaking at 120 min after H2O2 treatment. Genes affected include those involved with energy production, sulfate reduction, ribosomal structure and translation, H2O2 scavenging, posttranslational modification and DNA repair as evidenced by gene coexpression networks generated via a random matrix-theory based approach. Data from this study support the hypothesis that both PerR and Fur play important roles in H2O2-induced oxidative stress response. First, both PerR and Fur regulon genes were significantly up-regulated. Second, predicted PerR regulon genes ahpC and rbr2 were derepressedin Delta PerR and Delta Fur mutants and induction of neither gene was observed in both Delta PerR and Delta Fur when challenged with peroxide, suggesting possible overlap of these regulons. Third, both Delta PerR and Delta Fur appeared to be more tolerant of H2O2 as measured by optical density. Forth, proteomics data suggested de-repression of Fur during the oxidative stress response. In terms of the intracellular enzymatic H2O2 scavenging, gene expression data suggested that Rdl and Rbr2 may play major roles in the detoxification of H2O2. In addition, induction of thioredoxin reductase and thioredoxin appeared to be independent of PerR and Fur. Considering all data together, D. vulgaris employed a distinctive stress resistance mechanism to defend against increased cellular H2O2, and the temporal gene expression changes were consistent with the slowdown of cell growth at the onset of oxidative stress.

  9. Making the most of Responsive Electricity Customer. Energy Efficiency...

    Broader source: Energy.gov (indexed) [DOE]

    Making the most of Responsive Electricity Customer. Energy Efficiency and Demand Response: How do we make the most out of using less energy? Making the most of Responsive...

  10. Open Automated Demand Response Communications Specification (Version 1.0)

    E-Print Network [OSTI]

    Piette, Mary Ann

    2009-01-01T23:59:59.000Z

    and Techniques for Demand Response. May 2007. LBNL-59975.to facilitate automating  demand response actions at the Interoperable Automated Demand Response Infrastructure,

  11. Role of Standard Demand Response Signals for Advanced Automated Aggregation

    E-Print Network [OSTI]

    Kiliccote, Sila

    2013-01-01T23:59:59.000Z

    for the Open Automated Demand Response (OpenADR) StandardsControl for Automated Demand Response, Grid Interop, 2009. [C. McParland, Open Automated Demand Response Communications

  12. Northwest Open Automated Demand Response Technology Demonstration Project

    E-Print Network [OSTI]

    Kiliccote, Sila

    2010-01-01T23:59:59.000Z

    reliability signals for demand response GTA HTTPS HVAC IT kWand Commissioning Automated Demand Response Systems. ”and Techniques for Demand Response. California Energy

  13. Scenarios for Consuming Standardized Automated Demand Response Signals

    E-Print Network [OSTI]

    Koch, Ed

    2009-01-01T23:59:59.000Z

    of Fully Automated Demand Response in Large Facilities.Fully Automated Demand Response Tests in Large Facilities.Interoperable Automated Demand Response Infrastructure.

  14. Demand Response in U.S. Electricity Markets: Empirical Evidence

    E-Print Network [OSTI]

    Cappers, Peter

    2009-01-01T23:59:59.000Z

    Reliability Corporation. Demand response data task force:Energy. Benefits of demand response in electricity marketsAssessment of demand response & advanced metering, staff

  15. Demand Response Opportunities in Industrial Refrigerated Warehouses in California

    E-Print Network [OSTI]

    Goli, Sasank

    2012-01-01T23:59:59.000Z

    and Open Automated Demand Response. In Grid Interop Forum.work was sponsored by the Demand Response Research Center (load-management.php. Demand Response Research Center (2009).

  16. Open Automated Demand Response Dynamic Pricing Technologies and Demonstration

    E-Print Network [OSTI]

    Ghatikar, Girish

    2010-01-01T23:59:59.000Z

    Goodin. 2009. “Open Automated Demand Response Communicationsin Demand Response for Wholesale Ancillary Services. ” InOpen Automated Demand Response Demonstration Project. LBNL-

  17. Modeling, Analysis, and Control of Demand Response Resources

    E-Print Network [OSTI]

    Mathieu, Johanna L.

    2012-01-01T23:59:59.000Z

    advanced metering and demand response in electricityGoldman, and D. Kathan. “Demand response in U.S. electricity29] DOE. Benefits of demand response in electricity markets

  18. Coordination of Retail Demand Response with Midwest ISO Markets

    E-Print Network [OSTI]

    Bharvirkar, Ranjit

    2008-01-01T23:59:59.000Z

    Robinson, Michael, 2008, "Demand Response in Midwest ISOPresentation at MISO Demand Response Working Group Meeting,Coordination of Retail Demand Response with Midwest ISO

  19. Direct versus Facility Centric Load Control for Automated Demand Response

    E-Print Network [OSTI]

    Piette, Mary Ann

    2010-01-01T23:59:59.000Z

    Interoperable Automated Demand Response Infrastructure.and Techniques for Demand Response. LBNL Report 59975. Mayand Communications for Demand Response and Energy Efficiency

  20. Linking Continuous Energy Management and Open Automated Demand Response

    E-Print Network [OSTI]

    Piette, Mary Ann

    2009-01-01T23:59:59.000Z

    A. Barat, D. Watson. Demand Response Spinning ReserveOpen Automated Demand Response Communication Standards:Dynamic Controls for Demand Response in a New Commercial

  1. Open Automated Demand Response for Small Commerical Buildings

    E-Print Network [OSTI]

    Dudley, June Han

    2009-01-01T23:59:59.000Z

    of Fully Automated Demand  Response in Large Facilities.  Fully Automated Demand Response Tests in Large Facilities.  Open Automated  Demand Response Communication Standards: 

  2. Response to several FOIA requests - Renewable Energy. Demand...

    Office of Environmental Management (EM)

    Response to several FOIA requests - Renewable Energy. Demand for Fossil Fuels Response to several FOIA requests - Renewable Energy. Demand for Fossil Fuels Response to several FOIA...

  3. Northwest Open Automated Demand Response Technology Demonstration Project

    E-Print Network [OSTI]

    Kiliccote, Sila

    2010-01-01T23:59:59.000Z

    Building Control Strategies and Techniques for Demand Response.Building Systems and DR Strategies 16 Demand ResponseDemand Response Systems. ” Proceedings, 16 th National Conference on Building

  4. LEED Demand Response Credit: A Plan for Research towards Implementation

    E-Print Network [OSTI]

    Kiliccote, Sila

    2014-01-01T23:59:59.000Z

    in California. DEMAND RESPONSE AND COMMERCIAL BUILDINGSload and demand response against other buildings and alsoDemand Response and Energy Efficiency in Commercial Buildings",

  5. Open Automated Demand Response Communications Specification (Version 1.0)

    E-Print Network [OSTI]

    Piette, Mary Ann

    2009-01-01T23:59:59.000Z

    Keywords: demand response, buildings, electricity use, Interface  Automated Demand Response  Building Automation of demand response in  commercial buildings.   One key 

  6. Results and commissioning issues from an automated demand response pilot

    E-Print Network [OSTI]

    Piette, Mary Ann; Watson, Dave; Sezgen, Osman; Motegi, Naoya

    2004-01-01T23:59:59.000Z

    Management and Demand Response in Commercial Buildings", L BAutomated Demand Response National Conference on BuildingAutomated Demand Response National Conference on Building

  7. Addressing Energy Demand through Demand Response: International Experiences and Practices

    E-Print Network [OSTI]

    Shen, Bo

    2013-01-01T23:59:59.000Z

    Data for Automated Demand Response in Commercial Buildings,Demand Response Infrastructure for Commercial Buildings",demand response and energy efficiency functions into the design of buildings,

  8. Scenarios for Consuming Standardized Automated Demand Response Signals

    E-Print Network [OSTI]

    Koch, Ed

    2009-01-01T23:59:59.000Z

    Keywords: Demand response, automation, commercial buildings,Demand Response and Energy Efficiency in Commercial Buildings,Building Control Strategies and Techniques for Demand Response.

  9. Open Automated Demand Response for Small Commerical Buildings

    E-Print Network [OSTI]

    Dudley, June Han

    2009-01-01T23:59:59.000Z

    Demand  Response for Small Commercial Buildings.   CEC?500?automated demand response  For small commercial buildings, AUTOMATED DEMAND RESPONSE FOR SMALL COMMERCIAL BUILDINGS

  10. Automated Demand Response Strategies and Commissioning Commercial Building Controls

    E-Print Network [OSTI]

    Piette, Mary Ann; Watson, David; Motegi, Naoya; Kiliccote, Sila; Linkugel, Eric

    2006-01-01T23:59:59.000Z

    for Demand Response in New and Existing Commercial BuildingsDemand Response Strategies and National Conference on BuildingDemand Response Strategies and Commissioning Commercial Building

  11. Open Automated Demand Response Dynamic Pricing Technologies and Demonstration

    E-Print Network [OSTI]

    Ghatikar, Girish

    2010-01-01T23:59:59.000Z

    for Automated Demand Response in Commercial Buildings. Inbased demand response information to building controlDemand Response Standard for the Residential Sector. California Energy Commission, PIER Buildings

  12. Northwest Open Automated Demand Response Technology Demonstration Project

    E-Print Network [OSTI]

    Kiliccote, Sila

    2010-01-01T23:59:59.000Z

    is manual demand response where building staff receive acommercial buildings’ demand response technologies andBuilding Control Strategies and Techniques for Demand Response.

  13. Direct versus Facility Centric Load Control for Automated Demand Response

    E-Print Network [OSTI]

    Piette, Mary Ann

    2010-01-01T23:59:59.000Z

    Keywords: Demand response, automation, commercial buildings,Demand Response and Energy Efficiency in Commercial Buildings,Building Control Strategies and Techniques for Demand Response.

  14. A Babcock-Leighton solar dynamo model with multi-cellular meridional circulation in advection- and diffusion-dominated regimes

    E-Print Network [OSTI]

    Belucz, Bernadett; Forgacs-Dajka, Emese

    2015-01-01T23:59:59.000Z

    Babcock-Leighton type solar dynamo models with single-celled meridional circulation are successful in reproducing many solar cycle features. Recent observations and theoretical models of meridional circulation do not indicate a single-celled flow pattern. We examine the role of complex multi-cellular circulation patterns in a Babcock-Leighton solar dynamo in advection- and diffusion-dominated regimes. We show from simulations that presence of a weak, second, high-latitude reverse cell speeds up the cycle and slightly enhances the poleward branch in butterfly diagram, whereas the presence of a second cell in depth reverses the tilt of butterfly wing to an anti-solar type. A butterfly diagram constructed from middle of convection zone yields a solar-like pattern, but this may be difficult to realize in the Sun because of magnetic buoyancy effects. Each of the above cases behaves similarly in higher and lower magnetic diffusivity regimes. However, our dynamo with a meridional circulation containing four cells in...

  15. Conditions for self-assembly of quantum fortresses and analysis of their possible use as quantum cellular automata

    SciTech Connect (OSTI)

    Vandervelde, T.E.; Kalas, R.M.; Kumar, P.; Kobayashi, T.; Pernell, T.L.; Bean, J.C. [Department of Physics, University of Virginia, Charlottesville, Virginia 22904 (United States); Department of Electrical and Computer Engineering, University of Virginia, Charlottesville, Virginia 22904 (United States)

    2005-02-15T23:59:59.000Z

    In this study, we detail the conditions that result in the generation of self-assembled quantum fortresses (QFs), in SiGe/Si. A QF consists of four quantum dots (QDs) clustered around a central square pit, one QD per side. This structure strongly resembles the proposed quantum cellular automata (QCA) unit cell - the basis for a computer architecture. We map the growth conditions (epilayer thickness and Ge concentration) under which self-assembly of strain-stabilized QFs and their precursors occur. Additionally, we characterize how QFs change in height, width, and internal size scales within this parameter space. From this information, we develop a phenomenological model for why QFs form based upon changes in lattice spacing. We then calculate how QFs of the observed shapes and sizes would function as QCAs based on a Hubbard-type Hamiltonian model. This analysis reveals that self-assembled QFs grown at 550 deg. C, a rate of 1 A/s, a SiGe alloy composition of 37-40%, and a thickness of 15-35 nm could be used as QCAs.

  16. ERK Oscillation-Dependent Gene Expression Patterns and Deregulation by Stress-Response

    SciTech Connect (OSTI)

    Waters, Katrina M.; Cummings, Brian S.; Shankaran, Harish; Scholpa, Natalie E.; Weber, Thomas J.

    2014-09-15T23:59:59.000Z

    Studies were undertaken to determine whether ERK oscillations regulate a unique subset of genes in human keratinocytes and subsequently, whether the p38 stress response inhibits ERK oscillations. A DNA microarray identified many genes that were unique to ERK oscillations, and network reconstruction predicted an important role for the mediator complex subunit 1 (MED1) node in mediating ERK oscillation-dependent gene expression. Increased ERK-dependent phosphorylation of MED1 was observed in oscillating cells compared to non-oscillating counterparts as validation. Treatment of keratinocytes with a p38 inhibitor (SB203580) increased ERK oscillation amplitudes and MED1 and phospho-MED1 protein levels. Bromate is a probable human carcinogen that activates p38. Bromate inhibited ERK oscillations in human keratinocytes and JB6 cells and induced an increase in phospho-p38 and decrease in phospho-MED1 protein levels. Treatment of normal rat kidney cells and primary salivary gland epithelial cells with bromate decreased phospho-MED1 levels in a reversible fashion upon treatment with p38 inhibitors (SB202190; SB203580). Our results indicate that oscillatory behavior in the ERK pathway alters homeostatic gene regulation patterns and that the cellular response to perturbation may manifest differently in oscillating vs non-oscillating cells.

  17. Demand Response For Power System Reliability: FAQ

    SciTech Connect (OSTI)

    Kirby, Brendan J [ORNL

    2006-12-01T23:59:59.000Z

    Demand response is the most underutilized power system reliability resource in North America. Technological advances now make it possible to tap this resource to both reduce costs and improve. Misconceptions concerning response capabilities tend to force loads to provide responses that they are less able to provide and often prohibit them from providing the most valuable reliability services. Fortunately this is beginning to change with some ISOs making more extensive use of load response. This report is structured as a series of short questions and answers that address load response capabilities and power system reliability needs. Its objective is to further the use of responsive load as a bulk power system reliability resource in providing the fastest and most valuable ancillary services.

  18. Safety Management Functions, Responsibilities, and Authorities

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2001-05-22T23:59:59.000Z

    This Manual provides the responsibilities of Headquarters and field element offices required by DOE P 411.1, Safety Management Functions, Responsibilities and Authorities Policy, dated 1-28-97. It also contains detailed requirements to supplement the policy's direction for each DOE organization having safety management functions to establish and maintain separate documentation of their responsibilities and authorities. Cancels DOE M 411.1-1A. Canceled by DOE M 411.1-1C.

  19. Approximating spheroid inductive responses using spheres

    SciTech Connect (OSTI)

    Smith, J. Torquil; Morrison, H. Frank

    2003-12-12T23:59:59.000Z

    The response of high permeability ({mu}{sub r} {ge} 50) conductive spheroids of moderate aspect ratios (0.25 to 4) to excitation by uniform magnetic fields in the axial or transverse directions is approximated by the response of spheres of appropriate diameters, of the same conductivity and permeability, with magnitude rescaled based on the differing volumes, D.C. magnetizations, and high frequency limit responses of the spheres and modeled spheroids.

  20. Structural Basis for Suppression of a Host Antiviral Response by Influenza A Virus

    SciTech Connect (OSTI)

    Das,K.; Ma, L.; Xiao, R.; Radvansky, B.; Aramini, J.; Zhao, L.; Marklund, J.; Kuo, R.; Twu, K.; Arnold, E.

    2008-01-01T23:59:59.000Z

    Influenza A viruses are responsible for seasonal epidemics and high mortality pandemics. A major function of the viral NS1A protein, a virulence factor, is the inhibition of the production of IFN-{beta}{beta} mRNA and other antiviral mRNAs. The NS1A protein of the human influenza A/Udorn/72 (Ud) virus inhibits the production of these antiviral mRNAs by binding the cellular 30-kDa subunit of the cleavage and polyadenylation specificity factor (CPSF30), which is required for the 3' end processing of all cellular pre-mRNAs. Here we report the 1.95- Angstroms resolution X-ray crystal structure of the complex formed between the second and third zinc finger domain (F2F3) of CPSF30 and the C-terminal domain of the Ud NS1A protein. The complex is a tetramer, in which each of two F2F3 molecules wraps around two NS1A effector domains that interact with each other head-to-head. This structure identifies a CPSF30 binding pocket on NS1A comprised of amino acid residues that are highly conserved among human influenza A viruses. Single amino acid changes within this binding pocket eliminate CPSF30 binding, and a recombinant Ud virus expressing an NS1A protein with such a substitution is attenuated and does not inhibit IFN-{beta} pre-mRNA processing. This binding pocket is a potential target for antiviral drug development. The crystal structure also reveals that two amino acids outside of this pocket, F103 and M106, which are highly conserved (>99%) among influenza A viruses isolated from humans, participate in key hydrophobic interactions with F2F3 that stabilize the complex.