Powered by Deep Web Technologies
Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

The Maize Primary Cell Wall Microfibril:? A New Model Derived from Direct Visualization  

Science Journals Connector (OSTI)

We noted two different types of cell wall depressions:? primary pits (Figure 1C) and primary pit-fields (primordial pits, Figure 1D) appear on different cell walls. ... (35)?Arioli, T.; Peng, L. C.; Betzner, A. S.; Burn, J.; Wittke, W.; Herth, W.; Camilleri, C.; Hofte, H.; Plazinski, J.; Birch, R.; Cork, A.; Glover, J.; Redmond, J.; Williamson, R. E. Molecular analysis of cellulose biosynthesis in Arabidopsis. ...

Shi-You Ding; Michael E. Himmel

2006-01-17T23:59:59.000Z

2

Maize variety and method of production  

DOE Patents [OSTI]

The disclosure relates to a maize plant, seed, variety, and hybrid. More specifically, the disclosure relates to a maize plant containing a Cal-1 allele, whose expression results in increased cell wall-derived glucan content in the maize plant. The disclosure also relates to crossing inbreds, varieties, and hybrids containing the Cal-1 allele to produce novel types and varieties of maize plants.

Pauly, Markus; Hake, Sarah; Kraemer, Florian J

2014-05-27T23:59:59.000Z

3

The Cochliobolus carbonum SNF1 Gene Is Required for Cell Wallâ??Degrading Enzyme Expression and Virulence on Maize  

Science Journals Connector (OSTI)

...XYL1 does not reduce growth on xylan or maize cell walls ( ). In...ccsnf1 mutant, yet growth on xylan is decreased by >60%. Similarly...enzymes needed for utilization of xylan or pectin, such as the enzymes...conceivably come from the plant leaf surface or epidermis, although the...

Nyerhovwo J. Tonukari; John S. Scott-Craig; Jonathan D. Waltonb

4

Identification of Novel Cell Wall Components  

SciTech Connect (OSTI)

Our DOE Biosciences-funded work focused on the fungal cell wall and morphogenesis. We are especially interested in how new cell wall material is targeted to appropriate areas for polar (asymmetric) growth. Polar growth is the only way that filamentous fungi explore the environment to find suitable substrates to degrade. Work funded by this grant has resulted in a total of twenty peer-reviewed publications. In work funded by this grant, we identified nine Aspergillus nidulans temperature-sensitive (ts) mutants that fail to send out a germ tube and show a swollen cell phenotype at restrictive temperature, the swo mutants. In other organisms, a swollen cell phenotype is often associated with misdirected growth or weakened cell walls. Our work shows that several of the A. nidulans swo mutants have defects in the establishment and maintenance of polarity. Cloning of several swo genes by complementation also showed that secondary modification of proteins seems is important in polarity. We also investigated cell wall biosynthesis and branching based on leads in literature from other organisms and found that branching and nuclear division are tied and that the cell wall reorganizes during development. In our most recent work we have focused on gene expression during the shift from isotropic to polar growth. Surprisingly we found that genes previously thought to be involved only in spore formation are important in early vegetative growth as well.

Michelle Momany

2009-10-26T23:59:59.000Z

5

Cell Wall Recipe: A Lesson on Biofuels  

K-12 Energy Lesson Plans and Activities Web site (EERE)

Students will investigate how changes in the DNA sequence that codes for cell wall formation can have a favorable outcome in producing plants that have higher levels of cellulose than the parent plant. The cellulose yield is most important in the production of ethanol: the greater the amount of cellulose within the cell wall, the greater the amount of ethanol that can be produced. To engage students, the first part of this lesson has students participating in a discovery activity where they will extract DNA from wheat germ.

6

Methods for degrading or converting plant cell wall polysaccharides  

DOE Patents [OSTI]

The present invention relates to methods for converting plant cell wall polysaccharides into one or more products, comprising: treating the plant cell wall polysaccharides with an effective amount of a spent whole fermentation broth of a recombinant microorganism, wherein the recombinant microorganism expresses one or more heterologous genes encoding enzymes which degrade or convert the plant cell wall polysaccharides into the one or more products. The present invention also relates to methods for producing an organic substance, comprising: (a) saccharifying plant cell wall polysaccharides with an effective amount of a spent whole fermentation broth of a recombinant microorganism, wherein the recombinant microorganism expresses one or more heterologous genes encoding enzymes which degrade or convert the plant cell wall polysaccharides into saccharified material; (b) fermenting the saccharified material of step (a) with one or more fermenting microoganisms; and (c) recovering the organic substance from the fermentation.

Berka, Randy (Davis, CA); Cherry, Joel (Davis, CA)

2008-08-19T23:59:59.000Z

7

Evidence of programmed cell death in maize suspension cultures  

E-Print Network [OSTI]

Programmed cell death (PCD) is an active cell death process involved in the selective elimination of unwanted cells, and it is found throughout animal and plant kingdoms. The term apoptosis usually refers to a morphological type often observed...

Huang, Yu-Shan

2001-01-01T23:59:59.000Z

8

A Survey of Databases for Analysis of Plant Cell Wall-Related Enzymes  

E-Print Network [OSTI]

Plant Cell Wall-Related Enzymes Peijian Cao & Ki-Hong Jung &plant cell wall-related enzymes. The goal of this review isfor Plant Cell Wall-Related Enzymes (plantcellwalls.ucdavis.

Cao, Peijian; Jung, Ki-Hong; Ronald, Pamela C.

2010-01-01T23:59:59.000Z

9

Potential digestibilities and digestion kinetics of forage cell wall components  

E-Print Network [OSTI]

LITERATURE REVIEW. EXPERIMENTAL PROCEDURES. Chemical Analysis Colorimetric Determinations Statistical Evaluation. 10 13 15 IV RESULTS AND DISCUSSION 16 V Characteristics of Forage Kinetics of Cell Wall Digestion SUMMARY AND CONCLUSIONS... and both of these variables appear to be the result of several dynamic processes. The amount of structural carbohydrates, the main constituents of the fibrous cell wall, ruminants can digest appears to be limited by the potential digestibility...

Tauskey, William Henry

1973-01-01T23:59:59.000Z

10

Influence of mefluidide on sorghum cell wall components  

E-Print Network [OSTI]

percentage points per day) (Ademosum et al. , 1968). This quality decline is attributed to an increase in poorly digestible cell wall components, i. e. ; lignin, cellulose, etc. , while the highly digestible cell contents and cell proteins decline..., cellulose, hemicellulose, lignin, and cellulase digestibility. All morphological studies indicated a reducton in plant height when mefluidide was applied to an early-to-mid vegetative stage in sorghum. Secondary basal tillering was initiated earlier...

Stair, David William

1989-01-01T23:59:59.000Z

11

Three Human Cell Types Respond to Multi-Walled Carbon Nanotubes...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Human Cell Types Respond to Multi-Walled Carbon Nanotubes and Titanium Dioxide Nanobelts with Cell-Specific Transcriptomic Three Human Cell Types Respond to Multi-Walled Carbon...

12

Chitosan, the Deacetylated Form of Chitin, Is Necessary for Cell Wall Integrity in Cryptococcus neoformans  

Science Journals Connector (OSTI)

...significantly reduced chitosan and are sensitive to cell wall inhibitors and elevated temperatures...sensitivity suggests that chitosan may be an essential...and mother cells. Chitosan-deficient strains...select cell wall inhibitors. The majority of...

Lorina G. Baker; Charles A. Specht; Maureen J. Donlin; Jennifer K. Lodge

2007-03-30T23:59:59.000Z

13

Anisotropic Expansion of the Plant Cell Wall  

E-Print Network [OSTI]

of Massachusetts, Amherst, Massachusetts 01003; email: baskin@bio.umass.edu Annu. Rev. Cell Dev. Biol. 2005. 21.annualreviews.org byUniversityofMassachusetts-Amherston10/11/05.Forpersonaluseonly. #12;Contents INTRODUCTION solar panels of leaves to the coiled grap- pling hooks of tendrils. Thompson (1917) re- alized

Baskin, Tobias

14

The characterization of cell wall mutants of Arabidopsis thaliana, combined with biochemical approaches toward the  

E-Print Network [OSTI]

source of terrestrial biomass and renewable energy. Cell wall material is also of great practical migrations do not contribute to the development of the plant body, the planes of cell divisions photosynthetically fixed carbon is incorporated into cell wall polymers, making plant cell walls the most abundant

Reiter, Wolf-Dieter

15

Diverse mechanisms of pectic polysaccharide degradation distinguished in fruit cell walls in vivo   

E-Print Network [OSTI]

Cell wall loosening and degradation are important processes in major stages of plant development including fruit ripening. Three main mechanisms have been proposed to contribute towards cell wall polysaccharide degradation ...

Othman, Babul Airianah

2012-11-30T23:59:59.000Z

16

How Does Plant Cell Wall Nanoscale Architecture Correlate with Enzymatic Digestibility?  

Science Journals Connector (OSTI)

...C. , Pre-formed xylogtlucans and xylans increase in molecular weight in three...C. , Extracellular cross-linking of xylan and xyloglucan in maize cell-suspension...digestion took 8±1 h. Movie S3 AFM of the surface of delignified pSW located in the stem...

Shi-You Ding; Yu-San Liu; Yining Zeng; Michael E. Himmel; John O. Baker; Edward A. Bayer

2012-11-23T23:59:59.000Z

17

Detection of cell wall structural polysaccharides by cellulase-gold and  

E-Print Network [OSTI]

, Bendtska 2, Czech Republic Abstract: The rigid cell wall of Chlorella vulgaris (Trebouxiophyceae wall of the symbiotic Chlorella Pbi strain the chitin-Iike substance was proved (KAPAUN & REISSER1995 Chlorella and Scenedesmus(TAKEDA1993, 1996). Monosaccharidal composition of the rigid cell wall provides

18

Reduction in Young`s modulus of aluminum foams due to cell wall curvature and corrugation  

SciTech Connect (OSTI)

Measurements of the Young`s modulus and compressive strength of several closed-cell aluminum foams indicate that they are lower than expected from models for foam behavior. Microstructural characterization has revealed that there are a number of defects in the cell structure which may contribute to the reduction in mechanical properties. These include: cell wall curvature, cell wall corrugations, density variations and non-equiaxed cell shape. Finite element analysis of a closed-cell tetrakaidecahedral unit cell with idealized curved or corrugated cell walls indicates that these two types of defects can reduce the Young`s modulus and compressive strength by up to 70%. In this paper the authors report the results of measurements of the curvature of the cell walls and of the amplitude and frequency of corrugations in the cell walls and use simple bounds to estimate the reduction in modulus that they are responsible for.

Sanders, W.; Gibson, L.J. [Massachusetts Inst. of Tech., Cambridge, MA (United States). Dept. of Materials Science and Engineering

1998-12-31T23:59:59.000Z

19

Delivery of Prolamins to the Protein Storage Vacuole in Maize Aleurone Cells  

Science Journals Connector (OSTI)

...in Vitro Culture Maize (Zea mays, inbred lines B73 and A636) were grown in a greenhouse under a 14-h-light/10-h-dark photoperiod, supplemental lighting (700 mumol m2 s1), and average temperature of 28C during the day and 21C at...

Francisca C. Reyes; Taijoon Chung; David Holding; Rudolf Jung; Richard Vierstra; Marisa S. Otegui

2011-02-22T23:59:59.000Z

20

Air-Stable High-Efficiency Solar Cells Using Improved Single-Walled Carbon Nanotube Films  

E-Print Network [OSTI]

1 Air-Stable High-Efficiency Solar Cells Using Improved Single-Walled Carbon Nanotube Films Kehang-3-5800-6983. #12;2 ABSTRACT We present the single-walled carbon nanotube/silicon (SWNT/Si) solar cells approaching, the PCEs of the fabricated solar cells slightly increased after six-month exposure in air without any

Maruyama, Shigeo

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Detecting Cellulase Penetration Into Corn Stover Cell Walls by Immuno-Electron Microscopy  

SciTech Connect (OSTI)

In general, pretreatments are designed to enhance the accessibility of cellulose to enzymes, allowing for more efficient conversion. In this study, we have detected the penetration of major cellulases present in a commercial enzyme preparation (Spezyme CP) into corn stem cell walls following mild-, moderate- and high-severity dilute sulfuric acid pretreatments. The Trichoderma reesei enzymes, Cel7A (CBH I) and Cel7B (EG I), as well as the cell wall matrix components xylan and lignin were visualized within digested corn stover cell walls by immuno transmission electron microscopy (TEM) using enzyme- and polymer-specific antibodies. Low severity dilute-acid pretreatment (20 min at 100 C) enabled <1% of the thickness of secondary cell walls to be penetrated by enzyme, moderate severity pretreatment at (20 min at 120 C) allowed the enzymes to penetrate {approx}20% of the cell wall, and the high severity (20 min pretreatment at 150 C) allowed 100% penetration of even the thickest cell walls. These data allow direct visualization of the dramatic effect dilute-acid pretreatment has on altering the condensed ultrastructure of biomass cell walls. Loosening of plant cell wall structure due to pretreatment and the subsequently improved access by cellulases has been hypothesized by the biomass conversion community for over two decades, and for the first time, this study provides direct visual evidence to verify this hypothesis. Further, the high-resolution enzyme penetration studies presented here provide insight into the mechanisms of cell wall deconstruction by cellulolytic enzymes.

Donohoe, B. S.; Selig, M. J.; Viamajala, S.; Vinzant, T. B.; Adney, W. S.; Himmel, M. E.

2009-06-15T23:59:59.000Z

22

Advancing Energy Cane Cell Wall Digestibility Screening by Near-Infrared Spectroscopy  

Science Journals Connector (OSTI)

Breeding energy cane for cellulosic biofuel production involves manipulating various traits. An important trait to optimize is cell wall degradability as defined by enzymatic...

Chong, Barrie Fong; O'Shea, Michael G

2013-01-01T23:59:59.000Z

23

Discovery of Fungal Cell Wall Components Using Evolutionary and Functional Genomics.  

E-Print Network [OSTI]

??Understanding the various processes/pathways necessary for the biogenesis and maintenance of the cell wall is of immense value as that knowledge can be used for… (more)

Sain, Divya

2013-01-01T23:59:59.000Z

24

Identification of PAN2 by Quantitative Proteomics as a Leucine-Rich Repeatâ??Receptor-Like Kinase Acting Upstream of PAN1 to Polarize Cell Division in Maize  

Science Journals Connector (OSTI)

...polarization of cell division is a process of fundamental importance for plant development. In...described in the Clontech Yeast Protocols Handbook (Protocol number PT3024-1, version...1994). Mutagenesis. In The Maize Handbook, M. Freeling and V. Walbot, eds...

Xiaoguo Zhang; Michelle Facette; John A. Humphries; Zhouxin Shen; Yeri Park; Dena Sutimantanapi; Anne W. Sylvester; Steven P. Briggs; Laurie G. Smith

2012-11-21T23:59:59.000Z

25

Cell Wall Chemotyping for Functional Applications of PyrolysisGas Chromatography / Mass  

E-Print Network [OSTI]

Cell Wall Chemotyping for Functional Genomics Applications of Pyrolysis­Gas Chromatography / Mass, Umeå 2012 #12;Cell Wall Chemotyping for Functional Genomics Applications of Pyrolysis.4.1 The Basic Tool-set 27 1.5 Wood Formation and Functional Genomics 31 2 Objectives 33 3 Methodological

26

COST E50 -Workplan 1 "CELL WALL MACROMOLECULES AND REACTION WOOD"  

E-Print Network [OSTI]

COST E50 - Workplan 1 COST E50 "CELL WALL MACROMOLECULES AND REACTION WOOD" (CEMARE) WORKPLAN A in the various cell wall layers determines the strength properties of individual fibres and solid wood. Moreover, it is a key parameter for the biomechanical function of wood in the living stem. Trees control the shape

27

E-Print Network 3.0 - architecture cell wall Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Search Powered by Explorit Topic List Advanced Search Sample search results for: architecture cell wall Page: << < 1 2 3 4 5 > >> 1 The Plant Cell, Vol. 9, 1031-1041, July 1997O...

28

Imaging cell wall architecture in single Zinnia elegans tracheary elements  

E-Print Network [OSTI]

indicated a loss of lignin and a modest loss of otherTEs accumulate lignin in their secondary walls and undergohemicelluloses, and also lignin, a complex aromatic polymer

Lacayo, Catherine

2012-01-01T23:59:59.000Z

29

Ultrastructure and Composition of the Nannochloropsis gaditana Cell Wall  

Science Journals Connector (OSTI)

...removing the walls from the green pellet at the bottom of the tube until no green pellet was observed...the National Renewable Energy Laboratory (46). Characterization...Environ. Prog. Sustain. Energy 32 :989-1001. doi...wall proteomics of the green alga Haematococcus pluvialis...

Matthew J. Scholz; Taylor L. Weiss; Robert E. Jinkerson; Jia Jing; Robyn Roth; Ursula Goodenough; Matthew C. Posewitz; Henri G. Gerken

2014-09-19T23:59:59.000Z

30

The structure, function, and biosynthesis of plant cell wall pectic polysaccharides  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

structure, structure, function, and biosynthesis of plant cell wall pectic polysaccharides Kerry Hosmer Caffall a , Debra Mohnen a,b, * a University of Georgia, Department of Biochemistry and Molecular Biology and Complex Carbohydrate Research Center, 315 Riverbend Road Athens, GA 30602, United States b DOE BioEnergy Science Center (BESC), 315 Riverbend Road Athens, GA 30602, United States a r t i c l e i n f o Article history: Received 18 November 2008 Received in revised form 4 May 2009 Accepted 6 May 2009 Available online 2 June 2009 Keywords: Cell wall polysaccharides Galacturonan Glycosyltransferases Homogalacturonan Pectin function Rhamnogalacturonan a b s t r a c t Plant cell walls consist of carbohydrate, protein, and aromatic compounds and are essential to the proper growth and development of plants. The carbohydrate components make up $90% of the primary wall, and are critical to wall

31

Self-Assembled Micro-Honeycomb Network of Single-Walled Carbon Nanotubes for Solar Cells  

E-Print Network [OSTI]

1 Self-Assembled Micro-Honeycomb Network of Single-Walled Carbon Nanotubes for Solar Cells Kehang nanotubes (SWNTs) into a self-assembled micro-honeycomb network (-HN) for the application to SWNT- Si solar-assembled, micro- honeycomb network, water vapor treatment #12;3 Single-walled carbon nanotubes (SWNTs) feature

Maruyama, Shigeo

32

Cell Wall Chitosan Is Necessary for Virulence in the Opportunistic Pathogen Cryptococcus neoformans  

Science Journals Connector (OSTI)

...Cda3, that can each produce chitosan. Strains of C. neoformans...deacetylases are deficient in chitosan production and have a common...to a variety of cell wall inhibitors. This indicates that chitosan is essential for the proper...

Lorina G. Baker; Charles A. Specht; Jennifer K. Lodge

2011-07-22T23:59:59.000Z

33

Identification of polysaccharide hydrolases involved in autolytic degradation of Zea cell walls  

SciTech Connect (OSTI)

Cell walls of Zea mays (cv L.G.11) seedlings labeled with {sup 14}C were treated with {alpha}-amylase from Bacillus subtilis to remove starch and mixed linkage glucans. These walls released arabinose, xylose, galactose, and galacturonic acid in addition to glucose when they were allowed to autolyze. Methylation analysis was performed on samples of wall which had been incubated autolytically and the results indicated that degradation of the major polymer of the wall, the glucoarabinoxylan, had occurred. A number of glycanases could be dissociated from the wall by use of 3 M LiCL. The proteins which were released were found to contain a number of exoglycosidase activities in addition to being effective in degrading the polysaccharide substrates, araban, xylan, galactan, laminarin, mannan, and polygalacturonic acid. The effects of these enzymes on the wall during autolysis appear to result from endo-activity in addition to exo-activity. The structural changes that occurred in the cell walls during autolysis were found to be related to the changes previously found to occur in cell walls during auxin induced extension.

Nock, L.P.; Smith, C.J. (Univ. of California, Davis (USA))

1987-08-01T23:59:59.000Z

34

CNT-SI HETEROJUNCTION SOLAR CELLS WITH STRUCTURE-CONTROLLED SINGLE-WALL CARBON NANOTUBE FILMS  

E-Print Network [OSTI]

CNT-SI HETEROJUNCTION SOLAR CELLS WITH STRUCTURE- CONTROLLED SINGLE-WALL CARBON NANOTUBE FILMS. The heterojunction solar cell was fabricated by dry depositing the SWNT film to the 3 mm by 3 mm n-type silicon solar cells. We proposed a water-vapor treatment to build up SWNTs to a self-assembled micro- honeycomb

Maruyama, Shigeo

35

Expression of cell wall invertase and several other genes of sugar metabolism in relation to seed development in sorghum (Sorghum bicolor)  

Science Journals Connector (OSTI)

Summary We report expression profiles of several genes of carbohydrate metabolism, cell wall invertase (CWI) in particular, to better understand sugar transport and its utilization in developing caryopses of grain sorghum [Sorghum bicolor (L.) Moench]. Gene expression analyses for CWI using RNA gel blot and real-time quantitative PCR approaches on developing caryopses, including the glumes (maternal tissue appended to the seeds), showed expression of SbIncw (ZmIncw2 ortholog) primarily in the basal sugar unloading zone of endosperm. The expression of ZmIncw1 ortholog was significantly less abundant and restricted to the glumes. The protein and enzyme activity data corroborated the temporal transcript expression profile that showed maximal CWI protein (INCW) expression preceding the starch-filling phase of endosperm development, i.e. 6–12 d-after-pollination (DAP). Protein gel blot analysis using polyclonal maize INCW1 antibodies showed a single polypeptide of 72 kDa. The highest level of enzyme activity was unique to the basal part of the endosperm, in particular the basal endosperm transfer cell (BETC) layer and the maternal pedicel region that were highly enriched for the INCW protein, as seen by immunolocalization. High hexose-to-sucrose ratio in 6–12 DAP seeds, and negligible starch deposition in glumes corroborated the CWI activity data. Additionally, we report transcription profiles of several other genes related to sugar-to-starch metabolism in developing sorghum endosperm. As in maize, the INCW-mediated apoplastic cleavage of sucrose in the BETC and pedicel during the early developmental stages of caryopses is essential for the normal development of filial tissues. The unique cell-specificity of the INCW protein to both proximal and distal ends of placental sac shown here for the first time is likely to greatly increase uptakes of both hexose sugars and water through turgor sensing into developing seed. This trait is unique to sorghum among cereals and may facilitate its survival in drought environment.

Mukesh Jain; Prem S. Chourey; Qin-Bao Li; Daryl R. Pring

2008-01-01T23:59:59.000Z

36

Proteomic Analysis of Candida albicans Cell Walls Reveals Covalently Bound Carbohydrate-Active Enzymes and Adhesins  

Science Journals Connector (OSTI)

...spectrometry [LC/MS/MS]) methods. HF-pyridine and NaOH were used to chemically...cerevisiae FY834 was used for developing the HF-pyridine method. Cells were cultured...resuspending the cell walls in undiluted HF-pyridine (Sigma-Aldrich, Buchs, Switzerland...

Piet W. J. de Groot; Albert D. de Boer; Jeff Cunningham; Henk L. Dekker; Luitzen de Jong; Klaas J. Hellingwerf; Chris de Koster; Frans M. Klis

2004-08-01T23:59:59.000Z

37

Studying plant cell walls for better biofuels | OpenEI Community  

Open Energy Info (EERE)

Studying plant cell walls for better biofuels Studying plant cell walls for better biofuels Home > Groups > OpenEI Community Central Graham7781's picture Submitted by Graham7781(1992) Super contributor 27 July, 2010 - 10:49 imported OpenEI A common garden plant known as zinnia may yield important results for better future biofuels. Current research at Lawrence Berkeley National Laboratory (LBNL) and the National Renewable Energy Laboratory (NREL) are focusing on the leaves of the zinnia plant, on the nanometer scale, to hopefully develop better biofuels than current biofuels. The researchers are trying to understand ways to break down lignin, the substance that cell walls are composed of. Lignin is tough to break down, so understanding the decomposition of it will help producing biofuels. The basic idea is that cellulose is composed of a polymer of sugars. If

38

Micro-Honeycomb Network Structure of Single-Walled Carbon Nanotubes for Heterojunction Solar Cell  

E-Print Network [OSTI]

Micro-Honeycomb Network Structure of Single-Walled Carbon Nanotubes for Heterojunction Solar Cell, The University of Tokyo, Tokyo 113-8656, Japan We propose a self-organized micro-honeycomb network structure in Fig. 2. The micro-honeycomb SWNTs network film was placed on top of the substrate which has a 3 mm Ã? 3

Maruyama, Shigeo

39

curve represents degradation where all the cell wall is accessible to enzymes and the  

E-Print Network [OSTI]

curve represents degradation where all the cell wall is accessible to enzymes and the 'Within, van Gelder AH, Driehuis F (1997) Anim. Feed Sci Technol 66, 31-45 A role for plant enzymes- ystwyth, Ceredigion, SY23 3EB, UK) Proteolytic enzymes in plants are inti- mately involved in controlled

Boyer, Edmond

40

Transformations of 14C lignin cell walls of wheat by a fungus and by bacteria from the rumen  

E-Print Network [OSTI]

Transformations of 14C lignin cell walls of wheat by a fungus and by bacteria from the rumen MA but little is known about the fate of lignins. The aim of this work was to study the transformation of 14C lignins of wheat straw by ruminal bacteria and fungi. Cell walls of wheat straw apical internodes

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Fine Structure in the Red Algae. III. A General Survey of Cell-Wall Structure in the Red Algae  

Science Journals Connector (OSTI)

...research-article Fine Structure in the Red Algae. III. A General Survey of Cell-Wall Structure in the Red Algae A. Myers R. D. Preston A general survey of cell-wall structure in the red algae has been carried out using the methods of X-ray...

1959-01-01T23:59:59.000Z

42

Formation of thin walled ceramic solid oxide fuel cells  

DOE Patents [OSTI]

To reduce thermal stress and improve bonding in a high temperature monolithic solid oxide fuel cell (SOFC), intermediate layers are provided between the SOFC's electrodes and electrolyte which are of different compositions. The intermediate layers are comprised of a blend of some of the materials used in the electrode and electrolyte compositions. Particle size is controlled to reduce problems involving differential shrinkage rates of the various layers when the entire structure is fired at a single temperature, while pore formers are provided in the electrolyte layers to be removed during firing for the formation of desired pores in the electrode layers. Each layer includes a binder in the form of a thermosetting acrylic which during initial processing is cured to provide a self-supporting structure with the ceramic components in the green state. A self-supporting corrugated structure is thus formed prior to firing, which the organic components of the binder and plasticizer removed during firing to provide a high strength, high temperature resistant ceramic structure of low weight and density.

Claar, Terry D. (Tisle, IL); Busch, Donald E. (Hinsdale, IL); Picciolo, John J. (Lockport, IL)

1989-01-01T23:59:59.000Z

43

Understanding Free and Complexed Enzyme Mechanisms and Factors Contributing to Cell Wall Recalcitrance (Presentation)  

SciTech Connect (OSTI)

Fungal free enzymes and bacterial complexed cellulosomes deconstruct biomass using different physical mechanisms. Free enzymes, which typically contain a large proportion of GH7 cellobiohydrolase, diffuse throughout the substrate and hydrolyze primarily from the cellulose reducing end, resulting in 'sharpened' macrofibrils. In contrast, complexed cellulosomes contain a diverse array of carbohydrate binding modules and multiple catalytic specificities leading to delamination and physical peeling of the cellulose macrofibril structures. To investigate how cellulose structure contributes to recalcitrance, we compared the deconstruction of cellulose I, II, and III; using free and complexed enzyme systems. We also evaluated both systems on Clean Fractionation and alkaline pretreated biomass, which remove much of the lignin, to determine the impact on enzyme loading reduction. Free fungal enzymes demonstrated a swelling of the outer surface of the plant cell walls while removing localized disruptions, resulting in a smooth surface appearance. Cellulosomes produced cell wall surfaces with localized areas of disruption and little surface layer swelling. These studies contribute to the overall understanding of biomass recalcitrance and how combining different enzymatic paradigms may lead to the formulation of new enzyme cocktails to reduce the cost of producing sugars from plant cell wall carbohydrates.

Resch, M.; Donohoe, B.; Katahira, R.; Ashutosh, M.; Beckham, G.; Himmel, M.; Decker, S.

2014-04-01T23:59:59.000Z

44

Self-Assembled Micro-Honeycomb Network of Single-Walled Carbon Nanotubes for Heterojunction Solar Cells  

E-Print Network [OSTI]

Self-Assembled Micro-Honeycomb Network of Single-Walled Carbon Nanotubes for Heterojunction Solar@photon.t.u-tokyo.ac.jp Keywords: Self-assembly, micro-honeycomb network, single-walled carbon nanotubes, heterojunction solar cell-assembled micro-honeycomb network (-HN) of SWNTs obtained by water or ethanol vapor treatment of as

Maruyama, Shigeo

45

Label-free in situ imaging of lignification in the cell wall of low lignin transgenic Populus trichocarpa  

E-Print Network [OSTI]

the cell wall of low lignin transgenic Populus trichocarpaand 1,700 cm ¡1 , diVerences in lignin signal intensity andSpatial heterogeneity in the lignin composition, in particu-

2009-01-01T23:59:59.000Z

46

Enhanced solar energy conversion in Au-doped, single-wall carbon nanotube-Si heterojunction cells  

Science Journals Connector (OSTI)

The power conversion efficiency (PCE) of single-wall carbon ... improved electrical conductivity of SCNT by increasing the carrier concentration and the enhancing the absorbance of ... doped SCNT/Si cells possess...

Leifeng Chen; Hong He; Shijun Zhang; Chen Xu; Jianjiang Zhao…

2013-05-01T23:59:59.000Z

47

Impact resistance and energy absorption of regular and functionally graded hexagonal honeycombs with cell wall material strain hardening  

Science Journals Connector (OSTI)

Abstract This paper highlights the effects of cell wall material strain hardening and density functional gradation (FG) on in-plane constant-velocity dynamic crushing response and impact behavior of hexagonal honeycombs. Results show that cell wall material strain hardening influences the distinct deformation modes induced by crushing velocity generally observed in regular hexagonal honeycombs. This is seen by a delay in the onset of localized deformation up until intermediate crushing velocities after which localization becomes dominant smearing out differences brought about by cell wall material strain hardening (plasticity convergence). In addition, during the impact loading on regular honeycombs, it was found that increasing the cell wall material strain hardening decreases the rate of gain of maximum crushing strain with increments in initial kinetic energy of impact. On the other hand, introducing FG brings about new deformation patterns due to changes in material distribution and preferential cell wall collapse of the weaker members. Interestingly, although the dynamic localization effect at higher crushing velocities observed earlier was not found to be particularly affected by FG, gradient convergence (i.e. smearing out the effects of FG due to higher velocities analogous to plasticity convergence) was not observed. On the contrary, gradient convergence emerged at higher impacting velocities primarily brought about by a combination of initial deformation localization and its subsequent advancement into FG region ahead. The kinetic energy threshold for the emergence of this gradient convergence effect was found to be considerably delayed by cell wall material strain hardening.

D. Mousanezhad; R. Ghosh; A. Ajdari; A.M.S. Hamouda; H. Nayeb-Hashemi; A. Vaziri

2014-01-01T23:59:59.000Z

48

Effects of Streptococcal Cell Wall Fragments on Phagocytosis and Tissue Culture Cells  

Science Journals Connector (OSTI)

...cells to the culture vessel. An effect of disengaging cells was not suggested...controls. This may represent an effect on the cell surface which tends to increase adherence. The relation- ship of this effect to the growth inhibitory prop...

Joe M. Jones; John H. Schwab

1970-03-01T23:59:59.000Z

49

Disrupting Two Arabidopsis thaliana Xylosyltransferase Genes Results in Plants Deficient in Xyloglucan, a Major Primary Cell Wall Component  

Science Journals Connector (OSTI)

...1995). Identification of novel cell surface epitopes using a leaf epidermal-strip...Monoclonal antibodies to plant cell wall xylans and arabinoxylans. J. Histochem. Cytochem...DNA, Bacterial 0 Glucans 0 T-DNA 0 Xylans 37294-28-3 xyloglucan EC 2.4.2...

David M. Cavalier; Olivier Lerouxel; Lutz Neumetzler; Kazuchika Yamauchi; Antje Reinecke; Glenn Freshour; Olga A. Zabotina; Michael G. Hahn; Ingo Burgert; Markus Pauly; Natasha V. Raikhel; Kenneth Keegstra

2008-06-10T23:59:59.000Z

50

Arabidopsis VASCULAR-RELATED NAC-DOMAIN6 Directly Regulates the Genes That Govern Programmed Cell Death and Secondary Wall Formation during Xylem Differentiation  

Science Journals Connector (OSTI)

...wall, namely, cellulose, xylan, and lignin. In addition to...cell wall over the entire cell surface, without forming a pattern...FLA12. IRX9 is required for xylan synthesis in the secondary cell...components: cellulose, lignin, and xylan (Zhong et al., 2007; McCarthy...

Kyoko Ohashi-Ito; Yoshihisa Oda; Hiroo Fukuda

2010-10-15T23:59:59.000Z

51

Differential Damage in Bacterial Cells by Microwave Radiation on the Basis of Cell Wall Structure  

Science Journals Connector (OSTI)

...consistent when the microwave radiation was repeated. Changes in the...NaCl was exposed to microwave radiation at 600 W, and its temperature...U200; Hitachi Co., Tokyo, Japan). All the experiments were...cells were treated by microwave radiation, the shape of the cells was...

Im-Sun Woo; In-Koo Rhee; Heui-Dong Park

2000-05-01T23:59:59.000Z

52

Disrupting the wall accumulation of human sperm cells by artificial corrugation  

E-Print Network [OSTI]

Many self-propelled microorganisms are attracted to surfaces. This makes their dynamics in restricted geometries very different from that observed in the bulk. Swimming along walls is beneficial for directing and sorting cells, but may be detrimental if homogeneous populations are desired, such as in counting microchambers. In this work, we characterize the motion of human sperm cells $\\sim$60$\\mu$m long, strongly confined to $\\sim$20$\\mu$m shallow chambers. We investigate the nature of the cell trajectories between the confining surfaces and their accumulation near the borders. Observed cell trajectories are composed of a succession of quasi-circular and quasi-linear segments. This suggests that the cells follow a path of intermittent trappings near the top and bottom surfaces separated by stretches of quasi-free motion in between the two surfaces. We show that the introduction of artificial petal-shaped corrugation in the lateral boundaries limits the accumulation near the borders and contributes to increase the concentration in the chamber interior. The steady state limit is achieved over times of the order of minutes, which agrees well with a theoretical estimate based on the assumption that the cell mean-square displacement is largely due to the quasi-linear segments. Pure quasi-circular trajectories would require several hours to stabilize. Our predictions also indicate that stabilization proceeds 2.5 times faster in the corrugated chambers than in the non-corrugated ones, which is another practical reason to prefer the former for microfluidic applications in biomedicine.

H. A. Guidobaldi; Y. Jeyaram; C. A. Condat; M. Oviedo; I. Berdakin; V. V. Moshchalkov; L. C. Giojalas; A. V. Silhanek; V. I. Marconi

2015-01-07T23:59:59.000Z

53

Systems Level Engineering of Plant Cell Wall Biosynthesis to Improve Biofuel Feedstock Quality  

SciTech Connect (OSTI)

Our new regulatory model of cell wall biosynthesis proposes original network architecture with several newly incorporated components. The mapped set of protein-DNA interactions will serve as a foundation for 1) understanding the regulation of a complex and integral plant component and 2) the manipulation of crop species for biofuel and biotechnology purposes. This study revealed interesting and novel aspects of grass growth and development and further enforce the importance of a grass model system. By functionally characterizing a suite of genes, we have begun to improve the sparse model for transcription regulation of biomass accumulation in grasses. In the process, we have advanced methodology and brachy molecular genetic tools that will serve as valuable community resource.

Hazen, Samuel

2013-09-27T23:59:59.000Z

54

Rapid Determination of Lignin Content via Direct Dissolution and 1HNMR Analysis of Plant Cell Walls  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

02/cssc.201000120 02/cssc.201000120 Rapid Determination of Lignin Content via Direct Dissolution and 1 H NMR Analysis of Plant Cell Walls Nan Jiang, [a, b] Yunqiao Pu, [b] and Arthur J. Ragauskas* [a, b] Increasing societal demand for environmental and economic sustainability is placing a renewed focus on the agro-forest in- dustry. This industry plays an essential role in the development of renewable energy and biofuels, especially in light of grow- ing concerns related to energy security and climate change. [1] The economical transformation of differing sources of biomass into biofuels has become a global research theme, directed at displacing nonrenewable petroluem-based resources to reduce long-term carbon dioxide emissions. [2] Although most current bioethanol and biodiesel plants represent first-generation biorefi- neries, utilizing readily processa- ble bioresources such as

55

Systematic Search for Cultivatable Fungi That Best Deconstruct Cell Walls of Miscanthus and Sugarcane in the Field  

Science Journals Connector (OSTI)

...berkeley.edu . 1 Energy Biosciences Institute...plant cell walls to make renewable transportation fuels...transportation fuels are C4 energy crops, e.g., Miscanthus...Sugarcane is widely used in Brazil, where sugarcane-derived...that cause disease in energy crops (1, 28, 29...

Prachand Shrestha; Timothy M. Szaro; Thomas D. Bruns; John W. Taylor

2011-06-17T23:59:59.000Z

56

Gene expression and enzyme activity of cell wall degrading enzymes in the latex of opium poppy Papaver somniferum L.  

E-Print Network [OSTI]

of pharmaceuticals. The continuous network allows large volumes of the latex to be released from the plant upon wounding, and is the preferred method for collecting the latex for the illegal drug trade. By studying the process of laticifer cell wall degradation...

Pilatzke, Innes Flora Christina

1999-01-01T23:59:59.000Z

57

Cellulose Binding Protein from the Parasitic Nematode Heterodera schachtii Interacts with Arabidopsis Pectin Methylesterase: Cooperative Cell Wall Modification during Parasitism  

Science Journals Connector (OSTI)

...Two-week-old seedlings were inoculated with 250 surface-sterilized J2 Heterodera schachtii or...d, each plant was inoculated with 150 surface-sterilized J2 of H. schachtii, and...recognition of plant cell walls by microbial xylan-specific carbohydrate-binding modules...

Tarek Hewezi; Peter Howe; Tom R. Maier; Richard S. Hussey; Melissa Goellner Mitchum; Eric L. Davis; Thomas J. Baum

2008-11-11T23:59:59.000Z

58

Cellulose Binding Protein from the Parasitic Nematode Heterodera schachtii Interacts with Arabidopsis Pectin Methylesterase: Cooperative Cell Wall Modification during Parasitism  

Science Journals Connector (OSTI)

...seedlings were inoculated with 250 surface-sterilized J2 Heterodera...plant was inoculated with 150 surface-sterilized J2 of H. schachtii...manufacturers instructions. DNase treatment of total RNA was performed...plant cell walls by microbial xylan-specific carbohydrate-binding...

Tarek Hewezi; Peter Howe; Tom R. Maier; Richard S. Hussey; Melissa Goellner Mitchum; Eric L. Davis; Thomas J. Baum

2008-11-11T23:59:59.000Z

59

Uniformity of Glycyl Bridge Lengths in the Mature Cell Walls of Fem Mutants of Methicillin-Resistant Staphylococcus aureus  

Science Journals Connector (OSTI)

...Berger-Baechi, A Tossi, H-G Sahl, and I Wiedemann...pentaglycine interpeptide bridge containing cell wall...Roos, J Wecke, and H Labischinski. 1996...peptidoglycan interpeptide bridge biosynthesis: a novel...Stranden AM , K Ehlert, H Labischinski, and...monoglycine cross-bridges and methicillin hypersusceptibility...

Shasad Sharif; Sung Joon Kim; Harald Labischinski; Jiawei Chen; Jacob Schaefer

2013-01-18T23:59:59.000Z

60

Structural Evidence for the Evolution of Xyloglucanase Activity from Xyloglucan Endo-Transglycosylases: Biological Implications for Cell Wall Metabolism  

Science Journals Connector (OSTI)

...pGEM T Easy (Promega) vector system, and 10 positive clones were...NHS-activated groups), was pumped through the column overnight...2000). Mobilisation of storage cell wall polysaccharides in...structure of a mixed-oligomer storage xyloglucan from seeds of Hymenaea...

Martin J. Baumann; Jens M. Eklöf; Gurvan Michel; �sa M. Kallas; Tuula T. Teeri; Mirjam Czjzek; Harry Brumer III

2007-06-08T23:59:59.000Z

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Imaging and quantitative data acquisition of biological cell walls with Atomic Force Microscopy and Scanning Acoustic Microscopy  

SciTech Connect (OSTI)

This chapter demonstrates the feasibility of Atomic Force Microscopy (AFM) and High Frequency Scanning Acoustic Microscopy (HF-SAM) as tools to characterize biological tissues. Both the AFM and the SAM have shown to provide imaging (with different resolution) and quantitative elasticity measuring abilities. Plant cell walls with minimal disturbance and under conditions of their native state have been examined with these two kinds of microscopy. After descriptions of both the SAM and AFM, their special features and the typical sample preparation is discussed. The sample preparation is focused here on epidermal peels of onion scales and celery epidermis cells which were sectioned for the AFM to visualize the inner surface (closest to the plasma membrane) of the outer epidermal wall. The nm-wide cellulose microfibrils orientation and multilayer structure were clearly observed. The microfibril orientation and alignment tend to be more organized in older scales compared with younger scales. The onion epidermis cell wall was also used as a test analog to study cell wall elasticity by the AFM nanoindentation and the SAM V(z) feature. The novelty in this work was to demonstrate the capability of these two techniques to analyze isolated, single layered plant cell walls in their natural state. AFM nanoindentation was also used to probe the effects of Ethylenediaminetetraacetic acid (EDTA), and calcium ion treatment to modify pectin networks in cell walls. The results suggest a significant modulus increase in the calcium ion treatment and a slight decrease in EDTA treatment. To complement the AFM measurements, the HF-SAM was used to obtain the V(z) signatures of the onion epidermis. These measurements were focused on documenting the effect of pectinase enzyme treatment. The results indicate a significant change in the V(z) signature curves with time into the enzyme treatment. Thus AFM and HF-SAM open the door to a systematic nondestructive structure and mechanical property study of complex biological cell walls. A unique feature of this approach is that both microscopes allow the biological samples to be examined in their natural fluid (water) environment.

Tittmann, B. R. [Penn State; Xi, X. [Penn State

2014-09-01T23:59:59.000Z

62

Populus trichocarpa cell wall chemistry and ultrastructure trait variation, genetic control and genetic correlations  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Populus Populus trichocarpa cell wall chemistry and ultrastructure trait variation, genetic control and genetic correlations Ilga Porth 1 *, Jaroslav Kla ´ ps ˇte ˇ 2 *, Oleksandr Skyba 1 , Ben S. K. Lai 1 , Armando Geraldes 3 , Wellington Muchero 4 , Gerald A. Tuskan 4 , Carl J. Douglas 3 , Yousry A. El-Kassaby 2 and Shawn D. Mansfield 1 1 Department of Wood Science, Faculty of Forestry, University of British Columbia, Vancouver, BC, V6T 1Z4, Canada; 2 Department of Forest Sciences, Faculty of Forestry, University of British Columbia, Vancouver, BC, V6T 1Z4, Canada; 3 Department of Botany, University of British Columbia, Vancouver, BC, V6T 1Z4, Canada; 4 BioSciences Division, Oak Ridge National Laboratory, Oak Ridge, TN, 37831, USA Authors for correspondence: Shawn D. Mansfield Tel: +1 604 822 0196 Email: shawn.mansfield@ubc.ca Yousry A. El-Kassaby Tel: +1 604 822 1821 Email: y.el-kassaby@ubc.ca

63

New Combined Laser Ablation Platform Determines Cell Wall Chemistry (Fact Sheet)  

SciTech Connect (OSTI)

NREL has designed and developed a combined laser ablation/pulsed sample introduction/mass spectrometry platform that integrates pyrolysis and/or laser ablation with resonance-enhanced multiphoton ionization (REMPI) time-of-flight mass spectrometry. Using this apparatus, we can measure the cell wall chemical composition of untreated biomass materials. Understanding the chemical composition of untreated biomass is key to both the biochemical and thermochemical conversion of lignocellulosic biomass to biofuels. In the biochemical conversion process, the new technique provides a better understanding of the chemistry of lignin and will improve accessibility to plant sugars. In thermochemical conversion, the information provided by the new technique may help to reduce the formation of unwanted byproducts during gasification. NREL validated the ability of the system to detect pyrolysis products from plant materials using poplar, a potentially high-impact bioenergy feedstock. In the technique, biomass vapors are produced by laser ablation using the 3rd harmonic of an Nd:YAG laser (355 nm). The resulting vapors are entrained in a free jet expansion of helium, then skimmed and introduced into an ionization region. REMPI is used to ionize the vapors because it is highly sensitive for detecting lignin and aromatic metabolites. The laser ablation method was used to selectively volatilize specific plant tissues and detect lignin-based products from the vapors with enhanced sensitivity. This will allow the determination of lignin distribution in future biomass studies.

Not Available

2011-09-01T23:59:59.000Z

64

Highly purified, multi-wall carbon nanotubes induce light-chain 3B expression in human lung cells  

SciTech Connect (OSTI)

Highlights: •HTT2800-treated BEAS-2B cells induced LC3B in a time-dependent manner. •HTT2800-treated BEAS-2B cells showed decreased cell proliferation that was both time- and dose-dependent. •Addition of 3-MA, LC3B-II protein and mRNA levels were significantly decreased. •3-MA and E64-d + pepstatin A, but not brefeldin A, provided protection against HTT2800-induced cell death. •These results suggest that HTT2800 predominantly causes autophagy rather than apoptotic cell death in BEAS-2B cells. -- Abstract: Bronchial epithelial cells are targets of inhalation and play a critical role in the maintenance of mucosal integrity as mechanical barriers against various particles. Our previous result suggest that vapor-grown carbon fiber, HTT2800, which is one of the most highly purified multi-wall carbon nanotubes (MWCNT) showed cellular uptake of the carbon nanotube, increased cell death, enhanced DNA damage, and induced cytokine release. Increasing evidence suggests that autophagy may critically influence vital cellular processes such as apoptosis, cell proliferation and inflammation and thereby may play a critical role in pulmonary diseases. Autophagy was recently recognized as a critical cell death pathway, and autophagosome accumulation has been found to be associated with the exposure of various nanoparticles. In this study, the authors focus on the autophagic responses of HTT2800 exposure. The HTT2800-exposed cells induced LC3B expression and induced cell growth inhibition.

Tsukahara, Tamotsu, E-mail: ttamotsu@kanazawa-med.ac.jp [Department of Hematology and Immunology, Kanazawa Medical University, 1-1 Daigaku, Uchinada, Ishikawa 920-0293 (Japan)] [Department of Hematology and Immunology, Kanazawa Medical University, 1-1 Daigaku, Uchinada, Ishikawa 920-0293 (Japan); Matsuda, Yoshikazu [Clinical Pharmacology Educational Center, Nihon Pharmaceutical University, Ina-machi, Saitama 362-0806 (Japan)] [Clinical Pharmacology Educational Center, Nihon Pharmaceutical University, Ina-machi, Saitama 362-0806 (Japan); Usui, Yuki [Research Center for Exotic Nanocarbons, Shinshu University, 4-17-1 Wakasato, Nagano-shi, Nagano 380-8553 (Japan)] [Research Center for Exotic Nanocarbons, Shinshu University, 4-17-1 Wakasato, Nagano-shi, Nagano 380-8553 (Japan); Haniu, Hisao [Department of Orthopaedic Surgery, Shinshu University School of Medicine, 3-1-1 Asahi, Matsumoto, Nagano 390-8621 (Japan)] [Department of Orthopaedic Surgery, Shinshu University School of Medicine, 3-1-1 Asahi, Matsumoto, Nagano 390-8621 (Japan)

2013-10-18T23:59:59.000Z

65

Genome-Scale Discovery of Cell Wall Biosynthesis Genes in Populus (JGI Seventh Annual User Meeting 2012: Genomics of Energy and Environment)  

ScienceCinema (OSTI)

Wellington Muchero from Oak Ridge National Laboratory gives a talk titled "Discovery of Cell Wall Biosynthesis Genes in Populus" at the JGI 7th Annual Users Meeting: Genomics of Energy & Environment Meeting on March 22, 2012 in Walnut Creek, California.

Muchero, Wellington [Oak Ridge National Laboratory

2013-01-22T23:59:59.000Z

66

BEL1-LIKE HOMEODOMAIN6 and KNOTTED ARABIDOPSIS THALIANA7 Interact and Regulate Secondary Cell Wall Formation via Repression of REVOLUTA  

Science Journals Connector (OSTI)

...figures in this article are displayed in color online but in black and white in the print edition. [W] Online version contains Web-only data. A negatively acting regulatory module in secondary cell wall biosynthesis involving three transcription factors...

Yuanyuan Liu; Shijun You; Mallorie Taylor-Teeples; Wenhua L. Li; Mathias Schuetz; Siobhan M. Brady; Carl J. Douglas

2014-12-09T23:59:59.000Z

67

CVD growth control and solar cell application of single-walled carbon nanotubes  

E-Print Network [OSTI]

demonstrated the air-stable SWNT/Si solar cells with power conversion efficiency (PCE) approaching 11% for the first time. The PCE of the solar cell slightly increases after 10-month ambient #12;ii exposure-HN to the SWNT-Si solar cell results in both high PCE and high fill factor. Note that the achieved PCE

Maruyama, Shigeo

68

Genome-Wide Distribution of Transposed Dissociation Elements in Maize  

Science Journals Connector (OSTI)

...Use of the transposon Ac as a gene-searching engine in the maize genome. Plant Cell 14 : 713-726...WebLogo: A Sequence Logo Generator. (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press). Das, L. and Martienssen...

Erik Vollbrecht; Jon Duvick; Justin P. Schares; Kevin R. Ahern; Prasit Deewatthanawong; Ling Xu; Liza J. Conrad; Kazuhiro Kikuchi; Tammy A. Kubinec; Bradford D. Hall; Rebecca Weeks; Erica Unger-Wallace; Michael Muszynski; Volker P. Brendel; Thomas P. Brutnell

2010-06-25T23:59:59.000Z

69

E-Print Network 3.0 - affects cell wall Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Berkeley, CA 94720-1710 Phone: (510) 642-4528, Home office Phone and Fax: (925) 946-0903 Cell Phone Source: Astaneh-Asl, Abolhassan - Department of Civil and Environmental...

70

Modeling and optimization of a test-cell upgrade for MFTF-B operating in the high neutron wall loading mode  

SciTech Connect (OSTI)

Models of the plasma particle and power balances in a tandem mirror with a high-field test-cell insert in the central cell have been used to calculate operating points for test-cell upgrades of the MFTF-B configuration. The code results have been benchmarked against the proposal plasma parameters for the MFTF-..cap alpha..+T configuration operating in the high neutron wall loading mode. Some parametric studies have been done. Using the results from these parametrics an optimized set of operating parameters for an MFTF-..cap alpha..+T-like configuration with a test-cell which will accommodate two 1.5 m long blanket test modules has been generated. This operating point has the same test-cell neutron wall loading as the original configuration and lower input powers to other systems in the device. The neutral beam power per unit blanket module length is also somewhat reduced in the optimized case.

Fenstermacher, M.E.

1985-04-03T23:59:59.000Z

71

Three Human Cell Types Respond to Multi-Walled Carbon Nanotubes and Titanium Dioxide Nanobelts with Cell-Specific Transcriptomic and Proteomic Expression Patterns.  

SciTech Connect (OSTI)

The growing use of engineered nanoparticles (NPs) in commercial and medical applications raises the urgent need for tools that can predict NP toxicity. Global transcriptome and proteome analyses were conducted on three human cell types, exposed to two high aspect ratio NP types, to identify patterns of expression that might indicate high versus low NP toxicity. Three cell types representing the most common routes of human exposure to NPs, including macrophage-like (THP-1), small airway epithelial and intestinal (Caco-2/HT29-MTX) cells, were exposed to TiO2 nanobelts (TiO2-NB; high toxicity) and multi-walled carbon nanotubes (MWCNT; low toxicity) at low (10 µg/mL) and high (100 µg/mL) concentrations for 1 and 24 h. Unique patterns of gene and protein expressions were identified for each cell type, with no differentially expressed (p < 0.05, 1.5-fold change) genes or proteins overlapping across all three cell types. While unique to each cell type, the early response was primarily independent of NP type, showing similar expression patterns in response to both TiO2-NB and MWCNT. The early response might, therefore, indicate a general response to insult. In contrast, the 24 h response was unique to each NP type. The most significantly (p < 0.05) enriched biological processes in THP-1 cells indicated TiO2-NB regulation of pathways associated with inflammation, apoptosis, cell cycle arrest, DNA replication stress and genomic instability, while MWCNT-regulated pathways indicated increased cell proliferation, DNA repair and anti-apoptosis. These two distinct sets of biological pathways might, therefore, underlie cellular responses to high and low NP toxicity, respectively.

Tilton, Susan C.; Karin, Norman J.; Tolic, Ana; Xie, Yumei; Lai, Xianyin; Hamilton, Raymond F.; Waters, Katrina M.; Holian, Andrij; Witzmann, Frank A.; Orr, Galya

2014-08-01T23:59:59.000Z

72

Theory of Elastic Interaction of the Colloidal Particles in the Nematic Liquid Crystal Near One Wall and in the Nematic Cell  

E-Print Network [OSTI]

We apply the method developed in Ref. [S.B.Chernyshuk and B.I.Lev, Phys.Rev.E, \\textbf{81}, 041701 (2010)] for theoretical investigation of colloidal elastic interactions between axially symmetric particles in the confined nematic liquid crystal (NLC) near one wall and in the nematic cell with thickness $L$. Both cases of homeotropic and planar director orientations are considered. Particularly dipole-dipole, dipole-quadrupole and quadrupole-quadrupole interactions of the \\textit{one} particle with the wall and within the nematic cell are found as well as corresponding \\textit{two particle} elastic interactions. A set of new results has been predicted: the effective power of repulsion between two dipole particles at height $h$ near the homeotropic wall is reduced gradually from inverse 3 to 5 with an increase of dimensionless distance $r/h$; near the planar wall - the effect of dipole-dipole \\textit{isotropic attraction} is predicted for large distances $r>r_{dd}=4.76 h$; maps of attraction and repulsion zones are crucially changed for all interactions near the planar wall and in the planar cell; one dipole particle in the homeotropic nematic cell was found to be shifted by the distance $\\delta_{eq}$ from the center of the cell \\textit{independent} of the thickness $L$ of the cell. The proposed theory fits very well with experimental data for the confinement effect of elastic interaction between spheres in the homeotropic cell taken from [M.Vilfan et al. Phys.Rev.Lett. {\\bf 101}, 237801, (2008)] in the range $1\\div1000 kT$.

S. B. Chernyshuk; B. I. Lev

2011-01-10T23:59:59.000Z

73

An Arabidopsis Cell Wall Proteoglycan Consists of Pectin and Arabinoxylan Covalently Linked to an Arabinogalactan Protein  

Science Journals Connector (OSTI)

...tpc.112.107334 Pectin and xylan are generally considered as...extractability of pectin and xylan immunoreactive epitopes in apap1...S. (2012). An update on xylan synthesis. Mol. Plant 5...key regulators at the cell surface? Plant Physiol. 153 : 403-419...

Li Tan; Stefan Eberhard; Sivakumar Pattathil; Clayton Warder; John Glushka; Chunhua Yuan; Zhangying Hao; Xiang Zhu; Utku Avci; Jeffrey S. Miller; David Baldwin; Charles Pham; Ronald Orlando; Alan Darvill; Michael G. Hahn; Marcia J. Kieliszewski; Debra Mohnen

2013-01-31T23:59:59.000Z

74

Substitution of l-Fucose by l-Galactose in Cell Walls of Arabidopsis mur1  

Science Journals Connector (OSTI)

...Mass, Fast Atom Bombardment Xylans deletion results...later. Cells were stained for surface B220 and CD43 or IgM and treated...value is the average of four treatments. Error bars indicate the standard...de-viation. The value of each treatment was calcu-lated from measurements...

Earl Zablackis; William S. York; Markus Pauly; Stephen Hantus; Wolf-Dieter Reiter; Clint C. S. Chapple; Peter Albersheim; Alan Darvill

1996-06-21T23:59:59.000Z

75

Proteins from Plant Cell Walls Inhibit Polygalacturonases Secreted by Plant Pathogens  

Science Journals Connector (OSTI)

...present in cell-surface polymers of the animal...cultures grown on xylan and cellulose, respectively...1% solutions of xylan (Koch-Light Laboratories...ammonium sulfate treatment yielded the proteins...oligosaccharide on the surface of the enzyme rather...

Peter Albersheim; Anne J. Anderson

1971-01-01T23:59:59.000Z

76

Requirement of Borate Cross-Linking of Cell Wall Rhamnogalacturonan II for Arabidopsis Growth  

Science Journals Connector (OSTI)

...respective monomers by treatment for 30 min at 20...and 5mM SrCl 2 . This treatment ensured that...0 Polysaccharides 0 Xylans 0 rhamnogalacturonan...plants because boric acid treatment promotes the growth...structures of cell-surface carbohydrates...

Malcolm A. O'Neill; Stefan Eberhard; Peter Albersheim; Alan G. Darvill

2001-10-26T23:59:59.000Z

77

Ectopic Lignification in the Flax lignified bast fiber1 Mutant Stem Is Associated with Tissue-Specific Modifications in Gene Expression and Cell Wall Composition  

Science Journals Connector (OSTI)

...figures in this article are displayed in color online but in black and white in the print edition. [W] Online version contains Web-only data. The cell walls of flax bast fibers contain high cellulose and low lignin levels, imparting tensile strength and...

Maxime Chantreau; Antoine Portelette; Rebecca Dauwe; Shingo Kiyoto; David Crônier; Kris Morreel; Sandrine Arribat; Godfrey Neutelings; Malika Chabi; Wout Boerjan; Arata Yoshinaga; François Mesnard; Sebastien Grec; Brigitte Chabbert; Simon Hawkins

2014-11-07T23:59:59.000Z

78

UDP-Glucose 4-Epimerase Isoforms UGE2 and UGE4 Cooperate in Providing UDP-Galactose for Cell Wall Biosynthesis and Growth of Arabidopsis thaliana  

Science Journals Connector (OSTI)

...Plant Growth Arabidopsis seeds were surface-sterilized in 5% cleaning bleach...scanning electron microscope. Sublimation of surface frost was performed at C for 3 min before...Monoclonal antibodies to plant cell wall xylans and arabinoxylans. J. Histochem. Cytochem...

Johannes Rösti; Christopher J. Barton; Sandra Albrecht; Paul Dupree; Markus Pauly; Kim Findlay; Keith Roberts; Georg J. Seifert

2007-05-11T23:59:59.000Z

79

Systems Biology Approaches to Dissecting Plant Cell Wall Biosynthesis Genes in Poplus (JGI Seventh Annual User Meeting 2012: Genomics of Energy and Environment)  

ScienceCinema (OSTI)

N. Louise Glass from the University of California, Berkeley, presents a talk titled "Systems Biology Approaches to Dissecting Plant Cell Wall Biosynthesis Genes in Poplus" at the JGI 7th Annual Users Meeting: Genomics of Energy & Environment Meeting on March 22, 2012 in Walnut Creek, California.

Glass, N Louise [UC Berkeley

2013-01-25T23:59:59.000Z

80

Real-Time Imaging of Plant Cell Wall Structure at Nanometer Scale, with Respect to Cellulase Accessibility and Degradation Kinetics (Presentation)  

SciTech Connect (OSTI)

Presentation on real-time imaging of plant cell wall structure at nanometer scale. Objectives are to develop tools to measure biomass at the nanometer scale; elucidate the molecular bases of biomass deconstruction; and identify factors that affect the conversion efficiency of biomass-to-biofuels.

Ding, S. Y.

2012-05-01T23:59:59.000Z

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Evaluation of Yeast Cell Wall on Early Production Laying Hen Performance  

E-Print Network [OSTI]

from non-hydrolyzable oligo and polysaccharides increases the proliferation of the gut epithelial cells, thus increasing intestinal tissue weight, with changes in the overall morphology of intestinal mucosa (Niba et al., 2009; Bonos et al., 2011... and multiply within the digestive tract mucosa (Baurhoo et al., 2007b; Bonos et al., 2011; Jacobs, 2011). Types of prebiotics Most identified prebiotics are classified as carbohydrate oligosaccharides with differing molecular structure that are normally...

Hashim, Mohammed Malik Hashim 1981-

2012-11-08T23:59:59.000Z

82

Coccidioides immitis vaccine: potential of an alkali-soluble, water-soluble cell wall antigen  

E-Print Network [OSTI]

consistently fai led to protect recipients against chal I enge (3, 29) . Vaccine trials in coccidioldcmycosis have been conducted by Kong (26, 29), Levine (3I, 35), Pappagi anis (38, 39, 4I, 42) and others (4, 5, 7-IO, 20, 45, 53). These investigators... stable attenuated mutant of C. immitis led investigators to assess the efficacy of killed mycelial phase (20, 31, 32, 41) and spherule phase (26, 31, 32, 53) cells as potential vaccines. Converse et al. (9) inoculated monkeys subcutaneously with 10...

Lecara, Grace

1980-01-01T23:59:59.000Z

83

Wall to Wall Optimal Transport  

E-Print Network [OSTI]

The calculus of variations is employed to find steady divergence-free velocity fields that maximize transport of a tracer between two parallel walls held at fixed concentration for one of two constraints on flow strength: a fixed value of the kinetic energy or a fixed value of the enstrophy. The optimizing flows consist of an array of (convection) cells of a particular aspect ratio Gamma. We solve the nonlinear Euler-Lagrange equations analytically for weak flows and numerically (and via matched asymptotic analysis in the fixed energy case) for strong flows. We report the results in terms of the Nusselt number Nu, a dimensionless measure of the tracer transport, as a function of the Peclet number Pe, a dimensionless measure of the energy or enstrophy of the flow. For both constraints the maximum transport Nu_{MAX}(Pe) is realized in cells of decreasing aspect ratio Gamma_{opt}(Pe) as Pe increases. For the fixed energy problem, Nu_{MAX} \\sim Pe and Gamma_{opt} \\sim Pe^{-1/2}, while for the fixed enstrophy scenario, Nu_{MAX} \\sim Pe^{10/17} and Gamma_{opt} \\sim Pe^{-0.36}. We also interpret our results in the context of certain buoyancy-driven Rayleigh-Benard convection problems that satisfy one of the two intensity constraints, enabling us to investigate how the transport scalings compare with upper bounds on Nu expressed as a function of the Rayleigh number \\Ra. For steady convection in porous media, corresponding to the fixed energy problem, we find Nu_{MAX} \\sim \\Ra and Gamma_{opt} \\sim Ra^{-1/2}$, while for steady convection in a pure fluid layer between free-slip isothermal walls, corresponding to fixed enstrophy transport, Nu_{MAX} \\sim Ra^{5/12} and Gamma_{opt} \\sim Ra^{-1/4}.

Pedram Hassanzadeh; Gregory P. Chini; Charles R. Doering

2014-04-14T23:59:59.000Z

84

Role of Sulfhydryl Sites on Bacterial Cell Walls in the Biosorption, Mobility and Bioavailability of Mercury and Uranium  

SciTech Connect (OSTI)

The goal of this exploratory study is to provide a quantitative and mechanistic understanding of the impact of bacterial sulfhydryl groups on the bacterial uptake, speciation, methylation and bioavailability of Hg and redox changes of uranium. The relative concentration and reactivity of different functional groups present on bacterial surfaces will be determined, enabling quantitative predictions of the role of biosorption of Hg under the physicochemical conditions found at contaminated DOE sites.The hypotheses we propose to test in this investigation are as follows- 1) Sulfhydryl groups on bacterial cell surfaces modify Hg speciation and solubility, and play an important role, specifically in the sub-micromolar concentration ranges of metals in the natural and contaminated systems. 2) Sulfhydryl binding of Hg on bacterial surfaces significantly influences Hg transport into the cell and the methylation rates by the bacteria. 3) Sulfhydryls on cell membranes can interact with hexavalent uranium and convert to insoluble tetravalent species. 4) Bacterial sulfhydryl surface groups are inducible by the presence of metals during cell growth. Our studies focused on the first hypothesis, and we examined the nature of sulfhydryl sites on three representative bacterial species: Bacillus subtilis, a common gram-positive aerobic soil species; Shewanella oneidensis, a facultative gram-negative surface water species; and Geobacter sulfurreducens, an anaerobic iron-reducing gram-negative species that is capable of Hg methylation; and at a range of Hg concentration (and Hg:bacterial concentration ratio) in which these sites become important. A summary of our findings is as follows- ? Hg adsorbs more extensively to bacteria than other metals. Hg adsorption also varies strongly with pH and chloride concentration, with maximum adsorption occurring under circumneutral pH conditions for both Cl-bearing and Cl-free systems. Under these conditions, all bacterial species tested exhibit almost complete removal of Hg from the experimental solutions at relatively low bacterial concentrations. ? Synchrotron based X-ray spectroscopic studies of these samples indicate that the structure and the coordination environment of Hg surface complexes on bacterial cell walls change dramatically- with sulfhydryls as the dominant Hg-binding groups in the micromolar and submicromolar range, and carboxyls and phosphoryls dominating at high micromolar concentrations. ? Hg interactions change from a trigonal or T-shaped HgS{sub 3} complex to HgS or HgS{sub 2} type complexes as the Hg concentration increases in the submicromolar range. Although all bacterial species studied exhibited the same types of coordination environments for Hg, the relative concentrations of the complexes change as a function of Hg concentration.

Myneni, Satish C.; Mishra, Bhoopesh; Fein, Jeremy

2009-04-01T23:59:59.000Z

85

Parallel Proteomic and Phosphoproteomic Analyses of Successive Stages of Maize Leaf Development  

Science Journals Connector (OSTI)

...Using examples from cell wall and hormone biology...proteome and phosphoproteome fuel hypotheses regarding...Expanding, or Mature Cells For analysis of proteotypes...hormone biosynthesis, degradation, and response (Figure...described earlier for cell wall-related proteins...

Michelle R. Facette; Zhouxin Shen; Fjola R. Björnsdóttir; Steven P. Briggs; Laurie G. Smith

2013-08-09T23:59:59.000Z

86

Self-Assembled Micro-Honeycomb Network of Single-Walled Carbon Nanotubes for Heterojunction Solar Cell  

E-Print Network [OSTI]

Self-Assembled Micro-Honeycomb Network of Single-Walled Carbon Nanotubes for Heterojunction Solar. Here, we propose a self-organized micro- honeycomb network structure of SWNTs obtained by water@photon.t.u-tokyo.ac.jp) Various forms of nano-carbon films such as random network of single-walled carbon nanotubes (SWNTs

Maruyama, Shigeo

87

Nutritional evaluation of tortillas and chips form quality protein maize and food grade maize  

E-Print Network [OSTI]

: Lo W. (Chairman of m' . . r'i J orman . So . aug (mes)ber J Karen Kubena (member ) . C. A. n (H ad of Depar ment) May 1985 ABSTRACT Nutritional Evaluation of Tortillas and Chips From Quality Protein Maize and Food Grade Maize. (May 1985... processing steps include cooking the maize in lime water, steeping (nixtamal ), washing, grinding (mass ), forming the mass into tortilla shape and then baking (Martinez-Herrera and Lachance, 1979). Optimization of the cooking procedure for making maize...

Sproule, Anastasia Marie

1985-01-01T23:59:59.000Z

88

Functional Genomics of Maize Endosperm Maturation and Protein Quality.  

E-Print Network [OSTI]

??Maize is one of the most important cereal crops and widely cultivated throughout the world. The study on maize kernel development including protein quality improvement… (more)

Yuan, Lingling

2014-01-01T23:59:59.000Z

89

Development of pachytene FISH maps for six maize chromosomes and their integration with other maize maps  

E-Print Network [OSTI]

Development of pachytene FISH maps for six maize chromosomes and their integration with other maize maps for insights into genome structure variation Debbie M. Figueroa & Hank W. Bass Received: 13 in situ hybridization (FISH) maps were devel- oped for chromosomes 1, 3, 4, 5, 6, and 8 of maize using

Ronquist, Fredrik

90

Update on the Maize Genome Sequencing Project The Maize Genome Sequencing Project  

E-Print Network [OSTI]

Update on the Maize Genome Sequencing Project The Maize Genome Sequencing Project Vicki L. Chandler Genome Sequencing Project. The momentum for this endeavor has been building within the maize (Zea mays- sion. This Update reviews the project goals and the expected deliverables deriving from the two funded

Brendel, Volker

91

Identification of PAN2 by Quantitative Proteomics as a Leucine-Rich Repeatâ??Receptor-Like Kinase Acting Upstream of PAN1 to Polarize Cell Division in Maize  

Science Journals Connector (OSTI)

...polarization of cell division is a process of fundamental importance...polarization appear to be similar and interrelated. The identities of PAN1 and...functioning in a wide variety of processes have been demonstrated to...pathways and other biological processes. Plant J. 37 : 914-939...

Xiaoguo Zhang; Michelle Facette; John A. Humphries; Zhouxin Shen; Yeri Park; Dena Sutimantanapi; Anne W. Sylvester; Steven P. Briggs; Laurie G. Smith

2012-11-21T23:59:59.000Z

92

Metabolic click-labeling with a fucose analog reveals pectin delivery, architecture, and dynamics in Arabidopsis cell walls  

Science Journals Connector (OSTI)

...2007 ) Comparison of five xylan synthesis mutants reveals new insight into the mechanisms of xylan synthesis . Plant J 52 : 1154 – 1168 . 6...wall porosity and available surface area of wheat straw and wheat...n 30 seedlings total per treatment), and seedlings in a...

Charles T. Anderson; Ian S. Wallace; Chris R. Somerville

2012-01-01T23:59:59.000Z

93

The pattern of xylan acetylation suggests xylan may interact with cellulose microfibrils as a two-fold helical screw in the secondary plant cell wall of Arabidopsis thaliana.  

E-Print Network [OSTI]

and fungi. They will also impact strategies to improve lignocellulose processing for biorefining and bioenergy. Page 4 of 64 SUBMITTED MANUSCRIPT The Plant Journal 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33... architecture of secondary cell walls will therefore be invaluable for the food, construction, paper and bioenergy sectors. The functions and pattern of decorations on the xylan backbone are still not fully clear. The xylan backbone, composed of ?-(1...

Busse-Wicher, Marta; Gomes, Thiago C. F.; Tryfona, Theodora; Nikolovski, Nino; Stott, Katherine; Grantham, Nicholas J.; Bolam, David N.; Skaf, Munir S.; Dupree, Paul D.

2014-06-02T23:59:59.000Z

94

Fertility Relationships in Maize-Teosinte Hybrids.  

E-Print Network [OSTI]

was originally obtained from southern Guatemala, had regularly 10 pairs of chromosomes, but in two of the pairs the chromosomes were of different lengths. Longley (5), in a study of the Fz hybrids of maize and the Chalco variety from Mexico, found 10 bival.... A cytological examination of chromosomes in Florida teosinte-maize hybrids revealed that chromosomes 5 and 9 of teosinte were consist- ently longer than their maize homologs, and that the long arm of these two clzromosomes did not always pair...

Rogers, John S. (John Sinclair)

1950-01-01T23:59:59.000Z

95

Macrotransposition and Other Complex Chromosomal Restructuring in Maize by Closely Linked Transposons in Direct Orientation  

Science Journals Connector (OSTI)

...2002). Use of the transposon Ac as a gene-searching engine in the maize genome. Plant Cell 14: 713-726. Dooner, H...1952). Chromosome organization and gene expression. Cold Spring Harbor Symp. Quant. Biol. 16: 13-47. McClintock, B...

Jun T. Huang; Hugo K. Dooner

2008-08-15T23:59:59.000Z

96

Controlled CVD Growth of Single-Walled Carbon Nanotubes and Application to CNT-Si Heterojunction Solar Cells  

E-Print Network [OSTI]

Solar Cells Shigeo Maruyama Department of Mechanical Engineering, The University of Tokyo 113 controlled assembly of SWNTs for SWNT-Si heterojunction solar cells will be discussed. We found SWNTs to a self-assembled micro- honeycomb network for the application of solar cells [4]. The micro

Maruyama, Shigeo

97

Controlled Growth of Single-Walled Carbon Nanotubes and Application to CNT-Si Heterojunction Solar Cells  

E-Print Network [OSTI]

assembly of SWNTs for SWNT-Si heterojunction solar cells will be discussed. We found the reversible to a self-assembled micro- honeycomb network for the application of solar cells [4]. The micro is very efficient to collect holes from the interface of Si. The heterojunction solar cell was fabricated

Maruyama, Shigeo

98

LiquidMaize LLC | Open Energy Information  

Open Energy Info (EERE)

LiquidMaize LLC LiquidMaize LLC Jump to: navigation, search Name LiquidMaize, LLC Place Denver, Colorado Zip 80237 Product LiquidMaize is an ethanol development and management company that builds, owns, and operates ethanol plants within existing cattle feed-yards and dairy operations. Coordinates 39.74001°, -104.992259° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":39.74001,"lon":-104.992259,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

99

Carbohydrate-binding modules promote the enzymatic deconstruction of intact plant cell walls by targeting and proximity effects  

Science Journals Connector (OSTI)

...is to bind soluble xylans and xylooligosaccharides on the surface of the endogenous...2009 ) Enzymatic treatments reveal differential capacities for xylan recognition and degradation...Receptors, Cell Surface 0 Xylans 0 saccharide-binding...

Cécile Hervé; Artur Rogowski; Anthony W. Blake; Susan E. Marcus; Harry J. Gilbert; J. Paul Knox

2010-01-01T23:59:59.000Z

100

XTH31, Encoding an in Vitro XEH/XET-Active Enzyme, Regulates Aluminum Sensitivity by Modulating in Vivo XET Action, Cell Wall Xyloglucan Content, and Aluminum Binding Capacity in Arabidopsis  

Science Journals Connector (OSTI)

...glucuronoxylan, glucomannan, xylan, and mannan (but not cellulose...wild-type background. Seeds were surface-sterilized and germinated...glucuronoxylan, cellulose, or xylan, giving sugar residues:AlCl3...aluminum and phosphorus on root surfaces and cell wall material. Plant...

Xiao Fang Zhu; Yuan Zhi Shi; Gui Jie Lei; Stephen C. Fry; Bao Cai Zhang; Yi Hua Zhou; Janet Braam; Tao Jiang; Xiao Yan Xu; Chuan Zao Mao; Yuan Jiang Pan; Jian Li Yang; Ping Wu; Shao Jian Zheng

2012-11-30T23:59:59.000Z

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

The effect of wind speed and direction and surrounding maize on hybrid ventilation in a dairy cow building in Denmark  

Science Journals Connector (OSTI)

Abstract This study evaluated the effect of wind speed and direction and surrounding maize field on the air exchange rate (ACH) and indoor air velocity in a dairy cow building with hybrid ventilation, which combined auto-controlled natural and partial mechanical pit ventilation. The standard k ? ? turbulence model and standard wall function were applied in CFD modeling with extension of capability to account for the aerodynamics effect of surrounding maize plant canopy in the wind domain by using user defined functions (UDF). This extended model was validated by on-site measured velocities and temperatures. A reasonably good agreement was found between simulated and measured results. The wind speed influenced ACH greatly while modeling the maize field had little effect on ACH with low wind speed. With wind speed of 3.86 m s?1 in validation case, modeling the maize field reduced total ACH by 24%, ACH via bottom openings on the sidewall by 89.7% and air speed measured upwind by 71%. The results revealed that the plant canopy had the most significant effect on ACH through the opening on the sidewall. With the variation of wind direction from 0° to 90°, the difference of ACH could be 60%.

L. Rong; D. Liu; E.F. Pedersen; G. Zhang

2015-01-01T23:59:59.000Z

102

Overexpression of the maize Corngrass1 microRNA prevents flowering, improves digestibility, and increases starch content of switchgrass  

Science Journals Connector (OSTI)

...accumulates in stems.Cg1 switchgrass aerial stems store starch and initiate both roots...maize . Plant Cell 6 : 1343 – 1355 . 28 Fukushima RS Hatfield RD ( 2004 ) Comparison of the acetyl bromide...CAAGTGCTACGGCAAGGAGG CGTGAGGGTCATTGTCTTCTGC 1. Fukushima RS, Hatfield RD (2004) Comparison...

George S. Chuck; Christian Tobias; Lan Sun; Florian Kraemer; Chenlin Li; Dean Dibble; Rohit Arora; Jennifer N. Bragg; John P. Vogel; Seema Singh; Blake A. Simmons; Markus Pauly; Sarah Hake

2011-01-01T23:59:59.000Z

103

Evaluation of Argentine maize hybrids and exotic x temperate testcrosses across environments  

E-Print Network [OSTI]

Maize (Zea mays L.) is grown in a wide range of environments and altitudes worldwide. Maize has transitioned from open pollinated varieties to single cross hybrids over the last century. While maize production and genetic gain has increased, genetic...

Ochs, Brett Allen

2005-11-01T23:59:59.000Z

104

E-Print Network 3.0 - al-tolerant maize line Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

1 2 3 4 5 > >> 1 2009 4 3 Regulation of maize plant architecture Summary: tagged maize lines that are extremely useful tools for understanding maize development and cellular......

105

The Genetic Architecture of Maize Flowering Time  

Science Journals Connector (OSTI)

...Sciences, University of Illinois, Urbana, IL 61801...identified that affect oil content in a large...large effect, but by the cumulative effects of numerous QTLs (Fig...security and to making maize production more environmentally...Edmeades G. O. , Field Crops Res. 48 , 65...

Edward S. Buckler; James B. Holland; Peter J. Bradbury; Charlotte B. Acharya; Patrick J. Brown; Chris Browne; Elhan Ersoz; Sherry Flint-Garcia; Arturo Garcia; Jeffrey C. Glaubitz; Major M. Goodman; Carlos Harjes; Kate Guill; Dallas E. Kroon; Sara Larsson; Nicholas K. Lepak; Huihui Li; Sharon E. Mitchell; Gael Pressoir; Jason A. Peiffer; Marco Oropeza Rosas; Torbert R. Rocheford; M. Cinta Romay; Susan Romero; Stella Salvo; Hector Sanchez Villeda; H. Sofia da Silva; Qi Sun; Feng Tian; Narasimham Upadyayula; Doreen Ware; Heather Yates; Jianming Yu; Zhiwu Zhang; Stephen Kresovich; Michael D. McMullen

2009-08-07T23:59:59.000Z

106

The 50th Annual Maize Genetics Conference  

SciTech Connect (OSTI)

The 50th Annual Maize Genetics Conference was held February 27 - March 2, 2008 at the Marriott Wardman Park Hotel in Washington, D.C. As the golden anniversary of the Conference and coinciding with the release of a draft of the maize genome sequence, this was a special meeting. To publicize this unique occasion, meeting organizers hosted a press conference, which was attended by members of the press representing science and non-science publications, and an evening reception at the Smithsonian National Museum of Natural History, where the draft sequence was announced and awards were presented to Dr. Mary Clutter and Senator Kit Bond to thank them for their outstanding contributions to maize genetics and genomics research. As usual, the Conference provided an invigorating forum for exchange of recent research results in many areas of maize genetics, e.g., cytogenetics, development, molecular genetics, transposable element biology, biochemical genetics, and genomics. Results were shared via both oral and poster presentations. Invited talks were given by four distinguished geneticists: Vicki Chandler, University of Arizona; John Doebley, University of Wisconsin; Susan Wessler, University of Georgia; and Richard Wilson, Washington University. There were 46 short talks and 241 poster presentations. The Conference was attended by over 500 participants. This included a large number of first-time participants in the meeting and an increasingly visible presence by individuals from underrepresented groups. Although we do not have concrete counts, there seem to be more African American, African and Hispanic/Latino attendees coming to the meeting than in years past. In addition, this meeting attracted many participants from outside the U.S. Student participation continues to be hallmark of the spirit of free exchange and cooperation characteristic of the maize genetics community. With the generous support provided by DOE, USDA NSF, and corporate/private donors, organizers were able to defray lodging and meal costs for 133 graduate and undergraduate students and 66 postdocs

Cone, Karen

2014-03-26T23:59:59.000Z

107

Characterization of cell wall proteins from yeast and mycelial cells of Candida albicans by labelling with biotin: comparison with other techniques.  

Science Journals Connector (OSTI)

...the large carbo- hydrate content and polydisperse...characteristics and behavior ob- served in vitro...exponential growth phase. Cells (blastoconidia...both morphologic phases of C. albicans are...in myce- lial-phase extracts and recognized...Wadsworth, and A. L. Sand- berg. 1988. Identification...

M Casanova; J L Lopez-Ribot; J P Martinez; R Sentandreu

1992-11-01T23:59:59.000Z

108

Wsc1 and Mid2 Are Cell Surface Sensors for Cell Wall Integrity Signaling That Act through Rom2, a Guanine Nucleotide Exchange Factor for Rho1  

Science Journals Connector (OSTI)

...this G-protein. In a related line of investigation, we identified the PMT2 gene in a genetic...pmt4delta mutants display osmotic-remedial cell lysis defects (45). Additionally...this G-protein. In a related line of investigation, we identified the PMT2 gene in a genetic...

Bevin Philip; David E. Levin

2001-01-01T23:59:59.000Z

109

Abstract 3699: Multi-walled carbon nanotubes induce apoptosis in normal human small airway epithelial cells through proteasome-mediated Mcl-1 protein degradation  

Science Journals Connector (OSTI)

...Washington, DC Abstract 3699: Multi-walled carbon nanotubes induce...are emerging as the major building blocks in nanotechnology thanks...CNTs, including single- and multi-walled (SWCNTs and MWCNT...the anti-apoptotic Bcl-2 family proteins and found that only...

Bao-Zhu Yuan; Joshua Chapman; Yon Rojanasakul; Vincent Castranova; and Steven H. Reynolds

2011-01-10T23:59:59.000Z

110

E-Print Network 3.0 - amylose maize starches Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

THE GELATINIZATION PROPERTIES OF STANDARD MAIZE STARCH Summary: , high amylose maize, potato and lentil starches. The magnitude of these changes was found... in gelatinization...

111

Wall surveyor project report  

SciTech Connect (OSTI)

A report is made on the demonstration of a first-generation Wall Surveyor that is capable of surveying the interior and thickness of a stone, brick, or cement wall. LLNL`s Micropower Impulse Radar is used, based on emitting and detecting very low amplitude and short microwave impulses (MIR rangefinder). Six test walls were used. While the demonstrator MIR Wall Surveyor is not fieldable yet, it has successfully scanned the test walls and produced real-time images identifying the walls. It is planned to optimize and package the evaluation wall surveyor into a hand held unit.

Mullenhoff, D.J.; Johnston, B.C.; Azevedo, S.G.

1996-02-22T23:59:59.000Z

112

Management of Aflatoxin Contaminated Maize in Tamaulipas, Mexico  

Science Journals Connector (OSTI)

Management of Aflatoxin Contaminated Maize in Tamaulipas, Mexico ... Maize is the staple food of the Mexicans, and Tamaulipas is an important producer and suffered a strong AF contamination in this cereal for several years, 440?000 tons just in 1991, both at field and at storage places. ... The Mexican Government has spent around 2 million U.S. dollars yearly to develop the Aflatoxin in Maize Detection Program of the State of Tamaulipas, where all the maize crop of this State was analyzed, around 20?000 AF chemical analysis every year (Juan et al., 1995). ...

Magda Carvajal; Gustavo Arroyo

1997-04-16T23:59:59.000Z

113

Maize, Kansas: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Maize, Kansas: Energy Resources Maize, Kansas: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 37.7791787°, -97.4672674° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":37.7791787,"lon":-97.4672674,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

114

Cell Wall Chemistry of Biofuel  

K-12 Energy Lesson Plans and Activities Web site (EERE)

This module focuses on the production of sugar (glucose and maltose) from cornstarch. The first lesson from this module relates glucose production from cornstarch to ethanol fuel production from corn stover.

115

Fluidized wall for protecting fusion chamber walls  

DOE Patents [OSTI]

Apparatus for protecting the inner wall of a fusion chamber from microexplosion debris, x-rays, neutrons, etc. produced by deuterium-tritium (DT) targets imploded within the fusion chamber. The apparatus utilizes a fluidized wall similar to a waterfall comprising liquid lithium or solid pellets of lithium-ceramic, the waterfall forming a blanket to prevent damage of the structural materials of the chamber.

Maniscalco, James A. (Danville, CA); Meier, Wayne R. (Livermore, CA)

1982-01-01T23:59:59.000Z

116

Biofuel, land and water: maize, switchgrass or Miscanthus?  

Science Journals Connector (OSTI)

The productive cellulosic crops switchgrass and Miscanthus are considered as viable biofuel sources. To meet the 2022 national biofuel target mandate, actions must be taken, e.g., maize cultivation must be intensified and expanded, and other biofuel crops (switchgrass and Miscanthus) must be cultivated. This raises questions on the use efficiencies of land and water; to date, the demand on these resources to meet the national biofuel target has rarely been analyzed. Here, we present a data-model assimilation analysis, assuming that maize, switchgrass and Miscanthus will be grown on currently available croplands in the US. Model simulations suggest that maize can produce 3.0–5.4 kiloliters (kl) of ethanol for every hectare of land, depending on the feedstock to ethanol conversion efficiency; Miscanthus has more than twice the biofuel production capacity relative to maize, and switchgrass is the least productive of the three potential sources of ethanol. To meet the biofuel target, about 26.5 million hectares of land and over 90 km3 of water (of evapotranspiration) are needed if maize grain alone is used. If Miscanthus was substituted for maize, the process would save half of the land and one third of the water. With more advanced biofuel conversion technology for Miscanthus, only nine million hectares of land and 45 km3 of water would probably meet the national target. Miscanthus could be a good alternative biofuel crop to maize due to its significantly lower demand for land and water on a per unit of ethanol basis.

Qianlai Zhuang; Zhangcai Qin; Min Chen

2013-01-01T23:59:59.000Z

117

Molecular Genetic Analysis of Maize Starch Branching Isoforms: Modulation of Starch Branching Enzyme Isoform Activities in Maize to Produce Starch with Novel Branching Architecture and Properties  

SciTech Connect (OSTI)

Modulation of Starch Branching enzyme Isoform Activities in Maize to Produce Starch with Novel Branching Architecture and Properties.

Guiltinan, Mark J.; Thompson, Donald

2009-07-21T23:59:59.000Z

118

Liquid Wall Chambers  

SciTech Connect (OSTI)

The key feature of liquid wall chambers is the use of a renewable liquid layer to protect chamber structures from target emissions. Two primary options have been proposed and studied: wetted wall chambers and thick liquid wall (TLW) chambers. With wetted wall designs, a thin layer of liquid shields the structural first wall from short ranged target emissions (x-rays, ions and debris) but not neutrons. Various schemes have been proposed to establish and renew the liquid layer between shots including flow-guiding porous fabrics (e.g., Osiris, HIBALL), porous rigid structures (Prometheus) and thin film flows (KOYO). The thin liquid layer can be the tritium breeding material (e.g., flibe, PbLi, or Li) or another liquid metal such as Pb. TLWs use liquid jets injected by stationary or oscillating nozzles to form a neutronically thick layer (typically with an effective thickness of {approx}50 cm) of liquid between the target and first structural wall. In addition to absorbing short ranged emissions, the thick liquid layer degrades the neutron flux and energy reaching the first wall, typically by {approx}10 x x, so that steel walls can survive for the life of the plant ({approx}30-60 yrs). The thick liquid serves as the primary coolant and tritium breeding material (most recent designs use flibe, but the earliest concepts used Li). In essence, the TLW places the fusion blanket inside the first wall instead of behind the first wall.

Meier, W R

2011-02-24T23:59:59.000Z

119

Tokamak reactor first wall  

DOE Patents [OSTI]

This invention relates to an improved first wall construction for a tokamak fusion reactor vessel, or other vessels subjected to similar pressure and thermal stresses.

Creedon, R.L.; Levine, H.E.; Wong, C.; Battaglia, J.

1984-11-20T23:59:59.000Z

120

Invertebrate biodiversity in maize following withdrawal of triazine herbicides  

Science Journals Connector (OSTI)

...was an important component of the regulatory process leading to possible commercialization of GMHT maize. The Advisory Committee for Releases...http://www.pesticides.gov.uk/ec_process/ECreviews/EC_review_programme.htm...

2005-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Great Wall Starbucks  

E-Print Network [OSTI]

along the Great Wall. When you think about it, it's not a bad marketing strategy: the Wall is high, the stairs relentless; what better than an espresso to energize you for the steep climb up? On second thought, make that a double. #ceas #china #tsutsui...

Hacker, Randi; Gatewood, Tyler; Tsutsui, William

2006-03-29T23:59:59.000Z

122

Maize Opaque Endosperm Mutations Create Extensive Changes in Patterns of Gene Expression  

Science Journals Connector (OSTI)

...outside of this phenotypically correlated cluster should be additive. However, if the basis of the mutant phenotype is zein...image was inspected visually for hybridization artifacts and manufacturing defects. Maize GeneChip Design and Data Analysis The maize...

Brenda G. Hunter; Mary K. Beatty; George W. Singletary; Bruce R. Hamaker; Brian P. Dilkes; Brian A. Larkins; Rudolf Jung

2002-09-26T23:59:59.000Z

123

RESEARCH ARTICLE Little fertilizer response but high N loss risk of maize  

E-Print Network [OSTI]

of biogas. The production and use of maize for biogas is more cost efficient compared with other crops and the cultivation, harvest and storage of maize is well established with farmers. Consequently, the biogas boom has

Paris-Sud XI, Université de

124

Comparison of Cellulosic Ethanol Yields from Midwestern Maize and Reconstructed Tallgrass Prairie Systems Managed for Bioenergy  

Science Journals Connector (OSTI)

Maize- and prairie-based systems were investigated as cellulosic feedstocks by conducting a 9 ha side-by-side comparison on fertile soils in the Midwestern United States. Maize was grown continuously with adequat...

V. A. Nichols; F. E. Miguez; M. E. Jarchow; M. Z. Liebman; B. S. Dien

2014-12-01T23:59:59.000Z

125

Molecular characterization of genes regulating fumonisin biosynthesis and development in maize pathogen fusarium verticilliodes  

E-Print Network [OSTI]

colonizes maize and maize-based products. Fumonisin B1 (FB1), the predominant form occurring in nature, can cause detrimental health effects in animals and humans. Several efforts were made to study the host and pathogen factors that contribute...

Sagaram, Uma Shankar

2009-05-15T23:59:59.000Z

126

EFFECT OF HYDROTHERMAL TREATMENT ON PHYSICOCHEMICAL1 PROPERTIES OF WHEAT, WAXY AND STANDARD MAIZE STARCHES2  

E-Print Network [OSTI]

1 EFFECT OF HYDROTHERMAL TREATMENT ON PHYSICOCHEMICAL1 PROPERTIES OF WHEAT, WAXY AND STANDARD MAIZE.10.005 #12;2 ABSTRACT18 Standard maize (SMS), waxy maize (WMS) and wheat (WTS) starches were19 hydrothermally treated at three pressure levels. Effects of D.I.C. processing conditions20 on thermal characteristics

Paris-Sud XI, Université de

127

Use of the Transposon Ac as a Gene-Searching Engine in the Maize Genome  

Science Journals Connector (OSTI)

...an excellent gene-searching engine in the highly repetitive maize...The Mutants of Maize. (Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press). Parinov...transposon Ac as a gene-searching engine in the maize genome. | We show...

Matthew Cowperthwaite; Wonkeun Park; Zhennan Xu; Xianghe Yan; Steven C. Maurais; Hugo K. Dooner

2002-03-08T23:59:59.000Z

128

Unitised Curtain Walls  

Science Journals Connector (OSTI)

Unitised curtain walling was developed to overcome the problems associated with the installation of stick systems (see Chapter 7) and to reduce the on-site installation time. It consists of large panels, usual...

2009-01-01T23:59:59.000Z

129

Ectopic Lignification in the Flax lignified bast fiber1 Mutant Stem Is Associated with Tissue-Specific Modifications in Gene Expression and Cell Wall Composition  

Science Journals Connector (OSTI)

...Phytotechnologie, F-80037 Amiens Cedex 1, France f Laboratory of Tree Cell Biology, Division of Forest and Biomaterials Science, Graduate School of Agriculture, Kyoto University, Sakyo-ku, Kyoto 606-8502, Japan g Department of Plant Systems Biology...

Maxime Chantreau; Antoine Portelette; Rebecca Dauwe; Shingo Kiyoto; David Crônier; Kris Morreel; Sandrine Arribat; Godfrey Neutelings; Malika Chabi; Wout Boerjan; Arata Yoshinaga; François Mesnard; Sebastien Grec; Brigitte Chabbert; Simon Hawkins

2014-11-07T23:59:59.000Z

130

Food quality and properties of quality protein maize.  

E-Print Network [OSTI]

, and the resulting starch has 50% amylose and 50% amylopectin, while regular corn has 25% amylose and 75% amylopectin (Strissel and Stiefel 2002). High lysine maize In 1964 Mertz and coworkers reported the high lysine genes opaque-2 and floury-2. The genes..., and the resulting starch has 50% amylose and 50% amylopectin, while regular corn has 25% amylose and 75% amylopectin (Strissel and Stiefel 2002). High lysine maize In 1964 Mertz and coworkers reported the high lysine genes opaque-2 and floury-2. The genes...

Leal Diaz, Ana Maria

2004-09-30T23:59:59.000Z

131

The Activity of a Wall-Bound Cellulase Is Required for and Is Coupled to Cell Cycle Progression in the Dinoflagellate Crypthecodinium cohnii  

Science Journals Connector (OSTI)

...polysaccharides, such as xyloglucan, xylan, glucomannan, pectin, and...FSC2 (proportional to the cell surface area), the data revealed that...result was not surprising, as surface coverings are intact at this...Konjac glucomannan (Megazyme), xylan from oat spelled (Sigma-Aldrich...

Alvin C.M. Kwok; Joseph T.Y. Wong

2010-04-20T23:59:59.000Z

132

The Activity of a Wall-Bound Cellulase Is Required for and Is Coupled to Cell Cycle Progression in the Dinoflagellate Crypthecodinium cohnii  

Science Journals Connector (OSTI)

...found in any of the treatments compared with the control...such as xyloglucan, xylan, glucomannan, pectin...control and all the treatments (Figure 2G). Bioinformatic...proportional to the cell surface area), the data revealed...glucomannan (Megazyme), xylan from oat spelled (Sigma-Aldrich...

Alvin C.M. Kwok; Joseph T.Y. Wong

2010-04-20T23:59:59.000Z

133

The Activity of a Wall-Bound Cellulase Is Required for and Is Coupled to Cell Cycle Progression in the Dinoflagellate Crypthecodinium cohnii  

Science Journals Connector (OSTI)

...size-mediated negative feedback mechanism to the cell cycle regulation engine has been reported for fission yeast (Martin and Berthelot-Grosjean...1988). Antibodies: A Laboratory Manual. (New York: Cold Spring Harbor Laboratory Press). Hartwell, L.H. and Weinert...

Alvin C.M. Kwok; Joseph T.Y. Wong

2010-04-20T23:59:59.000Z

134

BNL | Joseph S. Wall  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Joseph S. Wall Joseph S. Wall Emeritus Research Interests Mass mapping of unstained biological molecules with the scanning transmission electron microscope (STEM), particularly assemblies of complexes from subunits of known size and shape. Examples include: Alzheimer's filaments, viral capsids, annelid hemoglobins, hemocyanins, proteases, chaperonins, microtubule proteins, prions and various nucleic acid-protein complexes. Another research area is instrument development involving design and construction of an instrument for low-temperture, energy loss spectroscopy, and elemental mapping at low dose. This is being used to map phosphorus in nucleic acid-protein complexes, phosphorylated proteins and phospholipid structures. He also is director of the Scanning Transmission Electron Microscope STEM

135

Single-Walle 4. Single-Walled Carbon Nanotubes  

E-Print Network [OSTI]

applications, carbon nanotube research is ac- tively being pursued in diverse areas including energy storage105 Single-Walle 4. Single-Walled Carbon Nanotubes Sebastien Nanot, Nicholas A. Thompson, Ji Single-walled carbon nanotubes (SWCNTs) are hol- low, long cylinders with extremely large aspect ratios

Kono, Junichiro

136

Stick-System Curtain Walls  

Science Journals Connector (OSTI)

Curtain walls can be divided in two main types according to the system of fabrication and installation: stick systems and unitised panels. The traditional curtain-wall construction is the stick system, where m...

2009-01-01T23:59:59.000Z

137

New retaining wall design criteria based on lateral earth pressure measurements  

E-Print Network [OSTI]

. , 72 1X LIST OF FIGURES Figures Page Condition of Active Rankine State, Cantilever Wall . . 3 Cross Section of Cantilever Wall Location of Earth Pressure Cells, Cantilever Wall Movement Measurement Scheme, Cantilever Wall. 12 Measured Lateral... INTRODUCTION Earth Pressure Theories -- The principles of limiting equilibrium mechanics are used to desiqn earth retaining structures. In this approach the pressures that would exist at a failure condition are predicted from Coulomb or Rankine (13...

Wright, William Vincent

2012-06-07T23:59:59.000Z

138

Lignin and carbon transformation in roots of maize and mixed perennial biofuel crops.  

E-Print Network [OSTI]

??Perennial species are being explored as biofuel crops alternative to maize. In this study, fertilized and unfertilized mixed perennial prairie crops were compared with a… (more)

Rivas, Fritzie

2012-01-01T23:59:59.000Z

139

Application of hazard analysis (HACCP) in starch production by the wet milling of maize.  

E-Print Network [OSTI]

??This study is based on the Hazard Analysis in the Wet Milling of maize for the production of starch at the Bellville plant of African… (more)

Samuels, R. C.

1993-01-01T23:59:59.000Z

140

Genetic signals of origin, spread, and introgression in a large sample of maize landraces  

E-Print Network [OSTI]

evidence for maize cultivation (7). Other finds from Tabasco (7,300 y B.P.) (8) and Panama (7,400 y B

Doebley, John

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Evaluation of subtropical and tropical quality protein maize hybrids in Texas for agronomic performance, resistance to aflatoxin and quality  

E-Print Network [OSTI]

Common maize is deficient in essential amino acids, lysine and tryptophan, and has a low nutritive value compared to other cereals. Opaque-2, a regulatory gene, genetically enhances lysine content in normal maize endosperm by suppressing...

Bhatnagar, Sandeep

2012-06-07T23:59:59.000Z

142

In Vitro Utilization of Amylopectin and High-Amylose Maize (Amylomaize) Starch Granules by Human Colonic Bacteria  

Science Journals Connector (OSTI)

...starch, the amylose/amylopectin ratio, the...interaction, amylose-lipid complexes...presence of amylase inhibitors...include both a-amylase and a-glucosidase...shown that both amylopectin maize starch and high-amylose maize starch...

Xin Wang; Patricia Lynne Conway; Ian Lewis Brown; Anthony John Evans

1999-11-01T23:59:59.000Z

143

NREL: News Feature - NREL Breaks Down Walls for Biofuels  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

NREL Breaks Down Walls for Biofuels NREL Breaks Down Walls for Biofuels November 30, 2009 Researchers at the National Renewable Energy Laboratory (NREL) and ethanol producers are racing to come up with ways to make ethanol from cellulosic biomass that are cheaper and easier to produce than current methods. But they are hitting a wall. Cell walls in plants are making the production of cellulosic ethanol a challenge. So researchers are creating their own computer program to help model and break down the tiny fibers of cellulose - or fibrils - found in plant cells. Although ethanol is becoming more available to consumers, NREL is working closely with the U.S. Department of Energy (DOE) to meet a quickly approaching goal to produce competitively priced ethanol for $1.50 per gallon by 2012. Why the rush? DOE believes this is the price at which

144

Covering Walls With Fabrics.  

E-Print Network [OSTI]

the glue a dull surface to adhere to. Fill any gouges or nail holes with patching plaster and sand smooth after they have dried thoroughly. Minor ripples can be covered with spackling compound, a plaster-like substance that is spread thinly... during dry weather and in a well-ventilated room. Cut each panel 3 inches longer than the ceiling height. Match and cut sufficient fabric widths to cover completely one wall at a time. Start with Corner I nstall the first fabric panel so...

Anonymous,

1979-01-01T23:59:59.000Z

145

Domain walls in SU(5)  

Science Journals Connector (OSTI)

We consider the grand unified SU(5) model with a small or vanishing cubic term in the adjoint scalar field in the potential. This gives the model an approximate or exact Z2 symmetry whose breaking leads to domain walls. The simplest domain wall has the structure of a kink across which the Higgs field changes sign (??-?) and inside which the full SU(5) is restored. The kink is shown to be perturbatively unstable for all parameters. We then construct a domain wall solution that is lighter than the kink and show it to be perturbatively stable for a range of parameters. The symmetry in the core of this domain wall is smaller than that outside. The interactions of the domain wall with magnetic monopoles are discussed and it is shown that magnetic monopoles with certain internal space orientations relative to the wall pass through the domain wall. Magnetic monopoles in other relative internal space orientations are likely to be swept away on collision with the domain walls, suggesting a scenario where the domain walls might act like optical polarization filters, allowing certain monopole “polarizations” to pass through but not others. As SU(5) domain walls will also be formed at small values of the cubic coupling, this leads to a very complicated picture of the evolution of defects after the grand unified phase transition.

Levon Pogosian and Tanmay Vachaspati

2000-11-21T23:59:59.000Z

146

Phenotypic and genotypic characterization of white maize inbreds, hybrids and synthetics under stress and non-stress environments  

E-Print Network [OSTI]

correlations among traits across locations……………………………………………………………………………… 169 1 CHAPTER I INTRODUCTION Maize (Zea mays L.) is one of the three most important cereal crops in the world together with wheat and rice. Global production of maize... reached 622 million metric tons in 2003-2004 (USDA-FAS, 2005). It is estimated that about 68% of the global maize area is in the developing world, but the developing world accounts for only 46% of the world’s maize production (Pingali and Pandey, 2001...

Makumbi, Dan

2006-10-30T23:59:59.000Z

147

Maize Genetics 2000â??And Beyond  

Science Journals Connector (OSTI)

...and these results argue against the dominance theory and for the heterozygotic advantage theory. Guo used expression profiles to determine...Meyerowitz E.M. Signaling of cell fate decisions by CLAVATA3 in Arabidopsis shoot meristems...

Mark Running; Mike Scanlon; Neelima Sinha

148

Mx-rMx, a Family of Interacting Transposons in the Growing hAT Superfamily of Maize  

Science Journals Connector (OSTI)

...transposon Ac as a gene-searching engine in the maize genome. Plant...virus infection in maize. Cold Spring Harb. Symp. Quant. Biol...organization and gene expression. Cold Spring Harb. Symp. Quant. Biol...The Mutants of Maize. (Cold Spring Harbor, NY: Cold Spring Harbor...

Zhennan Xu; Hugo K. Dooner

2005-01-19T23:59:59.000Z

149

Domain Walls in Gapped Graphene  

Science Journals Connector (OSTI)

The electronic properties of a particular class of domain walls in gapped graphene are investigated. We show that they can support midgap states which are localized in the vicinity of the domain wall and propagate along its length. With a finite density of domain walls, these states can alter the electronic properties of gapped graphene significantly. If the midgap band is partially filled, the domain wall can behave like a one-dimensional metal embedded in a semiconductor and could potentially be used as a single-channel quantum wire.

G. W. Semenoff; V. Semenoff; Fei Zhou

2008-08-21T23:59:59.000Z

150

Vol. 82, No. 4, 2005 431 Phosphorus Concentrations and Flow in Maize Wet-Milling Streams  

E-Print Network [OSTI]

gluten meal (CGM) and corn gluten feed (CGF) is important to the maize wet-milling industry. HighVol. 82, No. 4, 2005 431 Phosphorus Concentrations and Flow in Maize Wet-Milling Streams Kent D in animal wastes. The objective was to measure the concentration and flow of phosphorus in the wet-milling

151

The Dent Stage of Maize Kernels Is the Most Conducive for Fumonisin Biosynthesis under Field Conditions  

Science Journals Connector (OSTI)

...that amylopectin metabolism participates in...regulator of nitrogen metabolism, induces a positive...maturation of maize seeds. Plant Physiol...regulator of nitrogen metabolism, during colonization...and amylopectin in starch from maize kernel...multi-wavelength analysis. J. Cereal Sci. 26 : 211-221...

Adeline Picot; Christian Barreau; Laëtitia Pinson-Gadais; François Piraux; Daniel Caron; Christian Lannou; Florence Richard-Forget

2011-10-07T23:59:59.000Z

152

Genotypic and phenotypic chacterization of maize testcross hybrids under stressed and non stressed conditions  

E-Print Network [OSTI]

and 2004????.. 181 1 CHAPTER I INTRODUCTION Maize (Zea mays, L.) is the first world?s staple cereal food crop. It is Africa?s second most important food crop behind cassava. Per capita consumption of maize in Africa is highest in Eastern...

Ganunga, Rosan Paterson

2007-04-25T23:59:59.000Z

153

Seasonal Maize Forecasting for South Africa and Zimbabwe Derived from an Agroclimatological Model  

E-Print Network [OSTI]

Seasonal Maize Forecasting for South Africa and Zimbabwe Derived from an Agroclimatological Model, with a hindcast correlation over 16 seasons of 0.92 for South Africa and 0.62 for Zimbabwe. Over 17 seasons and actual maize water-stress in South Africa, and a correlation of 0.79 for the same relationship

Martin, Randall

154

Zea mays iRS1563: A Comprehensive Genome-Scale Metabolic Reconstruction of Maize Metabolism  

E-Print Network [OSTI]

States Department of Energy (DOE) Grant DE-FG02-05ER25684. The funders had no role in study design, data, commonly known as maize or corn, is a plant organism of paramount importance as a food crop, biofuel]. Maize cultivation led to 12 billion bushels of grain in the USA alone in 2008 worth $47 billion [3

Maranas, Costas

155

Oven wall panel construction  

DOE Patents [OSTI]

An oven roof or wall is formed from modular panels, each of which comprises an inner fabric and an outer fabric. Each such fabric is formed with an angle iron framework and somewhat resilient tie-bars or welded at their ends to flanges of the angle irons to maintain the inner and outer frameworks in spaced disposition while minimizing heat transfer by conduction and permitting some degree of relative movement on expansion and contraction of the module components. Suitable thermal insulation is provided within the module. Panels or skins are secured to the fabric frameworks and each such skin is secured to a framework and projects laterally so as slidingly to overlie the adjacent frame member of an adjacent panel in turn to permit relative movement during expansion and contraction.

Ellison, Kenneth (20 Avondale Cres., Markham, CA); Whike, Alan S. (R.R. #1, Caledon East, both of Ontario, CA)

1980-04-22T23:59:59.000Z

156

Breeding Maize for Drought Tolerance: Diversity Characterization and Linkage Disequilibrium of Maize Paralogs ZmLOX4 and ZmLOX5  

E-Print Network [OSTI]

traits have been discovered and selected for, the different responses to drought stress at specific developmental stages of the maize plant have been selected as a whole when drought tolerance is evaluated. Herein we attempt to define the characteristics...

De La Fuente, Gerald

2012-07-16T23:59:59.000Z

157

Implications of Bt Traits on Mycotoxin Contamination in Maize: Overview and Recent Experimental Results in Southern United States  

Science Journals Connector (OSTI)

For example, up to 20 adult beetles per maize ear did not affect irrigated maize yields in Colorado,(43) whereas Kuhlman(44) attributed yield losses to as few as 5 beetles per plant in nonirrigated maize. ... Hutchison, W. D.; Burkness, E. C.; Mitchell, P. D.; Moon, R. D.; Leslie, T. W.; Fleischer, S. J.; Abrahamson, M.; Hamilton, K. L.; Steffey, K. L.; Gray, M. E.; Hellmich, R. L., II; Kaster, V.; Hunt, T. E.; Wright, R. J.; Pecinovsky, K. T.; Rabaey, T. L.; Flood, B. R.; Raun, E. S.Areawide suppression of European corn borer with Bt maize reaps savings to non-Bt maize growers Science 2010, 330, 222– 225 ...

Hamed K. Abbas; Robert M. Zablotowicz; Mark A. Weaver; W. Thomas Shier; H. Arnold Bruns; Nacer Bellaloui; Cesare Accinelli; Craig A. Abel

2013-06-10T23:59:59.000Z

158

Dynamics of strings between walls  

SciTech Connect (OSTI)

Configurations of vortex-strings stretched between or ending on domain walls were previously found to be 1/4 BPS states. Among zero modes of string positions, the center of mass of strings in each region between two adjacent domain walls is shown to be non-normalizable whereas the rests are normalizable. We study dynamics of vortex-strings stretched between separated domain walls by using two methods, the moduli space (geodesic) approximation of full 1/4 BPS states and the charged particle approximation for string endpoints in the wall effective action. In the first method we obtain the effective Lagrangian explicitly and find the 90 degree scattering for head-on collision. In the second method the domain wall effective action is assumed to be U(1){sup N} gauge theory, and we find a good agreement between two methods for well separated strings. This talk is based on the work [1].

Eto, Minoru [INFN, Sezione di Pisa, Largo Pontecorvo, 3, Ed. C, 56127 Pisa (Italy); Fujimori, Toshiaki; Nagashima, Takayuki [Department of Physics, Tokyo Institute of Technology, Tokyo 152-8551 (Japan); Nitta, Muneto [Department of Physics, Keio University, Hiyoshi, Yokohama, Kanagawa 223-8521 (Japan); Ohashi, Keisuke [Department of Applied Mathematics and Theoretical Physics, University of Cambridge, CB3 0WA (United Kingdom); Sakai, Norisuke [Department of Mathematics, Tokyo Woman's Christian University, Tokyo 167-8585 (Japan)

2008-11-23T23:59:59.000Z

159

Improvements to laboratory-scale maize wet-milling procedures  

Science Journals Connector (OSTI)

The wet milling of maize is difficult to study in the laboratory because some of the required separation steps are challenging to implement at bench-scale. This work was conducted to develop an improved 100-g wet-milling procedure that better models the industrial process. Several separation steps were modified from previously reported methods. Among the changes, germ was recovered by a flotation/skimming technique that is normally used on larger-scale procedures. Starch was recovered by tabling, but the flow profile at the end of the table was changed to reduce gluten settling and the partitioning and pumping of slurry fractions was changed to allow the tabling process to begin immediately after fiber recovery. Gluten was dewatering directly on the table overflow, and starch was recovered from the table before drying. These modifications eliminated some problems associated with other procedures, e.g. the scraping of tabled starch to reduce protein contamination, the loss of germ due to size reduction, and the separate recovery of coarse and fine fiber fractions. Compared with routine tabling methods, the modified method used in this work produced starch with less protein (0.42 versus 0.55% for the maize variety tested); however, the improvement was achieved at the expense of a slightly lower starch yield (64.4 versus 65.4%). Standard deviations for the product yields were 0.28% for starch, 0.27% for gluten, 0.24% for fiber, 0.13% for germ, and 0.07% for total solubles. The procedure will be beneficial for some maize wet-milling experiments.

Michael K. Dowd

2003-01-01T23:59:59.000Z

160

Resuspension of wall deposits in spray dryers  

Science Journals Connector (OSTI)

Wall deposition occurs in spray dryers when dried or partially dried particles contact and adhere to the walls during operation, thus reducing the yield of product collected. Wall deposits also present a product ...

M. J. Hanus; T. A. G. Langrish

2007-10-01T23:59:59.000Z

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Fabrication of thin-wall hollow nickel spheres and low density syntactic foams  

SciTech Connect (OSTI)

A process has been developed to fabricate thin-wall hollow spheres from conventional oxide powders at room temperature. The polymer- bonded powder shells are fired in air to sinter the walls, leaving the shells either impervious or porous. Alternatively, the oxide shells can be preferentially reduced to produce thin-wall hollow metal spheres which can be bonded together to produce an ultra light weight closed-cell foam. Processing and properties of this class of low density structures will be discussed.

Clancy, R.B.; Sanders, T.H. Jr.; Cochran, J.K.

1991-12-31T23:59:59.000Z

162

Demethylesterification of the Primary Wall by PECTIN METHYLESTERASE35 Provides Mechanical Support to the Arabidopsis Stem  

Science Journals Connector (OSTI)

...walls, such as lignin, cellulose, and xylans, were not affected by the mutation...and represented the distance between the surfaces of the plunger and the stage when 0...Monoclonal antibodies to plant cell wall xylans and arabinoxylans. J. Histochem. Cytochem...

Shoko Hongo; Kaori Sato; Ryusuke Yokoyama; Kazuhiko Nishitani

2012-06-12T23:59:59.000Z

163

Modelling China’s potential maize production at regional scale under climate change  

Science Journals Connector (OSTI)

With the continuing warming due to greenhouse gases concentration, it is important to examine the potential impacts on regional crop production spatially and temporally. We assessed China’s potential maize pro...

Wei Xiong; Robin Matthews; Ian Holman; Erda Lin; Yinglong Xu

2007-12-01T23:59:59.000Z

164

Cultivation of maize landraces by small-scale shade coffee farmers in western El Salvador  

E-Print Network [OSTI]

Cultivation of maize landraces by small-scale shade coffee farmers in western El Salvador Meryl of small-scale shade coffee farmers in western El Salvador. We conducted household interviews and focus

Vermont, University of

165

Two Approaches to Evaluate Drought Tolerance in Maize: Seedling Stress Response and Epicuticular Wax Accumulation  

E-Print Network [OSTI]

We wanted to develop rapid and cost-effective drought tolerance screening methods for mass amounts of germplasm. In 2009 and 2010, we evaluated sixty-two maize inbred lines and their hybrid testcross progeny using seedling stress response...

Meeks, Meghyn

2010-12-02T23:59:59.000Z

166

Nonsyntenic Genes Drive Highly Dynamic Complementation of Gene Expression in Maize Hybrids  

Science Journals Connector (OSTI)

...Authors ( www.plantcell.org ) is: Frank Hochholdinger ( hochholdinger@uni-bonn.de ). [W] Online version contains Web-only data. This study analyzes how transcriptome diversity between two maize inbred lines affects gene expression patterns...

Anja Paschold; Nick B. Larson; Caroline Marcon; James C. Schnable; Cheng-Ting Yeh; Christa Lanz; Dan Nettleton; Hans-Peter Piepho; Patrick S. Schnable; Frank Hochholdinger

2014-10-14T23:59:59.000Z

167

Dynamics of strings between walls  

SciTech Connect (OSTI)

Configurations of vortex strings stretched between or ending on domain walls were previously found to be 1/4 Bogomol'nyi-Prasad-Sommerfield (BPS) states in N=2 supersymmetric gauge theories in 3+1 dimensions. Among zero modes of string positions, the center of mass of strings in each region between two adjacent domain walls is shown to be non-normalizable whereas the rests are normalizable. We study dynamics of vortex strings stretched between separated domain walls by using two methods, the moduli space (geodesic) approximation of full 1/4 BPS states and the charged particle approximation for string end points in the wall effective action. In the first method we explicitly obtain the effective Lagrangian in the strong coupling limit, which is written in terms of hypergeometric functions, and find the 90 deg. scattering for head-on collision. In the second method the domain wall effective action is assumed to be U(1){sup N} gauge theory, and we find a good agreement between two methods for well-separated strings.

Eto, Minoru [INFN, Sezione di Pisa, Largo Pontecorvo, 3, Ed. C, 56127 Pisa (Italy); Department of Physics, University of Pisa Largo Pontecorvo, 3, Ed. C, 56127 Pisa (Italy); Fujimori, Toshiaki; Nagashima, Takayuki [Department of Physics, Tokyo Institute of Technology, Tokyo 152-8551 (Japan); Nitta, Muneto [Department of Physics, Keio University, Hiyoshi, Yokohama, Kanagawa 223-8521 (Japan); Ohashi, Keisuke [Department of Applied Mathematics and Theoretical Physics, University of Cambridge, CB3 0WA (United Kingdom); Sakai, Norisuke [Department of Mathematics, Tokyo Woman's Christian University, Tokyo 167-8585 (Japan)

2009-02-15T23:59:59.000Z

168

Density equation of bio-coal briquettes and quantity of maize cob in Phitsanulok, Thailand  

SciTech Connect (OSTI)

One of the most important crops in Phitsanulok, a province in Northern Thailand, is maize. BaseD on the calculation, the quantity of maize cob produced in this region was approximately 220 kton year{sup -1}. The net heating value of maize cob was found to be 14.2 MJ kg{sup -1}. Therefore, the total energy over 874 TJ year-1 can be obtained from this agricultural waste. In the experiments, maize cob was utilized as the major ingredient for producing biomass-coal briquettes. The maize cob was treated with sodium hydroxide solution before mixing with coal fine. The ratios of coal:maize were 1:2 and 1:3, respectively. The range of briquetting pressures was from 4-8 MPa. The result showed that the density was strongly affected by both parameters. Finally, the relationship between biomass ratio, briquetting pressures and briquette density was developed and validated by using regression technique. 13 refs., 2 figs.

Patomsok Wilaipon [Naresuan University, Phitsanulok (Thailand). Department of Mechanical Engineering

2008-07-01T23:59:59.000Z

169

Domain walls riding the wave.  

SciTech Connect (OSTI)

Recent years have witnessed a rapid proliferation of electronic gadgets around the world. These devices are used for both communication and entertainment, and it is a fact that they account for a growing portion of household energy consumption and overall world consumption of electricity. Increasing the energy efficiency of these devices could have a far greater and immediate impact than a gradual switch to renewable energy sources. The advances in the area of spintronics are therefore very important, as gadgets are mostly comprised of memory and logic elements. Recent developments in controlled manipulation of magnetic domains in ferromagnet nanostructures have opened opportunities for novel device architectures. This new class of memories and logic gates could soon power millions of consumer electronic devices. The attractiveness of using domain-wall motion in electronics is due to its inherent reliability (no mechanical moving parts), scalability (3D scalable architectures such as in racetrack memory), and nonvolatility (retains information in the absence of power). The remaining obstacles in widespread use of 'racetrack-type' elements are the speed and the energy dissipation during the manipulation of domain walls. In their recent contribution to Physical Review Letters, Oleg Tretiakov, Yang Liu, and Artem Abanov from Texas A&M University in College Station, provide a theoretical description of domain-wall motion in nanoscale ferromagnets due to the spin-polarized currents. They find exact conditions for time-dependent resonant domain-wall movement, which could speed up the motion of domain walls while minimizing Ohmic losses. Movement of domain walls in ferromagnetic nanowires can be achieved by application of external magnetic fields or by passing a spin-polarized current through the nanowire itself. On the other hand, the readout of the domain state is done by measuring the resistance of the wire. Therefore, passing current through the ferromagnetic wire is the preferred method, as it combines manipulation and readout of the domain-wall state. The electrons that take part in the process of readout and manipulation of the domain-wall structure in the nanowire do so through the so-called spin transfer torque: When spin-polarized electrons in the ferromagnet nanowire pass through the domain wall they experience a nonuniform magnetization, and they try to align their spins with the local magnetic moments. The force that the electrons experience has a reaction force counterpart that 'pushes' the local magnetic moments, resulting in movement of the domain wall in the direction of the electron flow through the spin-transfer torque. The forces between the electrons and the local magnetic moments in the ferromagnet also create additional electrical resistance for the electrons passing through the domain wall. By measuring resistance across a segment of the nanowire, one determines if a domain wall is present; i.e., one can read the stored information. The interaction of the spin-polarized electrons with the domain wall in the ferromagnetic nanowire is not very efficient. Even for materials achieving high polarization of the free electrons, it is very difficult to move the magnetic domain wall. Several factors contribute to this problem, with imperfections of the ferromagnetic nanowire that cause domain-wall pinning being the dominant one. Permalloy nanowires, one of the best candidates for domain-wall-based memory and logic devices, require current densities of the order of 10{sup 8} A/cm{sup 2} in order to move a domain wall from a pinning well. Considering that this current has to pass through a relatively long wire, it is not very difficult to imagine that most of the energy will go to Joule heating. The efficiency of the process - the ratio of the energy converted to domain-wall motion to the total energy consumed - is comparable to that of an incandescent light bulb converting electricity to light. A step towards more efficient domain-wall-based memory devices is the advance of using alternating currents or curren

Karapetrov, G.; Novosad, V.; Materials Science Division

2010-11-01T23:59:59.000Z

170

Experimental Study of Thermal Performance and the Contribution of Plant-Covered Walls to the Thermal Behavior of Building  

Science Journals Connector (OSTI)

Abstract This paper presented on experimental investigation of the influence of plant-covered wall on the thermal behavior of buildings in the semi-arid regions during the summer period. Thermal performance of a green walls system on facade walls has been experimentally investigated in a test room. The test cell dimensions are 1x1.2x0.8 m. In this study the thermal analysis concerns two test cells that incorporate non-covered and covered with two types of plants (Jasmine and Aristolochia). A Light source is used to simulate solar radiation. The results showed that plant cover improved indoor thermal comfort in both summer, and reduced heat gains and losses through the wall structure. It is verified that a microclimate between the wall of the test cell and the green wall is created, and it is characterized by slightly lower temperatures and higher relative humidity.

Saifi Nadia; Settou Noureddine; Necib Hichem; Damene Djamila

2013-01-01T23:59:59.000Z

171

Phytochrome induces changes in the immunodetectable level of a wall peroxidase that precede growth changes in maize seedlings  

Science Journals Connector (OSTI)

...the 20-min distilled water rinse, the light-treated...with a 3 x 8 array of gallium aluminum arsenide infrared light (IR...loading and distilled water rinse. Sections were...the binding state or solubility of the peroxidase could...

Sung-Ha Kim; James R. Shinkle; Stanley J. Roux

1989-01-01T23:59:59.000Z

172

Domain Walls, Triples and Acceleration  

E-Print Network [OSTI]

We present a construction of domain walls in string theory. The domain walls can bridge both Minkowski and AdS string vacua. A key ingredient in the construction are novel classical Yang-Mills configurations, including instantons, which interpolate between toroidal Yang-Mills vacua. Our construction provides a concrete framework for the study of inflating metrics in string theory. In some cases, the accelerating space-time comes with a holographic description. The general form of the holographic dual is a field theory with parameters that vary over space-time.

Travis Maxfield; Savdeep Sethi

2014-04-09T23:59:59.000Z

173

Liquid Walls Innovative Concepts for First Walls and Blankets  

E-Print Network [OSTI]

rrr �= V r J r PV r B r 1P 2P g r + - V r #12;Liquid Wall Options Thickness · Thin (~ 2cm with existing technology · Size of plasma devices and power plants can be substantially reduced High Poloidal

Abdou, Mohamed

174

Field measurements of lateral earth pressures on a pre-cast panel retaining wall  

E-Print Network [OSTI]

Test Wall Description Instrumentation Installation of Pressure Cells and Transducers Backfilling Procedure Properties of the Backfill Material Placement of Clay Backfill DATA COLLECTION Earth Pressure Cell Measurements Force Transducer... Analysis of Backfill Material 2 Lateral Earth Pressures Measured by Pressure Cells (Psi) . . . . . . . . . . . - . ~ . ~ 3 Maximum Deviation From Zero Gage Reading and Temperature Relationship. . . . 4 Forces Measured by Force Transducers (Kips) 5...

Prescott, David Monroe

2012-06-07T23:59:59.000Z

175

Dynamics of Domain Wall Networks  

E-Print Network [OSTI]

Networks or webs of domain walls are admitted in Abelian or non-Abelian gauge theory coupled to fundamental Higgs fields with complex masses. We examine the dynamics of the domain wall loops by using the moduli approximation and find a phase rotation induces a repulsive force which can be understood as a Noether charge of Q-solitons. Non-Abelian gauge theory allows different types of loops which can be deformed to each other by changing a modulus. This admits the moduli geometry like a sandglass made by gluing the tips of the two cigar-(cone-)like metrics of a single triangle loop. We conclude that the sizes of all loops tend to grow for a late time in general models with complex Higgs masses, while the sizes are stabilized at some values once triplet masses are introduced for the Higgs fields. We also show that the stationary motion on the moduli space of the domain wall webs represents 1/4 BPS Q-webs of walls.

Minoru Eto; Toshiaki Fujimori; Takayuki Nagashima; Muneto Nitta; Keisuke Ohashi; Norisuke Sakai

2007-07-22T23:59:59.000Z

176

Dynamics of domain wall networks  

SciTech Connect (OSTI)

Networks or webs of domain walls are admitted in Abelian or non-Abelian gauge theory coupled to fundamental Higgs fields with complex masses. We examine the dynamics of the domain wall loops by using the moduli approximation and find a phase rotation induces a repulsive force which can be understood as a Noether charge of Q-solitons. Non-Abelian gauge theory allows different types of loops which can be deformed to each other by changing a modulus. This admits the moduli geometry like a sandglass made by gluing the tips of the two cigar-(cone-)like metrics of a single triangle loop. We conclude that the sizes of all loops tend to grow for a late time in general models with complex Higgs masses, while the sizes are stabilized at some values once triplet masses are introduced for the Higgs fields. We also show that the stationary motion on the moduli space of the domain wall webs represents 1/4 Bogomol'nyi-Prasad-Sommerfield Q-webs of walls.

Eto, Minoru [INFN, Sezione di Pisa, Largo Pontecorvo, 3, Ed. C, 56127 Pisa (Italy); Department of Physics, University of Pisa Largo Pontecorvo, 3, Ed. C, 56127 Pisa (Italy); Fujimori, Toshiaki; Nagashima, Takayuki; Sakai, Norisuke [Department of Physics, Tokyo Institute of Technology, Tokyo 152-8551 (Japan); Nitta, Muneto [Department of Physics, Keio University, Hiyoshi, Yokohama, Kanagawa 223-8521 (Japan); Ohashi, Keisuke [Department of Applied Mathematics and Theoretical Physics, University of Cambridge, CB3 0WA (United Kingdom)

2007-12-15T23:59:59.000Z

177

Strontium 90 in Maize Field, Cattail Marsh and Oakwood Ecosystems Author(s): J. D. Ovington and D. B. Lawrence  

E-Print Network [OSTI]

Strontium 90 in Maize Field, Cattail Marsh and Oakwood Ecosystems Author(s): J. D. Ovington and D Ecology. http://www.jstor.org #12;STRONTIUM 90 IN MAIZE FIELD, CATTAIL MARSH AND OAKWOOD ECOSYSTEMS BY J in themilkand vegetationfromfourfarmsin Minnesotaand kindlyagreedto determine strontium90

Minnesota, University of

178

Remarks on Liquid Wall Research Mohamed Abdou  

E-Print Network [OSTI]

Wall Research Advances the Science and Energy Goals of Fusion in a Perfect Fit · If we can make liquidRemarks on Liquid Wall Research Mohamed Abdou Professor Mechanical and Aerospace Engineering UCLA Note For recent presentations and papers on liquid wall research by the APEX team see website: http

Abdou, Mohamed

179

Skyrmions from Instantons inside Domain Walls  

SciTech Connect (OSTI)

Some years ago, Atiyah and Manton described a method to construct approximate Skyrmion solutions from Yang-Mills instantons. Here we present a dynamical realization of this construction using domain walls in a five-dimensional gauge theory. The non-Abelian gauge symmetry is broken in each vacuum but restored in the core of the domain wall, allowing instantons to nestle inside the wall. We show that the world volume dynamics of the wall is given by the Skyrme model, including the four-derivative term, and the instantons appear as domain wall Skyrmions.

Eto, Minoru; Nitta, Muneto; Ohashi, Keisuke [Department of Physics, Tokyo Institute of Technology, Tokyo, 152-8551 (Japan); Tong, David [Department of Applied Mathematics and Theoretical Physics, University of Cambridge, Cambridge CB3 0WA (United Kingdom)

2005-12-16T23:59:59.000Z

180

Characterization of slow rusting components in maize (Zea mays) inbreds and single crosses  

E-Print Network [OSTI]

) under any of the conditions investigated. 14 Table 1. Disease proportion and progress rates of Puccinia polysora on maize inbreds. Year Genotype Proportion of diseasew Rate Y1 Y2 ky 1989 Tx 601 Tx5855 Tx29A Mo17 0. 45 b 0. 99 b 0. 20 c 0. 56 c...) under any of the conditions investigated. 14 Table 1. Disease proportion and progress rates of Puccinia polysora on maize inbreds. Year Genotype Proportion of diseasew Rate Y1 Y2 ky 1989 Tx 601 Tx5855 Tx29A Mo17 0. 45 b 0. 99 b 0. 20 c 0. 56 c...

Ngoko

2012-06-07T23:59:59.000Z

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Quantitative trait loci analysis to identify modifiers genes of the gene opaque2 in maize endosperm  

E-Print Network [OSTI]

with CIM analysis for traits related with endosperm texture modification (TEXT-F, TEXT-L, OPAC, and VITR) and amino acids content (Lys, Trp and Met) in a population of RILs derived from the cross between maize lines CML161 and B73o2 evaluated... with CIM analysis for traits related with endosperm texture modification (TEXT-F, TEXT-L, OPAC, and VITR) and amino acids content (Lys, Trp and Met) in a population of RILs derived from the cross between maize lines CML161 and B73o2 evaluated...

Gutierrez Rojas, Libardo Andres

2009-05-15T23:59:59.000Z

182

Microbiology: Break down the walls  

Science Journals Connector (OSTI)

... What do these findings mean for the development of biomass feedstocks? Lignification of some cell types occurs after the plant has finished growing, but early ...

Richard A. Dixon

2013-01-02T23:59:59.000Z

183

Maize Dwarf Mosaic Virus: Effect of Strain A On Corn Inbreds, Single- and Double-Cross Hybrids.  

E-Print Network [OSTI]

. '. .,~. k ? -. MAIZE DWARF MOSAIC VIRUS: EFFECT OF STRAIN A ON CORN INBREDS, SINGLE- AND DOUBLE-CROSS HYBRIDS R. W. Toler, A.J. Bockholt and F. G. Alston* *Respectively, Professor, Department of Plant Sciences, Associate Professor, and Graduate... significantly affected the performance of the hybrid. MAIZE DWARF MOSAIC VIRUS: EFFECT OF STRAIN A ON CORN INBREDS, SINGLE- AND DOUBLE-CROSS HYBRIDS R. W. Toler, A.J. Bockho1t and F. G. Alston INTRODUCTION Maize dwarf mosaic virus strain A (MDMV...

Toler, R.W.; Bockholt, A.J.; Alston, F.G.

1982-01-01T23:59:59.000Z

184

Quantum Fusion of Domain Walls with Fluxes  

E-Print Network [OSTI]

We study how fluxes on the domain wall world volume modify quantum fusion of two distant parallel domain walls into a composite wall. The elementary wall fluxes can be separated into parallel and antiparallel components. The parallel component affects neither the binding energy nor the process of quantum merger. The antiparallel fluxes, instead, increase the binding energy and, against naive expectations, suppress quantum fusion. In the small flux limit we explicitly find the bounce solution and the fusion rate as a function of the flux. We argue that at large (antiparallel) fluxes there exists a critical value of the flux (versus the difference in the wall tensions), which switches off quantum fusion altogether. This phenomenon of flux-related wall stabilization is rather peculiar: it is unrelated to any conserved quantity. Our consideration of the flux-related all stabilization is based on substantiated arguments that fall short of complete proof.

S. Bolognesi; M. Shifman; M. B. Voloshin

2009-07-20T23:59:59.000Z

185

Gene galaxies in the maize genome Virginia Walbot* and Dmitri A. Petrov  

E-Print Network [OSTI]

Commentary Gene galaxies in the maize genome Virginia Walbot* and Dmitri A. Petrov Department of higher eukary- otic genomes yielded the surprise that despite hundreds of millions of years in gene number, eukaryotic genome size varies over 5 orders of magnitude (4), a paradoxical feature

Petrov, Dmitri

186

A Genome-Wide Regulatory Framework Identifies Maize Pericarp Color1 Controlled Genes  

Science Journals Connector (OSTI)

...2-hydroxynaringenin, a key branch point in the P1-controlled pathway...pigmentation characteristic of Indian maize. Among the flavonoid...Naringenin, the branching point of the pathway, is converted...pericarp developmental time points. MYB95, encoding an R2R3-MYB...

Kengo Morohashi; María Isabel Casas; Maria Lorena Falcone Ferreyra; María Katherine Mejía-Guerra; Lucille Pourcel; Alper Yilmaz; Antje Feller; Bruna Carvalho; Julia Emiliani; Eduardo Rodriguez; Silvina Pellegrinet; Michael McMullen; Paula Casati; Erich Grotewold

2012-07-20T23:59:59.000Z

187

Association of isozyme marker-genes on chromosome 6 with resistance to MDMV in maize  

E-Print Network [OSTI]

in the estimated number of resistance genes, even for the same genotype. MATERIALS AND METHODS The choiceAssociation of isozyme marker-genes on chromosome 6 with resistance to MDMV in maize D Ignjatovi homozygous lines were chosen by both divergence in MDMV resistance and presence of segregating isozyme

Boyer, Edmond

188

POTENTIAL EFFECTS OF GLOBAL CLIMATIC CHANGE ON THE PHENOLOGY AND YIELD OF MAIZE IN VENEZUELA *  

E-Print Network [OSTI]

POTENTIAL EFFECTS OF GLOBAL CLIMATIC CHANGE ON THE PHENOLOGY AND YIELD OF MAIZE IN VENEZUELA de Ciencias, Universidad de Los Andes, Mdrida 5101, Venezuela 21nstitute of Applied Sciences, Venezuela 4Centro de Estudios Avanzados del Clima Tropical (CEACT), Ministerio deI Ambiente y de los

Robock, Alan

189

Maize Transformation -The First Papers to Copy and Read *Absolutely Essential  

E-Print Network [OSTI]

to protocol; Essential reading Armstrong, C.L., Green, C.E. and Phillips, R.L. (1991) DevelopmentMaize Transformation - The First Papers to Copy and Read *Absolutely Essential *Armstrong, C. Essential reading; how `HiII' line was derived. Armstrong, C.L. and Green, C.E. (1985) Establishment

Raizada, Manish N.

190

A Genome-Wide Regulatory Framework Identifies Maize Pericarp Color1 Controlled Genes  

Science Journals Connector (OSTI)

...overnight at 30C in 5 mL liquid SC Ura- Trp- medium containing...the 10 mL induction medium, SC Ura- Trp- containing 2...literature and bioinformatic searches were verified by a multitiered...searched on both the maize sequence website ( http://maizesequence...

Kengo Morohashi; María Isabel Casas; Maria Lorena Falcone Ferreyra; María Katherine Mejía-Guerra; Lucille Pourcel; Alper Yilmaz; Antje Feller; Bruna Carvalho; Julia Emiliani; Eduardo Rodriguez; Silvina Pellegrinet; Michael McMullen; Paula Casati; Erich Grotewold

2012-07-20T23:59:59.000Z

191

Incorporating Multiple cDNA Microarray Slide Scans -Application to Somatic Embryogenesis in Maize  

E-Print Network [OSTI]

Incorporating Multiple cDNA Microarray Slide Scans -Application to Somatic Embryogenesis in Maize 1 the measurements of gene expression. Because `optimal' settings may vary from slide to slide, operators typically scan each slide multiple times and then choose the reading with the fewest over-exposed and under

192

Parallel Proteomic and Phosphoproteomic Analyses of Successive Stages of Maize Leaf Development  

Science Journals Connector (OSTI)

...relevant phosphorylation sites. METHODS Plant Material Maize (Zea mays; B73) plants were grown in the greenhouse without supplemental lighting in 8-inch pots for 30 d, when leaf 8 was at least 50 cm long and leaf 10 was emerging from the whorl...

Michelle R. Facette; Zhouxin Shen; Fjola R. Björnsdóttir; Steven P. Briggs; Laurie G. Smith

2013-08-09T23:59:59.000Z

193

Balance between maternal and paternal alleles sets the timing of resource accumulation in the maize endosperm  

Science Journals Connector (OSTI)

...a) Plant material Diploid and tetraploid W23 inbred lines of maize (Zea mays) were greenhouse grown under a 16 h daylight cycle with supplementary lighting, at 22-28C (day) and 16-20C (night). Plants were watered to capacity and pollinations...

2010-01-01T23:59:59.000Z

194

Translational Genomics for Bioenergy Production from Fuelstock Grasses: Maize as the Model Species  

Science Journals Connector (OSTI)

...their stomata open for gas exchange during photosynthesis...MAKE SENSE FOR BIOFUEL PRODUCTION IN THE U.S. Sugarcane...sustainable biofuel production in most current discussions...KEY LESSON FROM MAIZE PRODUCTION AGRICULTURE A prime...progeny. To save the cost of manually detasseling...

Carolyn J. Lawrence; Virginia Walbot

2007-07-27T23:59:59.000Z

195

Panelized wall system with foam core insulation  

DOE Patents [OSTI]

A wall system includes a plurality of wall members, the wall members having a first metal panel, a second metal panel, and an insulating core between the first panel and the second panel. At least one of the first panel and the second panel include ridge portions. The insulating core can be a foam, such as a polyurethane foam. The foam can include at least one opacifier to improve the k-factor of the foam.

Kosny, Jan (Oak Ridge, TN); Gaskin, Sally (Houston, TX)

2009-10-20T23:59:59.000Z

196

First wall for polarized fusion reactors  

DOE Patents [OSTI]

Depolarization mechanisms arising from the recycling of the polarized fuel at the limiter and the first-wall of a fusion reactor are greater than those mechanisms in the plasma. Rapid depolarization of the plasma is prevented by providing a first-wall or first-wall coating formed of a low-Z, non-metallic material having a depolarization rate greater than 1 sec.sup.-1.

Greenside, Henry S. (Cranbury, NJ); Budny, Robert V. (Princeton, NJ); Post, Jr., Douglass E. (Buttonwood, CT)

1988-01-01T23:59:59.000Z

197

Skyrmions from Instantons inside Domain Walls  

E-Print Network [OSTI]

Some years ago, Atiyah and Manton described a method to construct approximate Skyrmion solutions from Yang-Mills instantons. Here we present a dynamical realization of this construction using domain walls in a five-dimensional gauge theory. The non-abelian gauge symmetry is broken in each vacuum but restored in the core of the domain wall, allowing instantons to nestle inside the wall. We show that the worldvolume dynamics of the wall is given by the Skyrme model, including the four-derivative term, and the instantons appear as Skyrmions.

Minoru Eto; Muneto Nitta; Keisuke Ohashi; David Tong

2005-08-18T23:59:59.000Z

198

Modeling Drilled Shafts in MSE Block Walls  

E-Print Network [OSTI]

ACKNOWLEDGEMENTS xii ABSTRACT xiii 1 INTRODUCTION 1 2 LITERATURE REVIEW 3 2.1 Physical Testing 3 2.1.1 MSE Wall Design (FHWA) 3 2.1.2 Design of Laterally Loaded Shafts 6 2.1.3 Design of Drilled Shafts Supporting Sound Walls 7 2.1.4 Topics Related to MSE... Wall Interaction with Bridges 8 2.1.5 Lateral Loading of Facing and Retained Soil 9 2.1.6 Physical Test Results 11 2.1.6.1 Construction and Instrumentation of Test Wall 12 2.1.6.2 Physical Testing and Results 17 2.2 Numerical Approaches 22 2...

Pierson, Matthew Charles

2010-09-01T23:59:59.000Z

199

Multiple moving wall dry coal extrusion pump  

DOE Patents [OSTI]

A pump for transporting particulate material includes a passageway defined on each side between an inlet and an outlet by a moving wall.

Fitzsimmons, Mark Andrew

2013-05-14T23:59:59.000Z

200

First wall for polarized fusion reactors  

DOE Patents [OSTI]

A first-wall or first-wall coating for use in a fusion reactor having polarized fuel may be formed of a low-Z non-metallic material having slow spin relaxation, i.e., a depolarization rate greater than 1 sec/sup -1/. Materials having these properties include hydrogenated and deuterated amorphous semiconductors. A method for preventing the rapid depolarization of a polarized plasma in a fusion device may comprise the step of providing a first-wall or first-wall coating formed of a low-Z, non-metallic material having a depolarization rate greater than 1 sec/sup -1/.

Greenside, H.S.; Budny, R.V.; Post, D.E. Jr.

1985-01-29T23:59:59.000Z

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Xylan and Lignin Deposition on the Secondary Wall of Fagus Crenata Fibers  

Science Journals Connector (OSTI)

ABSTRACT The secondary wall ultrastructure of Fagus crenata fibers was examined using field emission scanning electron microscopy (FESEM). Specimens were treated with sodium chlorite and xylanase to remove lignin and xylan, respectively. Microfibrils were clearly visible at the innermost surface of the differentiating fiber secondary wall and there were no globular substances observed in the control specimen. After delignification or xylanase-degradation, microfibrils remained almost the same size and had the same appearance as controls. Anti-xylan antiserum immunolabeling, however, indicated that the microfibrils were coated with very thin layer of xylan1. Microfibrils were not apparent in the secondary wall of the mature fiber in control specimens. The secondary wall appeared to be a single homogeneous substance. Microfibrils with many globular substances were observed in the delignified specimens and their diameter was larger than that of microfibrils at the surface of the differentiating secondary wall. Following xylanase treatment, the microfibrils had a smooth surface without any globules, indicating that the globular structure is xylan. On the basis of these results, we propose the following mechanism for secondary wall assembly. Cellulose microfibrils synthesized on the plasma membrane are released into the innermost surface of the secondary wall and coated with a very thin layer of xylan that was previously deposited there. Successive deposition of xylan into the cell wall increases the diameter of the microfibrils. The large amount of xylan deposited on the microfibrils has a globular appearance. Lignin deposition occurs simultaneously with xylan deposition and, finally, microfibrils with globular xylan are masked with lignin, resulting in the homogeneous appearance of the cell wall.

Tatsuya Awano; Keiji Takabe; Minoru Fujita

2001-01-01T23:59:59.000Z

202

Beetle Kill Wall at NREL  

ScienceCinema (OSTI)

When it comes to designing an interior decorative feature for one of the most energy efficient office buildings in the world, very few would consider bringing in a beetle to do the job. But thats what happened at the U.S. Department of Energy's (DOE) Research Support Facility (RSF) located on the National Renewable Energy Laboratory (NREL) campus.In June, the RSF will become home to more than 800 workers from DOE and NREL and building visitors will be greeted with a soaring, two-story high wall entirely covered with wood harvested from the bark beetle infestation that has killed millions of pine trees in the Western U.S. But, the use of beetle kill wood is just one example of the resources being leveraged to make the RSF a model for sustainability and one more step toward NRELs goal to be a net zero energy campus.

None

2013-05-29T23:59:59.000Z

203

Virtual gap dielectric wall accelerator  

DOE Patents [OSTI]

A virtual, moving accelerating gap is formed along an insulating tube in a dielectric wall accelerator (DWA) by locally controlling the conductivity of the tube. Localized voltage concentration is thus achieved by sequential activation of a variable resistive tube or stalk down the axis of an inductive voltage adder, producing a "virtual" traveling wave along the tube. The tube conductivity can be controlled at a desired location, which can be moved at a desired rate, by light illumination, or by photoconductive switches, or by other means. As a result, an impressed voltage along the tube appears predominantly over a local region, the virtual gap. By making the length of the tube large in comparison to the virtual gap length, the effective gain of the accelerator can be made very large.

Caporaso, George James; Chen, Yu-Jiuan; Nelson, Scott; Sullivan, Jim; Hawkins, Steven A

2013-11-05T23:59:59.000Z

204

Comparative analysis of environmental impacts of maize-biogas and photovoltaics on a land use basis  

SciTech Connect (OSTI)

This study aims to stimulate the discussion on how to optimize a sustainable energy mix from an environmental perspective and how to apply existing renewable energy sources in the most efficient way. Ground-mounted photovoltaics (PV) and the maize-biogas-electricity route are compared with regard to their potential to mitigate environmental pressure, assuming that a given agricultural area is available for energy production. Existing life cycle assessment (LCA) studies are taken as a basis to analyse environmental impacts of those technologies in relation to conventional technology for power and heat generation. The life-cycle-wide mitigation potential per area used is calculated for the impact categories non-renewable energy input, green house gas (GHG) emissions, acidification and eutrophication. The environmental performance of each system depends on the scenario that is assumed for end energy use (electricity and heat supply have been contemplated). In all scenarios under consideration, PV turns out to be superior to biogas in almost all studied impact categories. Even when maize is used for electricity production in connection with very efficient heat usage, and reduced PV performance is assumed to account for intermittence, PV can still mitigate about four times the amount of green house gas emissions and non-renewable energy input compared to maize-biogas. Soil erosion, which can be entirely avoided with PV, exceeds soil renewal rates roughly 20-fold on maize fields. Regarding the overall Eco-indicator 99 (H) score under most favourable assumptions for the maize-biogas route, PV has still a more than 100% higher potential to mitigate environmental burden. At present, the key advantages of biogas are its price and its availability without intermittence. In the long run, and with respect to more efficient land use, biogas might preferably be produced from organic waste or manure, whereas PV should be integrated into buildings and infrastructures. (author)

Graebig, Markus; Fenner, Richard [Centre for Sustainable Development, Department of Engineering, University of Cambridge (United Kingdom); Bringezu, Stefan [Wuppertal Institute for Climate, Environment and Energy. P.B. 100480, 42004 Wuppertal (Germany)

2010-07-15T23:59:59.000Z

205

Sealed feed-through for a wall in an alkaline battery  

SciTech Connect (OSTI)

The sealed feed-through interconnects two cells of an alkaline storage battery (eg. for an electrically propelled car) by passing through a wall of the battery. The battery includes a monobloc casing of plastic material defining at least two battery cell compartments which are separated by said wall, and said wall has an orifice for receiving the feed-through. The feed-through comprises a first portion for electrical connection to electrodes of a first polarity in a first one of the cells and a second portion for electrical connection to electrodes of opposite polarity in the other cell. In an alkaline battery, conventional welding techniques for making such feed-throughs in lead-acid batteries are not applicable because metals such as nickel steel must be used instead of lead. The resulting welding temperature would destroy the plastic wall. Instead, the first and second portions include interfitting male and female portions suitable for passing through said orifice from opposite sides thereof and for engaging each other in a force fit. Respective skirts surround said interfitting portions and serve to compress at least one deformable sealing member around the orifice. Stops are provided to prevent the wall being crushed when the feed-through portions are forced together.

Bellis, L.; Prokopp, R.

1984-10-30T23:59:59.000Z

206

Early Events in the Fusarium verticillioides-Maize Interaction Characterized by Using a Green Fluorescent Protein-Expressing Transgenic Isolate  

Science Journals Connector (OSTI)

...common maize fungi. Cereal Res. Commun. 25...grown from infected seeds. Plant Dis. 81...Fusarium pathosystem. Cereal Res. Commun. 25...Institute for Cereal Crop Improvement...Proteins genetics metabolism Microscopy, Fluorescence...Roots microbiology Seeds microbiology Transgenes...

Liat Oren; Smadar Ezrati; David Cohen; Amir Sharon

2003-03-01T23:59:59.000Z

207

Increasing influence of heat stress on French maize yields from the 1960s to the 2030s  

E-Print Network [OSTI]

Increasing influence of heat stress on French maize yields from the 1960s to the 2030s Ed Hawkins1 for each day with a maximum temperature above 32 C, in broad agreement with previous estimates. The recent

Hawkins, Ed

208

Emissions of carbon dioxide, methane and nitrous oxide from soil receiving urban wastewater for maize (Zea mays L.) cultivation  

Science Journals Connector (OSTI)

We investigated how amending maize with wastewater at 120 kg N ha?1 affected crop growth, soil characteristics and emissions of carbon dioxide (CO2), methane (CH4) and nitrous oxide (N2O) compared to plants ferti...

Fabián Fernández-Luqueño; Verónica Reyes-Varela…

2010-06-01T23:59:59.000Z

209

Remarks on Liquid Wall Research Mohamed Abdou  

E-Print Network [OSTI]

Remarks on Liquid Wall Research Mohamed Abdou Professor Mechanical and Aerospace Engineering UCLA physicists and engineering scientists · Enhances synergism between IFE and MFE · Provides excellent disciplines. #12;Several "Ideas" Have Been Proposed for Liquid Walls Fluids 1) High-conductivity, low Pr

California at Los Angeles, University of

210

Effects of environment and genotype on hardness and alkaline cooking properties of maize / by Troy Marc Goldstein  

E-Print Network [OSTI]

EFFECTS OF ENVIRONMENT AND GENOTYPE ON HARDNESS AND ALKALINE COOKING PROPERTIES OF MAIZE A Thesis by TROY MARC GOLDSTEIN Submitted to the Graduate College of Texas A&M University in partial fulfillment of the requirements for the degree... of MASTER OF SCIENCE December 1983 Major Subject: Food Science and Tecnnology EFFECTS OF ENVIRONMENT AND GENOTYPE ON HARDNESS AND ALKALINE COOKING PROPERTIES OF MAIZE A Thesis TROY MARC GOLDSTEIN Approved as to style and content by: / Lloyd W. Roonev...

Goldstein, Troy Marc

2012-06-07T23:59:59.000Z

211

Identification of opaque-2 genotypes in segregating populations of quality protein maize by analysis of restriction fragment length polymorphisms  

E-Print Network [OSTI]

IDENTIFICATION OF OPAQUE-2 GENOTYPES IN SEGREGATING POPULATIONS OF QUALITY PROTEIN MAIZE BY ANALYSIS OF RESTRICTION FRAGMENT LENGTH POLYMORPHISMS A Thesis by SRINIVAS REDDY KATA Submitted to the Office of Graduate Studies of Texas Adt...M University in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE August 1993 Major Subject: Genetics IDENTIFICATION OF OPAQUE-2 GENOTYPES IN SEGREGATING POPULATIONS OF QUALITY PROTEIN MAIZE BY ANALYSIS OF RESTRICTION FRAGMENT...

Kata, Srinivas Reddy

1993-01-01T23:59:59.000Z

212

Wall System Innovations: Familiar Materials, Better Performance  

Broader source: Energy.gov (indexed) [DOE]

1 1 Wall System Innovation Vladimir Kochkin Joseph Wiehagen April 2013 Wall Innovation Metrics  High R (thermal and air barrier)  High Performance  Durable, structural  Build-able  Low transition risk to builders  50% Building America Goal  ≈ R25+ (CZ 4 and higher) 2 Background  Technologies for high-R walls have been proposed and used for over 25 years  But real market penetration is very low  Often the last EE measure implemented by builders (e.g. E*) 3 Background  High-R wall solutions have not achieved a broad level of standardization and commonality  A large set of methods and materials entered the market  Multiple and conflicting details  Wall characteristics are more critical = RISK 4 New Home Starts -

213

Acreage response before and after the deregulation of the South African maize industry : the role of SAFEX in price discovery and price risk managment.  

E-Print Network [OSTI]

??Includes abstract. The withdwal of the Maize Board in 1996 meant that farmers could no longer rely on their pre-planting price or "voorskat" for price… (more)

Behar, Alexander.

2010-01-01T23:59:59.000Z

214

FREE CONVECTIVE LAMINAR FLOW WITHIN THE TROMBE WALL CHANNEL  

E-Print Network [OSTI]

LAMINAR FLOW WITHIN THE TROMBE WALL CHANNEL H. Akbarf andLAMINAR FLOW WITHIN THE TROMBE WALL CHANNEL H. Akbari andchannel surfaces of the Trombe wall has been investigated.

Akbari, H.

2011-01-01T23:59:59.000Z

215

Effective Action of Domain Wall Networks  

E-Print Network [OSTI]

U(Nc) gauge theory with Nf fundamental scalars admits BPS junctions of domain walls. When the networks/webs of these walls contain loops, their size moduli give localized massless modes. We construct Kahler potential of their effective action. In the large size limit Kahler metric is well approximated by kinetic energy of walls and junctions, which is understood in terms of tropical geometry. Kahler potential can be expressed in terms of hypergeometric functions which are useful to understand small size behavior. Even when the loop shrinks, the metric is regular with positive curvature. Moduli space of a single triangle loop has a geometry between a cone and a cigar.

Minoru Eto; Toshiaki Fujimori; Takayuki Nagashima; Muneto Nitta; Keisuke Ohashi; Norisuke Sakai

2006-12-01T23:59:59.000Z

216

Hydrogenation of single-walled carbon nanotubes  

E-Print Network [OSTI]

Towards the development of a useful mechanism for hydrogen storage, we have studied the hydrogenation of single-walled carbon nanotubes with atomic hydrogen using core-level photoelectron spectroscopy and x-ray absorption spectroscopy. We find that atomic hydrogen creates C-H bonds with the carbon atoms in the nanotube walls and such C-H bonds can be com-pletely broken by heating to 600 oC. We demonstrate approximately 65+/-15 at % hydrogenation of carbon atoms in the single-walled carbon nanotubes which is equivalent to 5.1+/-1.2 weight % hydrogen capacity. We also show that the hydrogenation is a reversible process.

Anton Nikitin; Hirohito Ogasawara; David Mann; Reinhard Denecke; Zhiyong Zhang; Hongjie Dai; KJ Cho; Anders Nilsson

2005-10-14T23:59:59.000Z

217

Symmetry of single-wall nanotubes  

Science Journals Connector (OSTI)

A review of the symmetry groups of the various single-wall nano- and microtubes considered in the literature (BN, GaN, MS2, C, BC3, BC2N) is presented.

Damnjanovic, M.

2001-04-27T23:59:59.000Z

218

Nonextensive statistical dynamics applied to wall turbulence  

E-Print Network [OSTI]

We apply a formalism of nonextensive statistical mechanics to experimental wall turbulence data, for the first time to our knowledge. Wind tunnel data for velocity differences a streamwise distance $r$ apart are compared to the prediction from theory as developed by Beck. The simplest theory, in which all free parameters are removed, is found to reproduce statistics for the wall-normal velocity component remarkably well, even for $r$ well beyond the corresponding integral scale, while the corresponding description of the streamwise velocity fluctuations is reasonable at separations below the integral scale. A least-squares 2-parameter fit is performed, and the dependence of the optimum parameter values on wall separation and $r$ is analysed. Both parameters are found to be approximately independent of wall-separation in the logarithmic sub-layer.

Simen Å Ellingsen; Per-Åge Krogstad

2014-02-10T23:59:59.000Z

219

Beautify Your Windows and Glass Walls.  

E-Print Network [OSTI]

-utside? How do your dqkrie outside of your house? 2 IlnKY color affect , Coloor, De~kn and Tex When choosing draperies to har- monize with a room, consider the room, proportions, exposure, view, walls, floors, furnishings, accessories...

Tompkins, Charlotte

1961-01-01T23:59:59.000Z

220

In situ Groundwater Remediation Using Treatment Walls  

Science Journals Connector (OSTI)

Development of treatment wall technology for the clean up of contaminated ground-water resources has expanded in the past few...ex situ and other in situ ground-water remediation approaches is reduced operation a...

Radisav D. Vidic; Frederick G. Pohland

2002-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

CLIMBING WALL POLICIES Open Bouldering Policies  

E-Print Network [OSTI]

. Climb at your own risk. Supervised Climbing Rules: 1. All climbers must check in at the climbing wall a munter knot and/or a figure eight belay device are not acceptable ways to belay. 11. Shirts and close

222

Axions from cosmic string and wall decay  

SciTech Connect (OSTI)

If inflation occurred with a reheat temperature > T{sub PQ}, axions from the decay of global axion strings and domain walls would make an important contribution to the cosmological energy density, comparable to that from vacuum misalignment. Several groups have numerically studied the evolution of axion strings and walls in the past, however substantial uncertainties remain in their contribution to the present density {Omega}{sub a,string+wall} {approx} 1-100 (f{sub a}/10{sup 12} GeV){sup 7/6}, where f{sub a} is the axion decay constant. I will describe the numerical methods used in our simulations and show results for several string and wall configurations.

Hagmann, C A

2010-03-10T23:59:59.000Z

223

Domain walls with non-Abelian clouds  

SciTech Connect (OSTI)

Domain walls in U(N) gauge theories, coupled to Higgs scalar fields with degenerate masses, are shown to possess normalizable non-Abelian Nambu-Goldstone (NG) modes, which we call non-Abelian clouds. We construct the moduli space metric and its Kaehler potential of the effective field theory on the domain walls by focusing on two models: a U(1) gauge theory with several charged Higgs fields, and a U(N) gauge theory with 2N Higgs fields in the fundamental representation. We find that non-Abelian clouds spread between two domain walls and that their rotation induces a long-range repulsive force, in contrast to a U(1) mode in models with fully nondegenerate masses which gives a short-range force. We also construct a bound state of dyonic domain walls by introducing the imaginary part of the Higgs masses. In the latter model we find that when all walls coincide, SU(N){sub L}xSU(N){sub R}xU(1) symmetry is broken down to SU(N){sub V}, and U(N){sub A} NG modes and the same number of quasi-NG modes are localized on the wall. When n walls separate, off-diagonal elements of U(n) NG modes have wave functions spreading between two separated walls (non-Abelian clouds), whereas some quasi-NG modes turn to NG bosons as a result of further symmetry breaking U(n){sub V}{yields}U(1){sub V}{sup n}. In the case of 4+1-dimensional bulk, we can dualize the effective theory to the supersymmetric Freedman-Townsend model of non-Abelian 2-form fields.

Eto, Minoru [INFN, Sezione di Pisa, Largo Pontecorvo, 3, Ed. C, 56127 Pisa (Italy); Department of Physics, University of Pisa Largo Pontecorvo, 3, Ed. C, 56127 Pisa (Italy); Fujimori, Toshiaki; Sakai, Norisuke [Department of Physics, Tokyo Institute of Technology, Tokyo 152-8551 (Japan); Nitta, Muneto [Department of Physics, Keio University, Hiyoshi, Yokohama, Kanagawa 223-8521 (Japan); Ohashi, Keisuke [Department of Applied Mathematics and Theoretical Physics, University of Cambridge, CB3 0WA (United Kingdom)

2008-06-15T23:59:59.000Z

224

Electric and Magnetic Walls on Dielectric Interfaces  

E-Print Network [OSTI]

Sufficient conditions of the existence of electric or magnetic walls on dielectric interfaces are given for a multizone uniform dielectric waveguiding system. If one of two adjacent dielectric zones supports a TEM field distribution while the other supports a TM (TE) field distribution, then the common dielectric interface behaves as an electric (magnetic) wall, that is, the electric (magnetic) field line is perpendicular to the interface while the magnetic (electric) field line is parallel to the interface.

Changbiao Wang

2010-07-20T23:59:59.000Z

225

INTOR impurity control and first wall system  

SciTech Connect (OSTI)

The highlights of the recent INTOR effort on examining the key issues of the impurity control/first wall system are summarized. The emphasis of the work was an integrated study of the edge-region physics, plasma-wall interaction, materials, engineering and magnetic considerations associated with the poloidal divertor and pump limiter. The development of limiter and divertor collector plate designs with an acceptable lifetime was a major part of the work.

Abdou, M.A.

1983-04-01T23:59:59.000Z

226

Modelling of Ion Cyclotron Wall Conditioning plasmas  

SciTech Connect (OSTI)

Ion Cyclotron Wall Conditioning (ICWC) is envisioned in ITER to clean the wall from impurities, to control the wall isotopic ratio and the hydrogen recycling in the presence of the toroidal magnetic field. Various experiments and modelling are advancing to consolidate this technique. In this contribution the modeling of ICWC is presented, which can be divided in two parts: plasma description and plasma wall interaction. Firstly a 0D plasma model, based on a set of energy and particle balance equations for Maxwellian Hydrogen and Helium species, is presented. The model takes into account elementary collision processes, coupled RF power, particle confinement, wall recycling, and active gas injection and pumping. The RF plasma production process is based mainly on electron collisional ionization. The dependency of the plasma parameters, the Hydrogen and Helium partial pressures and neutral or ionic fluxes on pressure and RF power are quantitatively in good agreement with those obtained experimentally on TORE SUPRA. Secondly an extension of the 0D model including the description of the wall interaction is presented and compared to TORE SUPRA multi-pulse ICWC discharges.

Douai, D.; Wauters, T.; Wuenderlich, D.; Bremond, S.; Lombard, G.; Mollard, P.; Pegourie, B. [CEA, IRFM, 13108 St Paul lez Durance (France); Lyssoivan, A. [LPP-ERM/KMS, 1000 Brussels (Belgium); Marchuk, O. [IEK-4, FZ Juelich, 52425 Juelich (Germany); Van Oost, G. [Ghent University, 9000 Ghent (Belgium)

2011-12-23T23:59:59.000Z

227

Demethylesterification of the Primary Wall by PECTIN METHYLESTERASE35 Provides Mechanical Support to the Arabidopsis Stem  

Science Journals Connector (OSTI)

...v/v) ethanol followed by treatment with 50% (v/v) aqueous...sections was analyzed for each treatment condition. The staining experiments...represented the distance between the surfaces of the plunger and the stage...antibodies to plant cell wall xylans and arabinoxylans. J. Histochem...

Shoko Hongo; Kaori Sato; Ryusuke Yokoyama; Kazuhiko Nishitani

2012-06-12T23:59:59.000Z

228

Supplementation of ogi, a maize-based infant weaning food, with African oil bean seed (Pentaclethra macrophylla Benth)  

Science Journals Connector (OSTI)

Maize ogi is a popular starchy porridge in the west coasts of Africa. Although consumed by adults as a breakfast cereal, its main use is as a weaning food for infants. In this study, the quality of ogi from a composite mixture of maize (Zea mays L.) and oil bean seed (Pentaclethra macrophylla Benth) flours was evaluated. Maize was substituted with oil bean seed at ratios of 90:10, 80:20, 70:30 and 60:40 maize/oil bean, with 100% maize ogi flour as control. The results show that protein content increased with increased oil bean seed substitution, reaching 33.25% dry weight at 60:40 ratio. The mineral composition also showed marked improvement with increased substitution. On the other hand, tannins and oxalates increased with higher content of oil bean seed. However, the level of phytic acid was lowered with higher oil bean substitution. Pasting characteristics showed that higher oil bean seed substitution meant marked depreciation in the ease of cooking, and the peak viscosity was lowered. Results of sensory evaluation show that colour and flavour were significantly (P oil bean seed beyond 20% substitution level, while the resultant ogi gels were still acceptable in terms of mouthfeel and overall acceptability at ? 20% substitution level. The present study indicates that the quality attributes of ogi can be enhanced at ? 20% oil bean seed substitution of the ogi mass, with higher nutrient content and lower content of anti-nutritional factors.

Victor N. Enujiugha

2006-01-01T23:59:59.000Z

229

Photoresponse from noble metal nanoparticles-multi walled carbon nanotube composites  

SciTech Connect (OSTI)

In this Letter, we investigated the photo-response of multi wall carbon nanotube-based composites obtained from in situ thermal evaporation of noble metals (Au, Ag, and Cu) on the nanotube films. The metal deposition process produced discrete nanoparticles on the nanotube outer walls. The nanoparticle-carbon nanotube films were characterized by photo-electrochemical measurements in a standard three electrode cell. The photocurrent from the decorated carbon nanotubes remarkably increased with respect to that of bare multiwall tubes. With the aid of first-principle calculations, these results are discussed in terms of metal nanoparticle-nanotube interactions and electronic charge transfer at the interface.

Scarselli, M.; Camilli, L.; Castrucci, P.; De Crescenzi, M. [Dipartimento di Fisica, Universita di Roma Tor Vergata, Via della Ricerca Scientifica 1, 00133 Roma (Italy); Matthes, L. [Dipartimento di Fisica, Universita di Roma Tor Vergata, Via della Ricerca Scientifica 1, 00133 Roma (Italy); Institut fuer Festkoepertheorie und optik, Friedrich Schiller Universitaet, Max-Wien Platz 1, Jena (Germany); Pulci, O. [Dipartimento di Fisica, Universita di Roma Tor Vergata, Via della Ricerca Scientifica 1, 00133 Roma (Italy); ETSF, MIFO, and CNR-ISM, Via del Fosso del Cavaliere, Roma (Italy); Gatto, E.; Venanzi, M. [Dipartimento di Scienze e Tecnologie Chimiche, Universita di Roma Tor Vergata, Via della Ricerca Scientifica 1, 00133 Roma (Italy)

2012-12-10T23:59:59.000Z

230

WallBots: Interactive Wall-Crawling Robots In the Hands of Public Artists and Political Activists  

E-Print Network [OSTI]

WallBots: Interactive Wall-Crawling Robots In the Hands of Public Artists and Political Activists present WallBots- autonomous, wall-crawling robots as a research probe for public expression across a wide, street art INTRODUCTION "People look at an oil painting and admire the use of brushstrokes to convey

Paulos, Eric

231

Ultrastructure and Composition of the Nannochloropsis gaditana Cell Wall  

Science Journals Connector (OSTI)

...Mesa, Arizona, USA Marine algae of the genus Nannochloropsis...insights from the oleaginous model alga Nannochloropsis gaditana. Bioengineered...Nejad. 2012. Large-scale biodiesel production using microalgae...2010. Genetic engineering of algae for enhanced biofuel production...

Matthew J. Scholz; Taylor L. Weiss; Robert E. Jinkerson; Jia Jing; Robyn Roth; Ursula Goodenough; Matthew C. Posewitz; Henri G. Gerken

2014-09-19T23:59:59.000Z

232

Macrophage activation by bacterial cell walls and related synthetic compounds.  

Science Journals Connector (OSTI)

...state, which results from an additive character of lipophilicity...state, which results from an additive character of lipophilicity...state, which results from an additive character of lipophilicity...BY [B30]-MDP Bachofen Manufacturing Engineers, Basel, Switzer...

H Takada; M Tsujimoto; K Kato; S Kotani; S Kusumoto; M Inage; T Shiba; I Yano; S Kawata; K Yokogawa

1979-07-01T23:59:59.000Z

233

Lipid Transfer Proteins Enhance Cell Wall Extension in Tobacco  

Science Journals Connector (OSTI)

...shows that these treatments completely inhibited...saturation. After dialysis at 5C overnight...degradation after papain treatment was confirmed by...two-dimensional electrophoresis was performed by...intermolecular NOEs with water and small organic...for Wetland and Water Research, Department...

Jeroen Nieuwland; Richard Feron; Bastiaan A.H. Huisman; Annalisa Fasolino; Cornelis W. Hilbers; Jan Derksen; Celestina Mariani

2005-06-03T23:59:59.000Z

234

Imaging cell wall architecture in single Zinnia elegans tracheary elements  

E-Print Network [OSTI]

processing steps in biomass conversion involves systematicof novel approaches for conversion of biomass to liquid bio-

Lacayo, Catherine

2012-01-01T23:59:59.000Z

235

Variants in the Structural Polysaccharides of Algal Cell Walls  

Science Journals Connector (OSTI)

... invariable presence in marine algae of a deposit of micro-crystalline material on the plant surfaces*. This deposit, which is often present in large amounts, especially in filamentous algae ... Roelofsen et al,12, correctly in our view, refer to the large amount of xylan present. We have found that treatment of Halicystis holocellulose with caustic potash solutions of ...

EVA FREI; R. D. PRESTON

1961-12-09T23:59:59.000Z

236

Aspergillus Enzymes Involved in Degradation of Plant Cell Wall Polysaccharides  

Science Journals Connector (OSTI)

...awamori on alkali-extractable cereal arabinoxylans. . F. J. M...of diverse origin on legume seed galactomannans. . B. V. McCleary...in the promoter region of the starch-inducible taka-amylase A...improvement of the quality of cereal foods. . J. Puls A. Borneman...

Ronald P. de Vries; Jaap Visser

2001-12-01T23:59:59.000Z

237

Lipid Transfer Proteins Enhance Cell Wall Extension in Tobacco  

Science Journals Connector (OSTI)

...hypothesize that LTP slightly reduces the energy barriers for rearrangements in the cellulose/xyloglucan network toward lower energy configurations, thereby facilitating...protein gene, during embryo development in Norway spruce (Picea abies). Plant Mol. Biol...

Jeroen Nieuwland; Richard Feron; Bastiaan A.H. Huisman; Annalisa Fasolino; Cornelis W. Hilbers; Jan Derksen; Celestina Mariani

2005-06-03T23:59:59.000Z

238

Lipid Transfer Proteins Enhance Cell Wall Extension in Tobacco  

Science Journals Connector (OSTI)

...semilogarithmically plotted to show log-like behavior. The logarithmic...nonlinear in t, it is linear in log(t/taun); therefore, N...and the cucumber hypocotyl are well described by Equation 1. We...Laboratory of the University of Alabama (Birmingham). To test protein...

Jeroen Nieuwland; Richard Feron; Bastiaan A.H. Huisman; Annalisa Fasolino; Cornelis W. Hilbers; Jan Derksen; Celestina Mariani

2005-06-03T23:59:59.000Z

239

A study of the molecular mechanics of wood cell walls  

E-Print Network [OSTI]

Wood is the original structural material, developed by nature to support tall plants. Every advantageous feature of wood as used in artificial structures is rooted in the plant's evolved capability to withstand the conditions ...

Adler, David, S.M. (David C.). Massachusetts Institute of Technology

2013-01-01T23:59:59.000Z

240

living walls | OpenEI Community  

Open Energy Info (EERE)

14 14 Varnish cache server Home Groups Community Central Green Button Applications Developer Utility Rate FRED: FRee Energy Database More Public Groups Private Groups Features Groups Blog posts Content Stream Documents Discussions Polls Q & A Events Notices My stuff Energy blogs 429 Throttled (bot load) Error 429 Throttled (bot load) Throttled (bot load) Guru Meditation: XID: 2142229614 Varnish cache server living walls Home Dc's picture Submitted by Dc(15) Member 15 November, 2013 - 13:26 Living Walls ancient building system architect biomimicry building technology cooling cu daylight design problem energy use engineer fred andreas geothermal green building heat transfer heating living walls metabolic adjustment net zero pre-electricity Renewable Energy Solar university of colorado utility grid Wind

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Effective action of domain wall networks  

SciTech Connect (OSTI)

U(N{sub C}) gauge theory with N{sub F} fundamental scalars admits BPS junctions of domain walls. When the networks/webs of these walls contain loops, their size moduli give localized massless modes. We construct Kaehler potential of their effective action. In the large size limit Kaehler metric is well approximated by kinetic energy of walls and junctions, which is understood in terms of tropical geometry. Kaehler potential can be expressed in terms of hypergeometric functions that are useful to understand small size behavior. Even when the loop shrinks, the metric is regular with positive curvature. Moduli space of a single triangle loop has a geometry between a cone and a cigar.

Eto, Minoru [Institute of Physics, University of Tokyo, Komaba 3-8-1, Tokyo 153-8902 (Japan); Fujimori, Toshiaki; Nagashima, Takayuki; Ohashi, Keisuke; Sakai, Norisuke [Department of Physics, Tokyo Institute of Technology, Tokyo 152-8551 (Japan); Nitta, Muneto [Department of Physics, Keio University, Hiyoshi, Yokohama, Kanagawa 223-8521 (Japan)

2007-02-15T23:59:59.000Z

242

Wall thickness measuring method and apparatus  

DOE Patents [OSTI]

An apparatus for measuring the wall thickness of a nonmagnetic article having a housing supporting a magnet and a contiguous supporting surface. The tubular article and the housing are releasably secured to the supporting surface and a support member of an optical comparator, respectively. To determine the wall thickness of the article at a selected point, a magnetically responsive ball is positioned within the tubular article over said point and retained therein by means of a magnetic field produced by the magnet. Thereafter, an optical comparator is employed to project a magnified image of the ball on a screen and the wall thickness at the selected point is calculated by using a ball surface measurement taken with the comparator in conjunction with a previously determined base line measurement.

Salzer, L.J.; Bergren, D.A.

1987-10-06T23:59:59.000Z

243

Thermodynamics of free Domain Wall fermions  

E-Print Network [OSTI]

Studying various thermodynamic quantities for the free domain wall fermions for both finite and infinite fifth dimensional extent N_5, we find that the lattice corrections are minimum for $N_T\\geq10$ for both energy density and susceptibility, for its irrelevant parameter M in the range 1.45-1.50. The correction terms are, however, quite large for small lattice sizes of $N_T\\leq8$. We propose modifications of the domain wall operator, as well as the overlap operator, to reduce the finite cut-off effects to within 10% of the continuum results of the thermodynamic quantities for the currently used N_T=6-8 lattices. Incorporating chemical potential, we show that \\mu^2 divergences are absent for a large class of such domain wall fermion actions although the chiral symmetry is broken for $\\mu\

R. V. Gavai; Sayantan Sharma

2008-11-19T23:59:59.000Z

244

Living Walls | OpenEI Community  

Open Energy Info (EERE)

Living Walls Living Walls Home > Groups > Buildings Dc's picture Submitted by Dc(15) Member 15 November, 2013 - 13:26 ancient building system architect biomimicry building technology cooling cu daylight design problem energy use engineer fred andreas geothermal green building heat transfer heating living walls metabolic adjustment net zero pre-electricity Renewable Energy Solar university of colorado utility grid Wind Much of the discussion surrounding green buildings centers around reducing energy use. The term net zero is the platinum standard for green buildings, meaning the building in question does not take any more energy from the utility grid than it produces using renewable energy resources, such as solar, wind, or geothermal installations (and sometimes these renewable energy resources actually feed energy back to the utility grid). Architects

245

Delivery of Prolamins to the Protein Storage Vacuole in Maize Aleurone Cells  

Science Journals Connector (OSTI)

...Wisconsin, Madison, Wisconsin 53706 c Department of Agronomy and Horticulture, Center for Plant Science Innovation, University of Nebraska...14-h-light/10-h-dark photoperiod, supplemental lighting (700 mumol m2 s1), and average temperature of 28C during...

Francisca C. Reyes; Taijoon Chung; David Holding; Rudolf Jung; Richard Vierstra; Marisa S. Otegui

2011-02-22T23:59:59.000Z

246

Delivery of Prolamins to the Protein Storage Vacuole in Maize Aleurone Cells  

Science Journals Connector (OSTI)

...53706 c Department of Agronomy and Horticulture, Center for Plant Science Innovation...lines B73 and A636) were grown in a greenhouse under a 14-h-light/10-h-dark photoperiod, supplemental lighting (700 mumol m2 s1), and average...

Francisca C. Reyes; Taijoon Chung; David Holding; Rudolf Jung; Richard Vierstra; Marisa S. Otegui

2011-02-22T23:59:59.000Z

247

Transcriptional dynamics during cell wall removal and regeneration reveals key genes involved in cell wall development in rice.  

E-Print Network [OSTI]

biosynthesis including an alpha amylase (LOC_Os09g28400),glycosyl hydrolases (alpha amylase, beta amylase, chitinase

Sharma, Rita; Tan, Feng; Jung, Ki-Hong; Sharma, Manoj K; Peng, Zhaohua; Ronald, Pamela C

2011-01-01T23:59:59.000Z

248

The effect of the time of inoculation with Maize Dwarf Mosaic Virus on grain sorghum  

E-Print Network [OSTI]

the effect of the time of inoculation with Maize Dwarf Mosaic Virus on some agronomic charac- teristics of a tolerant and a susceptible grain sorghum hybrid. A completely randomized block design with three replications was util- ized, Mass inoculation.... The magn ?. 'tu. :e of the effects of tl e viru' was dependent tl. e particular hybz. id and the time of inoculation. As expected, the toLerant hybrid was affected to s. esser degree than the susceptible hybrid. Tn general, the earlier in the growth...

Batte, Robert Dan

2012-06-07T23:59:59.000Z

249

Genetic Combining Analysis of Food-Grade Maize: Colored and Quality Protein  

E-Print Network [OSTI]

% of total phenol content (Cabrera-Soto, et al., 2009). Total phenol content has been reported (Sosulski et al., 1982; Del Pozo-Insfran et al., 2006; De la Parra et al., 2007) in several studies but with a limited genotype, non-breeding emphasis. Like all... to nixtamalization, cooked maize was divided in half with one treatment being acidified and the other a normal treatment. The treatment of acid resulted in reduction of total antioxidant for tortillas and chips to be 11 and 17%, respectively (Del Pozo-Insfran et...

Mahan, Adam Lyle

2012-10-19T23:59:59.000Z

250

Hot wire production of single-wall and multi-wall carbon nanotubes  

DOE Patents [OSTI]

Apparatus (210) for producing a multi-wall carbon nanotube (213) may comprise a process chamber (216), a furnace (217) operatively associated with the process chamber (216), and at least one filament (218) positioned within the process chamber (216). At least one power supply (220) operatively associated with the at least one filament (218) heats the at least one filament (218) to a process temperature. A gaseous carbon precursor material (214) operatively associated with the process chamber (216) provides carbon for forming the multi-wall carbon nanotube (213). A metal catalyst material (224) operatively associated with the process (216) catalyzes the formation of the multi-wall carbon nanotube (213).

Dillon, Anne C. (Boulder, CO); Mahan, Archie H. (Golden, CO); Alleman, Jeffrey L. (Lakewood, CO)

2010-10-26T23:59:59.000Z

251

THE CHINESE WALL LATTICE Ravi Sandhu  

E-Print Network [OSTI]

security policy for confidentiality · Mixture of free choice (discretionary) and mandatory of interest class #12;4 CHINESE WALL EXAMPLE BANKS OIL COMPANIESBANKS OIL COMPANIES A B X Y #12;5 READ ACCESS BREWER-NASH SIMPLE SECURITY S can read O only if · O is in the same company dataset as· O is in the same

Sandhu, Ravi

252

Symmetry groups of single-wall nanotubes  

Science Journals Connector (OSTI)

An approach to the determination of the symmetry groups of structural analogs of single-wall carbon nanotubes using ideas in color symmetry theory is described. The line group structures of the symmetry groups of BN, BC3, BCN and BC2N nanotubes are identified. An extension of the method to address nanotubes with non-hexagonal symmetry is also presented.

De Las Pe?as, M.L.A.N.

2013-11-26T23:59:59.000Z

253

Annual Report Diana H. Wall, Director  

E-Print Network [OSTI]

Student Sustainability Center more than doubled its student engagement, and our pre-college Summer2013-2014 Annual Report #12;Diana H. Wall, Director CSU is at the forefront of sustainability if such systems are to endure, and developing the expertise that is needed to shape a sustainable future

254

Wall Precursor Effects in Gaseous Detonation  

Science Journals Connector (OSTI)

... and 5 mm long, were used in an investigation of electrical phenomena in stoichiometric oxyhydrogen detonations produced in a 4 m long stainless steel tube of hexagonal cross-section. The ... , which was insulated from the tube wall, recorded the time of arrival of the detonation plasma at the plane of observation. Only when both the probes and insulating surfaces ...

M. C. CAVENOR

1970-02-21T23:59:59.000Z

255

Subcooled Boiling Near a Heated Wall  

SciTech Connect (OSTI)

Experimental measurements of void fraction, bubble frequency, and velocity are obtained in subcooled R-134a flowing over a heated flat plate near an unheated wall and compared to analytical predictions. The measurements were obtained for a fixed system pressure and mass flow rate (P = 2.4 MPa and w = 106 kg/hr) at various inlet liquid temperatures. During the experiments, electrical power was applied at a constant rate to one side of the test section. The local void fraction data, acquired with a hot-film anemometer probe, showed the existence of a significant peak near the heated wall and a smaller secondary peak near the unheated wall for the larger inlet subcoolings. Local vapor velocity data, taken with the hot-film probe and a laser Doppler velocimeter, showed broad maxima near the centerline between the heated and unheated plates. Significant temperature gradients near the heated wall were observed for large inlet subcooling. Bubble size data, inferred from measurements of void fraction, bubble frequency and vapor velocity, when combined with the measured bubble chord length distributions illustrate the transition from pure three dimensional spherical to two-dimensional planar bubble flow, the latter being initiated when the bubbles fill the gap between the plates. These various two-phase flow measurements were used for development of a multidimensional, four-field calculational method; comparisons of the data to the calculations show reasonable agreement.

T.A. Trabold; C.C. Maneri; P.F. Vassallo; D.M. Considine

2000-10-27T23:59:59.000Z

256

Design of wetted wall bioaerosol concentration cyclones  

E-Print Network [OSTI]

...................................................................................... 24 Aerosol-to-aerosol collection efficiency.................................................... 24 Wetting pattern on the impacting wall ? effect of an atomizer.................. 24..................................................................................... 67 Figure 3.4. Cold temperature experiemental setup ........................................................... 68 Figure 3.5. Preliminary heating system for the 1250 L/min cyclone and thermo-couple locations...

Seo, Youngjin

2009-05-15T23:59:59.000Z

257

RNA-Seq Analysis of Sulfur-Deprived Chlamydomonas Cells Reveals Aspects of Acclimation Critical for Cell Survival  

Science Journals Connector (OSTI)

...Z. (2007). The role of hydrogen peroxide in regulation of plant...A.R. (2001). Sulfur economy and cell wall biosynthesis...hypersensitive cell death by hydrogen peroxide produced through polyamine...2002). Probing green algal hydrogen production. Philos. Trans...

David González-Ballester; David Casero; Shawn Cokus; Matteo Pellegrini; Sabeeha S. Merchant; Arthur R. Grossman

2010-06-29T23:59:59.000Z

258

Structural and Metabolic Transitions of C4 Leaf Development and Differentiation Defined by Microscopy and Quantitative Proteomics in Maize  

Science Journals Connector (OSTI)

...these enzymes or their homologs in the literature (Buchanan et al., 2000; Bowsher et...Maize and sorghum: Genetic resources for bioenergy grasses. Trends Plant Sci. 13 : 415-420...suppressors of var2 leaf variegation: A review. J. Integr. Plant Biol. 52 : 750-761...

Wojciech Majeran; Giulia Friso; Lalit Ponnala; Brian Connolly; Mingshu Huang; Edwin Reidel; Cankui Zhang; Yukari Asakura; Nazmul H. Bhuiyan; Qi Sun; Robert Turgeon; Klaas J. van Wijk

2010-11-16T23:59:59.000Z

259

Vol. 83, No. 2, 2006 121 Analysis of Heat Transfer Fouling by Dry-Grind Maize Thin Stillage  

E-Print Network [OSTI]

Vol. 83, No. 2, 2006 121 Analysis of Heat Transfer Fouling by Dry-Grind Maize Thin Stillage Using increases heat transfer resistance, energy use, cleaning costs, downtime to restore evaporators to optimal, particularly energy use. Under- standing the fouling of heat transfer surfaces and the tendencies of process

260

INFLUENCE OF D.I.C HYDROTHERMAL PROCESS CONDITIONS ON THE GELATINIZATION PROPERTIES OF STANDARD MAIZE STARCH  

E-Print Network [OSTI]

INFLUENCE OF D.I.C HYDROTHERMAL PROCESS CONDITIONS ON THE GELATINIZATION PROPERTIES OF STANDARD ABSTRACT Standard maize starch was hydrothermally treated at residual moisture content (~12 %) by Instantaneous Controlled Pressure Drop for various pressure levels and processing times. In order to examine

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

A new transgenic maize was observed to be less recalcitrant than wild-type biomass, as manifested through lower severity  

E-Print Network [OSTI]

to convert into biofuels. Part of the high production cost of cellulosic biofuels is the relatively poor into biofuels. Key Result Through expression of a single gene derived from bacteria, transgenic maize. Transgenic Plants Lower the Costs of Cellulosic Biofuels NREL Highlights SCIENCE E1 cellulase expression

262

A shrunken-2 Transgene Increases Maize Yield by Acting in Maternal Tissues to Increase the Frequency of Seed Development  

Science Journals Connector (OSTI)

...Maize Yield by Acting in Maternal Tissues to Increase the Frequency of Seed Development [W] L. Curtis Hannah a 1 Brandon Futch a James Bing b Janine R. Shaw a Susan Boehlein a Jon D. Stewart c Robert Beiriger d Nikolaos Georgelis a 2 Thomas Greene b...

L. Curtis Hannah; Brandon Futch; James Bing; Janine R. Shaw; Susan Boehlein; Jon D. Stewart; Robert Beiriger; Nikolaos Georgelis; Thomas Greene

2012-06-29T23:59:59.000Z

263

TBU-0061- In the Matter of Misti Wall  

Broader source: Energy.gov [DOE]

Misti Wall (the complainant or Wall), appeals the dismissal of her complaint of retaliation filed under 10 C.F.R. Part 708, the Department of Energy (DOE) Contractor Employee Protection Program. As...

264

Double Diffusion in Enclosure Bounded by Massive and Volatilizing Walls  

E-Print Network [OSTI]

-10), are considered. Other governing parameters are maintained constant (Rayleigh number, Prandtl number, Lewis number and width ratio of massive wall to enclosure). The conjugate heat transfer of the thick wall and indoor airflow and the enhanced heat transfer...

Liu, D.; Tang, G.; Zhao, F.

2006-01-01T23:59:59.000Z

265

Helium Pumping Wall for a Liquid Lithium Tokamak Richard Majeski...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Helium Pumping Wall for a Liquid Lithium Tokamak Richard Majeski This invention is designed to be a subsystem of a device, a tokamak with walls or plasma facing components of...

266

After Exodus : re-occupation of the metropolitan wall  

E-Print Network [OSTI]

The title "Exodus alludes to a restricted exclave encircled by a forbidding wall -- effect, a prison on the scale of a metropolis, and one in which people sought refuge voluntarily. Over the past forty years, similar walls ...

Allison, Jordan Lloyd Norman

2012-01-01T23:59:59.000Z

267

Reading the Cosmic Writing on the Wall  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Reading the Cosmic Reading the Cosmic Writing on the Wall Reading the Cosmic Writing on the Wall NERSC Key to Planck's Revision of Universal Recipe March 21, 2013 Contact: Margie Wylie, mwylie@lbl.gov, + 1 510 486 7421 map800-600.jpg This map shows the oldest light in our universe, as detected with the greatest precision yet by the Planck mission. The ancient light, called the cosmic microwave background, was imprinted on the sky when the universe was 370,000 years old. (Image credit: ESA and the Planck Collaboration) Thanks to a supersensitive space telescope and some sophisticated supercomputing, scientists from the international Planck collaboration have made the closest reading yet of the most ancient story in our universe: the cosmic microwave background (CMB). Today, the team released preliminary results based on the Planck

268

Gravitational infall in the hard wall model  

E-Print Network [OSTI]

An infalling shell in the hard wall model provides a simple holographic model for energy injection in a confining gauge theory. Depending on its parameters, a scalar shell either collapses into a large black brane, or scatters between the hard wall and the anti-de Sitter boundary. In the scattering regime, we find numerical solutions that keep oscillating for as long as we have followed their evolution, and we provide an analytic argument that shows that a black brane can never be formed. This provides examples of states in infinite-volume field theory that never thermalize. We find that the field theory expectation value of a scalar operator keeps oscillating, with an amplitude that undergoes modulation.

B. Craps; E. J. Lindgren; A. Taliotis; J. Vanhoof; H. Zhang

2014-12-15T23:59:59.000Z

269

Enhanced dielectric-wall linear accelerator  

DOE Patents [OSTI]

A dielectric-wall linear accelerator is enhanced by a high-voltage, fast e-time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators. A high voltage is placed between the electrodes sufficient to stress the voltage breakdown of the insulator on command. A light trigger, such as a laser, is focused along at least one line along the edge surface of the laminated alternating layers of isolated conductors and insulators extending between the electrodes. The laser is energized to initiate a surface breakdown by a fluence of photons, thus causing the electrical switch to close very promptly. Such insulators and lasers are incorporated in a dielectric wall linear accelerator with Blumlein modules, and phasing is controlled by adjusting the length of fiber optic cables that carry the laser light to the insulator surface. 6 figs.

Sampayan, S.E.; Caporaso, G.J.; Kirbie, H.C.

1998-09-22T23:59:59.000Z

270

Wall, Pennsylvania: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Wall, Pennsylvania: Energy Resources Wall, Pennsylvania: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 40.3936801°, -79.7861577° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":40.3936801,"lon":-79.7861577,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

271

Manipulation and Imaging of Individual Single-Walled Carbon Nanotubes  

E-Print Network [OSTI]

Manipulation and Imaging of Individual Single-Walled Carbon Nanotubes with an Atomic Force Microscope** By Henk W. C. Postma, Allard Sellmeijer, and Cees Dekker* Carbon nanotubes[1] have attracted-walled nanotubes,[3±5] the prototype single-walled tubes are much more difficult to study since their diameter

272

Proposal on Lithium Wall Experiment (LWX) on PBXM 1  

E-Print Network [OSTI]

Proposal on Lithium Wall Experiment (LWX) on PBX­M 1 Leonid E. Zakharov, Princeton University; OUTLINE 1. Mini­conference on Lithium walls and low recycling regime. 2. PBX­M Capabilities. 3. Motivation "Lithium covered walls and low recycling regimes in toka­ maks". APS meeting, October 23­27, 2000, Quebec

Zakharov, Leonid E.

273

Particle Sizing using Passive Ultrasonic Measurement of Vessel Wall Vibrations  

E-Print Network [OSTI]

Particle Sizing using Passive Ultrasonic Measurement of Vessel Wall Vibrations Gillian Carson for particle sizing using an ultrasonic transducer to measure vessel wall vibrations and 1 #12;considers in a stirred vessel, its subse- quent impact with the vessel wall, and the resulting flexural vibrations

Mottram, Nigel

274

Brick Walls and AdS/CFT  

E-Print Network [OSTI]

We discuss the relationship between the bulk-boundary correspondence in Rehren's algebraic holography (and in other 'fixed-background' approaches to holography) and in mainstream 'Maldacena AdS/CFT'. Especially, we contrast the understanding of black-hole entropy from the viewpoint of QFT in curved spacetime -- in the framework of 't Hooft's 'brick wall' model -- with the understanding based on Maldacena AdS/CFT. We show that the brick-wall modification of a Klein Gordon field in the Hartle-Hawking-Israel state on 1+2-Schwarzschild AdS (BTZ) has a well-defined boundary limit with the same temperature and entropy as the brick-wall-modified bulk theory. One of our main purposes is to point out a close connection, for general AdS/CFT situations, between the puzzle raised by Arnsdorf and Smolin regarding the relationship between Rehren's algebraic holography and mainstream AdS/CFT and the puzzle embodied in the 'correspondence principle' proposed by Mukohyama and Israel in their work on the brick-wall approach to black hole entropy. Working on the assumption that similar results will hold for bulk QFT other than the Klein Gordon field and for Schwarzschild AdS in other dimensions, and recalling the first author's proposed resolution to the Mukohyama-Israel puzzle based on his 'matter-gravity entanglement hypothesis', we argue that, in Maldacena AdS/CFT, the algebra of the boundary CFT is isomorphic only to a proper subalgebra of the bulk algebra, albeit (at non-zero temperature) the (GNS) Hilbert spaces of bulk and boundary theories are still the 'same' -- the total bulk state being pure, while the boundary state is mixed (thermal). We also argue from the finiteness of its boundary (and hence, on our assumptions, also bulk) entropy at finite temperature, that the Rehren dual of the Maldacena boundary CFT cannot itself be a QFT and must, instead, presumably be something like a string theory.

Bernard S. Kay; L. Ortiz

2014-05-22T23:59:59.000Z

275

Conserved currents for Mobius Domain Wall Fermions  

E-Print Network [OSTI]

We derive the exactly conserved vector, and almost conserved axial currents for rational approximations to the overlap operator with a general Mobius kernel. The approach maintains manifest Hermiticity, and allows matrix elements of the currents to be constructed at no extra cost after solution of the usual 5d system of equations, similar to the original approach of Furman and Shamir for domain wall Fermions.

P. A. Boyle

2014-11-20T23:59:59.000Z

276

1993 NEC 1) (Single-Walled Carbon  

E-Print Network [OSTI]

MWNT (Vapor-grown carbon fiber, VGCF)33) 10001300 34) SWNT CCVD Smalley 15) CO SWNT SWNT 1993 NEC 1) (Single-Walled Carbon Nanotubes, SWNTs) 1(a) 1nm µm µm SWNTs 2) (MWNTs) 1(c 29,30,35-41) SWNT , MgO Fe/Co, Ni/Co, Mo/Co nm SWNT VGCF Fe(CO)5 SWNT Ethanol tank Hot

Maruyama, Shigeo

277

Phenomenology of Wall Bounded Newtonian Turbulence  

E-Print Network [OSTI]

We construct a simple analytic model for wall-bounded turbulence, containing only four adjustable parameters. Two of these parameters characterize the viscous dissipation of the components of the Reynolds stress-tensor and other two parameters characterize their nonlinear relaxation. The model offers an analytic description of the profiles of the mean velocity and the correlation functions of velocity fluctuations in the entire boundary region, from the viscous sub-layer, through the buffer layer and further into the log-layer. As a first approximation, we employ the traditional return-to-isotropy hypothesis, which yields a very simple distribution of the turbulent kinetic energy between the velocity components in the log-layer: the streamwise component contains a half of the total energy whereas the wall-normal and the cross-stream components contain a quarter each. In addition, the model predicts a very simple relation between the von-K\\'arm\\'an slope $\\kappa $ and the turbulent velocity in the log-law region $v^+$ (in wall units): $v^+=6 \\kappa$. These predictions are in excellent agreement with DNS data and with recent laboratory experiments.

Victor S. L'vov; Anna Pomyalov; Itamar Procaccia; Sergej S. Zilitinkevich

2005-06-28T23:59:59.000Z

278

Genomic Analysis of Natural Variation for Seed and Plant Size in Maize ( JGI Seventh Annual User Meeting 2012: Genomics of Energy and Environment)  

ScienceCinema (OSTI)

Shawn Kaeppler from the University of Wisconsin-Madison on "Genomic Analysis of Biofuel Traits in Maize and Switchgrass" at the 7th Annual Genomics of Energy & Environment Meeting on March 21, 2012 in Walnut Creek, Calif

Kaeppler, Shawn [University of Wisconsin, Madison

2013-01-15T23:59:59.000Z

279

A Study of the Filling of Wall Cavities With Retrofit Wall Insulation.  

SciTech Connect (OSTI)

The Pacific Northwest Power Marketing Agency, the Bonneville Power Administration (BPA), conducted a retrofit wall insulation study to determine the effects of various obstructions within a wall cavity, where voids are likely to occur, and preferred filling methods and material types. The insulation test structure was composed of four 8-foot /times/ 12-foot walls, and was built using standard construction practices. The inside walls were clear plastic glazing, instead of gypsum board, to enable viewing of the filling process. A total of eight tests were performed: four cellulose, two rockwool, and two fiberglass. One- and two-hole filling methods were observed. All insulations were found to perform in the same basic manner with all experiencing the same problem areas. Common installer problems were empty spaces at the tops of cavities and missed cavities, especially above headers. Wiring and lath and plaster consistently caused reduced insulation densities in cavities. The problems with wiring, lath and plaster, and other features in the wall cavities were avoided with the use of a filler tube. The filler tube also provided a more consistent fill along the length of the entire cavity. 2 figs., 3 tabs.

Flores, Joseph A.; Grill, Alan R.

1988-08-01T23:59:59.000Z

280

Effect of elasticity of wall on diffusion in nano channel  

SciTech Connect (OSTI)

Confining walls of nano channel are taken to be elastic to study their effect on the diffusion coefficient of fluid flowing through the channel. The wall is elastic to the extent that it responses to molecular pressure exerted by fluid. The model to study diffusion is based on microscopic considerations. Results obtained for fluid confining to 20 atomic diameter width contrasted with results obtained by considering rigid and smooth wall. The effect of roughness of wall on diffusion can be compensated by the elastic property of wall.

Tankeshwar, K., E-mail: tankesh@pu.ac.in [Computer Centre, Panjab University Chandigarh,- 160014 (India); Srivastava, Sunita [Department of Physics, Panjab University, Chandigarh 160014 (India)

2014-04-24T23:59:59.000Z

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Method of non-destructively inspecting a curved wall portion  

DOE Patents [OSTI]

A method of non-destructively inspecting a curved wall portion of a large and thick walled vessel for a defect by computed tomography is provided. A collimated source of radiation is placed adjacent one side of the wall portion and an array of detectors for the radiation is placed on the other side adjacent the source. The radiation from the source passing through the wall portion is then detected with the detectors over a limited angle, dependent upon the curvature of the wall of the vessel, to obtain a dataset. The source and array are then coordinately moved relative to the wall portion in steps and a further dataset is obtained at each step. The plurality of datasets obtained over the limited angle is then processed to produce a tomogram of the wall portion to determine the presence of a defect therein. In a preferred embodiment, the curved wall portion has a center of curvature so that the source and the array are positioned at each step along a respective arc curved about the center. If desired, the detector array and source can be reoriented relative to a new wall portion and an inspection of the new wall portion can be easily obtained. Further, the source and detector array can be indexed in a direction perpendicular to a plane including the limited angle in a plurality of steps so that by repeating the detecting and moving steps at each index step, a three dimensional image can be created of the wall portion.

Fong, James T. (Bethel Park, PA)

1996-01-01T23:59:59.000Z

282

Highly Energy Efficient Wall Systems Research Project | Department of  

Broader source: Energy.gov (indexed) [DOE]

Highly Energy Efficient Wall Systems Highly Energy Efficient Wall Systems Research Project Highly Energy Efficient Wall Systems Research Project The Department of Energy is currently conducting research into highly energy efficient wall systems. Walls with high R-values are better insulators, and their development can help buildings come closer to having zero net energy consumption. Project Description This project seeks to develop a commercially viable wall system up to R-40 through integration of vacuum technology with the exterior insulated façade system (EIFS). Dow Corning will develop a wall system configuration of expanded polystyrene vacuum isolation panels that can be specified for R-values of 20, 30, and 40. This project also aims to develop a unitized protection system of vacuum isolation panels and to validate current code

283

Stochastic Domain-Wall Depinning in Magnetic Nanowires  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Stochastic Domain-Wall Depinning Stochastic Domain-Wall Depinning in Magnetic Nanowires Stochastic Domain-Wall Depinning in Magnetic Nanowires Print Wednesday, 29 July 2009 00:00 Reliably controlling the motion of magnetic domain walls along magnetic nanowires is a key requirement for current technological development of novel classes of logic and storage devices, but understanding the nature of non-deterministic domain-wall motion remains a scientific challenge. A statistical analysis of high-resolution magnetic soft x-ray microscopy images by a Berkeley Lab-University of Hamburg group has now revealed that the stochastic behavior of the domain-wall depinning field in notch-patterned Ni80Fe20 (permalloy) nanowires depends strongly on the wire width and the notch depth. This result both provides valuable insight into the motion of magnetic-domain walls and opens a path to further technological developments in spintronics applications.

284

Domain Walls and Vortices in Chiral Symmetry Breaking  

E-Print Network [OSTI]

We study domain walls and vortices in chiral symmetry breaking in a QCD-like theory with N flavors in the chiral limit. If the axial anomaly is absent, there exist stable Abelian axial vortices winding around the spontaneously broken U(1)_A symmetry and non-Abelian axial vortices winding around both the U(1)_A and non-Abelian SU(N) chiral symmetries. In the presence of the axial anomaly term, metastable domain walls are present and Abelian axial vortices must be attached by N domain walls, forming domain wall junctions. We show that a domain wall junction decays into N non-Abelian vortices attached by domain walls, implying its metastability. We also show that domain walls decay through the quantum tunneling by creating a hole bounded by a closed non-Abelian vortex.

Minoru Eto; Yuji Hirono; Muneto Nitta

2013-09-18T23:59:59.000Z

285

Moisture Management of High-R Walls (Fact Sheet), Building America...  

Energy Savers [EERE]

wall with ccSPF cavity insulation Double stud wall with cellulose insulation and polyethylene vapor retarder Double stud wall with cellulose and 2 in. of ccSPF Double stud wall...

286

Vascular targeted single-walled carbon nanotubes for near-infrared light therapy of cancer This article has been downloaded from IOPscience. Please scroll down to see the full text article.  

E-Print Network [OSTI]

Vascular targeted single-walled carbon nanotubes for near-infrared light therapy of cancer.1088/0957-4484/22/45/455101 Vascular targeted single-walled carbon nanotubes for near-infrared light therapy of cancer Whitney M uptake of the conjugate. This targeted cell killing was further enhanced when coupled with near-infrared

Resasco, Daniel

287

Cell signalling and phospholipid metabolism  

SciTech Connect (OSTI)

These studies explored whether phosphoinositide (PI) has a role in plants analogous to its role in animal cells. Although no parallel activity of PI in signal transduction was found in plant cells, activity of inositol phospholipid kinase was found to be modulated by light and by cell wall degrading enzymes. These studies indicate a major role for inositol phospholipids in plant growth and development as membrane effectors but not as a source of second messengers.

Boss, W.F.

1990-01-01T23:59:59.000Z

288

Detonation limits in rough walled tubes  

Science Journals Connector (OSTI)

Abstract The present paper reports the results of a study of detonation limits in rough tubes. Detonation velocity is measured by photodiodes and ionization probes spaced at 10 cm intervals along the length of the tube. Short lengths of smoked foils inserted into the core of the rough tube is used to register the structure of the detonation wave. Pressure transducers are also used to obtain the pressure profile. The results indicate that in rough tubes, the detonation velocity is generally much lower than the corresponding values for smooth tubes. The velocity decreases slowly at first and then more rapidly as the limit is approached. The velocity variation is generally continuous and at the limits, the failure velocity is of the order of about 0.4 V CJ for all cases. The detonation limits in rough tubes are found to be wider than for a smooth tube. This indicates that the turbulence generated by the wall roughness facilitates the propagation of the detonation and extends the limits. Smoked foil records show that in the core of the rough tube the detonation front has a cellular structure corresponding to the usual cellular structure due to instability of the detonation. Thus the intrinsic unstable cellular structure is quite robust and retains its global characteristics in spite of the large perturbations generated by the rough wall. The detonation in the core of the rough tube goes from multi-headed to single headed as the limit is approached. Past the single headed spin, the low velocity detonation has no cellular structure but consists of interacting weak transverse waves from the rough wall. The averaged pressure of the low velocity detonation front corresponds to about the constant volume explosion pressure, in accord with the velocity of the low velocity detonation.

Amanda Starr; John H.S. Lee; Hoi Dick Ng

2014-01-01T23:59:59.000Z

289

Melting Instantons, Domain Walls, and Large N  

E-Print Network [OSTI]

Monte Carlo studies of $CP^{N-1}$ sigma models have shown that the structure of topological charge in these models undergoes a sharp transition at $N=N_c\\approx 4$. For $NN_c$ it is dominated by extended, thin, 1-dimensionally coherent membranes of topological charge, which can be interpreted as domain walls between discrete quasi-stable vacua. These vacua differ by a unit of background electric flux. The transition can be identified as the delocalization of topological charge, or "instanton melting," a phenomenon first suggested by Witten to resolve the conflict between instantons and large $N$ behavior. Implications for $QCD$ are discussed.

H. B. Thacker

2008-10-22T23:59:59.000Z

290

Gas turbine bucket wall thickness control  

DOE Patents [OSTI]

A core for use in casting a turbine bucket including serpentine cooling passages is divided into two pieces including a leading edge core section and a trailing edge core section. Wall thicknesses at the leading edge and the trailing edge of the turbine bucket can be controlled independent of each other by separately positioning the leading edge core section and the trailing edge core section in the casting die. The controlled leading and trailing edge thicknesses can thus be optimized for efficient cooling, resulting in more efficient turbine operation.

Stathopoulos, Dimitrios (Glenmont, NY); Xu, Liming (Greenville, SC); Lewis, Doyle C. (Greer, SC)

2002-01-01T23:59:59.000Z

291

Flame-wall interaction simulation in a turbulent channel flow  

SciTech Connect (OSTI)

The interaction between turbulent premixed flames and channel walls is studied. Combustion is represented by a simple irreversible reaction with a large activation temperature. A low heat release assumption is used, but feedback to the flowfield can be allowed through viscosity changes. The effect of wall distance on local and global flame structure is investigated. Quenching distances and maximum wall heat fluxed computed in laminar cases are compared to DNS results. It is found that quenching distances decrease and maximum heat fluxes increase relative to laminar flame values, scaling with the turbulent strain rate. It is shown that these effects are due to large coherent structures which push flame elements towards the wall. The effect of wall strain in flame-wall interaction is studied in a stagnation line flow; this is used to explain the DNS results. The effects of the flame on the flow through viscosity changes is studied. It is also shown that remarkable flame events are produced by flame interaction with a horseshoe vortex: burned gases are pushed towards the wall at high speed and induce quenching and high wall heat flux while fresh gases are expelled from the wall region and form finger-like structures. Effects of the wall on flame surface density are investigated.

Bruneaux, G.; Akselvoll, K.; Poinsot, T.; Ferziger, J.H.

1996-10-01T23:59:59.000Z

292

Chem. Phys. Lett. in press Cold wall CVD generation of single-walled carbon nanotubes  

E-Print Network [OSTI]

-furnace [3] and arc-discharge [4] methods, several techniques employing the CVD approach [5-13] have been Catalytic CVD generation of high-purity single-walled carbon nanotubes (SWNTs) without use of an electric without resort to an electric furnace or a hot filament is proposed. All one needs is a vacuum chamber

Maruyama, Shigeo

293

The effect of adapting cultivars on the water use efficiency of dryland maize (Zea mays L.) in northwestern China  

Science Journals Connector (OSTI)

Abstract Global warming is predicted to have adverse effects on crop productivity and will present an enormous challenge to sustainable development and food security, especially in dryland regions. Prior studies have identified that adapted crop cultivars could effectively act to offset the effects of climate warming; however, the water use of adapted cultivars subject to climate warming is much less understood. We analysed warming trends across the Loess Plateau in north-western China beginning in 1960. There has been significant warming, especially since 1980, with an increase in the growing degree days (GDD, from April to September) of 260–330 °C being observed over the past 30 years. If the maize cultivars had remained unchanged, the decreased yield potential would have been 0.39–1.83 t ha?1 over the last 30 years. Meanwhile, the use of historical maize varieties has resulted in significantly decreased water use efficiency (WUE) across the Loess Plateau. Based on the increase in the GDD in each decade, we suggest planting adapted later-maturing maize cultivars to improve productivity. Compared with historical cultivars, the adapted later-maturing varieties significantly prolonged the maize growing cycle by an average of 27 d, thereby increasing the yield potential by 24.2–64.8% and the WUE by 9.0–38.1% throughout the Loess Plateau. However, the adapted maturing varieties may increase the water consumption (ET), which is the disadvantage for sustainable dryland farming, especially in dry regions. Hence, continuing to develop water-harvesting techniques (e.g., plastic film mulching) will help to offset the decreasing rainfall and guarantee food security and sustainability in dry regions.

Lingduo Bu; Xinping Chen; Shiqing Li; Jianliang Liu; Lin Zhu; Shasha Luo; Robert Lee Hill; Ying Zhao

2015-01-01T23:59:59.000Z

294

Proteolytic enzyme activities in abscisic acid insensitive (vp), abscisic acid deficient (vp5) and normal maize kernels during tissue development  

E-Print Network [OSTI]

and CP enzymes are the most common, and these may be responsible for storage protein degradation. Early research involving proteolytic enzyme activity suggested that EP was present at all stages of development in all tissues of inbred maize. However... protein which is soluble in water and occurs widely in plants and animal tissues. Globulin is a protein fraction which is soluble in dilute salt and occurs in plant and animal tissues. Zein is a storage protein fraction in corn kernels which...

Tjhen, Kien Hoa

2012-06-07T23:59:59.000Z

295

Effect of a Compost and Its Water-Soluble Fractions on Key Enzymes of Nitrogen Metabolism in Maize Seedlings  

Science Journals Connector (OSTI)

Effect of a Compost and Its Water-Soluble Fractions on Key Enzymes of Nitrogen Metabolism in Maize Seedlings ... The GC?MS analyses were conducted on a PerkinElmer Autosystem XL gas chromatograph, equipped with a PerkinElmer Turbomass Gold mass spectrometer. ... Such components are liable to ensure the solubility of these compost fractions, thereby conferring a more flexible conformational structure, and promoting a more efficient diffusion of the bioactive humic-like components at cellular membrane level (47). ...

Silvia Vaccaro; Adele Muscolo; Diego Pizzeghello; Riccado Spaccini; Alessandro Piccolo; Serenella Nardi

2009-11-05T23:59:59.000Z

296

Effect of Inoculation Pressure on Maize Dwarf Mosaic Virus Strain-A Disease Incidence, Severity and Titer in Sorghum.  

E-Print Network [OSTI]

and concentration on varietal disease response of sorghum following spray gun inoculation with maize dwarf mosaic virus. Crop Science 23:83-85. Mention of a trademark or a proprietary product does not constitute a guarantee or a warranty of the product... by The Texas Agricultural Experiment Station and does not imply its approval to the exclusion of other products that also may be suitable. All programs and information of The Texas Agricultural Experiment Station are available to everyone without re gard...

Mahuku, George S.; Toler, R.W.

1992-01-01T23:59:59.000Z

297

Stochastic Domain-Wall Depinning in Magnetic Nanowires  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Stochastic Domain-Wall Depinning in Magnetic Nanowires Print Stochastic Domain-Wall Depinning in Magnetic Nanowires Print Reliably controlling the motion of magnetic domain walls along magnetic nanowires is a key requirement for current technological development of novel classes of logic and storage devices, but understanding the nature of non-deterministic domain-wall motion remains a scientific challenge. A statistical analysis of high-resolution magnetic soft x-ray microscopy images by a Berkeley Lab-University of Hamburg group has now revealed that the stochastic behavior of the domain-wall depinning field in notch-patterned Ni80Fe20 (permalloy) nanowires depends strongly on the wire width and the notch depth. This result both provides valuable insight into the motion of magnetic-domain walls and opens a path to further technological developments in spintronics applications.

298

Stochastic Domain-Wall Depinning in Magnetic Nanowires  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Stochastic Domain-Wall Depinning in Magnetic Nanowires Print Stochastic Domain-Wall Depinning in Magnetic Nanowires Print Reliably controlling the motion of magnetic domain walls along magnetic nanowires is a key requirement for current technological development of novel classes of logic and storage devices, but understanding the nature of non-deterministic domain-wall motion remains a scientific challenge. A statistical analysis of high-resolution magnetic soft x-ray microscopy images by a Berkeley Lab-University of Hamburg group has now revealed that the stochastic behavior of the domain-wall depinning field in notch-patterned Ni80Fe20 (permalloy) nanowires depends strongly on the wire width and the notch depth. This result both provides valuable insight into the motion of magnetic-domain walls and opens a path to further technological developments in spintronics applications.

299

Stochastic Domain-Wall Depinning in Magnetic Nanowires  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Stochastic Domain-Wall Depinning in Magnetic Nanowires Print Stochastic Domain-Wall Depinning in Magnetic Nanowires Print Reliably controlling the motion of magnetic domain walls along magnetic nanowires is a key requirement for current technological development of novel classes of logic and storage devices, but understanding the nature of non-deterministic domain-wall motion remains a scientific challenge. A statistical analysis of high-resolution magnetic soft x-ray microscopy images by a Berkeley Lab-University of Hamburg group has now revealed that the stochastic behavior of the domain-wall depinning field in notch-patterned Ni80Fe20 (permalloy) nanowires depends strongly on the wire width and the notch depth. This result both provides valuable insight into the motion of magnetic-domain walls and opens a path to further technological developments in spintronics applications.

300

Webs of domain walls in supersymmetric gauge theories  

SciTech Connect (OSTI)

Webs of domain walls are constructed as 1/4 Bogomol'nyi-Prasad-Sommerfield (BPS) states in d=4, N=2 supersymmetric U(N{sub C}) gauge theories with N{sub F} hypermultiplets in the fundamental representation. Webs of walls can contain any numbers of external legs and loops like (p,q) string/5-brane webs. We find the moduli space M of a 1/4 BPS equation for wall webs to be the complex Grassmann manifold. When moduli spaces of 1/2 BPS states (parallel walls) and the vacua are removed from M, the noncompact moduli space of genuine 1/4 BPS wall webs is obtained. All the solutions are obtained explicitly and exactly in the strong gauge coupling limit. In the case of Abelian gauge theory, we work out the correspondence between configurations of wall web and the moduli space CP{sup N{}sub F}{sup -1}.

Eto, Minoru; Isozumi, Youichi; Nitta, Muneto; Ohashi, Keisuke; Sakai, Norisuke [Department of Physics, Tokyo Institute of Technology, Tokyo 152-8551 (Japan)

2005-10-15T23:59:59.000Z

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Hollow porous-wall glass microspheres for hydrogen storage  

DOE Patents [OSTI]

A porous wall hollow glass microsphere is provided having a diameter range of between 1 to 200 microns, a density of between 1.0 to 2.0 gm/cc, a porous-wall structure having wall openings defining an average pore size of between 10 to 1000 angstroms, and which contains therein a hydrogen storage material. The porous-wall structure facilitates the introduction of a hydrogen storage material into the interior of the porous wall hollow glass microsphere. In this manner, the resulting hollow glass microsphere can provide a membrane for the selective transport of hydrogen through the porous walls of the microsphere, the small pore size preventing gaseous or liquid contaminants from entering the interior of the hollow glass microsphere.

Heung, Leung K. (Aiken, SC); Schumacher, Ray F. (Aiken, SC); Wicks, George G. (Aiken, SC)

2010-02-23T23:59:59.000Z

302

En-Vac Robotic Wall Scabbler. Innovative Technology Summary Report  

SciTech Connect (OSTI)

The Idaho National Engineering and Environmental Laboratory (INEEL)demonstrated an En-Vac Robotic Wall Scabbler from Japan to remove contaminated paint and concrete up to five times faster than workers using a hand-held scabbling/grinding tool. The Robotic Wall Scabbler uses abrasive steel grit to blast metal and concrete surfaces and it moves along the wall and adheres to the surface using vacuum suction. The Robotic Wall Scabbling unit includes the robot, grit recycling unit, debris filtration system, vacuum system, and remote control station. It scabbles concrete at depths up to 1/8-inch per pass. The demonstration was conducted on the walls of the Decontamination Shop of Test Area North which is contaminated with polychlorobiphenyls, lead, and radionuclides. Besides production rate, other benefits of the robotic wall scabbler include reduced radiation dose to workers and no airborne contamination.

None

2001-04-01T23:59:59.000Z

303

Stochastic Domain-Wall Depinning in Magnetic Nanowires  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Stochastic Domain-Wall Depinning in Magnetic Nanowires Print Stochastic Domain-Wall Depinning in Magnetic Nanowires Print Reliably controlling the motion of magnetic domain walls along magnetic nanowires is a key requirement for current technological development of novel classes of logic and storage devices, but understanding the nature of non-deterministic domain-wall motion remains a scientific challenge. A statistical analysis of high-resolution magnetic soft x-ray microscopy images by a Berkeley Lab-University of Hamburg group has now revealed that the stochastic behavior of the domain-wall depinning field in notch-patterned Ni80Fe20 (permalloy) nanowires depends strongly on the wire width and the notch depth. This result both provides valuable insight into the motion of magnetic-domain walls and opens a path to further technological developments in spintronics applications.

304

Stochastic Domain-Wall Depinning in Magnetic Nanowires  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Stochastic Domain-Wall Depinning in Magnetic Nanowires Print Stochastic Domain-Wall Depinning in Magnetic Nanowires Print Reliably controlling the motion of magnetic domain walls along magnetic nanowires is a key requirement for current technological development of novel classes of logic and storage devices, but understanding the nature of non-deterministic domain-wall motion remains a scientific challenge. A statistical analysis of high-resolution magnetic soft x-ray microscopy images by a Berkeley Lab-University of Hamburg group has now revealed that the stochastic behavior of the domain-wall depinning field in notch-patterned Ni80Fe20 (permalloy) nanowires depends strongly on the wire width and the notch depth. This result both provides valuable insight into the motion of magnetic-domain walls and opens a path to further technological developments in spintronics applications.

305

D-brane Configurations for Domain Walls and Their Webs  

SciTech Connect (OSTI)

Supersymmetric U(NC) gauge theory with NF massive hypermultiplets in the fundamental representation admits various BPS solitons like domain walls and their webs. In the first part we show as a review of the previous paper that domain walls are realized as kinky fractional D3-branes interpolating between separated D7-branes. In the second part we discuss brane configurations for domain wall webs. This is a contribution to the conference based on the talk given by MN.

Eto, Minoru; Isozumi, Youichi; Nitta, Muneto; Ohashi, Keisuke; Sakai, Norisuke [Department of Physics, Tokyo Institute of Technology, Tokyo 152-8551 (Japan); Ohta, Kazutoshi [Theoretical Physics Laboratory, Institute of Physical and Chemical Research (RIKEN), 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan)

2005-12-02T23:59:59.000Z

306

Self-assembling functionalized single-walled carbon nanotubes  

E-Print Network [OSTI]

scale synthesis of carbon nanotubes." Nature, Vol.358, 220-Ropes of Metallic Carbon Nanotubes." Science, Vol.273(5274),of single- wall carbon nanotubes. Process, product, and

Gao, Yan

2011-01-01T23:59:59.000Z

307

Stud Walls With Continuous Exterior Insulation for Factory Built...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

density, fairly simple window and door framing details can be used. Easily installed plastic sill flashing is an added benefit. STUD WALLS WITH FOAM- CONTROL NAILBRACE AFM's...

308

Concept for Reducing Hall Thruster Chamber Wall Erosion with...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Concept for Reducing Hall Thruster Chamber Wall Erosion with Lithium Vapor Shielding. Hall thrusters have been established as a compact and reliable means for satellite...

309

Security Walls, LLC, January 14-18, 2013  

Broader source: Energy.gov (indexed) [DOE]

Assistance Washington, DC 20585 Security Walls, LLC DOE-VPP Onsite Review January 2013 Foreword The Department of Energy (DOE) recognizes that true excellence can be...

310

Electromagnetic Interference (EMI) Shielding of Single-Walled Carbon  

E-Print Network [OSTI]

Electromagnetic Interference (EMI) Shielding of Single-Walled Carbon Nanotube Epoxy Composites Ning (SWNT)-polymer composites have been fabricated to evaluate the electromagnetic interference (EMI

Gao, Hongjun

311

Fracture of welded aluminum thin-walled structures  

E-Print Network [OSTI]

A comprehensive methodology was developed in the thesis for damage prediction of welded aluminum thin-walled structures, which includes material modeling, calibration, numerical simulation and experimental verification. ...

Zheng, Li, Ph. D. Massachusetts Institute of Technology

2006-01-01T23:59:59.000Z

312

Seismic design, testing and analysis of reinforced concrete wall buildings  

E-Print Network [OSTI]

and Priestley M.J.N. (1992). “Seismic Design of Reinforced2007). “Displacement Based Seismic Design of Structures”.318-99 Provisions for Seismic Design of Structural Walls.

Panagiotou, Marios

2008-01-01T23:59:59.000Z

313

Wall and laser spot motion in cylindrical hohlraums  

SciTech Connect (OSTI)

Wall and laser spot motion measurements in empty, propane-filled and plastic (CH)-lined gold coated cylindrical hohlraums were performed on the Omega laser facility [T. R. Boehly et al., Opt. Commun. 133, 495 (1997)]. Wall motion was measured using axial two-dimensional (2D) x-ray imaging and laser spot motion was perpendicularly observed through a thinned wall using streaked hard x-ray imaging. Experimental results and 2D hydrodynamic simulations show that while empty targets exhibit on-axis plasma collision, CH-lined and propane-filled targets inhibit wall expansion, corroborated with perpendicular streaked imaging showing a slower motion of laser spots.

Huser, G.; Courtois, C.; Monteil, M.-C. [CEA, DAM, DIF, F-91297 Arpajon (France)

2009-03-15T23:59:59.000Z

314

Self-assembling functionalized single-walled carbon nanotubes  

E-Print Network [OSTI]

Single-walled carbon nanotubes Carbon nanotubes (CNTs) arescale synthesis of carbon nanotubes." Nature, Vol.358, 220-Ropes of Metallic Carbon Nanotubes." Science, Vol.273(5274),

Gao, Yan

2011-01-01T23:59:59.000Z

315

Nuclear Rocket Test Facility Decommissioning Including Controlled Explosive Demolition of a Neutron-Activated Shield Wall  

SciTech Connect (OSTI)

Located in Area 25 of the Nevada Test Site, the Test Cell A Facility was used in the 1960s for the testing of nuclear rocket engines, as part of the Nuclear Rocket Development Program. The facility was decontaminated and decommissioned (D&D) in 2005 using the Streamlined Approach For Environmental Restoration (SAFER) process, under the Federal Facilities Agreement and Consent Order (FFACO). Utilities and process piping were verified void of contents, hazardous materials were removed, concrete with removable contamination decontaminated, large sections mechanically demolished, and the remaining five-foot, five-inch thick radiologically-activated reinforced concrete shield wall demolished using open-air controlled explosive demolition (CED). CED of the shield wall was closely monitored and resulted in no radiological exposure or atmospheric release.

Michael Kruzic

2007-09-01T23:59:59.000Z

316

Mr. Andy Wall0 The Aerospace Corporation  

Office of Legacy Management (LM)

'k.f' :, , j '"; ,,' 'k.f' :, , j '"; ,,' DEC 5 1984 Mr. Andy Wall0 The Aerospace Corporation suite 4000 955 L'Enfant Plaza, S.W. Washington, D.C. 20024 Dear Mr. Wallo: The Divisfon of Remedial Action Projects staff has reviewed the authority review documents for Gardinler, Inc., Tampa, Florida; Conserv (formerly Virginia-Carolina Chemical Co.), Nichols, Florida; and Blockson Chemical co., Joliet, Illinois. Based on the content therein and in consultation with Mr. Steve Miller, Office of General Counsel (C&11), Departamt of Energy, It has been determined that the Department has no authority, through the Atomic Energy Act of 1954, as amended, to conduct remedial action at the aforementioned sites, Therefore, please prepare the document packages necessary to notify the appropriate state authorities and the

317

Hadronization at the AdS wall  

E-Print Network [OSTI]

We describe hadronization events, using the AdS/CFT Correspondence, which display many of the qualitative features expected in QCD. In particular we study the motion of strings with separating end points in a back-reacted hard wall geometry. The solutions show the development of a linear QCD-like string. The end points oscillate in the absence of string breaking. We introduce string breaking by hand and evolve the new state forward in time to observe the separation of two string segments. A kink associated with this breaking evolves to the end points of the string inducing rho meson production. We explicitly compute the rho meson production at the end point.

Nick Evans; James French; Kristan Jensen; Ed Threlfall

2009-08-04T23:59:59.000Z

318

High-resolution timing of cell cycle-regulated gene expression  

Science Journals Connector (OSTI)

...CLN2, CLB1, and PCL9); a Cdc28p inhibitor (SWE1); a positive regulator of...regu-lates expression of the cyclin kinase inhibitor p40SIC1. Mol Cell Biol, 16:5701 ZZQQhy7...synthesis of chitin in cell walls and chitosan in spore walls. Yeast, 8:1089 ZZQQhy99...

Maga Rowicka; Andrzej Kudlicki; Benjamin P. Tu; Zbyszek Otwinowski

2007-01-01T23:59:59.000Z

319

Improving angular acceptance of stationary low-concentration photovoltaic compound parabolic concentrators using acrylic lens-walled structure  

Science Journals Connector (OSTI)

Low-concentration photovoltaic compound parabolic concentrators (PV-CPC) are a significant addition of solar cell application especially in Building Integrated Photovoltaics because it does not need a tracking system and can be installed in a stationary condition. However higher concentrations correspond with the smaller half acceptance angle which is a limitation but can be improved by a lens-walled structure. In this paper to validate the rationale of this structure a low-concentration PV-CPC using an acrylic lens-walled structure module was designed and fabricated with low-cost materials. The corresponding simulation was also performed with different materials to determine whether the factor that the truncation had a significant effect. The observed outcome implied that the low-concentration PV-CPC using an acrylic lens-walled structure has a larger half acceptance angle than the mirror CPC and that a maximum optical efficiency of more than 80% can be achieved using Schott BK glass as the lens wall material. The lens-walled structure improved the angular acceptance of stationary low-concentration PV-CPC providing a basis for further research.

2014-01-01T23:59:59.000Z

320

Wall Lake Municipal Utilities Wind Farm | Open Energy Information  

Open Energy Info (EERE)

Wall Lake Municipal Utilities Wind Farm Wall Lake Municipal Utilities Wind Farm Jump to: navigation, search Name Wall Lake Municipal Utilities Wind Farm Facility Wall Lake Municipal Utilities Sector Wind energy Facility Type Commercial Scale Wind Facility Status In Service Owner Wall Lake Municipal Utilities Developer Wall Lake Municipal Utilities Energy Purchaser Wall Lake Municipal Utilities Location Wall Lake IA Coordinates 42.281965°, -95.094098° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.281965,"lon":-95.094098,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Resistive ferromagnetic wall modes in theory and experiment  

SciTech Connect (OSTI)

Effects of the ferromagnetic resistive wall on the plasma stability are analyzed. The analysis is based on the equations describing the perturbation dynamics outside the plasma, assuming a linear plasma response. A single-mode cylindrical model is used with two features that differ from the standard case: the wall magnetic permeability is incorporated and the thin-wall approximation is waived. The derivations are performed so that the results can be applied to both tokamaks and line-tied pinches. This is done to allow conclusions for tokamaks from comparison of the developed theory with the experimental data on the resistive and ferromagnetic wall modes in the Wisconsin rotating wall machine with and without a ferritic wall [W. F. Bergerson, D. A. Hannum, C. C. Hegna, R. D. Kendrick, J. S. Sarff, and C. B. Forest, Phys. Rev. Lett. 101, 235005 (2008)]. The model shows that the ferromagnetic wall effect is always destabilizing. However, it must be small under standard conditions in tokamaks. The effect can be much stronger in the pinch with lower magnetic field and larger wall permeability. The dispersion relation obtained here makes possible an explanation of the experimental results available so far, including those from the Wisconsin machine reported recently as strongly contradictory to expectations based on earlier models. Also, an easy practical solution for compensating the destabilizing ferromagnetic effect in tokamaks is proposed.

Pustovitov, V. D. [Nuclear Fusion Institute, Russian Research Centre Kurchatov Institute, Kurchatov Square 1, Moscow 123182 (Russian Federation)

2009-05-15T23:59:59.000Z

322

Laser-produced plasma-wall interaction O. RENNER,1  

E-Print Network [OSTI]

Laser-produced plasma-wall interaction O. RENNER,1 R. LISKA,2 AND F.B. ROSMEJ3,4 1 Institute, France (RECEIVED 30 August 2009; ACCEPTED 21 September 2009) Abstract Jets of laser­generated plasma surfaces (walls). The pilot experiments carried out on the iodine laser system (5­200 J, 0.44 mm, 0

Liska, Richard

323

Electron-wall interaction in Hall thrustersa... Y. Raitsesb  

E-Print Network [OSTI]

Electron-wall interaction in Hall thrustersa... Y. Raitsesb and D. Staack Princeton Plasma Physics; accepted 22 February 2005; published online 2 May 2005 Electron-wall interaction effects in Hall thrusters this threshold, the electron energy gain is constant in the acceleration region and therefore, secondary electron

324

A review on Phase Change Materials Integrated in Building Walls  

E-Print Network [OSTI]

A review on Phase Change Materials Integrated in Building Walls Fr´ed´eric Kuznika, , Damien Davida review of the integration of phase change materials in building walls. Many considerations are discussed in this paper including physical considerations about building envelop and phase change material, phase change

325

CP-Violating Bubble Wall and Electroweak Baryogenesis  

Science Journals Connector (OSTI)

...August 1997 research-article Articles CP-Violating Bubble Wall and Electroweak...baryogenesis depends on the profile of the CP-violating bubble wall created at the first...point out that a sufficiently small explicit CP violation gives nonperturbative effects......

Koichi Funakubo; Akira Kakuto; Shoichiro Otsuki; Fumihiko Toyoda

1997-08-01T23:59:59.000Z

326

Global structure of moduli space for BPS walls  

SciTech Connect (OSTI)

We study the global structure of the moduli space of BPS walls in the Higgs branch of supersymmetric theories with eight supercharges. We examine the structure in the neighborhood of a special Lagrangian submanifold M, and find that the dimension of the moduli space can be larger than that naively suggested by the index theorem, contrary to previous examples of BPS solitons. We investigate BPS wall solutions in an explicit example of M using Abelian gauge theory. Its Higgs branch turns out to contain several special Lagrangian submanifolds including M. We show that the total moduli space of BPS walls is the union of these submanifolds. We also find interesting dynamics between BPS walls as a by-product of the analysis. Namely, mutual repulsion and attraction between BPS walls sometimes forbid a movement of a wall and lock it in a certain position; we also find that a pair of walls can transmute to another pair of walls with different tension after they pass through.

Eto, Minoru; Isozumi, Youichi; Nitta, Muneto; Ohashi, Keisuke; Sakai, Norisuke [Department of Physics, Tokyo Institute of Technology, Tokyo 152-8551 (Japan); Ohta, Kazutoshi [Theoretical Physics Laboratory, The Institute of Physical and Chemical Research (RIKEN), Saitama 351-0198 (Japan); Tachikawa, Yuji [Department of Physics, University of Tokyo, Tokyo 112-0033 (Japan)

2005-05-15T23:59:59.000Z

327

Absorption spectroscopy of individual single-walled carbon nanotubes  

E-Print Network [OSTI]

Absorption spectroscopy of individual single-walled carbon nanotubes Stéphane Berciaud,a Laurent-walled carbon nanotubes (SWNTs) lead to heterogeneous samples containing mixtures of metallic and semiconducting species with a variety of lengths and defects. Optical detection at the single nanotube level should thus

Boyer, Edmond

328

Simulations of nanosensors based on single walled carbon nanotubes  

E-Print Network [OSTI]

Simulations of nanosensors based on single walled carbon nanotubes Polina Pine1, Yuval E. Yaish2. The potential of single-walled carbon nanotubes as mass sensors is examined. The change in mass leads to proportional changes in the nanotube vibrational frequencies, which are monitored during atomistic simulations

Adler, Joan

329

Scanning tunneling spectroscopy of suspended single-wall carbon nanotubes  

E-Print Network [OSTI]

Scanning tunneling spectroscopy of suspended single-wall carbon nanotubes B. J. LeRoy,a) S. G-wall carbon nanotubes that are freely suspended over a trench. The nanotubes were grown by chemical vapor on the freestanding portions of the nanotubes. Spatially resolved spectroscopy on the suspended portion of both

Dekker, Cees

330

Characterization of single wall carbon nanotubes by nonane preadsorption  

E-Print Network [OSTI]

energy for nitrogen adsorbed in nanotubes at zero coverage within the range of 12­18 kJ/mol. This bindingCharacterization of single wall carbon nanotubes by nonane preadsorption Oleg Byl a , Jie Liu b The preferential blocking of the interior adsorption sites of single walled carbon nanotubes (SWNTs) by n

Liu, Jie

331

Electrical Transport in Single-Wall Carbon Nanotubes  

E-Print Network [OSTI]

. (a) Schematic view a nanotube field-effect transistor (b) The Dirac energy dispersion coneElectrical Transport in Single-Wall Carbon Nanotubes Michael J. Biercuk1,3 , Shahal Ilani2 metal and semiconducting single-wall carbon nanotubes. The fundamental scattering mechanisms governing

McEuen, Paul L.

332

Raman Measurements on Electrochemically Doped Single-Walled Carbon Nanotubes  

E-Print Network [OSTI]

Raman Measurements on Electrochemically Doped Single-Walled Carbon Nanotubes P. M. Rafailov, M and studied the Raman response of electro- chemically doped single-walled carbon nanotubes (SWNT) using different salt solutions. The fre- quency shift of the radial breathing mode (RBM) and the high-energy mode

Nabben, Reinhard

333

Wall Sculpture by Ellsworth Kelly Installed on Dartmouth Campus  

E-Print Network [OSTI]

Wall Sculpture by Ellsworth Kelly Installed on Dartmouth Campus Dartmouth Panels will be dedicated District, a wall sculpture by renowned abstract artist Ellsworth Kelly has been installed on the eastern façade of the Hopkins Center for the Arts, facing the Visual Arts Center. Kelly was in attendance

Shepherd, Simon

334

NON-RECTANGULAR RC WALLS: A REVIEW ON EXPERIMENTAL INVESTIGATIONS  

E-Print Network [OSTI]

section. It was rare that tests were done using load paths that did not follow the principal axes subjected to unidirectional or bidirectional loading along one or both of the principal axes of the wall-sections such as for example L-shaped or U-shaped walls which were tested under quasi-static or dynamic loads. The tests

Thévenaz, Jacques

335

Optical absorption intensity of semiconductor single-wall carbon nanotubes  

E-Print Network [OSTI]

Optical absorption intensity of semiconductor single-wall carbon nanotubes Y. Oyama1 , R. Saito1. The optical absorption intensity is inversely proportional to the diameter in the unit of per carbon atom of single-wall carbon nanotubes (SWNT) synthesized by alcohol CCVD (ACCVD) method and HiPco method [1

Maruyama, Shigeo

336

ORIGINAL PAPER Hydrothermal process synthesized electrocatalytic multi-walled  

E-Print Network [OSTI]

ORIGINAL PAPER Hydrothermal process synthesized electrocatalytic multi-walled carbon nanotubes as MWCNTs-Au, have been successfully prepared by a facile hydrothermal pro- cess of gold(III) chloride (Au. Keywords Hydrothermal Á Composites Á Au microparticles Á Multi-walled carbon nanotubes Á Ethanol oxidation

Guo, John Zhanhu

337

Associative model for solving the wall-following problem  

Science Journals Connector (OSTI)

A navigation system for a robot is presented in this work. The Wall-Following problem has become a classic problem of Robotics due to robots have to be able to move through a particular stage. This problem is proposed as a classifying task and it is ... Keywords: associative models, classification, morphological models, wall-following

Rodolfo Navarro; Elena Acevedo; Antonio Acevedo; Fabiola Martínez

2012-06-01T23:59:59.000Z

338

Optical microcavity with semiconducting single-wall carbon nanotubes  

E-Print Network [OSTI]

Optical microcavity with semiconducting single- wall carbon nanotubes Etienne Gaufrès,1 Nicolas-Perot microcavities based on semiconducting single-wall carbon nanotubes with a quality factor of 160. We properties References and links 1. P. Avouris, M. Freitag and V. Perebeinos, "Carbon nanotube photonics

Paris-Sud XI, Université de

339

Transverse Effect due to Short-range Resistive Wall Wakefield  

SciTech Connect (OSTI)

For accelerator designs with ultra short electron beams, beam dynamics study has to invoke the short-range wakefields. In this paper, we first obtain the short-range dipole mode resistive wall wakefield. Analytical approach is then developed to study the single bunch transverse beam dynamics due to this short-range resistive wall wake. The results are applied to the LCLS undulator.

Juhao Wu; Alex Chao; Jean Delayen

2007-06-18T23:59:59.000Z

340

Borehole-Wall Imaging with Acoustic and Optical Televiewers for  

Open Energy Info (EERE)

Borehole-Wall Imaging with Acoustic and Optical Televiewers for Borehole-Wall Imaging with Acoustic and Optical Televiewers for Fractured-Bedrock Aquifer Investigations Jump to: navigation, search OpenEI Reference LibraryAdd to library Conference Paper: Borehole-Wall Imaging with Acoustic and Optical Televiewers for Fractured-Bedrock Aquifer Investigations Abstract Imaging with acoustic and optical televiewers results in continuous and oriented 360 degree views of the borehole wall from which the character and orientation of lithologic and structural features can be defined for fractured-bedrock aquifer investigations. Fractures are more clearly defined under a wider range of conditions on acoustic images than on optical images including dark-colored rocks, cloudy borehole water, and coated borehole walls. However, optical images allow for the direct viewing

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Theoretical comparison between field emission from single-wall and multi-wall carbon nanotubes A. Mayer,1,  

E-Print Network [OSTI]

Theoretical comparison between field emission from single-wall and multi-wall carbon nanotubes A s : 73.63.Fg, 79.70. q, 85.35.Kt, 03.65.Nk I. INTRODUCTION Carbon nanotubes show interesting field-emission of field emission from carbon nanotubes,13­16 we now consider the depen- dence of the emission from single

Mayer, Alexandre

342

Domain wall QCD with physical quark masses  

E-Print Network [OSTI]

We present results for several light hadronic quantities ($f_\\pi$, $f_K$, $B_K$, $m_{ud}$, $m_s$, $t_0^{1/2}$, $w_0$) obtained from simulations of 2+1 flavor domain wall lattice QCD with large physical volumes and nearly-physical pion masses at two lattice spacings. We perform a short, O(3)%, extrapolation in pion mass to the physical values by combining our new data in a simultaneous chiral/continuum `global fit' with a number of other ensembles with heavier pion masses. We use the physical values of $m_\\pi$, $m_K$ and $m_\\Omega$ to determine the two quark masses and the scale - all other quantities are outputs from our simulations. We obtain results with sub-percent statistical errors and negligible chiral and finite-volume systematics for these light hadronic quantities, including: $f_\\pi$ = 130.2(9) MeV; $f_K$ = 155.5(8) MeV; the average up/down quark mass and strange quark mass in the $\\overline {\\rm MS}$ scheme at 3 GeV, 2.997(49) and 81.64(1.17) MeV respectively; and the neutral kaon mixing parameter, $B_K$, in the RGI scheme, 0.750(15) and the $\\overline{\\rm MS}$ scheme at 3 GeV, 0.530(11).

RBC; UKQCD collaborations; :; T. Blum; P. A. Boyle; N. H. Christ; J. Frison; N. Garron; R. J. Hudspith; T. Izubuchi; T. Janowski; C. Jung; A. Juettner; C. Kelly; R. D. Kenway; C. Lehner; M. Marinkovic; R. D. Mawhinney; G. McGlynn; D. J. Murphy; S. Ohta; A. Portelli; C. T. Sachrajda; A. Soni

2014-11-25T23:59:59.000Z

343

Pneumatic wall-locking geophone system  

DOE Patents [OSTI]

A seismic signal receiving system is provided for use in boreholes to receive seismic waves in carrying out geophysical investigations. The system includes three pairs of opposed plates, each of the pairs of plates including oppositely facing outer surfaces for engagement with opposite sides of a borehole. A seismic receiver is mounted on the inner surface of each of the plates for receiving seismic signals. A double-acting, fluid-operated actuator selectively causes relative movement of the plates of the pairs of plates away from each other to provide expansion thereof so as to enable the plates to engage the walls of a borehole and selectively causes relative movement of the plates of the pairs of plates toward each other to provide retraction thereof so as to enable the system to be removed from a borehole. The pairs of plates each comprise a relatively long plate and a relatively short plate. An expandable linkage interconnects the long plates at the distal ends thereof. The plates are mechanically biassed into the retracted state so that the plates return to this state in the event of a system failure.

Kuhlman, Harland L. (Minneapolis, MN); Cumerlato, Calvin L. (Minneapolis, MN); Tweeton, Daryl R. (Apple Valley, MN)

1991-01-01T23:59:59.000Z

344

Dynamics of domain wall networks with junctions  

SciTech Connect (OSTI)

We use a combination of analytic tools and an extensive set of the largest and most accurate three-dimensional field theory numerical simulations to study the dynamics of domain wall networks with junctions. We build upon our previous work and consider a class of models which, in the limit of large number N of coupled scalar fields, approaches the so-called ''ideal'' model (in terms of its potential to lead to network frustration). We consider values of N between N=2 and N=20, and a range of cosmological epochs, and we also compare this class of models with other toy models used in the past. In all cases we find compelling evidence for a gradual approach to scaling, strongly supporting our no-frustration conjecture. We also discuss the various possible types of junctions (including cases where there is a hierarchy of them) and their roles in the dynamics of the network. Finally, we provide a cosmological Zel'dovich-type bound on the energy scale of this kind of defect network: it must be lower than 10 keV.

Avelino, P. P.; Oliveira, J. C. R. E. [Centro de Fisica do Porto, Rua do Campo Alegre 687, 4169-007 Porto (Portugal); Departamento de Fisica da Faculdade de Ciencias da Universidade do Porto, Rua do Campo Alegre 687, 4169-007 Porto (Portugal); Martins, C. J. A. P. [Centro de Astrofisica da Universidade do Porto, Rua das Estrelas s/n, 4150-762 Porto (Portugal); DAMTP, University of Cambridge, Wilberforce Road, Cambridge CB3 0WA (United Kingdom); Menezes, J. [Centro de Fisica do Porto, Rua do Campo Alegre 687, 4169-007 Porto (Portugal); Centro de Astrofisica da Universidade do Porto, Rua das Estrelas s/n, 4150-762 Porto (Portugal); Departamento de Fisica, Universidade Federal da Paraiba, Caixa Postal 5008, 58051-970 Joao Pessoa, Paraiba (Brazil); Menezes, R. [Departamento de Fisica, Universidade Federal da Paraiba, Caixa Postal 5008, 58051-970 Joao Pessoa, Paraiba (Brazil)

2008-11-15T23:59:59.000Z

345

Macrophage Reporter Cell Assay for Screening Immunopharmacological Activity of Cell Wall-Active Antifungals  

Science Journals Connector (OSTI)

...a modification of methods described by Wheeler and Fink (3) for evaluating macrophage...1726-1733. doi: 10.1086/314495 . 3. Wheeler, RT , and GR Fink. 2006. A drug-sensitive...176-185. doi: 10.1086/589304 . 5. Wheeler, RT , D Kombe, SD Agarwala, and GR...

Russell E. Lewis; Guangling Liao; Katherine Young; Cameron Douglas; Dimitrios P. Kontoyiannis

2014-01-06T23:59:59.000Z

346

AUXIN BINDING PROTEIN1 Links Cell Wall Remodeling, Auxin Signaling, and Cell Expansion in Arabidopsis  

Science Journals Connector (OSTI)

...to ACTIN. Statistics Classical statistical analyses were performed using either Students t test or nonparametric Kruskal-Wallis analysis according to experimental constraints. Accession Numbers Sequence data from this article can be found in...

Sébastien Paque; Grégory Mouille; Laurie Grandont; David Alabadí; Cyril Gaertner; Arnaud Goyallon; Philippe Muller; Catherine Primard-Brisset; Rodnay Sormani; Miguel A. Blázquez; Catherine Perrot-Rechenmann

2014-01-14T23:59:59.000Z

347

Comparative activity of agrochemical treatments on mycotoxin levels with regard to corn borers and Fusarium mycoflora in maize (Zea mays L.) fields  

Science Journals Connector (OSTI)

Field trials were carried out in nine areas located in France during 2004, 2005 and 2006 to study the control of Lepidoptera caterpillars by agrochemical treatments and their consequences on Fusarium spp. mycoflora and mycotoxin levels. Treatments involved either an insecticide or an insecticide–fungicide association. Two species of maize borers: Ostrinia nubilalis Hübner [Lepidoptera: Crambidae] and Sesamia nonagrioides Lefebvre [Lepidoptera: Noctuidae], were monitored. Although the insect populations were controlled by agrochemicals, there was no reduction in Fusarium spp. mycoflora. Conversely a significant reduction of mycotoxin (trichothecenes, fumonisins and zearalenone) levels resulted from insecticide treatment. These experiments and results are discussed regarding the biology of maize borers and relationships with Fusarium spp.

Laurent Folcher; Marc Jarry; Alain Weissenberger; Florence Gérault; Nathalie Eychenne; Marc Delos; Catherine Regnault-Roger

2009-01-01T23:59:59.000Z

348

Case history: Vertical barrier wall system for Superfund Site  

SciTech Connect (OSTI)

Design considerations and construction aspects are presented for the installation of a vertical barrier wall system for the Boeing Company at a Superfund Site near Seattle, WA. The construction was performed during 1996. The vertical barrier wall system included: (1) a soil-bentonite (SB) slurry wall, approximately 670 meters (2200 feet) in length, ranging from 12 to 21 meters (40 to 70 feet) in depth; (2) expansion of a cover system over the area enclosed by the SB wall; and (3) surface drainage improvements. Design and construction of the system addressed requirements of a Consent Decree for the site issued in 1993. The paper discusses the development of the design to meet remedial performance goals of preventing migration of contaminants in the soil/groundwater system and aiding aquifer restoration. Secondly, the paper details installation of the SB wall, highlighting the more significant construction issues, which included excavation of the wall through glacially deposited cobbles/boulders/till as well as addressing the severe elevation changes along the wall alignment. Thirdly, the paper presents Quality Assurance (QA) monitoring and testing performed during the construction phase.

Koelling, M.A.; Kovac, C.P.; Norris, J.E.

1997-12-31T23:59:59.000Z

349

Enzymatic Hydrolysis of Yeast Cell Walls I. Isolation of Wall-Decomposing Organisms and Separation and Purification of Lytic Enzymes  

Science Journals Connector (OSTI)

...1937) for the purification of mannan. The white, water- soluble polysaccharide...column with 200 ml of water ,3-1-*6 glucanase...against distilled water or buffe ,6-1...the separation and purification of j3-l3 and l-1-6...

Hirosato Tanaka; Herman J. Phaff

1965-06-01T23:59:59.000Z

350

Conductance-Controlled Point Functionalization of Single-Walled Carbon Nanotubes  

E-Print Network [OSTI]

of Single-Walled Carbon Nanotubes Brett R. Goldsmith, 1 Johnof Single-Walled Carbon Nanotubes Brett R. Goldsmith et al.single-walled carbon nanotubes (SWNTs) to fabricate single-

Collins, Philip G

2007-01-01T23:59:59.000Z

351

Advanced Metal Fiber Wall-Flow DPF For Diesel Emission Control...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Metal Fiber Wall-Flow DPF For Diesel Emission Control Advanced Metal Fiber Wall-Flow DPF For Diesel Emission Control A new metal fiber wall-flow DPF with up to 99% efficiency and...

352

A High Resolution Ultrawideband Wall Penetrating Erman Engin, Berkehan iftiolu, Meri zcan and brahim Tekin  

E-Print Network [OSTI]

for underground mine detection [1], [2], through the wall imaging [3], cancerous tissue detection applications [4 respiratory activity of a human behind a 23 cm thick brick wall. Keywords: UWB Radar, Wall penetrating Radar

Yanikoglu, Berrin

353

SUBCRITICAL BUBBLES NEAR THE PHASE SPACE DOMAIN WALL  

E-Print Network [OSTI]

We study the subcritical bubble formation near the phase space domain wall. We take into account that the phase of the scalar field can vary using complex U(1) symmetric field and a phenomenological potential with cubic term responsible to symmetry breaking. We show that the presence of the domain wall induces subcritical bubbles so that their formation rate near the wall is considerably larger than far of it. The allowed deviations of the phases of new bubbles are so large that they prevent the system from induced nucleation.

J. Sirkka; I. Vilja

1995-03-31T23:59:59.000Z

354

Conceptual design of the INTOR first-wall system  

SciTech Connect (OSTI)

The design concept and performance characteristics of the first-wall design for the phase-1 INTOR (International Tokamak Reactor) study is described. The reference design consists of a water-cooled stainless steel panel. The major uncertainty regarding the performance of the bare stainless steel wall relates to the response of a thin-melt layer predicted to form on limited regions during a plasma disruption. A more-complex backup design, which incorporates radiatively cooled graphite tiles on the inboard wall, is briefly described.

Smith, D.L.; Majumdar, S.; Mattas, R.F.; Turner, L.; Jung, J.; Abdou, M.A.; Bowers, D.; Trachsel, C.; Merrill, B.

1981-10-01T23:59:59.000Z

355

Crystalline mesoporous zirconia catalysts having stable tetragonal pore wall structure  

DOE Patents [OSTI]

Methods are disclosed for the preparation of new sulfated mesoporous zirconia materials/catalysts with crystalline pore walls of predominantly tetragonal crystal structure, characterized by nitrogen physical sorption measurement, X-ray diffraction, transmission electron microscopy and catalytic tests using n-butane isomerization to iso-butane and alkylation of 1-naphthol with 4-tert-butylstyrene as probe reactions. Sulfate deposition is preferred for the transformation of a mesoporous precursor with amorphous pore walls into a material with crystalline pore walls maintaining the mesoporous characteristics. 17 figs.

Sachtler, W.M.H.; Huang, Y.Y.

1998-07-28T23:59:59.000Z

356

High power density fuel cell comprising an array of microchannels  

DOE Patents [OSTI]

A phosphoric acid fuel cell according to one embodiment includes an array of microchannels defined by a porous electrolyte support structure extending between bottom and upper support layers, the microchannels including fuel and oxidant microchannels; fuel electrodes formed along some of the microchannels; and air electrodes formed along other of the microchannels. A method of making a phosphoric acid fuel cell according to one embodiment includes etching an array of microchannels in a substrate, thereby forming walls between the microchannels; processing the walls to make the walls porous, thereby forming a porous electrolyte support structure; forming anode electrodes along some of the walls; forming cathode electrodes along other of the walls; and filling the porous electrolyte support structure with a phosphoric acid electrolyte. Additional embodiments are also disclosed.

Sopchak, David A; Morse, Jeffrey D; Upadhye, Ravindra S; Kotovsky, Jack; Graff, Robert T

2014-05-06T23:59:59.000Z

357

Selection of Haploid Maize Kernels from Hybrid Kernels for Plant Breeding Using Near-Infrared Spectroscopy and SIMCA Analysis  

SciTech Connect (OSTI)

Samples of haploid and hybrid seed from three different maize donor genotypes after maternal haploid induction were used to test the capability of automated near-infrared transmission spectroscopy to individually differentiate haploid from hybrid seeds. Using a two-step chemometric analysis in which the seeds were first classified according to genotype and then the haploid or hybrid status was determined proved to be the most successful approach. This approach allowed 11 of 13 haploid and 25 of 25 hybrid kernels to be correctly identified from a mixture that included seeds of all the genotypes.

Jones, Roger W.; Reinot, Tonu; Frei, Ursula K.; Tseng, Yichia; Lübberstedt, Thomas; McClelland, John F.

2012-04-01T23:59:59.000Z

358

E-Print Network 3.0 - anterior vaginal wall Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

vaginal wall Search Powered by Explorit Topic List Advanced Search Sample search results for: anterior vaginal wall Page: << < 1 2 3 4 5 > >> 1 Anterior repair using Bologna...

359

E-Print Network 3.0 - aligned single-walled carbon Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary: Thermal conductivity measurement of vertically-aligned single-walled carbon nanotubes by 3 omega... the high-purity vertically aligned single-walled carbon nanotubes 2,...

360

E-Print Network 3.0 - aligned double-walled carbon Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary: , and H. M. Cheng. Polarized raman analysis of aligned double- walled carbon nanotubes. Physical Review B... Nonlinear Oscillations of a Double-Walled Carbon Nanotube...

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

E-Print Network 3.0 - antibody-functionalized single-walled carbon...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 > >> 1 Molecular Dynamics Simulation of Nucleation Process of Single-Walled Carbon Nanotubes Summary: Molecular Dynamics Simulation of Nucleation Process of Single-Walled Carbon...

362

E-Print Network 3.0 - aligned single wall Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Summary: Thermal conductivity measurement of vertically-aligned single-walled carbon nanotubes by 3 omega... the high-purity vertically aligned single-walled carbon nanotubes 2,...

363

Magnetic soft x-ray microscopy of the domain wall depinning process in permalloy magnetic nanowires  

E-Print Network [OSTI]

R P 2002 Magnetic domain-wall logic Science 296 1688 [2]magnetic domain»wall nanowire shift register Science 320

Im, Mi-Young

2014-01-01T23:59:59.000Z

364

Experimental Investigation of Natural Convection in Trombe Wall Systems  

E-Print Network [OSTI]

In this paper, experiments with a passive solar building with Trombe wall in the north cold climate are carried out and discussed, and the natural convection heat transfer process has been investigated. The relativity of the factors affecting indoor...

Chen, B.; Zhao, J.; Chen, C.; Zhuang, Z.

2006-01-01T23:59:59.000Z

365

Accident Simulation Tests on a Wet-Wall LNG Design  

Science Journals Connector (OSTI)

The “wet wall” design concept for containing cryogenic Hquids has been successfully employed in the Apollo space program [1...] and may be described as a double-hulled tank with a liquid-tight insulation system. ...

P. O. Metz; R. W. Lautensleger; D. A. Sarno

1977-01-01T23:59:59.000Z

366

High-R Walls - Building America Top Innovation | Department of...  

Broader source: Energy.gov (indexed) [DOE]

R values and the need for vented cladding to reduce condensation potential with some insulation types. Research on common high-R wall assemblies has shown that the measured R-value...

367

Superconductivity in Bundles of Double-Wall Carbon Nanotubes  

E-Print Network [OSTI]

We present electrical and thermal specific heat measurements that show superconductivity in double-wall carbon nanotube (DWCNT) bundles. Clear evidence, comprising a resistance drop as a function of temperature, magnetoresistance ...

Shi, Wu

368

Building America Case Study: Evaluating Through-Wall Air Transfer...  

Energy Savers [EERE]

the performance of market-available through-wall air transfer fans with respect to Air Conditioning Contractors of America (ACCA) Manual RS and ASHRAE Standard 55-2010...

369

Xylan deposition on secondary wall of Fagus crenata fiber  

Science Journals Connector (OSTI)

...Delignified and/or xylanase-treated secondary walls of Fagus crenata fibers were examined by field emission scanning electron microscopy. Microfibrils with a smooth surface were visible in the innermost surface

T. Awano; K. Takabe; M. Fujita

2002-02-01T23:59:59.000Z

370

Domain wall induced magnetoresistance in a superconductor/ferromagnet nanowire  

E-Print Network [OSTI]

In a nanowire consisting of a ferromagnet/insulator/superconductor multilayer structure, the superconductivity is shown to depend strongly on the configuration of the magnetic domain walls in the neighboring ferromagnetic ...

Miao, G. X.

371

Characterization of double walled carbon nanotubes-polyvinylidene fluoride nanocomposites  

E-Print Network [OSTI]

One of the main objectives of this thesis is to disperse double-walled carbon nanotubes (DWNT) in a polyvinylidene fluoride (PVDF) matrix, and to characterize the resulting composite using electrical, thermal, and mechanical characterization...

Almasri, Atheer Mohammad

2007-04-25T23:59:59.000Z

372

Dynamic analysis of concrete coupled wall structures : a parametric study  

E-Print Network [OSTI]

Concrete coupled wall structure is a system that can efficiently dissipate energy under the effect of lateral loads. It has been widely used in medium height buildings for several decades. While researchers have conducted ...

Huang, Elaine Annabelle, 1981-

2005-01-01T23:59:59.000Z

373

Conserval aka SolarWall | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Name: Conserval (aka SolarWall) Place: Toronto, Ontario, Canada Zip: M3J2N5 Sector: Solar Product: Makes solar passive heating and cooling...

374

Field measurements of earth pressure on a cantilever retaining wall  

E-Print Network [OSTI]

. The measurements were made before and after backfilling for a duration of 385 days. The effects of a clay surcharge were studied. The total thrust of the measured lateral earth pressures was com- pared to total thrust determined from a Culmann graphical... to bearing pressures calculated by conventional methods. The measured bearing pressures compared reasonably well with the calculated pressures. Wall movement data indicated that the wall tilted or rotated toward the backfill during sand backfilling...

Schulze, Larry Wayne

2012-06-07T23:59:59.000Z

375

Excess free energy of supercooled liquids at disordered walls  

E-Print Network [OSTI]

Using a novel thermodynamic integration scheme, we compute the excess free energy, $\\gamma$, of a glass-forming, binary Lennard-Jones liquid in contact with a frozen amorphous wall, formed by particles frozen into a similar structure as the liquid. We find that $\\gamma$ is non-zero, becoming negative at low temperature. This indicates that the thermodynamics of the system is perturbed by the effect of the amorphous wall.

Benjamin, Ronald

2014-01-01T23:59:59.000Z

376

Field measurement of lateral earth pressures on retaining walls  

E-Print Network [OSTI]

. The measured pressures are compared with the computed Coulomb and Rankine pressures for the active case. The measured pressures on the cantilever wall are in close agreement with the theoretical pressures on the upper half of the wall, but the measured... Pressure Variance with Time and Temperature. INTRODUCTION Present Status of the Question -- The latera1 earth pressure theories developed by Coulomb in 1776 and Rankine in 1S57 are known as the classical earth pressure theories (5)*. The basic equation...

Riggins, Michael

2012-06-07T23:59:59.000Z

377

LiveWall Operational Evaluation: Seattle Law Enforcement Pilot  

SciTech Connect (OSTI)

The LiveWall concept envisioned as an outgrowth of the Precision Information Environment (PIE) project allows communications between separate groups using interactive video, audio, and a shared desktop environment; this allows everyone to participate and collaborate in real time, regardless of location. The LiveWall concept provides a virtual window to other locations, where all parties can interact and collaboratively work with each other. This functionality is intended to improve multi-site coordination amongst emergency operations centers (EOC), field operations sites and across organizations and jurisdictions to accommodate communications during routine and emergency events. For the initial LiveWall operational evaluation PNNL partnered with the Seattle Police Department (SPD). This partnership allowed for the creation of an excellent LiveWall test bed specific to law enforcement. This partnership made it possible to test the LiveWall concept with scenarios involving the many facets of the law enforcement work done by SPD. PNNL and SPD agreed that integrating the systems into operations for a real event would be the best test of the technology and give SPD staff greater visibility into the functionality and benefits offered by the LiveWall concept.

Barr, Jonathan L.; Burtner, Edwin R.; Stein, Steven L.

2013-10-01T23:59:59.000Z

378

Cell signalling and phospholipid metabolism. Final report  

SciTech Connect (OSTI)

These studies explored whether phosphoinositide (PI) has a role in plants analogous to its role in animal cells. Although no parallel activity of PI in signal transduction was found in plant cells, activity of inositol phospholipid kinase was found to be modulated by light and by cell wall degrading enzymes. These studies indicate a major role for inositol phospholipids in plant growth and development as membrane effectors but not as a source of second messengers.

Boss, W.F.

1990-12-31T23:59:59.000Z

379

The dicer-like1 Homolog fuzzy tassel Is Required for the Regulation of Meristem Determinacy in the Inflorescence and Vegetative Growth in Maize  

Science Journals Connector (OSTI)

...Instructions for Authors ( www.plantcell.org ) is: Beth Thompson ( thompsonb@ecu.edu ). [W] Online version contains Web-only data. The maize fuzzy tassel mutant is the first dcl1 mutant reported in a plant other than Arabidopsis and enables functional...

Beth E. Thompson; Christine Basham; Reza Hammond; Queying Ding; Atul Kakrana; Tzuu-Fen Lee; Stacey A. Simon; Robert Meeley; Blake C. Meyers; Sarah Hake

2014-12-02T23:59:59.000Z

380

Accessible DNA and Relative Depletion of H3K9me2 at Maize Loci Undergoing RNA-Directed DNA Methylation  

Science Journals Connector (OSTI)

...Instructions for Authors ( www.plantcell.org ) is: R. Kelly Dawe ( kdawe@uga.edu ). [W] Online version contains Web-only data. [OPEN] Articles can be viewed online without a subscription. Only a small fraction of the maize genome undergoes...

Jonathan I. Gent; Thelma F. Madzima; Rechien Bader; Matthew R. Kent; Xiaoyu Zhang; Maike Stam; Karen M. McGinnis; R. Kelly Dawe

2014-12-02T23:59:59.000Z

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

The dicer-like1 Homolog fuzzy tassel Is Required for the Regulation of Meristem Determinacy in the Inflorescence and Vegetative Growth in Maize  

Science Journals Connector (OSTI)

...Instructions for Authors ( www.plantcell.org ) is: Beth Thompson ( thompsonb@ecu.edu ). [W] Online version contains Web-only data. [OPEN] Articles can be viewed online without a subscription. The maize fuzzy tassel mutant is the first dcl1...

Beth E. Thompson; Christine Basham; Reza Hammond; Queying Ding; Atul Kakrana; Tzuu-Fen Lee; Stacey A. Simon; Robert Meeley; Blake C. Meyers; Sarah Hake

2014-12-02T23:59:59.000Z

382

Mould incidence and mycotoxin contamination in maize kernels from Swat Valley, North West Frontier Province of Pakistan  

Science Journals Connector (OSTI)

Mould incidence and aflatoxin B1 (AFB1) and ochratoxin A (OTA) contamination as well as proximate composition and minerals content of maize kernels from Swat Valley, North West Frontier Province of Pakistan was studied during the year, 2007. Results indicated that the mean moisture content of the kernels was within the recommended safe storage levels of ?15%. Across the whole valley, Aspergillus, Fusarium, Penicillium and Rhizopus were the most predominant fungal genera identified and amongst the mycotoxigenic species, Aspergillus flavus had the highest incidence. AFB1 content ranged from none to 30.92 ?g/kg with the average values of 14.94 and 16.22 ?g/kg for Upper and Lower Swat regions, respectively. Similar trend was observed for OTA with the contamination level ranged from Valley may be exposed to the danger of aflatoxins and ochratoxins poisoning. Thus, there is a need for policy makers to establish and enforce maize quality standards and regulations related to moulds and mycotoxins across the area.

Hamid Ullah Shah; Thomas J. Simpson; Sahib Alam; Khanzadi Fatima Khattak; Sajida Perveen

2010-01-01T23:59:59.000Z

383

Solid oxide fuel cell generator  

DOE Patents [OSTI]

A solid oxide fuel cell generator has a pair of spaced apart tubesheets in a housing. At least two intermediate barrier walls are between the tubesheets and define a generator chamber between two intermediate buffer chambers. An array of fuel cells have tubes with open ends engaging the tubesheets. Tubular, axially elongated electrochemical cells are supported on the tubes in the generator chamber. Fuel gas and oxidant gas are preheated in the intermediate chambers by the gases flowing on the other side of the tubes. Gas leakage around the tubes through the tubesheets is permitted. The buffer chambers reentrain the leaked fuel gas for reintroduction to the generator chamber.

Draper, Robert (Churchill Boro, PA); George, Raymond A. (Pittsburgh, PA); Shockling, Larry A. (Plum Borough, PA)

1993-01-01T23:59:59.000Z

384

The Tangled1 Gene Is Required for Spatial Control of Cytoskeletal Arrays Associated with Cell Division during Maize Leaf Development  

Science Journals Connector (OSTI)

...these cytoskeleton-dependent processes critical for plant development...division site required for this process are not known. One attractive...Indeed, because so many interrelated factors can influence the...that are affected in these processes. In recent years, this approach...

Ann L. Cleary; Laurie G. Smith

385

The Cochliobolus carbonum SNF1 Gene Is Required for Cell Wallâ??Degrading Enzyme Expression and Virulence on Maize  

Science Journals Connector (OSTI)

...Cotty P.J. Cleveland T.E. Dean R.A. Molecular genetic evidence for the involvement of a specific polygalacturonase, P2c, in the invasion and spread of Aspergillus flavus in cotton bolls Sposato J.P. Ahn J.-H. Walton J.D. Characterization...

Nyerhovwo J. Tonukari; John S. Scott-Craig; Jonathan D. Waltonb

386

Threats, design limits and design windows for laser IFE dry wall chambers  

E-Print Network [OSTI]

Threats, design limits and design windows for laser IFE dry wall chambers A. Rene´ Raffray-drive targets and a dry wall chamber. The dry wall must accommodate the ion and photon threat spectra from. The neutron energy is deposited deeper in the first wall and blanket and does not represent a major threat

Raffray, A. René

387

Improved Confinement in JET High {beta} Plasmas with an ITER-Like Wall  

E-Print Network [OSTI]

The replacement of the JET carbon wall (C-wall) by a Be/W ITER-like wall (ILW) has affected the plasma energy confinement. To investigate this, experiments have been performed with both the C-wall and ILW to vary the heating power over a wide range for plasmas with different shapes.

Challis, C D; Beurskens, M; Buratti, P; Delabie, E; Drewelow, P; Frassinetti, L; Giroud, C; Hawkes, N; Hobirk, J; Joffrin, E; Keeling, D; King, D B; Maggi, C F; Mailloux, J; Marchetto, C; McDonald, D; Nunes, I; Pucella, G; Saarelma, S; Simpson, J

2015-01-01T23:59:59.000Z

388

IN-SITU MEASUREMENT OF WALL THERMAL PERFORMANCE: DATA INTERPRETATION AND APPARATUS DESIGN RECOMMENDATIONS  

E-Print Network [OSTI]

Unit (ETTU): Field Measurement of Wall Performance, Presented at Third International Symposium on Energy

Modera, M.P.; Sherman, M.H.; de Vinuesa, S.G.

2008-01-01T23:59:59.000Z

389

Heavy wall casing in C110 grade for sour service  

SciTech Connect (OSTI)

The recent developments of high pressure and sour wells in the North Sea area have increased the need for high strength H{sub 2}S resistant carbon steels. Steel chemistry and heat treatment solutions have been available to provide products suitable for use in these environments within the constraints of classic well design since the early 90`s but operators are now demanding higher strength and heavier wall products for HPHT wells. Well completion design teams are now specifying from OCTG suppliers C110 grade products in increasingly heavy wall and the challenge facing suppliers is to guarantee product integrity not only of these heavy wall casing but also the associated coupling stocks. This paper was aimed at evaluating the performances of thick walled C110 tubulars (up to 2in) for sour environments. Metallurgical characteristics (microstructure, structure, microhardness), mechanical properties (hardness, tensile, toughness), Sulfide Stress Cracking resistance (smooth tensile, DCB) have been investigated throughout the wall thickness. The C110 proprietary grade proved to be an excellent material for use as Oil Country Tubular Goods (OCTG) in typical North Sea environments with improved assessment of H2S corrosion resistance properties according to both NACE and EFC (European Federation of Corrosion) philosophies.

Linne, C.P.; Blanchard, F.; Puissochet, F. [Vallourec Research Center, Aulnoye Aymeries (France). Corrosion and Metallurgical Dept.; Orlans-Joliet, B.J.; Hamilton, R.S.

1998-12-31T23:59:59.000Z

390

Anomalous conductivity in Hall thrusters: Effects of the non-linear coupling of the electron-cyclotron drift instability with secondary electron emission of the walls  

SciTech Connect (OSTI)

With the help of an implicit particle-in-cell code, we have shown in a previous paper that the electron-cyclotron drift instability was able to induce anomalous conductivity as well as anomalous heating. As such it can be a major actor among the mechanisms involved in the operation of Hall thrusters. However, experimental results show that the nature of wall material has a significant effect on the behavior of the thruster. The purpose of this paper is to study the plasma-wall interaction in the case where the plasma is heated self-consistently by electrostatic fluctuations induced by the electron-cyclotron drift instability.

Héron, A.; Adam, J. C. [Centre de physique théorique, CNRS-Ecole Polytechnique, 91128 Palaiseau Cedex (France)] [Centre de physique théorique, CNRS-Ecole Polytechnique, 91128 Palaiseau Cedex (France)

2013-08-15T23:59:59.000Z

391

"Seismic Behavior and Design of Steel Shear Walls", A. Astaneh-Asl, SEAONC Seminar, November 2001, San Francisco. of 181 Seismic Behavior and Design of Steel Shear Walls  

E-Print Network [OSTI]

"Seismic Behavior and Design of Steel Shear Walls", A. Astaneh-Asl, SEAONC Seminar, November 2001, San Francisco. of 181 Seismic Behavior and Design of Steel Shear Walls By Abolhassan Astaneh-Asl, Ph.ce.berkeley.edu/~astaneh Introduction Steel plate shear wall systems have been used in recent years in highly seismic areas to resist

Astaneh-Asl, Abolhassan

392

D-brane construction for non-Abelian walls  

SciTech Connect (OSTI)

Supersymmetric U(N{sub C}) gauge theory with N{sub F} massive hypermultiplets in the fundamental representation is given by the brane configuration made of N{sub C} fractional Dp-branes stuck at the Z{sub 2} orbifold singularity on N{sub F} separated D(p+4)-branes. We show that non-Abelian walls in this theory are realized as kinky fractional Dp-branes interpolating between D(p+4)-branes. Wall solutions and their duality between N{sub C} and N{sub F}-N{sub C} imply extensions of the s-rule and the Hanany-Witten effect in brane dynamics. We also find that the reconnection of fractional D-branes occurs in this system. Diverse phenomena in non-Abelian walls found in field theory can be understood very easily by this brane configuration.

Eto, Minoru; Isozumi, Youichi; Nitta, Muneto; Ohashi, Keisuke; Ohta, Kazutoshi; Sakai, Norisuke [Department of Physics, Tokyo Institute of Technology, Tokyo 152-8551 (Japan); Theoretical Physics Laboratory, the Institute of Physical and Chemical Research (RIKEN), 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan)

2005-06-15T23:59:59.000Z

393

Spin alignment of dark matter haloes in filaments and walls  

E-Print Network [OSTI]

The MMF technique is used to segment the cosmic web as seen in a cosmological N-body simulation into wall-like and filament-like structures. We find that the spins and shapes of dark matter haloes are significantly correlated with each other and with the orientation of their host structures. The shape orientation is such that the halo minor axes tend to lie perpendicular to the host structure, be it a wall or filament. The orientation of the halo spin vector is mass dependent. Low mass haloes in walls and filaments have a tendency to have their spins oriented within the parent structure, while higher mass haloes in filaments have spins that tend to lie perpendicular to the parent structure.

Miguel A. Aragón-Calvo; Rien van de Weygaert; Bernard J. T. Jones; J. M. Thijs van der Hulst

2006-10-09T23:59:59.000Z

394

Wall Adhesion and Constitutive Modelling of Strong Colloidal Gels  

E-Print Network [OSTI]

Wall adhesion effects during batch sedimentation of strongly flocculated colloidal gels are commonly assumed to be negligible. In this study in-situ measurements of colloidal gel rheology and solids volume fraction distribution suggest the contrary, where significant wall adhesion effects are observed in a 110mm diameter settling column. We develop and validate a mathematical model for the equilibrium stress state in the presence of wall adhesion under both viscoplastic and viscoelastic constitutive models. These formulations highlight fundamental issues regarding the constitutive modeling of colloidal gels, specifically the relative utility and validity of viscoplastic and viscoelastic rheological models under arbitrary tensorial loadings. The developed model is validated against experimental data, which points toward a novel method to estimate the shear and compressive yield strength of strongly flocculated colloidal gels from a series of equilibrium solids volume fraction profiles over various column widths.

Daniel R. Lester; Richard Buscall; Anthony D. Stickland; Peter J. Scales

2013-12-30T23:59:59.000Z

395

Studies of Resistive Wall Heating at JLAB FEL  

SciTech Connect (OSTI)

When the JLAB FEL is under CW operation, it had been observed that temperature rises over the wiggler vacuum chamber, presumably as the result of the power deposition on the resistive wall of the wiggler chamber. Previous analyses have been done on the resistive wall impedance for various cases, such as DC, AC, and anomalous skin effects*. Here we report an investigation on the beam kinetic energy losses for each of these cases. This study includes the non-ultrarelativistic effect on resistive wall loss, for both round pipe and parallel plates. We will present the comparison of our results with the measured data obtained during CW operation of the JLAB FEL. Other possible factors contributing to the measured heating will also be discussed.

Li, Rui; Benson, Stephen V.

2013-06-01T23:59:59.000Z

396

Earth melter with rubble walls and method of use  

DOE Patents [OSTI]

The present invention is an improvement to the earth melter described and claimed in U.S. Pat. No. 5,443,618. The improvement is the use of rubble for retaining walls. More specifically, the retaining walls rest on ground level and extend above ground level piling rubble around a melt zone. A portion of the melter may be below grade wherein sidewalls are formed by the relatively undisturbed native soil or rock, and the rubble may be used as a backfill liner for the below grade sidewalls.

Chapman, Chris C. (Richland, WA)

1998-01-01T23:59:59.000Z

397

Effect of Trapped Energetic Particles on the Resistive Wall Mode  

SciTech Connect (OSTI)

A stability analysis for the resistive wall mode is studied in the presence of trapped energetic particles (EPs). When the EPs' beta exceeds a critical value, a fishbonelike bursting mode (FLM) with an external kink eigenstructure can exist. This offers the first analytic interpretation of the experimental observations [Phys. Rev. Lett. 103, 045001 (2009)]. The mode-particle resonances for the FLM and the q=1 fishbone occur in different regimes of the precession frequency of EPs. In certain ranges of the plasma rotation speed and the EPs' beta, a mode conversion can occur between the resistive wall mode and FLM.

Hao, G. Z.; Wang, A. K.; Qiu, X. M. [Southwestern Institute of Physics, Post Office Box 432, Chengdu 610041 (China); Liu, Y. Q. [Euratom/CCFE Fusion Association, Culham Science Centre, Abingdon, Oxon OX14 3DB (United Kingdom)

2011-07-01T23:59:59.000Z

398

Effective hydrogen storage in single-wall carbon nanotubes  

Science Journals Connector (OSTI)

The hydrogen-storage behavior of single-wall carbon nanotubes was studied using molecular dynamics simulations and ab initio electronic calculations. Hydrogen atoms with kinetic energy of 16–25 eV were observed to penetrate into and be trapped inside the tube. Consecutively injected H atoms form hydrogen molecules, and gradually condense to become liquid hydrogen in the tube. The density of injected hydrogen in the tube and the pressure on the wall of the nanotube induced by the stored hydrogen molecules were evaluated at room temperature.

Yuchen Ma; Yueyuan Xia; Mingwen Zhao; Ruijin Wang; Liangmo Mei

2001-03-02T23:59:59.000Z

399

MHK Technologies/Water Wall Turbine | Open Energy Information  

Open Energy Info (EERE)

Turbine Turbine < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Water Wall Turbine.png Technology Profile Primary Organization Water Wall Turbine Technology Resource Click here Current Technology Type Click here Cross Flow Turbine Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description WWTurbine has developed and introduced a new commercially viable system for the extraction of Potential and Kinetic Energy from large fast moving water currents for conversion into Electric Energy Mooring Configuration Monopile Optimum Marine/Riverline Conditions min current velocity of 2 m s Technology Dimensions Technology Nameplate Capacity (MW) 0 5 3 0 MW Device Testing

400

BPS domain wall junctions in infinitely large extra dimensions  

Science Journals Connector (OSTI)

We consider models of scalar fields coupled to gravity which are higher-dimensional generalizations of four dimensional supergravity. We use these models to describe domain wall junctions in an anti–de Sitter background. We derive Bogomol’nyi equations for the scalar fields from which the walls are constructed and for the metric. From these equations a BPS-like formula for the junction energy can be derived. We demonstrate that such junctions localize gravity in the presence of more than one uncompactified extra dimension.

Sean M. Carroll; Simeon Hellerman; Mark Trodden

2000-07-27T23:59:59.000Z

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Method of controlling the side wall thickness of a turbine nozzle segment for improved cooling  

DOE Patents [OSTI]

A gas turbine nozzle segment has outer and inner bands and a vane extending therebetween. Each band has a side wall, a cover and an impingement plate between the cover and nozzle wall defining two cavities on opposite sides of the impingement plate. Cooling steam is supplied to one cavity for flow through apertures of the impingement plate to cool the nozzle wall. The side wall of the band has an inturned flange defining with the nozzle wall an undercut region. The outer surface of the side wall is provided with a step prior to welding the cover to the side wall. A thermal barrier coating is applied in the step and, after the cover is welded to the side wall, the side wall is finally machined to a controlled thickness removing all, some or none of the coating.

Burdgick, Steven Sebastian (Schenectady, NY)

2002-01-01T23:59:59.000Z

402

Analyses using Cell Wall Glycan-directed Monoclonal Antibodies Reveal Xylan-degradation by Two Microbial Glycosyl Hydrolases in Cell Walls from Poplar and Switchgrass Biomass  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

ISSN:2155-6199 ISSN:2155-6199 The International Open Access Journal of Bioremediation & Biodegradation Special Issue Title: Biofuels & their applications Handling Editor(s) Kirill I Kostyanovskiy Texas Agri Life Research & Extension Center, USA T his article was originally published in a journal by OMICS Publishing Group, and the attached copy is provided by OMICS Publishing Group for the author's benefit and for the benefit of the author's institution, for commercial/research/educational use including without limitation use in instruction at your institution, sending it to specific colleagues that you know, and providing a copy to your institution's administrator. All other uses, reproduction and distribution, including without limitation commercial reprints, selling or licensing copies or access,

403

General formulation of the resistive wall mode coupling equations  

SciTech Connect (OSTI)

A theoretical framework to describe the magnetic coupling of the toroidal plasma with the resistive wall and other sources of the field asymmetry is formulated. This is done for general toroidal geometry without restrictions on the plasma, while the wall is considered as a thin shell. Mathematically, the approach here exploits the Chance concept [M. S. Chance, Phys. Plasmas 4, 2161 (1997)], but with an essential difference: each source of the magnetic perturbation b (plasma, wall, external currents) is treated separately with account of their differences in space and nature. This allows much simpler formulation of the problem than was known before. The final equation couples the normal component of {partial_derivative}b/{partial_derivative}t at the wall to the perturbation at the plasma surface. Step by step reduction of this first-principle equation is performed with demonstration of its main features, starting from the known problem of singularities. This also includes the reduction to axially symmetric geometry, large-aspect-ratio, and the cylindrical limits. In the latter case, the known 'cylindrical' equation is reproduced, but now from the full 'toroidal' equations.

Pustovitov, V. D. [Nuclear Fusion Institute, Russian Research Centre 'Kurchatov Institute', Kurchatov Sq., 1, Moscow, 123182 (Russian Federation)

2008-07-15T23:59:59.000Z

404

Transpiring wall supercritical water oxidation reactor salt deposition studies  

SciTech Connect (OSTI)

Sandia National Laboratories has teamed with Foster Wheeler Development Corp. and GenCorp, Aerojet to develop and evaluate a new supercritical water oxidation reactor design using a transpiring wall liner. In the design, pure water is injected through small pores in the liner wall to form a protective boundary layer that inhibits salt deposition and corrosion, effects that interfere with system performance. The concept was tested at Sandia on a laboratory-scale transpiring wall reactor that is a 1/4 scale model of a prototype plant being designed for the Army to destroy colored smoke and dye at Pine Bluff Arsenal in Arkansas. During the tests, a single-phase pressurized solution of sodium sulfate (Na{sub 2}SO{sub 4}) was heated to supercritical conditions, causing the salt to precipitate out as a fine solid. On-line diagnostics and post-test observation allowed us to characterize reactor performance at different flow and temperature conditions. Tests with and without the protective boundary layer demonstrated that wall transpiration provides significant protection against salt deposition. Confirmation tests were run with one of the dyes that will be processed in the Pine Bluff facility. The experimental techniques, results, and conclusions are discussed.

Haroldsen, B.L.; Mills, B.E.; Ariizumi, D.Y.; Brown, B.G. [and others

1996-09-01T23:59:59.000Z

405

Unified first wall-blanket structure for plasma device applications  

DOE Patents [OSTI]

A plasma device for use in controlling nuclear reactions within the plasma including a first wall and blanket formed in a one-piece structure composed of a solid solution containing copper and lithium and melting above about 500.degree. C.

Gruen, Dieter M. (Downers Grove, IL)

1987-01-01T23:59:59.000Z

406

Instrument for measurement of vacuum in sealed thin wall packets  

DOE Patents [OSTI]

An instrument is described for the measurement of vacuum within sealed packets, the packets having a wall sufficiently thin that it can be deformed by the application of an external vacuum to small area thereof. The instrument has a detector head for placement against the deformable wall of the packet to apply the vacuum in a controlled manner to accomplish a limited deformation or lift of the wall, with this deformation or lift monitored by the application of light as via a bifurcated light pipe. Retro-reflected light through the light pipe is monitored with a photo detector. An abrupt change (e.g., a decrease) of retro-reflected light signals the wall movement such that the value of the vacuum applied through the head to achieve this initiation of movement is equal to the vacuum within the packet. In a preferred embodiment a vacuum reference plate is placed beneath the packet to ensure that no deformation occurs on the reverse surface of the packet. A packet production line model is also described. 3 figures.

Kollie, T.G.; Thacker, L.H.; Fine, H.A.

1993-10-05T23:59:59.000Z

407

CP-Violating Profile of the Electroweak Bubble Wall  

Science Journals Connector (OSTI)

......November 1995 research-article Articles CP-Violating Profile of the Electroweak Bubble...electroweak baryogenesis, the profile of the CP violating bubble wall, created at the first-order...solutions. Two of them smoothly connect the CP-violating broken phase and the symmetric......

Koichi Funakubo; Akira Kakuto; Shoichiro Otsuki; Kazunori Takenaga; Fumihiko Toyoda

1995-11-01T23:59:59.000Z

408

STEEL PLATE SHEAR WALL BUILDINGS: DESIGN REQUIREMENTS AND RESEARCH  

E-Print Network [OSTI]

STEEL PLATE SHEAR WALL BUILDINGS: DESIGN REQUIREMENTS AND RESEARCH Michel Bruneau, P.E. 1 Dr. Bruneau is conducting research on the seismic evaluation and retrofit of existing steel bridges, steel of this research, and has co- authored the book "Ductile Design of Steel Structures" published in 1997 by Mc

Bruneau, Michel

409

Gravitational collapse and thermalization in the hard wall model  

E-Print Network [OSTI]

We study a simple example of holographic thermalization in a confining field theory: the homogeneous injection of energy in the hard wall model. Working in an amplitude expansion, we find black brane formation for sufficiently fast energy injection and a scattering wave solution for sufficiently slow injection. We comment on our expectations for more sophisticated holographic QCD models.

Ben Craps; Elias Kiritsis; Christopher Rosen; Anastasios Taliotis; Joris Vanhoof; Hongbao Zhang

2014-03-03T23:59:59.000Z

410

Electrochemical and Raman measurements on single-walled carbon nanotubes  

E-Print Network [OSTI]

Electrochemical and Raman measurements on single-walled carbon nanotubes M. Stoll a,*, P performed on a carbon nanotube mat as a working electrode using different salt solutions. The gravimetric capacitance of the nanotube material was estimated and its effective surface area was de- termined in a purely

Nabben, Reinhard

411

THE ELECTRONIC PROPERTIES OF MULTI-WALLED CARBON NANOTUBES  

E-Print Network [OSTI]

THE ELECTRONIC PROPERTIES OF MULTI-WALLED CARBON NANOTUBES A Thesis Submitted to the Faculty I #12;rst started. I also thank Michael Buss for his insight and for making my #12;rst nanotube family for the many yawns and blank stares at the mention of the word nanotube. At least they listened

412

Energy-momentum balance in particle - domain wall perforating collision  

E-Print Network [OSTI]

We investigate the energy-momentum balance in the perforating collision of a point particle with an infinitely thin planar domain wall within the linearized gravity in arbitrary dimensions. Since the metric of the wall increases with distance, the wall and the particle are never free, and their energy-momentum balance involves not only the instantaneous kinetic momenta, but also the non-local contribution of gravitational stresses. However, careful analysis shows that the stresses can be unambiguously divided between the colliding objects leading to definition of the gravitationally dressed momenta. These take into account for gravity in the same way as the potential energy does in the non-relativistic theory, but our treatment is fully relativistic. Another unusual feature of our problem is the non-vanishing flux of the total energy-momentum tensor through the lateral surface of the world tube. In this case the zero divergence of the energy-momentum tensor does not imply conservation of the total momentum defined as the integral over the space-like section of the tube. But one can still define the conservation low infinitesimally, passing to time derivatives of the momenta. Using this definition we establish the momentum balance in terms of the dressed particle and wall momenta.

D. V. Gal'tsov; E. Yu. Melkumova; P. A. Spiirin

2014-11-01T23:59:59.000Z

413

Flame/Wall interactions : laminar study of unburnt HC formation  

E-Print Network [OSTI]

for an important part to the sources of hydrocarbon (HC) emission in a combustion chamber. The aim of this work in gasoline engine. A skeletal mechanism (29 species and 48 reactions) mimicking iso-octane combustion is used, wall heat flux, quench distances as well as HC families are investigated by varying parameters like

Paris-Sud XI, Université de

414

Experimental cosiderations regarding brick masonry structural walls consolidating  

Science Journals Connector (OSTI)

This paper aims at giving a succinct presentation of some aspects regarding the advantages of the brick masonry walls, which makes their consolidation necessary and realistic in case of damage. Secondly, various solutions are presented for strengthening, ... Keywords: consolidation, ferrocement, micro-concrete, structure measurement

Gavrila Muntean; Radu Muntean; Traian Onet

2009-05-01T23:59:59.000Z

415

Turbulence Structure and Wall Signature in Hypersonic Turbulent Boundary Layer  

E-Print Network [OSTI]

Turbulence Structure and Wall Signature in Hypersonic Turbulent Boundary Layer Yin-Chiu Kan , Clara and hypersonic turbulent boundary layer datasets from direct numerical simulation (DNS). Contour plots and Marusic5 and Mathis, Hutchins and Marusic16 ). In contrast to supersonic and hypersonic flow regimes

Martín, Pino

416

Turbulence Structure and Wall Signature in Hypersonic Boundary Layer  

E-Print Network [OSTI]

Turbulence Structure and Wall Signature in Hypersonic Boundary Layer Yin-Chiu Kan , Beekman Izaak and low- speed features, found in subsonic experiments, are present in our supersonic and hypersonic and hypersonic regimes due to the lack of detailed flow field data, and the studies have been mostly restricted

Martín, Pino

417

Geckobot and Waalbot: Small-Scale Wall Climbing Ozgur Unver  

E-Print Network [OSTI]

surfaces smooth metal or painted structures. This paper proposes two semi-autonomous small-scale robotGeckobot and Waalbot: Small-Scale Wall Climbing Robots Ozgur Unver oUnver@andrew.cmu.edu Michael P robots able to navigate on smooth vertical surfaces which use adhesive materials for attachment. Geckobot

Sitti, Metin

418

Instrument for measurement of vacuum in sealed thin wall packets  

DOE Patents [OSTI]

An instrument for the measurement of vacuum within sealed packets 12, the packets 12 having a wall 14 that it can be deformed by the application of an external dynamic vacuum to an area thereof. The instrument has a detector head 18 for placement against the deformable wall 14 of the packet to apply the vacuum in a controlled manner to accomplish a limited deformation or lift of the wall 14, with this deformation or lift monitored by the application of light as via a bifurcated light pipe 20. Retro-reflected light through the light pipe is monitored with a photo detector 26. A change (e.g., a decrease) of retro-reflected light signals the wall movement such that the value of the dynamic vacuum applied through the head be to achieve this initiation of movement is equal to the vacuum within the packet 12. In a preferred embodiment a vacuum plate 44 is placed beneath the packet 12 to ensure that no deformation occurs on the reverse surface 16 of the packet. A vacuum can be applied to a recess in this vacuum plate, the value of which can be used to calibrate the vacuum transducer in the detector head.

Kollie, Thomas G. (Oak Ridge, TN); Thacker, Louis H. (Knoxville, TN); Fine, H. Alan (Lexington, KY)

1995-01-01T23:59:59.000Z

419

Instrument for measurement of vacuum in sealed thin wall packets  

DOE Patents [OSTI]

An instrument is disclosed for the measurement of vacuum within sealed packets, the packets having a wall that it can be deformed by the application of an external dynamic vacuum to an area thereof. The instrument has a detector head for placement against the deformable wall of the packet to apply the vacuum in a controlled manner to accomplish a limited deformation or lift of the wall with this deformation or lift monitored by the application of light as via a bifurcated light pipe. Retro-reflected light through the light pipe is monitored with a photo detector. A change (e.g., a decrease) of retro-reflected light signals the wall movement such that the value of the dynamic vacuum applied through the head be to achieve this initiation of movement is equal to the vacuum within the packet. In a preferred embodiment a vacuum plate is placed beneath the packet to ensure that no deformation occurs on the reverse surface of the packet. A vacuum can be applied to a recess in this vacuum plate, the value of which can be used to calibrate the vacuum transducer in the detector head. 4 figs.

Kollie, T.G.; Thacker, L.H.; Fine, H.A.

1995-04-18T23:59:59.000Z

420

Instrument for measurement of vacuum in sealed thin wall packets  

DOE Patents [OSTI]

An instrument for the measurement of vacuum within sealed packets 12, the packets 12 having a wall 14 sufficiently thin that it can be deformed by the application of an external vacuum to small area thereof. The instrument has a detector head 18 for placement against the deformable wall 14 of the packet to apply the vacuum in a controlled manner to accomplish a limited deformation or lift of the wall 14, with this deformation or lift monitored by the application of light as via a bifurcated light pipe 20. Retro-reflected light through the light pipe is monitored with a photo detector 26. An abrupt change (e.g., a decrease) of retro-reflected light signals the wall movement such that the value of the vacuum applied through the head 18 to achieve this initiation of movement is equal to the vacuum Within the packet 12. In a preferred embodiment a vacuum reference plate 44 is placed beneath the packet 12 to ensure that no deformation occurs on the reverse surface 16 of the packet. A packet production line model is also described.

Kollie, Thomas G. (117 Oklahoma Ave., Oak Ridge, TN 37830); Thacker, Louis H. (3727 Frostwood Rd., Knoxville, TN 37921); Fine, H. Alan (949 Wishbone Cir., Lexington, KY 40502)

1993-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Radial elasticity of multi-walled boron nitride nanotubes  

SciTech Connect (OSTI)

We investigated the radial mechanical properties of multi-walled boron nitride nanotubes (MW-BNNTs) using atomic force microscopy. The employed MW-BNNTs were synthesized using pressurized vapor/condenser (PVC) methods and were dispersed in aqueous solution using ultrasonication methods with the aid of ionic surfactants. Our nanomechanical measurements reveal the elastic deformational behaviors of individual BNNTs with two to four tube walls in their transverse directions. Their effective radial elastic moduli were obtained through interpreting their measured radial deformation profiles using Hertzian contact mechanics models. Our results capture the dependences of the effective radial moduli of MW-BNNTs on both the tube outer diameter and the number of tube layers. The effective radial moduli of double-walled BNNTs are found to be several-fold higher than those of single-walled BNNTs within the same diameter range. Our work contributes directly to a complete understanding of the fundamental structural and mechanical properties of BNNTs and the pursuits of their novel structural and electronics applications.

Michael W. Smith, Cheol Park, Meng Zheng, Changhong Ke ,In-Tae Bae, Kevin Jordan

2012-02-01T23:59:59.000Z

422

Interactive Weather Simulation and Visualization on a Display Wall  

E-Print Network [OSTI]

.hoai.ha,john.markus.bjorndalen,otto.anshus}@uit.no, {tormsh,daniels}@cs.uit.no Abstract. Numerical Weather Prediction models (NWP) used for op- erational Weather Model, WRF, Tiled Display Walls, Live Data Sets, On-Demand Computation. 1 Introduction Numerical Weather Prediction models for use in weather forecasting centers are often computed for a fixed static

Ha, Phuong H.

423

Violating privacy through walls by passive monitoring of radio windows  

Science Journals Connector (OSTI)

We investigate the ability of an attacker to passively use an otherwise secure wireless network to detect moving people through walls. We call this attack on privacy of people a "monitoring radio windows" (MRW) attack. We design and implement the MRW ... Keywords: line crossing, radio window, signal strength, wifi

Arijit Banerjee; Dustin Maas; Maurizio Bocca; Neal Patwari; Sneha Kasera

2014-07-01T23:59:59.000Z

424

Dynamics of biased domain walls and the devaluation mechanism  

SciTech Connect (OSTI)

We study the evolution of biased domain walls in the early universe. We explicitly discuss the roles played by the surface tension and volume pressure in the evolution of the walls, and quantify their effects by looking at the collapse of spherical wall solutions. We then apply our results to a particular mechanism, known as the devaluation scenario, in which the dynamics of biased domain walls was suggested as a possible solution to the cosmological constant problem. Our results indicate that devaluation will, in general, lead to values of the cosmological constant that differ by several orders of magnitude from the observationally inferred value, {rho}{sub vac}{sup 1/4}{approx}10{sup -3} eV. We also argue that the reasons behind this are not specific to a particular realization, and are expected to persist in any scenario of this kind, except if a low-energy cutoff on the spectra of vacuum energy densities, of the order of the critical density at the present time, is postulated. This implies that any such scenario will require a fine-tuning similar to the usual one.

Avelino, P. P.; Sousa, L. [Centro de Fisica do Porto, Rua do Campo Alegre 687, 4169-007 Porto (Portugal); Departamento de Fisica da Faculdade de Ciencias da Universidade do Porto, Rua do Campo Alegre 687, 4169-007 Porto (Portugal); Martins, C. J. A. P. [Centro de Astrofisica, Universidade do Porto, Rua das Estrelas s/n, 4150-762 Porto (Portugal); DAMTP, University of Cambridge, Wilberforce Road, Cambridge CB3 0WA (United Kingdom)

2008-08-15T23:59:59.000Z

425

Models of cell differentiation in conidial fungi.  

Science Journals Connector (OSTI)

...Secondary metabolism and its relation- ship to growth and development, p. 33-58...and animals, part B. Pathogenicity and detection. Marcel Dekker, New York. 111. Cox...Edwards, M., and K. E. Fritz. 1985. Detection of an antigenic cell wall layer in Histoplasma...

G T Cole

1986-06-01T23:59:59.000Z

426

Modeling of Spherical Torus Plasmas for Liquid Lithium Wall Experiments  

SciTech Connect (OSTI)

Liquid metal walls have the potential to solve first-wall problems for fusion reactors, such as heat load and erosion of dry walls, neutron damage and activation, and tritium inventory and breeding. In the near term, such walls can serve as the basis for schemes to stabilize magnetohydrodynamic (MHD) modes. Furthermore, the low recycling characteristics of lithium walls can be used for particle control. Liquid lithium experiments have already begun in the Current Drive eXperiment-Upgrade (CDX-U). Plasmas limited with a toroidally localized limiter have been investigated, and experiments with a fully toroidal lithium limiter are in progress. A liquid surface module (LSM) has been proposed for the National Spherical Torus Experiment (NSTX). In this larger ST, plasma currents are in excess of 1 MA and a typical discharge radius is about 68 cm. The primary motivation for the LSM is particle control, and options for mounting it on the horizontal midplane or in the divertor region are under consideration. A key consideration is the magnitude of the eddy currents at the location of a liquid lithium surface. During plasma start up and disruptions, the force due to such currents and the magnetic field can force a conducting liquid off of the surface behind it. The Tokamak Simulation Code (TSC) has been used to estimate the magnitude of this effect. This program is a two dimensional, time dependent, free boundary simulation code that solves the MHD equations for an axisymmetric toroidal plasma. From calculations that match actual ST equilibria, the eddy current densities can be determined at the locations of the liquid lithium. Initial results have shown that the effects could be significant, and ways of explicitly treating toroidally local structures are under investigation.

R. Kaita; S. Jardin; B. Jones; C. Kessel; R. Majeski; J. Spaleta; R. Woolley; L. Zakharo; B. Nelson; M. Ulrickson

2002-01-29T23:59:59.000Z

427

Electro-optical memory of a nematic liquid crystal doped by multi-walled carbon nanotubes  

E-Print Network [OSTI]

A pronounced irreversible electro-optical response (memory effect) has been recently observed for nematic liquid crystal (LC) EBBA doped by multi-walled carbon nanotubes (MWCNTs) near the percolation threshold of the MWCNTs (0.02-0.05 wt. %). It is caused by irreversible homeotropic-to-planar reorientation of LC in an electric field. This feature is explained by electro-hydrodynamically stimulated dispergation of MWCNTs in LC and by the formation of a percolation MWCNT network which acts as a spatially distributed surface stabilizing the planar state of the LC. This mechanism is confirmed by the absence of memory in the EBBA/MWCNT composites, whose original structure is fixed by a polymer. The observed effect suggests new operation modes for the memory type and bistable LC devices, as well as a method for \\textit{in situ} dispergation of carbon nanotubes in LC cells.

L. Dolgov; O. Yaroshchuk; S. Tomylko; N. Lebovka

2012-10-04T23:59:59.000Z

428

Effect of mechanical inoculation (air-gun technique) for selecting levels of maize dwarf mosaic virus strain a resistance in sorghum  

E-Print Network [OSTI]

of sorghum (S. bicolor) with MDMV has led to the release of tolerant inbreds and hybrids. When a spray gun is used for inoculation, differences in pressure during inoculation could result in a selectively affected disease rating among cultivars. Toler...EFFECT OF MECHANICAL INOCULATION (AIR-GUN TECHNIQUE) FOR SELECTING LEVELS OF MAIZE DWARF MOSAIC VIRUS STRAIN A RESISTANCE IN SORGHUM A Thesis by GEORGE SIMBA MAHUKU Submitted to the Office of Graduate Studies of Texas ASM University...

Mahuku, George Simba

2012-06-07T23:59:59.000Z

429

Building America Top Innovations Hall of Fame Profile … High-R Walls  

Broader source: Energy.gov (indexed) [DOE]

require walls that cost-effectively require walls that cost-effectively control both thermal and moisture flow. Building America research results have provided proven high-R wall options for builders across the country. Building America's research teams have conducted modeling analysis as well as field studies of several different wall assemblies to identify effective "whole- wall" R-values that take into account thermal bridging of framing members. Researchers have also investigated critical moisture potential and durability issues since high-R walls have much less drying potential. Between 2008 and 2012, CARB conducted several evaluations of wall types (see for example Aldrich et al. 2010). In one study, CARB performed THERM and WUFI analysis on three typical cold climate wall assemblies modeled at ASHRAE

430

Numerical Simulation of Wind Tunnel Wall Effects on the Transonic Flow around an Airfoil Model  

Science Journals Connector (OSTI)

For wind tunnel measurements in closed-wall test sections, possible interference effects of the wind tunnel walls play an important role. Three-dimensional TAU simulations were performed for the transonic flow ar...

K. Richter; H. Rosemann

2013-01-01T23:59:59.000Z

431

Apparatus for impingement cooling a side wall adjacent an undercut region of a turbine nozzle segment  

DOE Patents [OSTI]

A gas turbine nozzle segment has outer and inner bands and vanes therebetween. Each band includes a side wall, a cover and an impingement plate between the cover and nozzle wall defining two cavities on opposite sides of the impingement plate. Cooling steam is supplied to one cavity for flow through apertures of the impingement plate to cool the nozzle wall. The side wall of the band and inturned flange define with the nozzle wall an undercut region. Slots are formed through the inturned flange along the nozzle side wall. A plate having through-apertures extending between opposite edges thereof is disposed in each slot, the slots and plates being angled such that the cooling medium exiting the apertures in the second cavity lie close to the side wall for focusing and targeting cooling medium onto the side wall.

Burdgick, Steven Sebastian (Schenectady, NY)

2002-01-01T23:59:59.000Z

432

Synthesis and Electronic Transport in Known Chirality Single Wall Carbon Nanotubes  

E-Print Network [OSTI]

Synthesis and Electronic Transport in Known Chirality Single Wall Carbon Nanotubes Bhupesh Chandra;ABSTRACT Synthesis and Electronic Transport in Known Chirality Single Wall Carbon Nanotubes Bhupesh Chandra Carbon nanotubes are intriguing new materials with extraordinary electrical properties originating from

Hone, James

433

Ultrafast Mid-Infrared Intra-Excitonic Response of Individualized Single-Walled Carbon Nanotubes  

E-Print Network [OSTI]

Z. Ma et al. , in: Carbon Nanotubes, edited by A. Jorio, G.Single-Walled Carbon Nanotubes Jigang Wang, 1, 2 Matt W.7,5) single-walled carbon nanotubes. Strong photoinduced

Wang, Jigang

2011-01-01T23:59:59.000Z

434

Reduction of Metal Oxides by Microwave Heating of Multi-walled...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Reduction of Metal Oxides by Microwave Heating of Multi-walled Carbon Nanotubes Microwave heating of a metal oxide in the presence of multi-walled carbon nanotubes may result in...

435

Phenomenological theory of a single domain wall in uniaxial trigonal ferroelectrics: Lithium niobate and lithium tantalate  

E-Print Network [OSTI]

Phenomenological theory of a single domain wall in uniaxial trigonal ferroelectrics: Lithium niobate and lithium tantalate David A. Scrymgeour and Venkatraman Gopalan Department of Materials Science, lithium niobate and lithium tantalate. The contributions to the domain- wall energy from polarization

Gopalan, Venkatraman

436

Growth Conditions of Double-Walled Carbon Nanotubes in Arc Discharge  

Science Journals Connector (OSTI)

Growth Conditions of Double-Walled Carbon Nanotubes in Arc Discharge ... Preparation conditions for large-scale synthesis of double-walled carbon nanotubes (DWCNTs) by using electric arc discharge were examined. ...

Yahachi Saito; Takanori Nakahira; Sashiro Uemura

2003-01-04T23:59:59.000Z

437

An analysis model for wind resistance performance of automated exterior wall painting robots in apartment buildings  

Science Journals Connector (OSTI)

The painting of exterior walls on apartment buildings involves ... to fatalities. Although the market for domestic painting is expanding, painters tend to avoid the risk of painting exterior walls. Accordingly, m...

Ji-Won Cho; Jeong-Ho Lee; Young-Suk Kim…

2014-05-01T23:59:59.000Z

438

Uniform Directional Alignment of Single-Walled Carbon Nanotubes in Viscous Polymer Flow  

Science Journals Connector (OSTI)

In this work, we probed the effects of shear flow on the alignment of dispersed single-walled carbon nanotubes in polymer solutions. Two different systems were compared:? Single-walled carbon nanotubes dispersed using an anionic surfactant and single-...

Erin Camponeschi; Bill Florkowski; Richard Vance; Glenn Garrett; Hamid Garmestani; Rina Tannenbaum

2006-01-14T23:59:59.000Z

439

Phase-Change Frame Walls (PCFWs) for Peak Demand Reduction, Load Shifting, Energy Conservation and Comfort  

E-Print Network [OSTI]

) for lowering peak heat transfer rates across walls of residential and small commercial buildings. A PCFW is a typical wall in which phase change materials (PCMs) have been incorporated via macroencapsulation to enhance the energy storage capabilities...

Medina, M.; Stewart, R.

440

Solution of Air Conditioning Cooling Load Temperature for New Energy-Saving Walls  

E-Print Network [OSTI]

With the development of wall reforms, the production scale and engineering applications of energy savings are increasing daily. It is inevitable to aggressively extend production of new energy-saving walls. Based on the thermal instantaneous...

Wang, X.; Hong, J.; Deying, L.

2006-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Passive test-cell experiments during the winter of 1979-1980  

SciTech Connect (OSTI)

During the winter of 1979-80 the performance of a variety of passive solar heating configurations in 14 passive test cells were monitored. The cells included attached greenhouses, masonry and water walls with black-chrome absorber surfaces, night insulation, and phase-change thermal storage walls. The results of these side-by-side tests were used to make quantitative comparisons of the delivered performance of these configurations for the conditions under which they were tested.

Hyde, J.C.

1981-11-01T23:59:59.000Z

442

Modeling the Impact of Agricultural Terrace Walls on Spatial Patterns of Erosion and Landscape Evolution  

E-Print Network [OSTI]

Modeling the Impact of Agricultural Terrace Walls on Spatial Patterns of Erosion and Landscape Evolution Jennifer Glaubius Department of Geography University of Kansas Research Objectives 2 1. Implement terrace walls within a landscape evolution... model 2. Test the impact of human intervention with the terrace walls a. Interval between checking the wall for maintenance b. Time since abandonment of terraced land Model 3 Landscape evolution model from Chen et al. (2014); implemented in Python...

Glaubius, Jennifer

2014-11-19T23:59:59.000Z

443

Anticavitation protection of pressure outlets through regulation of velocities in wall layer of the flow  

Science Journals Connector (OSTI)

1. The tests showed that an installation forming a continuous low-velocity flow along a wall comprising a solid ...

P. R. Khlopenkov; G. A. Chepaikin

1976-08-01T23:59:59.000Z

444

Radiation Damage and Tritium Breeding Study in a Fusion Reactor Using a Liquid Wall of Various Thorium Molten Salts  

Science Journals Connector (OSTI)

A new magnetic fusion reactor design, called APEX uses a liquid wall between fusion plasma and solid first wall to reach ... replacement of the first wall structure during the reactor’s operation due to the radia...

Mustafa Übeyli

2007-12-01T23:59:59.000Z

445

Walled Lake, Michigan: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Walled Lake, Michigan: Energy Resources Walled Lake, Michigan: Energy Resources Jump to: navigation, search Equivalent URI DBpedia Coordinates 42.537811°, -83.4810481° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":42.537811,"lon":-83.4810481,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

446

Wall conditioning and power balance for spheromak plasmas in SSPX  

Science Journals Connector (OSTI)

We report here results from power balance measurements for ohmically heated plasmas in the sustained spheromak physics experiment. The plasma is formed inside a close-fitting tungsten-coated copper shell; wall conditioning by baking, glow discharge cleaning (GDC), Ti gettering, and helium shot conditioning produces clean plasmas (Zeff<2.5) and reduces impurity radiation to a small fraction of the input energy, except when the molybdenum divertor plate has been overheated. We find that most of the input energy is lost by conduction to the walls (the divertor plate and the inner electrode in the coaxial source region). Recently, carborane was added during GDC to boronize the plasma-facing surfaces, but little benefit was obtained.

D.N. Hill; R.D. Wood; R. Bulmer; H.S. McLean; D. Ryutov; B.W. Stallard; S. Woodruff

2003-01-01T23:59:59.000Z

447

Trombe Walls in Low-Energy Buildings: Practical Experiences; Preprint  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Trombe Walls in Low-Energy Trombe Walls in Low-Energy Buildings: Practical Experiences Preprint July 2004 * NREL/CP-550-36277 P. Torcellini and S. Pless To be presented at the World Renewable Energy Congress VIII and Expo Denver, Colorado August 29-September 3, 2004 National Renewable Energy Laboratory 1617 Cole Boulevard, Golden, Colorado 80401-3393 303-275-3000 * www.nrel.gov Operated for the U.S. Department of Energy Office of Energy Efficiency and Renewable Energy by Midwest Research Institute * Battelle Contract No. DE-AC36-99-GO10337 NOTICE The submitted manuscript has been offered by an employee of the Midwest Research Institute (MRI), a contractor of the US Government under Contract No. DE-AC36-99GO10337. Accordingly, the US Government and MRI retain a nonexclusive royalty-free license to publish or reproduce the published

448

Sustainable wall construction and exterior insulation retrofit technology process and structure  

DOE Patents [OSTI]

A low-cost process for exterior wall insulation retrofit, or new wall construction by stacking layers of fabric tube filled with insulating material against a wall and covering them with mesh and stucco provides a durable structure with good insulating value.

Vohra, Arun (Bethesda, MD)

2000-01-01T23:59:59.000Z

449

Heat Transfer in Buildings: Application to Solar Air Collector and Trombe Wall Design  

E-Print Network [OSTI]

11 Heat Transfer in Buildings: Application to Solar Air Collector and Trombe Wall Design H. Boyer focuses on the modeling of Trombe solar walls. In each case, detailed modeling of heat transfer allows with same thermal behaviour). For heat conduction in walls, it results from electrical analogy

Paris-Sud XI, Université de

450

Oxidative enzymatic response of white-rot fungi to single-walled carbon nanotubes  

E-Print Network [OSTI]

Oxidative enzymatic response of white-rot fungi to single-walled carbon nanotubes Timothy D. Berry-walled carbon nanotubes (SWCNT) are becoming increasingly prevalent in manufacturing, there is little knowledge. Introduction Single-walled carbon nanotubes (SWCNTs), formed from single- atom thick sheets of carbon wound

Blanchette, Robert A.

451

Carbon nanotubes Growth of Single-Walled Carbon Nanotubes from Sharp  

E-Print Network [OSTI]

Carbon nanotubes Growth of Single-Walled Carbon Nanotubes from Sharp Metal Tips Julio A. Rodri Banhart* The nucleation and growth of single-walled carbon nanotubes is observed in situ in a transmission a region of high surface curvature, spontaneous nucleation and growth of single-walled carbon nanotubes

Nordlund, Kai

452

Propagating and reflecting of spin wave in permalloy nanostrip with 360° domain wall  

SciTech Connect (OSTI)

By micromagnetic simulation, we investigated the interaction between propagating spin wave (or magnonic) and a 360° domain wall in a nanostrip. It is found that propagating spin wave can drive a 360° domain wall motion, and the velocity and direction are closely related to the transmission coefficient of the spin wave of the domain wall. When the spin wave passes through the domain wall completely, the 360° domain wall moves toward the spin wave source. When the spin wave is reflected by the domain wall, the 360° domain wall moves along the spin wave propagation direction. Moreover, when the frequency of the spin wave is coincident with that of the 360° domain wall normal mode, the 360° domain wall velocity will be resonantly enhanced no matter which direction the 360 DW moves along. On the other hand, when the spin wave is reflected from the moving 360° domain wall, we observed the Doppler effect clearly. After passing through a 360° domain wall, the phase of the spin wave is changed, and the phase shift is related to the frequency. Nevertheless, phase shift could be manipulated by the number of 360° domain walls that spin wave passing through.

Zhang, Senfu; Mu, Congpu; Zhu, Qiyuan; Zheng, Qi; Liu, Xianyin; Wang, Jianbo; Liu, Qingfang, E-mail: liuqf@lzu.edu.cn [Key Laboratory for Magnetism and Magnetic Materials of Ministry of Education, Lanzhou University, Lanzhou 730000 (China)

2014-01-07T23:59:59.000Z

453

Supporting Information to: Single-Molecule Electrocatalysis by Single-Walled Carbon Nanotubes  

E-Print Network [OSTI]

S1 Supporting Information to: Single-Molecule Electrocatalysis by Single-Walled Carbon Nanotubes. Experimental Methods I.1. Purification of SWNTs. The single-walled carbon nanotubes were purchased from Carbon Nanotechnologies Incorporated (Purified HiPCO single-walled carbon nanotubes). These SWNTs have an average diameter

Chen, Peng

454

ccsd-00008772,version1-15Sep2005 Nucleation and growth of single wall carbon nanotubes  

E-Print Network [OSTI]

ccsd-00008772,version1-15Sep2005 Nucleation and growth of single wall carbon nanotubes F. Beuneu and growth of single wall carbon nanotubes from a carbon-saturated catalytic particle surrounded by a single. INTRODUCTION Since their discovery nearly fifteen years ago, sin- gle wall carbon nanotubes (SWNT) have

Boyer, Edmond

455

Protective interior wall and attaching means for a fusion reactor vacuum vessel  

DOE Patents [OSTI]

The wall basically consists of an array of small rectangular plates attached to the existing walls with threaded fasteners. The protective wall effectively conceals and protects all mounting hardware beneath the plate array, while providing a substantial surface area that will absorb plasma energy.

Phelps, R.D.; Upham, G.A.; Anderson, P.M.

1985-03-01T23:59:59.000Z

456

Single-Walled Carbon Nanotubes of Controlled Diameter and Bundle Size and Their Field Emission Properties  

E-Print Network [OSTI]

Single-Walled Carbon Nanotubes of Controlled Diameter and Bundle Size and Their Field Emission: June 8, 2005 Field emission studies were conducted on as-produced CoMoCAT single-walled carbon nanotube electron emitter. By adjusting the catalytic synthesis conditions, single-walled carbon nanotubes (SWNT

Resasco, Daniel

457

Field Emission Properties of Single-Walled Carbon Nanotubes with a Variety of Emitter-Morphologies  

E-Print Network [OSTI]

1 Field Emission Properties of Single-Walled Carbon Nanotubes with a Variety of Emitter@chemsys.t.u-tokyo.ac.jp Field emission properties of single-walled carbon nanotubes (SWNTs), which have been prepared through: single-walled carbon nanotube, field emission, alcohol catalytic chemical vapor deposition, ethanol

Maruyama, Shigeo

458

Symmetry Properties of Single-Walled BC2N Nanotubes  

SciTech Connect (OSTI)

The symmetry properties of the single-walled BC2N nanotubes were investigated. All the BC2N nanotubes possess nonsymmorphic line groups. In contrast with the carbon and boron nitride nanotubes, armchair and zigzag BC2N nanotubes belong to different line groups, depending on the index n (even or odd) and the vector chosen. The number of Raman- active phonon modes is almost twice that of the infrared-active phonon modes for all kinds of BC2N nanotubes.

Pan, Hui [ORNL; Feng, Yuan Ping [National University of Singapore; Lin, Jainyi [Institute of Chemical and Engineering, Singapore

2009-06-01T23:59:59.000Z

459

Vortex energy and 360 Neel walls in thinfilm  

E-Print Network [OSTI]

.Ignat@math.u-psud.fr) Courant Institute, New York University, New York, NY 10012, USA (e-mail: knuepfer@cims.nyu.edu) 1 #12Vortex energy and 360 ­N´eel walls in thin­film micromagnetics Radu Ignat , Hans Kn¨upfer October-section. The model is based on the following energy functional: E2d (m) = Z B2 |m|2 dx + | ln | 2 Z R2 ||-1

460

Domain wall network evolution in (N+1)-dimensional FRW universes  

SciTech Connect (OSTI)

We develop a velocity-dependent one-scale model for the evolution of domain wall networks in flat expanding or collapsing homogeneous and isotropic universes with an arbitrary number of spatial dimensions, finding the corresponding scaling laws in frictionless and friction dominated regimes. We also determine the allowed range of values of the curvature parameter and the expansion exponent for which a linear scaling solution is possible in the frictionless regime.

Avelino, P. P. [Centro de Fisica do Porto, Rua do Campo Alegre 687, 4169-007 Porto (Portugal); Departamento de Fisica da Faculdade de Ciencias da Universidade do Porto, Rua do Campo Alegre 687, 4169-007 Porto (Portugal); Departamento de Fisica, Universidade Federal da Paraiba 58051-970 Joao Pessoa, Paraiba (Brazil); Sousa, L. [Centro de Fisica do Porto, Rua do Campo Alegre 687, 4169-007 Porto (Portugal); Departamento de Fisica da Faculdade de Ciencias da Universidade do Porto, Rua do Campo Alegre 687, 4169-007 Porto (Portugal)

2011-02-15T23:59:59.000Z

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Binding of Nucleobases with Single-Walled Carbon Nanotubes  

E-Print Network [OSTI]

We have calculated the binding energy of various nucleobases (guanine (G), adenine (A), thymine (T) and cytosine (C)) with (5,5) single-walled carbon nanotubes (SWNTs) using ab-initio Hartre-Fock method (HF) together with force field calculations. The gas phase binding energies follow the sequence G $>$ A $>$ T $>$ C. We show that main contribution to binding energy comes from van-der Wall (vdW) interaction between nanotube and nucleobases. We compare these results with the interaction of nucleobases with graphene. We show that the binding energy of bases with SWNTs is much lower than the graphene but the sequence remains same. When we include the effect of solvation energy (Poisson-Boltzman (PB) solver at HF level), the binding energy follow the sequence G $>$ T $>$ A $>$ C $>$, which explains the experiment\\cite{zheng} that oligonucleotides made of thymine bases are more effective in dispersing the SWNT in aqueous solution as compared to poly (A) and poly (C). We also demonstrate experimentally that there is differential binding affinity of nucleobases with the single-walled carbon nanotubes (SWNTs) by directly measuring the binding strength using isothermal titration (micro) calorimetry. The binding sequence of the nucleobases varies as thymine (T) $>$ adenine (A) $>$ cytosine (C), in agreement with our calculation.

Anindya Das; A. K. Sood; Prabal K. Maiti; Mili Das; R. Varadarajan; C. N. R. Rao

2007-09-19T23:59:59.000Z

462

Energy-momentum balance in particle - domain wall perforating collision  

E-Print Network [OSTI]

We investigate the energy-momentum balance in the perforating collision of a point particle with an infinitely thin planar domain wall within the linearized gravity in arbitrary dimensions. Since the metric of the wall increases with distance, the wall and the particle are never free, and their energy-momentum balance involves not only the instantaneous kinetic momenta, but also the non-local contribution of gravitational stresses. However, careful analysis shows that the stresses can be unambiguously divided between the colliding objects leading to definition of the gravitationally dressed momenta. These take into account for gravity in the same way as the potential energy does in the non-relativistic theory, but our treatment is fully relativistic. Another unusual feature of our problem is the non-vanishing flux of the total energy-momentum tensor through the lateral surface of the world tube. In this case the zero divergence of the energy-momentum tensor does not imply conservation of the total momentum de...

Gal'tsov, D V; Spiirin, P A

2014-01-01T23:59:59.000Z

463

Three-component borehole wall-locking seismic detector  

DOE Patents [OSTI]

A seismic detector for boreholes is described that has an accelerometer sensor block for sensing vibrations in geologic formations of the earth. The density of the seismic detector is approximately matched to the density of the formations in which the detector is utilized. A simple compass is used to orient the seismic detector. A large surface area shoe having a radius approximately equal to the radius of the borehole in which the seismic detector is located may be pushed against the side of the borehole by actuating cylinders contained in the seismic detector. Hydraulic drive of the cylinders is provided external to the detector. By using the large surface area wall-locking shoe, force holding the seismic detector in place is distributed over a larger area of the borehole wall thereby eliminating concentrated stresses. Borehole wall-locking forces up to ten times the weight of the seismic detector can be applied thereby ensuring maximum detection frequency response up to 2,000 hertz using accelerometer sensors in a triaxial array within the seismic detector.

Owen, Thomas E. (Helotes, TX)

1994-01-01T23:59:59.000Z

464

Mitochondrial Aldehyde Dehydrogenase Activity Is Required for Male Fertility in Maize  

Science Journals Connector (OSTI)

...without urea. The dialysis tubing containing...membrane by treatment with 0.2...LR White (Electron Microscopy Sciences...JA111(DE3) by electroporation. Two pMAP11...using a semidry electrophoretic transfer cell...washed with water and resuspended...Between sonication treatments, the cellular...

Feng Liu; Xiangqin Cui; Harry T. Horner; Henry Weiner; Patrick S. Schnable

465

Inactivation of a DNA Methylation Pathway in Maize Reproductive Organs Results in Apomixis-Like Phenotypes  

Science Journals Connector (OSTI)

...nucleotide groups. In Arabidopsis, where the process is best understood, at least three classes...DMT102 and DMT103 likely act on a common process in the ovule, consistent with their...Hieracium subgenus pilosella are closely interrelated developmental pathways. Plant Cell 15...

Marcelina Garcia-Aguilar; Caroline Michaud; Olivier Leblanc; Daniel Grimanelli

2010-10-29T23:59:59.000Z

466

Plasma–wall interaction in laser inertial fusion reactors: novel proposals for radiation tests of first wall materials  

Science Journals Connector (OSTI)

Dry-wall laser inertial fusion (LIF) chambers will have to withstand strong bursts of fast charged particles which will deposit tens of kJ m?2 and implant more than 1018 particles m?2 in a few microseconds at a repetition rate of some Hz. Large chamber dimensions and resistant plasma-facing materials must be combined to guarantee the chamber performance as long as possible under the expected threats: heating, fatigue, cracking, formation of defects, retention of light species, swelling and erosion. Current and novel radiation resistant materials for the first wall need to be validated under realistic conditions. However, at present there is a lack of facilities which can reproduce such ion environments.This contribution proposes the use of ultra-intense lasers and high-intense pulsed ion beams (HIPIB) to recreate the plasma conditions in LIF reactors. By target normal sheath acceleration, ultra-intense lasers can generate very short and energetic ion pulses with a spectral distribution similar to that of the inertial fusion ion bursts, suitable to validate fusion materials and to investigate the barely known propagation of those bursts through background plasmas/gases present in the reactor chamber. HIPIB technologies, initially developed for inertial fusion driver systems, provide huge intensity pulses which meet the irradiation conditions expected in the first wall of LIF chambers and thus can be used for the validation of materials too.

J Alvarez Ruiz; A Rivera; K Mima; D Garoz; R Gonzalez-Arrabal; N Gordillo; J Fuchs; K Tanaka; I Fernández; F Briones; J Perlado

2012-01-01T23:59:59.000Z

467

Thermal conductor for high-energy electrochemical cells  

DOE Patents [OSTI]

A thermal conductor for use with an electrochemical energy storage device is disclosed. The thermal conductor is attached to one or both of the anode and cathode contacts of an electrochemical cell. A resilient portion of the conductor varies in height or position to maintain contact between the conductor and an adjacent wall structure of a containment vessel in response to relative movement between the conductor and the wall structure. The thermal conductor conducts current into and out of the electrochemical cell and conducts thermal energy between the electrochemical cell and thermally conductive and electrically resistive material disposed between the conductor and the wall structure. The thermal conductor may be fabricated to include a resilient portion having one of a substantially C-shaped, double C-shaped, Z-shaped, V-shaped, O-shaped, S-shaped, or finger-shaped cross-section. An elastomeric spring element may be configured so as to be captured by the resilient conductor for purposes of enhancing the functionality of the thermal conductor. The spring element may include a protrusion that provides electrical insulation between the spring conductor and a spring conductor of an adjacently disposed electrochemical cell in the presence of relative movement between the cells and the wall structure. The thermal conductor may also be fabricated from a sheet of electrically conductive material and affixed to the contacts of a number of electrochemical cells.

Hoffman, Joseph A. (Minneapolis, MN); Domroese, Michael K. (South St. Paul, MN); Lindeman, David D. (Hudson, WI); Radewald, Vern E. (Austin, TX); Rouillard, Roger (Beloeil, CA); Trice, Jennifer L. (Eagan, MN)

2000-01-01T23:59:59.000Z

468

How are basement walls input in REScheck? | Building Energy Codes Program  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

basement walls input in REScheck? basement walls input in REScheck? After selecting a basement wall type, a basement wall illustration will appear with input boxes for the basement wall height, depth below grade, and depth of insulation. The illustration helps identify the dimensions being requested. You may enter basement wall dimensions directly into this illustration and select the OK button to have them transferred to the corresponding row in the table on the Envelope screen. If you prefer to enter the dimensions directly into the table on the Envelope screen, you can select Cancel to remove the illustration without entering dimensions. To view the basement wall illustration and inputs at a later time, click the right-mouse button anywhere on the basement row and select Edit Basement Inputs from the popup menu.

469

Apparatus and methods for impingement cooling of a side wall of a turbine nozzle segment  

DOE Patents [OSTI]

A gas turbine nozzle segment has outer and inner bands and a vane therebetween. Each band includes a nozzle wall, a side wall, a cover and an impingement plate between the cover and the nozzle wall defining two cavities on opposite sides of the impingement plate. Cooling steam is supplied to one cavity for flow through apertures of the impingement plate to cool the nozzle wall. The side wall of the band and inturned flange define with the nozzle wall an undercut region. The impingement plate has a turned flange welded to the inturned flange. A backing plate overlies the turned flange and aligned apertures are formed through the backing plate and turned flange to direct and focus cooling flow onto the side wall of the nozzle segment.

Burdgick, Steven Sebastian (Schenectady, NY)

2002-01-01T23:59:59.000Z

470

The logic behind thick, liquid-walled, fusion concepts  

SciTech Connect (OSTI)

It may be possible to surround the region where fusion reactions are taking place with a neutronically thick liquid blanket which has penetrations that allow only a few tenths of a percent of the neutrons to leak out. Even these neutrons can be attenuated by adding an accurately placed liquid or solid near the target to shadow-shield the beam ports from line-of-sight neutrons. The logic of such designs are discussed and their evolution is described with examples applied to both magnetic and inertial fusion (HYLIFE-II). These designs with liquid protection are self healing when exposed to pulsed loading and have a number of advantages-over the usual designs with solid first walls. For example, the liquid-protected solid components will last the life of the plant, and therefore the capacity factor is estimated to be approximately 10% higher than for the non-liquid-walled blankets, because no blanket replacement shutdowns are required. The component replacement, operations, and maintenance costs might be half the usual value because no blanket change-out costs or accompanying facilities are required. These combined savings might lower the cost of electricity by 20%. Nuclear-grade construction should not be needed, largely because the liquid attenuates neutrons and results in less activation of materials. Upon decommissioning, the reactor materials should qualify for disposal by shallow burial even when constructed of ordinary 304 stainless steel. The need for a high-intensity 14-MeV neutron test facility to develop first-wall materials is avoided or greatly reduced, saving billions of development dollars. Flowing molten Li, the molten salt Flibe (Li{sub 2}BeF{sub 4}), and molten Li{sub l7}Pb{sub 83} have been considered. An advantage of molten salt is that it will not burn and has a low tritium solubility and therefore low tritium inventory.

Moir, R.W.

1994-04-15T23:59:59.000Z

471

Tin-wall hollow ceramic spheres from slurries. Final report  

SciTech Connect (OSTI)

The overall objective of this effort was to develop a process for economically fabricating thin-wall hollow ceramic spheres from conventional ceramic powders using dispersions. This process resulted in successful production of monosized spheres in the mm size range which were point contact bonded into foams. Thin-wall hollow ceramic spheres of small (one to five millimeter) diameter have novel applications as high-temperature insulation and light structural materials when bonded into monolithic foams. During Phase 1 of this program the objective as to develop a process for fabricating thin-wall hollow spheres from powder slurries using the coaxial nozzle fabrication method. Based on the success during Phase 1, Phase 2 was revised to emphasize the assessment of the potential structural and insulation applications for the spheres and modeling of the sphere formation process was initiated. As more understanding developed, it was clear that to achieve successful structural application, the spheres had to be bonded into monolithic foams and the effort was further expanded to include both bonding into structures and finite element mechanical modeling which became the basis of Phase 3. Successful bonding techniques and mechanical modeling resulted but thermal conductivities were higher than desired for insulating activities. In addition, considerable interest had been express by industry for the technology. Thus the final Phase 4 concentrated on methods to reduce thermal conductivity by a variety of techniques and technology transfer through individualized visits. This program resulted in three Ph.D. theses and 10 M.S. theses and they are listed in the appropriate technical sections.

Chapman, A.T.; Cochran, J.K.

1992-12-31T23:59:59.000Z

472

Short note on the stability of a dilatonic wall  

E-Print Network [OSTI]

A nontopological soliton solution of dilaton-Maxwell theory describes a domain wall-like solution which confines magnetic flux in its core [G.W. Gibbons and C.G. Wells, Class. Quant. Grav. 11, 2499 (1994)]. Since the solution is not stabilized by a nontrivial topology of the vacuum manifold, it is interesting to see if the static solution is stable against small fluctuations. We consider the stability of the solution in response to small fluctuations in the scalar and magnetic fields. It is determined that the ansatz solution does indeed exhibit stability.

J. R. Morris

2014-09-29T23:59:59.000Z

473

Domain-growth kinetics of systems with soft walls  

Science Journals Connector (OSTI)

It has recently been suggested by Mouritsen on the basis of computer simulations that systems with soft domain walls exhibit slower domain growth than the R?t1/2 growth law predicted by Lifshitz and Allen and Cahn. We underscore the reasons to believe this interpretation of the data to be incorrect and draw attention to an experiment by Pindak, Young, Meyer, and Clark, whose results are in complete agreement with the predictions of Allen and Cahn. The reason for the unexpected growth dynamics observed in Mouritsen’s simulations is suggested.

Wim van Saarloos and Martin Grant

1988-02-01T23:59:59.000Z

474

Single-wall carbon nanotubes as coherent plasmon generators  

Science Journals Connector (OSTI)

The possibility of low-energy surface plasmon amplification by optically excited excitons in small-diameter single-wall carbon nanotubes is theoretically demonstrated. The nonradiative exciton-plasmon energy transfer causes the buildup of macroscopic population numbers of coherent localized surface plasmons associated with high-intensity coherent local fields formed at nanoscale throughout the nanotube surface. These strong local fields can be used in a variety of new optoelectronic applications of carbon nanotubes, including near-field nonlinear-optical probing and sensing, optical switching, enhanced electromagnetic absorption, and materials nanoscale modification.

I. V. Bondarev

2012-01-30T23:59:59.000Z

475

Field-ion microscopy observation of single-walled carbon  

Science Journals Connector (OSTI)

Field-ion microscopy (FIM), a tool for surface analysis with atomic resolution, has been employed to observe the end structure of single-walled carbon nanotubes (SWCNTs). FIM images revealed the existence of open SWCNT ends. Amorphous carbon atoms were also observed to occur around SWCNTs and traditional field evaporation failed to remove them. Heat treatment was found to be efficacious in altering the end structures of SWCNT bundles. Carbon and oxygen atoms released from heated tungsten filament are believed to be responsible for the decoration imposed on the SWCNT ends.

Zhang Zhao-Xiang; Zhang Geng-Min; Du Min; Jin Xin-Xi; Hou Shi-Min; Sun Jian-Ping; Gu Zhen-Nan; Zhao Xing-Yu; Liu Wei-Min; Wu Jin-Lei; Xue Zeng-Quan

2002-01-01T23:59:59.000Z

476

LiWall Fusion - The New Concept of Magnetic Fusion  

SciTech Connect (OSTI)

Utilization of the outstanding abilities of a liquid lithium layer in pumping hydrogen isotopes leads to a new approach to magnetic fusion, called the LiWall Fusion. It relies on innovative plasma regimes with low edge density and high temperature. The approach combines fueling the plasma by neutral injection beams with the best possible elimination of outside neutral gas sources, which cools down the plasma edge. Prevention of cooling the plasma edge suppresses the dominant, temperature gradient related turbulence in the core. Such an approach is much more suitable for controlled fusion than the present practice, relying on high heating power for compensating essentially unlimited turbulent energy losses.

L.E. Zakharov

2011-01-12T23:59:59.000Z

477

Solid oxide fuel cell having monolithic core  

DOE Patents [OSTI]

A solid oxide fuel cell is described for electrochemically combining fuel and oxidant for generating galvanic output, wherein the cell core has an array of electrolyte and interconnect walls that are substantially devoid of any composite inert materials for support. Instead, the core is monolithic, where each electrolyte wall consists of thin layers of cathode and anode materials sandwiching a thin layer of electrolyte material therebetween. The electrolyte walls are arranged and backfolded between adjacent interconnect walls operable to define a plurality of core passageways alternately arranged where the inside faces thereof have only the anode material or only the cathode material exposed. Means direct the fuel to the anode-exposed core passageways and means direct the oxidant to the anode-exposed core passageways and means direct the oxidant to the cathode-exposed core passageway; and means also direct the galvanic output to an exterior circuit. Each layer of the electrolyte and interconnect materials is of the order of 0.002 to 0.01 cm thick; and each layer of the cathode and anode materials is of the order of 0.002 to 0.05 cm thick.

Ackerman, J.P.; Young, J.E.

1983-10-12T23:59:59.000Z

478

BiFeO3 Domain Wall Energies and Structures: A Combined Experimental and Density Functional Theory+U Study  

DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

We determined the atomic structures and energies of 109°, 180°, and 71° domain walls in BiFeO3, combining density functional theory+U calculations and aberration-corrected transmission electron microscopy images. We find a substantial Bi sublattice shift and a rather uniform Fe sublattice across the walls. The calculated wall energies (?) follow the sequence ?109 180 71 for the 109°, 180°, and 71° walls. We attribute the high 71° wall energy to an opposite tilting rotation of the oxygen octahedra and the low 109° wall energy to the opposite twisting rotation of the oxygen octahedra across the domain walls.

Wang, Yi; Nelson, Chris; Melville, Alexander; Winchester, Benjamin; Shang, Shunli; Liu, Zi-Kui; Schlom, Darrell G.; Pan, Xiaoqing; Chen, Long-Qing

2013-06-01T23:59:59.000Z

479

Bentonite-water slurry rheology and cutoff wall trench stability  

SciTech Connect (OSTI)

The rheological behavior of bentonite-water slurry is responsible for its ability to stabilize trenches that are made for construction of subsurface barriers to ground water flow. This paper reviews the rheology of bentonite-water slurries and presents property values for a range of bentonite concentrations. Test results indicate that, if the D{sub 15} size of the native ground is less than 0.4 mm, it is likely that a bentonite filter cake will form on the face of an excavation supported by bentonite-water slurry. For soils that are too coarse for a filter cake to form, it was found that the penetration distance of slurry into the soil increases as the D{sub 5} size and void ratio of the soil increase. An expression for the factor of safety against local sloughing failure of the trench wall is presented. Local sloughing failures that occurred during construction of the cutoff wall at Island Copper Mine, Vancouver Island, BC, are discussed, and calculated factors of safety are in good agreement with the observed performance.

Filz, G.M. [Virginia Tech, Blacksburg, VA (United States); Boyer, R.D. [Langan Engineering and Environmental Services, Elmwood Park, NJ (United States); Davidson, R.R. [Woodward-Clyde Consultants, Denver, CO (United States)

1997-12-31T23:59:59.000Z

480

Hierarchical, multilayered cell walls reinforced by recycled silk cocoons enhance the structural integrity of honeybee combs  

Science Journals Connector (OSTI)

...the indentation moduli of anisotropic biomaterials (2 ZZQQhy6), although for anisotropic media, the indentation...Indentation of elastically anisotropic half-spaces by cones...Concrete, bone, and shale. J Am Ceram Soc 90:2677...

Kai Zhang; Huiling Duan; Bhushan L. Karihaloo; Jianxiang Wang

2010-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "maize cell walls" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Discovery of Fungal Cell Wall Components Using Evolutionary and Functional Genomics  

E-Print Network [OSTI]

domain containing alpha amylase and glycosyl transferasekingdoms containing an alpha-amylase domain and implicatedGH13-1 are usually alpha-amylases (Henrissat 1991). Motif

Sain, Divya

2013-01-01T23:59:59.000Z

482

Cellulose Binding Domains of a Phytophthora Cell Wall Protein Are Novel Pathogen-Associated Molecular Patterns  

Science Journals Connector (OSTI)

...except after heat treatment of the medium (Meindl...and neutralized by dialysis against 100 volumes of water at 4C for 16 h...strain GV3101 by electroporation, and transformed...et al. (1980). Electron Microscopy and Immunogold...

Elodie Gaulin; Nani Dramé; Claude Lafitte; Trudy Torto-Alalibo; Yves Martinez; Carine Ameline-Torregrosa; Moustafa Khatib; Honoré Mazarguil; François Villalba-Mateos; Sophien Kamoun; Christian Mazars; Bernard Dumas; Arnaud Bottin; Marie-Thérèse Esquerré-Tugayé; Martina Rickauer

2006-06-09T23:59:59.000Z

483

A Survey of Databases for Analysis of Plant Cell Wall-Related Enzymes  

E-Print Network [OSTI]

Yongin 446-701, Korea Bioenerg. Res. (2010) 3:108–114Biochem J 279(Pt 2):529–535 Bioenerg. Res. (2010) 3:108–114Feedstocks Division, Joint BioEnergy Institute, Emeryville,

Cao, Peijian; Jung, Ki-Hong; Ronald, Pamela C

2010-01-01T23:59:59.000Z

484

The Cell Wall Hydroxyproline-Rich Glycoprotein RSH Is Essential for Normal Embryo Development in Arabidopsis  

Science Journals Connector (OSTI)

...development of a body plan with bilateral symmetry...into two (for recent reviews, see Staehelin and...orientation relative to plant regulatory sequences. Such a library...4) with its native regulatory sequences produced both...RSH-GFP) using native RSH regulatory sequences. Because...

Qi Hall; Maura C. Cannon

2002-04-29T23:59:59.000Z

485

Investigating plant cell wall components that affect biomass recalcitrance in poplar and switchgrass  

E-Print Network [OSTI]

recalcitrance or when designing processing conditions to efficiently convert a specific biomass feedstock

California at Riverside, University of

486

Structure of a Plant Cell Wall Fragment Complexed to Pectate Lyase C  

Science Journals Connector (OSTI)

...Eastern Regional Research Center, 600 E. Mermaid Lane, Wyndmoor...Department of Molecular Genetics of Industrial Microorganisms, Wageningen...the San Diego Supercomputer Center. The research was conducted...221-230. Brunger A.T. Assessment of phase accuracy by cross...

Robert D. Scavetta; Steven R. Herron; Arland T. Hotchkiss; Nobuhiro Kita; Noel T. Keen; Jacques A. E. Benen; Harry C. M. Kester; Jaap Visser; Frances Jurnak

487

Algological Studies 100 95-105 Stuttgart, December 2000 Cell wall development, microfibril and pyrenoid  

E-Print Network [OSTI]

and pyrenoid structure in type strains of Chlorella vulgaris, C. kessleri, C sorokiniana compared with C glucosamine-type Chlorella species (C. vulgarisvar. vulgaris, C. kessleri,C. sorokiniana), forming a related of microfibrils in all studied speciesis about 5 nm. Key words: Trebouxiophyceae, Chlorophyta, Chlorella vulgaris

488

Effect of acetate and other cell wall components on enzymatic hydrolysis of aspen wood  

E-Print Network [OSTI]

although it can be imagined that the xylan removal would result in more accessible pore volume and specific surface area, which would favor increased enzyme penetration and attachment to cellulose. Since acetate plays an important role in the resistance... although it can be imagined that the xylan removal would result in more accessible pore volume and specific surface area, which would favor increased enzyme penetration and attachment to cellulose. Since acetate plays an important role in the resistance...

Kong, Fanran

2012-06-07T23:59:59.000Z

489

Identification of plant cell wall mutants by means of a forward chemical genetic approach using hydrolases  

Science Journals Connector (OSTI)

...mutant phenotype. Also, treatment of seedlings with the...thaliana seeds were surface sterilized by washing...ethanol, followed by treatment with 3% sodium hypochloride...Biochemical control of xylan biosynthesis—which...Monosaccharides 0 T-DNA 0 Xylans 37294-28-3 xyloglucan...

Sascha Gille; Ulrike Hänsel; Mark Ziemann; Markus Pauly

2009-01-01T23:59:59.000Z

490

The Arabidopsis Mutant cev1 Links Cell Wall Signaling to Jasmonate and Ethylene Responses  

Science Journals Connector (OSTI)

...result of the limited solubility or mobility of potential...analyzed using a 610 series gas chromatograph (ATI Unicam...harvested, frozen in liquid nitrogen, ground with a mortar...and resuspended in water. An aliquot was reserved...pellet was washed with water and quantified colorimetrically...

Christine Ellis; Ioannis Karafyllidis; Claus Wasternack; John G. Turner

491

Impact of Cell Wall Acetylation on Corn Stover Hydrolysis by Cellulolytic and Xylanolytic Enzymes  

SciTech Connect (OSTI)

Analysis of variously pretreated corn stover samples showed neutral to mildly acidic pretreatments were more effective at removing xylan from corn stover and more likely to maintain the acetyl to xylopyranosyl ratios present in untreated material than were alkaline treatments. Retention of acetyl groups in the residual solids resulted in greater resistance to hydrolysis by endoxylanase alone, although the synergistic combination of endoxylanase and acetyl xylan esterase enzymes permitted higher xylan conversions to be observed. Acetyl xylan esterase alone did little to improve hydrolysis by cellulolytic enzymes, although a direct relationship was observed between the enzymatic removal of acetyl groups and improvements in the enzymatic conversion of xylan present in substrates. In all cases, effective xylan conversions were found to significantly improve glucan conversions achievable by cellulolytic enzymes. Additionally, acetyl and xylan removal not only enhanced the respective initial rates of xylan and glucan conversion, but also the overall extents of conversion. This work emphasizes the necessity for xylanolytic enzymes during saccharification processes and specifically for the optimization of acetyl esterase and xylanase synergies when biomass processes include milder pretreatments, such as hot water or sulfite steam explosion.

Selig, M. J.; Adney, W. S.; Himmel, M. E.; Decker, S. R.

2009-01-01T23:59:59.000Z

492

Conditional Mutants of Staphylococcus aureus Defective in Cell Wall Precursor Synthesis  

Science Journals Connector (OSTI)

...sucrose, this demonstrates that the remedial capacity of a solute is simply dependent...initial stages of this project. This investigation was supported by National Science Foundation...and J. Friis. 1964. Osmotic-remedial mutants. A new classification for nutritional...

C. M. Good; D. J. Tipper

1972-07-01T23:59:59.000Z

493

Prebiotic Properties of Yeast Cell Wall Mannanoligosaccharides and Guar Gum Galactomannans in Starting Broilers  

E-Print Network [OSTI]

of YCW-MOS. Both the products tested produced significant improvement in growth rate compare to the control birds. However, the blend of YCW-MOS showed approximately 15% improvement in growth rate with 10% reduction in feed conversion rate (FCR...

Kakani, Radhika

2013-12-04T23:59:59.000Z

494

Sucrose synthase affects carbon partitioning to increase cellulose production and altered cell wall ultrastructure  

Science Journals Connector (OSTI)

...and Paper Industry Useful Method 250 (TAPPI UM-250) (47). Determination of {alpha}-Cellulose...of the Pulp and Paper Industry ( 1991 ) Tappi Useful Method UM-250. Acid-soluble lignin in wood and pulp ( Tappi Press , Atlanta ). 48 Yokoyama T Kadla...

Heather D. Coleman; Jimmy Yan; Shawn D. Mansfield

2009-01-01T23:59:59.000Z

495

Cell wall structure and formation of maturing fibres of moso bamboo (Phyllostachys pubescens) increase buckling resistance  

Science Journals Connector (OSTI)

...materials. In Advances in lignocellulosics characterization (ed. D. S. Argyropoulos), pp. 201-225. Atlanta, GA: TAPPI Press. 24 Takei, T. , N. Kato, T. Iijima, and M. Higaki 1995 Raman spectroscopic analysis of wood and bamboo lignin...

2012-01-01T23:59:59.000Z

496

E-Print Network 3.0 - arterial wall cells Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Universit Montpellier II Collection: Physics ; Mathematics 8 Residual Stresses in Oscillating Thoracic Arteries Reduce Circumferential Stresses and Stress Gradients...

497

A framework for studying the effect of compliant surfaces on wall turbulence  

E-Print Network [OSTI]

This paper extends the resolvent formulation proposed by McKeon & Sharma (2010) to consider turbulence-compliant wall interactions. Under this formulation, the turbulent velocity field is expressed as a linear superposition of propagating modes, identified via a gain-based decomposition of the Navier-Stokes equations. Compliant surfaces, modeled as a complex wall-admittance linking pressure and velocity, affect the gain and structure of these modes. With minimal computation, this framework accurately predicts the emergence of the quasi-2D propagating waves observed in recent direct numerical simulations. Further, the analysis also enables the rational design of compliant surfaces, with properties optimized to suppress flow structures energetic in wall turbulence. It is shown that walls with unphysical negative damping are required to interact favorably with modes resembling the energetic near-wall cycle, which could explain why previous studies have met with limited success. Positive-damping walls are eff...

Luhar, M; McKeon, B J

2014-01-01T23:59:59.000Z

498

Performance of a selective-surface trombe wall in a small commercial building  

SciTech Connect (OSTI)

The design and construction of a 100% passive solar building utilizing a clerestory and a trombe wall are described. The use of three selectively absorptive and emissive coverings on the trombe wall outer surface are investigated. One of the coverings and its laminating adhesive are tested for degradation after a year of exposure under normal operating conditions. Ambient temperature, room air temperature, trombe wall interior and exterior surface temperatures, and solar radiation are measured.

Judkoff, R.; Sokol, F.

1981-03-01T23:59:59.000Z

499

Material Characterization and Design Recommendations for Mechanically Stabilized Earth Retaining Walls  

E-Print Network [OSTI]

. ................................... 120  Figure 94. Ka FLAC Comparison with Ka_Rankine for Different ? (Retain) for 10 ft Wall Height with No Dilation Angle. .................................................... 121  xiv Figure 95. Ka_FLAC Comparison with Ka_Rankine for Different... ? (Retain) for 10 ft Wall Height with Dilation Angle. .......................................................... 122  Figure 96. Ka_FLAC Comparison with Ka_Rankine for Different ? (Retain) for 20 ft Wall Height with No Dilation Angle...

Dantal, Vishal

2013-12-04T23:59:59.000Z

500

E-Print Network 3.0 - accelerator wall materials Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

interactions Neutron damage to first wall and optics Channel formation 12;The types of research ... Source: UK Fusion Center at Culham (UKAEA) Collection: Plasma...