Powered by Deep Web Technologies
Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

UNIVERSIDAD CARLOS III de MADRID Madrid, Spain  

E-Print Network [OSTI]

UNIVERSIDAD CARLOS III de MADRID Madrid, Spain College of Charleston Bilateral Exchange Program Spain and around the world. It programs in Business Ad- ministration, Economics and Law are ranked among the best in Spain. While studying at UC3M, students are able to partake of the vibrant culture of Madrid

Young, Paul Thomas

2

SPAIN PROGRAM Madrid Four Week /  

E-Print Network [OSTI]

SPAIN PROGRAM Madrid Four Week / Madrid and Málaga Six Week 2014 Summer Program APPLICATION FORM face to scapobia@binghamton.edu. It will be used to make a photo ID card for you to use in Spain. 7 and the full refund and cancellation policy on the Spain program website pages. 8. Submit all materials to the

Suzuki, Masatsugu

3

Professor Ignacio Luengo, Universidad Complutense, Madrid, Spain ...  

E-Print Network [OSTI]

Apr 14, 2009 ... Speaker: Professor Ignacio Luengo, Universidad Complutense, Madrid, Spain. Title: “Rational Cuspidal Curves, Surface Singularities and ...

1910-90-41T23:59:59.000Z

4

Last date modified 1/16/13 Location and Institution SPAIN -MADRID  

E-Print Network [OSTI]

Last date modified 1/16/13 Location and Institution SPAIN - MADRID ST. LOUIS/or Scholarships http://spain.slu in Spain. You must apply within 3 months prior to departure. Documents must

Galles, David

5

Madrid, Spain: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429Lacey,(MonasterLowell Point,ECO Auger11.Spain: Energy Resources Jump to:

6

Time-resolved pattern evolution in a large-aperture class A laser Nonlinear Dynamics and Chaos Group. Universidad Rey Juan Carlos, 28933 Mostoles, Madrid, Spain  

E-Print Network [OSTI]

and Chaos Group. Universidad Rey Juan Carlos, 28933 Mo´stoles, Madrid, Spain J. M. Guerra Departamento de Optica, Facultad de Ciencias Fi´sicas, Universidad Complutense de Madrid, 28040 Madrid, Spain Received 15

Rey Juan Carlos, Universidad

7

Long-period eccentricity control on sedimentary sequences in the continental Madrid Basin (middle Miocene, Spain)  

E-Print Network [OSTI]

Miocene, Spain) Hemmo A. Abels a,b, , Hayfaa Abdul Aziz a,b , Wout Krijgsman b , Sander J.B. Smeets Madrid Basin (central Spain) is dated bio-magnetostratigraphically between 15.2 Ma and 11.5 Ma-dominated intervals is similar to a previously documented Late Miocene shift in the Teruel Basin of northeast Spain

Utrecht, Universiteit

8

Madrid, Spain *This program is offered every Summer, Spring and Fall  

E-Print Network [OSTI]

Madrid, Spain *This program is offered every Summer, Spring and Fall To view the most recent information about the Spanish Language Immersion Program in Spain please go to the SDSU College of Extended 2009 Gloria Cossio and Jose Alberto Martinez Spain Summer 2008 Experience by Rodolfo Nubes My

Ponce, V. Miguel

9

Ocean Waves Measurement and Analysis, Fifth International Symposium WAVES 2005, 3rd-7th, July, 2005. Madrid, Spain Paper number: 197  

E-Print Network [OSTI]

. Madrid, Spain Paper number: 197 #12;Ocean Waves Measurement and Analysis, Fifth International Symposium WAVES 2005, 3rd-7th, July, 2005. Madrid, Spain #12;Ocean Waves Measurement and Analysis, Fifth International Symposium WAVES 2005, 3rd-7th, July, 2005. Madrid, Spain #12;Ocean Waves Measurement and Analysis

Grilli, Stéphan T.

10

Highlights of Spanish Astrophysics VI, Proceedings of the IX Scientific Meeting of the Spanish Astronomical Society held on September 13 -17, 2010, in Madrid, Spain. M. R. Zapatero Osorio et al. (eds.)  

E-Print Network [OSTI]

, in Madrid, Spain. M. R. Zapatero Osorio et al. (eds.) Chromospheric activity of FGK stars. Astrof´isica, E-28040 Madrid, Spain 2 Universidad Aut´onoma de Madrid, Dpto. de F´isica Te´orica C-XI, Fac. Ciencias, Madrid, Spain 3 LAEX, CAB (CSIC-INTA), ESAC Campus, P.O. BOX 73, 28691 Villanueva de la

Complutense de Madrid, Universidad

11

European Wind Energy Conference & Exhibition EWEC 2003, Madrid, Spain. Forecasting of Regional Wind Generation by a Dynamic  

E-Print Network [OSTI]

European Wind Energy Conference & Exhibition EWEC 2003, Madrid, Spain. Forecasting of Regional Wind. Abstract-Short-term wind power forecasting is recognized nowadays as a major requirement for a secure and economic integration of wind power in a power system. In the case of large-scale integration, end users

Paris-Sud XI, Université de

12

Highlights of Spanish Astrophysics VI, Proceedings of the IX Scientific Meeting of the Spanish Astronomical Society held on September 13 -17, 2010, in Madrid, Spain. M. R. Zapatero Osorio et al. (eds.)  

E-Print Network [OSTI]

, in Madrid, Spain. M. R. Zapatero Osorio et al. (eds.) Chemical Tagging the Hyades-28040 Madrid, Spain. 2 Instituto de Astrof´isica de Canarias, C/ Via L´actea s/n, E-38200 La Laguna, Spain Abstract Stellar Kinematic Groups are kinematical coherent groups of stars which may share a com

Complutense de Madrid, Universidad

13

European Wind Energy Conference & Exhibition EWEC 2003, Madrid, Spain. State-of-the-Art on Methods and Software Tools for Short-Term  

E-Print Network [OSTI]

European Wind Energy Conference & Exhibition EWEC 2003, Madrid, Spain. State-of-the-Art on Methods and Software Tools for Short-Term Prediction of Wind Energy Production G. Giebel*, L. Landberg, Risoe National Roskilde, Denmark Abstract: The installed wind energy capacity in Europe today is 20 GW, while

Paris-Sud XI, Université de

14

*Holder of a Scholarship from the Fondo de Investigacin Sanitaria (File No. 97/5653). Sensitization to Anisakis simplex: prevalence in an allergy outpatient clinic of Madrid (Spain)  

E-Print Network [OSTI]

Background: Anisakis simplex is a nematode that has been implicated in IgE-mediated allergic episodes. The aim of this study was to determine the prevalence of clinical and subclinical sensitization to A. simplex in adults attending an allergy outpatient clinic in Madrid (Spain), as well as to assess clinical and laboratory data related to the diagnosis of A. simplex allergy. Methods: We have investigated the alimentary habits (fish ingestion) and the presentation of associated acute or chronic gastrointestinal symptoms in 87 patients referred to our Allergy Outpatient Clinic because of various pathologic conditions. Skin prick tests were performed with an A. simplex extract, and the total and specific (to this parasite) serum IgE levels were measured (CAP-FEIA). Results: Clinical and subclinical sensitization to A. simplex was found in 5.7 % and 23 % of the patients, respectively. The skin tests and the CAP were positive to A. simplex in 16 % and 22 % of the patients, respectively, but the two techniques were simultaneously positive in only 9% of the cases. Forty-four per cent of the patients who had sought medical care because of urticaria, angioedema or anaphylaxis of undetermined aetiology showed a positive CAP assay to A. simplex, as compared to 17 % of those with other reasons for requesting medical consultation (p<0.01). There were no statistically significant differences between the two groups in regard to the results of the skin prick tests. The alimentary habits in the patients with positive skin prick tests and/or positive CAP assay were not signifi-cantly different from those of the patients with negative results. Conclusions. A high proportion of clinical and subclinical sensiti-zation to A. simplex has been detected among patients attending an outpatient allergy clinic in Madrid (Spain). A discrepancy was detected between the skin prick tests and CAP assay results. A habit of fish ingestion and recurrent gastrointestinal episodes do not

M. P. Lpez Sez; J. M. Zubeldia; V. Matheu; M. T. Gracia; M. De Barrio; P. Tornero; T. Herrero

15

E-Print Network 3.0 - anesthesia santiago spain Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

groups J. Lopez-Santiago... Complutense de Madrid, E-28040 Madrid, Spain. (dmg@astrax.fis.ucm.es) During the last years (1999 - 2004), our Source: Gutirrez, David Montes -...

16

MODELING MULTIFUNCTIONAL AGROFORESTRY SYSTEMS WITH ENVIRONMENTAL VALUES: DEHESA IN SPAIN AND WOODLAND  

E-Print Network [OSTI]

Chapter MODELING MULTIFUNCTIONAL AGROFORESTRY SYSTEMS WITH ENVIRONMENTAL VALUES: DEHESA IN SPAIN Research (CSIC) Pinar 25, 28006, Madrid, Spain. e-mail: pcampos@ieg.csic.es; acaparros@ieg.csic.es 2 University Complutense, Madrid, Spain. E-mail: ecerdate@ccee.ucm.es 3 College of Natural Resources

Standiford, Richard B.

17

Immigration, work and health in Spain: the influence of legal status and employment contract on reported health indicators  

E-Print Network [OSTI]

Universidad de Valencia, Valencia, Spain J. Benach HealthNetwork (Emconet), Barcelona, Spain A. M. Garc? a Á M.and Health (ISTAS), Madrid, Spain C. Ruiz-Frutos Department

2010-01-01T23:59:59.000Z

18

Live in Spain while earning academic credit Spring 2013  

E-Print Network [OSTI]

+ + + Live in Spain while earning academic credit Spring 2013 · Study at one of Spain's oldest Spain with other CSU students · Take advantage of the opportunities you will have to travel throughout Spain & greater Europe Centrally located 20 miles from the vibrant city of Madrid, Alcalá de Henares

19

Meteorology Group, Departament de Fsica, Universitat de les Illes Balears, Palma de Mallorca, Spain IMEDEA, UIB-CSIC, Palma de Mallorca, Spain  

E-Print Network [OSTI]

, Spain 2 IMEDEA, UIB-CSIC, Palma de Mallorca, Spain 3 Instituto Nacional de Meteorologõ�a, Madrid, Spain Geltru, Barcelona, Spain A Case of Convection Development over the Western Mediterranean Sea: A Study of precipitation were recorded in coastal lands of eastern Spain, and 180 mm were estimated over the sea with radar

Romero, Romu

20

Ad Hoc Advisory Group to the Madrid Conference on Food Security Chaired by Prof. Jeffrey Sachs  

E-Print Network [OSTI]

Ad Hoc Advisory Group to the Madrid Conference on Food Security Chaired by Prof. Jeffrey Sachs Minister Rodriguez Zapatero of Spain, invited Professor Jeffrey Sachs to lead an Ad Hoc Advisory Group

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Theory Auger neutralization and deexcitation slow ions metal surfaces Materialen Fisika Kimika Fakultatea, 1072 Postakutxatila, Euskal Herriko Unibertsitatea, 20080 Donostia, Spain  

E-Print Network [OSTI]

Kimika Fakultatea, 1072 Postakutxatila, Euskal Herriko Unibertsitatea, 20080 Donostia, Spain Lorente Unibertsitatea, 20080 Donostia, Spain Unidad Asociada al Instituto Ciencia Ciencia Materiales, C.S.I.C., Cantoblanco, 28049 Madrid, Spain #Received contribution of conduction electrons to Auger neutralization

Muiño, Ricardo Díez

22

Regional Management of Mediterranean Ecosystems in Spain1  

E-Print Network [OSTI]

Regional Management of Mediterranean Ecosystems in Spain1 Jose A. Carrera, Estanislao de Simon Conservacion de la Naturaleza), Madrid, Spain. Abstract: Management of the fragile and greatly modified level studies on reforestation, hydrol- ogy, and desert control. Most of Spain has a typical

Standiford, Richard B.

23

Fusing Statecharts and Java MARIA-CRISTINA MARINESCU, Computer Science Dept., Universidad Carlos III, Leganes, Spain  

E-Print Network [OSTI]

III, Legan´es, Spain C ´ESAR S ´ANCHEZ, IMDEA Software Institute, Spain and Institute for Applied Physics, CSIC, Spain This paper presents FUSE, an approach for modeling and implementing embedded software-Cristina Marinescu, Computer Science Dept., Universidad Carlos III de Madrid, Leganes, Spain; C´esar S´anchez IMDEA

Sánchez, César

24

Fire Effects and Fuel Management in Mediterranean Ecosystems in Spain1  

E-Print Network [OSTI]

Fire Effects and Fuel Management in Mediterranean Ecosystems in Spain1 Ricardo Vélez2 1 Presented, California. 2 Doctor Ingeniero de Montes, ICONA - Forest Fire Section, Madrid Spain. Abstract: Forest fuels in the Mediterranean eco- systems of Spain are characterized by generalized pyrophytism and large accumulations

Standiford, Richard B.

25

Astronomical forcing of sedimentary cycles in the middle to late Miocene continental Calatayud Basin (NE Spain)  

E-Print Network [OSTI]

Basin (NE Spain) H. Abdul Aziz aY *, F. Hilgen a , W. Krijgsman b , E. Sanz c , J.P. Calvo d, Spain d Departemento de Petrologia y Geoqu|¨mica, Fac. CC. Geolo¨gicas, Universidad Complutense, 28040 Madrid, Spain Received 16 August 1999; received in revised form 28 January 2000; accepted 29 January 2000

Utrecht, Universiteit

26

SEDIMENTARY ARCHITECTURE AND CONTROLING MECHANISMS, LLOBREGAT DELTA, HOLOCENE-PLEISTOCENE (SPAIN)  

E-Print Network [OSTI]

SEDIMENTARY ARCHITECTURE AND CONTROLING MECHANISMS, LLOBREGAT DELTA, HOLOCENE-PLEISTOCENE (SPAIN baixa. E-08034 Barcelona, Spain. E-mail: (desire.gamez@upc.edu) 2 ICREA, Geomodels- Dep. of Geotechnical Madrid, Spain The reconstruction of the sedimentary architecture of the Llobregat delta is based

Politècnica de Catalunya, Universitat

27

Last updated: June 13, 2013 4:29 pm Brain drain in Spain leaves  

E-Print Network [OSTI]

Last updated: June 13, 2013 4:29 pm Brain drain in Spain leaves scientific research on the wane By Tobias Buck in Madrid Amaya Moro-Martín returned to Spain five years ago, after spending 11 years generous funding and a tenured position in Spain. Ms Moro-Martín's fellowship runs out at the end

Moro-Martin, Amaya

28

DOE New Madrid Seismic Zone Electric Utility Workshop Summary...  

Broader source: Energy.gov (indexed) [DOE]

New Madrid Seismic Zone Electric Utility Workshop Summary Report - August 2010 DOE New Madrid Seismic Zone Electric Utility Workshop Summary Report - August 2010 The DOE New Madrid...

29

INFORMATION MEETINGS: HBC 340-G from 12:00-1:00 on Wednesday, 9/28 Spend Spring Break in Spain  

E-Print Network [OSTI]

in Spain Spring break 2012 in Madrid, Toledo and Barcelona SPA 300.3 Culture and Arts of Spain (1 and monuments in Castile Tuesday, March 13: Excursion to Toledo Lecture Jewish Spain and El Greco's paintings in Toledo Group lunch in Toledo Wednesday, March 14: Contemporary Spain

Kovalev, Leonid

30

See also http://www.umass.edu/loop/content/civil-andenvironmental-engineering-student-wins-fulbright-study-rail-transportation-spain  

E-Print Network [OSTI]

See also http://www.umass.edu/loop/content/civil-andenvironmental-engineering- student-wins-fulbright-study-rail-transportation-spain to study transportation engineering in Madrid, Spain during 2013-2014. I had the good fortune to meet with Radha a short time ago and learned during our conversation that while abroad in Spain, one of her

Massachusetts at Amherst, University of

31

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Engineering and Computer Science on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

32

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

and Economics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

33

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

34

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Engineering and Computer Science on ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

35

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science and Mathematics on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

36

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

37

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

of Education on the ASI Board of Directors Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

38

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Science Mathematics on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

39

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Health & Human Development on the ASI Board of Directors Cell Phone:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

40

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of the Arts on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

Representing the College of Communications on the ASI Board of Directors Cell Phone: ( )_______-_________ Email:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

42

Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________  

E-Print Network [OSTI]

on the ASI Board of Directors FY 13-14 Cell Phone: ( )_______-_________ Email Address:_________________________________________________City:______________________Zip:__________ Home Phone: ( )_______-_________ Work Phone: ( )_______-_________ Student ID

de Lijser, Peter

43

Zipping mechanism for force-generation by growing filament bundles  

E-Print Network [OSTI]

We investigate the force generation by polymerizing bundles of filaments, which form because of short-range attractive filament interactions. We show that bundles can generate forces by a zipping mechanism, which is not limited by buckling and operates in the fully buckled state. The critical zipping force, i.e. the maximal force that a bundle can generate, is given by the adhesive energy gained during bundle formation. For opposing forces larger than the critical zipping force, bundles undergo a force-induced unbinding transition. For larger bundles, the critical zipping force depends on the initial configuration of the bundles. Our results are corroborated by Monte Carlo simulations.

Torsten Kuehne; Reinhard Lipowsky; Jan Kierfeld

2011-03-02T23:59:59.000Z

44

ZipZone Technologies | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia:FAQ < RAPID Jump to:SeadovCooperative JumpWilliamsonWoodsonCounty is aYoakumYuHange BatteryZim'sZipZone

45

REGULATORY MECHANISMS OF SLC39A4 (ZIP4) AND SLC39A5 (ZIP5) IN THE ADAPTIVE RESPONSE TO ZINC AVAILABILITY  

E-Print Network [OSTI]

The aims of this research were to determine how Zip4 and Zip5 are regulated in response to zinc availability and how Zip4 impacts development. Loss of Zip4 resulted in embryonic lethality. Heterozygosity negatively affected eye, heart, and brain...

Weaver, Benjamin Patrick

2009-04-06T23:59:59.000Z

46

3 Your Place in Madrid 5 Program Overview  

E-Print Network [OSTI]

madrid city signature The Bear and the Madroño Tree (featuredonfrontcover) Located at the Puerta del Sol in Madrid, the statue of a bear eating fruit from a berry tree is the heraldic symbol of the city, Dieter Roberto Kuehl, Ph.D. director SyracuseUniversityinMadrid #12;...in Madrid Syracuse University

Mather, Patrick T.

47

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along  

E-Print Network [OSTI]

Bullet trains and steam engines: Exogenous attention zips but endogenous attention chugs along: Chakravarthi, R., & VanRullen, R. (2011). Bullet trains and steam engines: Exogenous attention zips

VanRullen, Rufin

48

NAME: STUDENT NUMBER (PID): CITY, STATE ZIP: DAYTIME PHONE NUMBER  

E-Print Network [OSTI]

NAME: STUDENT NUMBER (PID): ADDRESS: CITY, STATE ZIP: DAYTIME PHONE NUMBER: CELL PHONE NUMBER of financial institution. 14 Cell Phone Expenses 15 Other ordinary and necessary living expenses. 16 TOTAL (add

49

SUMMER COURSES 2014 UNIVERSIDAD PONTIFICIA COMILLAS MADRID  

E-Print Network [OSTI]

designed for ENGINEERING students Courses: Business Planning Quality Control and Management · Module MANAGEMENT Courses: Techniques in Negotiation Management in Human Resources Strategic Management in the center of Madrid, near museums, theaters, cultural centers and parks. Throughout the academic year, more

Kuehnlenz, Kolja

50

CARLOS FRANCO Nace en Madrid en 1951  

E-Print Network [OSTI]

, Costa Rica. Carlos Franco, Puerto Rico. Carlos Franco, Museo Oscar Niemeyer, Curitiba, Brasil. Carlos Franco, Centro Caixa Económica, Salvador de Bahía, Brasil. Carlos Franco: el telón de la Casa de la asesino. Galería Ovidio, Madrid. 1981 Bienal de Sao Paulo, Brasil. Otras Figuraciones. Caja de Pensiones

51

Protein folding by zipping and assembly S. Banu Ozkan*  

E-Print Network [OSTI]

Protein folding by zipping and assembly S. Banu Ozkan* , G. Albert Wu* , John D. Chodera, CA, May 2, 2007 (received for review April 13, 2006) How do proteins fold so quickly? Some denatured proteins fold to their native structures in only microseconds, on average, implying that there is a folding

Southern California, University of

52

Early Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Calcasieu Parish Public Library Central Branch 301 W. Claude St. Lake Charles 70605 #12;STATE LIBRARYEarly Restoration Plan Repositories STATE LIBRARY ADDRESS CITY ZIP AL Dauphin Island Sea Laboratory. Walton 32548 FL Panama City Beach Public Library 125000 Hutchison Blvd Panama City Beach 32407 FL

53

Ingenieria Geologica Universidad Politecnica de Madrid MECANICA DE MEDIOS CONTINUOS  

E-Print Network [OSTI]

Ingenier´ia Geol´ogica Universidad Polit´ecnica de Madrid MEC´ANICA DE MEDIOS CONTINUOS Problemas

Romero, Ignacio

54

A review of "The Sale of the Century: Artistic Relations between Spain and Great Britain, 1604-1655." by Jonathan Brown and John Elliott, eds.  

E-Print Network [OSTI]

. Jonathan Brown and John Elliott, eds. The Sale of the Century: Ar- tistic Relations between Spain and Great Britain, 1604?1655. Madrid: Yale University Press and Museo Nacional del Prado, 2002. 315 pp. $65 hardback. Review by ELIZABETH R. WRIGHT..., UNIVERSITY OF GEORGIA. Art historian Jonathan Brown and historian John Elliott have joined forces to provide an indispensable guide to the political and artistic relationship between Spain and England in the first half of the seventeenth century. Though...

Elizabeth R. Wright

2003-01-01T23:59:59.000Z

55

Property:Incentive/Cont2Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes, PleaseAddrPagesZip

56

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear memory  

E-Print Network [OSTI]

Intra-amygdala infusion of the protein kinase Mzeta inhibitor ZIP disrupts foreground context fear-pseudosubstrate inhibitory peptide (ZIP) remains in the brain after infusion. Here, we demon- strate that foreground context the brain by 24 h after infusion. These data contribute to a growing body of lit- erature that demonstrates

Helmstetter, Fred J.

57

Highlights of Spanish Astrophysics VIII, Proceedings of the XI Scientific Meeting of the Spanish Astronomical Society held on September 8 12, 2014, in Teruel, Spain. A. J. Cenarro, F. Figueras, C. Hernndez-Monteagudo, J. Trujillo, and L.  

E-Print Network [OSTI]

/INTA), ctra. de Ajalvir km. 4, 28850 Torrej´on de Ardoz, Madrid, Spain 2 Center for Detectors, Rochester, circumstellar extinction and age of FS CMa stars in an unprecedented way. Due to their relatively low brightness ([14]). The distinguishing features consisted of a sharp decrease of the mid-infrared flux above 20µm

Figer, Donald F.

58

Name (last, first, middle initial) Date of birth City, State, ZIP/Postal code  

E-Print Network [OSTI]

Name (last, first, middle initial) Date of birth Address City, State, ZIP/Postal code Province or less. 1. Proponents of cognitive enhancement--the use of "smart pills," deep brain stimulation

59

In Proc. Sixth International Symposium on Programming Language Implementation and Logic Programming, Madrid (Spain),  

E-Print Network [OSTI]

styles with a complete operational semantics are based on narrowing. In order to avoid useless described in this paper was supported in part by the German Mini* *stry for Research and Technology (BMFT at an outer position. Similarly to pure functional programming, such a lazy strat- egy avoids some useless

Hanus, Michael

60

Integrated Plant for the Municipal Solid Waste of Madrid  

E-Print Network [OSTI]

such as steam- boiler water treatment, compressed-air, control and instrumentation, etc. The incinerator of the project was to recover the energy content of RDF generated by the recycling plant of the city of Madrid and Composting Plant The MSW is brought by the collecting trucks which unload in the storage area with a two

Columbia University

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Universidad Autonoma de Madrid Algebra. Curso 201213 Ingenieria Informatica. Grupo 112  

E-Print Network [OSTI]

Universidad Aut´onoma de Madrid ´Algebra. Curso 2012­13 Ingenier´ia Inform´atica. Grupo 112 Segundo

Otero Domínguez, Margarita

62

ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY  

E-Print Network [OSTI]

86 #12;87 ZIP CODE NUMBERS: SUFFOLK AND NASSAU COUNTY POST OFFICES SUFFOLK COUNTY Amagansett 11930 11784 Brightwaters 11718 Kings Park 11754 Setauket 11733 Brookhaven 11719 Lake Grove 11755 Shelter River 11739 Port Jefferson Station 11776 NASSAU COUNTY Albertson 11507 Greenvale 11548 Old Westbury

Ohta, Shigemi

63

Early Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP  

E-Print Network [OSTI]

Public Library Central Branch 301 W. Claude St. Lake Charles 70605 29. LA Iberia Parish Library 445 EEarly Restoration Plan (Phase III FERP)Repositories STATE LIBRARY ADDRESS CITY ZIP 1. AL Dauphin. Mobile 36606 6. AL City of Bayou La Batre Public Library 12747 Padgett Switch Road Irvington 36544 7. FL

64

Universidad Autonoma de Madrid Curso 2011-12 ALGEBRA LINEAL Matematicas  

E-Print Network [OSTI]

Universidad Aut´onoma de Madrid Curso 2011-12 ´ALGEBRA LINEAL Matem´aticas Informaci´on b´ANDEZ, ´Algebra Lineal y Geometr´ia, Ed. Univ. Aut´onoma de Madrid (1994). - M. CASTELLET, I. LLERENA, Algebra´asica sobre la asignatura. PROGRAMA Tema 1. Matrices y sistemas lineales. - Los espacios num

González Díez, Gabino

65

Index of /~lipman/Spain  

E-Print Network [OSTI]

Index of /~lipman/Spain. [ICO], Name · Last modified · Size · Description. [DIR], Parent Directory, -. [ ], 1. Derived_categories_and_functors.pdf, 22-Feb-2009 04:

66

MHK Projects/New Madrid Bend Project | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpIncMAK Technologies JumpLuangwaoldid=676597"NenanaNew Madrid

67

A review of "The Plaza Mayor and the Shaping of Baroque Madrid." by Jesús Escobar  

E-Print Network [OSTI]

other more rounded works in this field before accepting this one at face value. Jes?s Escobar. The Plaza Mayor and the Shaping of Baroque Madrid. Cambridge: Cambridge University Press, 2004. xxvii + 347 pp. + 123 illus. $85.00. Review by ELIZABETH R... environment and interacted with their rulers. One of the most important facets of this book relates to Escobar?s consideration of Madrid?s urban reforms in an international context that encompasses other European cities, as well as the evolving urban spaces...

Elizabeth R. Wright

2005-01-01T23:59:59.000Z

68

Diciembre 2013 Biblioteca y Archivo Universidad Autnoma de Madrid Biblioteca Politcnica  

E-Print Network [OSTI]

; London : The MIT Press, © 2013 9780262019538 INF/A8730/BUR Hernández, Eugenio Algebra lineal y geometría de Madrid Biblioteca Politécnica 5 Reid, Miles Undergraduate commutative algebra / Miles Reid

Autonoma de Madrid, Universidad

69

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico:CommunityNorthwestInformation GreatersourceOhmsettZip

70

Mirrors and Echoes: Women's Writing in Twentieth-Century Spain  

E-Print Network [OSTI]

Contemporary Women Writers of Spain. Boston: Twayne, 1988.L. , ed. Women Writers of Spain: An Annotated Bio-Biblio-Identity in Contemporary Spain, ed. Jo Labanyi. New York:

Bergmann, Emilie L.; Herr, Richard

2007-01-01T23:59:59.000Z

71

Economy and Rhetoric of Exchange in Early Modern Spain  

E-Print Network [OSTI]

Elliott, J. H. Imperial Spain 1469-1716. London: Penguin,2002. ---. Spain and its World 1500-1700. New Haven andin Early Seventeenth- Century Spain. Lewisburg: Bucknell UP,

Ruiz, Eduardo German

2010-01-01T23:59:59.000Z

72

The Electricity Industry In Spain Edward Kahn  

E-Print Network [OSTI]

PWP-032 The Electricity Industry In Spain Edward Kahn August 1995 This paper is part of the working-5180 www.ucei.berkeley.edu/ucei #12;1 The Electricity Industry In Spain Edward Kahn Lawrence Berkeley the current structure of the electricity industry in Spain and recent changes to its legal and regulatory

California at Berkeley. University of

73

Foreign Fishery Developments United States-Spain  

E-Print Network [OSTI]

Foreign Fishery Developments United States-Spain Fisheries Trade, 1980-85 Introduction The U though Spain was forced to become a net importer of fishery products in 1977. due to the extension of 200-mile Exclusive Economic Zones (EEZ) by coastal coun tries. U.S. exports of edible seafoods to Spain

74

Pain in Spain: Immigrant Integration and Prosperity  

E-Print Network [OSTI]

Pain in Spain: Immigrant Integration and Prosperity Kevin Kennedy University of New Hampshire % Unemployment Rate, 2008-2010 Time #12;Background Foreign Population in Spain by Countries 2011 2010 Foreigners #12;Foreign-Born Population in Spain Year Total % of Total Population 2008 6418. 1 14.1 2007 6044. 5

New Hampshire, University of

75

2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go to presentations and download.  

E-Print Network [OSTI]

Laboratory Geochemical Tools for Monitoring Geologic Carbon Sequestration, (David Cole, ORNL) Andre Duguid-surface carbon sequestration T.S. Ramakrishnan (Jim Johnson, speaker) Schlumberger Capacity and Injectivity2009 Carb Sequestration Workshop Presentations for Download (zipped) 1. Click on Title to go

Daniels, Jeffrey J.

76

Complementary Pu Resuspension Study at Palomares, Spain  

SciTech Connect (OSTI)

Soil in an area near Palomares, Spain, was contaminated with plutonium as a result of a mid-air collision of U.S. military aircraft in January 1966. The assessment for potential inhalation dose can be found in Iranzo et al., (1987). Long-term monitoring has been used to evaluate remedial actions (Iranzo et al., 1988) and there are many supporting studies of the Pu contamination at Palomares that have been carried out by the Centro de Investigaciones Energeticas, Medioambientales y Tecnologicas (CIEMAT) in Madrid. The purpose of this study is to evaluate the resuspension of Pu from the soil in terms of Pu-concentrations in air and resuspension rates in a complementary investigation to those of CIEMAT but in an intensive short-term field effort. This study complements the resuspension studies of CIEMAT at Palomares with additional information, and with confirmation of their previous studies. Observed mass loadings (M) were an average of 70 mg/m{sup 3} with peaks in the daytime of 130 mg/m{sup 3} and low values at night below 30 {micro}g/m{sup 3}. The Pu-activity of aerosols (A) downwind of plot 2-1 was 0.12 Bq/g and the enhancement factor (E{sub f}) had a value of 0.3, which is low but similar to a typical value of 0.7 for other undisturbed sites. This E{sub f} value may increase further away from ground zero. The particle size distribution of the Pu in air measured by cascade impactors was approximately lognormal with a median aerodynamic diameter of 3.7 {micro}m and a geometric standard deviation of 3.5 in the respirable range. This peak midway between 1 ? m and 10 {micro}m in the respirable range is commonly observed. Daily fluctuations in the Pu concentration in air (C) detected by the UHV were lognormally distributed with a geometric standard deviation of 4.9 indicating that the 98th percentile would be 24 times as high as the median. Downwind of plot 2-1 the mean Pu concentration in air, C, was 8.5 {micro}Bq/m{sup 3}. The resuspension factor (Sf) was 2.4 x 10{sup -10} m{sup -1} and agrees very well with the values between 10{sup -10} m{sup -1} and 10{sup -9} m{sup -1} previously reported. We observed a mean Pu/Am ratio of 7.1 with a relative variation of 30%, which compares well with a mean value of 6.5 for nearby plot 2-2. The resuspension rate (R) was in the middle of the range, 10{sup -11} s{sup -1} to 10{sup -12} s{sup -1} as observed in other stable sites, and indicates low potential for Pu redistribution.

Shinn, J

2002-10-01T23:59:59.000Z

77

approval information summary: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

INFORMATION Full Name Daniel Olmedilla Place of birth Madrid Date Madrid Madrid, Spain Grade "summa cum laude" with European mention 1997 - 2001 Computer Science Engineer...

78

Universidad Autonoma de Madrid Algebra Lineal. Curso 2010-11 Matematicas  

E-Print Network [OSTI]

Universidad Aut´onoma de Madrid ´Algebra Lineal. Curso 2010-11 Matem´aticas ´ALGEBRA LINEAL Hoja 3: Aplicaciones lineales 1. Determinar cu´ales de las siguientes aplicaciones son lineales: (a) F : R2 - R2 una aplicaci´on lineal con las propiedades que se indican. (Si existe definirla y si no existe dar una

González Díez, Gabino

79

La Universidad de Alicante expone en Madrid maquetas de arquitecturas singulares hechas por sus alumnos  

E-Print Network [OSTI]

La Universidad de Alicante expone en Madrid maquetas de arquitecturas singulares hechas por sus Lightness 6 bajo el lema "Arquitectura Música Luz= espacio sonido sombra", está instalada en la sala de exposiciones de Fundación Arquitectura COAM, coordinada por el profesor Antonio Maciá con la colaboración de

Escolano, Francisco

80

Effects of epitaxial strain on the growth mechanism in YBa2Cu3O7x thin films in YBa2Cu3O7x PrBa2Cu3O7 superlattices  

E-Print Network [OSTI]

, 28040 Madrid, Spain 2 Materials Sciences Division, 72-222, Lawrence Berkeley National Laboratory Legane´s, Madrid, Spain 4 Instituto de Ciencia de Materiales ICMM-CSIC, 28049 Madrid, Spain Received 27

Krishnan, Kannan M.

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

The Virtual Observatory and Grid in Spain  

E-Print Network [OSTI]

The Virtual Observatory (VO) is nearing maturity, and in Spain the Spanish VO (SVO) exists since June 2004. There have also been numerous attempts at providing more or less encompassing grid initiatives at the national level, and finally Spain has an official National Grid Initiative (NGI). In this article we will show the VO and Grid development status of nationally funded initiatives in Spain, and we will hint at potential joint VO-Grid use-cases to be developed in Spain in the near future.

J. D. Santander-Vela

2008-07-08T23:59:59.000Z

82

TME Spain | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORTOpenWende NewSowitec do Brasil EnergiaSur deT-O Green EuropeTME Spain

83

from the members: The naked truth of postdocs in Spain  

E-Print Network [OSTI]

cuts will cause “exodus” from Spain. Science, 336, 139-140.naked truth of postdocs in Spain With this letter we intendfellowship to later return to Spain thanks to another (

Jimenez-Valverde, Alberto; Acevedo, Pelayo

2012-01-01T23:59:59.000Z

84

Is Nothing Sacred? Spain Performs the Death of God  

E-Print Network [OSTI]

The Poetry of modernismo in Spain." The Cambridge HistoryNothing Sacred? Spain Performs the Death of God Is Alrick C.tone of nineteenth-century Spain evolves, in the strategy of

Knight, Jr., Alrick C.

2006-01-01T23:59:59.000Z

85

Light pollution in Spain. An european perspective  

E-Print Network [OSTI]

Spain appears in light pollution maps as a country less polluted than their neighbours in the European Union. This seems to be an illusion due to its low population density. The data indicate that Spain is one of the most contaminated countries. To reach these conclusions we compare the Spanish case to those of other European countries.

Alejandro Sanchez de Miguel; Jaime Zamorano

2008-10-23T23:59:59.000Z

86

Secrets of the arts : Enlightenment Spain's contested Islamic craft heritage  

E-Print Network [OSTI]

This dissertation examines the artistic and architectural mutations occurring in Spain during the eighteenth century, when Spain decided to participate in the Enlightenment's philosophical project that emphasized the ...

Francis, Razan

2014-01-01T23:59:59.000Z

87

Universidad Autonoma de Madrid Algebra Lineal. Curso 2010-11 Matematicas  

E-Print Network [OSTI]

Universidad Aut´onoma de Madrid ´Algebra Lineal. Curso 2010-11 Matem´aticas ´ALGEBRA LINEAL Hoja 7 respecto de B) coincide con la aplicaci´on lineal f(x, y, z) = x - y. Encontrar bases de Ker(f) = N(f) y de Im f. Comprobar la f´ormula de la dimensi´on. 2. Sea f : M2×2 R3 la aplicaci´on lineal dada por f

González Díez, Gabino

88

Universidad Autonoma de Madrid Algebra Lineal. Curso 2011-12 Matematicas  

E-Print Network [OSTI]

Universidad Aut´onoma de Madrid ´Algebra Lineal. Curso 2011-12 Matem´aticas ´ALGEBRA LINEAL Hoja 8 respecto de B) coincide con la aplicaci´on lineal f(x, y, z) = x - y. Encontrar bases de Ker(f) = N(f) y de Im f. Comprobar la f´ormula de la dimensi´on. 2. Sea f : M2×2 R3 la aplicaci´on lineal dada por f

González Díez, Gabino

89

Universidad Autonoma de Madrid ALGEBRA LINEAL Hoja 5. Aplicaciones lineales: Nucleo e imagen. Cambios de base.  

E-Print Network [OSTI]

Universidad Aut´onoma de Madrid ´ALGEBRA LINEAL Hoja 5. Aplicaciones lineales: N´ucleo e imagen. Cambios de base. 1.- Se consideran las aplicaciones lineales f : R3 R3 dada por f(x1, x2, x3) = (x1 + x2 lineales f : E F y g: F G. Demostrar que Nuc(g f) = f-1 [Nuc g Im f]. 4.- Sean V1, V2 y V3 K

Otero Domínguez, Margarita

90

Universidad Autonoma de Madrid Algebra Lineal. Curso 2011-12 Matematicas  

E-Print Network [OSTI]

Universidad Aut´onoma de Madrid ´Algebra Lineal. Curso 2011-12 Matem´aticas ´ALGEBRA LINEAL Hoja 3 conjunto de soluciones de un sistema de ecuaciones lineales homog´eneas. 2. Demuestra que los siguientes lineales homog´eneas. (a) V1 = {A M(R)2 : A = At} (b) V2 = {A M(R)2 : A es diagonal } 3. Sea W el

González Díez, Gabino

91

Spain offers a total of 900 Millions Spain proposes to double her contribution to host ITER, the experimental fusion  

E-Print Network [OSTI]

Spain offers a total of 900 Millions Spain proposes to double her contribution to host ITER commission Romani Prodi and the rotating presidency of the European Union, held by Italy, that Spain. The science and technology minister, Juan Costa, stated that Spain is now willing to contribute 20

92

Course Syllabus-"Sketches of Spain": Spain in Contemporary Mass and Visual Culture Language of Instruction: English  

E-Print Network [OSTI]

Course Syllabus-"Sketches of Spain": Spain in Contemporary Mass and Visual Culture Language and assets and in the development of Spain's main industries and businesses, leveraging the legacy would address questions such as: how is "Spanish-ness" been fabricated in Spain and outside? how does

93

A residential energy demand system for Spain  

E-Print Network [OSTI]

Sharp price fluctuations and increasing environmental and distributional concerns, among other issues, have led to a renewed academic interest in energy demand. In this paper we estimate, for the first time in Spain, an ...

Labandeira Villot, Xavier

2005-01-01T23:59:59.000Z

94

Discriminating Shareholders through the Exclusion of Pre-emption Rights? The European Infringement Proceeding against Spain  

E-Print Network [OSTI]

Kristoffel Grechenig ECFR 4/2007 V. Why Spain? . . . . . . .Commission decided to call on Spain to change its corporatewould decrease in value. Spain considered the Com- missions

Grechenig, Kristoffel

2009-01-01T23:59:59.000Z

95

Black Africans in Barcelona, Spain: An Exploration of Integration into Catalan Society  

E-Print Network [OSTI]

les minoreis elniques. Lerida, Spain: Universitat de L1eida.6 200 1-2004. Catalunya, Spain: Grinver. SA. Gozalvez Perez,Picanya (Valencia), Spain: Generalitat Valenciana. Makom •

Osuji, Chinyere

2006-01-01T23:59:59.000Z

96

Is Spain a Statist Society? A Research Perspective on Organizations, Reflexivity and Collective Action  

E-Print Network [OSTI]

the United Kingdom and Spain”, Dirección General de Cienciathe United Kingdom and Spain. ” Dirección General de Ciencia1994b. “Social Movements in Spain. ” Tocqueville Revue, Vol.

Laraña, Enrique

2009-01-01T23:59:59.000Z

97

Readings in Common: Assimilation and Interpretive Authority in Early Modern Spain  

E-Print Network [OSTI]

Practice in Early Modern Spain. Minneapolis: University of1993. Harvey, L. P. Muslims in Spain, 1500-1614. Chicago:of Religion in Early Modern Spain. Princeton: Princeton

Kimmel, Seth Ross

2010-01-01T23:59:59.000Z

98

Mediterranean clonal selections evaluated for modern hedgerow olive oil production in Spain  

E-Print Network [OSTI]

station, Constantí, Catalonia, Spain. We are grateful toBoella farm (La Canonja, Spain) for their collaboration inolive oil production in Spain Paul M. Vossen by Joan Tous,

Tous, Joan; Romero, Agusti; Hermoso, Juan Francisco; Ninot, Antonia

2011-01-01T23:59:59.000Z

99

WITeLibrary Home of the Transactions of the Wessex Institute.  

E-Print Network [OSTI]

Universidad Politecnica de Madrid, Spain AAldama IMTA, Mexico C Alessandri Universita di Ferrara, Italy D

Qin, Qinghua

100

The Pitfalls of Democracy and Debate: Authority and Inequality in Classrooms in Southeast Spain  

E-Print Network [OSTI]

F. (2011, February 7). Spain’s salad growers are modern-dayclasses in southeast Spain. She can be contacted atin Classrooms in Southeast Spain Maisa Taha University of

Taha, Maisa

2013-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Internship in Toulouse FRANCE / Girona SPAIN / Nottingham UK The Company  

E-Print Network [OSTI]

Internship in Toulouse FRANCE / Girona SPAIN / Nottingham UK The Company Stipje is an organisation. We have offices in the United Kingdom, France and Spain and have students working with us from almost

Rostock, Universität

102

Computer Architecture and Electronics Department University of Crdoba (Spain)  

E-Print Network [OSTI]

Computer Architecture and Electronics Department University of Córdoba (Spain) Advance Driver. The University of Córdoba is one of the most prestigious universities in Spain, and a pioneer in the fields

Kuehnlenz, Kolja

103

Senior DOE Officials in Spain to Participate in World Petroleum...  

Broader source: Energy.gov (indexed) [DOE]

Senior DOE Officials in Spain to Participate in World Petroleum Congress, July 1, 2008 Senior DOE Officials in Spain to Participate in World Petroleum Congress, July 1, 2008 Senior...

104

PENSAMIENTO arborVolumen CLXXXIII N 728 noviembre-diciembre [2007] Madrid [Espaa] ISSN: 0210-1963  

E-Print Network [OSTI]

CIENCIA PENSAMIENTO Y CULTURA arborVolumen CLXXXIII Nº 728 noviembre-diciembre [2007] Madrid CIENCIA CONSEJO SUPERIOR DE INVESTIGACIONES CIENTÍFICAS #12;ARBOR Ciencia, Pensamiento y Cultura CLXXXIII muy fructífero de la ciencia del siglo XXI. PALABRAS CLAVE: Einstein, sistemas complejos. 1

Rey Juan Carlos, Universidad

105

AREA ANEP REFERENCIA NOMBRE CENTRO PROVINCIA FISICA Y CIENCIAS DEL ESPACIO 11-675-01-01 GIANLUCA CALGAGNI IEM MADRID  

E-Print Network [OSTI]

AREA ANEP REFERENCIA NOMBRE CENTRO PROVINCIA FISICA Y CIENCIAS DEL ESPACIO 11-675-01-01 GIANLUCA CALGAGNI IEM MADRID FISICA Y CIENCIAS DEL ESPACIO 11-675-01-02 MERCEDES LOPEZ MORALES ICE BARCELONA FISICA Y CIENCIAS DEL ESPACIO 11-675-01-03 MICHELE DELLA MORTE IFIC VALENCIA FISICA Y CIENCIAS DEL ESPACIO

Fitze, Patrick

106

Short Paper submitted to Bicycle Session at T2M Madrid 2012 Historical factors for better cycling  

E-Print Network [OSTI]

1 Short Paper submitted to Bicycle Session at T2M Madrid 2012 Historical factors for better, the bicycle as a transport mode has focused little historical research, at least available sources relating to cycling for transport1. The bicycle fleet is well

Paris-Sud XI, Université de

107

CP 2005 Sitges, Spain, October 3, 2005 Preference Reasoning  

E-Print Network [OSTI]

CP 2005 Sitges, Spain, October 3, 2005 Preference Reasoning Francesca Rossi University of Padova, Italy CP 2005 Sitges, Spain, October 3, 2005 Joint work with ... Stefano Bistarelli, Univ. Pescara, Australia CP 2005 Sitges, Spain, October 3, 2005 Ultimate goal A formalism to model many kinds

Rossi, Francesca

108

Spain and the Bologna Plan: A Modern Day  

E-Print Network [OSTI]

Spain and the Bologna Plan: A Modern Day Controversy By: Danielle Vasan Communication of Privatization #12;Higher Education in Spain before Bologna 1983: Three-cycled degree system Diplomado (3-5 years) Licenciado (1-2 years) Doctor (3 years & Thesis) #12;Higher Education in Spain Today Graduado

New Hampshire, University of

109

UMass Lowell Intensive Spanish Language & Culture in Cdiz, Spain  

E-Print Network [OSTI]

UMass Lowell Intensive Spanish Language & Culture in Cádiz, Spain Program Description Travel to Spain and study at the University of Cádiz in a specialized intensive language program established Lowell During the Summer in Cádiz, Spain! Complete Levels 1-4 (12 credit) of Spanish language in one

Massachusetts at Lowell, University of

110

INTRODUCTION The massive sulfide deposits of southern Spain  

E-Print Network [OSTI]

INTRODUCTION The massive sulfide deposits of southern Spain and Portugal were formed about 300 Ma). Spain became a Roman province, and mining of the rich deposits of the Iberian pyrite belt for copper, California 94025 A. Palanques Instituto de Ciencias del Mar, 08039 Barcelona, Spain ABSTRACT A metal

van Geen, Alexander

111

Renewable Energy Policy and Developments in Spain  

E-Print Network [OSTI]

Renewable Energy Policy and Developments in Spain Wednesday, October 30, 2013 4:00 - 5:30 p in Spanish energy policy. In this talk, Labandeira describes Spanish policies to promote renewable energy, assessing their effectiveness within a wider energy and public-policy context. RSVP link: Download any free

Zhang, Junshan

112

Limnetica, 29 (2): x-xx (2011)Limnetica, 30 (1): 59-70 (2011) c Asociacion Iberica de Limnologia, Madrid. Spain. ISSN: 0213-8409  

E-Print Network [OSTI]

las ´areas m´as ´aridas del Mediterr´aneo occidental, pre- senta una amplia variedad de ecosistemas

Murcia, Universidad de

113

Preprint submitted to the Proceedings of the European Wind Energy Conference EWEC in Madrid, Spain June 2003 PREVIENTO meets HORNS REV  

E-Print Network [OSTI]

of future offshore wind farms. Surprisingly, in all possible thermal conditions measured speeds of westerly Horns Rev offshore wind farm has to be considered as a step to new dimensions in wind power production June 2003 1 PREVIENTO meets HORNS REV Short-Term Wind-Power Prediction ­ adaptation to Offshore Sites

Heinemann, Detlev

114

Fitze, P. S. (2012). Spanish Sand Racer Psammodromus hispanicus. En: Enciclopedia Virtual de los Vertebrados Espaoles. Salvador, A., Marco, A. (Eds.). Museo Nacional de Ciencias Naturales, Madrid.  

E-Print Network [OSTI]

Vertebrados Españoles. Salvador, A., Marco, A. (Eds.). Museo Nacional de Ciencias Naturales, Madrid. http los Vertebrados Españoles. Salvador, A., Marco, A. (Eds.). Museo Nacional de Ciencias Naturales

Alvarez, Nadir

115

Territorial Dimension as Political Strategy: Elite-driven Center-Periphery Cleavage in Spain 1977-2008  

E-Print Network [OSTI]

Party Collaboration in Spain (1977-2004). ComparativeEthnoterritorial Concurrence in Spain. Publius: Journal ofand Regional Elections in Spain. South European Society and

Martinez-Tapia, Oscar

2008-01-01T23:59:59.000Z

116

Universidad Autonoma de Madrid, doble grado Matematicas-Informatica Curso 2013-14 ALGEBRA LINEAL Y GEOMETRIA  

E-Print Network [OSTI]

LINEAL Y GEOMETR´IA Hoja 0. Repaso de ´Algebra Lineal 1. Sean F := {(x, y, z, t) R4 : x + y + z = 0, zUniversidad Aut´onoma de Madrid, doble grado Matem´aticas-Inform´atica Curso 2013-14 ´ALGEBRA´on. iii) ¿Cu´al es el m´inimo n´umero de ecuaciones lineales homog´eneas que necesitamos para de- scribir

Fernández Gallardo, Pablo

117

Universidad Autonoma de Madrid, doble grado Matematicas-Informatica Curso 2013-14 ALGEBRA LINEAL Y GEOMETRIA  

E-Print Network [OSTI]

Universidad Aut´onoma de Madrid, doble grado Matem´aticas-Inform´atica Curso 2013-14 ´ALGEBRA LINEAL Y GEOMETR´IA Hoja 6. Espacio af´in ii 1. Considera el siguiente par de rectas del espacio af´in A3´on de los valores de y . b) Describe la variedad lineal suma af´in de r y s, tambi´en en funci´on de

Fernández Gallardo, Pablo

118

Universidad Autonoma de Madrid Curso 2012-13 ALGEBRA LINEAL Primero del Doble Grado Matematicas-Informatica  

E-Print Network [OSTI]

Universidad Aut´onoma de Madrid Curso 2012-13 ´ALGEBRA LINEAL Primero del Doble Grado Matem´an colgando en la p´agina de la asignatura. Bibliograf´ia M. Castellet e I. Llerena, ´Algebra Lineal y Geometr´ia. Ed. Revert´e 1991 (teor´ia de los temas I,II y IV) L. Merino y E. Santos, ´Algebra Lineal con m

Otero Domínguez, Margarita

119

Universidad Autonoma de Madrid, doble grado Matematicas-Informatica Curso 2013-14 ALGEBRA LINEAL Y GEOMETRIA  

E-Print Network [OSTI]

Universidad Aut´onoma de Madrid, doble grado Matem´aticas-Inform´atica Curso 2013-14 ´ALGEBRA LINEAL Y GEOMETR´IA Hoja 5. Espacio af´in i 1. Sea S el conjunto de puntos (x1, x2, x3) de A3 R que satisfacen la condici´on 2x1 +x2 -x3 = 3. Demuestra, usando la definici´on, que S es una variedad lineal de A

Fernández Gallardo, Pablo

120

asturias spain genetic: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

true of Jurassic turtles from Wes- tern Europe. A new genus and species of Late Jurassic turtle Benton, Michael 204 Last date modified 11613 Location and Institution SPAIN...

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

andratx mallorca spain: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Websites Summary: Iron oxide mineralogy in late Miocene red beds from La Gloria, Spain: rock-magnetic, voltammetric spectroscopy and voltammetry. All three methods have low limits...

122

E-Print Network 3.0 - active region spectra Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

de Madrid, Dpt. de Astrofsica, Facultad C.C. Fsicas, Madrid, Spain, dmg@astrax.fis.ucm.es, Summary: -infrared indicators of chromospheric activity. The spectra have been...

123

Zarzuela : or lyric theatre as consumer nationalism in Spain, 1874-1930  

E-Print Network [OSTI]

2003. Carr, Raymond. Spain, 1808-1975. 2 nd ed. Oxford:Chase, Gilbert. The Music of Spain. 2 nd rev. ed. New York:in Renaissance England and Spain. Ithaca: Cornell UP, 1985.

Young, Clinton David

2006-01-01T23:59:59.000Z

124

First approach to the El Frontal tracksite (Berriasian, Soria, Spain): perspectives on  

E-Print Network [OSTI]

207 First approach to the El Frontal tracksite (Berriasian, Soria, Spain): perspectives Català de Paleontologia Miquel Crusafont. Carrer Escola Industrial, 23, 08201 Sabadell (Barcelona) Spain Ciencias. Universidad de Zaragoza. Calle Pedro Cerbuna, 12, 50009 Zaragoza, Spain. bernat

Falkingham, Peter

125

International Family Business Succession Planning. Recent Developments in Germany and Spain  

E-Print Network [OSTI]

4. Recents reforms in Spain 4.1. Family Protocols in theDevelopments in Germany and Spain Business Roland Krausein North America; 50% in Spain and 80 % in Germany. 8

Krause, Roland

2009-01-01T23:59:59.000Z

126

Traumatized subjects : horror film and the legacy of mass extermination in post-dictatorship Spain  

E-Print Network [OSTI]

6-18. No-Do. Dir. Elio Quiroga. Spain: Eqlipse ProduccionesDir. Antonio Bayona. Spain: Rodar y Rodar, 2007. Los ojos deDir. Guillem Morales. Spain: Rodar y Rodar, 2010. Ortega y

Boehm, Scott Walter

2012-01-01T23:59:59.000Z

127

A Transatlantic Dialogue: Argentina, Mexico, Spain, and the Literary Magazines that Bridged the Atlantic (1920-1930)  

E-Print Network [OSTI]

literarias entre España y la Argentina. Madrid: Instituto devanguardias literarias: Argentina, Uruguay, Paraguay. Eds.revistas literarias argentinas (1893-1967). Buenos Aires: El

Fernandez, Vanessa

2013-01-01T23:59:59.000Z

128

SPAN 320's (all civ courses, Spain and Latin America) Course Objectives and Programmatic Alignment  

E-Print Network [OSTI]

SPAN 320's (all civ courses, Spain and Latin America) Course Objectives in Spain/Latin America's social history Graded oral presentation Essays 1a, 1b

Mayfield, John

129

E-Print Network 3.0 - asturias spain idria Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sites from northwestern Spain... , near Spain, by 1988 (Hay 1990). In Venice Lagoon in northern Italy in 1992 and in Mar Picolo Source: San Francisco Estuary...

130

E-Print Network 3.0 - almaden asturias spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

sites from northwestern Spain... , near Spain, by 1988 (Hay 1990). In Venice Lagoon in northern Italy in 1992 and in Mar Picolo Source: San Francisco Estuary...

131

ROSER MATAMALA Ph.D. in Biological Sciences, 1997. University of Barcelona (Spain), Smithsonian  

E-Print Network [OSTI]

-1993 Research Assistant, Institut de Recerca i Tecnologia Agroalimentaries, IRTA, Cabrils, Spain Publications

Kemner, Ken

132

CROSS-CULTURAL BUSINESS BEHAVIOR. DOING BUSINESS IN SPAIN. (SUMMER 2012)  

E-Print Network [OSTI]

CROSS-CULTURAL BUSINESS BEHAVIOR. DOING BUSINESS IN SPAIN. (SUMMER 2012) Lecturer: Ms. Pilar Barra etiquette and the way to negotiate in Spain. - To analyse the keys to improve business negotiations in Spain Traditions and Customs 2.- Corporate Culture in Spain 2.1 Spanish Economy 2.2 Corporate Culture in Spanish

Escolano, Francisco

133

Volume 102, pp. 209220 OctoberDecember 2007 Observations in Pluteus section Pluteus in Spain  

E-Print Network [OSTI]

in Spain: two new records for Europe A. Justo & M.L. Castro fjusto@uvigo.es or alfredo de Vigo E-36310 Vigo Spain Abstract -- Pluteus atropungens and Pluteus brunneidiscus are recorded in studies of fungal biodiversity in the Iberian Peninsula (Spain, Portugal) and Balearic Islands (Spain

Hibbett, David S.

134

Coming out in Spain: 'Los Invisibles Published Thursday 24th February 11  

E-Print Network [OSTI]

Coming out in Spain: 'Los Invisibles Published Thursday 24th February 11 Dr Richard Cleminson in Spain. His co-authored 'Los Invisibles': A History of Male Homosexuality in Spain, 1850 been published in Spain. "The history of this period must never be forgotten. It serves not only

Berzins, M.

135

GENERAL CO-CHAIRS: F. J. Perales (Univ. Illes Balears, Spain)  

E-Print Network [OSTI]

GENERAL CO-CHAIRS: F. J. Perales (Univ. Illes Balears, Spain) B. Fisher (University of Edinburgh, UK) PROGRAM COMMITTEE: Abásolo, M. (DMI-UIB, Spain) Aloimonos, Y. (Univ. of Maryland, USA) Bagdanov, A. D. (UAB-CVC, Spain) Baldasarri, S. (Univ. Zaragoza, Spain) Bartoli A. (CNRS_LASMEA, France

Illes Balears, Universitat de les

136

MANAGING THE NATIONAL ROAD NETWORK MAINTENANCE IN SPAIN Vctor Gmez Fras  

E-Print Network [OSTI]

MANAGING THE NATIONAL ROAD NETWORK MAINTENANCE IN SPAIN Víctor Gómez Frías GETINSA (Spain), vgomez@getinsa.es Teresa Sánchez Chaparro ANECA (Spain), tsanchez@aneca.es ABSTRACT The Spanish Ministry of Public Works point of view. In order to understand the importance and difficulty that presents in Spain

Paris-Sud XI, Université de

137

Sir --We read with interest your editorial "Ending the pain in Spain" (Nature 428, 1;  

E-Print Network [OSTI]

Sir -- We read with interest your editorial "Ending the pain in Spain" (Nature 428, 1; 2004 expertise and will to come and work in Spain. Mark van Raaij* Departamento de Bioquímica, Facultad de postdoc working outside Spain for almost five years, I welcome your Editorial "Ending the pain in Spain

138

Comparison of the Evolution of Energy Intensity in Spain and in the EU15. Why is Spain Different?  

E-Print Network [OSTI]

Energy intensity in Spain has increased since 1990, while the opposite has happened in the EU15. Decomposition analysis of primary energy intensity ratios has been used to identify which are the key sectors driving the ...

Ocaña, Carlos

139

July 2013 M.S. in Genetics -University of A Corua, A Corua, Spain June 2012 B.S. in Biology -University of A Corua, A Corua, Spain  

E-Print Network [OSTI]

EDUCATION July 2013 M.S. in Genetics - University of A Coruña, A Coruña, Spain June 2012 B.S. in Biology - University of A Coruña, A Coruña, Spain RESEARCH INTERESTS Marine Biology, Genotoxicology, Chromosomal Proteins, Molecular Evolution, Genomics, Molecular Techniques. 2011 University of A Coruña, Spain

Eirin Lopez, Jose Maria

140

AND RELATIVE RICHARDSON-  

E-Print Network [OSTI]

´ia, Consejo Superior de Investigaciones Cient´ificas, Serrano 144, 28006 Madrid, Spain. M. Torres Instituto de F´isica Aplicada, Consejo Superior de Investigaciones Cient´ificas, Serrano 144, 28006 Madrid, Spain

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Computers & Graphics 26 (2002) 143149 Chaos and Graphics  

E-Print Network [OSTI]

, Manuel Alfonsecaa a Departamento de Ingenier!ia Inform!atica, Universidad Aut!onoma de Madrid, Informatica, Madrid, Spain b Centro de Investigaciones Energ!eticas, Medioambientales y Tecnol!ogicas, Spain

Alfonseca, Manuel

142

Published: March 07, 2011 r 2011 American Chemical Society 2179 dx.doi.org/10.1021/ma102707f |Macromolecules 2011, 44, 21792189  

E-Print Network [OSTI]

Tecnologia de Polimeros, ICTP-CSIC, Juan de la Cierva 3, 28006 Madrid, Spain ) Health Sciences Electron

Hitchcock, Adam P.

143

COLLOQUE DE PHYSIQUE Colloque C4, suppl6ment au 11'14, Tome 51, 15 juillet 1990  

E-Print Network [OSTI]

and Instituto de Cienca de Materiales, CSIC, Serrano 144, SP-28006 Madrid, Spain Un melanqe de poudres de Fe et

Paris-Sud XI, Université de

144

On showy dwarfs and sober giants: body size as a constraint for the evolution of bird plumage colouration  

E-Print Network [OSTI]

of Natural Sciences (Museo Nacional de Ciencas Naturales, CSIC), Madrid, SPAIN Galván I., Negro J. J

Carrascal, Luis M.

145

Forging an Ascetic Planet: Jesuit Lives and Virtues on the Mission Frontier of Eighteenth-Century New Spain  

E-Print Network [OSTI]

Atlantic World: Britain and Spain in America, 1492-1830. Newcentury Revolution in Spain. Princeton: Princeton UP, 1958.265-76. Lynch, John. Bourbon Spain, 1700-1808. New York:

Green, Bryan David

2012-01-01T23:59:59.000Z

146

Awardee AwardeeHeadquarters RecoveryFunding TotalValue Denmark  

Open Energy Info (EERE)

TotalValue Denmark Catalonia Spain Tech Inc Pittsburgh Pennsylvania Madrid Spain Germany Italy Belgium Czech Republic France Germany Ireland Norway United Kingdom Minnesota...

147

VOLUME 84, NUMBER 19 P H Y S I C A L R E V I E W L E T T E R S 8 MAY 2000 Theory and Experiments on Elastic Band Gaps  

E-Print Network [OSTI]

Investigaciones Científicas (CSIC), Serrano 144, 28006 Madrid, Spain 2 Ames Laboratory, Iowa State University, Ames, Iowa 50011 3 Instituto de Acústica, CSIC, Serrano 144, 28006 Madrid, Spain 4 Instituto de Física Aplicada, CSIC, Serrano 144, 28006 Madrid, Spain (Received 26 February 1999) We study elastic band gaps

148

ACTIVITY COORDINATOR HOST LOCATION 1.1. Observation session for management level European partners UA Spain  

E-Print Network [OSTI]

UA Spain 1.2. Observation session for Staff level European partners UPMF France 2.1. Development.3. Management meetings UA, PU UA, PU Spain, Jordan 4. Networking and sustainability (network) 3. Capacity

149

E-Print Network 3.0 - asturias northern spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Publishers. Printed in the Netherlands. Summary: , near Spain, by 1988 (Hay 1990). In Venice Lagoon in northern Italy in 1992 and in Mar Picolo... Spain in Galicia by 1988,...

150

Proactive Recruitment and Retentionist Patterns of Migration and Nationality Policy in Argentina, Italy, and Spain (1850-1919).  

E-Print Network [OSTI]

and Nationality Policies in Argentina, Italy, and Spain (First, I examine Argentina’s policy of attracting migrants/and Nationality Policy in Argentina, Italy, and Spain (1850-

Cook Martín, David

2005-01-01T23:59:59.000Z

151

Join the College of Business and Behavioral Science in Barcelona, Spain When: First Summer Session 2012  

E-Print Network [OSTI]

Join the College of Business and Behavioral Science in Barcelona, Spain When: First Summer Session 2012 Where: Barcelona, Spain Courses: Clemson University courses taught in English by Clemson Spain's Majestic Costa Brava Current plans call for students and professors to live together

Bolding, M. Chad

152

Tips on Studying Abroad at the Universidad Politcnica de Valencia in Spain  

E-Print Network [OSTI]

Tips on Studying Abroad at the Universidad Politécnica de Valencia in Spain Want to know what it- ence a new culture. · Valencia was the only place that CEE majors could go in Spain, so that's where I largest city in Spain, so don't worry about running out of things to do or being bored. From the City

Li, Mo

153

PEFC-Certified Fencing for 2010 Pamplona Bull Run JUL 05 2010 | SPAIN  

E-Print Network [OSTI]

PEFC-Certified Fencing for 2010 Pamplona Bull Run JUL 05 2010 | SPAIN This year, the fences marking and to create local jobs. Welcoming the decision, PEFC Spain Director, Ana Noriega commented "we are delighted to PEFC, the world's largest forest certification system and the leading system in Spain, ensuring

154

Late Quaternary deposition and facies model for karstic Lake Estanya (North-eastern Spain)  

E-Print Network [OSTI]

Late Quaternary deposition and facies model for karstic Lake Estanya (North-eastern Spain) MARIO-50059 Zaragoza, Spain (E-mail: mariomm@ipe.csic.es) EAWAG, Swiss Federal Institute of Aquatic Research Ca´diz, Poli´gono Ri´o San Pedro s/n, 11510 Puerto Real (Ca´diz), Spain Associate Editor: Stephen

Gilli, Adrian

155

Country Profile -Spain What are my chances of getting a job?  

E-Print Network [OSTI]

1 Country Profile - Spain Job market What are my chances of getting a job? Finding graduate work in Spain is currently very difficult as unemployment is extremely high. In March 2012 the BBC reported that Spain has the highest unemployment rate in the European Union (EU), with almost one in four people

Banaji,. Murad

156

Numerical simulation and sensitivity study of a severe hailstorm in northeast Spain  

E-Print Network [OSTI]

Numerical simulation and sensitivity study of a severe hailstorm in northeast Spain E. García Atmósfera, Instituto de Medio Ambiente, Universidad de León, 24071 León, Spain b Grup de Meteorologia, Departament de Física, Universitat de les Illes Balears, Palma de Mallorca, Spain Accepted 8 August 2005

Romero, Romu

157

A Comparison of Management Strategies in the Oak Woodlands of Spain and California1  

E-Print Network [OSTI]

A Comparison of Management Strategies in the Oak Woodlands of Spain and California1 Lynn Huntsinger and savannas in California and southern Spain are compared. There are many similarities between the Spanish woodlands and savanna in California and southern Spain (table 1). Although the two woodlands have much

Standiford, Richard B.

158

Cultural Capital in Spain'S MeMory WarS Dr. SebaStiaan Faberoberlin College  

E-Print Network [OSTI]

History MeMory trutH Cultural Capital in Spain'S MeMory WarS Dr. SebaStiaan Faberoberlin College Since the late 1990s, Spain has seen a series of public disputes over the historical memory tell it--and the relationship that today's Spain should have with that past. In the past fifteen years

Andrews, Peter B.

159

SPAIN: COTS Data-Center Ethernet for Multipathing over Arbitrary Topologies  

E-Print Network [OSTI]

SPAIN: COTS Data-Center Ethernet for Multipathing over Arbitrary Topologies Jayaram Mudigonda switches, which could obviate the commodity pricing of these parts. In this paper, we describe SPAIN ("Smart Path Assign- ment In Networks"). SPAIN provides multipath forward- ing using inexpensive

160

Cestodes from Artemia parthenogenetica (Crustacea, Branchiopoda) in the Odiel Marshes, Spain  

E-Print Network [OSTI]

Cestodes from Artemia parthenogenetica (Crustacea, Branchiopoda) in the Odiel Marshes, Spain/n, 41013 Seville, Spain Abstract A total of 3,300 specimens of brine shrimps Artemia parthenogenetica from the Odiel Marshes, Huelva Province, SW Spain, were studied during several seasons of 2002 and 2003

Green, Andy J.

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

2011-2012BROWNBAGCOLLOQUIUMSERIES A Gambler's Penance in Seventeenth Century Spain  

E-Print Network [OSTI]

2011-2012BROWNBAGCOLLOQUIUMSERIES A Gambler's Penance in Seventeenth Century Spain WEDNESDAY, and Collaboration in Early Modern Spain," has been published in 2011. He has also published various chapters in books about Cervantes or about Masculinity in Spain and Italy. Additionally, he is a member

Berdichevsky, Victor

162

Analysis of badlands: coupling of tectonic and land surface processes in the Pyrenees of Spain  

E-Print Network [OSTI]

Analysis of badlands: coupling of tectonic and land surface processes in the Pyrenees of Spain MSc to rainstorms. In north-east Spain, sediment from rapidly eroding badlands has significantly reduced reservoir-funded research consortium (SESAM II) with partners at the University of Lleida, Spain

Baer, Christian

163

Testing models for the Messinian salinity crisis: The Messinian record in Almera, SE Spain  

E-Print Network [OSTI]

Testing models for the Messinian salinity crisis: The Messinian record in Almería, SE Spain Juan C Fuentenueva s.n., Universidad de Granada, 18002 Granada, Spain b School of Earth, Ocean and Planetary Sciences, SE Spain, display excellent exposures of Messinian (Late Miocene) sequences. The Sorbas, Almería

Riding, Robert

164

FEEDING ECOLOGY OF THE BARN OWL IN CENTRAL CHILE AND SOUTHERN SPAIN: A COMPARATIVE STUDY  

E-Print Network [OSTI]

FEEDING ECOLOGY OF THE BARN OWL IN CENTRAL CHILE AND SOUTHERN SPAIN: A COMPARATIVE STUDY CARLOSM. HERREV&AND FABIANM. JAKSI·1 EstacidnBioldgicade Dogaria, Sevilla-12, Andalucia, Spain, and Instituto de of the Barn Owl (Tyro alba) in the mediterranean- climate areasof central Chile and southernSpain. In both

Herrera, Carlos M.

165

First report of Neofusicoccum parvum causing canker and die-back of Eucalyptus in Spain  

E-Print Network [OSTI]

First report of Neofusicoccum parvum causing canker and die-back of Eucalyptus in Spain Eugenia disease in Eucalyptus globulus in North Spain. Keywords Eucalyptus canker. Neofusicoccum parvum . Botryosphaeriaceae A canker disease outbreak was observed for the first time on Eucalyptus globulus in North Spain

166

Seropositivity and Risk Factors Associated with Toxoplasma gondii Infection in Wild Birds from Spain  

E-Print Network [OSTI]

Spain Oscar Cabezo´ n1 , Ignacio Garci´a-Bocanegra2 , Rafael Molina-Lo´ pez3 , Ignasi Marco1 , Juan M Veterinaria, Universitat Auto`noma de Barcelona, Bellaterra, Spain, 2 Departamento de Sanidad Animal, Facultad de Veterinaria, Universidad de Co´rdoba, Co´rdoba, Spain, 3 Centre de Fauna Salvatge de Torreferrussa

Richner, Heinz

167

Facultad de Ciencias Econmicas y Empresariales CROSS-CULTURAL BUSINESS BEHAVIOR. DOING BUSINESS IN SPAIN.  

E-Print Network [OSTI]

IN SPAIN. (SUMMER 2011) Lecturer: Ms. Pilar Barra. Department: Finance and Accounting. Universidad de intercultural communication. - To learn both business etiquette and the way to negotiate in Spain. - To analyse the keys to improve business negotiations in Spain. CONTENTS 0.- Introduction. Stereotypes 1.- Influences

Escolano, Francisco

168

BC3954/BC5974 Construction and Culture through Spain and Portugal  

E-Print Network [OSTI]

BC3954/BC5974 Construction and Culture through Spain and Portugal December 27, 2014 ­ January 11 and Culture through Spain and Portugal December 27, 2014 ­ January 11, 2015 The Department of Building Construction is offering its 13th annual interdisciplinary Winter Education Abroad Program through Spain

Beex, A. A. "Louis"

169

WORKING PAPER N 2007 -39 Income and wealth concentration in Spain in a  

E-Print Network [OSTI]

WORKING PAPER N° 2007 - 39 Income and wealth concentration in Spain in a historical and fiscal and Wealth Concentration in Spain in a Historical and Fiscal Perspective Facundo Alvaredo, Paris School of income and wealth in Spain over the 20th century using personal income and wealth tax return statistics

Boyer, Edmond

170

Holocene forest history of the eastern plateaux in the Segura Mountains (Murcia, southeastern Spain)  

E-Print Network [OSTI]

Holocene forest history of the eastern plateaux in the Segura Mountains (Murcia, southeastern Spain´nica), Facultad de Biologi´a, Universidad de Murcia, Campus de Espinardo, 30100 Murcia, Spain b Area de Bota´nica, Facultad de Ciencias, Universidad Auto´noma de Barcelona, 01893 Bellaterra, Barcelona, Spain c School

Herrera, Carlos M.

171

Paternal Genetic History of the Basque Population of Spain  

E-Print Network [OSTI]

This study examines the genetic variation in Basque Y chromosome lineages using data on 12 Y-short tandem repeat (STR) loci in a sample of 158 males from four Basque provinces of Spain (Alava, Vizcaya, Guipuzcoa, and Navarre). As reported...

Young, Kristin Leigh; Sun, Guangyun; Deka, Ranjan; Crawford, Michael H.

2011-01-01T23:59:59.000Z

172

The Ranero Hydrothermal Dolomites (Albian, Karrantza Valley, Northwest Spain)  

E-Print Network [OSTI]

The Ranero Hydrothermal Dolomites (Albian, Karrantza Valley, Northwest Spain): Implications Recherche Développement, Carbonate Sedimentology Group, avenue Larribau s/n, 64018 Pau Cedex - France e'Espagne) sont présentées dans cette étude. Les corps dolomitiques sont encaissés dans des carbonates de

Paris-Sud XI, Université de

173

1 INTRODUCTION In Spain, Plasticized polyvinyl chloride (PVC-  

E-Print Network [OSTI]

1 INTRODUCTION In Spain, Plasticized polyvinyl chloride (PVC- P) geomembranes began being used in waterproof- ing of infrastructure in the seventies. Early usage of PVC-P geomembranes was not particularly for the PVC-P homogeneous geomem- branes used in roofing. Subsequently, other stan- dards were drafted

Zornberg, Jorge G.

174

July 2010 M.S. in Molecular, Cellular Biology and Genetics -University of A Corua, A Corua, Spain. July 2009 B.S. in Biology -University of A Corua, A Corua, Spain.  

E-Print Network [OSTI]

, A Coruña, Spain. July 2009 B.S. in Biology - University of A Coruña, A Coruña, Spain. RESEARCH INTERESTS, Spain. ISBN:978-3-8484-5960-8, pp. 1-66. Ciro Rivera-Casas Ph. D. Student - Department of Cellular15171, Spain GRANTS Grants as a particioant researcher 2011 MICINN, Spanish Research Program

Eirin Lopez, Jose Maria

175

A review of "Conscience on Stage: The Comedia as Casuistry in Early Modern Spain" by Hillaire Kallendorf  

E-Print Network [OSTI]

, social and cultural historians? (20). Hilaire Kallendorf. Conscience on Stage: The Comedia as Casuistry in Early Modern Spain. Toronto: University of Toronto Press, 2007. x + 299 pp. $65. Review by elizabeth r. wright, university of georgia. Spain?s... playwrights. Yet a miniscule proportion of plays have attracted careful and sustained scholarly scrutiny or are performed regularly in repertories. This book reports on one scholar?s project to widen the lens through which we view Spain?s ?Golden Age...

Wright, Elizabeth

2009-01-01T23:59:59.000Z

176

Tourism's Impact on Economic Growth and Development in Spain  

E-Print Network [OSTI]

Tourism's Impact on Economic Growth and Development in Spain Jessica Dennis #12;Spanish Civil War,500,000,000 International Tourism Receipts 1960-2008 (US$ in year 2000) #12;$0 $200,000,000,000 $400,000,000,000 $600 (US$ in the year 2000) #12;0.00% 1.00% 2.00% 3.00% 4.00% 5.00% 6.00% International Tourism Receipts

New Hampshire, University of

177

26 IEEE COMPUTATIONAL INTELLIGENCE MAGAZINE | NOVEMBER 2011 1556-603X/11/$26.002011IEEE European Centre for Soft Computing, SPAIN  

E-Print Network [OSTI]

, European Centre for Soft Computing, SPAIN O. Cordón, European Centre for Soft Computing, SPAIN CITIC-UGR: Research Center on Information and Communication Technologies, University of Granada, 18014 Granada, SPAIN, SPAIN J. Santamaría, University of Granada, SPAIN #12;NOVEMBER 2011 | IEEE COMPUTATIONAL INTELLIGENCE

Granada, Universidad de

178

NCORRECTEDPROOF JVAC 4963 111  

E-Print Network [OSTI]

-08003 Barcelona, Spain7 b Department of Organic Chemistry, University of Barcelona, Barcelona, Spain8 c Animal Health Research Center (INIA), Valdeolmos, Madrid, Spain9 d Severo Ochoa Center for Molecular Biology, CSIC, Cantoblanco, Madrid, Spain10 Received 19 August 2004; accepted 22 October 2004 11 Abstract

Pompeu Fabra, Universitat

179

Therapeutic Index of Gramicidin S is Strongly Modulated by D-Phenylalanine Analogues at the Concepcion Solanas,  

E-Print Network [OSTI]

, Spain, Departament de Cie`ncies Experimentals i de la Salut, UniVersitat Pompeu Fabra, Dr. Aiguader 88, 08003 Barcelona, Spain, Centro de InVestigaciones Biolo´gicas, CSIC, Ramiro de Maeztu 9, 28040 Madrid, Spain, and Instituto de Qui´mica-Fi´sica Rocasolano, CSIC, Serrano 119, 28006 Madrid, Spain Recei

Pompeu Fabra, Universitat

180

The C-Terminus of H-Ras as a Target for the Covalent Binding of Reactive Compounds Modulating Ras-  

E-Print Network [OSTI]

´ficas, Madrid, Spain, 2 Department of Experimental and Health Sciences, Universitat Pompeu Fabra, Barcelona, Spain, 3 Department of Organic Chemistry, Faculty of Sciences, University of Ma´laga, Ma´laga, Spain, 4 Microbiologi´a, Instituto de Salud Carlos III, Madrid, Spain Abstract Ras proteins are crucial players

Pompeu Fabra, Universitat

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Abstract--This paper describes the extensibility mechanism that has been incorporated to the CAIN Adaptation Engine, that  

E-Print Network [OSTI]

.molina@ uam.es). J. M. Martínez, Grupo de Tratamiento de Imágenes, EPS, Universidad Autonoma de Madrid, Madrid Autonoma de Madrid, Madrid, Spain. phone: 0034-91-497-22-60; e-mail: victor.valdes@ uam.es). F. López

Autonoma de Madrid, Universidad

182

E-Print Network 3.0 - ai seville spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

5 > >> 1 Country Host University Provider Course Title Summary: with your Study Abroad Advisor for details. Spain Universidad de Alicante CIEE, Council 20th Century Spanish......

183

E-Print Network 3.0 - arousa nw spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

on Nutrient and Phytoplankton Dynamics in a Shallow Estuary After Summary: Kingdom (Wash, Thames estuary, Horecambe and Caenarfon bays), in Spain (Galice, Mediterranean coast......

184

E-Print Network 3.0 - almeria spain alteracion Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

del Grup d'Hidrologia Subterrnia Dept. Enginyeria del Terreny, Cartogrfica i Geofsica UPC Summary: Groundwater flow and recharge in the Doana aquifer system (Huelva, SW Spain)...

185

E-Print Network 3.0 - algeciras spain steel Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

lower values than model columns... : at a station in Spain. Bottom: at a station in Netherland. The model simulation with assimilation shows better Source: Ecole Polytechnique,...

186

International Family Business Succession Planning. Recent Developments in Germany and Spain  

E-Print Network [OSTI]

Tools of transmission in Germany 2.1. Power of attorney postas being unconstitutional. 33 Germany's Constitutional CourtRecent Developments in Germany and Spain Business Roland

Krause, Roland

2009-01-01T23:59:59.000Z

187

Continuous Time Random Walks and South Spain Seismic Series  

E-Print Network [OSTI]

Levy flights were introduced through the mathematical research of the algebra or random variables with infinite moments. Mandelbrot recognized that the Levy flight prescription had a deep connection to scale-invariant fractal random walk trajectories. The theory of Continuous Time Random Walks (CTRW) can be described in terms of Levy distribution functions and it can be used to explain some earthquake characteristics like the distribution of waiting times and hypocenter locations in a seismic region. This paper checks the validity of this assumption analyzing three seismic series localized in South Spain. The three seismic series (Alboran, Antequera and Loja) show qualitatively the same behavior, although there are quantitative differences between them.

A. Posadas; J. Morales; F. Vidal; O. Sotolongo-Costa; J. C. Antoranz

2002-05-27T23:59:59.000Z

188

Association of Renewable Energy Producers Spain | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160 EastMaine: Energy Resources JumpAspen Aerogels JumpRenewable Energy Producers Spain

189

BeyWatch (Smart Grid Project) (Spain) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin: Energy ResourcesJersey: EnergyBerthoud,Biodiesel Place: Orem,BeyWatchSpain)

190

Spain Installed Wind Capacity Website | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA Region -SonelgazSunbelt Wind FarmSouthwestSpain

191

The 1964 Festival of Music of the Americas and Spain: A Critical Examination of Ibero-American Musical Relations in the Context of Cold War Politics  

E-Print Network [OSTI]

Rodrigo dies, telling him that Spain will be reborn from theAsturias. All bells of Spain miraculously toll at Rodrigo’s1964): 6. ———. “Bases in Spain. ” The Washington Post, 10

Payne, Alyson

2012-01-01T23:59:59.000Z

192

8th International Symposium on Growth and Nutrition in Children with Chronic Renal Disease: 28–30 May 2009, Oviedo, Asturias, Spain  

E-Print Network [OSTI]

2009, Oviedo, Asturias, Spain Fernando Santos & Frederick J.of Oviedo, Oviedo, Asturias, Spain F. J. Kaskel Montefiores/n, 33006 Oviedo, Asturias, Spain e-mail: fsantos@uniovi.es

Santos, Fernando; Kaskel, Frederick J.; Mak, Robert H.; Caldas, Alberto

2010-01-01T23:59:59.000Z

193

July 2012 M.S. in Molecular Cellular and Genetic Biology (honors) -University of A Corua, A Corua, Spain July 2011 B.S. in Biology -University of A Corua, A Corua, Spain  

E-Print Network [OSTI]

of A Coruña, A Coruña, Spain July 2011 B.S. in Biology - University of A Coruña, A Coruña, Spain RESEARCH, University of A Coruña, Spain. Advisors: Dr. Jose M. Eirin Lopez, Dr. Josefina Mendez. 2011 - 2012 Master student, Dept. Cellular and Molecular Biology, University of A Coruña, Spain. 2005 - 2011 Bachelor student

Eirin Lopez, Jose Maria

194

Animal Antimicrobial Peptides: An Overview  

E-Print Network [OSTI]

, Barcelona, Spain 2 Centro de Investigaciones Biolo´ gicas (CSIC), Madrid, Spain Abstract: Antibiotic´ i Franque`s 1-11, E-08028 Barcelona, Spain; email: andreu@admin.qo.ub.es Contract grant sponsor

Pompeu Fabra, Universitat

195

International Irradiated Concrete Information Exchange. Report...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Research, 21 Church Street, 5A15, Rockville, MD 20850 16 Snchez Javier Spain National Research Council of Spain (CSIC) Serrano Galvache, 4 St. 28033, Madrid, Spain 17 Navarro...

196

Quality of environmental impact statements in Portugal and Spain  

SciTech Connect (OSTI)

One of the key steps of the Environmental Impact Assessment Process, defined by Directive 337/85 'on the assessment of the effects of certain public and private projects' is the preparation of the Environmental Impact Statement (EIS) of a Project. The quality of the EIS is of great importance to properly inform the public and the decision makers about the significant environmental effects of the project. Using the 'Guidance on EIA-EIS Review' 2001 report, produced with the support of the European Commission, this paper analyses the overall quality of 46 recently elaborated EIS from Portugal and Spain (1998-2003). It also analyses the quality of the various chapters of the EIS and the Non-Technical Summary. A comparison is made between the quality of the EIS from Portugal and from Spain. The results for Portugal are also compared with those of other European countries (Ireland and United Kingdom) in similar periods. Finally it presents overall conclusions and suggestions for improvement.

Canelas, Leonel; Almansa, P.; Merchan, M.; Cifuentes, Pedro

2005-04-15T23:59:59.000Z

197

Helsinki Journal, Entry 38, April 22, 2007 Well, we have successfully completed our eleven day trip to Spain. Our itinerary  

E-Print Network [OSTI]

to Spain. Our itinerary was as follows: catch a morning flight from Helsinki to Barcelona, sightsee-efficient design and architecture, but thank God for countries like Spain, where beauty can trump practicality

Bardsley, John

198

November 2010-Ph.D. in Biology. University of A Corua, Spain. Dr. J.M. Eirin-Lopez, advisor (Genetics, Evolution). July 2007-M.S. in Genetics and Biochemistry University of A Corua, Spain.  

E-Print Network [OSTI]

EDUCATION November 2010- Ph.D. in Biology. University of A Coruña, Spain. Dr. J.M. Eirin-Lopez, advisor (Genetics, Evolution). July 2007- M.S. in Genetics and Biochemistry University of A Coruña, Spain. July 2005- B.S. in Biology (honors). University of A Coruña, Spain. RESEARCH INTERESTS Marine Biology

Eirin Lopez, Jose Maria

199

Orange County Zip Codes Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

Irvine Anaheim Hills 92807 92603 Irvine Anaheim Hills 92808 92604 Irvine Anaheim Hills 92809 92605 Huntington Beach PO Box Only Anaheim Hills 92817 92606 Irvine Atwood 92870 92607 Laguna Beach Duplicate; PO 92609 Lake Forest PO Box Only Brea 92821 92610 El Toro Brea 92822 PO Box Only 92610 Foothill Ranch Brea

de Lijser, Peter

200

Orange County Zip Codes By Jurisdiction Zip Note By Zip Jurisdiction Note  

E-Print Network [OSTI]

only 92607 Laguna Niguel Duplicate; PO Box only Brea 92823 92609 Lake Forest PO Box only Buena Park Valley 92728 Duplicate; PO Box only 92629 Dana Point Fullerton 92831 92630 Lake Forest Fullerton 92832 92637 Laguna Hills duplicate Fullerton 92833 92637 Laguna Woods duplicate Fullerton 92834 PO Box only

de Lijser, Peter

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Use of high-resolution ichnological and stable isotope data for assessing completeness of a KP boundary section, Agost, Spain  

E-Print Network [OSTI]

­P boundary section, Agost, Spain Francisco J. Rodri´guez-Tovar a,*, Francisca Marti´nez-Ruiz b , Stefano M. Bernasconi c a Departamento de Estratigrafi´a y Paleontologi´a, Universidad de Granada, 18002 Granada, Spain b Instituto Andaluz de Ciencias de la Tierra CSIC-Universidad de Granada, 18002 Granada, Spain c

Gilli, Adrian

202

On the late Miocene closure of the MediterraneanAtlantic gateway through the Guadix basin (southern Spain)  

E-Print Network [OSTI]

(southern Spain) S.K. Hüsing a, , O. Oms b , J. Agustí c , M. Garcés d , T.J. Kouwenhoven e , W. Krijgsman, 08193 Bellaterra, Spain c Institut de Paleontologia M. Crusafont, Escola Industrial 23, 08201 Sabadell, Spain d Group of Geodynamics and Basin Analysis, University of Barcelona, Campus de Pedralbes, 08028

Utrecht, Universiteit

203

CAMBRIDGE, U.K., AND BARCELONA, SPAIN--As the horse-trading to select a site for the Inter-  

E-Print Network [OSTI]

CAMBRIDGE, U.K., AND BARCELONA, SPAIN--As the horse-trading to select a site for the Inter studying four candidate sites, in Canada, Japan, France, and Spain. To boost its odds, the E.U. decided to put forward only one candidate--either Cadarache in France or Vandellòs in Spain--and asked David King

204

STANDARD RESIDUE REGULATIONS FOR CHLORAMPHENICOL Departmento de Farmacologia y Toxicologia, Facultad de Veterinaria, Universidad de Leon, Spain  

E-Print Network [OSTI]

STANDARD RESIDUE REGULATIONS FOR CHLORAMPHENICOL IN SPAIN A. ANADON Departmento de Farmacologia y Toxicologia, Facultad de Veterinaria, Universidad de Leon, Spain Chloramphenicol is an antibiotic widely used forms mainly used in Spain are the free base, succinate and palmitate and the dosage forms

Boyer, Edmond

205

A Statistical Adjustment of Regional Climate Model Outputs to Local Scales: Application to Platja de Palma, Spain  

E-Print Network [OSTI]

de Palma, Spain A. AMENGUAL Grup de Meteorologia, Departament de Fi´sica, Universitat de les Illes Mallorca, Spain V. HOMAR AND R. ROMERO Grup de Meteorologia, Departament de Fi´sica, Universitat de les Illes Balears, Palma de Mallorca, Spain S. ALONSO Grup de Meteorologia, Departament de Fi

Romero, Romu

206

The multi-dimensional additionality of innovation policies. A multi-level application to Italy and Spain.  

E-Print Network [OSTI]

and Spain. Alberto Marzucchi & Sandro Montresor October 2012 Preliminary ­ Do not quote without prior, at the national and regional level (multi-level). An empirical application is carried out for Italy and Spain, while they show output additionality in Spain only, where they are also able to spur innovative

Sussex, University of

207

Birori Goa Lima Mexico City Lisbon Naples Palermo Seville Soriano Liampo Villanovafranca Beyond Italy and New Spain  

E-Print Network [OSTI]

Italy and New Spain Itineraries for an Iberian Art History (1440-1640) Convened by Michael Cole Iberian Europe to the Kingdom of the New Spain. New proposals of itineraries for the origin and interpretation of corn cane sculptures Joana Barreto (Villa Medici, Rome): Spain, Italy, Flanders: Some Dynamics

Qian, Ning

208

Tornadoes over complex terrain: an analysis of the 28th August 1999 tornadic event in eastern Spain  

E-Print Network [OSTI]

Tornadoes over complex terrain: an analysis of the 28th August 1999 tornadic event in eastern Spain Fi´sica, Universitat de les Illes Balears, Palma de Mallorca 07071, Spain b Instituto Nacional de Meteorologi´a, Centre Meteorolo`gic a les Illes Balears, Palma de Mallorca, Spain c IMEDEA, UIB-CSIC, Palma de

Romero, Romu

209

J, PHYS. IV FRANCE 7 (1997) Colloque Cl, SupplCmentau Journal de Physique I11de mars 1997  

E-Print Network [OSTI]

. Garcia, E.M. Alcalii*, C. Negro and F. L6pez-Mateos Dpto. Ingenieria Quimica, Facultad de Ciencias Quimicas, UniversidadComplutensede Madrid, Avda. Complutenses/n, 28040Madrid, Spain *Dpto. Fisica de

Paris-Sud XI, Université de

210

E-Print Network 3.0 - autopesula ostab spectra Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

de Madrid, Dpt. de Astrofsica, Facultad C.C. Fsicas, Madrid, Spain, dmg@astrax.fis.ucm.es, Summary: a Virtual Observatory (VO) compliant version of the libraries of high...

211

Stabilization and restoration of an uranium mill site in Spain  

SciTech Connect (OSTI)

In the south of Spain on the outskirts of the town of Andujar an inactive uranium mill tailings site has been remediated in place. Mill equipment, buildings and process facilities have been dismantled and demolished and 06q the resulting metal wastes and debris have been placed in the tailings pile. The tailings mass has been reshaped by flattening the sideslopes to improve stability and a cover system has been placed over the pile. Remedial action works started in February 1991 and were completed by April 1994. This paper describes the remediation works for the closure of the Andujar mill site and in particular discusses the approaches used for the dismantling and demolition of the processing facilities and the stabilization of the tailings pile.

Santiago, J.L.; Estevez, C.P. [ENRESA, Madrid (Spain)

1995-12-31T23:59:59.000Z

212

AUSTRALIA BELGIUM CHINA FRANCE GERMANY HONG KONG SAR INDONESIA (ASSOCIATED OFFICE) ITALY JAPAN PAPUA NEW GUINEA SAUDI ARABIA SINGAPORE SPAIN SWEDEN  

E-Print Network [OSTI]

PAPUA NEW GUINEA SAUDI ARABIA SINGAPORE SPAIN SWEDEN UNITED ARAB EMIRATES UNITED KINGDOM UNITED STATES

Royal Holloway, University of London

214

Bird Census News 2009, 22/2: 76 -80 Books, reports & journals  

E-Print Network [OSTI]

. The common breeding birds in Spain. Populations in 2004-2006. SEO/BirdLife, Madrid. 202 pages. (in Spanish 978-84-936441-3-0. Order at: SEO/BirdLife, c/Melquiades Biencinto 34, E-28053 Madrid, Spain, or via seo@seo.org The database from the long-term monitoring scheme on common breeding birds in Spain (SACRE

Carrascal, Luis M.

215

Kondo effects in carbon nanotubes: From SU(4) to SU(2) symmetry Jong Soo Lim  

E-Print Network [OSTI]

Física, Universitat de les Illes Balears, E-07122 Palma de Mallorca, Spain M. Y. Choi Department, Spain Ramón Aguado Teoría de la Materia Condensada, Instituto de Ciencia de Materiales de Madrid (CSIC) Cantoblanco, 28049 Madrid, Spain Received 4 August 2006; published 27 November 2006 We study the Kondo effect

Choi, Mahn-Soo

216

Journal of Catalysis 195, 207216 (2000) doi:10.1006/jcat.2000.2981, available online at http://www.idealibrary.com on  

E-Print Network [OSTI]

de Cantoblanco, Camino de Valdelatas s/n, 28049 Madrid, Spain; Chemistry Department, University de Sevilla, 41092 Sevilla, Spain Received April 27, 2000; revised June 23, 2000; accepted June 27´imica-F´isica, Facultad de Qu´imica, Universidad Complutense, 28040 Madrid, Spain. tion (3) or the decomposition

217

Marta Poblet, Universitat Autonoma de Barcelona, Spain (Ed.) Mobile Technologies for Conflict  

E-Print Network [OSTI]

in conflict prevention and dispute management aiming to learn how mobile technologies can play a disruptive. Mobile Technologies, Conflict Management, and ODR: Exploring Common Grounds; Marta Poblet.- Part IMarta Poblet, Universitat Autonoma de Barcelona, Spain (Ed.) Mobile Technologies for Conflict

Autònoma de Barcelona, Universitat

218

To Spain and Back: Changing Roles and Identities of Ecuadorian Female Migrants  

E-Print Network [OSTI]

In the late 1990s and early 2000s, Ecuadorian migration to Spain expanded due to economic and political push and pull factors between the two countries. Through the feminization of migration, women came to represent approximately half of all...

Dudley, Lindsay Erin

2013-05-31T23:59:59.000Z

219

Mediterranean clonal selections evaluated for modern hedgerow olive oil production in Spain  

E-Print Network [OSTI]

oil output Cumulative oil production tons/acre 5.68b 5.83bmodern hedgerow olive oil production in Spain Paul M. VossenNinot Traditional olive oil production is limited by its

Tous, Joan; Romero, Agusti; Hermoso, Juan Francisco; Ninot, Antonia

2011-01-01T23:59:59.000Z

220

E-Print Network 3.0 - area cadiz spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Search Sample search results for: area cadiz spain Page: << < 1 2 3 4 5 > >> 1 CURRICULUM VITAE (update October 2007) Mariana Ribas Ribas mariana.ribas@uca.es Summary: ....

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Transmission grid access and pricing in Norway, Spain, and California: A comparative study  

E-Print Network [OSTI]

Energy Researh (SEfAS) Norway Ms. Grønli has been workingPower Research Institute), Norway, since 1995. She holds aGRID ACCESS AND PRICING IN NORWAY, SPAIN AND CALIFORNIA – A

Gronli, Helle; Gomez San Ramon, Tomas; Marnay, Chris

1999-01-01T23:59:59.000Z

222

Contribution (Poster) TNT2008 September 01-05, 2008 Oviedo-Spain  

E-Print Network [OSTI]

Contribution (Poster) TNT2008 September 01-05, 2008 Oviedo-Spain LIGHT EMITTING DIODES ON SILICON) or quantum well (QW) light-emitting diodes by molecular beam epitaxy to obtain direct band gaps on GaP grown

Boyer, Edmond

223

E-Print Network 3.0 - andalusia sothern spain Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

6164, 2008 www.adv-sci-res.net2612008 Summary: , in Spain, Eastern Andalusia (AOR), Aragon (ARN), the Balearic Islands (BAL), Castilla la Man- cha (MCM... ogico en Illes...

224

The Photovoltaic Crisis and the Demand-side Generation in Spain  

E-Print Network [OSTI]

The RES-E promotion policy in Spain gave priority to the photovoltaic (henceforth, PV) ground-mounted installations. For years, the coupling of customer-side generation coupled with excess energy exports was never specifically considered. However...

Mir-Artigues, Pere

2013-03-01T23:59:59.000Z

225

Arsenic in public water supplies and cardiovascular mortality in Spain  

SciTech Connect (OSTI)

Background: High-chronic arsenic exposure in drinking water is associated with increased cardiovascular disease risk. At low-chronic levels, as those present in Spain, evidence is scarce. In this ecological study, we evaluated the association of municipal drinking water arsenic concentrations during the period 1998-2002 with cardiovascular mortality in the population of Spain. Methods: Arsenic concentrations in drinking water were available for 1721 municipalities, covering 24.8 million people. Standardized mortality ratios (SMRs) for cardiovascular (361,750 deaths), coronary (113,000 deaths), and cerebrovascular (103,590 deaths) disease were analyzed for the period 1999-2003. Two-level hierarchical Poisson models were used to evaluate the association of municipal drinking water arsenic concentrations with mortality adjusting for social determinants, cardiovascular risk factors, diet, and water characteristics at municipal or provincial level in 651 municipalities (200,376 cardiovascular deaths) with complete covariate information. Results: Mean municipal drinking water arsenic concentrations ranged from <1 to 118 {mu}g/L. Compared to the overall Spanish population, sex- and age-adjusted mortality rates for cardiovascular (SMR 1.10), coronary (SMR 1.18), and cerebrovascular (SMR 1.04) disease were increased in municipalities with arsenic concentrations in drinking water >10 {mu}g/L. Compared to municipalities with arsenic concentrations <1 {mu}g/L, fully adjusted cardiovascular mortality rates were increased by 2.2% (-0.9% to 5.5%) and 2.6% (-2.0% to 7.5%) in municipalities with arsenic concentrations between 1-10 and>10 {mu}g/L, respectively (P-value for trend 0.032). The corresponding figures were 5.2% (0.8% to 9.8%) and 1.5% (-4.5% to 7.9%) for coronary heart disease mortality, and 0.3% (-4.1% to 4.9%) and 1.7% (-4.9% to 8.8%) for cerebrovascular disease mortality. Conclusions: In this ecological study, elevated low-to-moderate arsenic concentrations in drinking water were associated with increased cardiovascular mortality at the municipal level. Prospective cohort studies with individual measures of arsenic exposure, standardized cardiovascular outcomes, and adequate adjustment for confounders are needed to confirm these ecological findings. Our study, however, reinforces the need to implement arsenic remediation treatments in water supply systems above the World Health Organization safety standard of 10 {mu}g/L.

Medrano, Ma Jose, E-mail: pmedrano@isciii.es [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain); Boix, Raquel; Pastor-Barriuso, Roberto [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain)] [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain); Palau, Margarita [Subdireccion General de Sanidad Ambiental y Salud Laboral, Direccion General de Salud Publica y Sanidad Exterior, Ministerio de Sanidad y Politica Social, Madrid (Spain)] [Subdireccion General de Sanidad Ambiental y Salud Laboral, Direccion General de Salud Publica y Sanidad Exterior, Ministerio de Sanidad y Politica Social, Madrid (Spain); Damian, Javier [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain)] [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain); Ramis, Rebeca [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain) [Centro Nacional de Epidemiologia, Instituto de Salud Carlos III, Sinesio Delgado 6, 28029 Madrid (Spain); CIBER en Epidemiologia y Salud Publica (CIBERESP), Madrid (Spain); Barrio, Jose Luis del [Departamento de Salud Publica, Universidad Rey Juan Carlos, Madrid (Spain)] [Departamento de Salud Publica, Universidad Rey Juan Carlos, Madrid (Spain); Navas-Acien, Ana [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States) [Department of Environmental Health Sciences, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States); Department of Epidemiology, Welch Center for Prevention, Epidemiology and Clinical Research, Johns Hopkins Bloomberg School of Public Health, Baltimore, MD (United States)

2010-07-15T23:59:59.000Z

226

Genetic Variation in the Population of Ibiza (Spain): Genetic Structure, Geography, and Language  

E-Print Network [OSTI]

Genetic Variation in the Population of Ibiza (Spain): Genetic Structure, Geography, and Language ANTONIA PICORNELL,' ANA MIGUEL,' JOSE A. CASTRO,' M. MISERICORDIA RAMON,' RECTOR ARYA,2 AND M.H. CRAWFORD2 Abstract A sample of 203 individuals from... Ibiza (Balearic Islands, Spain) were tested for blood group and serum protein genetic variation and compared with other circum-Mediterranean populations. Allele fre- quencies were calculated for the following blood group and serum sys- tems: ABO, Rh...

Picornell, Antonia; Miguel, Ana; Castro, Jose A.; Ramon, M. Misericordia; Arya, Rector; Crawford, Michael H.

1996-11-01T23:59:59.000Z

227

2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim 899 www.advmat.de  

E-Print Network [OSTI]

de la Cruz 3, 28049 Madrid, Spain E-mail: paco.guinea@icmm.csic.es Dr. E. Cappelluti Institute Madrileño de Estudios Avanzados en Nanociencia IMDEA-Nanociencia E-28049 Madrid, Spain Prof. N. Agraït, Prof Campus de Cantoblanco, E-28049 Madrid, Spain E-mail: gabino.rubio@uam.es DOI: 10.1002/adma.201203731 Two

Cappelluti, Emmanuele

228

Tight MIP Formulations of the Power-Based Unit Commitment Problem  

E-Print Network [OSTI]

Jul 8, 2014 ... ... Institute for Research in Technology (IIT) of the School of Engineering (ICAI), Universidad Pontificia Comillas, Madrid, Spain Istituto di Analisi ...

Germán Morales-España

2014-07-08T23:59:59.000Z

229

aasvee elvira kurvinen: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Virtualized Services Elvira Albert Complutense University of Madrid, Spain elvira services, it is necessary to address two important problems: (1) the efficient...

230

Z .Synthetic Metals 108 2000 5765 www.elsevier.comrlocatersynmet  

E-Print Network [OSTI]

,) a Instituto de Ciencia y Tecnologia de Polimeros del CSIC, crJuan de la CierÕa 3, 28006 Madrid, Spain´ ´ b Uni

Otero, Toribio Fernández

231

E-Print Network 3.0 - admission control mechanism Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

control for Grid services in IP networks C. Cardenas, M. Gagnaire, V. Lopez, J... atica Universidad Autonoma de Madrid, Spain Email:Victor.Lopez,Javier.Aracil@ua...

232

Effective formulation reductions for the quadratic assignment problem  

E-Print Network [OSTI]

... Madrid, Spain. ‡miguel.constantino@fc.ul.pt, DEIO/ Centro de Investigaç˜ao Operacional, Faculdade de. Ciências, Universidade de Lisboa, Lisbon, Portugal.

2008-12-11T23:59:59.000Z

233

JOURNAL DE PHYSIQUE IV Colloque C2, supplkment au Journal de Physique In,Volume 5, fevrier 1995  

E-Print Network [OSTI]

Politdcnica de Madrid, Spain *Dept. Cienca de 10s Materiales e IngenieriaMetalLirgica, E.T.S. Ing. Industriales

Paris-Sud XI, Université de

234

Inbreeding, uctuating asymmetry, and ejaculate quality in an endangered ungulate  

E-Print Network [OSTI]

(CSIC), c/Jose¨ Gutierrez Abascal 2, 28006-Madrid, Spain 3 Estacio¨ n Experimental de Zonas Aridas (CSIC

Museo Nacional de Ciencias Naturales

235

adaptive support vector: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(GPDS) Doctor Moliner 50, 46100, Burjassot, Valencia - Spain 3- University Hospital Virgen de la Arrixaca - Lab. of Electrophysiology Ct. Madrid-Cartagena sn, 30120, El...

236

arterias digitales palmares: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(GPDS) Doctor Moliner 50, 46100, Burjassot, Valencia - Spain 3- University Hospital Virgen de la Arrixaca - Lab. of Electrophysiology Ct. Madrid-Cartagena sn, 30120, El...

237

amyloid fibril mass-per-length: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(GPDS) Doctor Moliner 50, 46100, Burjassot, Valencia - Spain 3- University Hospital Virgen de la Arrixaca - Lab. of Electrophysiology Ct. Madrid-Cartagena sn, 30120, El...

238

Adaptive Speciation U. Dieckmann, M. Doebeli, J.A.J. Metz, and D. Tautz  

E-Print Network [OSTI]

3207, Australia Ruiz de Alarcón 13, 28014 Madrid, Spain Dock House, The Waterfront, Cape Town 8001 Processes . . . . . . . . . . . 52 4 Adaptive Dynamics of Speciation: Ecological Underpinnings 54 Stefan A

Dieckmann, Ulf

239

International Work Placement Case Study: Les Sol de Portecarrero, Almeria, Lara spent nine months in 2011/2012 as an English teaching assistant in Almeria in Spain  

E-Print Network [OSTI]

International Work Placement Case Study: Les Sol de Portecarrero, Almeria, Spain Lara spent nine months in 2011/2012 as an English teaching assistant in Almeria in Spain at Les Sol de Portocarrero

Mumby, Peter J.

240

Phone: (+34) 965 90 3707 -Fax: (+34) 965 90 3678 -email: dic@ua.es -twitter: @dic_ua Po. Box 99 -03080 -Alicante (Spain)  

E-Print Network [OSTI]

. Box 99 - 03080 - Alicante (Spain) NEWS & EVENTS PROFESSOR FLORENTINO REGALADO, AWARDED THE MEDAL Raspeig s/n 03690 San Vicente del Raspeig Alicante (Spain) Tel: (+34) 96 590 3707 Fax: (+34) 96 590 3678

Escolano, Francisco

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Santander (Spain), July 1-5, 2008 Laforcade-Zendagui-Barr 1 Supporting the Specification ofSupporting the Specification of  

E-Print Network [OSTI]

Santander (Spain), July 1-5, 2008 Laforcade-Zendagui-Barré 1 Supporting the Specification of #12;Santander (Spain), July 1-5, 2008 Laforcade-Zendagui-Barré 2 Outline 1. Research context. Summary and ongoing work #12;Santander (Spain), July 1-5, 2008 Laforcade-Zendagui-Barré 3 Research Context

Laforcade, Pierre

242

The Dirichlet Problem for the Total Variation Flow Dept. de An'alisis Matem'atico, Universitat de Valencia, 46100 Burjassot (Valencia), Spain  

E-Print Network [OSTI]

'atico, Universitat de Valencia, 46100 Burjassot (Valencia), Spain C. Ballester Department of Tecnologia, University of Pompeu­Fabra, La Rambla 30­32, 08002 Barcelona, Spain V. Caselles Department of Tecnologia, University of Pompeu­Fabra, La Rambla 30­32, 08002 Barcelona, Spain J. M. Maz'on Dept. de An'alisis Matem

Caselles, Vicent

243

The Education Office of the Embassy of Spain in Canada would appreciate if your Organization/Institution could circulate among potential candidates this information about  

E-Print Network [OSTI]

The Education Office of the Embassy of Spain in Canada would appreciate if your Organization AND CULTURE TEACHING ASSISTANTS IN SPAIN FOR 2014/2015 (ENGLISH OR FRENCH LANGUAGES) Positions available as an English or French language teaching assistant all over Spain for university graduates or undergraduate

244

For most of its history Spain had been a country of emigration--sending laborers abroad to find employment. But the latter quarter of the 20th  

E-Print Network [OSTI]

1 I. Problem For most of its history Spain had been a country of emigration--sending laborers abroad to find employment. But the latter quarter of the 20th century has seen Spains status shift from individuals to live and work in the southern European state. Immigrants to Spain come from diverse locations

New Hampshire, University of

245

Nonlinear Invertible Representation for Joint Statistical and Perceptual Feature Decorrelation  

E-Print Network [OSTI]

. Malo 1 , R. Navarro 3 , I. Epifanio 2 , F. Ferri 2 , and J.M. Artigas 1 1 Dpt. d' ` Optica, Universitat Burjassot, Val`encia, Spain 3 Instituto de ' Optica (CSIC) C/ Serrano 122, 28006 Madrid, Spain Abstract

Malo, Jesus

246

First International Symposium on Fishing Vessel Energy Efficiency E-Fishing, Vigo, Spain, May 2010  

E-Print Network [OSTI]

First International Symposium on Fishing Vessel Energy Efficiency E-Fishing, Vigo, Spain, May 2010 HydroPêche: a way to improve energy efficiency of fishing devices Grégory Germain 1 , Philippe Druault 2 should provide a substantial gain on the fuel consumed of actual fishing devices while maintaining

Lewandowski, Roger

247

Forms Of Address In The Popular Press: A Comparison of Spain, Mexico and the United States  

E-Print Network [OSTI]

with each form of address. A comparison of forms of address in magazines and newspapers in Spain, Mexico, and the United States reveals certain correlations with speech patterns in those three countries, as well as with the products and services advertised....

Callahan, Laura

2000-01-01T23:59:59.000Z

248

Multicomponent reactive transport modeling at the Ratones uranium mine, Cceres (Spain)  

E-Print Network [OSTI]

Multicomponent reactive transport modeling at the Ratones uranium mine, Cáceres (Spain) Modelación management. The Ratones uranium mine was abandoned and flooded in 1974. Due to its reducing underground water, uranium, reactive transport, granite hydrochemistry, Ratones mine. Resumen La inundación de minas

Politècnica de Catalunya, Universitat

249

The Early Aptian of Aralar (northern Spain): stratigraphy, sedimentology, ammonite biozonation, and OAE1  

E-Print Network [OSTI]

The Early Aptian of Aralar (northern Spain): stratigraphy, sedimentology, ammonite biozonation Stratigraphy Ammonite biozonation TOC Oceanic Anoxic Event 1 a b s t r a c t The stratigraphy, sedimentology. The sedimentology indicates general deposition in a shallow marine environment, corresponding to mixed siliciclastic

Gilli, Adrian

250

Samuel Johnson Born 24 January 1980 in Seville, Spain. British nationality.  

E-Print Network [OSTI]

Samuel Johnson Born 24 January 1980 in Seville, Spain. British nationality. samuel networks, S. Johnson, J. J. Torres, J. Marro, and M. A. Muñoz, Physical Review Letters, in press. arXiv: 1002.3286. Evolving networks and the development of neural systems, S. Johnson, J. Marro and J. J

Johnson, Samuel

251

Tectonic control for evaporite formation in the Eastern Betics (Tortonian; Spain)  

E-Print Network [OSTI]

Tectonic control for evaporite formation in the Eastern Betics (Tortonian; Spain) Wout Krijgsman a for the Venta de la Virgen section by integration of biostratigraphic, magnetostratigraphic and isotopic dating for the emergence of a threshold that finally led to evaporite formation in the Fortuna basin. © 2006 Elsevier B

Utrecht, Universiteit

252

Impact of the lateral boundary conditions resolution on dynamical downscaling of precipitation in mediterranean spain  

E-Print Network [OSTI]

. We represent the spectrum of GCMs resolutions currently applied in climate change research by using for climate simulation and future climate change assessment (IPCC 2001). Although they incorpo- rate the main in mediterranean spain A. Amengual Ã? R. Romero Ã? V. Homar Ã? C. Ramis Ã? S. Alonso Received: 27 March 2006 / Accepted

Romero, Romu

253

2008 European PV Conference, Valencia, Spain COMPARISON OF SOLAR RADIATION FORECASTS FOR THE USA  

E-Print Network [OSTI]

2008 European PV Conference, Valencia, Spain COMPARISON OF SOLAR RADIATION FORECASTS FOR THE USA J models 1 INTRODUCTION Solar radiation and PV production forecasts are becoming increasingly important/) three teams of experts are benchmarking their solar radiation forecast against ground truth data

Perez, Richard R.

254

Benthic foraminiferal turnover across the Cretaceous/ Paleogene boundary at Agost (southeastern Spain)  

E-Print Network [OSTI]

;c a Departamento de Ciencias de la Tierra, Universidad de Zaragoza, 50009 Zaragoza, Spain b Department of Earth and Environmental Sciences, Wesleyan University, Middletown, CT 06459-0139, USA c Center for the Study of Global, benthic foraminifera are rare. Several opportunistic taxa (e.g. the agglutinant Haplophragmoides sp.) have

Royer, Dana

255

Supported by a grant from Iceland, Liechtenstein and Norway through the EEA Financial Mechanism. Secretary: +34 91 394 4385 e-mail: imi@mat.ucm.es  

E-Print Network [OSTI]

Supported by a grant from Iceland, Liechtenstein and Norway through the EEA Financial Mechanism AND RESEARCHERS IN UNIVERSIDAD COMPLUTENSE DE MADRID (MADRID, SPAIN) AND IN RESEARCH INSTITUTIONS IN NORWAY in the frame of the "Improving student, researchers and artists mobility and cooperation between Spain, Norway

Tradacete, Pedro

256

Supported by a grant from Iceland, Liechtenstein and Norway through the EEA Financial Mechanism. Secretary: +34 91 394 4385 e-mail: imi@mat.ucm.es  

E-Print Network [OSTI]

Supported by a grant from Iceland, Liechtenstein and Norway through the EEA Financial Mechanism IN UNIVERSIDAD COMPLUTENSE DE MADRID (MADRID, SPAIN) AND IN RESEARCH INSTITUTIONS IN NORWAY, ICELAND of the "Improving student, researchers and artists mobility and cooperation between Spain, Norway, Iceland

Tradacete, Pedro

257

EUROPEAN ORGANIZATION FOR NUCLEAR RESEARCH CERN-LHC/98-12 (EET)  

E-Print Network [OSTI]

EUROPEAN ORGANIZATION FOR NUCLEAR RESEARCH CERN-LHC/98-12 (EET) May 06,1999 "Experimental, Spain; (n) Universidad Politécnica de Madrid, Madrid, Spain. Abstract Energy and space distributions) such as the Energy Amplifier (EA) [1] has the potential to destroy all actinide elements by fission, thereby

Paris-Sud XI, Université de

258

Organochlorine pesticides in cow's milk from agricultural region in Northwestern Spain  

SciTech Connect (OSTI)

During the past 30 years, the variety and usage of pesticides have increased in Spain and worldwide. Agricultural use of pesticides can be expected to result in residues in or food and feed. Several limited monitoring programs have received an extensive investigation in order to detect residues from organochlorine compounds in milk. This paper reports the findings of a pesticide residue study in cow's milk samples examined during the time period of one year between May of 1987 and March of 1988. The cow's milk samples destined to human consumption were collected from an agrarian area located at a geographic region of northwestern Spain. Analyses were conducted for DDT complex DDT{sub s}, DDD, DDE and isomers alpha, beta and gamma (lindane), aldrin, dieldrin, endrin, heptachlor, heptachlor epoxide, alpha- and beta-endosulfan, metoxichlor and mirex.

La Riva, C. de (Municipal Lab. of Leon, (Spain)); Anadon, A. (Univ. Complutense, Madrid (Spain))

1991-04-01T23:59:59.000Z

259

`Home Away From Home:' Migrant Organizations and Transnational Politics Among Latin American Migrants in Spain  

E-Print Network [OSTI]

, Argentina, Bolivia, Chile, Colombia, Costa Rica, the Dominican Republic, Ecuador, Equatorial Guinea Guatemala, Honduras, Nicaragua, Paraguay, Peru, the Philippines, Portugal, and Uruguay. 3 Although the process of migration has never been... well be the catalyst for national political change, and at the very least may alter the political priorities of governments by focusing their energies abroad (Itzigsohn 2000). 19 In the case of Latin American migrants to Spain, their presence...

Freudenburg, Kevin Michael

2011-04-27T23:59:59.000Z

260

Fast neutron incineration in the energy amplifier as alternative to geologic storage the case of Spain  

E-Print Network [OSTI]

In previous reports [1][2] we have presented the conceptual design of a fast neutron driven sub-critical device (Energy Amplifier) designed both for energy amplification (production) and for the incineration of unwanted ³waste² from Nuclear Light Water Reactors (LWR). The latter scheme is here applied to the specific case of Spain, where 9 large LWR¹s are presently in operation. It is shown that a cluster of 5 EA¹s is a very effective and realistic solution to the elimination (in 37 years) of the present and foreseen (till 2029) LWR-Waste stockpiles of Spain, but with major improvements over Geologic Storage, since: (1) only a Low Level Waste (LLW) surface repository of reasonable size is ultimately required; (2) the large amount of energy stored in the trans-Uranics is recovered, amounting for each of the 37 years of incineration to a saving of about 8% of the present primary energy demand of Spain (100 MTep/y); (3) the slightly enriched (1.1%) Uranium, unburned by LWR¹s, can be recovered for further us...

Rubbia, Carlo; Kadi, Y; Rubio, Juan Antonio

1997-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

RESEARCH ARTICLE The cost of resistance to colistin in Acinetobacter  

E-Print Network [OSTI]

Andreu2 and Luis Rivas1** 1 Center for Biological Research (CIB-CSIC), Madrid, Spain 2 Proteomics Unit, Barcelona, Spain 3 Services of Infectious Diseases, Virgen del Rocío University Hospitals, Sevilla, Spain Barce- lona, Spain E-mail: david.andreu@upf.edu Abbreviations: OM, outer membrane; PMXs, polymyxins; SRP

Pompeu Fabra, Universitat

262

Property:Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar PowerstoriesNrelPartnerType Jump to: navigation,References Jump to:Business01 +

263

First Results of a Full Scaled Passive Treatment System for High Metal Concentration AMD at the Iberian Pyrite Belt, SW Spain  

E-Print Network [OSTI]

at the Iberian Pyrite Belt, SW Spain M. A. Caraballo a), F. Macías a), T. S. Rötting b), J. M. Nieto a), C. Ayora c) a) Department of Geology, University of Huelva. Avda. Fuerzas Armadas s/n, 21071 Huelva, Spain "Jaume Almera" CSIC, Lluís Solé y Sabarís, s/n. Barcelona 08028, Spain. Abstract Acidity load

Politècnica de Catalunya, Universitat

264

UAMcifrasen Universidad Autnoma de Madrid  

E-Print Network [OSTI]

Piloto Ingeniería Química y Tecnologías de los Alimentos 0 1 1 1 Química 1 1 0 1 Quimica Agricola, Geología y Geoquímica 1 1 1 3 3 3 6 Química Analítica y Análisis Instrumental 1 1 1 1 2 Quimica Física

Autonoma de Madrid, Universidad

265

UAMcifrasen Universidad Autnoma de Madrid  

E-Print Network [OSTI]

y Tecnologías de los Alimentos 0 1 1 1 Química 1 1 0 1 Quimica Agricola, Geología y Geoquímica 2 1 3 3 3 6 Química Analítica y Análisis Instrumental 1 1 1 1 2 Quimica Física Aplicada 1 1 2 3 1 4 6

Autonoma de Madrid, Universidad

266

UAMcifrasen Universidad Autnoma de Madrid  

E-Print Network [OSTI]

362 8 73 1650 72 ING.TEC.INDUSTRIAL: QUIMICA INDUSTRIAL 80 5 6,01 678 88 61 11 15 754 113 MAESTRO 1 135 2346 246 PSICOLOGIA 445 5,88 0 3650 583 175 36 48 3873 507 QUIMICA 320 5 5 1383 100 1 0 4 1388

Autonoma de Madrid, Universidad

267

UAMcifrasen Universidad Autnoma de Madrid  

E-Print Network [OSTI]

CONDENSADA 1 1 1 1 2 MATEMATICAS 1 1 2 2 QUIMICA 1 1 1 QUIMICA AGRIC GEOL Y GEOQUIM 1 1 2 3 1 4 6 QUIMICA ANALITICA Y A.INSTRUMEN. 1 1 1 1 2 QUIMICA FISICA APLICADA 2 2 5 5 7 QUIMICA INORGANICA 1 1 2 2 3 QUIMICA ORGANICA 1 1 1 1 2 PL. PILOTO ING. QUIMICA Y TEC. ALIMENT. 1 1 1 TALLER DE MICROELECTRONICA 1 1 2 2 TOTAL

Autonoma de Madrid, Universidad

268

Transmission grid access and pricing in Norway, Spain, and California: A comparative study  

SciTech Connect (OSTI)

The openness of the transmission grid and the incentives given by transmission pricing form the foundation for retail and wholesale competition in the electricity market. The deregulated markets of Norway, Spain, and California all have introduced retail access and wholesale competition, although with different approaches to pricing of transmission grid services. This paper will briefly describe the three different solutions, and discuss some of their implications. Of the three electricity systems, Norway was the first to open the grid to competition in electricity trade. The Norwegian Energy Law of 1990 introduced open competition to wholesale and retail trade starting January 1991. In Spain, the Electricity Law of 1997 came into force early in 1998. Wholesale and retail markets in California were opened for competition on April 1, 1998, following the passage of Assembly Bill 1890, in August 1996. Introducing competition in electricity markets also implies introducing Third Party Access to the transmission grid. All potential competitors have to be given access to the grid in order to compete, no matter who owns the actual wires. This principle raises several challenges, notably, how to price transmission services. Who is to pay for which transmission services? The Norwegian grid is divided into three levels depending on its function. The transmission grid includes all parts of the national grid having a transmission function, meaning that some lower voltage levels also are included. In Spain, the definition of the transmission grid is similar, including the 400 kV and 220 kV national grid as well as lower voltage installations that could affect transmission operation or generation dispatch. For historic reasons, wholesale electricity transactions in the US are regulated by the federal government through the FERC. However, operations of utility systems within one state fall primarily under state jurisdiction. Because the utility systems in California generally are large and exchanges between them limited, the role of FERC was small prior to restructuring, although the state is a large importer of power.

Gronli, H.; Gomez San Ramon, T.; Marnay, C.

1999-09-01T23:59:59.000Z

269

Decommissioning and waste disposal methods for an uranium mill facility in Spain  

SciTech Connect (OSTI)

In the south of Spain on the outskirts of the town of Andujar an inactive uranium mill tailings pile is being stabilized in place. Mill equipment, buildings and process facilities have been dismantled and demolished and the resulting metal wastes and debris will be placed in the pile. The tailings mass is being reshaped by flattening the sideslopes and a cover system will be placed over the pile. This paper describes the technical procedures used for the remediation and closure of the Andujar mill site and in particular discusses the approaches used for the dismantling and demolition of the processing facilities and the disposal of the metal wastes and demolition debris.

Santiago, J.L. [ENRESA, Madrid (Spain); Sanchez, M. [INITEC, Madrid (Spain)

1993-12-31T23:59:59.000Z

270

Sabine Pass, LA Exports to Spain Liquefied Natural Gas (Million Cubic Feet)  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998Hampshire"RhodeWest Virginia"TotalFeet) Brazil LiquefiedSpain

271

Cameron, LA Liquefied Natural Gas Exports to Spain (Million Cubic Feet)  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2007 10,998 9,933 10,998 10,643 10,998 10,643 10,998 10,998 10,64397 272 522 542 627ThousandThousandSpain

272

U.S. and Spain to Develop Solar Decathlon Europe | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE:YearRound-Up from theDepartment of Dept. of Energy, OfficeDepartment ofSpain to Develop Solar

273

Incorporation of Sb in InAs/GaAs quantum dots S. I. Molina,a  

E-Print Network [OSTI]

, Universidad de Cádiz, Campus Río San Pedro, s/n, Puerto Real, 11510 Cádiz, Spain M. F. Chisholm, M. Varela Cádiz, Campus Río San Pedro, s/n, Puerto Real, 11510 Cádiz, Spain A. J. Papworthb and P. J. Goodhew de Microelectrónica de Madrid (CNM, CSIC), Isaac Newton 8, 28760 Tres Cantos, Madrid, Spain Received

Pennycook, Steve

274

Delivered by Ingenta to: Oak Ridge National Laboratory  

E-Print Network [OSTI]

Cadiz, Campus Rio San Pedro, s/n, 11510 Puerto Real, Cadiz, Spain 3 Departamento de Lenguajes y Sistemas Informáticos, CASEM, Universidad de Cádiz, Campus Río San Pedro, s/n, 11510 Puerto Real, Cádiz, Spain 4 Instituto de Microelectrónica de Madrid (CNM, CSIC), Isaac Newton 8, 28760 Tres Cantos, Madrid, Spain We

Pennycook, Steve

275

Organochlorine pollutants in water, soils, and earthworms in the Guadalquivir River, Spain  

SciTech Connect (OSTI)

Organochlorine compounds (insecticides and polychlorinated biphenyls) are known to maintain their stability in the aquatic environment for long periods. DDT and cyclodiene insecticides were used widely in Spain until their use was banned in 1976; DDT and its degradation products are still found in environmental samples. Since DDT has been legally restricted for use, lindane has become important as a substitute for DDT. This study has been carried out along Guadalquivir River, Spain. This river runs across an agricultural area where pesticides are used extensively. The Guadalquivir basin is the most economically important area of the South of the Iberian Peninsula; its economic importance stems from its proximity to a major metropolitan areas (Cordova, Seville), which indicates the presence of numerous urban, commercial, and industrial locations in the vicinity of the sampling stations. The purposes of this investigation are: (1) to determine the levels of organochlorine compounds in water, soils, and earthworms sampled in ten stations of the Guadalquivir River; (2) to evaluate biological accumulation of pollutants studied within the food webs; (3) to evaluate regional patterns and time trends of residues. 15 refs., 1 fig., 2 tabs.

Hernandez, L.M.; Fernandez, M.A.; Gonzalez, M.J. (Institute of Organic Chemistry, Madrid (Spain))

1992-08-01T23:59:59.000Z

276

A proposal to improve ecological compensation practice in road and railway projects in Spain  

SciTech Connect (OSTI)

To reduce ecological impacts caused by development projects, avoidance, minimization and compensation techniques have to be taken together into consideration along Environmental Impact Assessment (EIA) procedures. This paper explores the particular role that ecological compensation has had in recent road and railway EIA procedures in Spain, as seen through the review of a set of recent EIA Records of Decision (RODs) that confirms precedent findings. Noticing that residual impacts are not paid much attention, and that there is no evidence of a solid public participation in ecological impact evaluation, it proposes to increase the awareness on residual impacts, as a way to make easier public access to the allegedly most sensitive moment of EIA implementation: (residual) impact evaluation. -- Highlights: ? Ecological compensation practice in Spain is much lower than avoidance or mitigation. ? Residual impacts are overlooked in EIA processes and public participation is low. ? An increased awareness of residual impacts may also promote public participation. ? Current context needs these small steps to move towards better compensation practice.

Villarroya, Ana, E-mail: avillarroya@alumni.unav.es; Puig, Jordi, E-mail: jpbaguer@unav.es

2013-09-15T23:59:59.000Z

277

A Review of "New World Gold: Cultural Anxiety and Monetary Disorder in Early Modern Spain" by Elvira Vilches  

E-Print Network [OSTI]

) and the Dominican Tom?s Mercado?s Suma de tratos y contratos (Guide to negotiations and contracts, 1569). Not unlike the bumper crop of books on personal finance that have ap- peared since our own economic meltdown of 2008, the proliferation of such texts... of Columbus?s travel log or Cort?s?s ?Letters from Mexico.? Whether read in parts or as a whole, Vilches?s book offers the reader a layered and insightful examination of early modern Spain?s ?Golden Age,? attune to all the contradictions that follow from...

Wright, Elizabeth R.

2011-01-01T23:59:59.000Z

278

Email: {xxf064000, busso, John.Hansen}@utdallas.edu Slide 1 EUSIPCO 2011, Barcelona Spain, August 29-September Xing Fan, Carlos Busso and John H.L. Hansen  

E-Print Network [OSTI]

Email: {xxf064000, busso, John.Hansen}@utdallas.edu Slide 1 EUSIPCO 2011, Barcelona Spain, August Barcelona, Spain #12;Email: {xxf064000, busso, John.Hansen}@utdallas.edu Slide 2 EUSIPCO 2011, Barcelona with neutral speech #12;Email: {xxf064000, busso, John.Hansen}@utdallas.edu Slide 3 EUSIPCO 2011, Barcelona

Busso, Carlos

279

An estimate of the effects of climate change on the rainfall of Mediterranean Spain by the late twenty first century  

E-Print Network [OSTI]

An estimate of the effects of climate change on the rainfall of Mediterranean Spain by the late outside the periods, which would incorporate changing AP frequencies during a period of sustained climate the atmospheric circulation at 925 and 500 hPa and the distribution of daily pre- cipitation for Mediterranean

Romero, Romu

280

Decommissioning of facilities and encapsulation of wastes for an uranium mill site in Spain  

SciTech Connect (OSTI)

In the south of Spain on the outskirts of the town of Andujar an inactive uranium mill tailings site is being remediated in place. Mill equipment, buildings and process facilities have been dismantled and demolished and the resulting metal wastes and debris have been placed in the tailings pile. The tailings mass has been reshaped by flattening the sideslopes to improve stability and a cover system has been placed over the pile. Remedial action works started in February 1991 and will be completed by March 1994. This paper describes the progress of the remediation works for the closure of the Andujar mill site and in particular discusses the approaches used for the dismantling and demolition of the processing facilities and the stabilization of the tailings pile.

Santiago, J.L. [Enresa, Madrid (Spain); Sanchez, M. [Initec, Madrid (Spain)

1994-12-31T23:59:59.000Z

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

MARTA GOMEZ-CHIARRI Curriculum vitae Department of Fisheries, Animal and Veterinary Science  

E-Print Network [OSTI]

Educación y Ciencia, Fundación Jiménez Díaz, Madrid, Spain APPOINTEMENTS 2013 Fellowship, Ministerio de Educacion y Ciencia (Spain). #12;2 1993-1994 Postdoctoral Ciencia (Spain). 1990 Cilag Award in Nephrology Research, Sociedad Española de

Shen, Yang

282

Presented at the 31 IEEE Photovoltaics Specialist Conference, Orlando Florida, January 3-7 2005.  

E-Print Network [OSTI]

. QUANTUM DOT INTERMEDIATE BAND SOLAR CELL MATERIAL SYSTEMS WITH NEGLIGIBLE VALENCE BAND OFFSETS Michael Y and Computer Engineering, University of Delaware, Newark, Delaware, 19716-3130, USA 3 Instituto de Energia Solar - ETSIT, Universidad Politécnica de Madrid, Ciudad Universitaria sn, 28040 Madrid, Spain ­ EU

Honsberg, Christiana

283

JOURNAL DE PHYSIQUEIV Colloque C7, supplkment au Journal de Physique 111, Volume 3, novembre 1993  

E-Print Network [OSTI]

Diffusion bonding of hardmetals (WC-Co) with metallic interlayers J.M. GOMEZDE SALAZAR and A. URENA Dpto de Madrid, 28040Madrid, Spain ABSTRACT Diffusion bonding of hardmetals (WC-Co) to themselves bonding techniques similar to diffusion bonding (3). It minimizes handicaps similar to: fumes (brazing

Boyer, Edmond

284

Evaluation of operational on-line-coupled regional air quality models over Europe and North America in the context of AQMEII phase 2. Part  

E-Print Network [OSTI]

s , Khairunnisa Yahya u , Rahela Zabkar m, v , Yang Zhang u , Junhua Zhang o , Christian Hogrefe r , Stefano, Technical University of Madrid (UPM), Campus de Montegancedo, Boadilla del Monte, Madrid 28660, Spain r that are of concern for policy. * Corresponding author. E-mail addresses: ulasim77@gmail.com (U. Im), Stefano

Curci, Gabriele

285

E-Print Network 3.0 - ap star beta Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Madrid,Dpt. de Astrofsica, Facultad C.C. Fsicas, Madrid, Spain, E-mail : klutsch@astrax.fis.ucm.es Summary: .frpublicDEAsupportsDea45beta.pdf IAU-SpS7:YoungStars,BrownDwarfs,a...

286

Battery-Aware Selective Transmitters in Energy-Harvesting Sensor Networks: Optimal Solution and Stochastic Dual Approximation  

E-Print Network [OSTI]

Battery-Aware Selective Transmitters in Energy-Harvesting Sensor Networks: Optimal Solution-Sueiro, Carlos III University of Madrid, Leganes, 28911, Madrid, SPAIN Abstract Energy-harvesting devices alleviate the problem of sensor nodes being powered by finite-capacity batteries. Since har- vested energy

Marques, Antonio Garcia

287

Heterozoan carbonate lithofacies and sequence stratigraphy: a study of Pliocene strata of the Agua Amarga basin, southeastern Spain  

E-Print Network [OSTI]

). Heterozoan systems are likely to behave differently than photozoan systems in response to hydrodynamics and relative sea-level change, making the use of heterozoan models important for accurate prediction of facies distribution. The hydrodynamic regimen... response to sea- level change than is typical for photozoan carbonates. GEOLOGIC SETTING Throughout the Neogene, the Betic Cordillera of southern and southeastern Spain was compressed by the Iberia-Africa collision, with regional shortening oriented...

Hess, Anya Victoria

2011-12-31T23:59:59.000Z

288

Artal et al. Vol. 12, No. 2/February 1995/J. Opt. Soc. Am. A 195 Odd aberrations and double-pass  

E-Print Network [OSTI]

-pass measurements of retinal image quality Pablo Artal Laboratorio de Optica, Departamento de F´isica, Universidad Optica, Consejo Superior de Investigaciones Cient´ificas, Serrano 121, 28006 Madrid, Spain David R

Williams, David

289

Evidence for surface initiated solidification in Ge films upon picosecond laser pulse irradiation  

E-Print Network [OSTI]

. Siegel,a) J. Solis, and C. N. Afonso Instituto de Optica, CSIC, C/Serrano 121, 28006 Madrid, Spain F. Vega Department d'Optica i Optometria, Universitat Politecnica de Catalunya, C/Violinista Vellsola 37

von der Linde, D.

290

E-Print Network 3.0 - air school bus Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Study Abroad Course Equivalency Database Summary: EnglandLondon School of Economics & Political SciencePrinciples of AccountingACC 311 LondonBUS Spain... Suffolk University-Madrid...

291

Hydrol. Earth Syst. Sci., 15, 11851196, 2011 www.hydrol-earth-syst-sci.net/15/1185/2011/  

E-Print Network [OSTI]

Naturales, CSIC, Serrano 115bis, 28006 Madrid, Spain 2Department of Civil Engineering, Universidad Nacional: Facultad de Ingenier´ias, Universidad de Medell´in, Medell´in, Colombia Received: 26 November 2010

Sheldon, Nathan D.

292

amigo enemigos naturales: Topics by E-print Network  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

ESPA?OLES Sociedad de et al., 2010, 2012). The type locality is in central Spain in Perales de Tajua, Madrid (Fitze et al Alvarez, Nadir 31 Graellsia, 64(2):...

293

Mobile delivery of news using hierarchical query-biased summaries  

E-Print Network [OSTI]

Sweeney,S. Crestani,F. Tombros,A. In the Proceedings of the 17th ACM Symposium on Applied Computing, pp.634-639. Madrid, Spain, March 2002. ACM Press

Sweeney, S.; Crestani, F.; Tombros, A.

294

Communication delay in wormhole-routed torus networks  

E-Print Network [OSTI]

Shahrabi,A. Ould-Khaoua,M. Mackenzie,L.M. Proc. 17th ACM Symposium on Applied Computing (SAC'2002), Madrid, Spain, March 10-14, 2002 pp 825-829 ACM

Shahrabi, A.; Ould-Khaoua, M.

295

E-Print Network 3.0 - aves empleando chia Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

de Ciencias Naturales, CSIC. C Jos Gutirrez Abascal 2, 28006 Summary: rea de Estudio y Seguimiento de Aves, SEOBirdLife. C Melquiades Biencinto 34, 28053 Madrid, Spain. 3......

296

BIOLOGY OF REPRODUCTION 69, 602611 (2003) Published online before print 16 April 2003.  

E-Print Network [OSTI]

Naturales (CSIC),4 28006-Madrid, Spain Estacio´n Experimental de Zonas Aridas (CSIC), 5 04001-Almeri´n Experimental de Zonas Aridas (EEZA) has developed captive-breeding programs for three endangered gazelle

Museo Nacional de Ciencias Naturales

297

Phase-Controlled Collapse and Revival of Entanglement of Two Interacting Qubits Vladimir S. Malinovsky  

E-Print Network [OSTI]

. Sola Departamento de Quimica Fisica I, Universidad Complutense, 28040 Madrid, Spain (Received 9 motion, Ei 2 is the transition energy in the i qubit (for instance, the excited internal state

Dobaczewski, Jacek

298

Patterns of coding variation in the complete exomes of three Neandertals  

E-Print Network [OSTI]

Investigaciones Científicas, 28006 Madrid, Spain; i Anthropology Center of the Croatian Academy of Sciences and Arts, HR-10000 Zagreb, Croatia; j Croatian Academy of Sciences and Arts, Institute for Quaternary

Pääbo, Svante

299

Emotional Trends in Social Media A State Space Approach  

E-Print Network [OSTI]

. Contrary to this approach, many approaches in re- search use an absolute time base to analyze the dynamic Consulting S.A., Madrid, Spain, email: francisco.rangel@autoritas.es 3 NLE Lab ­ PRHLT Research Center

Rosso, Paolo

300

Environmental performance of construction waste: Comparing three scenarios from a case study in Catalonia, Spain  

SciTech Connect (OSTI)

The main objective of this paper is to evaluate environmental impacts of construction wastes in terms of the LIFE 98 ENV/E/351 project. Construction wastes are classified in accordance with the Life Program Environment Directive of the European Commission. Three different scenarios to current waste management from a case study in Catalonia (Spain) have been compared: landfilling, recycling and incineration, and these scenarios were evaluated by means of Life Cycle Assessment. The recommendations of the Catalan Waste Catalogue and the European Waste Catalogue have been taken into account. Also, the influence of transport has been evaluated. Results show that in terms of the Global Warming Potential, the most environmentally friendly treatment was recycling, followed by incineration and lastly landfilling. According to the influence of treatment plants location on the GWP indicator, we observe that incineration and recycling of construction wastes are better than landfilling, even for long distances from the building site to the plants. This is true for most wastes except for the stony types, than should be recycled close to the building site. In summary, data from construction waste of a Catalan case study was evaluated using the well established method of LCA to determine the environmental impacts.

Ortiz, O., E-mail: oscarortiz@unipamplona.edu.c [Rovira i Virgili University, Environmental Analysis and Management Group (AGA), Chemical Engineering Department, Av. Paisos Catalans 26, 43007, Tarragona (Spain); University of Pamplona, Department of Industrial Engineering, Km 1 Via Bucaramanga, Pamplona, N de S (Colombia); Pasqualino, J.C.; Castells, F. [Rovira i Virgili University, Environmental Analysis and Management Group (AGA), Chemical Engineering Department, Av. Paisos Catalans 26, 43007, Tarragona (Spain)

2010-04-15T23:59:59.000Z

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Guilt by Association: United States Ties and Vulnerability to Transnational Terrorist Attacks  

E-Print Network [OSTI]

were killed and more than 1,200 were injured by deadly terrorist attacks on commuter trains and stations in Madrid. These attacks had an enormous impact on the citizens of Spain, as well as the entire international community. The Madrid bombings... in its ?War on Terror? may carry additional costs. One unanticipated effect of these attacks was the victory of the Socialists over the ruling Partido Popular party in Spain in the next election. More importantly, this occurrence led to a sharp...

Warhol, Matthew Grant

2011-02-22T23:59:59.000Z

302

Lagrangian transport in a microtidal coastal area: the Bay of Palma, island of Mallorca, Spain  

E-Print Network [OSTI]

Coastal transport in the Bay of Palma, a small region in the island of Mallorca, Spain, is characterized in terms of Lagrangian descriptors. The data sets used for this study are the output for two months (one in autumn and one in summer) of a high resolution numerical model, ROMS, forced atmospherically and with a spatial resolution of 300 m. The two months were selected because its different wind regime, which is the main driver of the sea dynamics in this area. Finite-size Lyapunov Exponents (FSLEs) were used to locate semi-persistent Lagrangian coherent structures (LCS) and to understand the different flow regimes in the Bay. The different wind directions and regularity in the two months have a clear impact on the surface Bay dynamics, whereas only topographic features appear clearly in the bottom structures. The fluid interchange between the Bay and the open ocean was tudied by computing particle trajectories and Residence Times (RT) maps. The escape rate of particles out of the Bay is qualitatively different, with a 32$%$ more of escape rate of particles to the ocean in October than in July, owing to the different geometric characteristics of the flow. We show that LCSs separate regions with different transport properties by displaying spatial distributions of residence times on synoptic Lagrangian maps together with the location of the LCSs. Correlations between the time-dependent behavior of FSLE and RT are also investigated, showing a negative dependence when the stirring characterized by FSLE values moves particles in the direction of escape.

Ismael Hernández-Carrasco; Cristóbal López; Alejandro Orfila; Emilio Hernández-García

2013-11-05T23:59:59.000Z

303

Road-corridor planning in the EIA procedure in Spain. A review of case studies  

SciTech Connect (OSTI)

The assessment of different alternatives in road-corridor planning must be based on a number of well-defined territorial variables that serve as decision making criteria, and this requires a high-quality preliminary environmental assessment study. In Spain the formal specifications for the technical requirements stipulate the constraints that must be considered in the early stages of defining road corridors, but not how they should be analyzed and ranked. As part of the feasibility study of a new road definition, the most common methodology is to establish different levels of Territorial Carrying Capacity (TCC) in the study area in order to summarize the territorial variables on thematic maps and to ease the tracing process of road-corridor layout alternatives. This paper explores the variables used in 22 road-construction projects conducted by the Ministry of Public Works that were subject to the Spanish EIA regulation and published between 2006 and 2008. The aim was to evaluate the quality of the methods applied and the homogeneity and suitability of the variables used for defining the TCC. The variables were clustered into physical, environmental, land-use and cultural constraints for the purpose of comparing the TCC values assigned in the studies reviewed. We found the average quality of the studies to be generally acceptable in terms of the justification of the methodology, the weighting and classification of the variables, and the creation of a synthesis map. Nevertheless, the methods for assessing the TCC are not sufficiently standardized; there is a lack of uniformity in the cartographic information sources and methodologies for the TCC valuation. -- Highlights: • We explore 22 road-corridor planning studies subjected to the Spanish EIA regulation. • We analyze the variables selected for defining territorial carrying capacity. • The quality of the studies is acceptable (methodology, variable weighting, mapping). • There is heterogeneity in the methods for territorial carrying capacity valuation.

Loro, Manuel, E-mail: manuel.loro@upm.es [Department of Urban and Regional Planning and Environment, Civil Engineering School, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain) [Department of Urban and Regional Planning and Environment, Civil Engineering School, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Transport Research Centre (TRANSyT-UPM) Universidad Politécnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain); Centro de investigación del transporte, TRANSyT-UPM, ETSI Caminos, Canales y Puertos, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Arce, Rosa M., E-mail: rosa.arce.ruiz@upm.es [Department of Urban and Regional Planning and Environment, Civil Engineering School, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Transport Research Centre (TRANSyT-UPM) Universidad Politécnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain); Centro de investigación del transporte, TRANSyT-UPM, ETSI Caminos, Canales y Puertos, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Ortega, Emilio, E-mail: e.ortega@upm.es [Transport Research Centre (TRANSyT-UPM) Universidad Politécnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain) [Transport Research Centre (TRANSyT-UPM) Universidad Politécnica de Madrid, ETSI Caminos, Canales y Puertos, Prof. Aranguren s/n, 28040 Madrid (Spain); Centro de investigación del transporte, TRANSyT-UPM, ETSI Caminos, Canales y Puertos, Universidad Politécnica de Madrid, Prof. Aranguren s/n, 28040 Madrid (Spain); Department of Construction and Rural Roads, Forestry Engineering School, Universidad Politécnica de Madrid, Ciudad Universitaria s/n, 28040 Madrid (Spain); and others

2014-01-15T23:59:59.000Z

304

Workshop (W60) on "Burning Plasma Physics and Simulation" 4-5 July 2005, University Campus, Tarragona, Spain  

E-Print Network [OSTI]

. Reimerdes EPS[2005] no wall limit ideal wall limit no wall limit with External coils #12;3.5 4.0 4.5 5.0 5.8 0.6 0.4 0.2 0 0.2 0.4 0.6 0.8 1.0 1.20 1.4 RFA b / 3.4li MARS with wall beta limit Pulse No: 59223, Tarragona, Spain Under the Auspices of the IEA Large Tokamak Implementing Agreement Present understanding

305

Attitudes to diversity: A cross-cultural study of education students in Spain, England, and the United States  

E-Print Network [OSTI]

, Florian, Lani , Rouse, Martyn and Stough, Laura M.(2010) 'Attitudes to diversity: a cross-cultural study of education students in Spain, England and the United States', European Journal of Teacher Education, 33: 3, 245 — 264 To link to this Article: DOI...), and American students (70% White or European American, 19% Hispanic, 4% Asian American, 2% African American, and 4% other). The average age of the students was 26 years with a mean teaching experience of 2.31 years (SD = 4.38) (5.68 for the Spanish students, 1...

Stough, Laura

2010-01-01T23:59:59.000Z

306

,"Liquefied U.S. Natural Gas Re-Exports to Spain (Million Cubic Feet)"  

U.S. Energy Information Administration (EIA) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel), 2002; Level: National and Regional Data; Row: NAICS Codes; Column: EnergyShale Proved Reserves (Billion Cubic Feet)" ,"Click worksheet name orSpain (Million

307

Competitive sorption of cadmium and lead in acid soils of central Spain  

SciTech Connect (OSTI)

The bioavailability and ultimate fate of heavy metals in the environment are controlled by chemical sorption. To assess competitive sorption of Pb and Cd, batch equilibrium experiments (generating sorption isotherms) and kinetics sorption studies were performed using single and binary metal solutions in surface samples of four soils from central Spain. For comparisons between soils, as well as, single and binary metal solutions, soil chemical processes were characterized using the Langmuir equation, ionic strength, and an empirical power function for kinetic sorption. In addition, soil pH and clay mineralogy were used to explain observed sorption processes. Sorption isotherms were well described by the Langmuir equation and the sorption kinetics were well described by an empirical power function within the reaction times in this study. Soils with higher pH and clay content (characterized by having smectite) had the greatest sorption capacity as estimated by the maximum sorption parameter (Q) of the Langmuir equation. All soils exhibited greater sorption capacity for Pb than Cd and the presence of both metals reduced the tendency for either to be sorbed although Cd sorption was affected to a greater extent than that of Pb. The Langmuir binding strength parameter (k) was always greater for Pb than for Cd. However, these k values tended to increase as a result of the simultaneous presence of both metals, that may indicate competition for sorption sites promoting the retention of both metals on more specific sorption sites. The kinetic experiments showed that Pb sorption is initially faster than Cd sorption from both single and binary solutions although the simultaneous presence of both metals affected the sorption of Cd at short times while only a minor effect was observed on Pb. The estimated exponents of the kinetic function were in all cases smaller for Pb than for Cd, likely due to diffusion processes into micropores or interlayer space of the clay minerals which occurs more readily for Cd than Pb. Finally, the overall sorption processes of Pb and Cd in the smectitic soil with the highest sorption capacity of the studied soils are slower than in the rest of the soils with a clay mineralogy dominated by kaolinite and illite, exhibiting these soils similar sorption rates. These results demonstrate a significant interaction between Pb and Cd sorption when both metals are present that depends on important soil properties such as the clay mineralogy.

Serrano, S.; Garrido, F.; Campbell, C.G.; Garcia-Gonzolez, Maria Teresa

2004-01-30T23:59:59.000Z

308

An analysis of markets for small-scale, advanced coal-combustion technology in Spain, Italy, and Turkey  

SciTech Connect (OSTI)

This report discusses the examination of potential overseas markets for using small-scale, US-developed, advanced coal-combustion technologies (ACTs). In previous work, member countries of the Organization for Economic Cooperation and Development (OECD) were rated on their potential for using ACTs through a comprehensive screening methodology. The three most promising OECD markets were found to be Spain, Italy, and Turkey. This report provides in-depth analyses of these three selected countries. First, it addresses changes in the European Community with particular reference to the 1992 restructuring and its potential effect on the energy situation in Europe, specifically in the three subject countries. It presents individual country studies that examine demographics, economics, building infrastructures, and energy-related factors. Potential niches for ACTs are explored for each country through regional analyses. Marketing channels, strategies, and the trading environments in each country are also discussed. The information gathered indicates that Turkey is a most promising market, Spain is a fairly promising market, and Italy appears to be a somewhat limited market for US ACTs. 76 refs., 16 figs., 14 tabs.

Placet, M.; Gerry, P.A.; Kenski, D.M.; Kern, D.M.; Nehring, J.L.; Szpunar, C.B.

1989-09-01T23:59:59.000Z

309

European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2DO.1.6 BULK LIFETIME ENHANCEMENT BY FIRING STEPS  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2DO.1.6 1 to getter metallic impurities and firing of silicon nitride (SiN) to induce hydrogen passivation. We analyse impurities and hydrogen bulk passivation, respectively. Additionally, the fired SiN layers have to ensure

310

G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June -1 July 2005 Tarragona (Spain) 1 Source Regulation of Fast Energetic  

E-Print Network [OSTI]

G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005 Tarragona (Spain, Rome, Italy #12;G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005, EPM, ...) #12;G. Vlad et al., P2.107 32nd EPS Plasma Physycs Conference. 27 June - 1 July 2005

Vlad, Gregorio

311

European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.25 MODELLING THE CURING DYNAMICS OF ETHYLENE-VINYL ACETATE  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3. Alshuth2 , M. Köntges1 and R. Brendel1,3 1 Institute for Solar Energy Research Hamelin (ISFH), Am Ohrberg 1, D-31860 Emmerthal, Germany 2 German Institute of Rubber Technology, Eupener Stra�e 33, D-30519

312

European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2BO.3.1 ELECTRON AND HOLE MOBILITY REDUCTION AND HALL FACTOR IN PHOSPHORUS-  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2BO.3.1 1 of Engineering, The Australian National University, Canberra, ACT 0200, Australia 2 Department of Electronic Materials Engineering, The Australian National University, Canberra ACT 0200, Australia 3 Institut für

313

European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2BO.1.5 BORON-OXYGEN-RELATED RECOMBINATION CENTERS IN COMPENSATED SILICON  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2BO.1 Rougieux2 , Daniel Macdonald2 , Karsten Bothe1 , and Jan Schmidt1 1 Institute for Solar Energy Research and Computer Science, The Australian National University Canberra ACT 0200, Australia ABSTRACT: The impact

314

To Appear in Proc. Third International Workshop on Solar Polarization, Tenerife, Spain, 2002, Eds. J. Trujillo Bueno & J. Sanchez Almeida., ASP Conference Series  

E-Print Network [OSTI]

window and secondary optics. The secondary optics uses a field mirror to re-image the pupil on a 25 cmTo Appear in Proc. Third International Workshop on Solar Polarization, Tenerife, Spain, 2002, Eds Solar Telescope G¨oran B. Scharmer, Dan Kiselman, Mats G. L¨ofdahl & Luc H. M. Rouppe van der Voort

Löfdahl, Mats

315

European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2CV.3.24 DAIDALOS A PLUGIN BASED FRAMEWORK  

E-Print Network [OSTI]

these plugins, complex objects can be created in a modular way. The definitions of input- and output-data within25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2CV.3,2 1 Institute for Solar Energy Research Hamelin (ISFH), Am Ohrberg 1, 31860 Emmerthal, Germany 2

316

Instituto de Ciencia de Materiales de Madrid  

E-Print Network [OSTI]

litio en espinelas LiMyMn2-yO4 Baterías Li-ión Electrónica portátil 2003 20001994 2006 Li+ J.M. Amarilla

317

Instituto de Ciencia de Materiales de Madrid  

E-Print Network [OSTI]

: Seguridad para las personas Fabricación con cero emisiones Reciclado y valorización de materiales como

318

UNIVERSIDAD AUTONOMA DE MADRID ESCUELA POLITECNICA SUPERIOR  

E-Print Network [OSTI]

BASED ON VISUAL ACTIVITY -PROYECTO DE FIN DE CARRERA- Virginia Fernández Arguedas JUNIO 2008 #12;ii SUMMARIZATION OF SURVEILLANCE VIDEOS BASED ON VISUAL ACTIVITY -PROYECTO DE FIN DE CARRERA- AUTOR: Virginia de 2008 #12;iii -PROYECTO DE FIN DE CARRERA- Título: Summarization of surveillance videos based

Autonoma de Madrid, Universidad

319

UNIVERSIDAD COMPLUTENSE DE MADRID FACULTAD DE INFORMATICA  

E-Print Network [OSTI]

/ Algebra Coordinador: Ruiz Bermejo, César Descripción de contenidos mínimos: · Los números reales, derivación e integración numérica. · Sistemas lineales y matrices. · Programación lineal. · Espacios vectoriales. · Aplicaciones lineales. · Rangos y determinantes. · Sistemas lineales. · Resolución numérica de

Fernando, Jose F.

320

Universidad Autonoma de Madrid Escuela politecnica superior  

E-Print Network [OSTI]

seguimiento de las actividades y la asistencia. Problemas en este ´area pueden causar consecuencias directas tales como incendios o fugas de agua. Pero este seguimiento puede revelar tambi´en actividades humanas´on de un sistema de monitorizaci´on no intrusivo de cargas de dispositivos (Non-Intrusive Appliance Load

Autonoma de Madrid, Universidad

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Universidad Autonoma de Madrid Escuela Politecnica Superior  

E-Print Network [OSTI]

´ES DE LOS ODORANTES RECIBIDOS Ingenier´ia de Telecomunicaci´on Tom´as V´azquez Rubio Abril 2013 #12´iguez Ortiz GNB Dpto. de Ingenier´ia Inform´atica Escuela Polit´ecnica Superior Universidad Aut´onoma de (con la sinapsis qu´imica era necesario simular el CPG previamente en un PC). Se deber´a buscar un

Autonoma de Madrid, Universidad

322

Universidad Autonoma de Madrid Escuela Politecnica Superior  

E-Print Network [OSTI]

valor num´erico en forma de relaci´on de verosimilitud o LR que repre- sente el peso de la evidencia

Autonoma de Madrid, Universidad

323

Polytechnic University of Madrid | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrangePeru:Job Corp Jump Partner PolandPolytechnic

324

Madrid, Alabama: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429Lacey,(MonasterLowell Point,ECO Auger11. It isMadisonMadisonburg,

325

Lung Cancer Attributable to Indoor Radon Exposures in Two Radon--Prone Areas, Stei (Romania) and Torrelodones (Spain)  

SciTech Connect (OSTI)

Radon and radon progeny are present indoors, in houses and others dwellings, representing the most important contribution to dose from natural sources of radiation. Most studies have demonstrated an increased risk of lung cancer at high concentration of radon for both smokers and nonsmokers. For medium and low concentrations which are the typical residential radon levels, recent researches have also demonstrated increased risks of lung cancer for people exposed. The work presents a comparative analysis of the radon exposure data in the two radon--prone areas, Stei, Transylvania, (Romania), in the near of old Romanian uranium mines and in the granitic area of Torrelodones town, Sierra de Guadarrama (Spain). One important difference between the two studied areas is related to the houses built using uranium waste as construction material in Stei area. Measurements of indoor radon were performed in 280 dwellings (Romania) and 91 dwellings (Spain) by using nuclear track detectors, CR 39. The highest value measured in Stei area was 2650 Bq{center_dot}m{sup -3}. and 366 Bq{center_dot}m{sup -3} in the Spanish region. The results are compute with the BEIR VI report estimates using the age-duration model at an exposure rate below 2650 Bq{center_dot}m{sup -3}. A total of 233 lung cancer deaths were calculated in the Stei area for a period of 13 years (1994-2006), which is 116.82% higher than observed from the national statistics. In comparison, in Torrelodones area, a number of 276 deaths caused by lung cancer were estimated along a period of 13 years, which is 2.09 times higher than the number observed by authorities. This represents a significantly evidence that elevated risk can strongly be associated with cumulated radon exposure.

Dinu, Alexandra; Cosma, Constantin; Vasiliniuc, Stefan [Faculty of Env. Science, 'Babes-Bolyai' University, Fantanele, No. 30 Cluj Napoca (Romania); Sainz, Carlos; Poncela, Luis Santiago Quindos [Department of Medical Physics, Faculty of Medicine, University of Cantabria, c/Herrera Oria s/n. 39011, Santander (Spain)

2009-05-22T23:59:59.000Z

326

"BNC Seminar" June 10th, 2014 @ 2:00pm  

E-Print Network [OSTI]

at the Universidad Autónoma de Madrid, Spain). In 2002 he was at the University of Bath (UK) as a research visitor electrodes for electrochromic devices. In 2003 he joined the Photovoltaic and Optoelectronic Devices Group at the Universitat Jaume I (Castellón, Spain) where he obtained his PhD in 2006 based on the preparation

Ginzel, Matthew

327

OG 4.3.07 1 The GRAAL project  

E-Print Network [OSTI]

, Universidad Complutense, E-28040 Madrid, Spain© CIEMAT-Departamento Energias Renovables, Plataforma Solar de) makes use of the CESA-1 heliostat field at the "Plataforma Solar de Almeria" (Spain) as a gamma mirror area of an exist- ing solar-power plant. The optical principle of Mini- GRAAL is different from

328

OG 4.3.07 1 The GRAAL project  

E-Print Network [OSTI]

, Universidad Complutense, E­28040 Madrid, Spain 2 CIEMAT­Departamento Energias Renovables, Plataforma Solar de) makes use of the CESA­1 heliostat field at the ``Plataforma Solar de Almeria'' (Spain) as a gamma mirror area of an exist­ ing solar­power plant. The optical principle of Mini­ GRAAL is different from

329

Detection of cosmic -rays using a heliostat field: the case of F. Arqueros1  

E-Print Network [OSTI]

Fisicas. Universidad Complutense. E-28040 Madrid. Spain 2 CIEMAT-Departamento de Energias renovables. Plataforma Solar de Almeria. E-04080 Almeria. Spain 3 Max-Planck Institute f¨ur Physik. D-80805 M¨unchen. Germany Abstract. Gamma-Ray telescopes based on a solar plant are able to accurately measure the spatial

330

Future Network & MobileSummit 2013 Conference Proceedings Paul Cunningham and Miriam Cunningham (Eds)  

E-Print Network [OSTI]

Atos, Madrid, Spain 8 i2CAT, Barcelona, Spain 9 Fraunhofer FOKUS, Berlin, Germany 10 University of Bristol, Bristol, UK 11 IT innovation centre, Southampton, UK Abstract: Internet systems are currently too of innovative research ideas that could arise from the mixture of their diverse technologies and resources

Sandhu, Ravi

331

A. Camacho, et al., Int. J. of Design & Nature and Ecodynamics. Vol. 7, No. 3 (2012) 239250 2012 WIT Press, www.witpress.com  

E-Print Network [OSTI]

of Mathematics, Universidad Autónoma de Madrid, Spain. 6Agencia Estatal de Meteorologia, Spain. ABSTRACT Remote, environmental prognoses, Maritime Antarctica, regional warming, remote lakes, sensor systems, simple food webs in hydrology, biogeo- chemical cycles and the composition of biological communities and species interactions

Justel Eusebio, Ana

332

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

of Texas Congress Avenue Austin Texas http www biodieselcoalitionoftexas org Texas Area Boots on the Roof Boots on the Roof Automall Parkway Fremont California http www...

333

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Russia Cp Holdings Llc Cp Holdings Llc Stillwater Minnesota Carbon An external carbon advisor DHL Neutral Services DHL Neutral Services Bracknell United Kingdom RG12 AN Carbon...

334

Institution Name Institution Name Address Place Zip Notes Website...  

Open Energy Info (EERE)

www ecn nl home Energy Technology Data Exchange Energy Technology Data Exchange P O Box Oak Ridge Tennessee http www etde org home html Energy Environment and Development Network...

335

Name Name Address Place Zip Category Sector Telephone number...  

Open Energy Info (EERE)

Laboratory Inc Shrewsbury Street Holden Massachusetts Category Testing Facility Operators Hydro http www aldenlab com Alden Tow Tank Alden Wave Basin Alden Small Flume Alden Large...

336

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

significantly better heating efficiency than conventional coiled wire elements A O Smith A O Smith Wisconsin Efficiency Solar Wisconsin based based company that makes both...

337

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

CECO Environmental Corp CECO Environmental Corp Cincinnati Ohio Services Provider of air pollution control products and services CEEG NanJing New Energy CEEG NanJing New...

338

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Boston Area Green Fuel Technologies Corporation Green Fuel Technologies Corporation Smith Place Cambridge Massachusetts Biofuels Recycles CO2 from flue gases to produce...

339

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Energy Ltd A A Energy Ltd Nagpur Maharashtra India Biomass Nagpur based biomass project developer A S NaturEnergie GmbH A S NaturEnergie GmbH Pfaffenhofen Germany Biomass Germany...

340

Exploring zipping and assembly as a protein folding principle  

E-Print Network [OSTI]

C. Are there pathways for protein folding? Journal de Chimieand the mechanism of protein folding. Ann Rev Biochem 1982;Baldwin RL. How does protein folding get started? TRENDS in

Voelz, Vince A; Dill, Ken A

2007-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons Coop,

342

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerCons

343

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas PowerConsSolar

344

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcas

345

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energy

346

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar Energys

347

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBusPFAN)ChangeOnPACenEditOrcasAustin Solar

348

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png Roadmap

349

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(UtilityCounty, Michigan:OregonTransmissionHeader.png RoadmapCambridge Energy

350

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)Columbus

351

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom Efficiency

352

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLC

353

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom EfficiencyLLCe

354

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdom

355

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg A

356

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den Berg

357

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den BergAG

358

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan den

359

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan denAFS

360

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United Kingdomvan

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners ANV

362

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 NoPublic Utilities Address: 160Benin:EnergyWisconsin: Energy,(EC-LEDS)ColumbusDHeat Ltd United KingdomvanPartners

363

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Arava Power...

364

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Thessaloniki Greece Renewable Energy Solar Water Heaters Solar Collector Hot water Tanks http www mevaconh gr MGE UPS SYSTEMS Inc MGE UPS SYSTEMS Inc Costa Mesa California...

365

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

GmbH Braunschweig Germany Solar Manufactures and markets solar collectors hot water tanks and heating Solydair Energies Solydair Energies Miraval Les Thuiles Renewable Energy...

366

Name Address Place Zip Sector Product Stock Symbol Year founded...  

Open Energy Info (EERE)

Free Flow has raised some initial funding and is prototype testing in rivers and tanks http www free flow power com Functional Design Engineering Inc Marine and Hydrokinetic...

367

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

Designs manufactures and exports solar tube thermal solar collectors solar storage tanks waste heat recovery systems solar controllers and related components Apros Solar Apros...

368

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

energy Wind energy Germany based power project developer particularly active in wind and biogas projects and now starting to do geothermal BE Geothermal GmbH BE Geothermal GmbH...

369

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

power http www relion inc com Pacific Northwest Area Roth Rau AG Roth Rau AG Zimmritz Germany Hydro Hydrogen Solar Roth Rau offers equipment for fully automated solar cell...

370

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU Institute

371

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to: navigation,CSU

372

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:

373

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center for

374

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climate compatible development Jump to:Fraunhofer Center

375

Name Name Address Place Zip Category Sector Telephone number Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories onFocus AreaDataBus Jump to:NSTAR

376

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:

377

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington Second

378

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:Washington

379

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump to:WashingtonTIER

380

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A123

382

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentratingRenewable Solutions LLC Jump to: navigation, search Name:CXD) Jump23 Systems A1230

383

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation American

384

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <Foundation

385

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives <FoundationFund

386

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentives

387

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California Coast

388

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum California

389

Organization Organization Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth'sOklahoma/GeothermalOrange County is a countyIncentivesForum CaliforniaCompany

390

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz Limited

391

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDIT REPORT Americium/CuriumSunways JVGroupChoice Logo: ColoradoVoltz

392

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo Avenue

393

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia Menlo

394

Company Name Company Name Address Place Zip Product Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexas

395

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

396

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasInc

397

Company Name Company Name Address Place Zip Sector Product Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhioOglesby,Sullivan,InformationInformationCalifornia MenloTexasIncA1

398

Property:Incentive/Cont4Zip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County, Maine:PlugNumberOfArraProjectTypeTopic2GrossGenYes,Phone"AEP

399

Property:Incentive/ContZip | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoadingPenobscot County,ContAddr2 Jump to: navigation, search Property

400

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal CapacityRenewable

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled Geothermal

402

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution Name

403

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled GeothermalInstitution

404

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalled

405

Institution Name Institution Name Address Place Zip Notes Website Region  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's Heat JumpInc Place: Eden Prairie,InfieldInstalledResearch Caltech Center for

406

In T. R. G. Green, J. J. Canas, & C. P. Warren (Eds): Proceedings of the Eight Conference on Cognitive Ergonomics. p 139-144. (ECCE8, Granada, Spain, September 10-13.)  

E-Print Network [OSTI]

on Cognitive Ergonomics. p 139-144. (ECCE8, Granada, Spain, September 10-13.) Reusing processes and documenting Ergonomic Psychology Group Language and Communication Laboratory Ergonomic Psychology Group INRIA

Paris-Sud XI, Université de

407

Radar-based dynamic testing of the cable-suspended bridge crossing the Ebro River at Amposta, Spain  

SciTech Connect (OSTI)

Microwave remote sensing is the most recent experimental methodology suitable to the non-contact measurement of deflections on large structures, in static or dynamic conditions. After a brief description of the radar measurement system, the paper addresses the application of microwave remote sensing to ambient vibration testing of a cable-suspended bridge. The investigated bridge crosses the Ebro River at Amposta, Spain and consists of two steel stiffening trusses and a series of equally spaced steel floor beams; the main span is supported by inclined stay cables and two series of 8 suspension cables. The dynamic tests were performed in operational conditions, with the sensor being placed in two different positions so that the response of both the steel deck and the arrays of suspension elements was measured. The experimental investigation confirms the simplicity of use of the radar and the accuracy of the results provided by the microwave remote sensing as well as the issues often met in the clear localization of measurement points.

Gentile, Carmelo [Politecnico di Milano, Dept. of Architecture, Built environment and Construction engineering (ABC), Piazza Leonardo da Vinci 32, 20133 Milan (Italy); Luzi, Guido [Centre Tecnòlogic de Telecomunicacions de Catalunya (CTTC), Division of Geomatics, Av. Gauss, 7 E-08860 Castelldefels (Barcelona) (Spain)

2014-05-27T23:59:59.000Z

408

Roof-top solar energy potential under performance-based building energy codes: The case of Spain  

SciTech Connect (OSTI)

The quantification at regional level of the amount of energy (for thermal uses and for electricity) that can be generated by using solar systems in buildings is hindered by the availability of data for roof area estimation. In this note, we build on an existing geo-referenced method for determining available roof area for solar facilities in Spain to produce a quantitative picture of the likely limits of roof-top solar energy. The installation of solar hot water systems (SHWS) and photovoltaic systems (PV) is considered. After satisfying up to 70% (if possible) of the service hot water demand in every municipality, PV systems are installed in the remaining roof area. Results show that, applying this performance-based criterion, SHWS would contribute up to 1662 ktoe/y of primary energy (or 68.5% of the total thermal-energy demand for service hot water), while PV systems would provide 10 T W h/y of electricity (or 4.0% of the total electricity demand). (author)

Izquierdo, Salvador; Montanes, Carlos; Dopazo, Cesar; Fueyo, Norberto [Fluid Mechanics Group, University of Zaragoza and LITEC (CSIC), Maria de Luna 3, 50018 Zaragoza (Spain)

2011-01-15T23:59:59.000Z

409

Viability Conditions for a Compartmentalized Protometabolic System: A Semi-Empirical Approach  

E-Print Network [OSTI]

, Madrid, Spain, 2 Departamento de Lo´gica y Filosofi´a de la Ciencia, Universidad del Pai´s Vasco, Donostia-San Sebastia´n, Spain, 3 Unidad de Biofi´sica, Consejo Superior de Investigaciones Cienti´ficas-Universidad del Pai´s Vasco, Leioa, Spain, 4 Center for Fundamental Living Technology, University of Southern

410

NREL Response to the Report 'Study of the Effects on Employment of Public Aid to Renewable Energy Sources' from King Juan Carlos University (Spain) (White Paper)  

SciTech Connect (OSTI)

Job generation has been a part of the national dialogue surrounding energy policy and renewable energy (RE) for many years. RE advocates tout the ability of renewable energy to support new job opportunities in rural America and the manufacturing sector. Others argue that spending on renewable energy is an inefficient allocation of resources and can result in job losses in the broader economy. The report, Study of the Effects on Employment of Public Aid to Renewable Energy Sources, from King Juan Carlos University in Spain, is one recent addition to this debate. This report asserts that, on average, every renewable energy job in Spain 'destroyed' 2.2 jobs in the broader Spanish economy. The authors also apply this ratio to the U.S. context to estimate expected job loss from renewable energy development and policy in the United States. This memo discusses fundamental and technical limitations of the analysis by King Juan Carlos University and notes critical assumptions implicit in the ultimate conclusions of their work. The memo also includes a review of traditional employment impact analyses that rely on accepted, peer-reviewed methodologies, and it highlights specific variables that can significantly influence the results of traditional employment impact analysis.

Lantz, E.; Tegen, S.

2009-08-01T23:59:59.000Z

411

Please cite this article in press as: Otero, I., et al., Loss of water availability and stream biodiversity under land abandonment and climate change in a Mediterranean catchment (Olzinelles, NE Spain). Land Use Policy (2010), doi:10.1016/j.landusepol.201  

E-Print Network [OSTI]

biodiversity under land abandonment and climate change in a Mediterranean catchment (Olzinelles, NE Spain under land abandonment and climate change in a Mediterranean catchment (Olzinelles, NE Spain) Iago-cover change Warming Mediterranean catchment Water courses Aquatic fauna a b s t r a c t In the north rim

Gracia, Carlos

412

European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2AO.2.3 EFFECT OF SiN DEPOSITION TEMPERATURE ON SURFACE PASSIVATION OF N-TYPE CZ SILICON  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 2AO.2N deposition leads to increasing the hydrogen content of the SiN layers. This improves the supply of hydrogen silicon using thermally grown oxide or amorphous films based on hydrogenated silicon compounds has been

413

European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3.115 NON-LINEAR MECHANICAL PROPERTIES OF ETHYLENE-VINYL ACETATE (EVA) AND ITS  

E-Print Network [OSTI]

25th European Photovoltaic Solar Energy Conference, Valencia, Spain, 6-10 September 2010, 4AV.3,2 1 Institute for Solar Energy Research Hamelin (ISFH), Am Ohrberg 1, D-31860 Emmerthal, Germany 2 ABSTRACT: Polymers such as ethylene-vinyl acetate (EVA) encapsulants are known for their non

414

This is the authors' version of the work. It is posted here for your personal use only. Not for redistribution. The definitive version is accepted for publication in the European Wireless 2014, Barcelona, Spain, May 2014.  

E-Print Network [OSTI]

, Spain, May 2014. Distributed Spectrum Allocation for Autonomous Cognitive Radio Networks Anatolij Zubow usage of non-occupied spectrum licensed to Pri- mary Users (PU). With the Non-Contiguous OFDM of available spectrum. A promising solution to achieve this goal is the Cognitive Radio (CR) approach

Wichmann, Felix

415

A review of "English Merchants in Seventeenth Century Italy." by Gigliola Pagano de Divitiis  

E-Print Network [OSTI]

and insubstantial quality that too often mars Italian academic prose. Jonathan Brown and John Elliott, eds. The Sale of the Century: Ar- tistic Relations between Spain and Great Britain, 1604?1655. Madrid: Yale University Press and Museo Nacional del Prado, 2002.... 315 pp. $65 hardback. Review by ELIZABETH R. WRIGHT, UNIVERSITY OF GEORGIA. Art historian Jonathan Brown and historian John Elliott have joined forces to provide an indispensable guide to the political and artistic relationship between Spain...

James Paterson

2003-01-01T23:59:59.000Z

416

From Termination to Cost (in Object-Oriented Languages)  

E-Print Network [OSTI]

From Termination to Cost (in Object-Oriented Languages) Elvira Albert Complutense University of Madrid (Spain) 11th International Workshop on Termination Edinburgh, 14 July, 2010 Elvira Albert From Termination to Cost #12;Outline of the Talk 1 Simple Imperative Bytecode Programs Elvira Albert From

Politécnica de Madrid, Universidad

417

Engineering Virtualized Services Elvira Albert  

E-Print Network [OSTI]

Engineering Virtualized Services Elvira Albert Complutense University of Madrid, Spain elvira project FP7-610582 ENVISAGE: Engineering Virtualized Services (http://www.envisage-project.eu). level of an application-level service at the expense of potentially changing its cost profile. In traditional engineering

Johnsen, Einar Broch

418

Perceptually and Statistically Decorrelated Features for Image Representation: Application to Transform Coding  

E-Print Network [OSTI]

to Transform Coding Jesâ??us Malo, Francesc Ferri y Universitat de Valâ??encia Dpt. d' â?? Optica, y Dpt. d de â?? Optica (CSIC) C/ Serrano 121, 28006 Madrid, Spain r.navarro@io.csic.es Abstract Transform coding

Malo, Jesus

419

Intelligent Automation and Soft Computing, Vol. 14, No. 3, pp. 367-376, 2008 Copyright 2008, TSI  

E-Print Network [OSTI]

the solar system. It comprises three sites, located in Goldstone, California, USA; Madrid, Spain SCHEDULING OF SPACE NETWORK COMMUNICATIONS MARK D. JOHNSTON Jet Propulsion Laboratory California Institute and will be inadequate to support the anticipated growth in capacity over coming decades. Accordingly, there is a plan

Schaffer, Steven

420

ORIGINAL RESEARCH ARTICLE published: 25 July 2012  

E-Print Network [OSTI]

stimuli Ying Liu1, *, Anne-Lise Paradis2,3,4 , Lydia Yahia-Cherif 5 and Catherine Tallon-Baudry1 1 A. Strange, Technical University Madrid, Spain *Correspondence: Ying Liu, LNC, ENS, 29 rue d'Ulm, 75005 Paris, France. e-mail: ying.liu.gu@gmail.com There is converging evidence

Gutkin, Boris

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Scaling properties of weakly nonlinear coefficients in the Faraday problem A.C. Skeldon  

E-Print Network [OSTI]

- ids such as water (kinematic viscosity of about 1 cSt) with single frequency harmonic excitation [2, 3 Cardenal Cisneros 3, 28040 Madrid, Spain (Dated: June 14, 2011) Interesting and exotic surface wave container of fluid shaken up and down to provoke surface waves. This system is relatively compact, evolves

Skeldon, Anne C.

422

Very high-energy c-ray observations of the Crab nebula and other potential sources with the GRAAL experiment  

E-Print Network [OSTI]

Madrid, Spain b CIEMAT-Departamento Energias Renovables, Plataforma Solar de Almeria, E-04080 Almeria-1 field at the ``Plataforma Solar de Almeria'' to collect Cherenkov light from air showers. The detector is located in a central solar tower and detects photon-induced showers with an energy threshold

423

Proceedings of ICRC 2001: 1 c Copernicus Gesellschaft 2001  

E-Print Network [OSTI]

Complutense. E­28040 Madrid. Spain 2 CIEMAT­Departamento de Energias renovables. Plataforma Solar de Almeria­Ray telescopes based on a solar plant are able to accurately measure the spatial distribution and time structure ago Danaher et al. (1982) proposed to use the large mirrored area of a solar power plant (heliostat

424

Solid-Sfah Ekcfmnicr Vol 24. pp. 415A20, 1981 Printed in Great Britain.  

E-Print Network [OSTI]

A. LUQUE Instituto de Energia Solar (E.T.S.I.T.), Universidad Polittcnica de Madrid, Spain (Received Per8amonPressLtd. OPERATING LIMITS OF AL-ALLOYED HIGH-LOW JUNCTIONS FOR BSF SOLAR CELLS A D i g &?b 7 the invention of the Back Surface Field (BSF) solar cell [l] Al has been considered as an efficient dopant

del Alamo, Jesús A.

425

Orchestra: Developing a Unified Open Architecture for Risk Management Applications  

E-Print Network [OSTI]

and Innovation, Ordnance Survey, Romsey Road, Southamp- ton, SO16 4GU, UK, Joe.Greenwood@ordnancesurvey.co.uk 4, 28037 Madrid, Spain, anne- marie.sassen@atosorigin.com 7 Fraunhofer IITB, Fraunhoferstr. 1, 76131 Karlsruhe, Germany Thomas.Uslaender@iitb.fraunhofer.de hal-00713724,version1-2Jul2012 Author manuscript

Paris-Sud XI, Université de

426

Types of red cell potassium in seven Spanish native breeds Paquita GONZALEZ Maria Jess TUON M. VALLEJO  

E-Print Network [OSTI]

Note Types of red cell potassium in seven Spanish native breeds of cattle Paquita GONZALEZ Maria Madrid, Spain Summary The distribution of red-cell potassium was studied in seven Spanish native breeds-equiv/1. For HK animals the means ranged from 50.8 to 66.1 m-equiv/1. Key word : red cell potassium

Paris-Sud XI, Université de

427

European Journal of Forest ISSN 1612-4669  

E-Print Network [OSTI]

Pardos, Francisco Lario & Pedro Villar-Salvador #12;1 23 Your article is protected by copyright and all´ Climent · Maria Regina Chambel · Marta Pardos · Francisco Lario · Pedro Villar-Salvador Received: 6 May (Ourense), Spain P. Villar-Salvador Departamento de Ecologi´a, Universidad de Alcala´, Carretera Madrid

Villar-Salvador, Pedro

428

Phys. Plasmas 2 (8), August 1995, 3017 Wavelet bicoherence: A new turbulence analysis tool  

E-Print Network [OSTI]

1 Phys. Plasmas 2 (8), August 1995, 3017 Wavelet bicoherence: A new turbulence analysis tool B, Madrid, Spain Abstract A recently introduced tool for the analysis of turbulence, wavelet bicoherence [B and usefulness of a new analysis tool for chaos and turbulence that was recently introduced [1]. First, we

Martín-Solís, José Ramón

429

Influence of Heat Transmission Mode on Heating Rates and on the Selection of Patches for Heating in a Mediterranean Lizard  

E-Print Network [OSTI]

369 Influence of Heat Transmission Mode on Heating Rates and on the Selection of Patches for Heating in a Mediterranean Lizard Josabel Belliure* Luis M. Carrascal Department of Evolutionary Ecology´ Gutie´rrez Abascal 2, 28006 Madrid, Spain Accepted 6/6/02 ABSTRACT Heliothermy (heat gain by radiation

Carrascal, Luis M.

430

A&A 510, A5 (2010) DOI: 10.1051/0004-6361/200913215  

E-Print Network [OSTI]

00117+6412 Aina Palau1, Á. Sánchez-Monge2, G. Busquet2, R. Estalella2, Q. Zhang3, P. T. P. Ho3,4, M. T Exoplanetas, LAEFF campus, PO Box 78, 28691 Villanueva de la Cañada, Madrid, Spain e-mail: palau@ieec.uab.es 2

Beuther, Henrik

431

Proceedings of the International Workshop on Adaptation,  

E-Print Network [OSTI]

Proceedings of the 1st International Workshop on Adaptation, Personalization and REcommendation. Carrero3 1 Universidad Autónoma de Madrid, Spain {ivan.cantador, david.vallet}@uam.es 2 Yahoo! Research.carrero}@uem.es #12;#12;Preface The 1st International Workshop on Adaptation, Personalization and REcommendation

Cantador, Iván

432

Wake models are used to improve predictions of Annual Energy Production (AEP) of wind farms.  

E-Print Network [OSTI]

deficit in the near field, Proceedings of the European Wind Energy Conference, Madrid, Spain, European, Boundary Layer Meteorology 132, pp. 129-149, 2009. [3] G. Larsen, H. Madsen and N. Sørensen, Mean wake·Wake models are used to improve predictions of Annual Energy Production (AEP) of wind farms. ·Wake

Daraio, Chiara

433

DOI 10.1393/ncc/i2008-10324-3 IL NUOVO CIMENTO Online First  

E-Print Network [OSTI]

DOI 10.1393/ncc/i2008-10324-3 IL NUOVO CIMENTO Online First Filtered deterministic waves and analysis of the fractal dimension of the components of the wind velocity M. Tijera(1 )(), J. L. Cano(1 Meteorologia - Madrid, Spain (3 ) Department of Geotechnical Engineering and Geosciences, UPC - Barcelona

Bolster, Diogo

434

J. Phys.Chem. Thermochemistry of 2-and 3-Acetylthiophenes: Calorimetric and Computational Study  

E-Print Network [OSTI]

"Rocasolano", CSIC, Serrano 119, 28006 Madrid, Spain James S. Chickos Department of Chemistry and Biochemistry of Chemistry, Faculty of Science, University of Porto, Rua do Campo Alegre, 687, P-4169-007 Porto, Portugal, vaporization and sublimation were measured by rotating-bomb combustion calorimetry, Calvet microcalorimetry

Chickos, James S.

435

771Ann. For. Sci. 61 (2004) 771779 INRA, EDP Sciences, 2005  

E-Print Network [OSTI]

article The effects of thinning on the structural diversity of coppice forests Fernando MONTES*, Isabel 7,5, 28040 Madrid, Spain (Received 14 August 2002; accepted 26 February 2004) Abstract ­ Coppices thinning regimes applied in coppice stands of Quercus pyrenaica and Quercus faginea. Structural diversity

Boyer, Edmond

436

Proceedings of the 2011 IEEE International Conference on Mechatronics  

E-Print Network [OSTI]

, Jorge Godoy and Javier Alonso Centre for Automation and Robotics (UPM-CSIC), Madrid, Spain (e-Cooperative maneuver among autonomous and con ventional vehicles can be considered one of the next steps for ob taining. The experiments are focused on the longitudinal control when an autonomous vehicle is overtaking to other

Paris-Sud XI, Université de

437

CURRICULUM VITAE MARIA ISABEL BUENO CACHADINA  

E-Print Network [OSTI]

, Santa Cruz de la Sierra (Bolivia). 1997. 5. Bachelor's degree in Mathematics. (Licenciada en Matemáticas Madrid, Spain. 1994 - 2000 Professor, Universidad Privada de Santa Cruz de la Sierra, Bolivia. 1993 - 1994 Instructor, Universidad Nur, Bolivia. 1992 - 1993 High-school teacher, Colegio La Salle, Bolivia

Sideris, Thomas C.

438

UNIVERSIDAD COMPLUTENSE DE MADRID FACULTAD DE CIENCIAS FISICAS  

E-Print Network [OSTI]

TRANSVERSOS EN LASERES DE COLORANTE Y CO2 Inmaculada Leyva Callejas TESIS DOCTORAL #12;DEPARTAMENTO DE OPTICA, director del Depar- #12;tamento de Optica, el haber puesto a mi disposici´on los medios colectivos

Rey Juan Carlos, Universidad

439

Sidney Sussex College Chapel Virgin Saints, on loan in Madrid  

E-Print Network [OSTI]

of Pastoral Studies, Westcott House 11-November! The Ven John Beer, Archdeacon of Cambridge 18-November. The Revd Tiffany Conlin is Director of Pastoral Studies, Westcott House. The Ven John Beer is Archdeacon

Travis, Adrian

440

CantoblancoNoticiasdelaUniversidadAutnomadeMadrid Nmero6Abril1999  

E-Print Network [OSTI]

anterior. 2. Informe del Rector. 3. Debate y, en su caso, aprobación del proyecto de reforma de los. Propuestas adiciónales para el proyecto de Comercio Justo. 6. Propuestas sobre las encuestas al profesorado Claustro. Extraemos el primer párrafo del informe dis- tribuido entre los claustrales: "Tengo el honor de

Autonoma de Madrid, Universidad

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

CantoblancoNoticiasdelaUniversidadAutnomadeMadrid Nmero7Mayo1999  

E-Print Network [OSTI]

más interés suscitaron en- tre los participantes fueron el informe del Rector, la reforma de los proyecto de Comercio Justo, las encuestas al profesorado, la condena de ac- tos que atentan contra la de la comunidad universitaria el informe sobre las actividades y la gestión realizadas en la Autónoma

Autonoma de Madrid, Universidad

442

Biblioteca y Archivo Universidad Autnoma de Madrid Biblioteca Politcnica bibliogrficas  

E-Print Network [OSTI]

Editorial, © 2010 9788484485520 INF/B0290/SAN Golubitsky, Martin Algebra lineal y ecuaciones diferenciales 9706860401 INF/B0290H/GOL Merino González, Luis M. Álgebra lineal: con métodos elementales / Luis M. Merino

Autonoma de Madrid, Universidad

443

Biblioteca y Archivo Universidad Autnoma de Madrid Biblioteca Politcnica bibliogrficas  

E-Print Network [OSTI]

Hernández, Eugenio Algebra lineal y geometría / Eugenio Hernández Rodríguez, María Jesús Vázquez Gallo[etc.] : Thomson, D. L. 2007 9788497322904 INF/B0290/U�A Castellet, Manuel Algebra lineal y geometría / Manuel

Autonoma de Madrid, Universidad

444

Ingenieria Geologica Universidad Politecnica de Madrid MECANICA DE MEDIOS CONTINUOS  

E-Print Network [OSTI]

Tema 0: Algebra y c´alculo tensorial Curso 2006-07 Problema 1.-- Calcular las matrices de componentes de los siguientes tensores, definidos como aplicaciones lineales: 1. La proyecci´on de los vectores

Romero, Ignacio

445

CENTRO DE FORMACIN CONTINUA UNIVERSIDAD AUTNOMA DE MADRID  

E-Print Network [OSTI]

que abordan las principales temáticas acerca de la habilidad o competencia. 1. Creatividad e cosas. Unidades temáticas: Proactividad Creatividad Motivación de logro 2. Cooperación en equipo. La

Pazos, Florencio

446

UNIVERSIDAD COMPLUTENSE DE MADRID FACULTAD DE CIENCIAS FISICAS  

E-Print Network [OSTI]

energ´ia y criterio de Lawson . . . . . . . . . . . 4 1.3. M´etodos de confinamiento del plasma . . . . . . . . . . . . . . . . . . . . . . . . . . . 50 3.4.1. Resultados anal´iticos bajo la aproximaci´on local . . . . . . . 50 3.4.2. Resultados num´ericos. . . . . . . . . . . . . . . . . . . . . . 53 4. Esquema num´erico 57 4.1. Integraci´on espacial

Martín-Solís, José Ramón

447

Universidad Autnoma de Madrid Departamento de Ingeniera Informtica  

E-Print Network [OSTI]

that strongly lead the industry and the researchers to study the power consumption of the current digital circuits: mobile electronic devices, refrigeration accessories and packaging costs, environmental impact, energy cost, reliability, and restrictions to the VLSI integration density. Designing VLSI for low power

Todorovich, Elías

448

Universidad Carlos III de Madrid Departamento de Matem aticas  

E-Print Network [OSTI]

;erico de ecuaciones diferenciales estoc#19;asticas: Aplicaci#19;on a la Mec#19;anica Estad#19;#16;stica doctoral Estudio anal#19;#16;tico y num#19;erico de ecuaciones diferenciales estoc#19;asticas: Aplicaci#19

Moro, Esteban

449

19th INTERNATIONAL CONGRESS ON ACOUSTICS MADRID, 27 SEPTEMBER 2007  

E-Print Network [OSTI]

unison strings. These interactions give rise to beats and double decay phenomena, which are of particular of both scientific and musical communities regarding the middle range of the instrument. However, the double decay plays a determinant role in the treble range because sound level is lower and decay time

450

DOE New Madrid Seismic Zone Electric Utility Workshop Summary Report -  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "of EnergyEnergyENERGYWomenthe HouseStudents2.2at MultipleorderNuclear Plants |Department ofApril 30,

451

New Madrid County, Missouri: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(Utility Company) Jump to: navigation, searchOhio:

452

New Madrid, Missouri: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy ResourcesLoading map...(Utility Company) Jump to: navigation, searchOhio:MO) Jump to: navigation, search

453

DOE New Madrid Seismic Zone Electric Utility Workshop Summary Report  

Broader source: Energy.gov (indexed) [DOE]

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE:1 First Use of Energy for All Purposes (Fuel and Nonfuel),Feet) Year Jan Feb Mar Apr May Jun Jul(Summary) "ofEarly Career Scientists'Montana. DOCUMENTSof Energy DOEDOE LessonsDepartment of EnergyNSTBDOE New

454

Madrid, New Mexico: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429Lacey,(MonasterLowell Point,ECO Auger11. It

455

Madrid, New York: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to:46 - 429Lacey,(MonasterLowell Point,ECO Auger11.

456

City of New Madrid, Missouri (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of Inspector GeneralDepartmentAUDITOhio (UtilityHolyrood,Martinsville,Moultrie,Nelson Place:Holstein,Missouri

457

Ardeola 50(2), 2003, 295-300 * Departamento Interuniversitario de Ecologa, Universidad Autnoma de Madrid, E-28049 Madrid, Es-  

E-Print Network [OSTI]

.morales@uam.es AVES Y EVALUACI�N DE IMPACTO AMBIENTAL: ¿ESTAMOS IDENTIFICANDO EL PROBLEMA CORRECTAMENTE? Francisco evaluación de impacto ambiental: ¿estamos identificando el problema correcta- mente? En réplica al artículo que plantean los Estudios de Impacto Ambiental sobre las aves rapaces, discutimos al- gunos aspectos y

Oñate, Juan J.

458

Mechanical characterization of GdBCO/Ag and YBCO single grains fabricated by Top-Seeded Melt Growth at 77 and 300 K  

E-Print Network [OSTI]

Mechanical characterization of GdBCO/Ag and YBCO single grains fabricated by Top-Seeded Melt Growth at 77 and 300 K K. Konstantopoulou1, Y. H. Shi2, A. R. Dennis2, J. H. Durrell2, J. Y. Pastor1 and D. A. Cardwell2 1Departamento de Ciencia de... and D A Cardwell2 1Departamento de Ciencia de Materiales, Universidad Politécnica de Madrid, E. T. S. de Ingenieros de Caminos, C/Prof. Aranguren s/n, E28040 Madrid, Spain 2Department of Engineering, Bulk Superconductivity Group, University of Cambridge...

Konstantopoulou, K.; Shi, Y. H.; Dennis, A. R.; Durrell, J. H.; Pastor, J. Y.; Cardwell, D. A.

2014-10-20T23:59:59.000Z

459

Immosolar Spain | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data CenterFranconia, Virginia: Energy Resources Jump to: navigation,Ohio:GreerHiCalifornia:ISI SolarIdanha,Information JumpMorocco Jump

460

Oil and Gas Company Oil and Gas Company Address Place Zip Website  

Open Energy Info (EERE)

Irving Texas http www exxonmobil com Corporate Gazprom Gazprom Nametkina St Moscow Russia http www gazprom com Gulfsands Petroleum Gulfsands Petroleum Cork Street London United...

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Functional genomics analysis of the arabidopsis ABI5 bZIP transcription factor  

E-Print Network [OSTI]

results correlated best with qRT-PCR validation data for selected genes. A small number of genes including AtCOR413 pm-1 showed a consistent expression pattern across the three platforms. A robust ABRE cis-regulatory element was identified in the promoter...

Hur, Jung-Im

2009-05-15T23:59:59.000Z

462

Address State: Zip: All participants: please complete the form below and return it to  

E-Print Network [OSTI]

to UCDEA Contact the Retiree Center via e-mail: retireecenter@ucdavis.edu or telephone: (530) 752-5182

Schladow, S. Geoffrey

463

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

Last Name URL Products/Services NAICS Code NAICS Description &yet 2008 140 Gage Blvd Suite 100 Richland and user experience professionals. Build products, consult, and educate internationally and locally. 5415 Engineering, construction--air conditioning 5413 Architectural, engineering, and related services Advanced

464

A circular electrostatic zipping actuator for the application of a MEMS tunable capacitor  

E-Print Network [OSTI]

Micromechanical circuits such as MEMS switches, tunable capacitors (varactors) or resonators in general have lower loss and consume less power than their CMOS counterparts and have seen an increase of applications in ...

Yang, Xue'en, 1975-

2005-01-01T23:59:59.000Z

465

LAST NAME: FIRST NAME: M.I.: MAILING ADDRESS: CITY: STATE: ZIP  

E-Print Network [OSTI]

AND ISI S INFORMATION ORIGINAL ISIS TRANSACTION NUMBER: ______________ AMOUNT CREDITED TO ISIS: $______________ NEW ISIS TRANSACTION NUMBER: ______________ REFUND DUE CUSTOMER: $______________ DATE PROCESSED IN ISIS: Distribution: White-Accounting Yellow-Customer CREDIT STUDENT (ISIS) ACCOUNT REFUND (CHECK

Tsien, Roger Y.

466

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

water heating systems in the Tri-cities and surrounding area 2382 Solar Heating equipment installation, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power generation in irrigation canals 2211 Electric power generation, transmission and distribution Columbia Basin

467

Business Name Year Address City State Zip Phone Email Address Contact  

E-Print Network [OSTI]

is the premier provider of residential and commercial solar thermal water heating systems in the Tri, Environmental Services, Calibration Services, Facilities Leasing, Industrial Development 2211 Electric power-cities and surrounding area 2382 Solar Heating equipment installation Air Liquide America Corp 1902 231808 E Sr 397

468

3D compression: from A to Zip: a first complete example THOMAS LEWINER  

E-Print Network [OSTI]

the design of compression schemes adapted to specific class of models. The recent launch of Google Sketch'up

Lewiner, Thomas (Thomas Lewiner)

469

Phosphorylation of the Parsley bZIP Transcription Factor CPRF2 Is Regulated by Light*  

E-Print Network [OSTI]

in response to light, we analyzed the common plant regulatory factor 2 (CPRF2) from parsley (Petroselinum

Schäfer, Eberhard

470

Determining protein interaction specificity of native and designed bZIP family transcription factors  

E-Print Network [OSTI]

Protein-protein interactions are important for almost all cellular functions. Knowing which proteins interact with one another is important for understanding protein function as well as for being able to disrupt their ...

Reinke, Aaron W

2012-01-01T23:59:59.000Z

471

Quick Start The various sample data files after expansion (use Zip)  

E-Print Network [OSTI]

library (49 signature files and 1 library list file, all in ASCII, 300 KB). Duncan Knob.sdf Lidar full wave form SDF file (60 MB). Duncan Knob.idx Required index file for Duncan Knob.sdf (4.5 MB). sbet_mission 1.out Smoothed Best Estimate of Trajectory file. Needed for Duncan Knob.sdf (98 MB). Immediate

472

Photo of the Week: Power Up! Twenty Steps to Zip a Zipper | Department of  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankCombustion | Department ofT ib l L d F SSalesOE0000652GrowE-mail on August

473

Looking for a way to find utilites per zip code (a list?) | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Powerstories on climateJuno Beach,October,LighthouseInformationLongwood is

474

Name Address Place Zip Sector Product Stock Symbol Year founded Number  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision hasInformation Earth's HeatMexico: EnergyMithun JumpMuscoy,Jump9 Case Data Survey Type LotNYSERDAZip

475

State Oil and Gas Board State Oil and Gas Board Address Place Zip Website  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revisionEnvReviewNonInvasiveExplorationUT-g GrantAtlas (PACA RegionSpringview IISt.StarlightSystem

476

Do we get actual vendor name while we searched with zip code? | OpenEI  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home5b9fcbce19 No revision has beenFfe2fb55-352f-473b-a2dd-50ae8b27f0a6 No revision has TypeGeothermal Area JumpSix Well Flow

477

Electric Utility Company Assigned to a Zip Code? | OpenEI Community  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating Solar Power Basics (The followingDirectLow CarbonOpen1Model | OpenCDWR) Jump

478

Helen Gordon Child Development Center WAITLIST APPLICATION  

E-Print Network [OSTI]

____ Zip Code________ Cell Phone _______________ Other Phone ________________ E ____ Zip Code________ Cell Phone _______________ Other Phone ________________ E

Lafferriere, Gerardo

479

MEDICAL ENTRANCE FORM (REQUIRED) UNDER 18 YEARS OF AGE ONLY  

E-Print Network [OSTI]

: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ______________________ Zip Code: ______________ Cell Phone #: ___________________________ Email: ____________ Daytime phone: _________________ Evening phone: _________________ Email

Weitz, Joshua S.

480

Volume 161,number 1 CHEMICAL PHYSICS LETTERS I September 1989 COMPARISON OF CLASSICAL AND QUANTUM PHASE SPACE STRUCTURE  

E-Print Network [OSTI]

. Permanent address: Departamento Quimica C-14, Universi- dad Autonoma de Madrid, Cantoblanco, 28049Madrid

Note: This page contains sample records for the topic "madrid spain zip" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

Spatial Dispersion of Peering Clusters in the European Internet  

E-Print Network [OSTI]

.1777 Madrid, Spain -0.04 0.00485 -1.9773 dispersed FICIX -0.0673 Helsinki, Finland -0.07692 0.02584 0.05993 random GIGAPIX 0.01981 Lisbon, Portugal -0.07143 0.01928 0.65701 random GN-IX -0.1898 Groningen, Netherlands -0.125 0.03914 -0.3274 random INEX -0...

D'Ignazio, Alessio; Giovannetti, Emanuele

2006-03-14T23:59:59.000Z

482

The Attribute Selection for GRE Challenge: Overview and Evaluation Results  

E-Print Network [OSTI]

of the evaluation methods (Section 4). #12;Team ID Submitted Systems Organisation CAM CAM-B, CAM-BU, CAM-T, CAM-FBS, IS-IAC University of Stuttgart, Germany NIL NIL Universidad Complutense de Madrid, Spain TITCH TITCH-BS-STAT, TITCH-BS-DYN Tokyo Institute of Technology, Japan TITCH-AW-STAT, TITCH-AW-STAT-PLUS TITCH-RW-STAT, TITCH-RW-STAT

Belz, Anja

483

Industrial and natural sources of gaseous elemental mercury in the Almadén district (Spain): An updated report on this issue after the ceasing of mining and metallurgical activities in 2003 and major land reclamation works  

SciTech Connect (OSTI)

Two events during the last decade had major environmental repercussions in Almadén town (Spain). First it was the ceasing of activities in the mercury mine and metallurgical facilities in 2003, and then the finalization of the restoration works on the main waste dump in 2008. The combination of both events brought about a dramatic drop in the emissions of gaseous elemental mercury (GEM) to the atmosphere. Although no one would now call the Almadén area as ‘mercury-free’, the GEM levels have fallen beneath international reference safety levels for the first time in centuries. This has been a major breakthrough because in less than one decade the site went from GEM levels in the order of “tens of thousands” to mere “tens” nanogram per cubic meter. Although these figures are per se a remarkable achievement, they do not mark the end of the environmental concerns in the Almadén district. Two other sites remain as potential environmental hazards. (1) The Las Cuevas mercury storage complex, a partially restored ex-mining site where liquid mercury is being stored. The MERSADE Project (LIFE—European Union) has tested the Las Cuevas complex as a potential site for the installation of a future European prototype safe deposit of surplus mercury from industrial activities. Despite restoration works carried out in 2004, the Las Cuevas complex can still be regarded as hotspot of mercury contamination, with high concentrations above 800 ?g g{sup ?1} Hg{sub soil} and 300 ng m{sup ?3} Hg{sub gas}. However, as predicted by air contamination modeling using the ISC-AERMOD software, GEM concentrations fade away in a short distance following the formation of a NW–SE oriented narrow plume extending for a few hundred meters from the complex perimeter. (2) Far more dangerous from the human health perspective is the Almadenejos area, hosting the small Almadenejos village, the so-called Cerco de Almadenejos (CDA; an old metallurgical precinct), and the mines of La Nueva Concepción, La Vieja Concepción and El Entredicho. The CDA is an old metallurgical site that operated between 1794 and 1861, leaving behind a legacy of extremely contaminated soils (mean concentration=4220 ?g g{sup ?1} Hg) and GEM emissions that in summer can reach levels up to 4,000–5,000 ng m{sup ?3}. Thus the CDA remains the sole ‘urban’ site in the district surpassing GEM international reference safety levels. In order to prevent these emissions, the CDA requires immediate action regarding restoration works. These could involve the full removal of soils or their permanent capping to create an impermeable barrier.

Higueras, Pablo, E-mail: pablo.higueras@uclm.es [Departamento de Ingeniería Geológica y Minera, Escuela Universitaria Politécnica de Almadén, Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain) [Departamento de Ingeniería Geológica y Minera, Escuela Universitaria Politécnica de Almadén, Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain); Instituto de Geología Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain); María Esbrí, José [Departamento de Ingeniería Geológica y Minera, Escuela Universitaria Politécnica de Almadén, Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain) [Departamento de Ingeniería Geológica y Minera, Escuela Universitaria Politécnica de Almadén, Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain); Instituto de Geología Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain); Oyarzun, Roberto; Llanos, Willans [Instituto de Geología Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain) [Instituto de Geología Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain); Departamento de Cristalografía y Mineralogía, Facultad de Ciencias Geológicas, Universidad Complutense, 28040 Madrid (Spain); Martínez-Coronado, Alba [Instituto de Geología Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain)] [Instituto de Geología Aplicada (IGeA), Universidad de Castilla-La Mancha, Plaza M. Meca 1, 13400 Almadén (Spain); and others

2013-08-15T23:59:59.000Z

484

ADDRESS: STATE: ZIP: Please complete the appropriate section of this form along with your check made payable to UC Regents.  

E-Print Network [OSTI]

@ucdavis.edu or telephone: (530) 752-5182 No tickets will be sent. You will receive a reminder via e-mail prior to the event

Thomases, Becca

485

Name AKA_FKA Contract # Start Date End Date Contract Scope City State Zip Phone Site Last Review  

E-Print Network [OSTI]

experience Fossil OR 97830 541.763.2725 3 Ashland Pediatrics AFF-2009-1389 04/15/2010 06/30/2015 Nursing students clinical learning experience Ashland OR 97520 541.482.8114 1 Ashland School District #5 AFF-2012-0933 07/01/2012 06/30/2017 Nursing students clinical learning experience Ashland OR 97520 541.482.8771 6

Chapman, Michael S.

486

Investigating the Aggregation of the Basic Leucine Zipper (bZIP) Domain of Activating Transcription Factor 5 (ATF5)  

E-Print Network [OSTI]

was amplified using PCR for insertion to a plasmid using the following primers: 5’GCGCGCCCATGGGCCCTGCCACCACCCGA3’ (forward primer with NcoI restriction site), 5’GCGCGCCATATGCCTGCCACCACCCGAGGG3’ (forward primer with NdeI restriction site), 5.... The NcoI site was used to insert the ATF5 gene following a Glutathione-S-Transferase (GST) tag, whereas insertion at the NdeI site generated a construct from which untagged ATF5 could be expressed. The ligation product was transformed into competent...

Ciaccio, Natalie Anne

2010-05-31T23:59:59.000Z

487

Spain's Earth Scientists and the Oil Spill  

E-Print Network [OSTI]

and a south to north slope current on the sea (1­11), the decision to move the vessel from about 43°N, 9.5°WSpain's Earth Scientists and the Oil Spill THE SPANISH COAST OF GALICIA IS CURRENT- ly subject to an oil spill that, given its spatial and temporal extent, could become one of the worst spills ever

Brown, James H.

488

Import of fruits from Spain to Finland.  

E-Print Network [OSTI]

??The research is made for company named Karamelo Citrus S.L.L. It has already business links to many countries and they are working on the link… (more)

Hall, Hardi

2012-01-01T23:59:59.000Z

489

University of Castilla La Mancha Toledo, Spain  

E-Print Network [OSTI]

will be held concurrently. To Register online visit: swatmodel.tamu.edu/conferences/2011 Cancellation Policy Cancellation Policy: Cancel by April 15, 2011 -- receive 70% of registration fee. Cancel after April 15 gassman, Iowa State University, USA A.K. gosain, Indian Institute of Technology, India Ann van griensven

490

XIII REPSOLYPF-HARVARD SEMINAR SALAMANCA, SPAIN  

E-Print Network [OSTI]

of history would support my point. There has not been any politically-inspired price disruption arising from oil, natural gas, terrorism, and finally, about carbon. I offer these four thoughts to stimulate unpredictable and dangerous waters of energy policy in a turbulent and dangerous world. First, oil. We have

Deutch, John

491

XIII REPSOLYPF-HARVARD SEMINAR SALAMANCA, SPAIN  

E-Print Network [OSTI]

JOHN F. KENNEDY SCHOOL OF GOVERNMENT HARVARD UNIVERSITY 79 JFK Street Cambridge, MA 02138, USA REPSOL William W. Hogan French Electricity Liberalization and the European Context ............87 Michel Massoni.........................................................97 María Luisa Huidobro Restructuring Wholesale and Retail Electricity Markets in the United States

Deutch, John

492

Spain: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectric Coop, Inc Place: Missouri References: EIA

493

Barcelona, Spain: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Office of InspectorConcentrating SolarElectricEnergyCT BiomassArnprior,AurantiaBanburyBankInvestBarbados:

494

2011-2012 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

495

Cal State Fullerton Alumni Association Candidate Information Sheet  

E-Print Network [OSTI]

________________________________________________________________________ City____________________________________________State_________ ZIP__________________ Home phone__________________________Cell phone_______________________________________ Company name________________________________________________________________________ City____________________________________________State_________ ZIP____________________ Business Phone

de Lijser, Peter

496

2012-2013 ELECTED OFFICERS SIGNATURE PROFILE FORM Note: All student organizations are REQUIRED to have a president, vice-president, treasurer, and secretary.  

E-Print Network [OSTI]

#_________________________________ Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #___________________________________ Cell Phone #_____________________________ Cell Phone #_______________________________ Hunter E______________________________ City, State, Zip___________________________ City, State, Zip_____________________________ Phone

Qiu, Weigang

497

Intensities for the Four Largest Shocks of the New Madrid Earthquake Sequence  

E-Print Network [OSTI]

or are heard to rustle. Weak plaster and masonry D cracked.at roof line. Fall of plaster, loose bricks, stones, tiles,limbs or fruit; cracking of plaster/stucco; some damage to

Agnew, Duncan C

2011-01-01T23:59:59.000Z

498

A review of "The Spanish Match: Prince Charles’ Journey to Madrid, 1623." by Alexander Samson ed.  

E-Print Network [OSTI]

(the Spanish Habsburgs) 18 SEVENTEENTH-CENTURY NEWS and the Black Knight (Count Gondomar) especially. The final chapter, by Clare Wikeley, concerns John Taylor the Water Poet, in particular his mocking praise of the court fool, Archy Armstrong, who...

Pursell, Brennan C.

2007-01-01T23:59:59.000Z

499

Febrero 2013 Biblioteca y Archivo Universidad Autnoma de Madrid Biblioteca Politcnica  

E-Print Network [OSTI]

Algebra lineal y geometría / Manuel Castellet, Irene Llerena, con la colaboración de Carlos Casacuberta

Autonoma de Madrid, Universidad

500

Octubre 2012 Biblioteca y Archivo Universidad Autnoma de Madrid Biblioteca Politcnica  

E-Print Network [OSTI]

-Wesley) 9788478290093 INF/512/DOR Hernández, Eugenio Algebra lineal y geometría / Eugenio Hernández Rodríguez, María INF/C4240/INT Arvesú Carballo, Jorge Problemas resueltos de álgebra lineal / Jorge Arvesú Carballo INF/512/HER Leon, Steven J. Linear algebra with applications / Steven J. Leon 8th ed. (International

Autonoma de Madrid, Universidad