Powered by Deep Web Technologies
Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Lt.  

Office of Legacy Management (LM)

TJ3: 7-Z TJ3: 7-Z 2.u 7 ifp&i?: 9:. .$&q Lt. ~ 3," .z' b ( $ -&7 ;" i C$' d. , : e-. flp w EmfP af XXPW 3PWlJ DEPARTMENT OF ENVIRONMENTAL PROTECTION DIVISION OF ENVIRONMENTAL QUALITY BUREAU OF RADIATION PROTECTION 380 SCOTCH ROAD. TRENTON. N. J. 08628 December 21, 1978 Ms. Louisa Little Pierpont Associates, Inc. 405 Lexington Avenue New York City, New York 10017 Dear Ms. Little: The purpose of this letter is to inquire about the present status of the former M. hT. Kellogg site (Kellex) located at the intersection of New Jersey Route 440 and Kellogg Street in Jersey City, New Jersey. The N. J. Department of Environmental Protection (N.J. DEP) has received fnformation that construction is in progress at this site which has resulted in

2

MEMORANDUM GY  

Office of Legacy Management (LM)

GY GY DATE--- -- __-______-__ II II s7 /L SITE NAME: CITY:--~~~&L%J _________ ------STATE:-&!=- "";::;:'KA;~+ jqjuM..wti current: ~~~--_~---___-~~~----~~--- Owner contacted q yes if yes, date contacted-- TYPE OF OPERATION ----------------- fl&search & Development 0 Production scale testing 0 Pilot Scale q Bench Scale Process 0 Theoretical Studies 0 s ample & Analysis IX Cny t;-.e i)r&&.h 0 Production 0 Disposal/Storage 0 Prime 0 Subcantractbr Cl Purchase Order 0 Facility Type 0 Manufacturing 0 University 0 Research Organization a Government Sponsored Facility q Other ~~~~~~~~~---~~------~ 0 Other information (i.e., coat + fixed fee, unit price, time 88 material, gtc) ------_ Contract/Purchase Order # ---------------------------------

3

Lesotho: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Lesotho: Energy Resources Lesotho: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-29.5,"lon":28.25,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

4

Study in South Africa and Lesotho A Curriculum Development Project  

E-Print Network [OSTI]

Teachers Study in South Africa and Lesotho A Curriculum Development Project Integrating Visual Arts about the cultures and history of the Basotho people of southern Africa Participate in seminars-Hays award, graduate credit and/or CEUs Visit non-malarial and low risk areas in southern Africa and enjoy

Viola, Ronald

5

C. Lt. Cooper  

Office of Legacy Management (LM)

C. Lt. Cooper C. Lt. Cooper c i+ ."',Z &+.), . - p 1 i ,P. f %:,:-I ! 19~~3 L. - F.M \ E3rush 3eryllium Company ~~~~io,tp!rr~~~~~~~~!~~~~~ I. * I/ :@ k 3 on August 2nd, I visited Brush beryllium Company along with Edajor &dlock and %,l,jor Eussell. arush representatives in the conference were Dr. C, B. Saver, ?resident, and Xessrs. Ejellgren, Christiansen, Fletcher and Zavarine. production of Tuballoy at arush ceased on July 31St* Furnaces Tre- tiously used fmTuballoy will be remodelled for manufacture of aeryl- lium, thus releasing melting furnaces at the Loraine plant for produc- tion of beryllium fluoride. This shift will make. their metal production capacity 600 pounds per month of which 500 lbs. will be available,to the project. It was agreed that the kngineers would place a,n order with arush for

6

Robust LT codes with alternating feedback  

Science Journals Connector (OSTI)

In this paper, we propose robust LT codes with alternating feedback (LT-AF codes), which lightly utilize the feedback channel and surpass the performance of existing LT codes with feedback. In LT-AF codes, we consider a loss prone feedback channel for ... Keywords: Erasure channel, Feedback channel, Forward error correction codes, LT codes, Rateless codes

Ali Talari, Nazanin Rahnavard

2014-08-01T23:59:59.000Z

7

A-<  

Broader source: Energy.gov (indexed) [DOE]

< &lt; Enclosure 2 ..- Page 1 of 2 RECORDS DlSPOSrrlON AUTHORITY (k IrrEtnx;tmr wl ma^) DATE RECEIVED 1. FROM (AgbncyoreaWWmmt NOTIFICATION TO AGENCY DepamncntofErmyy . 1 4.. NA?$E OF PERSON WITH WHOM TO CONFER 5. TELEPHONE I 6 . A G t N C Y CtK l ItlCATION I ~ E a r t i f y t M I m ~ b 3 ~ f D T ~ . o 1 c 1 c y m ~ p b c . t r i n b . g t o t h e ~ o f ~ r s c o r e b u d t f r t t t h a r s c o r d r ~ f o r ~ m t h s d b e h d p r g s ( s ) w s n o t m n r c b d f o r t h a k a i n s r r o f t h b . g c n c y ~ w i l l n o t b s m d s d r r R t r t h s ~ p c w i o d r r p e c i f i e d ; P d m ~ a n c u r r s n o e f r a t h e ~ ~ D f f i a , w h p r w k a n s o f R t h 8 o f t h t GAO ktuunl for Guidance d Fsddnl Apsndro, Core Contract Records See attached description 115.109 NSN STANDARD FORM 115 (REV. 3.91) PREVIOUS EDITION NOT USABLE P-bul by NARA 36 CFR 1228 Enclosure 2 Page 2 of 2 (1) Unit - PNR Contracts and Security ~ivision (2) Description - Contracts for procurement of reactor cores,

8

RenGyS | Open Energy Information  

Open Energy Info (EERE)

RenGyS RenGyS Jump to: navigation, search Name RenGyS Place Shanghai, China Sector Renewable Energy Product RenGyS is an independent renewable energy developer focused on the Chinese energy market. Coordinates 31.247709°, 121.472618° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":31.247709,"lon":121.472618,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

10

2008 Building Energy2008 Building Energyg gy Efficiency Standards  

E-Print Network [OSTI]

Buildings p , p g , Luminaire Power, etc. for Nonresidential Buildings 4 #12;What is New for 2008? R d l B ld What is New for 2008? R d l B ldResidential BuildingsResidential Buildings Mandatory Measures2008 Building Energy2008 Building Energyg gy Efficiency Standards g gy Efficiency Standardsfficie

11

2008 Residential2008 Residential Energy Plan ReviewEnergy Plan Reviewe gy la eviewe gy la eview  

E-Print Network [OSTI]

2008 Residential2008 Residential Energy Plan ReviewEnergy Plan Reviewe gy la eviewe gy la eview #12;2008 Residential Energy Plan2008 Residential Energy Plan Review ChecklistReview Checklist Simplification 2005 Residential Energy Plan Review2005 Residential Energy Plan Review 2005 and 2008 Nonresidential

12

STIFFENED SPRINGBACK REFLECTORS L.T. Tan and S. Pellegrino  

E-Print Network [OSTI]

STIFFENED SPRINGBACK REFLECTORS L.T. Tan and S. Pellegrino Department of Engineering, University plastic (CFRP). The whole structure is made as a single piece, without any expensive and potentially the reliability of the system. This paper proposes a modification of the original concept, based on the idea

Pellegrino, Sergio

13

"Diffusion of Innovation: Solar Oven Use in Lesotho (Africa)." Grundy, William and Roy Grundy. Advances in Solar Cooking: Proceedings of the 2nd International Conference on Solar Cooker Use and Technology. Shyam S. Nandwani, ed. July 12-15, 1994.  

E-Print Network [OSTI]

"Diffusion of Innovation: Solar Oven Use in Lesotho (Africa)." Grundy, William and Roy Grundy. Advances in Solar Cooking: Proceedings of the 2nd International Conference on Solar Cooker Use and Technology. Shyam S. Nandwani, ed. July 12-15, 1994. pp. 240-247. 1 DIFFUSION OF INNOVATION: SOLAR OVEN USE

Noble, William Stafford

14

From: Jim Burson &lt;jburson@swtransco.coop>  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Jim Burson Jim Burson &lt;jburson@swtransco.coop> To: "dswpwrmrk@wapa.gov" CC: Donald Kimball , Patrick Ledger , Richard Kurtz Date: 10/20/10 8:25 AM Subject: ED5-Palo Verde Hub Project (SPPR Proposal) Attachments: westernspprsupport.docx.pdf Dear Mr. Moe: Southwest Transmission Cooperative, Inc. (SWTC) is a customer of Western Area Power Administration (Western). We have multiply Parker- Davis Project transmission service contracts with Western. SWTC agrees with the attached SPPR letter, supporting the expansion of the Parker-Davis Project to include the ED5-Palo Verde Hub project referred to in Western's October 6th open meeting as the "SPPR

15

Guidelines for Working at Voltages &lt; 240 Volts  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Guidelines for Working at Voltages < 240 Volts Guidelines for Working at Voltages &lt; 240 Volts February 4, 2005---DRAFT NOTE: Working hot is a LAST ALTERNATIVE. Electrical hot work is defined as: Working on or near exposed conducting parts that are or might become energized at 50V or more. Refer to Electrical Safety Flowchart for Working On or Near Live Parts. Engineered methods to prevent exposed sources of 50V and greater are to be implemented wherever practical. Only QUALIFIED PERSONNEL {as defined in NFPA 70E Article 110.6(D) 2004 edition} as authorized by the CAT/supervisor/division can perform such work. Refer to Qualified Electrical Worker Flow Chart. Training requirements: ES&H 114 (LOTO) / ES&H 375 (NFPA 70E) / ES&H 371 (electrical worker) - Observe Electrical Safe Work Practices. Refer to

16

From: Mohave Sun Power &lt;mohavesunpower@gmail.com>  

Broader source: Energy.gov (indexed) [DOE]

Mohave Sun Power Mohave Sun Power &lt;mohavesunpower@gmail.com> To: Date: 4/3/2009 5:12 PM Subject: public comments to Western Transmission Infrastructure Program Regarding Western's Transmission Infrastructure Program ("Program") for Recovery Act funding, we submit the following public comments. All of these comments are to better clarify the "Project Readiness" criteria critical to the Program's success. They are characteristics of projects that have a higher chance of getting financed with provisions of the Recovery Act: 1. We believe that Western should put a higher priority on projects that are already in a Western LGIP queue. The justification for this higher priority is that these projects have made substantial progress

17

From: Ed Roman &lt;EROMAN@smud.org>  

Broader source: Energy.gov (indexed) [DOE]

Ed Roman Ed Roman &lt;EROMAN@smud.org> To: CC: , "Howard Hirahara" Date: 4/3/2009 10:30 AM Subject: SMUD'S COMMENTS AND QUESTIONS ON THE PROPOSED TIP Attachments: AGM ES 09-006 Commnet Letter on TIP.pdf Attached are comments of the Sacramento Municipal Utility District (SMUD) on the proposed principles, policies and practices that the Western Area Power Administration (Western) plans to use to implement the authority provided to it in section 402 of the American Recovery and Reinvestment Act of 2009 (Recovery Act). These comments are provided in response to the Notice of Proposed Program and Request for Public Comments as posted by the Western Area Power Administration (Western) in

18

Jersey Central Power & Lt Co | Open Energy Information  

Open Energy Info (EERE)

(Redirected from JCP&L) (Redirected from JCP&L) Jump to: navigation, search Name Jersey Central Power & Lt Co Place Ohio Utility Id 9726 Utility Location Yes Ownership I NERC Location RFC NERC RFC Yes RTO PJM Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png GS (General Service) Commercial GST (General Service Time-Of-Day) Commercial

19

MFV Korenbloem LT 535 sea trials no1: ICES area VIIe  

E-Print Network [OSTI]

MFV Korenbloem LT 535 sea trials no1: ICES area VIIe the results Pete, the Skipper #12;the `new SWFPO #12;discarded fish (all species) reduced by 60% in the Korenbloem new net 0 1000 2000 3000 4000

20

Hypofractionated Radiation Therapy (66 Gy in 22 Fractions at 3 Gy per Fraction) for Favorable-Risk Prostate Cancer: Long-term Outcomes  

SciTech Connect (OSTI)

Purpose: To report long-term outcomes of low- and intermediate-risk prostate cancer patients treated with high-dose hypofractionated radiation therapy (HypoRT). Methods and Materials: Patients with low- and intermediate-risk prostate cancer were treated using 3-dimensional conformal radiation therapy to a dose of 66 Gy in 22 daily fractions of 3 Gy without hormonal therapy. A uniform 7-mm margin was created around the prostate for the planning target volume, and treatment was prescribed to the isocenter. Treatment was delivered using daily ultrasound image-guided radiation therapy. Common Terminology Criteria for Adverse Events, version 3.0, was used to prospectively score toxicity. Biochemical failure was defined as the nadir prostate-specific antigen level plus 2 ng/mL. Results: A total of 129 patients were treated between November 2002 and December 2005. With a median follow-up of 90 months, the 5- and 8-year actuarial biochemical control rates were 97% and 92%, respectively. The 5- and 8-year actuarial overall survival rates were 92% and 88%, respectively. Only 1 patient died from prostate cancer at 92 months after treatment, giving an 8-year actuarial cancer-specific survival of 98%. Radiation therapy was well tolerated, with 57% of patients not experiencing any acute gastrointestinal (GI) or genitourinary (GU) toxicity. For late toxicity, the worst grade ?2 rate for GI and GU toxicity was 27% and 33%, respectively. There was no grade >3 toxicity. At last follow-up, the rate of grade ?2 for both GI and GU toxicity was only 1.5%. Conclusions: Hypofractionation with 66 Gy in 22 fractions prescribed to the isocenter using 3-dimensional conformal radiation therapy produces excellent biochemical control rates, with moderate toxicity. However, this regimen cannot be extrapolated to the intensity modulated radiation therapy technique.

Patel, Nita [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada)] [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada); Faria, Sergio, E-mail: sergio.faria@muhc.mcgill.ca [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada)] [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada); Cury, Fabio; David, Marc; Duclos, Marie; Shenouda, George; Ruo, Russell; Souhami, Luis [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada)] [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada)

2013-07-01T23:59:59.000Z

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Figure 1:Energy Consumption in USg gy p 1E Roberts, Energy in US  

E-Print Network [OSTI]

Fluctuations and Global Events 14E Roberts, Energy in US DOE: 2011 Vehicle Technology Market Report #12;Figure 15: Effect of Oil Prices on US Economy 15E Roberts, Energy in US DOE: 2011 Vehicle Technology MarketFigure 1:Energy Consumption in USg gy p 2008 1E Roberts, Energy in US Source: www.eia.gov #12

Sutton, Michael

22

On the Performance of Distributed LT Codes Srinath Puducheri, Jorg Kliewer, and Thomas E. Fuja  

E-Print Network [OSTI]

the data can be transmitted to the sink by effectively using one big MLT code, rather than several small LT Department of Electrical Engineering, University of Notre Dame, Notre Dame, IN 46556, USA Email: {spuduche compared to traditional channel codes is that in a data transmission sce- nario with packet erasures (e

Kliewer, Joerg

23

L NATJDNAL BNII?GY TiEHMOLOGY LIBOCAYOlY V.0. DEPARTMENT OF  

Broader source: Energy.gov (indexed) [DOE]

NATJDNAL BNII?GY TiEHMOLOGY LIBOCAYOlY NATJDNAL BNII?GY TiEHMOLOGY LIBOCAYOlY V.0. DEPARTMENT OF Albany, OR .Morgantown, WV s Plllsburgh, PA @ENERGY Januaty 27,201 1 MEMORANDUM FOR MAXI( J. MATARRESE DIRECTOR, OFFICE OF ENVIRONMENT, SECURITY, SAFETY AND HEALTH l c ? FROM: \ DIVISION SUBJECT: Amual Natioilal Enviro~l~neiltal Policy Act (NEPA) Planning Summary for 2011 The attached documents conlprise the 201 1 Allnual NEPA Planning Summary for the National Enexgy TechnologyLaboratory. The infoimation is presented according to the guidance and fonnats provided by DOE'SNEPA office. As required by the Order 451.1B, the Annual NEPA Pla~lning Siimmary will be made available to the public. Please contact nte for any additional info~.mation regarding r\lETL,'s NEPA plans. Distribution: A. Chlgini

24

ULTRACAM photometry of the eclipsing cataclysmic variables GY Cnc, IR Com and HT Cas  

E-Print Network [OSTI]

We present high-speed, three-colour photometry of the eclipsing cataclysmic variables GY Cnc, IR Com and HT Cas. We find that the sharp eclipses in GY Cnc and IR Com are due to eclipses of the white dwarf. There is some evidence for a bright spot on the edge of the accretion disc in GY Cnc, but not in IR Com. Eclipse mapping of HT Cas is presented which shows changes in the structure of the quiescent accretion disc. Observations in 2002 show the accretion disc to be invisible except for the presence of a bright spot at the disc edge. 2003 observations, however, clearly show a bright inner disc and the bright spot to be much fainter than in 2002. Although no outburst was associated with either set of quiescent observations, the system was ~0.6 mJy brighter in 2003, mainly due to the enhanced emission from the inner disc. We propose that these changes are due to variations in the mass transfer rate from the secondary star and through the disc. The disc colours indicate that it is optically thin in both its inner and outer regions. We estimate the white dwarf temperature of HT Cas to be 15 000 +/- 1000 K in 2002 and 14 000 +/- 1000 K in 2003.

W. J. Feline; V. S. Dhillon; T. R. Marsh; C. A. Watson; S. P. Littlefair

2005-10-14T23:59:59.000Z

25

Jersey Central Power & Lt Co (New Jersey) | Open Energy Information  

Open Energy Info (EERE)

Co (New Jersey) Co (New Jersey) Jump to: navigation, search Name Jersey Central Power & Lt Co Place New Jersey Utility Id 9726 References EIA Form EIA-861 Final Data File for 2010 - File2_2010[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates Residential: $0.0523/kWh Commercial: $0.0561/kWh Industrial: $0.1420/kWh References ↑ "EIA Form EIA-861 Final Data File for 2010 - File2_2010" Retrieved from "http://en.openei.org/w/index.php?title=Jersey_Central_Power_%26_Lt_Co_(New_Jersey)&oldid=412648" Categories: EIA Utility Companies and Aliases Utility Companies Organizations Stubs

26

Measurement of the LT-asymmetry in ?^0 electroproduction at the energy of the ?(1232) resonance  

E-Print Network [OSTI]

The reaction p(e,e'p)pi^0 has been studied at Q^2=0.2 (GeV/c)^2 in the region of W=1232 MeV. From measurements left and right of q, cross section asymmetries \\rho_LT have been obtained in forward kinematics \\rho_LT(\\theta_\\pi^0=20deg) = (-11.68 +/- 2.36_stat +/- 2.36_sys)$ and backward kinematics \\rho_LT(\\theta_\\pi^0=160deg) =(12.18 +/- 0.27_stat +/- 0.82_sys). Multipole ratios \\Re(S_1+^* M_1+)/|M_1+|^2 and \\Re(S_0+^* M_1+)/|M_1+|^2 were determined in the framework of the MAID2003 model. The results are in agreement with older data. The unusally strong negative \\Re(S_0+^* M_1+)/|M_1+|^2 required to bring also the result of Kalleicher et al. in accordance with the rest of the data is almost excluded.

D. Elsner; A. Sle; P. Barneo; P. Bartsch; D. Baumann; J. Bermuth; R. Bhm; D. Bosnar; M. Ding; M. Distler; D. Drechsel; I. Ewald; J. Friedrich; J. M. Friedrich; S. Grzinger; P. Jennewein; S. Kamalov; F. H. Klein; M. Kohl; K. W. Krygier; H. Merkel; P. Merle; U. Mller; R. Neuhausen; Th. Pospischil; M. Potokar; G. Rosner; H. Schmieden; M. Seimetz O. Strhle; L. Tiator; Th. Walcher; M. Weis

2005-07-08T23:59:59.000Z

27

GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIPIENT:County of Escambia. FL  

Broader source: Energy.gov (indexed) [DOE]

, , ... ~. u.s. DEPAR n-IENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIPIENT:County of Escambia. FL PROJECT TITLE: Road Prison Geothermal Earth Coupled HVAC Upgrade Page 1 of2 STATE: FL Funding Opportunity Announcement Numbtr Procurement Instrument Number NEPA Control Number CID Number DE-FOA-OOOOO13 DE-EEOOOO764.oo1 0 Based on my review of the information concerning the proposed action. as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination; ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply

28

U.S. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION  

Broader source: Energy.gov (indexed) [DOE]

ENER ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION Page 1 of2 RECIPI[NT:Oklahoma Municipal Powwer Authority STATE: OK PROJECT TITLE: OKLAHOMA SEP ARRA· OMPA Large Systems Request AI Funding Opportunity Announcement Number Proc:urtmtnt Instrument Number NEPA Control Number CIO Number DE-FOA-OOOOO52 DE·EE0133 GF0-000133-062 Based on my review orlbe information concerning the proposed action, as NEPA Compliance Officer (authoriHd UDder DOE Order 451.IA), I have made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: B5.19 Ground source heat pumps The installation, mocMcabon, operation and removal of commercially available smallscale ground source heat pumps to support operatloos In single facilities (suCh as a school Of community center) or contiguous facilities

29

DEPARTMENT OF ENER GY EERE PROJECT M~~AGEMENT CE"lTER  

Broader source: Energy.gov (indexed) [DOE]

ENER ENER GY EERE PROJECT M~~AGEMENT CE"lTER NEPA DETERMINATION RECIPIENT: Youngstown State University PROJECT TITLE: Center for Efficiency in Sustainable Energy Systems Page 1 of2 STATE : OH Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-EEOOOO366 GFQ-10-143 0 Based on my review arlhe information concerning tbe proposed action, as NEPA Compliance Offictr (authorized under DOE O rder 4SI.lA), I have made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: A9 Infonnation galhenng (including, but oot limited to, literature surveys, inventones, audits), data analYSIs (induding computer modeling), document preparation (such as cooceptual design or feasibility studies, analytical energy supply

30

T OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERlIIINATION  

Broader source: Energy.gov (indexed) [DOE]

.0I0J. .0I0J. u .s . DEPARnvIEN T OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERlIIINATION RECIPIENT:Town of Irmo PROJECT TITLE: Irma Charing Cross Sidewalk Project ARRA·EECBG Page I of2 STATE: SC Funding Opportunity Announcement Number Procur ement Instrument Number NEPA Control Number CID Number EEOOOO950/000 DE-EEOO00950 0 Based OD my review ortbe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45I.1A), I have made the following determination : ex, EA, EIS APPENDIX AND NUMBER: Description: 8 5.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical

31

U.S. DEPARTI\IENT OF ENER GY EE RE PROJECT MANAG EMENT CENT  

Broader source: Energy.gov (indexed) [DOE]

ENER ENER GY EE RE PROJECT MANAG EMENT CENT ER NEPA DETERl\lINATION RECIPIENT:AA Solar Products PROJECT TITLE: AA Solar Tracking System Factory Page 1 of2 STATE: IL Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-OOOOOS2 EEOOOO119 GFO-1O-331 EE119 Based on my review of the information concerning the proposed action, as NEPA Compliance Omen (authorized under DOE Order 451.1A), I ban made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description : 81 .31 Relocation of machinery and equipment, such as analytical laboratory apparatus, electronic hardware, maintenance equipment, and health and safety equipment, including minor construction necessary for removal and installation, where uses of the relocated items will be similar to their former uses and consistent with the general missions of the

32

P,OU)JI U.S. DEPARTIIIEN T OF ENER GY EERE PROJECT MANAGEMENT CENTER  

Broader source: Energy.gov (indexed) [DOE]

OU)JI OU)JI U.S. DEPARTIIIEN T OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DE TERlVlINATION RECIPIENT:City of St Petersburg PROJECT TITLE: EECBG Gir( of St. Petersburg· Commercial Energy Efficiency Audit Program Page 1 0[2 STATE: FL Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000013 DE-EE00007BO 0 Based on my review or the infonnation concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45t.IA), I have made th l~ (ollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited 10, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply

33

RECIPIENT:NREL U.S. DEPARTUENT OF ENER GY EERE PROJECT M ANAGEMENT CENT  

Broader source: Energy.gov (indexed) [DOE]

DEPARTUENT OF ENER DEPARTUENT OF ENER GY EERE PROJECT M ANAGEMENT CENT ER NEPA DETERl\IINATION PROJECT TITLE: NREL Bus Service to Off-Site Parking lot; NREL Tracking No. 10-016 Page 1 of2 STATE: CO FUnding Opportunity Announcement Number Procurcmtntlnstrumtnt Number NEPA Control Number CIO Number NREl-10-016 G01 0337 Based on my review orlhe information concerning the proposed action, as N[PA Compliance Offi<:er (authoriud under DOE Order 4Sl.IA), I have made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: DOE/EA· 1440-5·1 .7 Final Supplement to Final Site-Wide Environmental Assessment of the National Renewable Energy Laboratory's (NREL) South Table Mountain Complex (May 2008) Transfer, lease, disposition , or acquisition of interests in personal property (e.g., equipment and materials) or

34

T OF ENER GY EERE PROJECT MAN Au EMENT CENTER NEPA DE TERl\IINATION  

Broader source: Energy.gov (indexed) [DOE]

IEN IEN T OF ENER GY EERE PROJECT MAN Au EMENT CENTER NEPA DE TERl\IINATION RECIPIENT:$acramenio Municipal Utility District PROJECT TITLE : CRED - SMUD: Van Warmerdam Dairy Page 1 of2 STATE: CA Funding Opportunity Announcement Number DE-FOA-OOOO122 Procurement Instrument Number DE-EE0003070 NEPA Control Number CID Number o Based on my review of the info r mation concerning the proposed action, as NEPA Compliance Officer (authorized undu DOE Order 451.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including , but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling). document preparation (such as conceptual design or feasibility studies, analytical energy supply

35

RECIPIENT:Louisvilie Metro u.s. DEPARTMENT OF ENER GY EE RE PROJECT MANAG  

Broader source: Energy.gov (indexed) [DOE]

Louisvilie Metro Louisvilie Metro u.s. DEPARTMENT OF ENER GY EE RE PROJECT MANAG EM ENT CENTER NEPA DETERl\lINATION PROJECT TITLE: Green Jobs Revolving Loan Fund Page 1 01'2 STATE: KY Funding Opportunity Announcement Number 09EE003966 Procurement Instrument Number DE-EEOOOO729.001 NEPA Control Number em Number o Based on my review orthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase tI1e indoor concentrations of potentially harmful substances. These actions may involve financial and technical

36

U.S. DEPARTI'vIENT OF ENER GY EERE PROJECT MANAGEMENT CENTER  

Broader source: Energy.gov (indexed) [DOE]

DEPARTI'vIENT OF ENER DEPARTI'vIENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DEIER1\IINATION RECIPIENT:City of Fort Wayne Page 1 of2 STATE: IN PROJECf TITLE: EECBG Fort Wayne , Indiana ARRA-EECBG (S) (SOW for Revised Activity #1 and Activity #3) Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-OOOOO13 DE-EEOO00825 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: B5.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical

37

u.s. DEPARUvlllNT OF ENER GY EE RE PROJECT MANAG EM ENT CENTER  

Broader source: Energy.gov (indexed) [DOE]

DEPARUvlllNT OF ENER DEPARUvlllNT OF ENER GY EE RE PROJECT MANAG EM ENT CENTER NEPA DETERl\IlNATION RECIPIENT:MI Department of Energy, Labor & Economic Growth PROJECT TITL E : SEP - Green Chemistry - CEAM Phase 3 - KTM Industries Page 1 oI2 STATE: Ml Funding Opportunity Announcement Number DE-FOA-OOOOO52 Procurement Instrument Number DE-EEOOOO166 NEPA Control Number em Num ber GFO-OOOO166-032 GOO Based on my review of the information concerning the proposed ac tion, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination : ex, EA, [IS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical

38

GY EE RE PROJECT MANAG EMENT CENTER NEPA DETERlvIINATION  

Broader source: Energy.gov (indexed) [DOE]

n-IENT OF ENER n-IENT OF ENER GY EE RE PROJECT MANAG EMENT CENTER NEPA DETERlvIINATION Page 1 01'2 RECIPIENT:COUNTY OF MONTEREY, DEPARTMENT OF PUBLIC WORKS STATE: CO PROJECf TITLE: RECOVERY ACT: COUNTY OF MONTEREY, CA ENERGY EFFICI ENCY AND CONSERVATION BLOCK GRANT Funding Opportunity Announcement Numi>t'r Procurement Instrumcnt Number NEPA Control Number em Number DE-FOA-OOOOO 13 OE-EEOOOO897.001 0 Based on my review of the inronnation concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the (ollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: B5.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financia

39

RECIPIENT:MRC Polymers U.S. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMDIT  

Broader source: Energy.gov (indexed) [DOE]

MRC Polymers MRC Polymers U.S. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMDIT CENTER NEPA DETERMrNATION PROJECf TITLE: MRC PET Recycling Facility Page 1 of2 STATE: IL Funding Opportunity Announcement Numbu Procurement Instrument Number NEPA Control Number elD Number DE-FOA-OCX)()()52 EEOOOO119 EE119 Based on my review of the inronnation conenning the proposed action, as NEPA Compliance Offker (authorized undu DOE Order 45I.1A), I have made the rollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners

40

U.S. DEPARTU E NT OF ENER GY EERE PROJECT MANAGEM ENT CENTER  

Broader source: Energy.gov (indexed) [DOE]

DEPARTU DEPARTU E NT OF ENER GY EERE PROJECT MANAGEM ENT CENTER NEPA DETERl\lINATION RECIPIENT:lllinois Department of Commerce & Economic Opportunity PROJECT TITLE: Joliet Junior College; Joliet Junior College Facilities Building Page 1 of2 STATE: IL Funding Opportunity Announcement Numbtr Procurement Instrument Number NEPA Control Number CID Number DE-FOA-OOOOOS2 EE119 Based on my review orlbe information concerning tbe proposed action, 8S NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following detennination: ex, EA, [IS APPENDIX AND NUMBER: Description : 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION  

Broader source: Energy.gov (indexed) [DOE]

Peoria Peoria u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION PROJECT TITLE: Storage Tanks and Dispensers for E85 and Biodiesel (IL) Page 1 of2 STATE: Il Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE·EE

42

u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION  

Broader source: Energy.gov (indexed) [DOE]

U)~) U)~) u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIPIENT:Arizona Governor's Office of Energy Policy PROJECT TITLE : Arizona Rooftop Challenge (ARC) Page 1 of2 STATE: AZ Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number cm Number DE-FOA-Q000549 DE-EEOOO5693 GFO-OOOO5693-001 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45 1.1A),1 have made the following determination: CX, EA, EIS APPENDIX AND NUMBE R: Description: A 11 Technical advice and assistance to organizations Technica! advice and planning assistance to international , national, state, and local organizations. A9 Information gathering, analysis, and dissemination

43

U.S. DEPARTlVIENT OF ENER GY EERE PROJECT M ANAGEM ENT CENTER  

Broader source: Energy.gov (indexed) [DOE]

0I.0 ~ \ 0I.0 ~ \ U.S. DEPARTlVIENT OF ENER GY EERE PROJECT M ANAGEM ENT CENTER NEPA DETERMINATION RECIPIENT:ldaho Office of Energy Resources - City of Nampa PROJECT TITLE: SEP ARRA REEZ Nampa Wastewater Treatment Plant Biogas Boiler Project Page 1 of2 STATE: 10 Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number elD Number DE-FOA-OOOOOS2 DE-EEOO0141 GFO-09-156-007 0 Based on my review orlhe information concerning tbe proposed action, as NEPA Compliance Officer (author ized under DOE Order 4SI. IA), I have made the (ollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do nol increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical

44

U.S. DEPARTIlIENT OF ENER GY EERE PROJECT MANAGEMENT CENTER  

Broader source: Energy.gov (indexed) [DOE]

ENER ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIPIENT: Hi-Q Geophysical Inc Page I of2 STATE: NV PROJECT TITLE: Phase 3 - Seismic Fracture Characterization Methodologies for Enhanced Geothermal Systems .' unding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-PS36-08G09800B DE-FG36-08G018191 GFO-G018191-003 G018191 Based on my review of the information concerning the proposed action, as NEP A Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: ex. EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply

45

eGY-Africa: Addressing the Digital Divide for Science in Africa  

SciTech Connect (OSTI)

Adoption of information and communication technologies and access to the Internet is expanding in Africa, but because of the rapid growth elsewhere, a Digital Divide between Africa and the rest of the world exists, and the gap is growing. In many sub-Saharan African countries, education and research sector suffers some of the worst deficiencies in access to the Internet, despite progress in development of NRENs - National Research and Education (cyber) Networks. By contrast, it is widely acknowledged in policy statements from the African Union, the UN, and others that strength in this very sector provides the key to meeting and sustaining Millennium Development Goals. Developed countries with effective cyber-capabilities proclaim the benefits to rich and poor alike arising from the Information Revolution. This is but a dream for many scientists in African institutions. As the world of science becomes increasingly Internet-dependent, so they become increasingly isolated. eGY-Africa is a bottom-up initiative by African scientists and their collaborators to try to reduce this Digital Divide by a campaign of advocacy for better institutional facilities. Four approaches are being taken. The present status of Internet services, problems, and plans are being mapped via a combination of direct measurement of Internet performance (the PingER Project) and a questionnaire-based survey. Information is being gathered on policy statements and initiatives aimed at reducing the Digital Divide, which can be used for arguing the case for better Internet facilities. Groups of concerned scientists are being formed at the national, regional levels in Africa, building on existing networks as much as possible. Opinion in the international science community is being mobilized. Finally, and perhaps most important of all, eGY-Africa is seeking to engage with the many other programs, initiatives, and bodies that share the goal of reducing the Digital Divide - either as a direct policy objective, or indirectly as a means to an end, such as the development of an indigenous capability in science and technology for national development. The expectation is that informed opinion from the scientific community at the institutional, national, and international levels can be used to influence the decision makers and donors who are in a position to deliver better Internet capabilities.

Barton, C.E.; /Australian Natl. U., Canberra; Amory-Mazaudier, C.; /Lab.Phys.Plasmas, Saint Maur des Fosses; Barry, B.; /Assoc.African Univ., Accra; Chukwuma; /Olabisi Onabanjo U.; Cottrell, R.L.; /SLAC; Kalim, U.; /Pakistan Natl. U.; Mebrahtu, A.; /Mekelle U.; Petitdidier, M.; /Lab. d'Atmos., Velizy; Rabiu, B.; /Federal Tech. U., Akure; Reeves, C.; /Earthworks bv, Delft; ,

2010-06-16T23:59:59.000Z

46

SWAAM-LT: The long-term, sodium/water reaction analysis method computer code  

SciTech Connect (OSTI)

The SWAAM-LT Code, developed for analysis of long-term effects of sodium/water reactions, is discussed. The theoretical formulation of the code is described, including the introduction of system matrices for ease of computer programming as a general system code. Also, some typical results of the code predictions for available large scale tests are presented. Test data for the steam generator design with the cover-gas feature and without the cover-gas feature are available and analyzed. The capabilities and limitations of the code are then discussed in light of the comparison between the code prediction and the test data.

Shin, Y.W.; Chung, H.H.; Wiedermann, A.H. [Argonne National Lab., IL (United States); Tanabe, H. [Power Reactor and Nuclear Fuel Development Corp., Tokai, Ibaraki (Japan)

1993-01-01T23:59:59.000Z

47

Inference of Causal Networks from Time-course Transcription Data in Response to a2 Gy Challenge Dose of Ionizing Radiation with or without a 10 cGy Priming Dose  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Causal Networks from Time-course Transcription Data in Response to a Causal Networks from Time-course Transcription Data in Response to a 2 Gy Challenge Dose of Ionizing Radiation with or without a 10 cGy Priming Dose Kai Zhang, Ju Han, Torsten Groesser, Priscilla Cooper, and Bahram Parvin Lawrence Berkeley National Laboratory Goal: To elucidate temporal-dependent gene templates, causal networks, and underlying biological processes that can be inferred in response to a 10 cGy priming dose with or without a later higher challenged dose. Background and significance: Mechanistic inference of regulatory network can provide new insights into radiation systems biology. The main challenge continues to be high dimensionality of data, complex network architecture and limited knowledge of biological processes.

48

Polarized Structure Function $\\sigma_{LT'}$ for $p({\\vec e},e'K^+)\\Lambda$ in the Nucleon Resonance Region  

SciTech Connect (OSTI)

The first measurements of the polarized structure function $\\sigma_{LT'}$ for the reaction $p(\\vec e,e'K^+)\\Lambda$ in the nucleon resonance region are reported. Measurements are included from threshold up to $W$=2.05 GeV for central values of $Q^2$ of 0.65 and 1.00 GeV$^2$, and nearly the entire kaon center-of-mass angular range. $\\sigma_{LT'}$ is the imaginary part of the longitudinal-transverse response and is expected to be sensitive to interferences between competing intermediate s-channel resonances, as well as resonant and non-resonant processes. The results for $\\sigma_{LT'}$ are comparable in magnitude to previously reported results from CLAS for $\\sigma_{LT}$, the real part of the same response. An intriguing sign change in $\\sigma_{LT'}$ is observed in the high $Q^2$ data at $W\\approx 1.9$ GeV. Comparisons to several existing model predictions are shown.

Nasseripour, Rakhsha; Raue, Brian; Ambrozewicz, Pawel; Carman, Daniel; Amaryan, Moscov; Amaryan, Moskov; Anciant, Eric; Anghinolfi, Marco; Asavapibhop, Burin; Asryan, Gegham; Audit, Gerard; Auger, Thierry; Avagyan, Harutyun; Baghdasaryan, Hovhannes; Baillie, Nathan; Ball, J.P.; Ball, Jacques; Ball, J.P.; Ball, Jacques; Ball, J.P.; Ball, Jacques; Ball, J.P.; Ball, Jacques; Baltzell, Nathan; Barrow, Steve; Battaglieri, Marco; Beard, Kevin; Bedlinskiy, Ivan; Bektasoglu, Mehmet; Bellis, Matthew; Benmouna, Nawal; Berman, Barry; Biselli, Angela; Blaszczyk, Lukasz; Bonner, Billy; Bouchigny, Sylvain; Boyarinov, Sergey; Bradford, Robert; Branford, Derek; Briscoe, William; Brooks, William; Burkert, Volker; Butuceanu, Cornel; Calarco, John; Careccia, Sharon; Casey, Liam; Cetina, Catalina; Chen, Shifeng; Cheng, Lu; Cole, Philip; Collins, Patrick; Coltharp, Philip; Cords, Dieter; Corvisiero, Pietro; Crabb, Donald; Crede, Volker; Dale, Daniel; Dashyan, Natalya; De Masi, Rita; De Vita, Raffaella; De Sanctis, Enzo; Degtiarenko, Pavel; Dennis, Lawrence; Deur, Alexandre; Dhuga, Kalvir; Dickson, Richard; Djalali, Chaden; Dodge, Gail; Doughty, David; Dragovitsch, Peter; Dugger, Michael; Dytman, Steven; Dzyubak, Oleksandr; Egiyan, Hovanes; Egiyan, Kim; Elfassi, Lamiaa; Elouadrhiri, Latifa; Eugenio, Paul; Fatemi, Renee; Fedotov, Gleb; Feldman, Gerald; Feuerbach, Robert; Forest, Tony; Fradi, Ahmed; Funsten, Herbert; Garcon, Michel; Gavalian, Gagik; Gevorgyan, Nerses; Gilfoyle, Gerard; Giovanetti, Kevin; Girard, Pascal; Girod, Francois-Xavier; Goetz, John; Gothe, Ralf; Gothe, Ralf; Griffioen, Keith; Guidal, Michel; Guillo, Matthieu; Guler, Nevzat; Guo, Lei; Gyurjyan, Vardan; Hafidi, Kawtar; Hakobyan, Hayk; Hanretty, Charles; Hardie, John; Heddle, David; Hersman, F.; Hicks, Kenneth; Hleiqawi, Ishaq; Holtrop, Maurik; Hu, Jicun; Hyde, Charles; Ilieva, Yordanka; Ireland, David; Ishkhanov, Boris; Isupov, Evgeny; Ito, Mark; Jenkins, David; Jo, Hyon-Suk; Johnstone, John; Joo, Kyungseon; Juengst, Henry; Kalantarians, Narbe; Kellie, James; Khandaker, Mahbubul; Kim, Kui; Kim, Kyungmo; Kim, Wooyoung; Klein, Andreas; Klein, Franz; Kossov, Mikhail; Krahn, Zebulun; Kramer, Laird; Kubarovsky, Valery; Kuhn, Joachim; Kuhn, Sebastian; Kuleshov, Sergey; Kuznetsov, Viacheslav; Lachniet, Jeff; Laget, Jean; Langheinrich, Jorn; Lawrence, David; Livingston, Kenneth; Lu, Haiyun; Lukashin, Konstantin; MacCormick, Marion; Manak, Joseph; Markov, Nikolai; Mattione, Paul; McAleer, Simeon; McKinnon, Bryan; McNabb, John; Mecking, Bernhard; Mestayer, Mac; Meyer, Curtis; Mibe, Tsutomu; Mikhaylov, Konstantin; Minehart, Ralph; Mirazita, Marco; Miskimen, Rory; Mokeev, Viktor; Moreno, Brahim; Moriya, Kei; Morrow, Steven; Moteabbed, Maryam; Mueller, James; Munevar Espitia, Edwin; Mutchler, Gordon; Nadel-Turonski, Pawel; Niccolai, Silvia; Niculescu, Gabriel; Niculescu, Maria-Ioana; Niczyporuk, Bogdan; Niroula, Megh; Niyazov, Rustam; Nozar, Mina; Osipenko, Mikhail; Ostrovidov, Alexander; Park, Kijun; Pasyuk, Evgueni; Paterson, Craig; Pereira, Sergio; Peterson, Gerald; Philips, Sasha; Pierce, Joshua; Pivnyuk, Nikolay; Pocanic, Dinko; Pogorelko, Oleg; Pozdnyakov, Sergey; Preedom, Barry; Price, John; Procureur, Sebastien; Prok, Yelena; Protopopescu, Dan; Qin, Liming; Riccardi, Gregory; Ricco, Giovanni; Ripani, Marco; Ritchie, Barry; Rosner, Guenther; Rossi, Patrizia; Rubin, Philip; Sabatie, Franck; Salamanca, Julian; Salgado, Carlos; Santoro, Joseph; Sapunenko, Vladimir; Sayre, Donald; Schumacher, Reinhard; Serov, Vladimir; Shafi, Aziz; Sharabian, Youri; Sharov, Dmitri; Shvedunov, Nikolay; Simionatto, Sebastio; Skabelin, Alexander; Smith, Elton; Smith, Lee; Sober, Daniel; Sokhan, Daria; Stavinsky, Aleksey; Stepanyan, Samuel; Stepanyan, Stepan; Stokes, Burnham; Stoler, Paul; Strakovski, Igor; Strauch, Steffen; Taiuti, Mauro; Taylor, Shawn; Tedeschi, David; Thoma, Ulrike; Thompson, Richard; Tkabladze, Avtandil; Tkachenko, Svyatoslav; Ungaro, Maurizio; Vineyard, Michael; Vlassov, Alexander; Wang,

2008-06-01T23:59:59.000Z

49

u.s. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETEIU.&lt;UNATION  

Broader source: Energy.gov (indexed) [DOE]

lt;UNATION Page I of2 RECIPIENT:Naviganl Consulting STATE: MA PROJECf TITLE: Offshore Wind Removing Market Barriers Funding Opportunity Announc:ement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-0000414, topic area 1.1 DE-EEOOO5360 GF()"()()()S360-OO1 0 Based on my review ofthe information concerning the proposed ac:tlon, as NEPA Compliance Officer (authori7-ed under DOE Order 451.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Informati on gatherin g, analysis, and dissemination Information gathering (including, but nollimited 10. literature surveys, inventories, site visits, and aUdits). data analysis (induding, but not limited to, computer modeling), document preparation (induding, but not limited to, conceptual design,

50

U.S. DEP.&lt;\RTlVIENT OF ENERGY EERE PROJECT MANAGEMENT CENTER  

Broader source: Energy.gov (indexed) [DOE]

<\RTlVIENT OF ENERGY &lt;\RTlVIENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETERlvIINATION RECIPIENT:Ohio Department of Development STATE: OH PROJECT SEP ARRA - Solid Waste Authority of Central Ohio TITLE: Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number EE0000165 GFO-0000165-017 GOO Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical

51

Energy Cost Calculator for Commercial Heat Pumps (5.4 >=&lt; 20 Tons) |  

Broader source: Energy.gov (indexed) [DOE]

Heat Pumps (5.4 >=< 20 Tons) Heat Pumps (5.4 >=&lt; 20 Tons) Energy Cost Calculator for Commercial Heat Pumps (5.4 >=< 20 Tons) October 8, 2013 - 2:22pm Addthis Vary equipment size, energy cost, hours of operation, and /or efficiency level. INPUT SECTION Input the following data (if any parameter is missing, calculator will set to default value). Defaults Project Type New Installation Replacement New Installation Condenser Type Air Source Water Source Air Source Existing Capacity * ton - Existing Cooling Efficiency * EER - Existing Heating Efficiency * COP - Existing IPLV Efficiency * IPLV - New Capacity ton 10 tons New Cooling Efficiency EER 10.1 EER New Heating Efficiency COP 3.2 COP New IPLV Efficiency IPLV 10.4 IPLV Energy Cost $ per kWh $0.06 per kWh

52

To: Mansueti, Lawrence &lt;Lawrence.Mansueti@hq.doe.gov>  

Broader source: Energy.gov (indexed) [DOE]

&lt;ecchimento@comcast.net> To: Mansueti, Lawrence Sent: Fri Nov 18 10:58:43 2005 Subject: Letter (9/12/05) for filing in DOE DCPSC Docket #EO-05-01 Mr. Mansueti, Would you please file for consideration the attached letter, originally sent to FERC, in DOE's Docket No. EO-05-01 regarding the DCPSC complaint? Thank you. Elizabeth Chimento and Poul Hertel 1200 North Pitt Street 1217 Michigan Court Alexandria, VA 22314 Alexandria, VA 22314 September 12, 2005 Joseph T. Kelliher, Chairman Federal Energy Regulatory Commission 888 First Street, N.E. Washington, D.C. 20426 Re: District of Columbia Public Service Commission Emergency Petition and Complaint Docket No. EL05-145-000 Dear Chairman Kelliher:

53

Set To Save *and* AB 811Set To Save and AB 811 Energy Independence Program (EIP)gy p g ( )  

E-Print Network [OSTI]

Set To Save *and* AB 811Set To Save and AB 811 Energy Independence Program (EIP)gy p g ( ) Lessons Learned (IOW How to avoid scar tissue) April 24, 2009 #12;Program StatusProgram Status · Set to Save goal: Save 30% citywide in 5 years. · 30% savings = 214 7 M kWh; 48 748 kW peak demand30% savings 214.7 M k

Kammen, Daniel M.

54

Beam-Target Double Spin Asymmetry A_LT in Charged Pion Production from Deep Inelastic Scattering on a Transversely Polarized He-3 Target at 1.4  

E-Print Network [OSTI]

We report the first measurement of the double-spin asymmetry $A_{LT}$ for charged pion electroproduction in semi\

J. Huang; K. Allada; C. Dutta; J. Katich; X. Qian; Y. Wang; Y. Zhang; K. Aniol; J. R. M. Annand; T. Averett; F. Benmokhtar; W. Bertozzi; P. C. Bradshaw; P. Bosted; A. Camsonne; M. Canan; G. D. Cates; C. Chen; J. -P. Chen; W. Chen; K. Chirapatpimol; E. Chudakov; E. Cisbani; J. C. Cornejo; F. Cusanno; M. M. Dalton; W. Deconinck; C. W. de Jager; R. De Leo; X. Deng; A. Deur; H. Ding; P. A. M. Dolph; D. Dutta; L. El Fassi; S. Frullani; H. Gao; F. Garibaldi; D. Gaskell; S. Gilad; R. Gilman; O. Glamazdin; S. Golge; L. Guo; D. Hamilton; O. Hansen; D. W. Higinbotham; T. Holmstrom; M. Huang; H. F. Ibrahim; M. Iodice; X. Jiang; G. Jin; M. K. Jones; A. Kelleher; W. Kim; A. Kolarkar; W. Korsch; J. J. LeRose; X. Li; Y. Li; R. Lindgren; N. Liyanage; E. Long; H. -J. Lu; D. J. Margaziotis; P. Markowitz; S. Marrone; D. McNulty; Z. -E. Meziani; R. Michaels; B. Moffit; C. Muoz Camacho; S. Nanda; A. Narayan; V. Nelyubin; B. Norum; Y. Oh; M. Osipenko; D. Parno; J. C. Peng; S. K. Phillips; M. Posik; A. J. R. Puckett; Y. Qiang; A. Rakhman; R. D. Ransome; S. Riordan; A. Saha; B. Sawatzky; E. Schulte; A. Shahinyan; M. H. Shabestari; S. irca; S. Stepanyan; R. Subedi; V. Sulkosky; L. -G. Tang; A. Tobias; G. M. Urciuoli; I. Vilardi; K. Wang; B. Wojtsekhowski; X. Yan; H. Yao; Y. Ye; Z. Ye; L. Yuan; X. Zhan; Y. -W. Zhang; B. Zhao; X. Zheng; L. Zhu; X. Zhu; X. Zong; for the Jefferson Lab Hall A Collaboration

2012-02-10T23:59:59.000Z

55

Thermoluminescence (TL) Analysis and Fading Studies of Naturally Occurring Salt Irradiated by 500 mGy Gamma Rays  

SciTech Connect (OSTI)

The aim of the present study was to investigate the potential of the naturally occurring salt for the dosimetry purposes, using TL. The fine powder samples (20 mg) were irradiated by {gamma}- rays from 500 mGy to 2500 mGy by using Theratron-780C Cobalt-60 source, however, this paper discusses about 500 mGy only. The TL glow curve peak parameters were studied by using Chen's peak shape equation. TL glow curves were compared with fitted curves using glow curve deconvolution (GCD) method by using Kitis expression. The kinetic parameter values (E, b and s) so calculated, are in good agreement with those available in literature. The calculated energy values were also verified by using various heating rate (VHR) method. {chi}{sup 2} test and figure of merit (FOM) calculation was done to accept the goodness of fit between the curves. Fading studies of the sample showed a good fitting between the curves. The analysis suggests that natural salt should be considered for dosimetry purposes.

Tiwari, Ramesh Chandra; Pau, Kham Suan [Department of Physics, Mizoram University: Tanhril Campus, Aizawl-796004, Mizoram (India)

2011-10-20T23:59:59.000Z

56

A&lt;ACD6B;GAQ=CD4Q  

Broader source: Energy.gov (indexed) [DOE]

Alt;ACD6B;GAQ=CD4Q =DCA3Q EG7@<9F5Q !' (*$!%), &", %!(#+, HIOKLMJPNMQ :8Q(%,1-Q .WAFTWbe?#Q 9TT@Xe (3* e.AO AW:K e&T[ O"Q- W:OY d  ]L *aA <[YI ^Ae) IWA= YTWe 0T: Oe 4WTF W:M Xe3C >Ae %RS[:Ke2:YITO:Ke+O_IWTONAOY:Ke5TKH=ce %

57

Degradation studies on acidbase blends for both LT and intermediate T fuel cells  

Science Journals Connector (OSTI)

Abstract In this study the ex-situ and in-situ behavior of acidbase blend membranes from sulfonated polyethersulfone and a partially fluorinated sulfonated polymer (prepared by condensation of decafluorobipenyl with bisphenol AF, followed by sulfonation of the obtained polymer) and two different polybenzmidazoles (F6-PBI and PBIOO) was investigated. Two types of acidbase blend membranes from the abovementioned polymers were prepared and characterized: acidbase blend membranes with a molar excess of acidic blend component for low-TH2 fuel cells (LT-FC) where the proton conductivity is overtaken by the sulfonic acid groups, and blend membranes comprising a molar excess of basic blend component which were subsequently doped with phosphoric acid for the usage in intermediate-TH2 fuel cells (IT-FC) where the network of phosphoric acid molecules in the membrane provides the proton conduction. For elucidation of the radical stability of the membranes, the membranes were subjected to Fenton's Reagent and were operated in a H2-PEMFC. After these tests, the membranes were investigated via SEC for molecular weight degradation. As a result, correlations could be found between degradation of the blend membranes in the fuel cell and after Fenton's test. Moreover, at IT-FC membranes, a correlation could be found between doping degree and fuel cell performance which are discussed in this paper. One of the membranes, a H3PO4-doped base-excess membrane from sPSU and PBIOO showed an excellent performance in an IT-FC at 180C of 0.85 A/cm2@0.5V without pressurization of the reactant gases.

A. Chromik; J.A. Kerres

2013-01-01T23:59:59.000Z

58

RECIPI ENT;Kitsap County u.s. DEPARTlvIENT OF ENER GY EERE PROJECT MANAGEMENT CENT  

Broader source: Energy.gov (indexed) [DOE]

ENT;Kitsap County ENT;Kitsap County u.s. DEPARTlvIENT OF ENER GY EERE PROJECT MANAGEMENT CENT ER NEPA DETERlVITNATION PROJECT TITLE: EECBG * Energy Service Corps (SOW) Page 1 01'2 STATE: WA Funding Opportunity Announcem ent Number DE-FOA..QOOOO13 Procurement Instrument Number NEPA Control Number CID Number DE-EEOOOO853 '1t;..o -6ObC>g5~- 0(.::)\ EE81128 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the foUowing determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Aclions 10 conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase Ihe indoor concentrations of potentially harmful substances, These actions may involve financial and technical

59

QUARTER SH OR T-T ER M EN ER GY OU TL OO K QUAR TERL Y PROJ  

Gasoline and Diesel Fuel Update (EIA)

1 1 2 QUARTER SH OR T-T ER M EN ER GY OU TL OO K QUAR TERL Y PROJ ECTIO NS ENERGY INFORMA TION ADMINIST RATION May 1991 This publication may be purchased from the Superintendent of Documents, U.S. Government Printing Office. Purchasing in formation for this or other Energy Information Administration (EIA) publications may be obtained from the Government Printing Office or ElA's National Energy Information Center. Questions on energy statistics should be directed to the Center by mail, telephone, or telecommunications device for the hearing impaired. Addresses, telephone numbers, and hours are as follows: National Energy Information Center, El-231 Energy Information Administration Forrestal Building, Room 1F-048 Washington, DC 20585 (202) 586-8800 Telecommunications Device for the

60

Gene expression analysis of human primary prostate epithelial and fibroblast cell cultures to an acute dose of 10cGy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

26, 2011 26, 2011 Gene expression analysis of human primary prostate epithelial and fibroblast cell cultures to an acute dose of 10cGy J. Tyson McDonald, Julia Fox, Heather Szelag, Annie Kang, Heiko Enderling, Peter Nowd, Douglas Scheinder, Giannoula Lakka Klement, Ingolf Tuerk, and Lynn Hlatky Center of Cancer Systems Biology, Steward St. Elizabeth's Medical Center, 736 Cambridge Street, Boston, Massachusetts 02135. Primary tissue represents a better model for studies than immortalized cell lines that are adapted

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

A SEARCH FOR L/T TRANSITION DWARFS WITH Pan-STARRS1 AND WISE: DISCOVERY OF SEVEN NEARBY OBJECTS INCLUDING TWO CANDIDATE SPECTROSCOPIC VARIABLES  

SciTech Connect (OSTI)

We present initial results from a wide-field (30,000 deg{sup 2}) search for L/T transition brown dwarfs within 25 pc using the Pan-STARRS1 and Wide-field Infrared Survey Explorer (WISE) surveys. Previous large-area searches have been incomplete for L/T transition dwarfs, because these objects are faint in optical bands and have near-infrared (near-IR) colors that are difficult to distinguish from background stars. To overcome these obstacles, we have cross-matched the Pan-STARRS1 (optical) and WISE (mid-IR) catalogs to produce a unique multi-wavelength database for finding ultracool dwarfs. As part of our initial discoveries, we have identified seven brown dwarfs in the L/T transition within 9-15 pc of the Sun. The L9.5 dwarf PSO J140.2308+45.6487 and the T1.5 dwarf PSO J307.6784+07.8263 (both independently discovered by Mace et al.) show possible spectroscopic variability at the Y and J bands. Two more objects in our sample show evidence of photometric J-band variability, and two others are candidate unresolved binaries based on their spectra. We expect our full search to yield a well-defined, volume-limited sample of L/T transition dwarfs that will include many new targets for study of this complex regime. PSO J307.6784+07.8263 in particular may be an excellent candidate for in-depth study of variability, given its brightness (J = 14.2 mag) and proximity (11 pc)

Best, William M. J.; Liu, Michael C.; Magnier, Eugene A.; Aller, Kimberly M.; Burgett, W. S.; Chambers, K. C.; Hodapp, K. W.; Kaiser, N.; Kudritzki, R.-P.; Morgan, J. S.; Tonry, J. L.; Wainscoat, R. J. [Institute for Astronomy, University of Hawaii at Manoa, Honolulu, HI 96822 (United States); Deacon, Niall R. [Max Planck Institute for Astronomy, Koenigstuhl 17, D-69117 Heidelberg (Germany); Dupuy, Trent J. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Redstone, Joshua [Facebook, 335 Madison Ave, New York, NY 10017-4677 (United States); Price, P. A., E-mail: wbest@ifa.hawaii.edu [Department of Astrophysical Sciences, Princeton University, Princeton, NJ 08544 (United States)

2013-11-10T23:59:59.000Z

62

DISCOVERY OF FOUR HIGH PROPER MOTION L DWARFS, INCLUDING A 10 pc L DWARF AT THE L/T TRANSITION {sup ,}  

SciTech Connect (OSTI)

We discover four high proper motion L dwarfs by comparing the Wide-field Infrared Survey Explorer (WISE) to the Two Micron All Sky Survey. WISE J140533.32+835030.5 is an L dwarf at the L/T transition with a proper motion of 0.85 0.''02 yr{sup 1}, previously overlooked due to its proximity to a bright star (V ? 12 mag). From optical spectroscopy we find a spectral type of L8, and from moderate-resolution J band spectroscopy we find a near-infrared spectral type of L9. We find WISE J140533.32+835030.5 to have a distance of 9.7 1.7 pc, bringing the number of L dwarfs at the L/T transition within 10 pc from six to seven. WISE J040137.21+284951.7, WISE J040418.01+412735.6, and WISE J062442.37+662625.6 are all early L dwarfs within 25 pc, and were classified using optical and low-resolution near-infrared spectra. WISE J040418.01+412735.6 is an L2 pec (red) dwarf, a member of the class of unusually red L dwarfs. We use follow-up optical and low-resolution near-infrared spectroscopy to classify a previously discovered fifth object WISEP J060738.65+242953.4 as an (L8 Opt/L9 NIR), confirming it as an L dwarf at the L/T transition within 10 pc. WISEP J060738.65+242953.4 shows tentative CH{sub 4} in the H band, possibly the result of unresolved binarity with an early T dwarf, a scenario not supported by binary spectral template fitting. If WISEP J060738.65+242953.4 is a single object, it represents the earliest onset of CH{sub 4} in the H band of an L/T transition dwarf in the SpeX Library. As very late L dwarfs within 10 pc, WISE J140533.32+835030.5 and WISEP J060738.65+242953.4 will play a vital role in resolving outstanding issues at the L/T transition.

Castro, Philip J.; Gizis, John E. [Department of Physics and Astronomy, University of Delaware, Newark, DE 19716 (United States); Harris, Hugh C. [US Naval Observatory, Flagstaff Station, 10391 West Naval Observatory Road, Flagstaff, AZ 86001 (United States); Mace, Gregory N.; McLean, Ian S. [Department of Physics and Astronomy, UCLA, Los Angeles, CA 90095-1547 (United States); Kirkpatrick, J. Davy [Infrared Processing and Analysis Center, MS 100-22, California Institute of Technology, Pasadena, CA 91125 (United States); Pattarakijwanich, Petchara [Department of Astrophysical Sciences, Princeton University, Ivy Lane, Princeton, NJ 08544 (United States); Skrutskie, Michael F., E-mail: pcastro@udel.edu, E-mail: gizis@udel.edu [Department of Astronomy, University of Virginia, Charlottesville, VA 22904 (United States)

2013-10-20T23:59:59.000Z

63

&lt;AVS>  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Antelope Valley Station to Neset Transmission Project Antelope Valley Station to Neset Transmission Project This environmental impact statement (EIS) prepared by the U.S. Department of Agriculture (USDA), Rural Utilities Service (RUS) provides information about the potential environmental impacts of the proposed Antelope Valley Station (AVS) to Neset Transmission Project. This project, proposed by Basin Electric Power Cooperative (Basin Electric), would include a new 345-kilovolt (kV) transmission line connecting the existing AVS, Charlie Creek, Williston, and Neset substations and the newly proposed Judson and Tande 345-kV substations. In addition to the approximately 190 miles of new 345-kV transmission line, the project would also construct two new 345 kV substations (Judson Substation west of Williston and Tande Substation southeast of Tioga), and several miles of 230-kV transmission line to connect the 345-kV transmission line into the existing area system.

64

G?)~~&lt;+!T  

Office of Legacy Management (LM)

- - G?)~~<+!T (?-?A / ;--\h \ , ; - \\ HAZARDOUS WASTE - _ I N S T A L L A T I O N ASSESSMENT REPORT BY D A V I D N - F A U V E R MAY 1986 IT kh; E,?$$ C / ~ R / I R ~ WORK PERFORMED UNDER C O N T R A C T NO. D E - A C 0 8 - 8 4 N V 1 0 3 2 7 REYNOLDS E L E C T R I C A L g ENGINEERING C O * , INC POST O F F I C E BOX 14400 LAS VEGAS, NV 8 9 1 1 q DISCLAIMER Portions of this document may be illegible in electronic image products. Images are produced from the best available original document. HAZARDOUS W A S T E I N S T A L L A T I O N A S S E S S M E N T R E P O R T B Y D A V I D N. F A U V E R MAY 1986 WORK PERFORMED U N D E R C O N T R A C T NO. D E - A C 0 8 - 8 4 N V 1 0 3 2 7 R E Y N O L D S E L E C T R I C A L & E N G I N E E R I N G COW, I N C - P O S T O F F I C E B O X 1 4 4 0 0 L A S VEGAS, N V 8 9 1 1 q This page intentionally left blank DISCLAIMER T h i s r e p o r t was p r e p a r e d as an account o f work sponsored by an agency o

65

* ^ -^. «*'*: IV: .&lt;:.**  

Gasoline and Diesel Fuel Update (EIA)

* ^ -^. «*'*: IV: .<:.**,.,? '* -^^V; , *"'^"T-'^T * .^'^ **'*--'"-* *'*V-; "'^ v ^V ^^-^^;-'jl^'-^^i5^^v>^Ll-';.i»S-'^^^ * . '"* L"".'"-'?_,. -*'-_*:'?'. v>;': |: ,^% ;'. >' 4-.**;- *"-.''' * Lite -^ t.-^»!, m ". *Bfc' Table 8. Foreign Crude Oil and Natural Gas Liquids Reserve Interest for FRS Companies, 1983 and Percent Change from 1982 Crude Oil and Reserves Total OECD Foreign___Canada___Europe Africa___Mtdeast Other Eastern Hemisphere Other Western Hemisphere 1983 (million barrels) Total Crude and |GL

66

Tesis LT.PDF  

Open Energy Info (EERE)

DETERMINACION DE LA IRRADIANCION SOLAR SOBRE EL DETERMINACION DE LA IRRADIANCION SOLAR SOBRE EL TERRITORIO DE CUBA A PARTIR DE IMÁGENES DE SATELITES. Autores: Israel Borrajero Montejo * Lourdes Lavastida** Juan Carlos Pelaez Chavez* Instituto de Meteorología de Cuba La investigación se realizo dentro del acápite relacionado con la radiación solar del Proyecto SWERA para Cuba * Grupo de Radiación Solar del Centro de Física de la Atmósfera del Instituto de Meteorología de Cuba Ministerio de Ciencia Tecnología y Medio Ambiente ** Dpto de Información de Satelites del Centro Nacional de Pronostico Instituto de Meteorología de Cuba Ministerio de Ciencia Tecnología y Medio Ambiente 2 Introducción. El Sol, fuente de vida, es la energía más importante disponible en el planeta y

67

Alanine-EPR dosimetry for measurements of ionizing radiation absorbed doses in the range 0.5-10 kGy  

E-Print Network [OSTI]

The usefulness of two, easy accessible alanine dosimeters (ALANPOL from IChTJ and foil dosimeter from Gamma Service, Radeberg, Germany) to radiation dose measurement in the range of 0.5-10 kGy, were investigated. In both cases, the result of the test was positive. The foil dosemeter from Gamma Service is recommended for dose distribution measurements in fantoms or products, ALANPOL - for routine measurements. The EPR-alanine method based on the described dosimeters can be successfully used, among others, in the technology of radiation protection of food.

Peimel-Stuglik, Z

2001-01-01T23:59:59.000Z

68

External Beam Accelerated Partial-Breast Irradiation Using 32 Gy in 8 Twice-Daily Fractions: 5-Year Results of a Prospective Study  

SciTech Connect (OSTI)

Purpose: External beam accelerated partial breast irradiation (APBI) is an increasingly popular technique for treatment of patients with early stage breast cancer following breast-conserving surgery. Here we present 5-year results of a prospective trial. Methods and Materials: From October 2003 through November 2005, 98 evaluable patients with stage I breast cancer were enrolled in the first dose step (32 Gy delivered in 8 twice-daily fractions) of a prospective, multi-institutional, dose escalation clinical trial of 3-dimensional conformal external beam APBI (3D-APBI). Median age was 61 years; median tumor size was 0.8 cm; 89% of tumors were estrogen receptor positive; 10% had a triple-negative phenotype; and 1% had a HER-2-positive subtype. Median follow-up was 71 months (range, 2-88 months; interquartile range, 64-75 months). Results: Five patients developed ipsilateral breast tumor recurrence (IBTR), for a 5-year actuarial IBTR rate of 5% (95% confidence interval [CI], 1%-10%). Three of these cases occurred in patients with triple-negative disease and 2 in non-triple-negative patients, for 5-year actuarial IBTR rates of 33% (95% CI, 0%-57%) and 2% (95% CI, 0%-6%; P<.0001), respectively. On multivariable analysis, triple-negative phenotype was the only predictor of IBTR, with borderline statistical significance after adjusting for tumor grade (P=.0537). Conclusions: Overall outcomes were excellent, particularly for patients with estrogen receptor-positive disease. Patients in this study with triple-negative breast cancer had a significantly higher IBTR rate than patients with other receptor phenotypes when treated with 3D-APBI. Larger, prospective 3D-APBI clinical trials should continue to evaluate the effect of hormone receptor phenotype on IBTR rates.

Pashtan, Itai M. [Harvard Radiation Oncology Program, Boston, Massachusetts (United States)] [Harvard Radiation Oncology Program, Boston, Massachusetts (United States); Recht, Abram [Department of Radiation Oncology, Beth Israel Deaconess Medical Center, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Beth Israel Deaconess Medical Center, Boston, Massachusetts (United States); Ancukiewicz, Marek [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); Brachtel, Elena [Department of Pathology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Pathology, Massachusetts General Hospital, Boston, Massachusetts (United States); Abi-Raad, Rita F. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); D'Alessandro, Helen A. [Department of Radiology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiology, Massachusetts General Hospital, Boston, Massachusetts (United States); Levy, Antonin; Wo, Jennifer Y. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); Hirsch, Ariel E. [Department of Radiation Oncology, Boston Medical Center, Boston University School of Medicine, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Boston Medical Center, Boston University School of Medicine, Boston, Massachusetts (United States); Kachnic, Lisa A. [Department of Surgery, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Surgery, Massachusetts General Hospital, Boston, Massachusetts (United States); Goldberg, Saveli [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); Specht, Michelle; Gadd, Michelle; Smith, Barbara L. [Department of Surgery, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Surgery, Massachusetts General Hospital, Boston, Massachusetts (United States); Powell, Simon N. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); Taghian, Alphonse G., E-mail: ataghian@partners.org [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)

2012-11-01T23:59:59.000Z

69

As you may kn&&lt;' the~de&tment of &~er& (D&j 1s involved'in'a pronram  

Office of Legacy Management (LM)

As you may kn&<' the~de&tment of &~er& (D&j 1s involved'in'a pronram As you may kn&&lt;' the~de&tment of &~er& (D&j 1s involved'in'a pronram '. to'chiiracterlze the radjologital cbndif~on of ,sites formerly used byythe . . . ., Manhattan Engineer Dlstrlct (NED) and/or Atomjc Energy Co$n~~lssiqq (AEC); in.. the development of 'nuclear energy.. As part..of this -programi' DOE is 1~ I+ preparing, ,a' series of. brJef~ summaries ,-of .the' history:. of' tho ,#D/AEC~ : : ..; 'i ..relatecl activities and 'Conditions at .thc. sneclfic. sites. The surnaaries~ are to 'document the activities 'frcmi the ~nitlation 'of a contract with' j.'., F:ED/AEC,-to the terminationof the firial.F1EO/AEC contract; The ,historical .: '_ ,,:~,st&naries aIs. briefly' describe the. currant .conditi,on of .each site.

70

E F F I C I E N CY A N D R E N E W A B L E E N E R GY D IV I S I O N CALIFORNIA ENERGY COMMISSION  

E-Print Network [OSTI]

. If this system is not installed properly, it not only wastes energy, but money as well. To prevent this, do two of the conditioned air into the attic or crawl space. Leaky ducts waste energy and make energy bills higher thanBLUEPRI NT E F F I C I E N CY A N D R E N E W A B L E E N E R GY D IV I S I O N CALIFORNIA ENERGY

71

LtBlue-LessInk  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

public power utilities understand and are confident in the results During the 6 th Plan review process * BPA contracted for measure review - this was useful, but many...

72

LT7484 2..5  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

to a magnetic-island width, as may be expected from current transport along magnetic-field lines. It is much larger than that predicted by resistive MHD for linear tearing modes...

73

&lt;GrandPrairie>  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Grande Praire Wind Farm, O'Neill, NE Grande Praire Wind Farm, O'Neill, NE The Western Area Power Administration (Western), an agency of the Department of Energy (DOE), intends to prepare an environmental impact statement (EIS) on the proposed interconnection of the Grande Prairie Wind Farm (Project) in Holt County, near the city of O'Neill, Nebraska. Grande Prairie Wind, LLC (Grande Prairie), a subsidiary of Midwest Wind Energy Development Group, LLC, has applied to Western to interconnect their proposed Project to Western's power transmission system. Western is issuing this notice to inform the public and interested parties about Western's intent to prepare an EIS, conduct a public scoping process, and invite the public to comment on the scope, proposed action, alternatives, and other issues to be addressed in the EIS.

74

A new measurement of the structure functions $P_{LL}-P_{TT}/epsilon$ and $P_{LT}$ in virtual Compton scattering at $Q^2=$ 0.33 (GeV/c)$^2$  

E-Print Network [OSTI]

The cross section of the $ep \\to e' p' \\gamma$ reaction has been measured at $Q^2 = 0.33$ (GeV/c)$^2$. The experiment was performed using the electron beam of the MAMI accelerator and the standard detector setup of the A1 Collaboration. The cross section is analyzed using the low-energy theorem for virtual Compton scattering, yielding a new determination of the two structure functions $P_LL}-P_{TT}/epsilon$ and $P_{LT}$ which are linear combinations of the generalized polarizabilities of the proton. We find somewhat larger values than in the previous investigation at the same $Q^2$. This difference, however, is purely due to our more refined analysis of the data. The results tend to confirm the non-trivial $Q^2$-evolution of the generalized polarizabilities and call for more measurements in the low-$Q^2$ region ($\\le$ 1 (GeV/c)$^2$).

The MAMI-A1 Collaboration; :; P. Janssens; L. Doria; P. Achenbach; C. Ayerbe Gayoso; D. Baumann; J. C. Bernauer; I. K. Bensafa; R. Bhm; D. Bosnar; E. Burtin; N. D'Hose; X. Defa; M. Ding; M. O. Distler; H. Fonvieille; J. Friedrich; J. M. Friedrich; G. Laveissire; M. Makek; J. Marroncle; H. Merkel; U. Mller; L. Nungesser; B. Pasquini; J. Pochodzalla; O. Postavaru; M. Potokar; D. Ryckbosch; S. Sanchez Majos; B. S. Schlimme; M. Seimetz; S. irca; G. Tamas; R. Van de Vyver; L. Van Hoorebeke; A. Van Overloop; Th. Walcher; M. Weinriefer

2008-03-06T23:59:59.000Z

75

G&lt; TEI-779 MASTER  

Office of Legacy Management (LM)

c*£ c*£ & G< TEI-779 MASTER (fA/L-y-yj. U. S. DEPARTMENT OF THE INTERIOR GEOLOGIC INVESTIGATIONS IN SUPPORT OF PROJECT CHARIOT, PHASE 111, IN THE VICINITY OF CAPE THOMPSON, NORTH- WESTERN ALASKA Preliminary Report By Reuben Kachadoorian Russell H. Campbell George W. Moore David W. Scholl January 1961 Arthur H. Lachenbruch Rex V. Allen Gordon W. Greene Roger M. Waller B. Vaughn Marshall Marvin J. Slaughter David F. Barnes This report is preliminary and has not been edited for con- formity with Geological Survey format and nomenclature. Geological Survey Washington, D. C. Prepared by Geological Survey for the UNITED STATES ATOMIC ENERGY COMMISSION Office of Technical Information L E G A L N O T I C E This report was prepared as an account of Government sponsored work. Neither the United

76

ORNL/RASA-84/LT6  

Office of Legacy Management (LM)

residues exist on this site. The amount of material present is in excess of DOE guide- lines (Table 1). Gamma Radiation Levels Results of the gamma scan of the surface of the...

77

~o-~,",,,,to $V)lt. \\,.,.",,, ,  

E-Print Network [OSTI]

's downtown Atlanta theatre of Andy Warhol's NUDE RESTAU- RANT with Taylor Mead & Viva & a book I had interview with Harry Smith, formed my image of downtown New York life. I dreamed of a movie version. Finally

McCombe, Bruce D.

78

Manhattan Project: San Ildefonso Pueblo Party&lt;/FONT>  

Office of Scientific and Technical Information (OSTI)

SAN ILDEFONSO PUEBLO PARTY SAN ILDEFONSO PUEBLO PARTY Los Alamos (December 1945) Resources > Photo Gallery San Ildefonso Pueblo party, December 1945 A special 1995 issue of the monthly publication of the Los Alamos National Laboratory, "Dateline: Los Alamos," described the party this way: "On a cold December night in 1945, the San Ildefonso Pueblo, a tribe of Native Americans living next to Los Alamos, invited a group of Los Alamos square dancers to their pueblo for an evening of fun and entertainment. The two communities had seen a lot of each other during the war as men and women from the pueblo commuted daily to work at Los Alamos. The association produced a cross fertilization of cultures. "Bernice Brode wrote: 'Some of us had more Indian crafts in our Army apartments than the Indians had in their homes, (and) modern American conveniences such as refrigerators and linoleum began cropping up in the pueblo.' At the dance, the Indians performed for the square dancers and the square dancers performed for the Indians. After the demonstrations, members from the two groups began dancing with each other. Charlie Masters, a teacher at the Los Alamos school, wrote: 'This fiesta-hoedown I like to remember as the climax of our relations with the natives.'

79

Maintenance Sheet for 2013 Chevrolet Malibu 1LT  

Broader source: Energy.gov (indexed) [DOE]

Date Mileage Description Cost 1172013 7,625 Changed oil and inspected generator control module - under warranty NC 1282013 9,105 Rotated tires 15.00 4172013 23,104 Changed...

80

Optimization of Generalized LT Codes for Progressive Image Transfer  

E-Print Network [OSTI]

propagation algorithm (BPA) is used to reduce de- codingmore iterations of the BPA. However, in many portableeach column after each BPA, because of the re- arrangement

Arslan, S; Cosman, P C; Milstein, L B

2012-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Pending LT LNG Export Apps (12-6-13).xlsx  

Broader source: Energy.gov (indexed) [DOE]

Current Current Processing Position Company DOE/FE Docket No. 1 Cameron LNG, LLC 11-162-LNG 2 Jordan Cove Energy Project, L.P. 12-32-LNG 3 LNG Development Company, LLC (d/b/a Oregon LNG) 12-77-LNG 4 Cheniere Marketing, LLC 12-97-LNG 5 Excelerate Liquefaction Solutions I, LLC 12-146-LNG 6 Carib Energy (USA) LLC 11-141-LNG 7 Gulf Coast LNG Export, LLC 12-05-LNG 8 Southern LNG Company, L.L.C. 12-100-LNG 9 Gulf LNG Liquefaction Company, LLC 12-101-LNG 10 CE FLNG, LLC 12-123-LNG 11 Golden Pass Products LLC 12-156-LNG 12 Pangea LNG (North America) Holdings, LLC 12-184-LNG 13 Trunkline LNG Export, LLC 13-04-LNG 14 Freeport-McMoRan Energy LLC 13-26-LNG 15 Sabine Pass Liquefaction, LLC 13-30-LNG 16 Sabine Pass Liquefaction, LLC 13-42-LNG 17 Venture Global LNG, LLC 13-69-LNG 18 Eos LNG LLC 13-116-LNG 19 Barca LNG LLC

82

Jersey Central Power & Lt Co | Open Energy Information  

Open Energy Info (EERE)

Place Ohio Place Ohio Utility Id 9726 Utility Location Yes Ownership I NERC Location RFC NERC RFC Yes RTO PJM Yes Operates Generating Plant Yes Activity Generation Yes Activity Transmission Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Wholesale Marketing Yes Alt Fuel Vehicle Yes Alt Fuel Vehicle2 Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] Energy Information Administration Form 826[2] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png GS (General Service) Commercial GST (General Service Time-Of-Day) Commercial RS Residential RT Residential Average Rates No Rates Available The following table contains monthly sales and revenue data for Jersey

83

u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION  

Broader source: Energy.gov (indexed) [DOE]

RECIPIENT: RECIPIENT: Govemor's Office of Energy Independence and Security PROJECT TITL.E: State Energy Program Year 2012 Fonnula Grant Page 1 of2 STATE: ME Funding Opportunity Announcement Number Procurement Instrument Number N[PA Control Number CID Number DE-FOA-0000643 R130272 GF0-0130272-OO1 Based on my ~view oftht information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination: ex, EA, tiS APPENDIX AND NUMBER: Description: A11 Technical advice and assistance to organizations A9 Information gathering, analysis, and dissemination Rational for determination: Technical adVice and planning assistance to International. nabonal state and local organtzatlons InfOOTlaboo gathenng (indudlng. but not limited to, literature surveys InventOrieS. Site visits and

84

u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION  

Broader source: Energy.gov (indexed) [DOE]

Page 1 of2 Page 1 of2 RECIPIENT:Hudson Valley Community College sub: Mohaw k Valley Community College STATE: NY PROJECT TITLE: Northeast Photovaltaic Regional Training Provider Funding Opportunity Announc~mtnl Number Procu~mtnt Instrument Number NEPA Control Number CID Number DE-EE-O:Xl2087 OE-EEOOO2087 GF().{)()()2087-OO7 Based on my review orthe inform ation concerning the proPOSH action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the (oUowinli': determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A91nfonnation Information gathering (indudlng, but not limited to, literature surveys, Inventones, site Visits, and audits), gathering, analysis, data analysis (including, but not limited to, computer modeling), document preparation (induding, but

85

u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION  

Broader source: Energy.gov (indexed) [DOE]

REClPIENT:Optony Inc. REClPIENT:Optony Inc. PROJECf Southwest Solar Transformation Initiative TITLE: Page 1 of2 STATE: CA Funding Opportunity Announcement Number Procuremrnt Instrument Number NEPA Control Number CID Number DOE·FQA.Q()()()549 DE-EEOOO5682 GF0-0005682-OO1 0 Based on my review of the information concerning the proposw action, as NEPA Compliance Offic:er (authorized under DOE Order 451.IA),1 have made the follOwing determination : ex, EA, [IS APPENDIX AND NUMBER: Ocscription : A11 Technical advice a nd as s istance to organizations Technical advice and planning assistance to international, national, state, and local organizabons A91nf ormation gathering. analysis, and dissemination Informabon gathenng (indudlng, but not limited 10, literature surveys, inventories, site VISits, and audits), data analysis

86

Autumn 2014 YoRK'S neW ReSeARCH StRAteGY  

E-Print Network [OSTI]

; Environmental Sustainability and Resilience; Health and Wellbeing; Justice and Equality; Risk, Evidence College ­ 4 a new student community Transforming the treatment 5 of cancer patients Pigs' unhappy balloon

87

ENE-.R:GY ORNL/Sub/80-61601/2 Research and Development of  

E-Print Network [OSTI]

~Supermarket Refrigeration Systems .~~~~E ~Volume 2 -- &i Supplementary Laboratory Testing William M. Toscano ENERGY-EFFICIENT SUPERMARKET REFRIGERATION SYSTEMS VOLUME 2 SUPPLEMENTAL LABORATORY TESTING JUNE, 1983 and development of a new, highly energy-efficient, supermarket refrigeration system: a. Investigate

Oak Ridge National Laboratory

88

u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA...  

Broader source: Energy.gov (indexed) [DOE]

individuals (such as builders, owners, consultan ts, designers), organizations (such as utilities), and state and local governments. Covered actions include, but are not limited...

89

Analysis of AGS E880 polarimeter data at Gy = 12.5.  

SciTech Connect (OSTI)

Data were collected with the AGS internal (E880) polarimeter at G{gamma} = 12.5 during the FY04 polarized proton run. Measurements were made with forward scintillation counters in coincidence with recoil counter telescopes, permitting an absolute calibration of the polarimeter for both nylon and carbon targets. The results are summarized and they will also be useful for an absolute calibration of the AGS CNI polarimeter at G{gamma} = 12.5.

Cadman, R.; Huang, H.; Krueger, K.; Spinka, H.; Underwood, D. (High Energy Physics); (Brookhaven National Laboratory)

2012-02-23T23:59:59.000Z

90

Inn vati ns at EECS: Techn l gy f r a gl bal future  

E-Print Network [OSTI]

of Society Invention Lab 141/143 Sutardja Dai Hall Center for Research in Energy Systems Transformation 406 - Peter Bailis, AMPLab (Algorithms, Machines, and People Laboratory) · Raven: An Energy Wireless Research Center) & E3S (Center for Energy Efficient Electronics Science) · Occupant Detection

California at Irvine, University of

92

IES &lt;Virtual Environment> version 6.1  

Broader source: Energy.gov (indexed) [DOE]

Tax Deduction Qualified Software Tax Deduction Qualified Software IES version 6.1 On this page you'll find information about the IES version 6.1 qualified computer software (buildings.energy.gov/qualified_software.html), which calculates energy and power cost savings that meet federal tax incentive requirements for commercial buildings. Date Documentation Received by DOE: 22 December 2009 Statements in quotes are from the software developer. Internal Revenue Code §179D (c)(1) and (d) Regulations Notice 2006-52, Section 6 requirements as amplified by Notice 2008-40, Section 4 requirements. (1) The name, address, and (if applicable) web site of the software developer; Integrated Environmental Solutions Limited Helix Building, West Of Scotland

93

Manhattan Project: A Tentative Decision to Build the Bomb&lt;!--Include title  

Office of Scientific and Technical Information (OSTI)

President Franklin Roosevelt's note to Vannevar Bush giving Bush the tentative go-ahead to build the atomic bomb. A TENTATIVE DECISION TO BUILD THE BOMB President Franklin Roosevelt's note to Vannevar Bush giving Bush the tentative go-ahead to build the atomic bomb. A TENTATIVE DECISION TO BUILD THE BOMB Washington, D.C.(1941-1942) Events > Early Government Support, 1939-1942 Einstein's Letter, 1939 Early Uranium Research, 1939-1941 Piles and Plutonium, 1939-1941 Reorganization and Acceleration, 1940-1941 The MAUD Report, 1941 A Tentative Decision to Build the Bomb, 1941-1942 Vannevar Bush moved swiftly to take advantage of the positive MAUD Report. Without waiting for Arthur Compton's latest committee to finish its work confirming the MAUD Committee's conclusions, Bush on October 9, 1941, met with President Franklin D. Roosevelt and Vice President Henry A. Wallace (who had been briefed on uranium research in July). Bush summarized the British findings, discussed cost and duration of a bomb project, and emphasized the uncertainty of the situation. He also received the President's permission to explore construction needs with the Army. Roosevelt instructed him to move as quickly as possible but not to go beyond research and development. Bush, then, was to find out if a bomb could be built and at what cost but not to proceed to the production stage without further presidential authorization. Roosevelt indicated that he could find a way to finance the project and asked Bush to draft a letter so that the British government could be approached "at the top.

94

Spin-Assisted Layer-by-Layer Assembly: Variation of Stratification as Studied with Neutron Reflectivity&lt;xref ref-type="fn" rid="end1">&lt;sup></sup><;/xref>  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

21/la9014042 21/la9014042 14017 Langmuir 2009, 25(24), 14017-14024 Published on Web 07/06/2009 pubs.acs.org/Langmuir © 2009 American Chemical Society Spin-Assisted Layer-by-Layer Assembly: Variation of Stratification as Studied with Neutron Reflectivity † Eugenia Kharlampieva, ‡ Veronika Kozlovskaya, ‡ Jennifer Chan, ‡ John F. Ankner, § and Vladimir V. Tsukruk* ,‡ ‡ Department of Materials Science and Engineering, Georgia Institute of Technology, Atlanta, Georgia 30332, and § Spallation Neutron Source, Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 Received April 20, 2009. Revised Manuscript Received June 10, 2009 We apply neutron reflectivity to probe the internal structure of spin-assisted layer-by-layer (SA-LbL) films composed of electrostatically assembled polyelectrolytes. We find that the level of stratification and the degree of layer

95

Living on and Under the Wing: A Biography of 1st Lt. Joaquin Castro.  

E-Print Network [OSTI]

Preparing for War 54 Hawaii in 1942 (January-April) 59 On Captain Hall?s Crew 66 Midway... Preparing for War 54 Hawaii in 1942 (January-April) 59 On Captain Hall?s Crew 66 Midway...

Guerrero, Arnold

2009-05-27T23:59:59.000Z

96

Length: 238' Width: 55' Draft: 15' Full-load displacement: 3,024 LT  

E-Print Network [OSTI]

electric drive Four diesel generator sets (Tier 4) Two AC propulsion motors and drives Bow and stern

Russell, Lynn

97

Search for superconductivity of Ag/Ge(100) surface alloys with UHV-LT-STM/STS  

Science Journals Connector (OSTI)

We have been searching novel superconducting materials only at their surface regions using a homemade ultra high vacuum low temperature scanning tunneling microscope. We found that scanning tunneling current-v...

Ken Hattori; Takushi Iimori; Yoshihiro Takahashi

1996-01-01T23:59:59.000Z

98

Observation of Inhomogeneous Spatial Conductivity on YBCO Single Crystal by LT-UHV-STM  

Science Journals Connector (OSTI)

We demonstrated that the current mode STM measurement can be used to reveal the inhomogeneous spatial conductivity of a flat surface. Utilizing this mode on an atomically flat YBCO single crystal with a specif...

R. Itti; Wu Ting; H. Sakai; Y. Yamada; Y. Ishimaru

1995-01-01T23:59:59.000Z

99

timetable for GEOG 4LT3 etable for CIV ENG 4G04  

E-Print Network [OSTI]

of Multiphase Flow (READING COURSE) Y. Guo Orientation Mtg to be annouced CIV ENG 720# Behaviour and Design (orientation mtg) 2:30 p.m. -5:30 p.m. JHE-332 CIV ENG 732* Concrete Structures - Materials, Maintenance see undergraduate tim CIV ENG 6U03 Unit Operations and Processes in Environmental Engineering TBA see

Smith, Spencer

100

DtSfeoooia. - * ! , fa, i j f c"i lt&fti,iBte:..*J"  

E-Print Network [OSTI]

Migsnål tfonwnaigiftigor yhdyMSn aktmcwMigy RIS?-M-2504 HEAT TRANSFER CORRELATIONS IN NUCLEAR REACTOR SAFETY CALCULATIONS packages of the nuclear reactor safety computer programmes RBLAP-5, TRAC (PP1) and NORA have been tested boiling 109 APPENDIX C. DISPERSED FLOW 129 CI. Droplet generation 129 C2. Droplet flow 136 C3. Droplet

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Microsoft Word - Peninsula_Light_Co_L0308_Mod_CX_and_EnvCkLt.doc  

Broader source: Energy.gov (indexed) [DOE]

3 3 REPLY TO ATTN OF: KEC-4 SUBJECT: Environmental Clearance Memorandum Chad Hamel, Project Manager, TEP-TPP-1 Proposed Action: Peninsula Light Company Line and Load Interconnection Request L0308 (amendment to previous Categorical Exclusion issued on May 5, 2011) Categorical Exclusion Applied (from Subpart D, 10 C.F.R. Part 1021): B4.12 Construction of powerlines Location: Mason County, WA Proposed by: Bonneville Power Administration (BPA) Description of the Proposed Action: BPA proposes a modification to a tap line that would interconnect Peninsula Light Company (PLC) into BPA's Shelton-Kitsap #2 115-kV transmission line in Mason County, WA. The original proposal involved constructing the tap within existing BPA right-of-way (ROW), as described in the categorical exclusion issued

102

E-Print Network 3.0 - ab5-type enterotoxins lt-i Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

45 GENERAL MICROBIOLOGY FACT SHEET PreventionTreatm Summary: of water, food or fomites; poor sanitation and hygiene. Produces a heat labile enterotoxin (ST). Low grade......

103

School of Civil and Environmental Engineering GE O RGIA IN S TITU TE O F TE CHN O LO GY  

E-Print Network [OSTI]

ENVIRONMENTAL ENGINEERING · Environmental biotechnology · Water quality and treatment · Wastewater reclamation in chemostat vessels. EnvE #12;CEE @ GT EFM&WR ENVIRONMENTAL FLUID MECHANICS & WATER RESOURCES . Science & engineering applications of environmental transport processes . Sustainable resource management . Innovative

Jacobs, Laurence J.

104

E-Print Network 3.0 - african ivory nut Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Cameroon... Lesotho Sierra Leone Cape Verde Liberia Somalia Central African Rep Libya South Africa Chad Source: Grant, James D.E. - Fakultt fr Mathematik, Universitt Wien...

105

Brochure front(2-09)  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Latvia Lesotho Libyan Arab Jamahiriya Lithuania Madagascar Malawi Mauritius Mexico Nepal The Netherlands New Zealand Nicaragua Nigeria Norway Philippines Poland Portugal...

106

Transportation Impact Assessment for Shipment of Uranium Hexafluoride (UF&lt;sub>6&lt;/sub>) Cylinders from the East Tennessee Technology Park to the Portsmouth and Paducah Gaseous Diffusion  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2 2 Transportation Impact Assessment for Shipment of Uranium Hexafluoride (UF 6 ) Cylinders from the East Tennessee Technology Park to the Portsmouth and Paducah Gaseous Diffusion Plants Environmental Assessment Division Argonne National Laboratory Operated by The University of Chicago, under Contract W-31-109-Eng-38, for the United States Department of Energy Argonne National Laboratory Argonne National Laboratory, with facilities in the states of Illinois and Idaho, is owned by the United States Government and operated by The University of Chicago under the provisions of a contract with the Department of Energy. This technical memorandum is a product of Argonne's Environmental Assessment Division (EAD). For information on the division's scientific and engineering

108

0097~848S/k4 S3.00 + .I0 Pergilmon mesr ,.tLt  

E-Print Network [OSTI]

+Kulta algorithm has been extended to compute parameter sensitivities in dynamical systems. The decomposed direct method (DDM) of sensitivity analysis results in a general and compact FORTRAN program, well-suited even for small computers. The straightforward DDM provides more accurate sensitivities than does the numerically

Valkó, Peter

109

A Training Simulation System with Realistic Autonomous Ship Control Monica Nicolescu, Ryan Leigh, Adam Olenderski, Lt. Ryan Aleson (Retd.)  

E-Print Network [OSTI]

1 A Training Simulation System with Realistic Autonomous Ship Control Monica Nicolescu, Ryan Leigh In this paper we present a computational approach to developing effective training systems for virtual simulation environments. In particular, we focus on a Naval simulation system, used for training of conning

Dascalu, Sergiu

110

A Repository Adapter for Resource Management Information T.M. Ong, L.T. Chia and B.S. Lee  

E-Print Network [OSTI]

in CIM. The adapter translates CIM constructs to an ontology-based language, the Data Centre Markup Lan of these managed resources. The Common Information Model (CIM) provides such a standard for their description. However, the CIM specifi- cation lacks formalism which limits its use in knowledge aggregation

Chia, Liang-Tien

111

L.T. Yang et al. (Eds.): EUC 2004, LNCS 3207, pp. 724733, 2004. Springer-Verlag Berlin Heidelberg 2004  

E-Print Network [OSTI]

Distributed Application Simulation Chang-Sun Shin 1 , Chang-Won Jeong 2 , and Su-Chong Joo 1 1 School

Joo, Su-Chong

112

7342 J. Am. Chem. SOC.1981, 103, 7342-7344 r lt r l+ r T-b  

E-Print Network [OSTI]

before.* The crude thiazole was taken over in a mixture of carbon tetrachloride (50 p of incorporation of 1-deoxy-D-threo-pentulosewithout carbon-carbon bond cleavage. H,-H,OH Hd-C H20HcH,-cn,on 1 2 5

Suslick, Kenneth S.

113

12reporTAgeDelTA.11 31-03-2011 `OMDAT JE ELKAAR ONTZETTEND STERK AANVuLT'  

E-Print Network [OSTI]

Lab bij 3mE. "Deze robot gebruikt zo min mogelijk energie als hij loopt", zegt Van der Vliet terwijl. In klinische colle- ges ontbreekt de vertaling van basale biologie naar een ziektebeeld volle- dig. Dat vind ik maken", zegt hij. "Die manier van denken op de TU Delft vind ik wel ontzettend leuk." Snellegenezing

114

E3NE3R'GY ORNL/Sub/80-13817/1&20 RD&D Opportunities for Large Air  

E-Print Network [OSTI]

by TRW Energy Engineering Division 800 Oak Ridge Turnpike Oak Ridge, Tennessee 37830 under Subcontract 62X-13817C, Letter Release 62X-20 JN -sf2;~~~~~~~~~for Oak Ridge National Laboratory Oak Ridge by TRW Energy Engineering Division 800 Oak Ridge Turnpike Oak Ridge, Tennessee 37830 Under Subcontract 62

Oak Ridge National Laboratory

115

Cell Cycle Disturbances and Mitotic Catastrophes in HeLa Hep2 Cells following 2.5 to 10 Gy of Ionizing Radiation  

Science Journals Connector (OSTI)

...death (2-5). Radiation is known to exert...molecules involved in this radiation-induced cellular safety machinery is p53...different doses of radiation at the molecular and...using the CellQuest software program, setting...

David Eriksson; Per-Olov Lfroth; Lennart Johansson; Katrine hlstrm Riklund; and Torgny Stigbrand

2007-09-15T23:59:59.000Z

116

Agriculture and food systems in sub-Saharan Africa in a 4C+ world  

Science Journals Connector (OSTI)

...data needed (maximum and minimum temperature, rainfall and solar radiation) for each grid cell using MarkSim, a third-order...Djibouti, Eritrea, Ethiopia, Kenya, Rwanda, Somalia, Sudan, Tanzania, Uganda. Southern: Angola, Botswana, Lesotho, Madagascar...

2011-01-01T23:59:59.000Z

117

IndIvIdual and Inter-populatIon varIatIon In afrIcan rock pIpIt Anthus crenAtus songs  

E-Print Network [OSTI]

2007 (Fig. 1). In these areas,ARPs occur on rocky hills with large boulders, surrounded by flat and Lesotho where it prefers rocky outcrops with open grass patches on mountain hillsides with scattered trees

de Villiers, Marienne

118

Governing Climate Change Post-2012: The Role of Global Cities -Melbourne  

E-Print Network [OSTI]

science and policy Renewable energy Resource conservation Sustainable agriculture Sustainable developmentRyan Corey `12 Electrical Engineering Ryan created a more energy efficient mid- infrared LED from China Ecuador Ethiopia Finland France Ghana India Italy Kenya Lesotho Liberia Madagascar Mexico

Watson, Andrew

119

Microsoft PowerPoint - Jangho Park_ATF User Meeting_Apr032009...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Beam based alignment Emittance measurement along to misalignment Conclusions ATF Layout Gun LT0 IN LT0 OUT LT1H LS1 LT1V LPOP-UP1 Column 1 Column 2 HPOP-UP1 LT2H LT2V TK1H TK1V...

120

^ &lt;\^ P. Franzmi, B. Leontic, D. Rahm and N. Saraios JS^'^'^'^^ Brookhaven National Laboratory, Upton, New York litHwIUl  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

r . . - r . . - Submitted to Phys. Rev. Letters January 1965 B-40 (BC) , ^ i r A Search for Massive Particles Produced in Interactions at 30 BeV* BNL 8751 ( ^ ^ <\^ P. Franzmi, B. Leontic, D. Rahm and N. Saraios JS^'^'^'^^ Brookhaven National Laboratory, Upton, New York litHwIUl .<^W<,^' o<^V ^' Schwartz sSr . . , ,<= ^^ <^ Columbia University, New York, New York We report here the results of a search for moderately stable negatively charged particles in the mass region of 2.5 - 5.0 BeV, produced in collisions of 30 BeV protons with tungsten nuclei at the Brookhaven A.G.S. The unitary symmetry model of strong interactions has received an impressive amount of experimental 2 confirmation. This in turn has stimulated a great deal of speculation concerning the origin of such a symmetry, leading to

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

LT-UHV-STM/STS Study on Laser Ablated Nd1+xBa2-xCu3O7-? Superconducting Thin Films  

Science Journals Connector (OSTI)

We have succeeded in growing high quality Nd1+xBa2-xCu3O7-? superconducting thin films on SrTiO3...(100) by laser ablation technique. The structural and superconducting properties have been investigated by XRD, A...

R. Itti; M. Badaye; K. Matsumoto; Wu Ting; H. Nakaji

1996-01-01T23:59:59.000Z

122

All I l d G id St d R lt i t tiAll Island Grid Study Results concerning system operation Peter Meibom, Ris DTU  

E-Print Network [OSTI]

Britain: · Eight aggregated power plant classes · Wind power production time series equal to Irish wind: Wind variability management studies · Impacts of renewable generation on All-Island power system · Stochastic input in the form of a scenario tree · Stochastic input: Wi d d ti f t (di t h)· Wind power

123

Nonlinear aeroelastic analysis of aircraft wing-with-store configurations  

E-Print Network [OSTI]

.7) 18 Using this expression, the variation of LT can be rewritten as LT = @LT@u _ + @LT@v _ + @LT@w _ + @LT@ + @LT@ + @LT@ +@LT@ _ _ + @LT@ _ _ + @LT@ _ _ + @LT@0 0 + @LT@0 0 + @LT@0 0 (2.8) where the partial derivatives of LT are de... which is stated in Appendix A given by cw (1 + u0)2 + v02 + w02 1 = 0 (2.10) Its variation is cw = u0u0 v0v0 w0w0 (2.11) So, for general non-zero cw = (u0u0 v0v0 w0w0) (2.12) The consideration of this inextensionality constraint modi...

Kim, Kiun

2004-09-30T23:59:59.000Z

124

E F F I C I E N CY A N D R E N E W A B L E E N E R GY D IV I S I O N CALIFORNIA ENERGY COMMISSION  

E-Print Network [OSTI]

to helping contractors and others comply with the Building Energy Efficiency Standards. The website received and timely technical information on how to comply with the Building Energy Efficiency Standards Schwarzenegger Governor California Energy Commission June 2010 CEC-400-2010-006 Minimum Best Practices Guide

125

E F F I C I E N CY A N D R E N E W A B L E E N E R GY D IV I S I O N CALIFORNIA ENERGY COMMISSION  

E-Print Network [OSTI]

COMMISSION Residential Indoor Air Quality under the 2008 Building Energy Efficiency Standards ASHRAE 62. Requirements The ASHRAE Standard requires a minimum level of ventilation in two areas: (1) whole-building for Residential Low- Rise Buildings (ASHRAE Standard) and various ways to meet this standard are described

126

. . . x, . C1 correlates the maximum inelastic displacements to linear elastic  

E-Print Network [OSTI]

Tolmezzo L,T 1.15 4 Imperial Valley 1940 El Centro Array 9 L,T 1.15 5 Kalamata 1986 Prefecture L,T 1.15 6 Loma Prieta 1989 Capitola L,T 1.15 7 Imperial Valley 1979 Bonds Corner L,T 1.15 #12;#12;#12;2 2.5 3 PGA

127

The Acute Side Effects of Bright Light Therapy: A Placebo-Controlled Investigation  

E-Print Network [OSTI]

Despite the emergence of numerous clinical and non-clinical applications of bright light therapy (LT) in recent decades, the prevalence and severity of LT side effects have not yet been fully explicated. A few adverse LT ...

Botanov, Yevgeny; Ilardi, Stephen S.

2013-09-24T23:59:59.000Z

128

UNIVERSITIES AND COLLEGES EMPLOYER'S ASSOCIATION U N I V E R S I T I E S SA F E TY A N D H E A LT H A SS O C I AT I O N  

E-Print Network [OSTI]

your institution find the best ways to promote a health and safety culture and therefore meet its legal.hse.gov.uk/leadership leading health and safety at work LEADERSHIP ACTIONS FOR VICE CHANCELLORS AND MEMBERS OF UNIVERSITY. Attitudes to health and safety are determined by the bosses, not the organisation's size. Health and safety

Davies, Christopher

129

MFR PAPER 1056 J . ~. Lt';] tlH.'n~"od i, ,,, ilh rhe "i;J\\a l l lIC1\\:r,e;] (e nler Hi n-  

E-Print Network [OSTI]

"I JI'I . dll Ihe, ('ncJ .1 l'll.ltl, n hd\\\\C~n ~ra) \\\\hdk anJ l'thl'r etaL.:an Inl h.:J Jull 'Ih

130

N e w Fa c u lt y P r o F i l e s K i N g H a l l e x Pa N s i o N &  

E-Print Network [OSTI]

of energy, enthusiasm, and urgency--and the feeling that something exciting is going on--at your UC Davis-acclaimed LL.M. program, which brings lawyers and judges from around the world to UC Davis. Marty West this summer. We all should be proud of our phenomenal success. UC Davis School of Law is the highest ranked

California at Davis, University of

131

G U I D E T O Y O U R H E A LT H B E N E F I T S Benefit plan year is now the same as the calendar year.  

E-Print Network [OSTI]

David C. Romans, Deputy Secretary Please read this guide carefully for details on these and many other II 1-800-501-9837 1-800-501-9837 (TTY/TDD) www.aetnamd.com CareFirst BlueCross BlueShield EPO, POSPlus POS, Options PPO 1-800-382-7513 1-800-553-7109 (TTY/TDD) www.uhcmaryland.com BEHAVIORAL HEALTH PLAN

Adali, Tulay

132

O P E N I N G T H E VA U LT S : M U M M I E S From deep within The Field Museum's vaults comes the mysterious world of mummies.  

E-Print Network [OSTI]

individuals into the afterlife · Stone mummy masks and false tomb doors from Egypt · 3D printed casts

Makovicky, Peter

133

Voici donc le dernier numro de Gosciences-Infos avant l't. Un t sans rapport AERES rdiger... Mais avec quelques devoirs de vacances tout de mme, de faon tre tout--fait  

E-Print Network [OSTI]

édito Voici donc le dernier numéro de Géosciences-Infos avant l'été. Un été sans rapport AERES à

Demouchy, Sylvie

134

I)ecp-ScaResearch,Vol 25. pp 1121It) 1161 ol)11-747I "s 12(111!21~12I,I I~ [~ergtunol/ PressItd lt)TNPritltedill(;rcat Brilaill  

E-Print Network [OSTI]

assemblage and population densities), and morphological distributions. Proliles from LVFS Stas. 4 to 8 ,, , %.>. ' .¢'j : " CL_j t---. .:.:. AFRICA RmGE /) " 32so,j ~:.- ' L, f,334 33106 ( / 7 ¢ / -20°S ~ [. - 3(Y

Bishop, James K.B.

135

ROYAL SOCIETY OF SOUTH AFRICA  

E-Print Network [OSTI]

ROYAL SOCIETY OF SOUTH AFRICA http://www.royalsocietysa.org.za ACADEMY OF SCIENCE OF SOUTH AFRICA and distribution of butterflies in the atlas region (South Africa, Lesotho and Swaziland), thereby providing-ordinator of Africa's first butterfly atlas, entitled `The metamorphosis of the butterfly atlas' The Southern African

de Villiers, Marienne

136

2nd Edition Nov. 2011 CampusFrance South Africa Newsletter  

E-Print Network [OSTI]

2nd Edition Nov. 2011 CampusFrance South Africa Newsletter Table of contents : o Current Bursary offered by the French Embassy aim to respond to South Africa and Lesotho's need to train and equip French per country) for Honours and Masters students from South Korea, Mexico, India, USA, South Africa

Wagner, Stephan

137

Mass Adult Education: A Necessary Element in the Development of Socialism in Tanzania  

E-Print Network [OSTI]

on aduLt education in Tanzania. He is currentLy head of theof Adul-t Educators in Tanzania. A paper delivered at theAduLt Education in Tanzania-- A Handbook on Approaches,

Hall, Budd L.

1972-01-01T23:59:59.000Z

138

Simulations of Organic Aerosol Concentrations in Mexico City Using the WRF-CHEM Model during the MCMA-2006/MILAGRO Campaign  

E-Print Network [OSTI]

) Aerodyne Research Inc, Billerica, MA, USA * Correspondence to: G. Li (lgh@mce2.org) and L.T. Molina

Meskhidze, Nicholas

139

The genome of Nectria haematococca: contribution of supernumerary chromosomes to gene expansion  

E-Print Network [OSTI]

LT (2000) Fungi from Chernobyl: mycobiota of the innerdamaged nuclear reactor at Chernobyl [12]. These fungi are

Coleman, J.J.

2010-01-01T23:59:59.000Z

140

Khesbn no. 98 - Autumn 1981 - Journal  

E-Print Network [OSTI]

ltJ'r{D yutt ly t? l'1lt 'fyl Ugi "l\\lsDu DIN ulri11yt,','fDn6 D't ltN -'syEo I)t bxnyl Ugi tg ltlj)tDyl u)! $] p:Nv

Admin, LAYCC

1981-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

d/b/a MC Applhmcc Corp.  

Broader source: Energy.gov (indexed) [DOE]

ruteruntionnl, Ii,c,, ruteruntionnl, Ii,c,, d/b/a MC Applhmcc Corp. (fi~ezers) BEFORic: THE U.S. DEPARTMENT OF ENERGY Wllshlngton, D.C. 20585 ) ) ) ) ) ) Case Number: 2013-SE-1430 COMPROMlSE AGREEMENT The U.S. Depl'lt'lJUent ofEnel'gy C'DOE' 1 ) Office of the General Counse], Office of Enforcement, initiated this acUon·against CNA International, Inc., d/b/a MC Appliance Coip. ("CNN' or "Respondent)!) pursuant to 10 C.F.R. § 429.122 by Notice ofProposed Civil Penalty. DOE alleged tha~reezer basic model - whiclt Respondent Jtnp01ted and distributed in commerce 1n the lhited States as Magic Chef-b1·and model HMCF7W, foiled to meet the applicable stnndard for maximum energy use. Soe 10 C.P.R. § 430.32(a). Respondent, on behalf of itself and mty pm·ent, sttbsidbwy, division or.othcr related entity, m\<1 DOE, by theh· authorized

142

Grobner Bases & their Computation Definitions + First Results  

E-Print Network [OSTI]

(r)) = lp(f ) 1: ui 0; r 0, h f 2: while (h = 0 ) do 3: if i s.t. lm(fi ) | lm(h) then 4: choose i least s.t. lm(fi ) | lm(h) 5: ui = ui + lt(h) lt(fi ) 6: h = h - lt(h) lt(fi ) fi 7: else 8: r = r + lt), i : lm(gi ) | lm(f ) P. Kalla (Univ. of Utah) Gr¨obner Bases October 6-8, 2014 4 / 26 #12;Gr

Kalla, Priyank

143

DMW 20-27, 31-34 SPG 20-27, 31-34  

E-Print Network [OSTI]

, PHY313 HI-LT03-65 DMW 20-27, 31-34 PHY106 HI-LT03-90 SPG 20-27, 31-34 PHY309 HI-LTC-100 DMW 20-27 PHY309 AT-LT09-100 DMW 31, 33-34 PHY102 HI-LT01-120 PK 20-27, 31, 33-34 PHY251 HI-LT07-120 VAK 20-65 DMW 20-27, 31-34 PHY216 AT-LT04-50 CNT 33-34 PHY216 AT-LT05-50 CNT 31-32 09:00 10:00 11:00 12:00 13

Crowther, Paul

144

Investigation of MEA degradation in a passive direct methanol fuel cell under different modes of operation  

Science Journals Connector (OSTI)

Abstract Direct methanol fuel cell (DMFC) durability tests were conducted in three different operational modes: continuous operation with constant load (LT1), onoff operation with constant load (LT2) and onoff operation with variable load (LT3). Porous carbon nanofiber (CNF) anode layers were employed in three sets of single passive DMFCs; each membrane electrode assembly (MEA) was run continuously in durability testing for 3000h. The objective of this study is to investigate the degradation mechanisms in an MEA with a porous CNF anode layer under different modes of operation. The polarization curves of single passive \\{DMFCs\\} before and after durability tests were compared. The degradation of DMFC performance under the cyclic LT1 mode was much more severe than that of LT2 and LT3 operation. The loss of maximum power density after degradation tests was 49.5%, 28.4% and 43.7% for LT1, LT2 and LT3, respectively. TEM, SEM and EDS mapping were used to investigate the causes of degradation. The lower power loss for LT2 was mainly attributed to the reversible degradation caused by poor water discharge, which thus reduced the air supply. Catalyst agglomeration was especially observed in LT1 and LT3 and is related to carbon corrosion due to possible fuel starvation. The loss of active catalyst area was a major cause of performance degradation in LT1 and LT3. In addition to this, the dissolution and migration of Ru catalyst from the anode to cathode was identified and correlated with degraded cell performance. In the DMFC, the carbon nanofiber anode catalyst support exhibited higher performance stability with less catalyst agglomeration than the cathode catalyst support, carbon black. This study helps understand and elucidate the failure mechanism of MEAs, which could thus help to increase the lifetime of DMFCs.

A.M. Zainoodin; S.K. Kamarudin; M.S. Masdar; W.R.W. Daud; A.B. Mohamad; J. Sahari

2014-01-01T23:59:59.000Z

145

t h e U N I V e R S I t Y O F U t A h M e s s ag e f r o M t h e M ayo r o f s a lt l a k e C i t y  

E-Print Network [OSTI]

of Real estate Development (with School of Business); an undergraduate degree in Urban ecology of Architecture), historic Preservation (with School of Architecture), and Real estate Development (with School, sustainable community planning and making long-term livability the bellwether of public policy. At the heart

Tipple, Brett

146

D I r E C t F r o M C D C e n v I r o n m e n tA L h e A Lt h S e r v I c e S B r A n c h Keep on Swimming!  

E-Print Network [OSTI]

swimming brochures (Figure 1) and pool chemical safety posters (Figure 2) were distributed. Order yours and with community partners such as pool operators), · education of the swimming public, and · regulation on Swimming! cAPt charles michele hlavsa, otto, III, rS, rn, mPh uSPhS editor's note: NEHA strives

147

5.0 R E S E A RC H R E S U LT S : I N T E G R AT I O N A N D C O N C LU S I O N S by Taina Tuominen and Colin Gray  

E-Print Network [OSTI]

OF THE BASINCURRENT STATUS Contaminants, including heavy metals, chlorinated phenolics, dioxins, furans

148

DFBT -Rica-Tec -FORCE Technology -Elsam Engineering -DTU, MEK Slutrapport 3106 050114.doc  

E-Print Network [OSTI]

PSO projekt nr. 3106: Afklaring af LT-CFB forgasseren til kraftværksmæssige anvendelser, samt bygning af 500 kW LT-CFB anlæg Slutrapport Peder Stoholm og Rasmus Glar Nielsen, DFBT ApS Martin Wittrup Engineering - DTU, MEK Forord Det rapporterede projekt "Afklaring af LT-CFB forgasseren til kraftværksmæssige

149

Summary of geology of Colorado related to geothermal potential...  

Open Energy Info (EERE)

Journal Article: Summary of geology of Colorado related to geothermal potential Author L.T. Grose Published Journal Colorado Geological Survey Bulletin, 1974 DOI Not Provided...

150

A Comprehensive Placement and Diversion Model for Matrix Acidizing in Vertical Wells in Heterogeneous Thick Formations  

E-Print Network [OSTI]

coefficient ? = specific gravity, dimensionless ?p = pressure drop, mLt-2, psi ?pball = pressure drop due to ball sealer blockage, mLt -2, psi ?pF = frictional pressure drop, mLt -2, psi ?pKE = kinetic energy pressure drop, mLt -2, psi ?p... ????? s pipec f cc dW dg dLvf dZ g g g vdv p dp ................................................ (2.2) If the fluid is incompressible (? is constant) and there is no shaft work device in the pipeline, this equation can be readily integrated...

Nozaki, Manabu

2012-07-16T23:59:59.000Z

151

E-Print Network 3.0 - art metodi di Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

dei metodi Complessit dei metodi di apprendimento (CoLT) 4. Metodi per ... Source: Di Mauro, Nicola - Dipartimento di Informatica, Universit degli Studi di Bari Collection:...

152

Revised Version DESY 96203 Hiroshima Univ. HUPD9615  

E-Print Network [OSTI]

in the Standard Model A. Ali \\Lambda , G. Hiller y , Deutsches Elektronen­Synchroton DESY, Hamburg L.T. Handoko z

153

LG: Proposed Penalty (2014-SE-15011) | Department of Energy  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

Penalty that LG Electronics USA, Inc. manufactured and distributed noncompliant room air conditioner basic model LT143CNR in the U.S. Federal law subjects manufacturers and...

154

~ior:nan D. Sr.hoen th!11 D:YI is a rld'!l-l u!\\ed i:,secti  

E-Print Network [OSTI]

:'_:::: .:::. ,":;-,'" .::".::~:: :·::~:~.:3 :'''i5~ £.......:. ·.:::ld~:[c St::-.;i~a. the United States For!.'!lt 5e::--~ice, ':one ;,!:m

155

Multiband Optical Absorption Controlled by Lattice Strain in...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Instruments: Ultra-high Vacuum, Low-temperature Scanning Probe Microscope Instrument, or UHV LT SPM Tags: Nanoscope IIIa topographical nanostructures nanodevices oxides catalysis...

156

Non-stoichiometric material transfer in the pulsed laser deposition...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Instruments: Ultra-high Vacuum, Low-temperature Scanning Probe Microscope Instrument, or UHV LT SPM Tags: Nanoscope IIIa topographical nanostructures nanodevices oxides catalysis...

157

Tuning the magnetic properties of Zn1-xCoxO films. | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Instruments: Ultra-high Vacuum, Low-temperature Scanning Probe Microscope Instrument, or UHV LT SPM Tags: Nanoscope IIIa topographical nanostructures nanodevices oxides catalysis...

158

Thermodynamic Instability at the Stoichiometric LaAlO3/SrTiO3...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Instruments: Ultra-high Vacuum, Low-temperature Scanning Probe Microscope Instrument, or UHV LT SPM Tags: Nanoscope IIIa topographical nanostructures nanodevices oxides catalysis...

159

Acetone-Assisted Oxygen Vacancy Diffusion on TiO2(110). | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Instruments: Ultra-high Vacuum, Low-temperature Scanning Probe Microscope Instrument, or UHV LT SPM Tags: adsorbate-covered solid surfaces space probe defect structures oxides...

160

LaCrO3 heteroepitaxy on SrTiO3(001) by molecular beam epitaxy...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Instruments: Ultra-high Vacuum, Low-temperature Scanning Probe Microscope Instrument, or UHV LT SPM Tags: Nanoscope IIIa topographical nanostructures nanodevices oxides catalysis...

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Jeffrey R. Guest | Argonne National Laboratory  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

he is combining low temperature ultra-high-vacuum scanning tunneling microscopy (LT UHV STM) and confocal optical microscopy and spectroscopy to explore single atoms or...

162

Band Alignment, Built-In Potential, and the Absence of Conductivity...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Instruments: Ultra-high Vacuum, Low-temperature Scanning Probe Microscope Instrument, or UHV LT SPM Tags: Nanoscope IIIa topographical nanostructures nanodevices oxides catalysis...

163

Stable highly conductive ZnO via reduction of Zn vacancies. ...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Instruments: Ultra-high Vacuum, Low-temperature Scanning Probe Microscope Instrument, or UHV LT SPM Tags: Nanoscope IIIa topographical nanostructures nanodevices oxides catalysis...

164

Epitaxial Cr on n-SrTiO3(001)An ideal Ohmic contact ....  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Instruments: Ultra-high Vacuum, Low-temperature Scanning Probe Microscope Instrument, or UHV LT SPM Tags: Nanoscope IIIa topographical nanostructures nanodevices oxides catalysis...

165

Understanding the mechanism of conductivity at the LaAlO3/SrTiO3...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Instruments: Ultra-high Vacuum, Low-temperature Scanning Probe Microscope Instrument, or UHV LT SPM Tags: Nanoscope IIIa topographical nanostructures nanodevices oxides catalysis...

166

SITE NAME: CITY:  

Office of Legacy Management (LM)

Purchase Order ,,LT-u----l ,+-et) -r&'b' f ------------- c t CONTRACTING PERIOD: &?2 -,?&&+k&&- ?g-'4J3'-'kr7 --- OWNERSHIP: AKNED AEC...

167

A quantitative application of the thermoelectric method for measuring water uptake by cotton plants  

E-Print Network [OSTI]

of Qm ior the MT series 71 72 '3 Values of Qzn for the HT series 73 4 Analysis of variance to coznpare the values of Qm for the LT, MT, and HT series B-1 Values of Qc for the LT series 2 ' Values of Qc for the MT series 3 Values of Qc for the HT... series 76 77 4 Analysis of variance to compare the values of Qc for the LT, MT, and HT series 78 C-1 Values of coefficient k for the LT series 2 Values of coeff";cient k for the MT series 3 Values of coefficient k for the HT series 4 Analysis...

Naghshineh-Pour, Bahman

2012-06-07T23:59:59.000Z

168

Microsoft PowerPoint - Enhancements_Schreiber  

Office of Environmental Management (EM)

Security Communications Protocol Ad Hoc Working Group 2014 Annual Meeting of the National Transportation Lt. Carla Schreiber Nebraska State Patrol Security Communications...

169

,1I)'rolof.,'''in, 89(-1), ]~I97, PI'. 65~-6GO. iC> 1997 hy 'I'll(' ~ew York Botanical GardclI, Bronx,;\\iY 104:,R.5126  

E-Print Network [OSTI]

)' of Slf'lIenb05ch, J~ /Jag XI, Alalidand 7602, ,)'olllh Africa Michael J. Wingfield /Jl'parlml7lt of ATin

170

Thin Film Morphology Control by Mechanical, Electronic and Chemical Interactions: a Scanning Tunneling Microscopy and Photoelectron Spectroscopy Study  

E-Print Network [OSTI]

17 UHV System and2-6 Schematic diagram of a my UHV-LT STM design in both top? ? . STM Instrumentation UHV System and Cyrostat In many

Sun, Dezheng

2012-01-01T23:59:59.000Z

171

National Action Programmes on Desertification | Open Energy Information  

Open Energy Info (EERE)

Programmes on Desertification Programmes on Desertification Jump to: navigation, search Name National Action Programmes on Desertification Agency/Company /Organization United Nations Convention to Combat Desertification Sector Land Focus Area Forestry, Agriculture Topics Co-benefits assessment, GHG inventory, Policies/deployment programs, Background analysis Resource Type Publications Website http://www.unccd.int/actionpro Country Algeria, Benin, Botswana, Burkina Faso, Burundi, Cameroon, Cape Verde, Chad, Democratic Republic of Congo, Djibouti, Egypt, Equatorial Guinea, Eritrea, Ethiopia, Gabon, Gambia, Ghana, Guinea, Kenya, Lesotho, Madagascar, Malawi, Mali, Mauritania, Morocco, Mozambique, Namibia, Niger, Nigeria, Senegal, South Africa, Sudan, Swaziland, Tanzania, Togo, Tunisia, Uganda, Zambia, Zimbabwe

172

Slide23 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide23 Slide23 Slide23 Developing Country Access Afghanistan Guatemala Nigeria Albania Guinea Pakistan Algeria Guinea-Bissau Palestinian Territories (West Bank/ Gaza) Angola Guyana Papua New Guinea Armenia Haiti Paraguay Azerbaijan Honduras Peru Bangladesh Indonesia Philippines Belize Iraq Rwanda Benin Jordan Samoa Bhutan Kenya Sao Tome and Principe Bolivia Kiribati Senegal Burkina Faso Kyrgyzstan Sierra Leone Burundi Lao People's Democratic Republic Solomon Islands Cambodia Lesotho Somalia Cameroon Liberia Sri Lanka Cape Verde Macedonia, The Former Yugoslav Republic of Swaziland Central African Republic Madagascar Tajikistan Chad Malawi Tanzania, United Republic of Colombia Maldives Thailand Comoros Mali Timor-Leste Congo Marshall Islands Togo Congo, The Democratic Republic of Mauritania Tonga

173

Shattuck Lecture: Chronic Infectious Disease and the Future of Health Care Delivery  

Science Journals Connector (OSTI)

...does or does not happen and how to improve it may now represent medicine's most important task. In settings of poverty, the delivery gap can be a gulf, especially in the case of chronic illness. In the rural villages and small towns in Rwanda, Malawi, and Lesotho, where the nongovernmental organization... Work that has been done in low-income countries to build health systems that can respond to AIDS and TB (as well as other acute and chronic diseases) shows that with adequate resources, we can improve care delivery, sharply reducing morbidity and mortality.

Farmer P.E.

2013-12-19T23:59:59.000Z

174

Solar radiation on variously oriented sloping surfaces  

SciTech Connect (OSTI)

Monthly average daily irradiation on surfaces tilted towards the equator and also inclined at various azimuth angles are estimated for two locations in Lesotho and the results are presented. The isotropic model suggested by Liu and Jordan (Trans. of Ashrae, 526, 1962) along with the modified equation of Klein (Solar Energy, 19, 4, 1977) are employed for the estimation purposes. Surface orientations are selected at three inclinations for six different azimuth angles. Conclusions are reached for optimum tilt and orientation for summer, winter and annual collection. Total annual radiation values are computed for all the slopes and orientations.

Gopinathan, K.K. (National Univ. of Lesotho, Roma (South Africa))

1991-01-01T23:59:59.000Z

175

E-Print Network 3.0 - absorption-biological reduction integrated...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

UOW Environment ManagementUOW Environment Management Summary: responses)gy g ( p ) Energy consumption reduction (205) RenewableAlternative energy Carbon (135)gy... ( ) -...

176

E A R T H Q U A K E R E S E A R C H | R E M E M B E R I N G G A R N E T B A LT I M O R E | A LU M N I T R A V E L P R O G R A M Alumni Magazine~Winter 2005-06  

E-Print Network [OSTI]

WEB DESIGNER Jeffrey Caron CONTRIBUTORS Theresa Bourgeois Amber Cleveland Jason Gorss Ellen Johnston the light at the end of a tunnel that had been dark for so long. The players moved without fear, without

Linhardt, Robert J.

177

C Y B E R C E N T E R o f D i s c o v e r y P a r k a n d R E G E N S T R I E F C E N T E R F O R H E A LT H C A R E E N G I N E E R I N G  

E-Print Network [OSTI]

: PHOTO HERE Dr. Md. Munirul Haque Computer and Information Sciences University of Alabama at Birmingham at the Department of Computer and Information Sciences at the University of Alabama at Birmingham. He holds a Ph care delivery, m-health, and HCI. He is especially interested in mobile-phone-based applications

Ginzel, Matthew

178

A D VA N C E M E N T O F T H E PRACTICEA D VA N C E M E N T O F T H E PRACTICE D I R E C T F R O M C D C E N V I R O N M E N TA L H E A LT H S E R V I C E S B R A N C H  

E-Print Network [OSTI]

Practices Identification Framework to Environmental Health Chris S. Kochtitzky, MSP Editor's Note: NEHA evaluations to determine that they continue to represent best practices with demonstrated success in the field conducted a literature review regarding best practices. We found that "best practice" and related terms do

179

U.S. Coast Guard Polar Icebreaker Operations  

E-Print Network [OSTI]

' Draft: 29.3' Displacement: 16k LT Propulsion: Diesel-Electric AC/AC SHP: 30,000 HP Fuel: 1.22M gals: Heavy Icebreaker Length: 399' Width: 83.5' Draft: 28' Displacement: 13.1k LT Propulsion: Diesel-Electric · Required extensive motor repairs following 2004 Antarctic mission · Additional work completed in 2007

Kuligowski, Bob

180

A new rateless code with unequal error protection property  

Science Journals Connector (OSTI)

In our previous work, ''robust transmission of scalable video stream using modified LT codes'', an LT code with unequal packet protection property was proposed. It was seen that applying the proposed code to any importance-sorted input data, could increase ...

Ehsan Namjoo; Ali Aghagolzadeh; Javad Museviniya

2013-10-01T23:59:59.000Z

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

VIROLOGY 60, 883-898 (1972) Specialized Transduction of Tetracycline Resistance by Phage P22  

E-Print Network [OSTI]

Salmonella typhimurium LT.2 to letR with P22 phage grown on an LT-2 strain car- rying the R factor 222. The HFT lysate contains defective P22 particles, called P22 Tc-10, which cannot grow or lysogenize (i.e., transduce tetn) upon single infection. However, two defective P22 Tc-10 particles can cooperate with each

Botstein, David

182

Khesbn no. 61-62 - Autumn - Winter 1970-1971 - Journal  

E-Print Network [OSTI]

StJ't lyl! )t rrtvj s I'N lgh r'ltNT J.r," ltJt' srs N ,-t:l t? illt D ''ly rrs;t /l1"lgh,, rtfty'l .rJD]t: 1y,'1 IrR

Admin, LAYCC

1971-01-01T23:59:59.000Z

183

The unique focus of Quality of Life technologies demands integration across diverse disciplines  

E-Print Network [OSTI]

and older adults. www.qolt.pitt.edu #12;Pre-college: QoLT EOD Partners: Through our formal programs of mutual collaboration. Highlight: TechLink robotics camp. EOD Pipeline Undergraduate: Re-entry to college Leadership Council. Contact QoLT EOD team: Mary Goldberg: mrh35@pitt.edu 412.822.3693 Maria Milleville

Sheikh, Yaser Ajmal

184

GREEN ENERGY AND ELECTRIC VEHICLES. BMW GROUP TECHNOLOGYOFFICE USA.  

E-Print Network [OSTI]

GREEN ENERGY AND ELECTRIC VEHICLES. BMW GROUP TECHNOLOGYOFFICE USA. LT-Z-Z, OCTOBER 2012 #12;GREEN E, LT-Z-Z,OCT 2012 Page 2 BACKGROUND. Markets for green energy and electric vehicles can accelerate each other. Nearly 40% of MINI E customers invested in residential solar. Adding Green-E options

California at Davis, University of

185

Synthetic Fuels: Will Government Lend the Oil Industry a Hand?  

Science Journals Connector (OSTI)

...500 million; production costs are pegged...4 and $6 per 42-galloni...feet of gas a day' (abouLt the...North American production w\\ithouLt...one Satur-day afternoon...30 November 1973). Some of...the Defense Production Act of 1950...thesis is that OPEC, like any cartel...

Robert Gillette

1974-02-15T23:59:59.000Z

186

LESSONS LEARNED FROM EVENTS NOTIFIED TO THE FRENCH NUCLEAR SAFETY AUTHORITY DURING THE PERIOD 200713 IN THE MEDICAL FIELD  

Science Journals Connector (OSTI)

......led to very high dose levels, to several organs in particular. The doses ranged from 4 to 60 Gy to the skin, 15 Gy to the brain (a few cubic centimetres), from 1 to 8 Gy to the lung and 2 Gy to the heart. Among events concerning medical staff, seven......

Carole Rousse; Paul Cillard; Aurelie Isambert; Marc Valero

2014-10-01T23:59:59.000Z

187

The Automatic Real-Time GRB Pipeline of the 2-m Liverpool Telescope  

E-Print Network [OSTI]

The 2-m Liverpool Telescope (LT), owned by Liverpool John Moores University, is located in La Palma (Canary Islands) and operates in fully robotic mode. In 2005, the LT began conducting an automatic GRB follow-up program. On receiving an automatic GRB alert from a Gamma-Ray Observatory (Swift, INTEGRAL, HETE-II, IPN) the LT initiates a special override mode that conducts follow-up observations within 2-3 min of the GRB onset. This follow-up procedure begins with an initial sequence of short (10-s) exposures acquired through an r' band filter. These images are reduced, analyzed and interpreted automatically using pipeline software developed by our team called "LT-TRAP" (Liverpool Telescope Transient Rapid Analysis Pipeline); the automatic detection and successful identification of an unknown and potentially fading optical transient triggers a subsequent multi-color imaging sequence. In the case of a candidate brighter than r'=15, either a polarimetric (from 2006) or a spectroscopic observation (from 2007) will be triggered on the LT. If no candidate is identified, the telescope continues to obtain z', r' and i' band imaging with increasingly longer exposure times. Here we present a detailed description of the LT-TRAP and briefly discuss the illustrative case of the afterglow of GRB 050502a, whose automatic identification by the LT just 3 min after the GRB, led to the acquisition of the first early-time (< 1 hr) multi-color light curve of a GRB afterglow.

C. Guidorzi; A. Monfardini; A. Gomboc; C. J. Mottram; C. G. Mundell; I. A. Steele; D. Carter; M. F. Bode; R. J. Smith; S. N. Fraser; M. J. Burgdorf; A. M. Newsam

2005-11-01T23:59:59.000Z

188

 

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

MAP NAME="INFORMATIONBAR"> MAP NAME="INFORMATIONBAR">&lt;AREA SHAPE="RECT" COORDS="8,1 107,19" HREF="http://www.ornl.gov/hgmis/faq/faqs1.html">&lt;AREA SHAPE="RECT" COORDS="128,1 212,19" HREF="http://compbio.ornl.gov/docs/pubs.shtml">&lt;/MAP> Publications 2003 Quick links: 1990-1999, 2000, 2001, 2002

189

Compressional-wave and shear-wave velocities from long-spaced sonic waveforms  

E-Print Network [OSTI]

-SPACED SONIC TOOL UT LTF R L TNR 3' Lr TN R LrTFR LT 10' C FR NR 8' D I FRI (( 'I ll NrR ) ( rt I ll ))8. I ) 8 I I I I ) I I I l I I I-I Ii& I ? ? +) ? +l ?? I I~ I lk ) I LT I ? I I 10' A LT Figure 2. Configuration... REFERENCES 56 VITA 58 LIST OF TABLES TABLE Page I Input parameters for synthetic sonic waveforms. 23 2 Synthetic waveform computed slowness error ? 9"-diameter borehole. . . . 25 3 Synthetic waveform computed slowness error ? 4"-diameter borehole...

Lake, Leonard Cornelius

2012-06-07T23:59:59.000Z

190

The effects of adverse environmental conditions on workload  

E-Print Network [OSTI]

WORKLOAD MEANS SHOWING SIGNIFICANT DIFFERENCES AS DETERMINED BY DUNCAN'S RANGE TEST Rank 1 2 3 4 5 6 7 Condition C HT HT/IN LT/CN LT/IN HT/CN LT Mean . 4287 . 5462 . 5475 . 5585 . 5684 . 6045 . 6071 C--Control condit1on HT--High temp. condition HT... Major Subject: Industrial Engineering THE EFFECTS OF ADVERSE ENVIRONMENTAL CONDITIONS ON WORKLOAD A Thesis by ANN ELIZABETH MARTIN Approved as to sty1e and content by: Chairman of Comnsttee Xc' ead of Departme lkI ?r, . ember Me er May 1975...

Martin, Ann Elizabeth

2012-06-07T23:59:59.000Z

191

E-Print Network 3.0 - albumin excretion rate Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of publications 1. Atthobari J, Gansevoort RT, Visser ST, de Jong PE, de Jong-Van den Berg LTW. Summary: PE, Berg LT. The effect of statins on urinary albumin excretion and...

192

When is the "Day of Reckoning" and How Will the Industry Respond...  

Gasoline and Diesel Fuel Update (EIA)

2017 2018 2019 2020 Thousand BPD Refinery Utilization Increases Refinery Expansions Condensate StabilizersSplitters Canadian ImportsExports WB non-Saudi PADD 5 Lt.+Med. WB...

193

g ert de M" B. BREUIL Le Campinien et l'Age du Mammouth en Flandre,  

E-Print Network [OSTI]

!lt, et met souvent à de rude;; épt·en,·es notre esprit d'im·es- tigation. J 'ni eul'ocea'iion tl

Paris-Sud XI, Université de

194

Das wirkl. Mitglied Edmund Hlawka legt ftir den Anzeiger eine Arheit VOl'  

E-Print Network [OSTI]

Bbarer Flmktionen auf (0,1] mit del' Eigenschaft, daB t e Y, y stetig, Ig(t)I:,,:::lt(t)1 flir aIle t impliziert: (J

Feichtinger, Hans Georg

195

Integrated Analysis of Multiple Gene Expression Profiling Datasets Revealed Novel Gene Signatures and Molecular Markers in Nasopharyngeal Carcinoma  

Science Journals Connector (OSTI)

...extracted describing both nuclear morphology (NM) and Laws texture (LT) within the nuclear regions. Independent 2-sample...found that, for the MRI dataset, Gabor texture features...while on histopathology, nuclear texture and convexity...

Chen Huang; Hailin Tang; Wenling Zhang; Xiaoling She; Qianjin Liao; Xiaoling Li; Minghua Wu; and Guiyuan Li

2012-01-01T23:59:59.000Z

196

E-Print Network 3.0 - adverse event safety Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Ecole Polytechnique, Centre de mathmatiques Collection: Mathematics 48 UNIVERSITIES AND COLLEGES EMPLOYER'S ASSOCIATION U N I V E R S I T I E S SA F E TY A N D H E A LT H A SS O...

197

The resulting skin dose in two-view mammography examinations  

Science Journals Connector (OSTI)

......3):274-280. http://www.mtp.lt/files/MEDICINA-2007-3-274-2801.pdf . 11 AutoCAD 2002. (2002) Autodesk, Inc. 12 International Commission on Radiological Protection (ICRP). Task group on reference man. (1975) Oxford: Pergamon......

D. Adliene; I. Cibulskaite; J. Laurikaitiene; G. Adlys

2010-01-01T23:59:59.000Z

198

January 2013 Most Viewed Documents for National Defense | OSTI...  

Office of Scientific and Technical Information (OSTI)

L.T. From separations to reconstitution - a short history of Plutonium in the U.S. and Russia Gray, L W Condensation induced water hammer safety Gintner, M.A. Direct calibration of...

199

NUDIBRANCH NEIGHBORHOOD: THE DISTRIBUTION OF TWO NUDIBRANCH SPECIES (CHROMODORIS LOCHI AND CHROMODORIS SP.) IN COOKS BAY, MOOREA, FRENCH POLYNESIA  

E-Print Network [OSTI]

LT and Glenn EP. 1994. Plaster standards to measure watermeasure current, I used plaster of Paris (calcium sulfate).standard ice cube tray, plaster of Paris cubes measure water

Hubner, Gwen

2011-01-01T23:59:59.000Z

200

CURRENT WORK BROADWAY-EUCLID TRANSPORTATION IMPROVEMENTS PROJECT  

E-Print Network [OSTI]

& Xcel relocation work NB transit stop on Broadway closed MU path detour as shown 24/7 NB lane closures) Qwest & Xcel utility work in 16th/Euclid intersection (after "new" Euclid and temp SB LT at 18th

Vasilyev, Oleg V.

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Kheshbn No. 41 - April 1965 - Journal  

E-Print Network [OSTI]

ltl ur': r! $ 't lr$ ,lN'rry ,lgh -'l'N lg tt't! yt't ,yty:gr b'r.l Ff tyr l''t ''lgh DSt't ltyn ,"ty: ll? , llylyl:

Admin, LAYCC

1965-01-01T23:59:59.000Z

202

Water Interactions with Terminal Hydroxyls on TiO2 (110). | EMSL  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Instruments: Ultra-high Vacuum, Low-temperature Scanning Probe Microscope Instrument, or UHV LT SPM Tags: oxides ultra-high vacuum UHV VT SPM atomic-resolution imaging structural...

203

Improved Stability Of Amorphous Zinc Tin Oxide Thin Film Transistors...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Instruments: Ultra-high Vacuum, Low-temperature Scanning Probe Microscope Instrument, or UHV LT SPM Tags: oxides ultra-high vacuum UHV VT SPM atomic-resolution imaging structural...

204

E-Print Network 3.0 - asphalt technology test Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

test Search Powered by Explorit Topic List Advanced Search Sample search results for: asphalt technology test Page: << < 1 2 3 4 5 > >> 1 Bi Oil i A h ltBio-Oil in Asphalt...

205

Department of Electrical & Computer  

E-Print Network [OSTI]

. · Offering courses and synchronous, customer tailored distance learning degree programs via VTE · Offering to Using Silvaco to Simulate and Design Tunnel Junctions, LT R. Gelinas, USN. · Distributed Beamforming

206

Khesbn no. 69-70 - Fall 1972 - Journal  

E-Print Network [OSTI]

f'-?.r{ rrri;t $. :,l.lt ugi- .o:n:irnln"'r-yo,::r x n'bu syur).rr) . 'WE gllrDljtl Ugi .lltb, p:1: ,pryrtrlJlyo ylyD

Admin, LAYCC

1972-01-01T23:59:59.000Z

207

BPA-2012-003364-FOIA Request  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Dec.2011 Memo To:W.C.Madsen,Wildlife Mgr.BPA Subject:Freedom of Information Act Request(FOIA) From:Rob Kavanaugh Lt42' Thanks for your response and letter dated Oct.31.2011 ref the...

208

MSU Extension Publication Archive Archive copy of publication, do not use for current recommendations. Up-to-date  

E-Print Network [OSTI]

for Michigan Soils Michigan State University Extension Service John Sims Issued January 1929 4 pages The PDF ,\\ ct (Ii ('()llgrl'~'. ,\\l:t \\. S, 1f)1 ~ . #12;, LIME FOR MICHIGAN SOILS BY JOHN SIMS Clover failures

209

Lieutenant General Frank G. Klotz, USAF (Ret) | National Nuclear...  

National Nuclear Security Administration (NNSA)

Commander of the Twentieth Air Force from 2003 to 2005. Lt. Gen. Klotz served at the White House from 2001 to 2003 as the Director for Nuclear Policy and Arms Control on the...

210

Building blocks for tobacco control: a handbook  

E-Print Network [OSTI]

FOR TOBACCO CONTROL: A HANDBOOK 60. Bowers S. ImperialFOR TOBACCO CONTROL: A HANDBOOK 90. Author unknown. YouthBlocks for Tobacco Control A Handbook W O R L D H E A LT H O

World Health Organization - Tobacco Free Initiative

2004-01-01T23:59:59.000Z

211

E-Print Network 3.0 - adjuvants induce distinct Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

i.m immunization induced low levels of serum IgA titers... of the nasal adjuvants like chitosan 37, 50, ISCOMS 51, lipids 25, 52, and LT 26 induce a mixed Th1Th2......

212

E-Print Network 3.0 - adjuvant induces qualitative Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

i.m immunization induced low levels of serum IgA titers... of the nasal adjuvants like chitosan 37, 50, ISCOMS 51, lipids 25, 52, and LT 26 induce a mixed Th1Th2......

213

E-Print Network 3.0 - activation analysis avaliacao Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

1979. L... .J. Newman. Complex Analysis, 2nd ed., Springer-Verlag, 1996 L.T. Magalhaes. Analise Complexa em Uma Vari... avel e Aplicacoes, IST, Fevereiro de 2004. ...

214

TCOM-05-0175 1 Simple Capacity-Achieving Ensembles of Rateless  

E-Print Network [OSTI]

bits are generated independently, LT codes can be expanded by adding extra parity bits without include turbo and low-density parity-check (LDPC) codes. of information bits by concatenating a low

Ping, Li

215

Microsoft Word - ^App Slipsheets.docx  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of the LT prospects() Assume 24 in. line, 700million, 16 yrs, 13.5% on capital, pipeline operation, pigging and inspection (no repair) for about 6% of CAPEX. On FSO, take...

216

OpL^^f-B^ JPL D-1085 D O Technical Information Report SP-100...  

Office of Scientific and Technical Information (OSTI)

ENER6Y Dyer Kenney DOEHQ Ehsan Khan DOEHQ * Stephen J. Lanes DOEHQ Lt. Col. Robert Smith DOEHQ Walter Von Flue DOESANS liEDL C. M. Cox IHEL Frank Fogarty JOHNSON SPACE...

217

Hanford Firefighters Compete in Combat Challenge | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Firefighters Compete in Combat Challenge Firefighters Compete in Combat Challenge Hanford Firefighters Compete in Combat Challenge October 30, 2013 - 12:00pm Addthis Hanford Fire Department Lt. Anthony Lovato, Jr. (left) urges his teammate, Capt. Sean Barajas, to carry the 175-pound life-sized dummy across the finish line at the Scott Firefighter Combat Challenge in Everett, Wash. Hanford Fire Department Lt. Anthony Lovato, Jr. (left) urges his teammate, Capt. Sean Barajas, to carry the 175-pound life-sized dummy across the finish line at the Scott Firefighter Combat Challenge in Everett, Wash. Hanford Fire Department Lt. Anthony Lovato, Jr. performs the 40-pound tower hoisting leg of the Scott Firefighter Combat Challenge in Everett, Wash. Hanford Fire Department Lt. Anthony Lovato, Jr. performs the 40-pound tower

218

A review of Geocorinae of the United States east of the 100th parallel (Hemiptera: lygaeidae)  

E-Print Network [OSTI]

, Geocoris sonoraensis Van Duzeep G. BQ1 lt tht d, G. mt lt '1 -B, G. ~Std lt Elyb, 'dG~M'1 e tt h t ddd t y Ph dg. b&lt pl d Blebby, G. ~Mtt 1'N t BtR dg. ~ltt h dlN t d M dt p 1 tt . N typ d lg tdf G. ~td tdy), h. ~att (Say), G. bullatus (Say), and I... and the parameres of the male were dissected and removed to a clean spot plate. A few drops of 90? ethanol were placed on the spermatheca or paramere while it was being examined and drawn; care had to be taken to insure consistency in the views figured...

Sweet, Janice Readio

2012-06-07T23:59:59.000Z

219

Monthly Performance Report  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Safety Management System L&T Logistics and Transportation MSA Mission Support Alliance, LLC ORP U.S. Department of Energy, Office of River Protection RHP Risk Handling Plan...

220

SHELDON, R. W. Measurement of phytoplankton growth by particle ...  

Science Journals Connector (OSTI)

Nov 1, 1977 ... practical handbook of seawater analysis. Bull. Fish. Res. Bd. Can. 167. .... line of k against l/t often does not be- come zero for any value of D in...

2000-01-09T23:59:59.000Z

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

LG: Noncompliance Determination (2014-SE-15011) | Department...  

Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

July 30, 2014 DOE issued a Notice of Noncompliance Determination to LG Electronics USA, Inc. finding that room air conditioner basic model LT143CNR does not comport with the...

222

PL2ESIDCNI The District Engineer, U. S. Engineer Office,  

Office of Legacy Management (LM)

w. -1. C1P.RSHAW PL2ESIDCNI The District Engineer, U. S. Engineer Office, Kanhattan liistrict, l-J. 0. Box 42, Station New York, N. Y. fi s Attention: Lt. L. C. Burman. Dear Sir:...

223

E-Print Network 3.0 - au point sur Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

: M. Jean Summary: travaux en cours sur l'cologie et la gestion du roseau commun (Phragmites australis) au Qubec No 21... au cours de l't 2010 sa seconde (et...

224

 

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Adobedÿí Adobedÿí&lt;TPhotoshop 3.08BIM%8BIMê°&lt;?xml version="1.0" encoding="UTF-8"?> com.apple.print.PageFormat.PMHorizontalRes com.apple.print.ticket.creator com.apple.printingmanager com.apple.print.ticket.itemArray com.apple.print.PageFormat.PMHorizontalRes 72 com.apple.print.ticket.client com.apple.printingmanager

225

Gauge Transformations as Spacetime Symmetries  

SciTech Connect (OSTI)

Weinberg has shown that massless fields of helicity {+-}1(vector fields) do not transform homogeneously under Unitary Lorentz Transformations (LT). We calculate explicitly the inhomogeneous term. We show that imposing strict invariance of the Lagrangian under LT for an iteracting Dirac field requires the fermion field to transform with a space-time (and photon creation and annihilation operators) dependent phase and dictates the interaction terms as those arising from the conventional gauge principle.

Angeles, Rene; Napsuciale, Mauro [Division de Ciencias e Ingenierias, Universidad de Guanajuato, Lomas del Bosque 103, Fraccionamiento Lomas del Campestre, Leon Guanajuato, 37150 (Mexico)

2009-04-20T23:59:59.000Z

226

IEEE TRANSACTIONS ON AUTOMATIC CONTROL, VOL. 52, NO. 8, AUGUST 2007 1495 Theorem 5: W.p.1, the IPA derivatives of the lost-sales time average  

E-Print Network [OSTI]

IEEE TRANSACTIONS ON AUTOMATIC CONTROL, VOL. 52, NO. 8, AUGUST 2007 1495 Theorem 5: W.p.1, the IPA, the sided IPA derivatives satisfy d d+ L(T;) st d d0L(T;); T > 0; 2 2: (4.8) Stochastic equality holds.7) and the definition of V + m ()and V 0n () by standard arguments. Theorem 6: Under Assumptions 1 and 4, the IPA

Lin, Feng

227

G F G F  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

a rio n M a rio n Sh e rm a n Sh e rm a n Gr a n t Gr a n t K lic k ita t K lic k ita t Pie rc e Pie rc e K it tit a s K it tit a s M o r ro w M o r ro w M u lt n o m a h M u lt n...

228

The influence of forced exercise and ration on carcass merit of ewe and wether lambs  

E-Print Network [OSTI]

-squares Means and Standard Errors for Area of ~lt t. 9 AA l ~ df tfdtf (A 9 of Six Neasurements) . . 4. . . . . . . ~. . . . . . 48 17 A lf fd t fA f~Lt 9 . 9 ', , 49 Least-squares Neans and Standard Errors for Conformation and Quality Scores... Fiber Diameter 109 A Comparison of Fresh snd Frozen Lamb Legs and Loin Chops . . . . . . . . . . . . . . . . . . 110 56 Simple Correlation Coefficients between Some Important Carcass Characteristics and Palatability Attributes as Determined...

Spaeth, Clifford Wayne

1967-01-01T23:59:59.000Z

229

SAFARI 2000 Data Set Released  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Set Released Set Released The ORNL DAAC announces the release of the data set "SAFARI 2000 MISR Level 2 Data, Southern Africa, Dry Season 2000". This data set is a product of the Southern African Regional Science Initiative containing 240 HDF-EOS formatted MISR Level 2 Top-of-Atmosphere/Cloud and Aerosol/Surface Products focused in a southern African study area which includes: Botswana, Lesotho, Malawi, Mozambique, Namibia, South Africa, Swaziland, Zambia, and Zimbabwe. The MISR Level 2 Products are geophysical measurements derived from the Level 1B2 data which consists of parameters that have been geometrically corrected and projected to a standard map grid. The products are in swaths, each derived from a single MISR orbit, where the imagery is 360 km wide and

230

Reply to comment | OSTI, US Dept of Energy, Office of Scientific and  

Office of Scientific and Technical Information (OSTI)

Reply to comment Reply to comment Slide23 Submitted by gibsone on Fri, 2013-08-30 06:22 FY2011-hitson Slide23 Developing Country Access Afghanistan Guatemala Nigeria Albania Guinea Pakistan Algeria Guinea-Bissau Palestinian Territories (West Bank/ Gaza) Angola Guyana Papua New Guinea Armenia Haiti Paraguay Azerbaijan Honduras Peru Bangladesh Indonesia Philippines Belize Iraq Rwanda Benin Jordan Samoa Bhutan Kenya Sao Tome and Principe Bolivia Kiribati Senegal Burkina Faso Kyrgyzstan Sierra Leone Burundi Lao People's Democratic Republic Solomon Islands Cambodia Lesotho Somalia Cameroon Liberia Sri Lanka Cape Verde Macedonia, The Former Yugoslav Republic of Swaziland Central African Republic Madagascar Tajikistan Chad Malawi Tanzania, United Republic of Colombia Maldives Thailand Comoros Mali Timor-Leste

231

Search for {ital CP} violation in {ital D}{sup 0} decay  

SciTech Connect (OSTI)

Using 2.7 fb{sup {minus}1} of data taken with the CLEO II detector, we have searched for {ital CP} violation in the charm system. We looked for asymmetries in the number of decays of {ital D}{sup 0}`s and {ital {bar D}}{sup 0}`s to the {ital CP} eigenstates {ital K}{sup +}{ital K}{sup {minus}}, {ital K}{sub {ital S}}{sup 0}{phi}, and {ital K}{sub {ital S}}{sup 0}{pi}{sup 0}. Confidence intervals (90%) on these asymmetries were found to be {minus}0.020{lt}{ital A}{sub {ital K}{ital K}}{lt}0.180, {minus}0.182{lt}{ital A}{sub {ital K}{ital S}}{sup 0}{phi}{lt}0.126, and {minus}0.067{lt}{ital A}{sub {ital K}{ital S}}{sup 0}{pi}{sup 0}{lt}0.031, respectively.

Bartelt, J.; Csorna, S.E.; Egyed, Z.; Jain, V. [Vanderbilt University, Nashville, Tennessee 37235 (United States)] [Vanderbilt University, Nashville, Tennessee 37235 (United States); Gibaut, D.; Kinoshita, K.; Pomianowski, P. [Virginia Polytechnic Institute and State University, Blacksburg, Virginia 24061 (United States)] [Virginia Polytechnic Institute and State University, Blacksburg, Virginia 24061 (United States); Barish, B.; Chadha, M.; Chan, S.; Cowen, D.F.; Eigen, G.; Miller, J.S.; O`Grady, C.; Urheim, J.; Weinstein, A.J.; Wuerthwein, F. [California Institute of Technology, Pasadena, California 91125 (United States)] [California Institute of Technology, Pasadena, California 91125 (United States); Asner, D.M.; Athanas, M.; Bliss, D.W.; Brower, W.S.; Masek, G.; Paar, H.P. [University of California, San Diego, La Jolla, California 92093 (United States)] [University of California, San Diego, La Jolla, California 92093 (United States); Gronberg, J.; Korte, C.M.; Kutschke, R.; Menary, S.; Morrison, R.J.; Nakanishi, S.; Nelson, H.N.; Nelson, T.K.; Qiao, C.; Richman, J.D.; Roberts, D.; Ryd, A.; Tajima, H.; Witherell, M.S. [University of California, Santa Barbara, California 93106 (United States)] [University of California, Santa Barbara, California 93106 (United States); Balest, R.; Cho, K.; Ford, W.T.; Lohner, M.; Park, H.; Rankin, P.; Smith, J.G. [University of Colorado, Boulder, Colorado 80309-0390 (United States)] [University of Colorado, Boulder, Colorado 80309-0390 (United States); Alexander, J.P.; Bebek, C.; Berger, B.E.; Berkelman, K.; Bloom, K.; Browder, T.E.; Cassel, D.G.; Cho, H.A.; Coffman, D.M.; Crowcroft, D.S.; Dickson, M.; Drell, P.S.; Dumas, D.J.; Ehrlich, R.; Elia, R.; Gaidarev, P.; Garcia-Sciveres, M.; Gittelman, B.; Gray, S.W.; Hartill, D.L.; Heltsley, B.K.; Henderson, S.; Jones, C.D.; Jones, S.L.; Kandaswamy, J.; Katayama, N.; Kim, P.C.; Kreinick, D.L.; Lee, T.; Liu, Y.; Ludwig, G.S.; Masui, J.; Mevissen, J.; Mistry, N.B.; Ng, C.R.; Nordberg, E.; Patterson, J.R.; Peterson, D.; Riley, D.; Soffer, A. [Cornell University, Ithaca, New York 14853 (United States)] [Cornell University, Ithaca, New York 14853 (United States); Avery, P.; Freyberger, A.; Lingel, K.; Rodriguez, J.; Yang, S.; Yelton, J. [University of Florida, Gainesville, Florida 32611 (United States)] [University of Florida, Gainesville, Florida 32611 (United States); Brandenburg, G.; Cinabro, D.; Liu, T.; Saulnier, M.; Wilson, R.; Yamamoto, H. [Harvard University, Cambridge, Massachusetts 02138 (United States)] [Harvard University, Cambridge, Massachusetts 02138 (United States); Bergfeld, T.; Eisenstein, B.I.; Ernst, J.; (CLEO Collaboration)

1995-11-01T23:59:59.000Z

232

Investigation of Radiation-Induced Free Radicals and Luminescence Properties in Fresh Pomegranate Fruits  

Science Journals Connector (OSTI)

Radiation-induced free radicals and luminescence properties were investigated in ?-irradiated (03 kGy) pomegranate (Punica granatum L.) fruits. Photostimulated luminescence (PSL) analysis showed limited applicability, and only 3 kGy-irradiated ...

Hafiz M. Shahbaz; Kashif Akram; Jae-Jun Ahn; Joong-Ho Kwon

2013-04-09T23:59:59.000Z

233

Improved Technique of Hydrogen Content Analysis by Slow Neutron Scattering  

DOE R&D Accomplishments [OSTI]

A slow-neutron-transmission method fro determining the H content of fluorcarbons is described (G.Y.)

Rainwater, L. J.; Havens, W. W. Jr.

1945-02-28T23:59:59.000Z

234

Banach-Semikategorien III SitzUngsbcrichtco dct Ostcm:i<:hlsehen Akaderoie dcr Wiasensc:haften  

E-Print Network [OSTI]

ist leicht einzusehen, daB der Teilraum aller spalten- und zeilenendliehen Matrizen [gyX] (d. h. flir in 8.1, dann be trachten wir den NormabsehluB des Teilraumes aller Matrizen [gyX], flir die gyX "" 0 nur flir endlich viele (X, Y) gilt (spater gemeinhin endliche Matrizen genannt), in [[G

Michor, Peter W.

235

Dosimetric Comparison of High-Dose-Rate Brachytherapy and Intensity-Modulated Radiation Therapy as a Boost to the Prostate  

SciTech Connect (OSTI)

Purpose: We compared the dose conformity of two radiation modalities: high-dose-rate brachytherapy (HDR BT) and intensity-modulated radiation therapy (IMRT) to deliver a boost to the prostate after external beam radiotherapy (EBRT). Methods and Materials: Ten successive patients with prostate adenocarcinoma treated with a single 10-Gy HDR BT boost after EBRT were investigated. Four theoretical IMRT plans were computed: (a) 32.85 Gy IMRT and (b) 26 Gy IMRT with CTV-PTV expansions, doses corresponding to the equivalent dose in 2-Gy fractions (EQD2) of one 10-Gy fraction calculated with a prostate alpha/beta ratio of respectively 1.5 and 3 Gy; and (c) 32.85 Gy IMRT and (d) 26 Gy IMRT without CTV-PTV expansions. The dose-volume histogram values converted in EQD2 with an alpha/beta ratio of 3 Gy for the organs at risk were compared. Results: The HDR BT plan delivered higher mean doses to the PTV compared with IMRT plans. In all, 33% of the rectal volume received a mean dose of 5.32 +- 0.65 Gy and 20% of bladder volume received 4.61 +- 1.24 Gy with HDR BT. In comparison, doses delivered with IMRT were respectively 13.4 +- 1.49 Gy and 10.81 +- 4 Gy, even if only 26 Gy was prescribed to the PTV with no CTV-PTV expansion (p < 0.0001). The hot spots inside the urethra were greater with HDR BT but acceptable. Conclusions: Use of HDR BT produced a more conformal plan for the boost to the prostate than IMRT even without CTV-PTV expansions.

Hermesse, Johanne, E-mail: jhermesse@chu.ulg.ac.b [Department of Radiation Oncology, Liege University Hospital, Liege (Belgium); Biver, Sylvie; Jansen, Nicolas [Department of Radiation Oncology, Liege University Hospital, Liege (Belgium); Lenaerts, Eric [Department of Medical Physics, Liege University Hospital, Liege (Belgium); Nickers, Philippe [Department of Radiation Oncology, Oscar Lambret Center, Lille (France)

2010-01-15T23:59:59.000Z

236

BEFORE THE U.S. DEPARTMENT OF ENERGY  

Broader source: Energy.gov (indexed) [DOE]

o o f 1 ) Jandy Pool Products, Inc. 1 Case Number: 20 10-CE- 1 1 1 1 (Pool heaters) ) 1 NOTICE OF PROPOSED CIVIL PENALTY Date issued: September 8,20 10 Number of alleged violations: 40 Maximum possible assessment: $2,398,000 Proposed civil penalty: $259,150 The Office of the General Counsel of the U.S. Department of Energy (DOE) alleges that Jandy Pool Products, Inc. violated certain provisions of the Energy Policy and Conservation Act, 42 U.S.C. fj 6201 et seq., 10 C.F.R. Part 430, or both. Specifically, DOE alleges: 1. Jandy Pool Products, Inc. manufactures or privately labels a variety of pool heaters, including models LRZE 125, LRZE 175, LRZE 250, LRZE 325, LRZE 400, LRZM 125, LRZM 175, LRZM 250, LRZM 325, LRZM 400, LXi 250, LXi 300, LXi 400, LX250, LX400, LT250, LT400, LX250-L, LX400-L, LT250-L,

237

Fire Department Gets New Trucks, Saves Money | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

Fire Department Gets New Trucks, Saves Money Fire Department Gets New Trucks, Saves Money Fire Department Gets New Trucks, Saves Money August 27, 2013 - 12:00pm Addthis Hanford firefighters stand next to the 31-year-old chemical truck. Pictured, left to right, are Hanford Fire Lt. Robert Smith, Firefighter/Paramedic Kyle Harbert, Firefighter Don Blackburn and Capt. Sean Barajas. Hanford firefighters stand next to the 31-year-old chemical truck. Pictured, left to right, are Hanford Fire Lt. Robert Smith, Firefighter/Paramedic Kyle Harbert, Firefighter Don Blackburn and Capt. Sean Barajas. One of two of the Hanford Fire Department’s new chemical trucks. One of two of the Hanford Fire Department's new chemical trucks. Hanford firefighters stand next to the 31-year-old chemical truck. Pictured, left to right, are Hanford Fire Lt. Robert Smith, Firefighter/Paramedic Kyle Harbert, Firefighter Don Blackburn and Capt. Sean Barajas.

238

Frequently Asked Questions on the Department of Energy's National Environmental Policy Act Regulations  

Broader source: Energy.gov (indexed) [DOE]

Lh[)E Lh[)E F 1W:i lt r)fi:~)i:lrtrllc!rlt d IF1'l(wqf .................................................................................................................................................................................................................................... ...:............................::.......... . . !"'111'111 (1!Ili''llll''llll 'c)11''!iall 11'''1111 (i 111,,)1111'''l111lll [l@il%: ww,:f m ANN IOF SIIJIWEC:V "1-cl ; A'll[gl;lst :?!1.j II '9 w ... . .. . .. ,!! 'Cmk (20 f ,N]b, 1+ A ,J" (:) ![ 1[ c, y and, ,!4,:! ~; ~,',? " ., ,,. I . ) >'ii L.ll,u.r . hWl[Ik: : 6-'! 1'{!11 :?!41 :k:l?i,:$d ""~][(:(:llL]f::~)lt~[:}r ihkd '[)tl:l(:$ti![]l[ ]l$ (Ml 'thE: ]~(fl~)~l]~lt~~l(:~lit ([]~f ~][]k:][[?jf $ (lDcws:)

239

Search for {ital B}{r_arrow}l{bar {nu}}{sub l}  

SciTech Connect (OSTI)

We search for the decays {ital B}{sup {minus}}{r_arrow}l{sup {minus}}{bar {nu}}{sub l} in a sample of 2.2{times}10{sup 6} charged {ital B} decays using the CLEO detector. We see no evidence for a signal in any channel and set upper limits on the branching fractions of {ital B}({ital B}{sup {minus}}{r_arrow}{tau}{sup {minus}}{bar {nu}}{sub {tau}}){lt}2.2{times}10{sup {minus}3}, {ital B}({ital B}{sup {minus}}{r_arrow}{mu}{sup {minus}}{nu}2;m{sub {mu}}){lt}2.1{times}10{sup {minus}5}, and {ital B}({ital B}{sup {minus}}{r_arrow}{ital e}{sup {minus}}{bar {nu}}{sub {ital e}}){lt}1.5{times}10{sup {minus}5} at the 90% confidence level.

Artuso, M.; Gao, M.; Goldberg, M.; He, D.; Horwitz, N.; Moneti, G.C.; Mountain, R.; Muheim, F.; Mukhin, Y.; Playfer, S.; Rozen, Y.; Stone, S.; Xing, X.; Zhu, G.; Bartelt, J.; Csorna, S.E.; Egyed, Z.; Jain, V.; Gibaut, D.; Kinoshita, K.; Pomianowski, P.; Barish, B.; Chadha, M.; Chan, S.; Cowen, D.F.; Eigen, G.; Miller, J.S.; O`Grady, C.; Urheim, J.; Weinstein, A.J.; Wuerthwein, F.; Asner, D.M.; Athanas, M.; Bliss, D.W.; Brower, W.S.; Masek, G.; Paar, H.P.; Gronberg, J.; Korte, C.M.; Kutschke, R.; Menary, S.; Morrison, R.J.; Nakanishi, S.; Nelson, H.N.; Nelson, T.K.; Qiao, C.; Richman, J.D.; Roberts, D.; Ryd, A.; Tajima, H.; Witherell, M.S.; Balest, R.; Cho, K.; Ford, W.T.; Lohner, M.; Park, H.; Rankin, P.; Smith, J.G.; Alexander, J.P.; Bebek, C.; Berger, B.E.; Berkelman, K.; Bloom, K.; Browder, T.E.; Cassel, D.G.; Cho, H.A.; Coffman, D.M.; Crowcroft, D.S.; Dickson, M.; Drell, P.S.; Dumas, D.J.; Ehrlich, R.; Elia, R.; Gaidarev, P.; Galik, R.S.; Garcia-Sciveres, M.; Gittelman, B.; Gray, S.W.; Hartill, D.L.; Heltsley, B.K.; Henderson, S.; Jones, C.D.; Jones, S.L.; Kandaswamy, J.; Katayama, N.; Kim, P.C.; Kreinick, D.L.; Liu, Y.; Ludwig, G.S.; Masui, J.; Mevissen, J.; Mistry, N.B.; Ng, C.R.; Nordberg, E.; Patterson, J.R.; Peterson, D.; Riley, D.; Soffer, A.; Avery, P.; Freyberger, A.; Lingel, K.; Rodriguez, J.; Yang, S.; Yelton, J.; Brandenburg, G.; Cinabro, D.; Liu, T.; Saulnier, M.; Wilson, R.; Yamamoto, H.; Bergfeld, T.; Eisenstein, B.I.; Ernst, J.; Gladding, G.E.; Gollin, G.D.; Palmer, M.; Selen, M.; Thaler, J.J.; Edwards, K.W.; McLean, K.W.; Ogg, M.; Bellerive, A.; Britton, D.I.; Hyatt, E.R.F.; Janicek, R.; MacFarlane, D.B.; Patel, P.M.; Spaan, B.; Sadoff, A.J.; Ammar, R.; Baringer, P.; Bean, A.; Besson, D.; Coppage, D.; Copty, N.; Davis, R.; Hancock, N.; Kelly, M.; Kotov, S.; Kravchenko, I.; Kwak, N.; Lam, H.; Kubota, Y.; Lattery, M.; Momayezi, M.; Nelson, J.K.; Patton, S.; Poling, R.; Savinov, V.; Schrenk, S.; Wang, R.; Alam, M.S.; Kim, I.J.; Ling, Z.; (CLEO Co..

1995-07-31T23:59:59.000Z

240

Plasma boundary experiments on DIII-D tokamak  

SciTech Connect (OSTI)

A survey of the boundary physics research on the DIII-D tokamak and an outline of the DIII-D Advanced Divertor Program (ADP) is presented. We will present results of experiments on impurity control, impurity transport, neutral particle transport, and particle effects on core confinement over a wide range of plasma parameters, I{sub p}{approx lt} 3 MA, {beta}{sub T} {approx lt} 10.7%, P(auxiliary) {approx lt} 20 MW. Based on the understanding gained in these studies, we in collaboration with a number of other laboratories have devised a series of experiments (ADP) to modify the core plasma conditions through changes in the edge electric field, neutral recycling, and plasma surface interactions. 41 refs., 8 figs., 1 tab.

Mahdavi, M.A.; Brooks, N.; Jackson, G.L.; Langhorn, A.; Leikind, B.; Lippmann, S.; Luxon, J.; Petersen, P.; Petrie, T.; Stambaugh, R.D.; Simonen, T.C.; Staebler, G. (General Atomics, San Diego, CA (USA)); Buchenauer, D. (Sandia National Labs., Livermore, CA (USA)); Futch, A.; Hill, D.N.; Rensink, M. (Lawrence Livermore National Lab., CA (USA)); Hogan, J.; Menon, M.; Mioduszewski, P.; Owen, L. (Oak Ridge National

1990-06-01T23:59:59.000Z

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Magnetic Reconnection During the Two-Phase Evolution of a Solar Eruptive Flare  

E-Print Network [OSTI]

We present a detailed multi-wavelength analysis and interpretation of the evolution of an M7.6 flare on October 24, 2003. The X-ray observations of the flare taken from the RHESSI spacecraft reveal two phases of the flare evolution. The first phase is characterized by the altitude decrease of the X-ray looptop (LT) source for $\\sim$11 minutes. Such a long duration of the descending LT source motion is reported for the first time. The EUV loops, located below the X-ray LT source, also undergo contraction with similar speed ($\\sim$15 km s$^{-1}$) in this interval. During the second phase the two distinct hard X-ray footpoints (FP) sources are observed which correlate well with UV and H$\\alpha$ flare ribbons. The X-ray LT source now exhibits upward motion. The RHESSI spectra during the first phase are soft and indicative of hot thermal emission from flaring loops with temperatures $T>25$ MK at the early stage. On the other hand, the spectra at high energies ($\\varepsilon \\gtrsim$25 keV) follow hard power laws during the second phase ($\\gamma = 2.6-2.8$). We show that the observed motion of the LT and FP sources can be understood as a consequence of three-dimensional magnetic reconnection at a separator in the corona. During the first phase of the flare, the reconnection releases an excess of magnetic energy related to the magnetic tensions generated before a flare by the shear flows in the photosphere. The relaxation of the associated magnetic shear in the corona by the reconnection process explains the descending motion of the LT source. During the second phase, the ordinary reconnection process dominates describing the energy release in terms of the standard model of large eruptive flares.

Bhuwan Joshi; Astrid Veronig; K. -S. Cho; S. -C. Bong; Y. -J. Moon; Jeongwoo Lee; B. V. Somov; P. K. Manoharan; Y. -H. Kim

2008-09-15T23:59:59.000Z

242

Detection of lactate threshold by including haemodynamic and oxygen extraction data  

Science Journals Connector (OSTI)

To date, few attempts have been made to correlate cardiovascular variables to lactate threshold (LT). This study was designed to determine the relationship between the accumulation of blood lactate and several haemodynamic variables during exercise. Eight male volunteer cyclists performed an incremental test on an electromagnetically braked cycle-ergometer consisting of a 50 W linear increase in workload every 3 min up to exhaustion. Blood lactate was measured with a portable analyser during each exercise step. Oxygen consumption (VO2) and pulmonary ventilation were measured by means of a mass spectrometer while heart rate, stroke volume and cardiac output (CO) were assessed by impedance cardiography. The arterio-venous oxygen difference (A-V O2 Diff) was obtained by dividing VO2 by CO. By applying the Dmax mathematical method, LT and thresholds of ventilatory and haemodynamic parameters were calculated. The Bland and Altman statistics used to assess agreement between two methods of measurement were applied in order to evaluate the agreement between LT and thresholds derived from ventilatory and haemodynamic data. The main result was that most of the haemodynamic variables did not provide thresholds which could be used interchangeably with LT. Only the threshold of A-V O2 Diff showed mean values that were no different compared to LT together with limits of agreement that were not very wide between thresholds (below 25%). Hence of the haemodynamic parameters, A-V O2 Diff appears to be the one most closely coupled with lactate accumulation and consequently it is also the most suitable for non-invasive calculation of the LT.

Antonio Crisafulli; Filippo Tocco; Gianluigi Pittau; Marcello Caria; Luigi Lorrai; Franco Melis; Alberto Concu

2006-01-01T23:59:59.000Z

243

A Contribution to the Modeling of Metal Plasticity and Fracture: From Continuum to Discrete Descriptions  

E-Print Network [OSTI]

and corresponding anisotropy parameters used in the unit cell calculations. Coe cients hi (i = L;T; S;TS; SL;LT) represent the diagonal elements of the Voigt representation of anisotropy tensor h, expressed in the frame of material orthotropy, and h is a scalar... invariant of h de ned in equation (2.14). Wider ranges of variation of hTS were also reported. 17 II Ranges of initial microstructural and loading parameters consid- ered in the unit cell calculations. Requires special choice of porosity as discussed...

Keralavarma, Shyam Mohan

2012-02-14T23:59:59.000Z

244

Pion elastic scattering from ?p4?sHe  

E-Print Network [OSTI]

) = . 4. 46 APPEVDIX B pppl Cttttttt'tttttt twtxtetett ttttttt PPP2 Cttttttt*tttttt*tettttt*tttttetttttt 0003 SUBROUTIiVE WFiVCRD(LT, TNSH, EFCTR, R) 0004 IiNCLL DE 'RVIPPRM. FOR' 0101 0102 0103 COMMON /LSINT j XXQLS(DlV'INS5), AAQLS(DMNS5...) = . 4. 46 APPEVDIX B pppl Cttttttt'tttttt twtxtetett ttttttt PPP2 Cttttttt*tttttt*tettttt*tttttetttttt 0003 SUBROUTIiVE WFiVCRD(LT, TNSH, EFCTR, R) 0004 IiNCLL DE 'RVIPPRM. FOR' 0101 0102 0103 COMMON /LSINT j XXQLS(DlV'INS5), AAQLS(DMNS5...

Mahmoud, Ahmed Mohamed

2012-06-07T23:59:59.000Z

245

The influence of bacterial metabolites on the motility of stallion spermatozoa  

E-Print Network [OSTI]

' ) f'lt t on spermatozoa motility expressed as a percentage of the extended semen plus filtered tryptose broth control. 47 The effect of four concentrations of Proteus mirabilis filtrate on spermatozoa motility expressed as a percentage... of the extended semen plus filtered tryptose broth control. 48 LIST OF FIGURES Figure Page 12 The effect of four concentrations of P d o ~ f'lt t p tozoa motzlity expressed as a percentage of the extended semen plus filtered tryptose broth control. 49 13...

Rideout, Merry Ilene

2012-06-07T23:59:59.000Z

246

Vertical profiles of radar reflectivity of convective cells in tropical and mid-latitude mesoscale convective systems  

E-Print Network [OSTI]

of tropical oceanic and tropical continental MCSs during the monsoon wet seasons of 1987/1988 and 1988/1989. The atmospheric structure, particularly the CAPE and low level vertical wind shear for all the MCS events studied is analyzed to help... lectivity, at a height of 1. 9 km, of the 68 72 2 December 1988 tropical monsoon case at 0542 LT . . 74 36 37 38 As in Fig. 35, except at 0609 LT Time series of zonal wind and CAPE at Darwin during the 1988/1989 monsoon wet season. Contour plot...

Lutz, Kurt Reed

2012-06-07T23:59:59.000Z

247

Texas Rice, Volume IV, Number 4  

E-Print Network [OSTI]

and acreage is ex- pected to exceed 190,000 acres. This is up about 7% or so from last year. Lets hope the rest of the year goes well. Keep on sending us your suggestions. Sincerely, L.T. (Ted) Wilson Professor and Center Director Jack. B. Wendt Endowed Chair... of information downloaded by visitors. If you would like to see specific features added to the website, please contact Ted Wilson at lt-wilson@aesrg.tamu.edu. Article by L. T. (Ted) Wilson, Yubin Yang, Peter Lu, Jay Cockrell, Jim Medley, Tammy Tindel, Jenny Wang...

248

Disappearance of Elliptic Flow: A New Probe for the Nuclear Equation of State  

SciTech Connect (OSTI)

Using a relativistic hadron transport model, we investigate the utility of the elliptic flow excitation function as a probe for the stiffness of nuclear matter and for the onset of a possible quark-gluon-plasma phase transition at alternating-gradient synchrotron energies 1{approx_lt}E{sub beam}{approx_lt}11A GeV . The excitation function shows a strong dependence on the nuclear equation of state, and exhibits characteristic signatures which could signal the onset of the transition. {copyright} {ital 1998} {ital The American Physical Society }

Lacey, R.A.; Pinkenburg, C.; Chung, P.; Alexander, J.M.; McGrath, R.L. [Departments of Chemistry and Physics, State University of New York at Stony Brook, Stony Brook, New York 11794-3400 (United States); Danielewicz, P.; Gossiaux, P. [National Superconducting Cyclotron Laboratory and the Department of Physics and Astronomy, Michigan State University, East Lansing, Michigan 48824-1321 (United States); Gossiaux, P. [SUBATECH, Ecole des Mines, F-44070 Nantes (France)

1998-09-01T23:59:59.000Z

249

Validation and Routine monitoring of Electron Beam sterilization  

E-Print Network [OSTI]

;2 Absorbed dose: Energy absorbed per unit mass 1 Gray (Gy) = 1 J/kg dose range for sterilization: 10-50 k after irradiation #12;5 Dosimeter examples #12;6 Calorimeter for dose measurement at high energy (Me Measures change in temperature Dose range: 1.5 kGy ­50 kGy Range based on : Tmax = 500C Tmin = 20C Stable

250

A Novel Unified Approach to Invariance in Control  

E-Print Network [OSTI]

May 20, 2014 ... Category 3: Applications -- Science and Engineering (Control Applications ) ... Gy?r, Hungary Department of Industrial and Systems Engineering,...

Zoltn Horvth

2014-05-20T23:59:59.000Z

251

E-Print Network 3.0 - applied high energy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

with high ener- gy efficiency. This is highly relevant to buildings... ), and gross energy consumption in buildings ... Source: Ris National Laboratory Collection:...

252

arXiv:nucl-th/0412037v110Dec2004 Transport Theories for Heavy Ion Collisions in the 1 AGeV  

E-Print Network [OSTI]

. Danielewicz8 , C. Fuchs9 , T. Gaitanos10 , C.M. Ko6 , A. Larionov5 , M. Reiter4 , Gy. Wolf11 , J. Aichelin2 1

Heger, Alexander

253

CONSTRAINING PERTURBATIVE EARLY DARK ENERGY WITH CURRENT OBSERVATIONS  

SciTech Connect (OSTI)

In this work, we study a class of early dark energy (EDE) models, in which, unlike in standard dark energy models, a substantial amount of dark energy exists in the matter-dominated era. We self-consistently include dark energy perturbations, and constrain these models using current observations. We consider EDE models in which the dark energy equation of state is at least w{sub m} {approx_gt} -0.1 at early times, which could lead to an EDE density of up to {Omega}{sub DE}(z{sub CMB})= 0.03{Omega}{sub m}(z{sub CMB}). Our analysis shows that marginalizing over the non-DE parameters such as {Omega}{sub m}, H{sub 0}, andn{sub s} , current CMB observations alone can constrain the scale factor of transition from EDE to late-time dark energy to a{sub t} {approx_gt} 0.44 and width of transition to {Delta}{sub t} {approx_lt} 0.37. The equation of state at present is somewhat weakly constrained to w{sub 0} {approx_lt} -0.6, if we allow H{sub 0} < 60 km s{sup -1} Mpc{sup -1}. Taken together with other observations, such as SNe, Hubble Space Telescope, and Sloan Digital Sky Survey luminous red galaxies, w{sub 0} is constrained much more tightly to w{sub 0} {approx_lt} -0.9, while redshift of transition and width of transition are also tightly constrained to a{sub t} {approx_lt} 0.19 and{Delta}{sub t} {approx_lt} 0.21. The evolution of the equation of state for EDE models is thus tightly constrained to {Lambda}CDM-like behavior at low redshifts. Incorrectly assuming dark energy perturbations to be negligible leads to different constraints on the equation of state parameters-w{sub 0} {approx_lt} -0.8, a{sub t} {approx_lt} 0.33, and{Delta}{sub t} {approx_lt} 0.31, thus highlighting the necessity of self-consistently including dark energy perturbations in the analysis. If we allow the spatial curvature to be a free parameter, then the constraints are relaxed to w{sub 0} {approx_lt} -0.77, a{sub t} {approx_lt} 0.35, and{Delta}{sub t} {approx_lt} 0.35 with -0.014 < {Omega}{sub {kappa}} < 0.031 for CMB + other observations. For perturbed EDE models, the 2{sigma} lower limit on {sigma}{sub 8} ({sigma}{sub 8} {>=} 0.59) is much lower than that in {Lambda}CDM ({sigma}{sub 8} {>=} 0.72), thus raising the interesting possibility of discriminating EDE from {Lambda}CDM using future observations such as halo mass functions or the Sunyaev-Zeldovich power spectrum.

Alam, Ujjaini [ISR-1, ISR Division, Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)

2010-05-10T23:59:59.000Z

254

Revisiting Low-Dose Total Skin Electron Beam Therapy in Mycosis Fungoides  

SciTech Connect (OSTI)

Purpose: Total skin electron beam therapy (TSEBT) is a highly effective treatment for mycosis fungoides (MF). The standard course consists of 30 to 36 Gy delivered over an 8- to 10-week period. This regimen is time intensive and associated with significant treatment-related toxicities including erythema, desquamation, anhydrosis, alopecia, and xerosis. The aim of this study was to identify a lower dose alternative while retaining a favorable efficacy profile. Methods and Materials: One hundred two MF patients were identified who had been treated with an initial course of low-dose TSEBT (5-<30 Gy) between 1958 and 1995. Patients had a T stage classification of T2 (generalized patch/plaque, n = 51), T3 (tumor, n = 29), and T4 (erythrodermic, n = 22). Those with extracutaneous disease were excluded. Results: Overall response (OR) rates (>50% improvement) were 90% among patients with T2 to T4 disease receiving 5 to <10 Gy (n = 19). In comparison, OR rates between the 10 to <20 Gy and 20 to <30 Gy subgroups were 98% and 97%, respectively. There was no significant difference in median progression free survival (PFS) in T2 and T3 patients when stratified by dose group, and PFS in each was comparable to that of the standard dose. Conclusions: OR rates associated with low-dose TSEBT in the ranges of 10 to <20 Gy and 20 to <30 Gy are comparable to that of the standard dose ({>=} 30 Gy). Efficacy measures including OS, PFS, and RFS are also favorable. Given that the efficacy profile is similar between 10 and <20 Gy and 20 and <30 Gy, the utility of TSEBT within the lower dose range of 10 to <20 Gy merits further investigation, especially in the context of combined modality treatment.

Harrison, Cameron, E-mail: cameronh@stanford.edu [Department of Dermatology, Stanford Cancer Center, Stanford, California (United States); Young, James; Navi, Daniel [Department of Dermatology, Stanford Cancer Center, Stanford, California (United States); Riaz, Nadeem [Department of Radiation Oncology, Stanford Cancer Center, Stanford, California (United States); Lingala, Bharathi; Kim, Youn [Department of Dermatology, Stanford Cancer Center, Stanford, California (United States); Hoppe, Richard [Department of Radiation Oncology, Stanford Cancer Center, Stanford, California (United States)

2011-11-15T23:59:59.000Z

255

STATE OF COLORADO DEPARTMENT OF HIGHER EDUCATION John Hickenlooper  

E-Print Network [OSTI]

STATE OF COLORADO DEPARTMENT OF HIGHER EDUCATION John Hickenlooper Governor Lt. Gov. Joseph A. Garcia Executive Director 1560 Broadway, Suite 1600, Denver, Colorado 80202 (303) 866-2723 fax (303) 866-4266 http://highered.colorado.gov STATEWIDE TRANSFER ARTICULATION AGREEMENT for a Bachelor of Arts

256

STATE OF COLORADO DEPARTMENT OF HIGHER EDUCATION John Hickenlooper  

E-Print Network [OSTI]

STATE OF COLORADO DEPARTMENT OF HIGHER EDUCATION John Hickenlooper Governor Lt. Gov. Joseph A. Garcia Executive Director 1560 Broadway, Suite 1600, Denver, Colorado 80202 (303) 866-2723 fax (303) 866-4266 http://highered.colorado.gov STATEWIDE TRANSFER ARTICULATION AGREEMENT for a Bachelor

257

STATE OF COLORADO 1560 Broadway, Suite 1600, Denver, Colorado 80202 (303) 866-2723 fax (303) 866-4266  

E-Print Network [OSTI]

STATE OF COLORADO 1560 Broadway, Suite 1600, Denver, Colorado 80202 (303) 866-2723 fax (303) 866-4266 http://highered.colorado.gov DEPARTMENT OF HIGHER EDUCATION John Hickenlooper Governor Lt. Gov. Joseph A. Garcia Executive Director EARLY CHILDHOOD TEACHER EDUCATION TRANSFER AGREEMENT Between COLORADO

Collett Jr., Jeffrey L.

258

Florence High School Wind Project | Open Energy Information  

Open Energy Info (EERE)

lt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":"" Hide Map Installed Capacity (MW) 0.0240.024 MW 24 kW 24,000 W 24,000,000 mW 2.4e-5 GW Number of Units 1...

259

w,&wwwKwA. Daigger & Company, lnc. 620 Lake View Parkway, Vernon Hills, lL 60061  

E-Print Network [OSTI]

Platform, is an enhanced version of the ORIGINAL VORTEX-GENIE@ Mixer produced by Scientific lndustries products. APPLICATIONS The 3-inch Platform accepts single or multiple test tubes, beakers and various flasks. The removable cover, made of thermoplastic rubber, is highly impervious to chemicals. lt is

260

An analysis of the travel times of S waves to North American stations in the distance range 28 to 82  

Science Journals Connector (OSTI)

...i o-,.s ~.... ~ ,, ~ ,,/ \\Lt ~ ..... o'~ ', ,' , t / -%, o WWSS stoflons \\ / \\ \\ = CaHech slo'iions 1.6 Fzo. 2. Map of S Residuals for.U.S. Stations. TRAVEL TIMES OF S WAVES 767 l I I I I I I I I I I I i I I x x I...

H. A. Doyle; A. L. Hales

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Liquid crystal phase transitions in suspensions of mineral colloids: new life from old roots  

Science Journals Connector (OSTI)

...and plates were performed by Camp Allen [73] as shown in figure-5...may conclude that, almost a century after their discovery, MCLCs...with L/T=10. Adapted from Camp Allen-[73]. 1997, American...PhysRevLett.45.1000 ) 73 Camp, PJ , and MP Allen. 1997 Phase...

2013-01-01T23:59:59.000Z

262

STATE OF COLORADO DEPARTMENT OF HIGHER EDUCATION John Hickenlooper  

E-Print Network [OSTI]

of Colorado Denver University of Northern Colorado Western State Colorado University #12;FINAL StatewideSTATE OF COLORADO DEPARTMENT OF HIGHER EDUCATION John Hickenlooper Governor Lt. Gov. Joseph A. Garcia Executive Director 1560 Broadway, Suite 1600, Denver, Colorado 80202 (303) 866-2723 fax (303

263

A Bayesian approach to paired comparison experimentation  

Science Journals Connector (OSTI)

......j} (i,j = l,...,t), where wit is the observed frequency of preference for object * over object j , with wti + wti = n^ and nH = wi{ = 0. Then if all pairwise comparisons are stochastically independent, the statistical model is defined......

ROGER R. DAVIDSON; DANIEL L. SOLOMON

1973-12-01T23:59:59.000Z

264

Energy Department Officially Dedicates New National Security Campus in Kansas City  

Broader source: Energy.gov [DOE]

Secretary of Energy Ernest Moniz was joined by the Administrator of the National Nuclear Security Administration (NNSA), Lt. Gen. Frank Klotz, United States Air Force (Ret), U.S. Representatives Emanuel Cleaver II and Vicky Hartzler, and other local officials today to officially dedicate the new National Security Campus in Kansas City.

265

O.O A partitton of positive inte  

E-Print Network [OSTI]

the number of p(rn)=O,whenncO). lT= the and fength parts of zr, the natural @ denotes ,w(n) Inl. I I say' He deflnea tfe ranlc of a partltton n to be tlhe number ro- Inl. (he left the rank of o undeflnred

Garvan, Frank

266

cOiridered to replace test fishing at the mouth of ri ver~ in Cook Inlet to more  

E-Print Network [OSTI]

the department to order another ide sca nner for applica- tion in Cook Inl et and elsewhere in th e state. Thi and subsequentl y \\~ould be brought to Cook Inl et for u e in counting adu lt a lmon escapements. Based

267

User's Guide for Microsoft Windows 95, 98, 2000,  

E-Print Network [OSTI]

Limited in Canada, the U.S. and/or other countries. Autodesk, AutoCAD, AutoCAD LT and Volo are registered trademarks of Autodesk Inc. in the U.S. and/or other countries. AutoVue is a trademark of Cimmetry Systems

Collett Jr., Jeffrey L.

268

AutoCAD 2014 Essentials: Autodesk Official Press, 1st edition  

Science Journals Connector (OSTI)

Learn crucial AutoCAD tools and techniques with this Autodesk Official Press BookQuickly become productive using AutoCAD 2014 and AutoCAD LT 2014 with this full color Autodesk Official Press guide. This unique learning resource features concise, straightforward ...

Scott Onstott

2013-06-01T23:59:59.000Z

269

LARGE AND SHARP SOLAR WIND DYNAMIC PRESSURE VARIATIONS AS A SOURCE OF  

E-Print Network [OSTI]

ellite, with t 6 he dist 6 uF rb 5 ances in t 6 he magnet 6 osp8 heric magneti 6 c field measuF red ress t 6 he magnet 6 osp8 here and resuF lt in a similar vG ariati 6 on in t 6 he magnet 6 osp8 heric

Richardson, John

270

FOR PURDUEA GUIDE FOR YOU AND YOUR FAMILY 2 To-do list  

E-Print Network [OSTI]

of people." MEGAN MALONEY BS '11, Nuclear Engineering Lt. Junior Grade, U.S. Navy Naval Submarine Base KingsPAYING FOR PURDUEA GUIDE FOR YOU AND YOUR FAMILY #12;CONTENTS 2 To-do list 4 Estimate your costs 6

Ginzel, Matthew

271

On the geometry of the term structure of interest rates  

Science Journals Connector (OSTI)

...r, Y ) V. Now fix (r , Y ) V. By induction of the preceding argument and proposition...fields, X0, . . . , Xd : U Rn . The generator of a Rn -valued It^o diffusion Zt...where Lt denotes the (time-dependent) generator of the process Zt on K and f D(K...

2004-01-01T23:59:59.000Z

272

UDC Develops Prototype High-Efficiency OLED Undercabinet Luminaire  

Broader source: Energy.gov [DOE]

Universal Display Corporation (UDC) has demonstrated the real-world application of a novel lighting technology by developing two pre-prototype OLED undercabinet lighting systems that exceed 420 total lumens at an efficacy of more than 55 lm/W, with an estimated lifetime (LT70) in excess of 10,000 hours, and a color rendering index (CRI) greater than 85.

273

Climate Change, Agriculture and Poverty Vulnerabilityand Poverty Vulnerability  

E-Print Network [OSTI]

of climate change debate: ­ Science: Detection vs. attribution Wh t i th l f i lt i GHG i i ?­ What is the role of agriculture in GHG emissions? ­ What is the role for agriculture in GHG abatement? ­ Abatement - Making the connection from rising GHG concentrations torising GHG concentrations to global warming

274

Reports and Publications  

Science Journals Connector (OSTI)

... California: Dr John Billingham, NASA/Ames Research Center, Code LT, 1972.) [221Norsk Polarinstitutt. Skrifter No. 138: Geology of the Adventdalen Map Area. By Harald Major ... Adventdalen Map Area. By Harald Major and Jeno Nagy. Pp. 58. (Oslo: Norsk Polarinstitutt, 1972.) [231

1973-05-25T23:59:59.000Z

275

Multiple solutions and numerical analysis to the dynamic and stationary models coupling a delayed energy balance model involving latent heat and discontinuous albedo with a deep ocean  

Science Journals Connector (OSTI)

...6. Funding statement The research of J.I.D. and L.T...2014 Parameter estimation for energy balance models with memory...Diaz, and II Vrabie. 2001 An abstract approximate controllability...analysis of some diffusive energy balance climate models. Mathematics...

2014-01-01T23:59:59.000Z

276

,Adv SpacaRes VoI12,NolO,pp.(10)199-(10)202,1992 PnntedmGreatBntamAllngbtsreserved  

E-Print Network [OSTI]

and the secondary modes (l-2,3, .) are nonlinearly generated by this fundamental mode Note that the onset Re is a Reynolds number For It'max(L,,,Lt),the interaction is viscous and the nonlinear effects through nonlinear interactions.That result is mostly linked to a feedback influence of the modification

Lott, Francois

277

Between Earth and Sky: The work of Jrn Utzon, as an exemplary phenomenological  

E-Print Network [OSTI]

and technical innovation of the Sydney Opera House, that has come to define the iconic identity not only housing Sydney, Storebælt Suspension Bridge Denmark and the European Embassies of the European Union Abuja and Design, Aalborg University, Denmark Hon. Assoc. Prof. University of Sydney, Australia Director, Utzon

Hansen, René Rydhof

278

Tests for tissue residues of hormone-like substances fed for improvement of weight gains and market quality of poultry  

E-Print Network [OSTI]

(~as~ lg~&g J. "n~"~ lgh2). Infect af khiaarccil~ o ~ e ' . "ra~~ en . m'. at 4g cnd ~citron of Wturc geo~ Carcce . ". . zLt ~Ai s The fcedin? of dicnestrol Qccoteta h~ t e lity of cat~o raasters (Tc&lo 3). 2his irprav~t of ~mt ~~" i. =s ~parent...

Lane, Richard P

2012-06-07T23:59:59.000Z

279

Time of day modulates low-temperature Ca2+ Arabidopsis  

E-Print Network [OSTI]

-induced increases in cytosolic-free calcium ([Ca2þ ]cyt), and regulation of [Ca2þ ]cyt-dependent outputs of the LT: circadian, calcium, cold, guard cell, signalling. Introduction Circadian clocks synchronize plant physiology). Circadian control is believed to derive from several interlocking and autoinhibitory loops of gene

Haseloff, Jim

280

Physical causes and modeling challenges of anomalous diffusion of sediment tracers  

E-Print Network [OSTI]

Physical causes and modeling challenges of anomalous diffusion of sediment tracers Douglas Jerolmack Earth & Environmental Science, UPenn [sediment@sas.upenn.edu] "Bridging the Gap", Princeton U., 2" describable by: 1. Particle volume, v [L3 ]. 2.Average velocity, us , of bed load sediment [L/T]. 3. Surface

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Model of clustering of earthquakes  

Science Journals Connector (OSTI)

...unknown function a(t), we have a(0) = 0. Eqs. 5-7 can then be reduced to the following: a r-qo(a)= y a [9a] dFIG. 2. Shape of the phase trajectories and l(t). (A) T/q i1. C t Geophysics...

G. I. Barenblatt; V. I. Keilis-Borok; M. M. Vishik

1981-01-01T23:59:59.000Z

282

The morphology and histology of the alimentary canal and malpighian tubes of the adult of the boll weevil, Anthonomus grandis Boh. (Coleoptera: Curculionidae  

E-Print Network [OSTI]

of the cytoplasmic elements~ such as striated muscle, Xofinition of the Alisaatacy Canal? The ?lid:exAarg ~ of ths irmut c~ ba defined as that pLct of tho fnod tabs uhioh tcasscaee tbo body fccu the nunhh to tba anus? aon stating of the focoguh? %5lt&05. . 8$ ot...

Sundman, Jack Allen

1961-01-01T23:59:59.000Z

283

ACO%"%k%4%j%:%`$K$*$1$kItJ,2r$NMxMQK!$K$D$$ On the using of partial solutions in ACO algorithms  

E-Print Network [OSTI]

$h$&$K99?7$5$l!$t t + 1 $H$7$F%"%k%4%j%:%`$, 7+$jJV$5$l$k!% ij(t + 1) = · ij(t) + m k=1 ij,k ij,k = 1 Ck

Tsutsui, Shigeyoshi

284

100MHz Current Feedback Amplifier  

E-Print Network [OSTI]

O PPLICATI s Video Amplifiers s Buffers s IF and RF Amplification s Cable Drivers s 8-, 10-, 12-Bit products. The LT1223 is manufactured on Linear Technology's proprietary complementary bipolar process. Video Cable Driver Voltage Gain vs Frequency U A O PPLICATITYPICAL INV OUTV RG 1k RF 1k 75 75 CABLE 75

Lanterman, Aaron

285

Early Differentiation of Glucagon-Producing Cells in Embryonic Pancreas: A Possible Developmental Role for Glucagon  

Science Journals Connector (OSTI)

...1973) I I I I I a Proc. Nat. Acad. Sci. USA 70 (1973) wit~ * X ta A- -; ' `, -4PO lt -t :.- 4' I{ -, P...24. Grillo, T. A. I., Okuno, G., Guidotti, G., Price, S. & Foa, P. P. (1964) in The Structure and Metabolism...

Leslie B. Rall; Raymond L. Pictet; Robert H. Williams; William J. Rutter

1973-01-01T23:59:59.000Z

286

Cost-Effectiveness of Prophylactic Surgery for Duodenal Cancer in Familial Adenomatous Polyposis  

Science Journals Connector (OSTI)

...S. dollars using the medical care component of the Consumer Price Index (U.S. Bureau of Labor Statistics, 2007). Patient...Wellesley (MA): UpToDate; 2008. 22 Cahen DL , Fockens P, de Wit LT, Offerhaus GJ, Obertop H, Gouma DJ. Local resection or...

Wesley H. Greenblatt; Chin Hur; Amy B. Knudsen; John A. Evans; Daniel C. Chung; and G. Scott Gazelle

2009-10-01T23:59:59.000Z

287

SCHEDA OFFERTA DI STAGE/LAVORO: X STAGE (durata mesi: 6 mesi )  

E-Print Network [OSTI]

controllo, sistemi di home e building automation, Il/La tiocinante sarà inserito/a in stage per un periodo Products, Power Systems, Low Voltage Products, Process Automation, Discrete Automation and Motion. All: http://www.unipv.eu/on- line/Home/Didattica.html) X Studente/laureando X Laureato Tipo laurea X LT

Segatti, Antonio

288

Si diffusion and segregation in low-temperature grown GaAs K. L. Kavanagh and J. C. P. Chang  

E-Print Network [OSTI]

spectroscopy (SIMS) using a Cs ion beam, and cross-sectional transmission electron micros- copy (TEM) using- files from SIMS data for a three layer LT-GaAs sample after anneals at 9-00"C for 10, 30 (forming gas

Woodall, Jerry M.

289

Curved finite elements by the method of initial strains  

E-Print Network [OSTI]

, pp. 383-432. 2. Clough, R. W. , "Comparison of Three Dimensional Finite Elements, " Proceedin s of the S osium on A lication of Finite Element Mhd l. t''i~Et f, Vd6'ltUt ty, 1969, pp. 1-26. 3. Stricklin, J. A. , informal proposal submitted to Dr...

Leick, Roger Dale

1974-01-01T23:59:59.000Z

290

8:00-8:30 Registration. Coffee 8:30-9:50 Opening Session. Chair E. Elias, Technion. Greetings by  

E-Print Network [OSTI]

. Ronen (Ben-Gurion University) - Nuclear power plant resistance enhancement against projectile hits 15 nuclear accidents and nuclear terror 13:40-14:05 M. Markovits, R. Ashkenazi (IAEC) - Implementation of nuclear accidents 9:50-10:10 Coffee break 10:10 - 11:10 Session I, Chair Lt-Col. B. Brosh, Head, IDF Home

Rimon, Elon

291

RECORDS OF PROCEEDINGS AT MEETINGS:  

Science Journals Connector (OSTI)

......the actual rays or paths of energy from it to an external point...which equally could transmit energy without spreading, no energy travels, any of the other possible...admitted into the Society. The Auditor (Lt.-Col. A. Cunningham......

Records of Proceedings at Meetings

1921-01-01T23:59:59.000Z

292

RECORDS OF PROCEEDINGS AT MEETINGS:  

Science Journals Connector (OSTI)

......Cunningham was appointed Auditor. The Council and Officers...development of abnormal kinetic energy by light elastic ions, and...members. In the absence of the Auditor (Lt.-Col. Cunningham...to the Treasurer and to the Auditor. Mr. G. T. Bennett, as......

Records of Proceedings at Meetings

1917-01-01T23:59:59.000Z

293

Fact #722: April 9, 2012 Hybrid Vehicles Can Save Money over...  

Energy Savers [EERE]

Hybrid 4wd 2,175 21 1.9 1.5 9,254 Cadillac 2012 Escalade Premium Awd 15 Chevrolet 2013 Malibu Eco 545 29 2.3 1.8 1,842 Chevrolet 2012 Malibu 2LT 26 Toyota 2012 Camry Hybrid...

294

Tetrahedron Letters,Vo1.30,No.44,pp 5997-6000,1989 0040-4039/89 $3.00 + .oo Printed in Great Britain Pergamon Press plc  

E-Print Network [OSTI]

-alkoxy tin reagent 5.ltJ2 preparation of the copper lithium reagent of 5 followed by the addition resulted in the formation of the methyl acetal from the enol ether to give 9 (3:l mixture of anomers of the 1,3-dicarbonyl system with lithium diethylamide followed by treatment of the lithium species

295

Ris-M-2705 Metallurgy Department  

E-Print Network [OSTI]

-241. if review of neutron scattering techniques as a probe far studying sulk and dynamic ptvpeitus of defect between fast km motion ami defect structure, ate discussed. The scattering formahsm far diffraction a mgh fMMMWN neutron powderdifftaLtUMfacility. Tynufihnprocesser med RF-sputtering. (

296

@flI&rik (.0"_ y, J~ }Oi r:V/v< $ ~~2.~rOjectlColiectors:'~"""'l.---:J--=--l(!....II'-.t",.C+-_........=-.!-"-,,,..  

E-Print Network [OSTI]

;USA:NM: Socorro CoUi\\t'j1 fR ~~5j 54t1W} SI 3bKn1 LJ of SOCO\\tD.. 33°SLf"LtLf4 1\\)., l07°~B"7~-7W 1147

297

Economics in Film Professors: Dr. Naphtali Hoffman  

E-Print Network [OSTI]

Economics in Film Professors: Dr. Naphtali Hoffman Office:LT 912 Office Phone: (607) 735: This course is designed to achieve two goals: The first is to introduce students to economic problems, debates, and ideas. The second is to develop critical thinking skill by applying what you know of economics

Suzuki, Masatsugu

298

Optimal mass transportation and Mather theory Patrick Bernard and Boris Buffoni  

E-Print Network [OSTI]

dimensional linear programming problems. This have motivated a lot of activity around the interface between as a continuous cost function c(x, y) : M ? M - R. Given two probability measures µ0 and µ1 on M, the mappings and satisfies standard hypotheses recalled later, and define our cost by c(x, y) = min 1 0 L((t), (t), t

299

E-Print Network 3.0 - adult onset lung Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

for Advanced Bronchiectasis Don Hayes Jr., M.D., F.A.A.P., F.A.C.P., F.C.C.P.1... and Keith C. Meyer, M.D., M.S., F.A.C.P., F.C.C.P.2 ABSTRACT Lung transplant (LT) can be ......

300

UNREDUCED SYMMETRIC KKT SYSTEMS ARISING FROM ...  

E-Print Network [OSTI]

Jul 1, 2014 ... We conclude this section by recalling a few suitable preconditioners for ..... 3,T. K3,reg?3 = P?1. 3,T f3 can be writ- ten as. P?1. 3,T. LT[K2,reg. 0.

2014-07-01T23:59:59.000Z

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

LG: Order (2014-SE-15011)  

Broader source: Energy.gov [DOE]

DOE ordered LG Electronics USA, Inc. to pay a $1,479,860 civil penalty after finding LG had manufactured and distributed in commerce in the U.S. at least 7,438 units of basic model LT143CNR, a noncompliant room air conditioner.

302

Simulations of the effect of final state interactions on the scattering reponses of helium droplets  

E-Print Network [OSTI]

(i p, j p)+rzoz(i p, j p)vv2) if(rr. lt. rc) rr=rc dex=dex+findx(rr) rr=sqrt(rxy2(i p, j p)+(z-rp(j p, 3))vv2) if(rr. lt. rc) rr=rc dex=dex-findx(rr) endif continue cr=exp(0. 5edex) cc=cr?exp(uivse(hm*v(i d)/q-q))epsai(i d)/psai(1) ri(i b)=r1(i...(i p, j p)+rzoz(i p, j p)vv2) if(rr. lt. rc) rr=rc dex=dex+findx(rr) rr=sqrt(rxy2(i p, j p)+(z-rp(j p, 3))vv2) if(rr. lt. rc) rr=rc dex=dex-findx(rr) endif continue cr=exp(0. 5edex) cc=cr?exp(uivse(hm*v(i d)/q-q))epsai(i d)/psai(1) ri(i b)=r1(i...

Yang, Jian

2012-06-07T23:59:59.000Z

303

Efficiency Ratings for the Daiken AC (Americas), Inc.  

E-Print Network [OSTI]

Efficiency Ratings for the Daiken AC (Americas), Inc. Altherma Air-to-Water Source Heat Pump System Description Model No. Capacity (tons) Space Heating Space Cooling SEER Water Heating Efficiency (E.F.)1 CEC Listing Date Heating Combined Hydronic HSPF E.F. Split Altherma LT ERLQ036

304

Lund university | sweden engineering lth  

E-Print Network [OSTI]

E Sol Voltaics � solar cells made of nanowires E Glo � low-energy LEDs E Gasporox � gas analysis. In the field of new energy sources, for example solar cells, LEDs and thermoelectric ma- terials that works to understand, explain and improve our world and the human condition. 0 3 #12;4 #12;5fa c u lt y o

305

Utilization and evaluation of an indoxacarb-based granular bait (Advion) developed for the control of the red imported fire ant, Solenopsis invicta Buren (Hymenoptera: Formicidae)  

E-Print Network [OSTI]

â?¢ ultimately resulted in 98-99% RIFA colony mortality, which was significantly greater than the 87% colony mortality resulting from broadcast treatment with Amdro?®. The 6.2 d LT90 for label-rate broadcast treatment with Advionâ?¢ was nearly one half...

Furman, Barry D.

2007-09-17T23:59:59.000Z

306

Reprinted from Analytical Chemistry 1989,61, 1029. Copyright 0 1989by the American Chemical Society and reprinted by permission of the copyright owner.  

E-Print Network [OSTI]

Akos Vertes*** and Marc De Wolf Ignition in Laser Ionization Department of Chemistry, University of laser tonlxatlon: laser desorptlon and laser plasma lonlzation. Our threshold deflnftlon made lt possible to calculate threshold laser lrradiances for CO, ruby, and quadrupled Nd-YAG lasers

Vertes, Akos

307

Master of Science Thesis Stockholm, Sweden 2006  

E-Print Network [OSTI]

Master of Science Thesis Stockholm, Sweden 2006 COS/CCS 2006-10 R O L A N D W A LT E R S S O N demonstrator, som även kan visa resultaten från den nämnda forskningen. Prototypen, implementerad som en

Maguire Jr., Gerald Q.

308

Pazopanib, a Novel Multitargeted Kinase Inhibitor, Shows Potent In Vitro Antitumor Activity in Gastric Cancer Cell Lines with FGFR2 Amplification  

Science Journals Connector (OSTI)

...panel of 38 gastric cancer cell lines to test the efficacy of pazopanib. In a growth...Becton Dickinson) with a cell-cycle test software, ModFit LT (Verity Software...were performed using the two-sided chi 2 test or the Fisher exact test. Differences...

Seung Tae Kim; Hye-Lim Jang; Su Jin Lee; Jeeyun Lee; Yoon-La Choi; Kyoung-Mee Kim; Jeonghee Cho; Se Hoon Park; Young Suk Park; Ho Yeong Lim; Masakazu Yashiro; Won Ki Kang; Joon Oh Park

2014-11-01T23:59:59.000Z

309

Inositol pyrophosphate mediated pyrophosphorylation of AP3B1 regulates HIV-1 Gag release  

Science Journals Connector (OSTI)

...5 106 independent clones were screened. Positive clones were retransformed with the bait into AH109 and grown on SD-LT m edia (SD without leucine and tryptophan) to assess growth and in SD-LTHA ( SD without leucine, tryptophan, histidine, and adenine...

Cristina Azevedo; Adam Burton; Ezequiel Ruiz-Mateos; Mark Marsh; Adolfo Saiardi

2009-01-01T23:59:59.000Z

310

FROM  

Office of Legacy Management (LM)

t. IIk l Ser@ew of the Ai%daun M&&B Co*. Bm st., lt4lu Ymc, IbY. 9e m. maJg83, c7amma Ftadlum Bdl Ilbrus5ws carp., 6130 d)tE;r Avenue, Aew York, R. Ye i cot Qf tkk43 tpip wu tQ...

311

LAPPED TRANSFORMS Ricardo L. de Queiroz  

E-Print Network [OSTI]

LAPPED TRANSFORMS Ricardo L. de Queiroz Advanced Color Imaging Xerox Corporation queiroz@wrc.xerox.com 0.1 Introduction The idea of a lapped transform (LT, for short) maintaining orthogonality and non with the blocking artifacts so common in traditional block transform coding of images. The idea was to extend

de Queiroz, Ricardo L.

312

Development of a High-Temperature Diagnostics-While-Drilling Tool  

Broader source: Energy.gov [DOE]

This report documents work performed in the second phase of the Diagnostics-While-Drilling (DWD) project in which a high-temperature (HT) version of the phase 1 low-temperature (LT) proof-of-concept (POC) DWD tool was built and tested. Descriptions of the design, fabrication and field testing of the HT tool are provided.

313

Optical turbulence simulations at Mt Graham using the Meso-NH model  

Science Journals Connector (OSTI)

......hawaii.edu . 2 lt denotes Local Time. 3 Near the ground the...authors have also shown that the wind speed is uniform on a horizontal...of kilometres for h 1 km. The wind speed from analyses close to...Allis R. J., 2008, in Proc. WRF User Workshop, Estimating the......

S. Hagelin; E. Masciadri; F. Lascaux

2011-04-21T23:59:59.000Z

314

A model system for edible vaccination using recombinant avidin produced in corn seed  

E-Print Network [OSTI]

st a/. followed up this work in 1999 with a paper describing experiments comparing the adjuvanticity of LT mutants in mtranasal and oral routes of administration. Female BALB/c mice were given 10 lrg of keyhole-limpet hemocyanin (KLH...

Bailey, Michele Renee

2012-06-07T23:59:59.000Z

315

Lifetime of carbon capture and storage as a climate-change mitigation technology  

Science Journals Connector (OSTI)

...Poisson ratio [-] Geothermal gradient [L-1...Lt Width of well array [L] W...COLORADO NEW MEXICO MILES KILOMETERS0...Table C1] Geothermal gradient ( C...S15 Width of well array (km...temperature [ C] Ts 1 Geothermal gradient [ C...2 Width of well array W 0.1...

Michael L. Szulczewski; Christopher W. MacMinn; Howard J. Herzog; Ruben Juanes

2012-01-01T23:59:59.000Z

316

Pion-less Effective Field Theory on Low-Energy Deuteron Electro-Disintegration  

E-Print Network [OSTI]

In view of its relation to Big-Bang Nucleo-Synthesis and a reported discrepancy between nuclear models and data taken at S-DALINAC, electro-induced deuteron break-up 2H(e,e' p)n is studied at momentum transfer qelectric dipole currents and at NLO for magnetic ones converges order-by-order better than quantitatively predicted and contains no free parameter. It is at this order determined by simple, well-known observables. Decomposing the doubly differential cross-section into the longitudinal-plus-transverse (L+T), transverse-transverse (TT) and longitudinal-transverse interference (LT) terms, we find excellent agreement with a potential-model calculation by Arenh"ovel et al using the Bonn potential. Theory and data also agree well on \\sigma_{L+T}. There is however no space on the theory-side for the discrepancy of up to 30%, 3-\\sigma between theory and experiment in \\sigma_{LT}. From universality, we conclude that no theoretical approach with the correct deuteron asymptotic wave-function can explain the data. Un-determined short-distance contributions that could affect \\sigma_{LT} enter only at high orders, i.e. at the few-percent level. We notice some issues with the kinematics and normalisation of the data reported.

Stefan Christlmeier; Harald W. Griesshammer

2008-03-09T23:59:59.000Z

317

UUvvAA && VVUU  

E-Print Network [OSTI]

state science world by storm in the early 1990's when they exhibited changes in electrical resistance there is a single group with STS data on these systems, which are currently of great interest worldwide, and so the scene is set for Amsterdam to make a big impact. Crystal structure. LEED image. The new LT, UHV-STM. STM

318

Comparing Linear Microinstability of the National Compact Stellarator Expriment and a Shaped Tokamak  

SciTech Connect (OSTI)

One metric for comparing con nement properties of di erent magnetic fusion energy con gurations is the linear critical gradient of drift wave modes. The critical gradient scale length determines the ratio of the core to pedestal temperature when a plasma is limited to marginal stability in the plasma core. The gyrokinetic turbulence code GS2 was used to calculate critical temperature gradients for the linear, collisionless ion tem- perature gradient (ITG) mode in the National Compact Stellarator Experiment (NCSX) and a prototypical shaped tokamak, based on the pro les of a JET H-mode shot and the stronger shaping of ARIES-AT. While a concern was that the narrow cross section of NCSX at some toroidal locations would result in steep gradients that drive instabilities more easily, it is found that other stabilizing e ects of the stellarator con guration o set this so that the normalized critical gradients for NCSX are competitive with or even better than for the tokamak. For the adiabatic ITG mode, NCSX and the tokamak had similar critical gradients, though beyond marginal stability, NCSX had larger growth rates. However, for the kinetic ITG mode, NCSX had a higher critical gradient and lower growth rates until a/LT ?#25; 1:5 a/LT;crit, when it surpassed the tokamak's. A discussion of the results presented with respect to a/LT vs R/LT is included.

J.A. Baumgaertel, G.W. Hammett and D.R. Mikkelsen

2012-11-20T23:59:59.000Z

319

ENERGY EFFICIENT TCP Master's thesis: L. Donckers  

E-Print Network [OSTI]

ENERGY EFFICIENT TCP Master's thesis: L. Donckers CAES/002/01 May, 2001 University of Twente.J.M. Smit dr. ing. P.J.M. Havinga ir. L.T. Smit #12;#12;Energy Efficient TCP L. Donckers I SAMENVATTING Een presteren op meer traditionele punten: throughput en latency. #12;Energy Efficient TCP II #12;L. Donckers

Havinga, Paul J.M.

320

The simulation model Porsim Decision aid in pig production  

E-Print Network [OSTI]

The simulation model « Porsim » Decision aid in pig production O. TEFFENE Y. SALA?N LT.P., Domaine de la Motte-au- Vicomte, B.P. 3, 35650 Le Rheu France A pig production simulation model (Porsim

Boyer, Edmond

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

CREEL CENSUS AND EXPENDITURE STUDY, NORTH FORK SUN RIVER,  

E-Print Network [OSTI]

CREEL CENSUS AND EXPENDITURE STUDY, NORTH FORK SUN RIVER, MONTANA, 1951 Marine Biological STUDY, NORTH FORK SUN RIVER, MONTANA, 1951 Marine Biological Laboratory JUN16 1954 WOODS HOLE, MASS MAP CREEL CENSUS SUN RIVER MONTANA DRAWN i*^ ^ TRACED- _2£jLt:l SUBMITTED . 1 V N 01 1 VN ei

322

Angular dependence of metamagnetic transitions in HoNi{sub 2}B{sub 2}C  

SciTech Connect (OSTI)

Detailed measurements of M(2 K, H, {theta}) of HoNi{sub 2}B{sub 2}C, where {theta} is the angle that the applied field H makes with the [110] axis while remaining perpendicular to the crystallographic c axis, reveal three metamagnetic transitions with angular dependences H{sub c1}=(4.1{plus_minus}0.1 kG)/cos({theta}), H{sub c2}=8.4{plus_minus}0.2 kG/cos({phi}), and H{sub c3}=(6.6{plus_minus}0.2 kG)/sin({phi}), where {phi}={theta}{minus}45 is the angle from the [100] axis. The high-field saturated moment, M{sub sat}{approx}10{mu}{sub B}cos{theta} is consistent with the local moments being confined to the [110] direction. The locally saturated moments for fields between H{sub ci} (i=1,2,3) also manifest angular dependences that are consistent with combinations of local moments along [110] axes. Analysis of these data lead us to infer that the net distribution of moments is ({up_arrow}{down_arrow}{up_arrow}{down_arrow}{up_arrow}{down_arrow}) for H{lt}H{sub c1}, ({up_arrow}{up_arrow}{down_arrow}{up_arrow}{up_arrow}{down_arrow}) for H{sub c1}{lt}H{lt}H{sub c2}, ({up_arrow}{up_arrow}{r_arrow}{up_arrow}{up_arrow}{r_arrow}) for H{sub c2}{lt}H{lt}H{sub c3}, and ({up_arrow}{up_arrow}{up_arrow}{up_arrow}{up_arrow}{up_arrow}) for H{gt}H{sub c3}. {copyright} {ital 1997} {ital The American Physical Society}

Canfield, P.C.; Budko, S.L.; Cho, B.K. [Ames Laboratory and Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States)] [Ames Laboratory and Department of Physics and Astronomy, Iowa State University, Ames, Iowa 50011 (United States); Lacerda, A. [National High Magnetic Field Laboratory--Pulse Facility, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States)] [National High Magnetic Field Laboratory--Pulse Facility, Los Alamos National Laboratory, Los Alamos, New Mexico 87545 (United States); Farrell, D.; Johnston-Halperin, E. [Department of Physics, Case Western Reserve University, Cleveland, Ohio 44106 (United States)] [Department of Physics, Case Western Reserve University, Cleveland, Ohio 44106 (United States); Kalatsky, V.A.; Pokrovsky, V.L. [Department of Physics, Texas AM University, College Station, Texas 77843 (United States)] [Department of Physics, Texas AM University, College Station, Texas 77843 (United States)

1997-01-01T23:59:59.000Z

323

Probing Ligand Effects on the Redox Energies of [4Fe-4S] Clusters Using Broken-Symmetry Density Functional Theory  

SciTech Connect (OSTI)

A central issue in understanding redox properties of iron-sulfur proteins is determining the factors that tune the reduction potentials of the Fe-S clusters. Recently, Solomon and coworkers have shown that the Fe-S bond covalency of protein analogs measured by %L, the percent ligand character of the Fe 3d orbitals, from ligand K-edge X-ray absorption spectroscopy (XAS) correlates with the electrochemical redox potentials. Also, Wang and coworkers have measured electron detachment energies for iron-sulfur clusters without environmental perturbations by gas-phase photoelectron spectroscopy (PES). Here the correlations of the ligand character with redox energy and %L character are examined in [Fe?S?L?]2? clusters with different ligands by broken symmetry density functional theory (BS-DFT) calculations using the B3LYP functional together with PES and XAS experimental results. These gas-phase studies assess ligand effects independently of environmental perturbations and thus provide essential information for computational studies of iron-sulfur proteins. The B3LYP oxidation energies agree well with PES data, and the %L character obtained from natural bond orbital analysis correlates with XAS values, although it systematically underestimates them because of basis set effects. The results show that stronger electron-donating terminal ligands increase %Lt, the percent ligand character from terminal ligands, but decrease %Sb, the percent ligand character from the bridging sulfurs. Because the oxidized orbital has significant Fe-Lt antibonding character, the oxidation energy correlates well with %Lt. However, because the reduced orbital has varying contributions of both Fe-Lt and Fe-Sb antibonding character, the reduction energy does not correlate with either %Lt or %Sb. Overall, BSDFT calculations together with XAS and PES experiments can unravel the complex underlying factors in the redox energy and chemical bonding of the [4Fe-4S] clusters in iron-sulfur proteins.

Niu, Shuqiang; Ichiye, Toshiko

2009-05-14T23:59:59.000Z

324

Experimental investigation of the 100 keV X-ray dose response of the high-temperature thermoluminescence in LiF:Mg,Ti (TLD-100): theoretical interpretation using the unified interaction model  

Science Journals Connector (OSTI)

......measured from 1 to 50 000 Gy using 100 keV X rays at the European Synchroton Radiation Facility. Glow curves were deconvoluted into component...from 1 to 50,000 Gy using 100 keV X rays at the European Synchroton Radiation Facility. Glow curves were deconvoluted into component......

J. Livingstone; Y. S. Horowitz; L. Oster; H. Datz; M. Lerch; A. Rosenfeld; A. Horowitz

2010-03-01T23:59:59.000Z

325

Dose-Response Effect of Charged Carbon Beam on Normal Rat Retina Assessed by Electroretinography  

SciTech Connect (OSTI)

Purpose: To compare the effects of carbon beam irradiation with those of proton beam irradiation on the physiology of the retina of rats. Methods and Materials: Eight-week-old Wister rats were used. The right eyes were irradiated with carbon beam (1, 2, 4, 8, and 16 Gy) or proton beam (4, 8, 16, and 24 Gy) with the rats under general anesthesia. Electroretinograms were recorded 1, 3, 6, and 12 months after the irradiation, and the amplitudes of the a and b waves were compared with those of control rats. Results: The amplitude of b waves was reduced more than that of a waves at lower irradiation doses with both types of irradiation. With carbon ion irradiation, the amplitudes of the b wave were significantly reduced after radiation doses of 8 and 16 Gy at 6 months and by radiation doses of 4, 8, and 16 Gy at 12 months. With proton beam irradiation, the b-wave amplitudes were significantly reduced after 16 and 24 Gy at 6 months and with doses of 8 Gy or greater at 12 months. For the maximum b-wave amplitude, a significant difference was observed in rats irradiated with carbon beams of 4 Gy or more and with proton beams of 8 Gy or more at 12 months after irradiation. Conclusions: These results indicate that carbon beam irradiation is about two times more damaging than proton beam irradiation on the rat retina at the same dose.

Mizota, Atsushi, E-mail: mizota-a@med.teikyo-u.ac.j [Department of Ophthalmology, Teikyo University School of Medicine, Tokyo (Japan); Department of Ophthalmology, Juntendo University Urayasu Hospital, Urayasu (Japan); Tanaka, Minoru [Department of Ophthalmology, Juntendo University Urayasu Hospital, Urayasu (Japan); Kubota, Mariko; Negishi, Hisanari [Department of Ophthalmology, National Hospital Organization Chiba Medical Center, Chiba (Japan); Watanabe, Emiko [Department of Ophthalmology, Teikyo University School of Medicine, Tokyo (Japan); Tsuji, Hiroshi; Miyahara, Nobuyuki; Furusawa, Yoshiya [National Institute of Radiological Sciences, Chiba (Japan)

2010-12-01T23:59:59.000Z

326

Angiotensin Converting Enzyme Inhibitors Mitigate Collagen Synthesis Induced by a Single Dose of Radiation to the Whole Thorax  

Science Journals Connector (OSTI)

......pneumonitis after whole-thoracic irradiation (WTI) even when therapy is started up to one...compared to those of animals receiving 13 Gy WTI alone. Based upon directives from the IACUC...after 13 Gy whole- thoracic irradiation (WTI). Drugs were started 1 week after irradia......

Lakhan Kma; Feng Gao; Brian L. Fish; John E. Moulder; Elizabeth R. Jacobs; Meetha Medhora

2012-01-01T23:59:59.000Z

327

Effects of High Dietary Iron and Gamma Radiation on Oxidative Stress and Bone  

E-Print Network [OSTI]

. Male Sprague-Dawley rats (15-weeks old, n=32) were randomized to receive an adequate (45 mg Fe/kg diet) or high (650 mg Fe/kg diet) Fe diet for 4 weeks and either 3 Gy (8 fractions, 0.375 Gy each) of 137Cs radiation (?RAD) or sham exposure every other...

Yuen, Evelyn P

2013-04-19T23:59:59.000Z

328

New Centers and Training Programs atNew Centers and Training Programs at the interface of nanotechnology and  

E-Print Network [OSTI]

on integration of nanotechnology and biology/medicine � World Fastest Transistor Transistor Laser 2 g p g gy gy of nanotechnology and biology Rashid Bashir Electrical and Computer Engineering & Bioengineeringp g g g g Director, Micro and Nanotechnology Laboratory University of Illinois at Urbana-Champaign, IL. USA 1 #12;Micro

Bashir, Rashid

329

Inhibition of Potential Lethal Damage Repair and Related Gene Expression after Carbon-ion Beam Irradiation to Human Lung Cancer Grown in Nude Mice  

Science Journals Connector (OSTI)

......Gy for X-ray and 5 Gy for car- bon-ion beam because each...after exposure to X-ray or car- bon-ion beams was reported...GCAGCCGCTATTACCGTATC TGTGCCAGTGTCATCATCAA Genes defective in diseases associated with...after exposure to X-ray or car- bon-ion beams has been observed......

Tomoyasu Yashiro; Kumiko Koyama-Saegusa; Takashi Imai; Takehiko Fujisawa; Tadaaki Miyamoto

2007-09-01T23:59:59.000Z

330

Cell cycle responses to low-dose ionizing radiation.  

Science Journals Connector (OSTI)

...47, 2006] 5178 Low-dose hyper-radiosensitivity...radiosensitivity of cells to doses of ionizing radiation less than 0.5 Gy...connection between low-dose HRS survival, Ataxia...the low dose radiation range (0-1 Gy). MR4 cells...

Sarah A. Krueger; George D. Wilson; Michael C. Joiner; and Brian Marples

2006-04-15T23:59:59.000Z

331

Ionizing Radiation-induced, Mitochondria-dependent Generation of Reactive Oxygen/Nitrogen  

Science Journals Connector (OSTI)

...exposing cells to ionizing radiation. In the 1-10 Gy dose range, the amount...demonstrated that ionizing radiation in the therapeutic dose range stimulates a...exposing cells to ionizing radiation. In the 1-10 Gy dose range, the amount...

J. Kevin Leach; Glenn Van Tuyle; Peck-Sun Lin; Rupert Schmidt-Ullrich; and Ross B. Mikkelsen

2001-05-15T23:59:59.000Z

332

Activation of mitogen-activated protein kinase pathway by extremely low-dose ionizing radiation  

Science Journals Connector (OSTI)

X-ray irradiation at very low doses, between 2 and 5 cGy, stimulated activity of a member of the mitogen-activated protein (MAP) kinase, the extracellular signal-regulated kinase (ERK) 1/2 in normal human diploid cells. Higher doses of irradiation at more than 1 Gy induced phosphorylation of ERK1/2 and accumulated p53 protein. Phosphorylation of ERK1/2 decreased with doses down to 50 cGy, however, doses of between 2 and 5 cGy phosphorylated ERK1/2 as efficiently as higher doses of X-rays, while the p53 protein level was no longer changed by doses below 50 cGy. Ataxia telangiectasia-mutated (ATM)-dependent phosphorylation of p53 protein at Ser15 and histone H2AX at Ser139 was only observed at higher doses of more than 10 cGy of X-rays. We found that the MEK1 inhibitor, PD98059, and the specific epidermal growth factor receptor tyrosine kinase inhibitor, AG1478, decreased phosphorylation of the ERK1/2 proteins induced by 2 cGy or 6 Gy of X-rays. These results indicate that a limited range of low-dose ionizing radiation differentially activates ERK1/2 kinases via activation of the epidermal growth factor receptor and MAP kinaseERK kinase, which mediates various effects of cells receiving very low doses of ionizing radiation.

Keiji Suzuki; Seiji Kodama; Masami Watanabe

2003-01-01T23:59:59.000Z

333

p53-Mediated Regulation of Proliferating Cell Nuclear Antigen Expression in Cells Exposed to Ionizing Radiation  

Science Journals Connector (OSTI)

...exposed to increasing doses of IR at 24 h posttransfection...cellular response to ionizing radiation in which p53-mediated...IR at 12 Gy, a dose that induced maximal...the 1- to 4-Gy range does not effectively...because a high radiation dose is used and the...

Jin Xu; Gilbert F. Morris

1999-01-01T23:59:59.000Z

334

Inactivation of 14-3-3? Influences Telomere Behavior and Ionizing Radiation-Induced Chromosomal Instability  

Science Journals Connector (OSTI)

...per dish was chosen to ensure that about 50 colonies would survive a particular radiation dose treatment. Cells were exposed to ionizing radiation in the dose range of 0 to 8 Gy at room temperature using a 137Cs ray at a dose rate of 1.1 Gy...

Sonu Dhar; Jeremy A. Squire; M. Prakash Hande; Raymund J. Wellinger; Tej K. Pandita

2000-10-01T23:59:59.000Z

335

Secondary neutron doses in proton therapy treatments of ocular melanoma and craniopharyngioma  

Science Journals Connector (OSTI)

......as the non-treated eye, the healthy brain tissue etc. and these should be taken...Non-treated eye 11.42 10.64 121.5 Brain 4.55 8.09 36.8 Thyroid 3.33 8...neutron absorbed doses received by the brain (1.5 microGy Gy1) and three times lower......

J. Farah; R. Sayah; F. Martinetti; L. Donadille; V. Lacoste; J. Hrault; S. Delacroix; C. Nauraye; I. Vabre; C. Lee; W. E. Bolch; I. Clairand

2014-10-01T23:59:59.000Z

336

Dosimetric performance evaluation regarding proton beam incident angles of a lithium-based AB-BNCT design  

Science Journals Connector (OSTI)

......suitable for the treatments of deep-seated brain tumours, such as glioblastoma multiforme...large energy deposition in the skin and the brain surface. The use of beryllium target with...60.0 RBE-Gy, (e) maximum healthy brain dose 12.5 RBE-Gy and (f) maximum......

Pei-Yi Lee; Yuan-Hao Liu; Shiang-Huei Jiang

2014-10-01T23:59:59.000Z

337

AFRRI Form 331 (12/2007) Page 1 of 6Patient's service number: Biodosimetry Worksheet  

E-Print Network [OSTI]

) Estimated time post-exposure (h) Dose (Gy) Reference radiation quality and dose rate (Gy/min) Time onset Record of Radiation Dose, Contamination, and Acute Radiation Sickness Response) Reporting Authority-mail: Country of origin: Date dose assessed (yymmdd): Time dose assessed: Place: Nature of exposure: radiation

338

The Estimation of Molecular and Cytogenetic Effects in Mice Exposed to Chronic Low Dose-Rate Gamma-Radiation  

Science Journals Connector (OSTI)

Molecular and cytogenetic parameters were estimated in male CBA/lac mice exposed to chronic low dose-rate ?-radiation (62 cGy/year) for 40, 80, 120, 210, and 365 days. After 40 days of exposure (6.7 cGy), sple...

A. N. Osipov; A. L. Elakov; P. V. Puchkov

2002-10-01T23:59:59.000Z

339

Lack of Radiation Maculopathy After Palladium-103 Plaque Radiotherapy for Iris Melanoma  

SciTech Connect (OSTI)

Purpose: To report on the risk of radiation maculopathy for iris and iridociliary melanomas treated by {sup 103}Pd plaque radiotherapy. Methods and Materials: This is a retrospective clinical case series of 30 eyes in 30 patients with melanomas limited to the iris or invading the ciliary body. The main outcome measures included demographic information, laterality, tumor size, location, visual acuity, radiation dose, local control, retinal evaluation, and duration of follow-up. Results: Thirty patients were followed for a median 36 months (range, 12-90 months). Sixteen of 30 tumors (53%) were pure iris melanomas, and 14 (47%) were primary iris melanomas extending into the ciliary body. Radiation dosimetry showed that the median tumor apex dose was 85 Gy (range, 75-100 Gy), lens dose 43.5 Gy (range, 17.8-60 Gy), fovea dose 1.8 Gy (range, 1.3-5 Gy), and central optic disc dose 1.7 Gy (range, 1.3-4.7 Gy). Cataracts developed in 20 of the 28 phakic eyes (71.4%). No patient in this series developed radiation maculopathy or radiation optic neuropathy. Last best-corrected visual acuity was {>=}20/25 in 28 patients (93%) at a median 36 months' follow-up. Conclusion: Though visual acuities were transiently affected by radiation cataract, no radiation maculopathy or optic neuropathy has been noted after {sup 103}Pd treatment of iris and iridociliary melanomas.

Yousef, Yacoub A. [New York Eye Cancer Center, New York Eye and Ear Infirmary, and New York University School of Medicine, New York, NY (United States); Finger, Paul T., E-mail: pfinger@eyecancer.com [New York Eye Cancer Center, New York Eye and Ear Infirmary, and New York University School of Medicine, New York, NY (United States)

2012-07-15T23:59:59.000Z

340

ESI_CS_Zirkle 1.6.indd  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Zirkle Fruit case study ZIRKLE FRUIT Utility Benton PUD ProJect Refrigeration, compressed air, door, and lighting upgrades eNerGy SAViNGS 3,441,532 kWhy eNerGy coSt SAViNGS...

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Radiochromic film for medical radiation dosimetry Martin J. Butsona,b  

E-Print Network [OSTI]

Cheunga , Peter Metcalfeb a Department of Physics and Materials Science, City University of Hong Kong, Tat, which have accurate dose measurement ranges from less than 1 Gy up to many kGy. A relatively energy independent dose response combined with automatic development of radiochromic film products has made

Yu, K.N.

342

SCH66336 (Sarasar), an oral farnesyl transferase inhibitor, synergizes with temozolomide and radiation therapy for orthotopic malignant gliomas  

Science Journals Connector (OSTI)

...completed prior to and at RT completion, and skin toxicity was assessed at week 3 and RT completion. We recorded patient demographics, body mass index (BMI), disease and treatment...Gy + 10 Gy boost. At RT completion, all patients had ST...

Jessica W. Barnes; Claire Sauvageot; Naren Ramakrishna; Jamie L. Dellagatta; Deviney Chaponis; Patrick Wen; Charles Stiles; Andrew Kung; and Mark W. Kieran

2006-04-15T23:59:59.000Z

343

Prospective Studies of Body Mass Index with Head and Neck Cancer Incidence and Mortality  

Science Journals Connector (OSTI)

...completed prior to and at RT completion, and skin toxicity was assessed at week 3 and RT completion. We recorded patient demographics, body mass index (BMI), disease and treatment...50 Gy 10 Gy boost. At RT completion, all patients had ST...

Mia M. Gaudet; Alpa V. Patel; Juzhong Sun; Janet S. Hildebrand; Marjorie L. McCullough; Amy Y. Chen; and Susan M. Gapstur

2012-03-01T23:59:59.000Z

344

Gene Expression Analysis of Apoptosis and Oxidative Stress in Mouse Brain  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Analysis of Apoptosis and Oxidative Stress in Mouse Brain Analysis of Apoptosis and Oxidative Stress in Mouse Brain After Low-dose and Acute Radiation Exposure Daila Gridley Loma Linda University & Medical Center Abstract Purpose: 1) To examine the induction of oxidative stress and apoptosis-associated gene expression profiles in brain after whole-body irradiation with low-dose/low-dose-rate (LDR) photons and acute exposure to photons 2) to compare these radiation-induced effects with those produced by LDR and acute exposure to protons. Material and Methods: C57BL/6 mice were exposed to 2 Gy of photons or protons at 0.8 Gy/min and 0.9 Gy/min, respectively, both with and without pre-exposure to 0.01 Gy LDR γ-rays (57Co) at 0.03 cGy/h. Brain tissues were harvested and quick-frozen for analyses by quantitative RTPCR at 56

345

Weekly Dose-Volume Parameters of Mucosa and Constrictor Muscles Predict the Use of Percutaneous Endoscopic Gastrostomy During Exclusive Intensity-Modulated Radiotherapy for Oropharyngeal Cancer  

SciTech Connect (OSTI)

Purpose: To define predictors of percutaneous endoscopic gastrostomy (PEG) use during intensity-modulated radiotherapy (IMRT) for oropharyngeal cancer. Methods and Materials: Data for 59 consecutive patients treated with exclusive IMRT at a single institution were recovered. Of 59 patients, 25 were treated with hyperfractionation (78 Gy, 1.3 Gy per fraction, twice daily; 'HYPER'); and 34 of 59 were treated with a once-daily fractionation schedule (66 Gy, 2.2 Gy per fraction, or 70 Gy, 2 Gy per fraction; 'no-HYPER'). On the basis of symptoms during treatment, a PEG tube could have been placed as appropriate. A number of clinical/dosimetric factors, including the weekly dose-volume histogram of oral mucosa (OM DVHw) and weekly mean dose to constrictors and larynx, were considered. The OM DVHw of patients with and without PEG were compared to assess the most predictive dose-volume combinations. Results: Of 59 patients, 22 needed a PEG tube during treatment (for 15 of 22, {>=}3 months). The best cutoff values for OM DVHw were V9.5 Gy/week <64 cm{sup 3} and V10 Gy/week <54 cm{sup 3}. At univariate analysis, fractionation, mean weekly dose to OM and superior and middle constrictors, and OM DVHw were strongly correlated with the risk of PEG use. In a stepwise multivariate logistic analysis, OM V9.5 Gy/week ({>=}64 vs. <64 cm{sup 3}) was the most predictive parameter (odds ratio 30.8, 95% confidence interval 3.7-254.2, p = 0.0015), confirmed even in the no-HYPER subgroup (odds ratio 21, 95% CI 2.1 confidence interval 210.1, p = 0.01). Conclusions: The risk of PEG use is drastically reduced when OM V9.5-V10 Gy/week is <50-60 cm{sup 3}. These data warrant prospective validation.

Sanguineti, Giuseppe, E-mail: gsangui1@jhmi.ed [Department of Radiation Oncology, University of Texas Medical Branch, Galveston, TX (United States); Department of Radiation Oncology and Molecular Radiation Sciences, Johns Hopkins University, Baltimore, MD (United States); Gunn, G. Brandon; Parker, Brent C.; Endres, Eugene J. [Department of Radiation Oncology, University of Texas Medical Branch, Galveston, TX (United States); Zeng Jing [Department of Radiation Oncology and Molecular Radiation Sciences, Johns Hopkins University, Baltimore, MD (United States); Fiorino, Claudio [Department of Medical Physics, San Raffaele Scientific Institute, Milano (Italy)

2011-01-01T23:59:59.000Z

346

Low Dose Suppression of Neoplastic Transformation in Vitro  

SciTech Connect (OSTI)

This grant was to study the low dose suppression of neoplastic transformation in vitro and the shape of the dose-response curve at low doses and dose-rates of ionizing radiation. Previous findings had indicated a suppression of transformation at dose <10cGy of low-LET radiation when delivered at high dose-rate. The present study indicates that such suppression extends out to doses in excess of 100cGy when the dose (from I-125 photons) is delivered at dose-rates as low as 0.2 mGy/min and out to in excess of {approx}25cGy the highest dose studied at the very low dose-rate of 0.5 mGy/day. We also examined dose-rate effects for high energy protons (which are a low-LET radiation) and suppression was evident below {approx}10cGy for high dose-rate delivery and at least out to 50cGy for low dose-rate (20cGy/h) delivery. Finally, we also examined the effect of low doses of 1 GeV/n iron ions (a high-LET radiation) delivered at high dose-rate on transformation at low doses and found a suppression below {approx}10cGy that could be attributable to an adaptive response in bystander cells induced by the associated low-LET delta rays. These results have implications for cancer risk assessment at low doses.

John Leslie Redpath

2012-05-01T23:59:59.000Z

347

Dose-Effect Relationships for the Submandibular Salivary Glands and Implications for Their Sparing by Intensity Modulated Radiotherapy  

SciTech Connect (OSTI)

Purpose: Submandibular salivary glands (SMGs) dysfunction contributes to xerostomia after radiotherapy (RT) of head-and-neck (HN) cancer. We assessed SMG dose-response relationships and their implications for sparing these glands by intensity-modulated radiotherapy (IMRT). Methods and Materials: A total of 148 HN cancer patients underwent unstimulated and stimulated SMG salivary flow rate measurements selectively from Wharton's duct orifices, before RT and periodically through 24 months after RT. Correlations of flow rates and mean SMG doses were modeled throughout all time points. IMRT replanning in 8 patients whose contralateral level I was not a target incorporated the results in a new cost function aiming to spare contralateral SMGs. Results: Stimulated SMG flow rates decreased exponentially by (1.2%){sup Gy} as mean doses increased up to 39 Gy threshold, and then plateaued near zero. At mean doses {<=}39 Gy, but not higher, flow rates recovered over time at 2.2%/month. Similarly, the unstimulated salivary flow rates decreased exponentially by (3%){sup Gy} as mean dose increased and recovered over time if mean dose was <39 Gy. IMRT replanning reduced mean contralateral SMG dose by average 12 Gy, achieving {<=}39 Gy in 5 of 8 patients, without target underdosing, increasing the mean doses to the parotid glands and swallowing structures by average 2-3 Gy. Conclusions: SMG salivary flow rates depended on mean dose with recovery over time up to a threshold of 39 Gy. Substantial SMG dose reduction to below this threshold and without target underdosing is feasible in some patients, at the expense of modestly higher doses to some other organs.

Murdoch-Kinch, Carol-Anne [Department of Oral Medicine/Hospital Dentistry, University of Michigan, Ann Arbor, MI (United States); Kim, Hyugnjin M. [Department of Biostatistics, University of Michigan, Ann Arbor, MI (United States); Vineberg, Karen A. [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States); Ship, Jonathan [Department of Oral Medicine/Hospital Dentistry, University of Michigan, Ann Arbor, MI (United States); Eisbruch, Avraham [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States)], E-mail: eisbruch@umich.edu

2008-10-01T23:59:59.000Z

348

l!Jm~~Ut~'1CV GrandChalienge",regardiessexl,'Cpt  

Broader source: Energy.gov (indexed) [DOE]

,;,,,,,..<:,,) ,;,,,,,..&lt;:,,) l!Jm~~Ut~'1CV GrandChalienge",regardiessexl,'Cpt tiide'rnJtlrsuant toP.,L 96-511,'asamended, and Natiunal i11lcnsifi.catiol1 capabHffies which yield.amatic cn~gf to a wide range chemical producti()n~ iB) High,. of stich inod refining, non.cmctallic.materials ·IKi[tHtle!tm4;ti. l't.~"<.4 u.an'~:1:;f:) .1.'<1 conventi onal hi gh jeat.!,\iltnillnl·l'AiJ1l~illl~t!l Recvvery - .... ,·"", :l~IWtlra.,;:c~ftjcjtl\tl'tsteaJn.PJtlfYd!uctio}jti!hilgh perr~lanceJllmacesand 5ustainability7 reduced ""liter and a carbQn t(lOtprint li)f indt.t,'}try; (D) Sustainable Manufacturing

349

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

8 8 Southern California Gas Co ..................... CA 269,739,909 7.31 Pacific Gas and Elec Co........................... CA 224,402,286 6.32 Northern Illinois Gas Co ........................... IL 196,608,329 4.63 Consumers Pwr Co .................................. MI 153,128,350 4.92 Columbia Gas Dist Co.............................. OH,KY,PA,MD 138,064,908 7.21 Pub Svc Elec and Gas Co........................ NJ 126,142,540 6.61 Michigan Consol Gas Co.......................... MI 125,456,377 5.35 East Ohio Gas Co .................................... OH 117,574,196 6.21 Peoples Gas Lt and Coke Co................... IL 89,685,006 6.81 Atlanta Gas Lt Co ..................................... GA 89,103,601 6.69 Lone Star Gas Co..................................... TX 84,559,915 5.95 Brooklyn Union Gas Co............................ NY

350

Northern Illinois Gas Co IL  

Gasoline and Diesel Fuel Update (EIA)

Northern Northern Illinois Gas Co ............................ IL 254,574,988 4.60 Southern California Gas Co ...................... CA 233,632,354 6.89 Columbia Gas Dist Co............................... OH,KY,PA,MD 196,322,935 6.64 Pacific Gas and Elec Co............................ CA 190,864,262 5.83 Consumers Pwr Co ................................... MI 188,587,672 4.81 Michigan Consol Gas Co........................... MI 160,809,168 5.16 East Ohio Gas Co ..................................... OH 146,802,045 5.44 Pub Svc Elec and Gas Co......................... NJ 140,712,209 6.62 Peoples Gas Lt and Coke Co.................... IL 126,356,925 6.40 Brooklyn Union Gas Co............................. NY 106,349,594 9.43 Atlanta Gas Lt Co ...................................... GA 106,075,815 6.66 Lone Star Gas Co......................................

351

SB Electronics Breaks Ground on New Factory | Department of Energy  

Broader source: Energy.gov (indexed) [DOE]

SB Electronics Breaks Ground on New Factory SB Electronics Breaks Ground on New Factory SB Electronics Breaks Ground on New Factory April 29, 2010 - 5:22pm Addthis U.S. Rep. Peter Welch (from left), Vermont Lt. Gov. Brian Dubie, SBE board member Win Hunter, SBE board chair Stan Fishkin, Assi U.S. Rep. Peter Welch (from left), Vermont Lt. Gov. Brian Dubie, SBE board member Win Hunter, SBE board chair Stan Fishkin, Assi Paul Lester Communications Specialist, Office of Energy Efficiency and Renewable Energy A Vermont company broke ground on a new factory that will produce cutting-edge technology for electric and hybrid cars and create more than 100 jobs. The event ushering in SB Electronics' power ring capacitor facility in Barre was attended by Vermont Gov. Jim Douglas and federal, state and local

352

Jefferson Lab Science Series - Einstein for Everyone  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

The Restoration of the USS Monitor The Restoration of the USS &lt;i>Monitor<;/i> Previous Video (The Restoration of the USS Monitor) Science Series Video Archive Next Video (The Mysterious Universe) The Mysterious Universe Einstein for Everyone Dr. Robert Piccioni October 5, 2010 Young Einstein was a rebel who seemed doomed to fail. How did he overcome rejection to become the most famous scientist in history? We will discuss and explain all his theories in plain English and without math, and we will discover how Einstein's achievements impact our lives through DVDs, GPS, iPods, computers and green energy. Is the space above this area blank? If so, there may be a problem loading the embedded version of the video from YouTube. Either their server is having issues or your school is actively blocking access to YouTube. If

353

CATEGORICAL EXCLUSION (CX) DETERMINATION BRIEF DESCRIPTION OF PROPOSED ACTION:  

Broader source: Energy.gov (indexed) [DOE]

'u ", lt~Fs::::N 'u ", lt~Fs::::N CATEGORICAL EXCLUSION (CX) DETERMINATION BRIEF DESCRIPTION OF PROPOSED ACTION: Southwestern Power Administration proposes to construct a maintenance garage for heavy vehicles and equipment at the Springfield, Missouri facility. PROPOSED BY: Southwestern Power Administration- U.S. Dept. of Energy DATE: December 7,2010 NUMBERS AND TITLES OF THE CATEGORICAL EXCLUSIONS BEING APPLIED: 10 CFR 1021, Appendix B to Subpart D, Part B1.15- Siting, construction or modification of support structures within or contiguous to an already developed area. REGULATORY REQUIREMENTS IN 10 CFR 1021.410(B): (1) The proposed action fits within a class of actions that is listed in Appendix A & B to Subpart D. For classes of action listed in Appendix A or B, the following conditions are integral elements, i.e., to fit within a class, the

354

2013 APS SLAC Site Office. pdf  

Broader source: Energy.gov (indexed) [DOE]

E!L ;L E!L ;&lt;C9DF@&lt;AGL B>L  !"# ,%!"L ,@.D>AE .343L-.;1E&365E ,>.1E (- #"E )2<9=E +.@4E $"E 51&.3L FBZH; M]r ]{ 6! 4125 QOSWBRG[O ISW< Mv~axg B0 O_D{a]{ Fax  Fi|a_v| bv| Iian` Sxa{]ivr~ Sbbi_a vb Y_iar_a IWSO= U] n Jvn]r @ Yia O]r]ea| YNBE Yia Sbbi_a Y[DMHEZ> Brr ]n R]ivr]o Hr i{vsqar]n Uvni_ B_ RHUB Un]rrirf

355

WASH-  

Office of Legacy Management (LM)

rcc.p,anc. 01 thts arf~cle. tha rcc.p,anc. 01 thts arf~cle. tha yubl~rhe, "r ~u~~iunl riknouu~adqnS the U.S. C;ov.rnmmnf' s rayhr (0 retam l nOn*aClulive.roy~ltV (r-0 ltconso In ma IO Dny Copvrlqhl WASH- covrrm~ the wtvdo. ISADIOLOGICAL SURVEY OF THE SEAWAY INDUSTRIAL PARK W . D. Cottrell, R. W . Leggett and H. W . Dickson Health Physics Division, Oak Ridge National Laboratory Oak Ridge, Tennessee 37830 December 1976 CONTENTS l&t of Tab1 es - . . . List of Illustrations . . Abstract . . . . . . Introduction . . . . ............ ............ ............ ............ Radiological Survey Techniques . . . . . . 1 . . Measurement of External Gamma and Beta-Gamma Radiation Levels . . . . . . . . . . . . Measurement of Radium in the Soil . . . . . . Measurement of Radioactivity in Surface Water

356

P"l.t!, U.S. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER  

Broader source: Energy.gov (indexed) [DOE]

l.t!, l.t!, U.S. DEPARTMENT OF ENERGY EERE PROJECT MANAGEMENT CENTER NEPA DETElUlINATION RECIPIENT:WI State Energy Office PROJECT TITLE: PY2012 State Energy Program - formula Grant Page 1 of2 STATE: WI Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-OOOO643 DE-F26-07NT43169 GF0-0005465-013 Based on my review orlhe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45 1.1A), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A11 Technical advice and assistance to organizations A9 Information gathering, analysis, and dissemination Rational for delenninalion: Technical advice and planning assistance to international, naUonal, slate, and local organizations.

357

ESS 2012 Peer Review - PV Plus Storage for Simultaneous Voltage Smoothing and Peak Shifting - Steve Willard, PNM  

Broader source: Energy.gov (indexed) [DOE]

Mexico (PNM) - Mexico (PNM) - PV Plus Storage for Simultaneous Voltage PV Plus Storage for Simultaneous Voltage Smoothing and Peak Shifting DOE Peer Review Steve Willard, P.E. September 26, 2012 Project Goals - Develop an even more Beneficial Renewable Resource - Transferable Nationwide Renewable Resource Transferable Nationwide *Created a dispatchable, renewables-based peaking resource *Combined PV and storage at a substation targeting 15% peak-load reduction D t ti bi ti th t i lt l iti t lt l l *Demonstrating a combination that can simultaneously mitigate voltage-level fluctuations as well as enable load shifting *Developed power system models (baseline and projected), and cost/benefit economic models eco o c ode s *Generating, collecting, analyzing and sharing resultant data *Enabling distributed solutions that reduce GHG emissions through the

358

Microsoft Word - Response to AMPUA Questions_092011.docx  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sep 20, 2011, at 12:00 PM, "" wrote: Sep 20, 2011, at 12:00 PM, "&lt;mcurtis401@aol.com>" &lt;mcurtis401@aol.com> wrote: > Yes and the Western team has done a great job, spent tremendous amount of time & consideration & my questions are basically answered. Good job. Good presentation. If we have more questions we will write. > Michael Curtis > > -----Original Message----- > From: Debby Emler > To: mcurtis401 > Sent: Tue, Sep 20, 2011 8:45 am > Subject: Re: AMPUA Question-Wapa Consolidation and Cost Allocation Seminar > > Michael: Thank you for attending yesterday's cost allocation presentation. Thanks also to the others on this list that may have attended either in person or by phone.

359

Instrument Series: Microscopy Ultra-High Vacuum, Low- Temperature Scanning  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Low- Low- Temperature Scanning Probe Microscope EMSL's ultra-high vacuum, low-temperature scanning probe microscope instrument, or UHV LT SPM, is the preeminent system dedicated to surface chemistry and physics at low temperatures down to 5 K. Operating at low temperatures provides high mechanical stability, superior vacuum conditions, and negligible drift for long-term experiments. With thermal diffusion being entirely suppressed, stable imaging becomes possible even for weakly bound species. The system is primarily used for probing single-site chemical reactivity, while the combination with a hyperthermal molecular beam allows the study of important chemical processes at energies corresponding to the operational temperatures well beyond typical UHV studies. The LT SPM provides

360

C:\ANNUAL\VENTCHAP.V8\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

3 3 Northern Illinois Gas Co ........................... IL 241,353,299 5.25 Southern California Gas Co ..................... CA 237,581,205 7.28 Pacific Gas and Elec Co........................... CA 191,919,171 6.12 Consumers Pwr Co .................................. MI 178,690,154 4.80 Columbia Gas Dist Co.............................. OH,KY,PA,MD 178,512,589 7.64 Michigan Consol Gas Co.......................... MI 152,111,213 5.59 East Ohio Gas Co .................................... OH 147,197,186 6.36 Pub Svc Elec and Gas Co........................ NJ 138,404,765 7.58 Peoples Gas Lt and Coke Co................... IL 113,561,765 6.96 Lone Star Gas Co..................................... TX 100,079,759 6.13 Atlanta Gas Lt Co ..................................... GA 96,381,162 7.41 Brooklyn Union Gas Co............................

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

OpenEI Community - Datapalooza  

Open Energy Info (EERE)

class="form-item"> Description: A forum for engagement class="form-item"> &lt;label>Description: &lt;/label> A forum for engagement between Energy Datapalooza attendees and their collaborators To continue the "awesomeness" demonstrated on October 1st, 2012, this forum exists to provide a free and open exchange of ideas, datasets and technologies. Datapalooza EDI Energy data Open Data Mon, 01 Oct 2012 21:43:48 +0000 Ianjkalin 533 at http://en.openei.org/community White House Energy Datapalooza live on Whitehouse.gov http://en.openei.org/community/blog/white-house-energy-datapalooza-live-whitehousegov Today,

362

Investigation of the electromagnetic structure of. eta. and. eta. prime mesons by two-photon interactions  

SciTech Connect (OSTI)

The TPC/Two-Gamma facility at the SLAC {ital e}{sup +}{ital e}{sup {minus}} storage ring PEP was used to study the reactions {gamma}{gamma}{sup *}{r arrow}{eta} and {gamma}{gamma}{sup *}{r arrow}{eta}{prime}. The {eta}{gamma}{sup *}{gamma} and {eta}{prime}{gamma}{sup *}{gamma} transition form factors were measured as functions of {ital Q}{sup 2}, the negative of the invariant mass squared of the tagged photon, in the range 0.1{lt}{ital Q}{sup 2}{lt}7 GeV{sup 2}. These determinations of the electromagnetic structure of the {eta} and {eta}{prime} mesons are consistent with both vector-meson dominance and QCD. They also provide new measurements of the pseudoscalar mixing angle and decay constants.

Aihara, H.; Alston-Garnjost, M.; Avery, R.E.; Barbaro-Galtieri, A.; Barker, A.R.; Barnett, B.A.; Bauer, D.A.; Bay, A.; Bobbink, G.J.; Buchanan, C.D.; Buijs, A.; Caldwell, D.O.; Chao, H.; Chun, S.; Clark, A.R.; Cowan, G.D.; Crane, D.A.; Dahl, O.I.; Daoudi, M.; Derby, K.A.; Eastman, J.J.; Eberhard, P.H.; Edberg, T.K.; Eisner, A.M.; Erne, F.C.; Fairfield, K.H.; Hauptman, J.M.; Hofmann, W.; Hylen, J.; Kamae, T.; Kaye, H.S.; Kenney, R.W.; Khacheryan, S.; Kofler, R.R.; Langeveld, W.G.J.; Layter, J.G.; Lin, W.T.; Linde, F.L.; Loken, S.C.; Lu, A.; Lynch, G.R.; Madaras, R.J.; Magnuson, B.D.; Masek, G.E.; Mathis, L.G.; Matthews, J.A.J.; Maxfield, S.J.; Miller, E.S.; Moses, W.; Nygren, D.R.; Oddone, P.J.; Paar, H.P.; Park, S.K.; Pellett, D.E.; Pripstein, M.; Ronan, M.T.; Ross, R.R.; Rouse, F.R.; Schwitkis, K.A.; Sens, J.C.; Shapiro, G.; Shen, B.C.; Smith, J.R.; Steinman, J.S.; Stephens, R.W.; Stevenson, M.L.; Stork, D.H.; Strauss, M.G.; Sullivan, M.K.; Takahashi, T.; Toutounchi, S.; van Tyen, R.; TPC /Two-Gamma Collaboration

1990-01-08T23:59:59.000Z

363

Numerical solution of the linear least squares problem for splines  

E-Print Network [OSTI]

~ 0 and max a + 0 as k+1 s ss s ss * s knots converge to t , then K -+ ~. Since t' g x for all m, 24 ~t* ? x ~ & 0. Order the x so that x&x&' ~ '&x&t &x?''x 1 2 q q+1 Next suppose that t* lies in the interval [t. , t. ] for j' j+1 some j, 1...=lt J JP1ML = JPI-L VM = VNIKX(L)/{OELTAP(L) + OELTAM{ JP1ML) ) VNIKX(L ) = VM+OELTAP(L ) + VMPREV VMPRFV = VM+DELTAM(JPIML) VNIKX( JP1) = YMPREV J = JPI IF ( J . LT ~ JHIGH) FUNCTION BVALUE ( Te Ae Nt Kw Xt IDERIV ) CALCULATES VALUE AT +X...

Vonderhaar, Thomas Jerome

1975-01-01T23:59:59.000Z

364

The design of efficient input circuits for class C amplifiers  

E-Print Network [OSTI]

?XXXXXXXXXXXXXXXXXXXXXXXXXXX?? ??X ??o?? hen?in? c?o?ef? tiinf?s?sfg o? g?s rn?eo jis??sf?? linfd?eggsi X ? ? ? ? ? ? ? ? X X X X X X X ?? m?cl aj lt?m?c lt?m? ?n?s ?? uni?ofe? tfn??ded o? ?nien? linfd?oi?si XXXXXXXXXXXXXXXXXXXXXXXX ?? ??X ?snd?is? nf? ?n????ngs? a...?geof ???? ??????? l?s ?fdgeg?gs o? rn?eo ?f?efssidX jX ?X lsi?nf? ?rn?eo sf?efssief????? ???in? ue?? ?oo? ?o??nf?? ????X ??X mX ??siegg? ??a?ge??? o?singef? ?of?egeofd ?oi ??ndd ? n???e?esid?? ?io?ss?ef?d o? ?fdgeg?gs o? rn?eo ?f?efssid ??? ??? ??????X ??jX ?X...

Fristoe, Harold T.

2013-10-04T23:59:59.000Z

365

Optimization of operating parameters for the Texas A&M Variable Energy Cyclotron  

E-Print Network [OSTI]

'S Empirical C on st r aint: Fr Fr e quency De e Vo 1 tag e (Kilo v o lt s ) Main Coil (Amps) TCO'l: TC02: TC03: TC04: TC05: TC06: TC07: TC08: TC09: TC10: TC11: TC12: TC13: TC14: TC15: TC16: TC17: ee Voltage equency; D 7. 04200 34 478...'S Empirical C on st r aint: Fr Fr e quency De e Vo 1 tag e (Kilo v o lt s ) Main Coil (Amps) TCO'l: TC02: TC03: TC04: TC05: TC06: TC07: TC08: TC09: TC10: TC11: TC12: TC13: TC14: TC15: TC16: TC17: ee Voltage equency; D 7. 04200 34 478...

Wolters, Richard Arthur

2012-06-07T23:59:59.000Z

366

A distinctive compassion in Kay Boyle's Thirty Stories  

E-Print Network [OSTI]

for the fox, who has lost his best friend, as well as for the family. And the reader suspects, too, that Kay Boyle is as sorry for the fox as she is for the family. The final significant animal treated as a h t 1 T~ht St t th ~lt th t appears irt "Hest... for the fox, who has lost his best friend, as well as for the family. And the reader suspects, too, that Kay Boyle is as sorry for the fox as she is for the family. The final significant animal treated as a h t 1 T~ht St t th ~lt th t appears irt "Hest...

Hilbrich, Bernadyne Elizabeth

2012-06-07T23:59:59.000Z

367

Additional Studies on the Control of Nutgras: (Cyperus Rotundus L.)  

E-Print Network [OSTI]

irlto a llew s ea is phenom&anal. Sm=''ch arid 1'ick (2~) ir a Irgetrnhouse experhrten showed that s, sinL&le tuber p FFduc d s, system of lt-'l6 tubers arid 'basal bulbs int 3-, months ~ A ries' tube" may b&, formed in 21 days a i'er s, r isolated... irlto a llew s ea is phenom&anal. Sm=''ch arid 1'ick (2~) ir a Irgetrnhouse experhrten showed that s, sinL&le tuber p FFduc d s, system of lt-'l6 tubers arid 'basal bulbs int 3-, months ~ A ries' tube" may b&, formed in 21 days a i'er s, r isolated...

Allen, William Wayne

2012-06-07T23:59:59.000Z

368

Economic Realities and Energy Efficient Polyphase Integral Horsepower Electric Motors  

E-Print Network [OSTI]

O~. r;I\\I. ~O. 9.65 86.92 Pcrformancc Cur'lt , .l.. Data Obtaincod lrom Ptrfor-naCUI" """ 0 " " 1\\ RaIlt , .l.. Data Obtaincod lrom Ptrfor-naCUI" """ 0 " " 1\\ RaI

Whittington, B. W.

1980-01-01T23:59:59.000Z

369

An intuitive approach to quantum circuit simulation  

E-Print Network [OSTI]

'(t)tf It, )Ill), &f)l;')'I' itttt') t)l&( i)t)tlt)fl ft), &:)ill() . )Lf) t)l I):)ttlttltfi)t) . ) Relllill I ltillilti I fluster hi 8'I l:t, IiV hl Xh t, RN . 'Iuhmtttett to the ()tliie iil I li?tot i I'rii i, imi (4 Ae;lttelHle ht llol;11+ht[ts I...'. tltet (' l), iu lii nti (I ellows . i tfetiot ) httu, tttf . ), I. unhtt&ntiet (I ietuttie l)tteitiii i Apt tl 2()()4 lt1, tjot I:leetiie;it Rii uteeon )&? IIII(?tr(e Appioric]1 Io ()(I i&it(if)i ( i&i?it Nifirrrl it&or) I . \\f)ill (I() ] I jtc...

Sensarn, Steven

2013-02-22T23:59:59.000Z

370

Separated cross sections in ?^0 electroproduction at threshold at Q^2 = 0.05 GeV^2/c^2  

E-Print Network [OSTI]

The differential cross sections \\sigma_0=\\sigma_T+\\epsilon \\sigma_L, \\sigma_{LT}, and \\sigma_{TT} of \\pi^0 electroproduction from the proton were measured from threshold up to an additional center of mass energy of 40 MeV, at a value of the photon four-momentum transfer of Q^2= 0.05 GeV^2/c^2 and a center of mass angle of \\theta=90^\\circ. By an additional out-of-plane measurement with polarized electrons \\sigma_{LT'} was determined. This showed for the first time the cusp effect above the \\pi^+ threshold in the imaginary part of the s-wave. The predictions of Heavy Baryon Chiral Perturbation Theory are in disagreement with these data. On the other hand, the data are somewhat better predicted by the MAID phenomenological model and are in good agreement with the dynamical model DMT.

M. Weis; P. Bartsch; D. Baumann; J. Bermuth; A. M. Bernstein; K. Bohinc; R. Bhm; M. Ding; M. O. Distler; I. Ewald; J. M. Friedrich; J. Friedrich; M. Kahrau; M. Kohl; K. W. Krygier; A. Liesenfeld; H. Merkel; P. Merle; U. Mller; R. Neuhausen; M. M. Pavan; Th. Pospischil; M. Potokar; G. Rosner; H. Schmieden; M. Seimetz; S. irca; A. Wagner; Th. Walcher

2007-05-25T23:59:59.000Z

371

Double Spin Asymmetries of Inclusive Hadron Electroproductions from a Transversely Polarized $^3\\rm{He}$ Target  

E-Print Network [OSTI]

We report the measurement of beam-target double-spin asymmetries ($A_\\text{LT}$) in the inclusive production of identified hadrons, $\\vec{e}~$+$~^3\\text{He}^{\\uparrow}\\rightarrow h+X$, using a longitudinally polarized 5.9 GeV electron beam and a transversely polarized $^3\\rm{He}$ target. Hadrons ($\\pi^{\\pm}$, $K^{\\pm}$ and proton) were detected at 16$^{\\circ}$ with an average momentum $$=2.35 GeV/c and a transverse momentum ($p_{T}$) coverage from 0.60 to 0.68 GeV/c. Asymmetries from the $^3\\text{He}$ target were observed to be non-zero for $\\pi^{\\pm}$ production when the target was polarized transversely in the horizontal plane. The $\\pi^{+}$ and $\\pi^{-}$ asymmetries have opposite signs, analogous to the behavior of $A_\\text{LT}$ in semi-inclusive deep-inelastic scattering.

The Jefferson Lab Hall A Collaboration; Y. X. Zhao; K. Allada; K. Aniol; J. R. M. Annand; T. Averett; F. Benmokhtar; W. Bertozzi; P. C. Bradshaw; P. Bosted; A. Camsonne; M. Canan; G. D. Cates; C. Chen; J. -P. Chen; W. Chen; K. Chirapatpimol; E. Chudakov; E. Cisbani; J. C. Cornejo; F. Cusanno; M. Dalton; W. Deconinck; C. W. de Jager; R. De Leo; X. Deng; A. Deur; H. Ding; P. A. M. Dolph; C. Dutta; D. Dutta; L. El Fassi; S. Frullani; H. Gao; F. Garibaldi; D. Gaskell; S. Gilad; R. Gilman; O. Glamazdin; S. Golge; L. Guo; D. Hamilton; O. Hansen; D. W. Higinbotham; T. Holmstrom; J. Huang; M. Huang; H. F Ibrahim; M. Iodice; X. Jiang; G. Jin; M. K. Jones; J. Katich; A. Kelleher; W. Kim; A. Kolarkar; W. Korsch; J. J. LeRose; X. Li; Y. Li; R. Lindgren; N. Liyanage; E. Long; H. -J. Lu; D. J. Margaziotis; P. Markowitz; S. Marrone; D. McNulty; Z. -E. Meziani; R. Michaels; B. Moffit; C. Muoz Camacho; S. Nanda; A. Narayan; V. Nelyubin; B. Norum; Y. Oh; M. Osipenko; D. Parno; J. -C. Peng; S. K. Phillips; M. Posik; A. J. R. Puckett; X. Qian; Y. Qiang; A. Rakhman; R. Ransome; S. Riordan; A. Saha; B. Sawatzky; E. Schulte; A. Shahinyan; M. H. Shabestari; S. irca; S. Stepanyan; R. Subedi; V. Sulkosky; L. -G. Tang; W. A. Tobias; G. M. Urciuoli; I. Vilardi; K. Wang; B. Wojtsekhowski; Y. Wang; X. Yan; H. Yao; Y. Ye; Z. Ye; L. Yuan; X. Zhan; Y. Zhang; Y. -W. Zhang; B. Zhao; X. Zheng; L. Zhu; X. Zhu; X. Zong

2015-02-04T23:59:59.000Z

372

BaBar  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Detektor der B - Fabrik, BaBar, wird durch eine internationale Detektor der B - Fabrik, BaBar, wird durch eine internationale Kollaboration gebaut. Er dient dazu, Paare von elektrisch neutralen B und anti-B Mesonen zu erzeugen. Das neutrale B enthält ein anti-b Quark und ein d Quark, während das neutrale anti-B ein b Quark und ein anti-d Quark enthält. Die Teilchenstrahlen werden so eingestellt, dass bei ihrer Kollision gerade die richtige Menge an Energie frei wird, um diese zwei Mesonen zu erzeugen. Weil Elektronen und Positronen mit verschiedenen Energien umlaufen, werden die so entstandenen B und anti-B Mesonen mit grosser Geschwindigkeit in derselben Richtung laufen. Dabei bewegen sie sich in gleicher Richtung wie die schneller laufenden Elektronen. Das macht es möglich, ihre Lebensdauer durch die Wegstrecke, die sie bis zu ihrem

373

Some perturbation methods for the study of unstable systems  

E-Print Network [OSTI]

') CO{{NON At8sNtDETNTsALENs8UNPsFKRtlPASsKPAS AN{)OE NP1=N+1 DQ I Is-ItN DO 2 J~l t NPI A{lt J)=RANG{1) IF {RANG{Z)-0 5) 3s3t2 A{ I t J)=-A{ lt J) CONTINUE CONTINUE CALL RESET RETURN END THESIS NASH JN ILCON SUBRQUT INE ILCQN A SEQUENCE... SEARCH COLUHN A(lpN+3) I='lpH ? SHIFT HOLD COLUNN 8(lpJ) Ip J=lpN SITE FGR CONSTRUCTIOH GF INVERSE DIHENSION A()03pl04) p 8(101p IO?3 CGHHGN ApBpNpOETNTpALEHpBUHPpFKRp IPASpNPASpHGDE DETNT=I+0 NPI=H+I NP2=N+2 NP3=N+3 A(NP2 ~ NP3)~0 NH1 = N-1 DO...

Nash, James Mosely

2012-06-07T23:59:59.000Z

374

The near-infra-red spectra of ferric acetylacetonate  

E-Print Network [OSTI]

(5?3& IBW?NP?NR ~ )F EQUIVALENCE (IBW ~ UBW& ~ (NR?MR) GO TO 966 READ(5?3) IBW&JBW&NP?NR&IF&MR FORMAT(613) READ(5?90) KON FORMAT(12& READ(5&201&SPLL&BGL FORMAT(2FB ~ 3) GO TP (9' 92 ' 93 ' 94?95&96?97?98&99&100&101&102&103 ~ 104&105 ~ 106...&I)IBG&ltJ)sSPL(ltJ& ~ I=I&NP) 110 FORMAT &F7 ' 0 ' 2F7 ~ 3) GO TO 969 967 DO )211=)eNP 121 READ(5 ' )20)(BG&leJ))J=I&NR& 120 FORMAT(IOF7 ~ 3) DO 123 1=1&NP 123 READ&5 F 124& (SPL&lsJ)sJ=1&MR& 124 FORMAT(10F7 ~ 3) READ&5 ~ 125&(LBDA(I& ~ 1=1&NP& 125 FORMAT(F7 ' 0...

Owen, James Travis

2012-06-07T23:59:59.000Z

375

THE INSTITUTIONAL ORIGINS OF THE DEPARTMENT OF ENERGY  

Broader source: Energy.gov (indexed) [DOE]

INSTITUTIONAL ORIGINS OF THE DEPARTMENT OF ENERGY INSTITUTIONAL ORIGINS OF THE DEPARTMENT OF ENERGY ManhattanEngineerDistrict (1942-1946) Ex ExecutiveOfficeof thePresident EnergyPolicyOffice(1973) Federal * .,.-, Office (1973-1974) AtomicEnergyCommission (1947 -1975) Federal Energy Administration (1974) -1977) Energy Research and DevelopmentAdministration3 (1975 - 1977) INCLUDES 1sPECIALEnergy Office ( t7J) tklr ... Energy Office(lt13) 2 Trea y-EnergyOffice

376

FORMERLY UTILIZED SITES REMEDIAL ACTION PROGRAM ELIMINATION REPORT  

Office of Legacy Management (LM)

< &lt; .. ,:. FORMERLY UTILIZED SITES REMEDIAL ACTION PROGRAM ELIMINATION REPORT FOR JESSOP STEEL COMPANY; 500 GREEN STREET: WASHINGTON, PENNSYLVANIA December 1991 U.S. Department of Energy Office of Environmental Restoration Elimination Report Jessop Steel Company CONTENTS INTRODUCTION ...................... .'. .... 1 BACKGROUND ............................. 1 Site Function Site Description : : : : : : : .................................... : Radiological History and Status ................. 2 ELIMINATION ANALYSIS ........................ 3 REFERENCES .............................. 4 Elimination Report Jessop Steel Company 1 INTRODUCTION The Department of Energy (DOE)., Office of Environmental Restoration, has reviewed the past activities of the Manhattan Engineer District (MED) and

377

Finite Element Modeling of the Fastening Systems and the Concrete  

E-Print Network [OSTI]

Sleeper and Ballast 0 500 1000 1500 2000 2500 3000 3500 4000 0.0000 0.0002 0.0004 0.0006 0.0008 0 of strands Rail seat area is between 0.39 m to 0.67 m Rail Seat Area Component Modeling: Concrete Sleeper Seat Area Position of concrete surface strain lt = 0.48 m Component Modeling: Concrete Sleeper

Barkan, Christopher P.L.

378

DC Optimal Power Flow Formulation in AMES Leigh Tesfatsion  

E-Print Network [OSTI]

@iastate.edu, http://www.econ.iastate.edu/tesfatsi/ Fig. 1. AMES day-ahead energy market activities during each day D wholesale power market testbed. I. AMES TESTBED The latest version of AMES (Agent-based Modeling.econ.iastate.edu/tesfatsi/AMESLMPDetermination.LT.pdf this objective, the ISO operates a day-ahead energy market settled by means of LMP. The welfare of each LSE j

Tesfatsion, Leigh

379

Egg activation, in vitro fertilization, and development of the gut and reproductive system of the parasitoid Campoletis sonorensis  

E-Print Network [OSTI]

~lt' ' ( ) (ll P ( h" ' ) gg could be dissected from females and activated by several techniques. A mechanical stress which imitates the oviposition process induced egg activation but was difficult to do. Low temperature shock (4 C) also induced activation..., each of which could be subdivided into 3 to 8 stages. The development of the gut and the reproductive system was investigated by dissecting each stage of the larva and the pupa. The dissections indicated that sex of the insect can be distinguishable...

Jang, Hye-Soon

1986-01-01T23:59:59.000Z

380

The design of an authentic Victorian era garden at The Antique Rose Emporium in Independence, Texas  

E-Print Network [OSTI]

INDEPENDENCE& TEXAS A PROFESSIONAL PAPER by KAREN HEIDI SCHWARTZ TAYLOR Approved as to style and content by: lt. Gregory Cobb (Committee Chairman) Christine D. Townsend (Member) Daniel Lineberger (Member) /('. Daniel Lineberger (Department Head... had three different advisors at three different universities. Dr. Cobb was by far the best. I would like to thank all of my committee members, Dr. B Gregory Cobb, Dr. Christine Townsend, and Dr. Daniel Lineberger for their invaluable advise...

Taylor, Karen Heidi Schwartz

2012-06-07T23:59:59.000Z

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

110 kW Stationary Combined Heat and Power Systems Status and  

E-Print Network [OSTI]

the status of 1­10 kW CHP stationary fuel cell systems and to comment on the achievability of cost-temperature proton exchange membrane (LT-PEM) fuel cell systems operating, for the most part, in a temperature range of 60°­90°C; high temperature PEM (HT-PEM) fuel cell systems operating in a temperature range of 130

382

Gamma ray bursts may be blueshifted bundles of the relic radiation  

E-Print Network [OSTI]

A hypothesis is proposed that the gamma-ray bursts (GRBs) may arise by blueshifting the emission radiation of hydrogen and helium generated during the last scattering epoch. The blueshift mechanism is provided by such a Lema\\^{\\i}tre -- Tolman (L--T) model, in which the bang-time function $t_B(r)$ is not everywhere constant. Blueshift arises on \\textit{radial} rays that are emitted over regions where $\\dril{t_B} r \

Krasi?ski, Andrzej

2015-01-01T23:59:59.000Z

383

Gamma ray bursts may be blueshifted bundles of the relic radiation  

E-Print Network [OSTI]

A hypothesis is proposed that the gamma-ray bursts (GRBs) may arise by blueshifting the emission radiation of hydrogen and helium generated during the last scattering epoch. The blueshift mechanism is provided by such a Lema\\^{\\i}tre -- Tolman (L--T) model, in which the bang-time function $t_B(r)$ is not everywhere constant. Blueshift arises on \\textit{radial} rays that are emitted over regions where $\\dril{t_B} r \

Andrzej Krasi?ski

2015-02-02T23:59:59.000Z

384

ma 166 name student id # recitation instructor recitation time  

E-Print Network [OSTI]

~.l-\\_. Tu xm. TK\\. Hm =anol. mH-lvl x3. Mfdw?i. l x. 7lt\\_\\o .w A;. To a. x .. , an an, on. >_ tr ... tank, and y = 0 at the base, the work required to pump all the water to the top of the tank is given .... (El Reno MP- Ow, _ i656: -- M:(n?) 460 41'. CU!)...

385

Dependency-style Generic Haskell  

E-Print Network [OSTI]

compb (Inl a1) (Inl a2) = compa a1 a2 comp Sum compa compb (Inl ) (Inr ) = LT comp Sum compa compb (Inr ) (Inl ) = GT comp Sum compa compb (Inr b1) (Inr b2) = compb b1 b2 comp Prod compa compb (a1, b1) (a2, b2: data Unit = Unit comp Sum compa compb (Inl a1) (Inl a2) = compa a1 a2 comp Sum compa compb (Inl ) (Inr

Löh, Andres

386

Both authors are members of the staff of the Northwest  

E-Print Network [OSTI]

they reached the bottom layer Dun ng the next 2 or 3 wee\\... . the alevins distnbuted them ehes until they were with th e pea\\... of emergence of fry from gravel Incuba- tors. Survival from eyed eggs to fry In th e Incubator With the turf substrate was 98 percent The high poro\\lt\\ o f A\\trol urf and the low denSi ty of th

387

Circuitos de corriente continua y alterna Tema 5. Circuitos de corriente continua y alterna  

E-Print Network [OSTI]

. Oscilaciones eléctricas. Circuitos de corriente continua variable. 5. Electrónica: materiales semiconductores yPasivos Disipativos: consumen energía Condensadores Bobinas Resistencias (conversión de energía química en eléctrica característica Potencia consumida RIVIP 2 == Resistencias dt tdI LtV )( )( = L (H) Una vez establecida la

Escolano, Francisco

388

The design of a traffic control system with distributed intelligence  

E-Print Network [OSTI]

' IN 0 4 9 6 C M 21 SOO/10 4500 / 5 FD I * ~ /00 I 505 12 M * I/tl C M lt M 5M $50C'M * ' 0 I 273 D3 n D?OI 0 I 0' d D M2C/0 M 60 1033 M 01 2021 30 OCM M IMO F 0- ~ 3 2011 0 5 I * Ml 0- ~ 50 Ot'M 2010...

Tietjen, Donald Louis

1973-01-01T23:59:59.000Z

389

Iatiku 03  

E-Print Network [OSTI]

?~.);~>R:1E0l.:y~lt :~;tr:: " " '0.'.. .. ' "0 . ".. ' . . .. . '. . . . " ~ ." .. .-', '0 .... : .. :' .. ' . ': .' . 00.. . ... 0 -. -, . . ' . . :\\~p'T:r'!f~~ i: '~':/ " . ~ : . :. :'.' )';'fr 1:1 ~ 1t~"V" '.. 1 .. 1h... ~: ,;" ~ ' .... ~ . . . t . ",~/ .II-...J-.,;-:I....;..r:,I .. ,.: :. t,.(:' : ";' . /~ . ~ 1."': ... ~ .. ~ . ~ .. l"'/ ""'' . ... .. . ~;~~J:U.~jfS-:~~.#7L.p.

Ostler, Nicholas D M

1996-01-01T23:59:59.000Z

390

POLONICI MATHEMATICI 83.1 (2004)  

E-Print Network [OSTI]

prove that the sequence ("-t ;[=ot ?k), converges strongly to a rank-one projection if and only-finite measure space' and 'Ll : Lt(Q,E,p) the space of all real-valued Lebesgue-integrable functions on (9, E,tten i.n the form (2) ]y;A.(Ds : ii l-(d- * ra)g drlu6 ft:1 A nzoreoaer) limrrr"o \\aoT"gdp,: g. Proof (i

Emel´yanov, Eduard

391

Talk, No Action On Nuclear Waste Plan  

Science Journals Connector (OSTI)

Talk, No Action On Nuclear Waste Plan ... Nowhere was how an exasperated Lt. Gen. Brent Scowcroft, chairman of the Blue Ribbon Commission on Americas Nuclear Future, described the status of the U.S.s search for a place to store spent commercial nuclear fuel and other radioactive waste. ... Although the blue-ribbon commission had completed its seminal report on nuclear waste in January, Scowcroft noted that action on its recommendations was nowhere. ...

JEFF JOHNSON

2012-09-30T23:59:59.000Z

392

8 2. Helium und Tritium in der Geosphre 2. Helium und Tritium in der Geosphre  

E-Print Network [OSTI]

TU ist es eigentlich nicht sinnvoll, Tritiumkonzentrationen in cm3STP/g oder Heliumkonzentrationen.1100 10-19 mol g = 66' 846 Atome g (2.4) Zusammen mit (2.2) erhält man die Umrechnung von cm3STP/g in TU.01.1014 (Torgersen et al., 1979) bis 4.021.1014 TU/(cm3STP/g) (Schlosser et al., 1989). Salzwasser mit der Salinität

Aeschbach-Hertig, Werner

393

Screening Data from the Cancer Chemotherapy National Service Center Screening Laboratories. XXVII  

Science Journals Connector (OSTI)

...tO U)U)0)0)0)Ot000N 4*.-INis toU)'010)0*0)N is.-iais...oisisNO)Nt') 01')lt) OisisNNis.-INis tois0)toN OOisisN .4is.-410N toN0...IDat. 1C')isIC N otoo. atC) .4. INis 0atisN atN. OC')at @ " atOis 0)0...

Joseph Leiter; B. J. Abbott; Saul A. Schepartz

1965-08-01T23:59:59.000Z

394

United states Department of the Interior, J. A. Krug> Secretary l"ish and Wildlife Service, Albert M. Day, Director  

E-Print Network [OSTI]

50 to 200 miles offshore , with some spavming taldnt; place at least as far sea"';ard as 30G miles(;n., as they cio trJ'oughO'.lt life, on min',lte organisms, plant 2nd animal, -)'Thich livE' suspended L'1 the se2 their inshore nursery grounds and take up the pelagic offshore life of adclts. Then they make their first appea

395

Anomalous scaling in a nonlocal growth model in the Kardar-Parisi-Zhang universality class Mario Castro,1,  

E-Print Network [OSTI]

describe electrochemical deposition experiments. The model allows for a finite density of biased random range of electrochemical deposition experiments. S1063-651X 98 50803-3 PACS number s : 05.40. j, 05¯L(t) 1/L xh(x,t): W2 L,t 1 L x h x,t h¯L t 2 , 1 where angular brackets stand for noise average. In many

Cuerno, Rodolfo

396

Contact Mechanics Based Mechanical Characterization of Portland Cement Paste  

E-Print Network [OSTI]

sp surface pressure 0P maximum Hertz pressure r radial coordinate for axisymmetry R tip radius RH relative humidity t time lt loading time ht load holding time ut unloading time ? dimensionless parameter... show the ability of the self-consistent solution to capture both repulsive and adhesive effects. Also plotted are the Hertzian pressure profiles for the same indentation depths. Notice that because the Hertz solution neglects the adhesion outside...

Jones, Christopher

2012-02-14T23:59:59.000Z

397

Nummer 1 2007 Antikrundan i RomAntikrundan i Rom  

E-Print Network [OSTI]

Nummer 1 · 2007 Antikrundan i RomAntikrundan i Rom GR?N JORDBRUKSDESIGN · INDUSTRIELLA EKONOMER F?R JOBB · ASKA MOT F?RSURNING #12;#12;LT H - n y t t n u m m e r 1 · 2 0 0 7 JAG M?TTE V?REN I ROM! Den inget svårt beslut. Vem vill inte se Rom med så initierade guider? Olle Svedberg och Anna-Maria Blennow

398

UCRL-CR--10  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

-10 -10 4934 DE91 000814 PHOTOCONDUCTIVITY OF ACTIVATED CARBONFIBERS ' Ko Kuriyama Mo S. ,Dresselhaus MIT ...... ' Cambridge, Massachusetts ' MASTEB ,_ ' _Yii:i" ' £31STRIBUTION OFIT_"IIS DoCUMEt"JT IS L I?',_'-:'_ , I)IS('I,AIMI,',R Work pt`rforlnt`(I iiil(|t`r lilt' llll._illl'_-'_Of lilt' I J,,H, I)t, pllrl- mt`ni of i,_nt`r_)' I),_' l,=lwrt`n_'t` I,Ivi.,rmort` Ntllhrn=ll l,ld_or=_- Ior,_'mldc,r _'onlrzlct mlml}t`r W-74(15-1,1N(;.4X, 'l'hi,_ doc'mm..||l t_'=l.,_ prt`p=lrt`d =Is ==_l=lt'v,,,|ml o1' work _ptm._(!rvd I_)' IIn =lp, t`|lC')' 01' lht` (ll|ilt`(l ,_tiHl's (;|_vt`rnn|t`nt. Nvilht, r lht` I Inilt`d ,Sl=dL, s (;o_'t`rl|u|el|l mir Iht` t ll|i_'t`r_lt.,,'of ('lllifl)r,fl_l mrr lilLY o1"II,.,Ir v|lll_l_|)'t`t`_, I|mkt`_ _lll)' ,_'_mrr_lnl); exprt`_ or i|npllt`d, or _l_sl|i|lt`_ _|,ly lel_=lllhd)lilly i_r r¢'sl)(m- _ihilll)'

399

GE PowerPoint Template  

Broader source: Energy.gov (indexed) [DOE]

Steels for Steels for Accident Tolera nt Fuel Cla ddings Ferritic Ma rtensitic Alloys a s Accident Tolera nt Fuel (ATF) Cla dding Ma teria l for Light Wa ter Rea ctors Ra ul B. Reba k, GE Globa l Resea rch DOE Integra tion Meeting, Sa lt La ke City 27-August-2013 DE NE 568 2 / GE Reba k - DOE Integra tion Meeting, Sa lt La ke City, 27-August-2013/ GE Project Tea m 3 / GE Reba k - DOE Integra tion Meeting, Sa lt La ke City, 27-August-2013/ Approa ch of GE Resea rch Proposa l * Demonstra te tha t sta inless iron ba sed bulk a lloys or Adva nced Steels ca n be used a s fuel cla dding ma teria ls in commercia l nuclea r rea ctors * The proposed ma teria l should be a s good a s Zr a lloys (or better tha n Zr a lloys) under norma l opera tion conditions 1. Resista nt to genera l corrosion a nd environmenta l cra

400

Evaluation of ketoprofen formulations via penetration rate and irritation in vivo study  

Science Journals Connector (OSTI)

The purpose of the present study was to design an optimal ketoprofen gel with appropriate penetration rate, shortened lag time and acceptable skin irritation. The combination of different mechanism enhancers including nonivamide, menthol and ethanol were used as multi-enhancers for producing a synergistic enhancement effect and reducing the skin irritation via diminishing the used amount of enhancers. The central composite design was applied to prepare a systemic formulation. The penetration rate (PR), lag time (LT) and skin irritation score (TIS) of a commercial product (Formax plus gel containing 3% ketoprofen) were determined by in vivo study and used as a criterion for designed formulations. The PR, LT and TIS of commercial product were 462.2162.5?g/h, 0.60.1h and 12.70.6, respectively. Among these designed experimental formulations, four formulations including F07 (code: ?1/+1/?1), F11 (code: +1/+1/?1), F13 (code: 0/0/?1.732) and F14 (code: 0/+1.732/0), their PR was not smaller and LT and TIS were not greater than that of commercial product, indicating that these experimental ketoprofen gels could be used in the clinical situation.

Yaw-Bin Huang; Ren-Jiunn Wang; Jui-Sheng Chang; Yi-Hung Tsai; Pao-Chu Wu

2007-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

University of Minnesota aquifer thermal energy storage (ATES) project report on the second long-term cycle  

SciTech Connect (OSTI)

The technical feasibility of high-temperature [>100{degrees}C (>212{degrees}F)] aquifer thermal energy storage (ATES) in a deep, confined aquifer was tested in a series of experimental cycles at the University of Minnesota`s St. Paul field test facility (FTF). This report describes the second long-term cycle (LT2), which was conducted from October 1986 through April 1987. Heat recovery; operational experience; and thermal, chemical, hydrologic, and geologic effects are reported. Approximately 61% of the 9.21 GWh of energy added to the 9.38 {times} 10{sup 4} m{sup 3} of ground water stored during LT2 was recovered. Temperatures of the water stored and recovered averaged 118{degrees}C (244{degrees}F) and 85{degrees}C (185{degrees}F), respectively. Results agreed with previous cycles conducted at the FTF. System operation during LT2 was nearly as planned. Operational experience from previous cycles at the FTF was extremely helpful. Ion-exchange softening of the heated and stored aquifer water prevented scaling in the system heat exchangers and the storage well, and changed the major-ion chemistry of the stored water. Sodium bicarbonate replaced magnesium and calcium bicarbonate as primary ions in the softened water. Water recovered form storage was approximately at equilibrium with respect to dissolved ions. Silica, calcium, and magnesium were significantly higher in recovered water than in injected water. Sodium was significantly lower in water recovered than in water stored.

Hoyer, M.C.; Hallgren, J.P.; Lauer, J.L.; Walton, M.; Eisenreich, S.J.; Howe, J.T.; Splettstoesser, J.F. [Minnesota Geological Survey, St. Paul, MN (United States)

1991-12-01T23:59:59.000Z

402

University of Minnesota aquifer thermal energy storage (ATES) project report on the second long-term cycle  

SciTech Connect (OSTI)

The technical feasibility of high-temperature (>100{degrees}C (>212{degrees}F)) aquifer thermal energy storage (ATES) in a deep, confined aquifer was tested in a series of experimental cycles at the University of Minnesota's St. Paul field test facility (FTF). This report describes the second long-term cycle (LT2), which was conducted from October 1986 through April 1987. Heat recovery; operational experience; and thermal, chemical, hydrologic, and geologic effects are reported. Approximately 61% of the 9.21 GWh of energy added to the 9.38 {times} 10{sup 4} m{sup 3} of ground water stored during LT2 was recovered. Temperatures of the water stored and recovered averaged 118{degrees}C (244{degrees}F) and 85{degrees}C (185{degrees}F), respectively. Results agreed with previous cycles conducted at the FTF. System operation during LT2 was nearly as planned. Operational experience from previous cycles at the FTF was extremely helpful. Ion-exchange softening of the heated and stored aquifer water prevented scaling in the system heat exchangers and the storage well, and changed the major-ion chemistry of the stored water. Sodium bicarbonate replaced magnesium and calcium bicarbonate as primary ions in the softened water. Water recovered form storage was approximately at equilibrium with respect to dissolved ions. Silica, calcium, and magnesium were significantly higher in recovered water than in injected water. Sodium was significantly lower in water recovered than in water stored.

Hoyer, M.C.; Hallgren, J.P.; Lauer, J.L.; Walton, M.; Eisenreich, S.J.; Howe, J.T.; Splettstoesser, J.F. (Minnesota Geological Survey, St. Paul, MN (United States))

1991-12-01T23:59:59.000Z

403

Oxygen contamination in liquid Argon: combined effects on ionization electron charge and scintillation light  

E-Print Network [OSTI]

A dedicated test of the effects of Oxygen contamination in liquid Argon has been performed at the INFN-Gran Sasso Laboratory (LNGS, Italy) within the WArP R&D program. Two detectors have been used: the WArP 2.3 lt prototype and a small (0.7 lt) dedicated detector, coupled with a system for the injection of controlled amounts of gaseous Oxygen. Purpose of the test with the 0.7 lt detector is to detect the reduction of the long-lived component lifetime of the Argon scintillation light emission at increasing O2 concentration. Data from the WArP prototype are used for determining the behavior of both the ionization electron lifetime and the scintillation long-lived component lifetime during the O2-purification process activated in closed loop during the acquisition run. The electron lifetime measurements allow to infer the O2 content of the Argon and correlate it with the long-lived scintillation lifetime data. The effect of Oxygen contamination on the scintillation light has been thus measured over a wide range of O2 concentration, spanning from about 10^-3 ppm up to about 10 ppm. The rate constant of the light quenching process induced by Oxygen in LAr has been found to be k'(O2)=0.54+-0.03 micros^-1 ppm^-1.

R. Acciarri; M. Antonello; B. Baibussinov; M. Baldo-Ceolin; P. Benetti; F. Calaprice; E. Calligarich; M. Cambiaghi; N. Canci; F. Carbonara; F. Cavanna; S. Centro; A. G. Cocco; F. Di Pompeo; G. Fiorillo; C. Galbiati; V. Gallo; L. Grandi; G. Meng; I. Modena; C. Montanari; O. Palamara; L. Pandola; F. Pietropaolo; G. L. Raselli; M. Roncadelli; M. Rossella; C. Rubbia; E. Segreto; A. M. Szelc; F. Tortorici; S. Ventura; C. Vignoli

2008-04-08T23:59:59.000Z

404

Search for the Decays {ital B}{sup 0}{r_arrow}{ital D}{sup ({asterisk})+}{ital D}{sup ({asterisk}){minus}}  

SciTech Connect (OSTI)

Using the CLEO-II data set we have searched for the decays B{sup 0}{r_arrow}D{sup (*)+}D{sup (* ){minus}} . We observe one candidate signal event for the decay B{sup 0}{r_arrow}D{sup *+}D{sup *{minus}} with an expected background of 0.022{plus_minus}0.011 events. This yield corresponds to a branching fraction of B(B{sup 0}{r_arrow}D{sup *+}D{sup *{minus}} )=[5.3{sup +7.1}{sub {minus}3.7}(stat ){plus_minus}1.0(syst)]{times} 10{sup {minus}4} and an upper limit of B(B{sup 0}{r_arrow}D{sup *+}D{sup *{minus}} ){lt}2.2{times}10{sup {minus}3} at the 90% C.L. We see no significant excess of signal above the expected background level in the other modes, and we calculate the 90% C.L.upper limits on the branching fractions to be B(B{sup 0}{r_arrow}D{sup *{plus_minus}}D{sup {minus_plus}}){lt}1.8{times}10{sup {minus}3} and B(B{sup 0}{r_arrow}D{sup +}D{sup {minus}}){lt}1.2{times}10{sup {minus}3} . {copyright} {ital 1997} {ital The American Physical Society}

Asner, D.M.; Bliss, D.W.; Brower, W.S.; Masek, G.; Paar, H.P.; Sharma, V. [University of California, San Diego, La Jolla, California 92093 (United States)] [University of California, San Diego, La Jolla, California 92093 (United States); Gronberg, J.; Kutschke, R.; Lange, D.J.; Menary, S.; Morrison, R.J.; Nelson, H.N.; Nelson, T.K.; Qiao, C.; Richman, J.D.; Roberts, D.; Ryd, A.; Witherell, M.S. [University of California, Santa Barbara, California 93106 (United States)] [University of California, Santa Barbara, California 93106 (United States); Balest, R.; Behrens, B.H.; Cho, K.; Ford, W.T.; Park, H.; Rankin, P.; Roy, J.; Smith, J.G. [University of Colorado, Boulder, Colorado 80309-0390 (United States)] [University of Colorado, Boulder, Colorado 80309-0390 (United States); Alexander, J.P.; Bebek, C.; Berger, B.E.; Berkelman, K.; Bloom, K.; Cassel, D.G.; Cho, H.A.; Coffman, D.M.; Crowcroft, D.S.; Dickson, M.; Drell, P.S.; Ecklund, K.M.; Ehrlich, R.; Elia, R.; Foland, A.D.; Gaidarev, P.; Gittelman, B.; Gray, S.W.; Hartill, D.L.; Heltsley, B.K.; Hopman, P.I.; Kandaswamy, J.; Katayama, N.; Kim, P.C.; Kreinick, D.L.; Lee, T.; Liu, Y.; Ludwig, G.S.; Masui, J.; Mevissen, J.; Mistry, N.B.; Ng, C.R.; Nordberg, E.; Ogg, M.; Patterson, J.R.; Peterson, D.; Riley, D.; Soffer, A.; Ward, C. [Cornell University, Ithaca, New York 14853 (United States)] [Cornell University, Ithaca, New York 14853 (United States); Athanas, M.; Avery, P.; Jones, C.D.; Lohner, M.; Prescott, C.; Yang, S.; Yelton, J.; Zheng, J. [University of Florida, Gainesville, Florida 32611 (United States)] [University of Florida, Gainesville, Florida 32611 (United States); Brandenburg, G.; Briere, R.A.; Gao, Y.S.; Kim, D.Y.; Wilson, R.; Yamamoto, H. [Harvard University, Cambridge, Massachusetts 02138 (United States)] [Harvard University, Cambridge, Massachusetts 02138 (United States); Browder, T.E.; Li, F.; Li, Y.; Rodriguez, J.L. [University of Hawaii at Manoa, Honolulu, Hawaii 96822 (United States)] [University of Hawaii at Manoa, Honolulu, Hawaii 96822 (United States); Bergfeld, T.; Eisenstein, B.I.; Ernst, J.; Gladding, G.E.; Gollin, G.D.; Hans, R.M.; Johnson, E.; Karliner, I.; Marsh, M.A.; Palmer, M.; Selen, M.; Thaler, J.J. [University of Illinois, Champaign-Urbana, Illinois 61801 (United States)] [University of Illinois, Champaign-Urbana, Illinois 61801 (United States); Edwards, K.W. [Carleton University, Ottawa, Ontario, K1S 5B6 (Canada)] [Carleton University, Ottawa, Ontario, K1S 5B6 (Canada); Bellerive, A.; Janicek, R.; MacFarlane, D.B.; McLean, K.W.; Patel, P.M. [McGill University, Montreal, Quebec, (Canada)] [McGill University, Montreal, Quebec, (Canada)

1997-08-01T23:59:59.000Z

405

On a recent preliminary study for the measurement of the Lense-Thirring effect with the Galileo satellites  

E-Print Network [OSTI]

It has been recently proposed to combine the node drifts of the future constellation of 27 Galileo spacecraft together with those of the existing LAGEOS-type satellites to improve the accuracy of the past and ongoing tests of the Lense-Thirring (LT) effect by removing the bias of a larger number of even zonal harmonics $J_{\\ell}$ than either done or planned so far. Actually, it seems a difficult goal to be realistically achieved for a number of reasons. First, the LT range signature of a Galileo-type satellite is as little as $0.5$ mm over 3-days arcs, corresponding to a node rate of just $\\dot\\Omega_{\\rm LT}=2$ milliarcseconds per year (mas yr$^{-1}$). Some tesseral and sectorial ocean tides such as $K_1,K_2$ induce long-period harmonic node perturbations with frequencies which are integer multiples of the extremely slow Galileo's node rate $\\dot\\Omega$ completing a full cycle in about 40 yr. Thus, over time spans $T$ of some years they would act as superimposed semi-secular aliasing trends. Since the coeffi...

Iorio, Lorenzo

2014-01-01T23:59:59.000Z

406

Translationally Controlled Tumor Protein Protects against DNA Damage in Low  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Translationally Controlled Tumor Protein Protects against DNA Damage in Low Translationally Controlled Tumor Protein Protects against DNA Damage in Low Dose γ-Irradiated Cells Edouard Azzam New Jersey Medical School Cancer Center Abstract We have previously shown that exposure to low dose/low dose rate γ-rays can protect normal human and rodent cells against oxidative/clastogenic damages induced spontaneously or by a subsequent challenge dose of ionizing radiation. To gain insight into the mechanisms underlying these effects, we used amine-specific isobaric tags for relative and absolute quantitation (iTRAQ)-based approach to identify induced proteolytic events. Intriguingly, the Translationally Controlled Tumor Protein (TCTP) was significantly up-regulated after 10cGy (0.2cGy/h) but not after 4 Gy (1 Gy/min) in several strains of normal human fibroblasts maintained in 2- or

407

Effect of Irradiation on DNA Synthetic Period of the Mitotic Cycle in Cells  

Science Journals Connector (OSTI)

Kinetics of DNA synthesis in mitotic cycle of mouse corneal epithelial cells after single ?-irradiation (4Gy) at the end of S period was studied by the method of radioautography. Normally, S period of corneal...

I. P. Shabalkin; E. Yu. Grigoreva

2012-05-01T23:59:59.000Z

408

Detection of ?-Irradiated Sesame Seeds before and after Roasting by Analyzing Photostimulated Luminescence, Thermoluminescence, and Electron Spin Resonance  

Science Journals Connector (OSTI)

Sesame seeds were irradiated using a 60Co irradiator (0?4 kGy) and then roasted (220 C for 10 min). To identify the irradiation treatment, physical detection methods like photostimulated luminescence (PSL), thermoluminescence (TL), and electron spin ...

Jeongeun Lee; Tusneem Kausar; Byeong-Keun Kim; Joong-Ho Kwon

2008-07-26T23:59:59.000Z

409

AAAS Council Meeting, 1983  

Science Journals Connector (OSTI)

...interests of the governments of Zaire, Tanzania, and the United States were engaged...from affiliation. The International Solar Ener-gy Society, American Section, has changed its name to American Solar En-ergy Society. As new affiliates...

Catherine Borras

1983-07-29T23:59:59.000Z

410

E-Print Network 3.0 - aquatic exposure assessment Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of aquatic biota (1 rad d-1 or 10 mGy d... risks to humans from exposures to unreclaimed uranium mining ... Source: Yucca Mountain Project, US EPA Collection: Environmental...

411

E-Print Network 3.0 - assess fish secondary Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

fish secondary Search Powered by Explorit Topic List Advanced Search Sample search results for: assess fish secondary Page: << < 1 2 3 4 5 > >> 1 (Bi*ol"o*gy) n. Gr. life + -logy:...

412

Radiosensitization Strategies for Enhanced E-beam Irradiation Treatment of Fresh Produce  

E-Print Network [OSTI]

necessary to develop treatments that will reduce their prevalence and numbers on fresh produce. Irradiation is a penetrating nonthermal treatment that effectively eliminates bacteria. Irradiated baby spinach leaves up to 1.0 kGy showed negligible (P>0...

Gomes, Carmen

2011-08-08T23:59:59.000Z

413

Implications for preserving neural stem cells in whole brain radiotherapy and prophylactic cranial irradiation: a review of 2270 metastases in 488 patients  

Science Journals Connector (OSTI)

......oligometastatic patients (WBRT plan) and extensive SCLC...to chemotherapy (PCI plan). Plans will be conducted in...in 10 fractions) and standard WBRT (30 Gy in 10 fractions...CONCLUSIONS Our retrospective review of 2270 metastases in......

Jue-Feng Wan; Sheng-Jian Zhang; Lu Wang; Kuai-Le Zhao

2013-03-01T23:59:59.000Z

414

Molecular Pathways: Targeted ?-Particle Radiation Therapy  

Science Journals Connector (OSTI)

...and profibrotic cytokines. Radiation-induced malignancy can...1-5 Gy). Kyoji Furukawa (Radiation Effect Research Foundation, Hiroshima, Japan) reviewed the Japanese atomic...late effects of ionizing radiation exposure at low/moderate...

Kwamena E. Baidoo; Kwon Yong; and Martin W. Brechbiel

2013-02-01T23:59:59.000Z

415

Numerical calculation of Green's functions  

E-Print Network [OSTI]

have: lim $ (x) represents E~O E (7+6 p dG lim) ( ? ( ) d. qG )dx = ? 1 E Then r '+' a ( ? (~) ? qG)d? = ? 1 and by direct integration ix= ad+6 6~0 x= g ? 6 The condition expressed by equation (1. 2. 6) is known as the jump condition.... Let 1 + x = y; then g(y) = e 1 I ( y I ) 2 = e y ( 2 - y ) 0 & y & 2 g(y) = o y & 0; then 23 ~d( ) ( ~d( ) ( &, ~tl ? (0) x=-1 y=0 y~ If y& 0 then g(y) = 0 and lim g-Z ? = 0, =1 I f y & 0 use z = ? in the expression then 1 lim ? g(y) = lim...

Urrea-Beltran, Julian

2012-06-07T23:59:59.000Z

416

:' , -_ i '; f~;--~', \\'?<;'~/}{.!T~':~'~'\\~:~~{J:~':;:;,-""," ~  

E-Print Network [OSTI]

: 'gy in Europe. Ready to Power j I o ABORDARE GLOBALA ENERGO-ECOLOGICA. ~I SINTE A PROBLEMEI Energetic Stage I. sourse". ETSUR-R-99. (1997). ecasting Application". EWEA, UK Wind Energy Resourse

Baica, Malvina

417

Secondary Sewage Treatment Versus Ocean Outfalls: An Assessment  

Science Journals Connector (OSTI)

...stable. The membrane will overheat and be de-stroyed...W. A. Beckman, in Solar Ener-gy Thermal Processes (Wiley, New...was supported by a Solar Energy Traineeship grant...have sufficient daytime solar insolation and sufficiently...

Charles B. Officer; John H. Ryther

1977-09-09T23:59:59.000Z

418

Hydrogen- and Oxygen from Water  

Science Journals Connector (OSTI)

...DUFFIE, J.A., SOLAR ENERGY THERMAL 178 ( 1974 ). FUNK...4, in which the thermal effects of operation...curve, QH, is the net solar heat flow into the...A. Beckman, in Solar Ener-gy Thermal Processes (Wiley...

Edward A. Fletcher; Roger L. Moen

1977-09-09T23:59:59.000Z

419

Electron beam induced modifications in crystalline structure of polyvinylidene fluoride/nanoclay composites  

Science Journals Connector (OSTI)

Abstract PVDF/nanoclay nanocomposites were prepared via melt mixing method. The intercalated dispersion of the nanoclay in PVDF matrix was confirmed by XRD. According to FTIR, DSC and XRD results, the presence of nanoclay facilitated transition from ?-to-? crystalline phase. Electron beam irradiation decreased the melting point of the nanocomposites. The decrease in melting point of the nanocomposites was about 11C at 500kGy. The crystallinity of nanocomposites increased at an irradiation dose of 100kGy and decreased at higher irradiation doses. The extent of crosslinking of the nanocomposites increased significantly with irradiation up to 300kGy. The nanoclay intensified the increase in yield strength with irradiation doses up to 300kGy. The combination of nanoclay and irradiation had a synergistic effect on the increase of yield strength.

Peyman Rahmani; Susan Dadbin; Masoud Frounchi

2014-01-01T23:59:59.000Z

420

GAOH Offshore | Open Energy Information  

Open Energy Info (EERE)

GAOH Offshore Jump to: navigation, search Name: GAOH Offshore Place: St Peter Port, United Kingdom Zip: GY1 4EE Sector: Wind energy Product: Intends to become the preferred...

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Trial Production of Examination Gloves from Irradiated Natural Rubber Latex on a Factory Scale  

Science Journals Connector (OSTI)

TRIAL PRODUCTION OF EXAMINATION GLOVES FROM IRRADIATED NATURAL RUBBER LATEX IN FACTORY SCALE: The production of irradiated latex by gamma rays from60...Co at 20 kGy dose in the presence of 1 phr (part hundred rat...

Marga Utama

1994-01-01T23:59:59.000Z

422

Proteasome Structures Affected by Ionizing Radiation  

Science Journals Connector (OSTI)

...Effect of ionizing radiation on 26S but...radiation doses, and immediately...the dose range 1 to 20 Gy...ionizing radiation induced a...38), ionizing radiation (39...over a wide range of radiation doses and further...

Milena Pervan; Keisuke S. Iwamoto; and William H. McBride

2005-07-01T23:59:59.000Z

423

The effect of ionizing radiation on dielectric properties of bovine achilles tendon collagen in the temperature range of thermal denaturation  

Science Journals Connector (OSTI)

The effect of ?-irradiation, with doses from 102?2103 kGy, on the dielectric properties of solid-state collagen was studied. The temperature dependence of the constants ?? and ??' revealed a decrease in the dena...

F. Jaroszyk; E. Marzec

1994-10-15T23:59:59.000Z

424

Human Heterochromatin Protein 1 Isoforms HP1Hs? and HP1Hs? Interfere with hTERT-Telomere Interactions and Correlate with Changes in Cell Growth and Response to Ionizing Radiation  

Science Journals Connector (OSTI)

...subsequently exposed to ionizing radiation (IR). The...a particular dose of radiation. The cells...to IR in the dose range of 0 to 8 Gy...treatment. Dose response curves...treated with ionizing radiation while growing...

Girdhar G. Sharma; Kyu-kye Hwang; Raj K. Pandita; Arun Gupta; Sonu Dhar; Julie Parenteau; Manjula Agarwal; Howard J. Worman; Raymund J. Wellinger; Tej K. Pandita

2003-11-01T23:59:59.000Z

425

Extremely Low Dose Ionizing Radiation Up-regulates CXC Chemokines in Normal Human Fibroblasts  

Science Journals Connector (OSTI)

...with radiation exposure (1). Ionizing radiation at moderate and higher doses (0.1-10 Gy) can produce DNA strand...death. Studies of mutants sensitive to ionizing radiation at this range of doses have revealed that the responsible genes...

Akira Fujimori; Ryuichi Okayasu; Hiroshi Ishihara; Satoshi Yoshida; Kiyomi Eguchi-Kasai; Kumie Nojima; Satoru Ebisawa; and Sentaro Takahashi

2005-11-15T23:59:59.000Z

426

Dosimetry of Y-90 Liquid Brachytherapy in a Dog with Osteosarcoma Using PET/CT  

E-Print Network [OSTI]

receive a total dose of over 1000 Gy. Y-90 liquid brachytherapy has the potential to be used as an adjuvant therapy or for palliation purposes. Future work includes evaluation of pharmacokinetics of the Y-90 radiopharmaceutical, calibration of PET...

Zhou, Jingjie

2011-08-08T23:59:59.000Z

427

7Li Cross Section  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

, X) (Current as of 05142012) NSR Reaction E (MeV) Cross Section File X4 Dataset Date Added 2004GY02 7Li(, ): deduced absolute resonance strengths 810 - 820 keV X4 02...

428

Therapeutic potential of atmospheric neutrons Cyril Voyant1,2*  

E-Print Network [OSTI]

(BNCT) - which exploits the interaction between Boron-10 atoms (introduced by vector molecules) and low containing Boron-10. Results The doses produced (an average of Gy in a 1g tumour) are not sufficient

Boyer, Edmond

429

Induction by ionizing radiation of the gadd45 gene in cultured human cells: lack of mediation by protein kinase C.  

Science Journals Connector (OSTI)

...coordinately induced by UV radiation and alkylating agents...rapidly after X rays at doses as low as 2 Gy. After...isolation & purification radiation effects DNA Damage Dose-Response Relationship, Radiation Genes radiation effects...

M A Papathanasiou; N C Kerr; J H Robbins; O W McBride; I Alamo Jr; S F Barrett; I D Hickson; A J Fornace Jr

1991-02-01T23:59:59.000Z

430

SEP Program Notice 10-006C  

Energy Savers [EERE]

the A American Re ecovery and Reinvestme ent Act of f 2009 (Reco overy Act; P Pub. L. No. 1 111-5) and S SEP formula a awards und der the Energ gy Policy y and Cons servation Ac...

431

Download  

Science Journals Connector (OSTI)

Jun 15, 1979 ... Abstract. The energy consumption of 4th instar larvae of Chaoborus triuittatus of two different ages was determined in a respirometer. Measurements included enel gy consumption of fed larvae ... unit costs could be estimated.

2000-01-12T23:59:59.000Z

432

PAPERS PUBLISHED / 2005-2006 Progress in Research / Cyclotron...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

C. Hartnack, H.W. Barz, M. Bleicher, E. Bratkovskaya, W. Cassing, L.W. Chen, P. Danielewicz, C. Fuchs, T. Gaitanos, C.M. Ko, A. Larionov, M. Reiter, Gy. Wolf, and J. Aichelin,...

433

Australasian Physical & Engineering Sciences in Medicine Volume 27 Number 4, 2004 LETTER TO THE EDITOR  

E-Print Network [OSTI]

within the 0.1 cGy range. Some radiochromic films have a relatively energy independent dose, N.S.W, 2500, Australia Tsang Cheung, and Peter K. N. Yu Dept. of Physics and Materials Science, City

Yu, K.N.

434

Effect of ?-Irradiation on Agaritine, ?-Glutaminyl-4-hydroxybenzene (GHB), Antioxidant Capacity, and Total Phenolic Content of Mushrooms (Agaricus bisporus)  

Science Journals Connector (OSTI)

Isolde Sommer , Heidi Schwartz , Sonja Solar * and Gerhard Sontag ... Sample irradiation was performed using a Cobalt-60-?-ray irradiator type Gammacell 220 (Nordion International, Inc., Kanata, Ontario, Canada) at a dose rate of 34 Gy/min. ...

Isolde Sommer; Heidi Schwartz; Sonja Solar; Gerhard Sontag

2009-06-08T23:59:59.000Z

435

E-Print Network 3.0 - av sammenhengen mellom Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Geosciences 4 Strling og Helse Vi lever i et hav av strling. Det er g-strling fra bakken, kosmisk strling ovenfra, radon i luften og radioaktiv- Summary: Gy og mer) kan gi...

436

Individualized 3D Reconstruction of Normal Tissue Dose for Patients With Long-term Follow-up: A Step Toward Understanding Dose Risk for Late Toxicity  

SciTech Connect (OSTI)

Purpose: Understanding the relationship between normal tissue dose and delayed radiation toxicity is an important component of developing more effective radiation therapy. Late outcome data are generally available only for patients who have undergone 2-dimensional (2D) treatment plans. The purpose of this study was to evaluate the accuracy of 3D normal tissue dosimetry derived from reconstructed 2D treatment plans in Hodgkin's lymphoma (HL) patients. Methods and Materials: Three-dimensional lung, heart, and breast volumes were reconstructed from 2D planning radiographs for HL patients who received mediastinal radiation therapy. For each organ, a reference 3D organ was modified with patient-specific structural information, using deformable image processing software. Radiation therapy plans were reconstructed by applying treatment parameters obtained from patient records to the reconstructed 3D volumes. For each reconstructed organ mean dose (D{sub mean}) and volumes covered by at least 5 Gy (V{sub 5}) and 20Gy (V{sub 20}) were calculated. This process was performed for 15 patients who had both 2D and 3D planning data available to compare the reconstructed normal tissue doses with those derived from the primary CT planning data and also for 10 historically treated patients with only 2D imaging available. Results: For patients with 3D planning data, the normal tissue doses could be reconstructed accurately using 2D planning data. Median differences in D{sub mean} between reconstructed and actual plans were 0.18 Gy (lungs), -0.15 Gy (heart), and 0.30 Gy (breasts). Median difference in V{sub 5} and V{sub 20} were less than 2% for each organ. Reconstructed 3D dosimetry was substantially higher in historical mantle-field treatments than contemporary involved-field mediastinal treatments: average D{sub mean} values were 15.2 Gy vs 10.6 Gy (lungs), 27.0 Gy vs 14.3 Gy (heart), and 8.0 Gy vs 3.2 Gy (breasts). Conclusions: Three-dimensional reconstruction of absorbed dose to organs at risk can be estimated accurately many years after exposure by using limited 2D data. Compared to contemporary involved-field treatments, normal tissue doses were significantly higher in historical mantle-field treatments. These methods build capacity to quantify the relationship between 3D normal tissue dose and observed late effects.

Ng, Angela [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada)] [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada); Brock, Kristy K.; Sharpe, Michael B. [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada) [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada); Department of Radiation Oncology, University of Toronto, Toronto, Ontario (Canada); Moseley, Joanne L. [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada)] [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada); Craig, Tim [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada) [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada); Department of Radiation Oncology, University of Toronto, Toronto, Ontario (Canada); Hodgson, David C., E-mail: David.Hodgson@rmp.uhn.on.ca [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada); Department of Radiation Oncology, University of Toronto, Toronto, Ontario (Canada)

2012-11-15T23:59:59.000Z

437

Treatment of left sided breast cancer for a patient with funnel chest: Volumetric-modulated arc therapy vs. 3D-CRT and intensity-modulated radiotherapy  

SciTech Connect (OSTI)

This case study presents a rare case of left-sided breast cancer in a patient with funnel chest, which is a technical challenge for radiation therapy planning. To identify the best treatment technique for this case, 3 techniques were compared: conventional tangential fields (3D conformal radiotherapy [3D-CRT]), intensity-modulated radiotherapy (IMRT), and volumetric-modulated arc therapy (VMAT). The plans were created for a SynergyS (Elekta, Ltd, Crawley, UK) linear accelerator with a BeamModulator head and 6-MV photons. The planning system was Oncentra Masterplan v3.3 SP1 (Nucletron BV, Veenendal, Netherlands). Calculations were performed with collapsed cone algorithm. Dose prescription was 50.4 Gy to the average of the planning target volume (PTV). PTV coverage and homogeneity was comparable for all techniques. VMAT allowed reducing dose to the ipsilateral organs at risk (OAR) and the contralateral breast compared with IMRT and 3D-CRT: The volume of the left lung receiving 20 Gy was 19.3% for VMAT, 26.1% for IMRT, and 32.4% for 3D-CRT. In the heart, a D{sub 15%} of 9.7 Gy could be achieved with VMAT compared with 14 Gy for IMRT and 46 Gy for 3D-CRT. In the contralateral breast, D{sub 15%} was 6.4 Gy for VMAT, 8.8 Gy for IMRT, and 10.2 Gy for 3D-CRT. In the contralateral lung, however, the lowest dose was achieved with 3D-CRT with D{sub 10%} of 1.7 Gy for 3D-CRT, and 6.7 Gy for both IMRT and VMAT. The lowest number of monitor units (MU) per 1.8-Gy fraction was required by 3D-CRT (192 MU) followed by VMAT (518 MU) and IMRT (727 MU). Treatment time was similar for 3D-CRT (3 min) and VMAT (4 min) but substantially increased for IMRT (13 min). VMAT is considered the best treatment option for the presented case of a patient with funnel chest. It allows reducing dose in most OAR without compromising target coverage, keeping delivery time well below 5 minutes.

Haertl, Petra M., E-mail: petra.haertl@klinik.uni-regensburg.de [Department of Radiotherapy, Regensburg University Medical Center, Regensburg (Germany); Pohl, Fabian; Weidner, Karin; Groeger, Christian; Koelbl, Oliver; Dobler, Barbara [Department of Radiotherapy, Regensburg University Medical Center, Regensburg (Germany)

2013-04-01T23:59:59.000Z

438

Intensity-Modulated Proton Therapy Versus Helical Tomotherapy in Nasopharynx Cancer: Planning Comparison and NTCP Evaluation  

SciTech Connect (OSTI)

Purpose: To compare intensity-modulated proton therapy (IMPT) and helical tomotherapy (HT) treatment plans for nasopharynx cancer using a simultaneous integrated boost approach. Methods and Materials: The data from 6 patients who had previously been treated with HT were used. A three-beam IMPT technique was optimized in the Hyperion treatment planning system, simulating a 'beam scanning' technique. HT was planned using the tomotherapy treatment planning system. Both techniques were optimized to simultaneously deliver 66 Gy in 30 fractions to planning target volume (PTV1; GTV and enlarged nodes) and 54 Gy to PTV2 subclinical, electively treated nodes. Normal tissue complication probability calculation was performed for the parotids and larynx. Results: Very similar PTVs coverage and homogeneity of the target dose distribution for IMPT and HT were found. The conformity index was significantly lower for protons than for photons (1.19 vs. 1.42, respectively). The mean dose to the ipsilateral and contralateral parotid glands decreased by 6.4 Gy and 5.6 Gy, respectively, with IMPT. The volume of mucosa and esophagus receiving {>=}20 Gy and {>=}30 Gy with IMPT was significantly lower than with HT. The average volume of larynx receiving {>=}50 Gy was significantly lower with HT, while for thyroid, it was comparable. The volume receiving {>=}30, {>=}20, and {>=}10 Gy in total body volume decreased with IMPT by 14.5%, 19.4%, and 23.1%, respectively. The normal tissue complication probability for the parotid glands was significantly lower with IMPT for all sets of parameters; however, we also estimated an almost full recovery of the contralateral parotid with HT. The normal tissue complication probability for the larynx was not significantly different between the two irradiation techniques. Conclusion: Excellent target coverage, homogeneity within the PTVs, and sparing of the organs at risk were reached with both modalities. IMPT allows for better sparing of most organs at risk at medium-to-low doses.

Widesott, Lamberto [ATreP-Provincial Agency for Proton Therapy, Trento (Italy)], E-mail: widesott@atrep.it; Pierelli, Alessio; Fiorino, Claudio [Department of Medical Physics, H.S. Raffaele, Milano (Italy); Dell'Oca, Italo [Department of Radiotherapy, H.S. Raffaele, Milano (Italy); Broggi, Sara; Cattaneo, Giovanni Mauro [Department of Medical Physics, H.S. Raffaele, Milano (Italy); Di Muzio, Nadia [Department of Radiotherapy, H.S. Raffaele, Milano (Italy); Fazio, Ferruccio [Department of Radiotherapy, H.S. Raffaele, Milano (Italy); IBFM-CNR, Milano (Italy); Calandrino, Riccardo [Department of Medical Physics, H.S. Raffaele, Milano (Italy); Schwarz, Marco [ATreP-Provincial Agency for Proton Therapy, Trento (Italy)

2008-10-01T23:59:59.000Z

439

Long-term Cardiac Mortality After Hypofractionated Radiation Therapy in Breast Cancer  

SciTech Connect (OSTI)

Purpose: To explore very-long-term mortality from ischemic heart disease (IHD) after locoregional radiation therapy of breast cancer (BC) in relation to degree of hypofractionation and other treatment variables. Methods and Materials: Two hypofractionated regimens used for locoregional radiation therapy for BC from 1975 to 1991 were considered. Patients received 4.3 Gy 2/week (10 fractions; target dose 43 Gy; n=1107) or 2.5 Gy 5/week (20 fractions; target dose 50 Gy; n=459). To estimate cardiac doses, radiation fields were reconstructed in a planning system. Time to death from IHD was the endpoint, comparing the groups with each other and with age-matched, cancer-free control individuals, modeled with the Cox proportional hazards model. Results: Patients given 4.3 Gy 10 had an increased risk of dying of IHD compared with both the 2.5 Gy group (hazard ratio [HR] = 2.37; 95% confidence interval [CI]: 1.06-5.32; P=.036) and the control group (HR = 1.59; 95% CI: 1.13-2.23; P=.008). Photon beams for parasternal fields gave an increased risk of dying of IHD compared with electron beams (HR = 2.56; 95% CI: 1.12-5.84; P=.025). Multivariate analysis gave an increased risk for the 4.3-Gy versus 2.5-Gy regimen with borderline significance (HR = 2.90; 95% CI: 0.97-8.79; P=.057) but not for parasternal irradiation. Conclusions: The degree of hypofractionation and parasternal photon beams contributed to increased cardiac mortality in this patient cohort. Differences emerged after 12 to 15 years, indicating the need of more studies with observation time of 2 decades.

Tjessem, Kristin Holm, E-mail: krtjes@ous-hf.no [Department of Oncology, Oslo University Hospital, National Resource Centre for Late Effects after Cancer Treatment, Oslo (Norway); Johansen, Safora [Department of Oncology, Oslo University Hospital-Radium Hospital, and Division of Radiotherapy/Radiography, College of Oslo and Akershus, Faculty of Health, Oslo (Norway); Malinen, Eirik [Department of Medical Physics, Oslo University Hospital, Oslo (Norway); Reinertsen, Kristin V. [Department of Oncology, Oslo University Hospital, National Resource Centre for Late Effects after Cancer Treatment, Oslo (Norway); Danielsen, Turi [Department of Medical Physics, Oslo University Hospital, Oslo (Norway); Foss, Sophie D.; Foss, Alexander [Department of Oncology, Oslo University Hospital, National Resource Centre for Late Effects after Cancer Treatment, Oslo (Norway)

2013-10-01T23:59:59.000Z

440

Risk Factors and Dose-Effect Relationship for Mandibular Osteoradionecrosis in Oral and Oropharyngeal Cancer Patients  

SciTech Connect (OSTI)

Purpose: To analyze risk factors and the dose-effect relationship for osteoradionecrosis (ORN) of the mandible after radiotherapy of oral and oropharyngeal cancers. Materials and Methods: One-hundred ninety-eight patients with oral (45%) and oropharyngeal cancer (55%) who had received external radiotherapy between 1990 and 2000 were retrospectively reviewed. All patients had a dental evaluation before radiotherapy. The median radiation dose was 60 Gy (range, 16-75 Gy), and the median biologically effective dose for late effects (BED{sub late}) in bone was 114 Gy{sub 2} (range, 30-167 Gy{sub 2}). Results: The frequency of ORN was 13 patients (6.6%). Among patients with mandibular surgery, eight had ORN at the surgical site. Among patients without mandibular surgery, five patients had ORN on the molar area of the mandible. The median time to ORN was 22 months (range, 1-69 months). Univariate analysis revealed that mandibular surgery and Co-60 were significant risk factors for ORN (p = 0.01 and 0.04, respectively). In multivariate analysis, mandibular surgery was the most important factor (p = 0.001). High radiation doses over BED 102.6 Gy{sub 2} (conventional dose of 54 Gy at 1.8 Gy/fraction) were also a significant factor for ORN (p = 0.008) and showed a positive dose-effect relationship in logistic regression (p = 0.04) for patients who had undergone mandibular surgery. Conclusions: Mandibular surgery was the most significant risk factor for ORN of mandible in oral and oropharyngeal cancers patients. A BED of 102.6 Gy{sub 2} or higher to the mandible also significantly increases the risk of ORN.

Lee, Ik Jae; Koom, Woong Sub [Department of Radiation Oncology, Yonsei University College of Medicine, Seoul (Korea, Republic of); Lee, Chang Geol, E-mail: cglee1023@yuhs.a [Department of Radiation Oncology, Yonsei University College of Medicine, Seoul (Korea, Republic of); Kim, Yong Bae; Yoo, Sei Whan; Keum, Ki Chang; Kim, Gwi Eon [Department of Radiation Oncology, Yonsei University College of Medicine, Seoul (Korea, Republic of); Choi, Eun Chang [Department of Otolaryngology, Yonsei University College of Medicine, Seoul (Korea, Republic of); Cha, In Ho [Department of Oral and Maxillofacial Surgery, Yonsei University College of Dentistry, Seoul (Korea, Republic of)

2009-11-15T23:59:59.000Z

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Carbon Ion Radiation Therapy Improves the Prognosis of Unresectable Adult Bone and Soft-Tissue Sarcoma of the Head and Neck  

SciTech Connect (OSTI)

Purpose: To evaluate the safety and efficacy of carbon ion radiotherapy (C-ion RT) with 70.4 GyE for unresectable bone and soft-tissue sarcoma of the adult head and neck. Methods and Materials: Twenty-seven patients (mean age, 46.2 years) were enrolled in this prospective study on C-ion RT with 70.4 GyE/16 fractions (fr) between April 2001 and February 2008. The primary end points were acute and late reactions of normal tissues, local control rate, and overall survival rate. The secondary end point was efficacy of the treatment in comparison to historical results with 57.6 or 64.0 GyE/16 fr. Results: The 3-year local control rate and overall survival rate for all patients were 91.8% (95% confidence interval [CI] = 81.0-100%) and 74.1% (95% CI = 57.5-90.6%), respectively. Acute reaction of Grade 3 or more was observed in only 1 patient. With regard to late reactions, visual loss was observed in 1 patient and a Grade 3 reaction of the maxillary bone was observed in 4 patients. A comparison with historical results revealed that the local control rate with 70.4 GyE was significantly higher than that with 57.6 or 64.0 GyE (3-year, 91.8% vs. 23.6%, p < 0.0001). Furthermore, the overall survival with 70.4 GyE tended to be higher than that with 57.6 or 64.0 GyE (3-year, 74.1% vs. 42.9%, p = 0.09). Conclusion: C-ion RT with 70.4 GyE/16 fr for bone and soft-tissue sarcoma of the adult head and neck appears to be effective with acceptable toxicities in comparison to conventional RT and C-ion RT with lower doses.

Jingu, Keiichi [Research Center for Charged Particle Therapy, National Institute of Radiological Sciences (NIRS), Chiba (Japan); Department of Radiation Oncology, Tohoku University School of Medicine, Sendai (Japan); Tsujii, Hirohiko, E-mail: tsujii@nirs.go.jp [Research Center for Charged Particle Therapy, National Institute of Radiological Sciences (NIRS), Chiba (Japan); Mizoe, Jun-Etsu; Hasegawa, Azusa; Bessho, Hiroki; Takagi, Ryo; Morikawa, Takamichi [Research Center for Charged Particle Therapy, National Institute of Radiological Sciences (NIRS), Chiba (Japan); Tonogi, Morio [Department of Oral Medicine, Tokyo Dental College, Ichihara (Japan); Tsuji, Hiroshi; Kamada, Tadashi [Research Center for Charged Particle Therapy, National Institute of Radiological Sciences (NIRS), Chiba (Japan); Yamada, Shogo [Department of Radiation Oncology, Tohoku University School of Medicine, Sendai (Japan)

2012-04-01T23:59:59.000Z

442

EPA 402-R-99-003 ESTIMATING RADIOGENIC CANCER RISKS  

E-Print Network [OSTI]

of ionizing radiation. Using this methodology, numerical estimates of the risk per unit dose were derived the Agency's methodology for deriving estimates of excess cancer morbidity and mortality due to low doses-body radiation: the low-LET nominal estimate increased from 5.1?10-2 Gy-1 to 5.75?10-2 Gy-1 . In this document

443

Feasibility of IMRT to Cover Pelvic Nodes While Escalating the Dose to the Prostate Gland: Dosimetric Data on 35 Consecutive Patients  

SciTech Connect (OSTI)

Utilizing available dosimetric and acute toxicity data, we confirm the feasibility of intensity modulated radiotherapy (IMRT) to include treatment of the pelvic nodes (PN) while escalating the dose to the prostate. Data were obtained from 35 consecutive patients with prostate cancer with {>=}15% risk of PN involvement. Patients received an initial boost to the prostate, delivering 16 Gy over 8 fractions using a 6-field conformal technique, followed by an 8-field coplanar inverse planning IMRT technique delivering an additional 60 Gy over 30 fractions to the prostate (76 Gy total) and 54 Gy over 30 fractions to the seminal vesicles (SV) and PN. Dose-volume histogram analysis was performed for planning target volumes and organs at risk. Acute toxicity (RTOG/EORTC scale) was prospectively and independently scored weekly for each patient. The maximum, mean, minimum dose, and D95 to each planning target volume is provided: prostate (82.2, 78.2, 72.6, 75.2 Gy), SV (79.0, 72.5, 56.9, 61.1 Gy), and PN (80.4, 59.7, 46.5, 53.3 Gy), respectively. The percent volume receiving a dose at or above 'x' Gy (Vx) was recorded for V75, V70, V65, V60, and V50 as: bladder (14%, 24%, 32%, 39%, and 54%) and rectum (3%, 18%, 26%, 34%, and 51%), respectively. Acute toxicity was as follows: 54% grade 2+ GI (n = 19), 25% grade 2+ GU (n = 9). IMRT enables treatment of pelvic nodes while escalating dose to the prostate and is clinically feasible with acute toxicity within expected ranges.

Bayouth, John E. [Department of Radiation Oncology, University of Iowa Health Care, Iowa City, IA (United States)], E-mail: john-bayouth@uiowa.edu; Pena, John [Department of Medical Physics, University of Texas Medical Branch, Galveston, TX (United States); Culp, Laura [Department of Radiation Oncology, University of Texas Medical Branch, Galveston, TX (United States); Brack, Collin [Department of Medical Physics, University of Texas Medical Branch, Galveston, TX (United States); Sanguineti, Giuseppe [Department of Radiation Oncology, University of Texas Medical Branch, Galveston, TX (United States)

2008-10-01T23:59:59.000Z

444

Is there a 'mucosa-sparing' benefit of IMRT for head-and-neck cancer?  

SciTech Connect (OSTI)

Purpose: To investigate whether intensity-modulated radiation therapy (IMRT) allows more mucosal sparing than standard three-field technique (3FT) radiotherapy for early oropharyngeal cancer. Methods and Materials: Whole-field IMRT plans were generated for 5 patients with early-stage oropharyngeal cancer according to Radiation Therapy Oncology Group 0022 (66 Gy/30 fractions/6 weeks) guidelines with and without a dose objective on the portion of mucosa not overlapping any PTV. 3FT plans were also generated for the same 5 patients with two fractionation schedules: conventional fractionation (CF) to 70 Gy/35 fractions/7 weeks and concomitant boost (CB) to 72 Gy/40 fractions/6 weeks. Cumulative dose volume histograms (DVHs) of the overall mucosal volume (as per in-house definition) from all trials were compared after transformation into the linear quadratic equivalent dose at 2 Gy per fraction with a time factor correction. Results: Compared with IMRT without dose objective on the mucosa, a 30-Gy maximum dose objective on the mucosa allows {approx}20% and {approx}12% mean absolute reduction in the percentage of mucosa volume exposed to a dose equivalent to 30 Gy (p < 0.01) and 70 Gy (p < 0.01) at 2 Gy in 3 and 7 weeks, respectively, without detrimental effect on the coverage of other regions of interest. Without mucosal dose objective, IMRT is associated with a larger amount of mucosa exposed to clinically relevant doses compared with both concomitant boost and conventional fractionation; however, if a dose objective is placed, the reverse is true, with up to {approx}30% reduction in the volume of the mucosa in the high-dose region compared with both concomitant boost and conventional fractionation (p < 0.01). Conclusions: Intensity-modulated radiation therapy can be potentially provide more mucosal sparing than traditional approaches.

Sanguineti, Giuseppe [Department of Radiation Oncology, University of Texas Medical Branch, Galveston, TX (United States)]. E-mail: gisangui@utmb.edu; Endres, Eugene [Department of Medical Physics, University of Texas Medical Branch, Galveston, TX (United States); Gunn, Brandon G. [Department of Radiation Oncology, University of Texas Medical Branch, Galveston, TX (United States); Parker, Brent [Department of Medical Physics, University of Texas Medical Branch, Galveston, TX (United States)

2006-11-01T23:59:59.000Z

445

Radiation Dose-Volume Effects in the Brain  

SciTech Connect (OSTI)

We have reviewed the published data regarding radiotherapy (RT)-induced brain injury. Radiation necrosis appears a median of 1-2 years after RT; however, cognitive decline develops over many years. The incidence and severity is dose and volume dependent and can also be increased by chemotherapy, age, diabetes, and spatial factors. For fractionated RT with a fraction size of <2.5 Gy, an incidence of radiation necrosis of 5% and 10% is predicted to occur at a biologically effective dose of 120 Gy (range, 100-140) and 150 Gy (range, 140-170), respectively. For twice-daily fractionation, a steep increase in toxicity appears to occur when the biologically effective dose is >80 Gy. For large fraction sizes (>=2.5 Gy), the incidence and severity of toxicity is unpredictable. For single fraction radiosurgery, a clear correlation has been demonstrated between the target size and the risk of adverse events. Substantial variation among different centers' reported outcomes have prevented us from making toxicity-risk predictions. Cognitive dysfunction in children is largely seen for whole brain doses of >=18 Gy. No substantial evidence has shown that RT induces irreversible cognitive decline in adults within 4 years of RT.

Lawrence, Yaacov Richard, E-mail: richard.lawrence@jefferson.ed [Department of Radiation Oncology, Thomas Jefferson University, Philadelphia, PA (United States); Li, X. Allen [Department of Radiation Oncology, Medical College of Wisconsin, Milwaukee, WI (United States); El Naqa, Issam [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, MO (United States); Hahn, Carol A. [Department of Radiation Oncology, Duke University Medical Center, Durham, NC (United States); Marks, Lawrence B. [Department of Radiation Oncology, University of North Carolina, Chapel Hill, NC (United States); Merchant, Thomas E. [Department of Radiation Oncology, St. Jude Children's Research Hospital, Memphis, TN (United States); Dicker, Adam P. [Department of Radiation Oncology, Thomas Jefferson University, Philadelphia, PA (United States)

2010-03-01T23:59:59.000Z

446

Specific gene expression by extremely low-dose ionizing radiation which related to enhance proliferation of normal human diploid cells  

Science Journals Connector (OSTI)

We demonstrated that X-ray irradiation at low doses of between 2 and 5 cGy stimulated proliferation of a normal human diploid. At low doses of between 2 and 5 cGy, ERK1/2 was phosphorylated as efficiently as at higher doses between 50 and 100 cGy of X-rays, while the p53 protein level was not increased by doses below 50 cGy. On the other hand, the p53 protein was efficiently accumulated at higher doses of X-ray more than 100 cGy. ERK1/2 was phosphorylated by doses over 50 cGy with increasing doses. We found that activated ERK1/2 augmented phosphorylation of the Elk-1 protein. Furthermore, over expression of ERK2 in NCI-H1299, and human lung carcinoma cells, potentiated enhanced proliferation, while down-regulation of ERK2 using the anti-sense ERK2 gene abrogated the stimulative effect of low-dose irradiation. These results indicate that a limited range of low-dose ionizing radiation differentially activate ERK1/2 kinases, which causes enhanced proliferation of cells receiving very low doses of ionizing radiation.

Masami Watanabe; Keiji Suzuki; Seiji Kodama

2002-01-01T23:59:59.000Z

447

Consolidative Involved-Node Proton Therapy for Stage IA-IIIB Mediastinal Hodgkin Lymphoma: Preliminary Dosimetric Outcomes From a Phase II Study  

SciTech Connect (OSTI)

Purpose: To compare the dose reduction to organs at risk (OARs) with proton therapy (PT) versus three-dimensional conformal radiotherapy (3D-CRT) and intensity-modulated radiotherapy (IMRT) in patients with mediastinal Hodgkin lymphoma (HL) enrolled on a Phase II study of involved-node radiotherapy (INRT). Methods and Materials: Between June 2009 and October 2010, 10 patients were enrolled on a University of Florida institutional review board-approved protocol for de novo 'classical' Stage IA-IIIB HL with mediastinal (bulky or nonbulky) involvement after chemotherapy. INRT was planned per European Organization for Research and Treatment of Cancer guidelines. Three separate optimized plans were developed for each patient: 3D-CRT, IMRT, and PT. The primary end point was a 50% reduction in the body V4 with PT compared with 3D-CRT or IMRT. Results: The median relative reduction with PT in the primary end point, body V4, was 51% compared with 3D-CRT (p = 0.0098) and 59% compared with IMRT (p = 0.0020), thus all patients were offered treatment with PT. PT provided the lowest mean dose to the heart, lungs, and breasts for all 10 patients compared with either 3D-CRT or IMRT. The median difference in the OAR mean dose reduction with PT compared with 3D-CRT were 10.4 Gy/CGE for heart; 5.5 Gy/CGE for lung; 0.9 Gy/CGE for breast; 8.3 Gy/CGE for esophagus; and 4.1 Gy/CGE for thyroid. The median differences for mean OAR dose reduction for PT compared with IMRT were 4.3 Gy/CGE for heart, 3.1 Gy/CGE for lung, 1.4 Gy/CGE for breast, 2.8 Gy/CGE for esophagus, and 2.7 Gy/CGE for thyroid. Conclusions: All 10 patients benefitted from dose reductions to OARs with PT compared with either 3D-CRT or IMRT. It is anticipated that these reductions in dose to OAR will translate into lower rates of late complications, but long-term follow-up on this Phase II INRT study is needed.

Hoppe, Bradford S., E-mail: bhoppe@floridaproton.org [University of Florida Proton Therapy Institute, Jacksonville, FL (United States); Flampouri, Stella; Su Zhong; Morris, Christopher G. [University of Florida Proton Therapy Institute, Jacksonville, FL (United States); Latif, Naeem [University of Florida Hematology/Oncology, Jacksonville, FL (United States); Dang, Nam H.; Lynch, James [University of Florida Hematology/Oncology, Gainesville, FL (United States); Li Zuofeng; Mendenhall, Nancy P. [University of Florida Proton Therapy Institute, Jacksonville, FL (United States)

2012-05-01T23:59:59.000Z

448

Comparison of the Effects of High-Energy Photon Beam Irradiation (10 and 18 MV) on 2 Types of Implantable Cardioverter-Defibrillators  

SciTech Connect (OSTI)

Purpose: Radiation therapy for cancer may be required for patients with implantable cardiac devices. However, the influence of secondary neutrons or scattered irradiation from high-energy photons (?10 MV) on implantable cardioverter-defibrillators (ICDs) is unclear. This study was performed to examine this issue in 2 ICD models. Methods and Materials: ICDs were positioned around a water phantom under conditions simulating clinical radiation therapy. The ICDs were not irradiated directly. A control ICD was positioned 140 cm from the irradiation isocenter. Fractional irradiation was performed with 18-MV and 10-MV photon beams to give cumulative in-field doses of 600 Gy and 1600 Gy, respectively. Errors were checked after each fraction. Soft errors were defined as severe (change to safety back-up mode), moderate (memory interference, no changes in device parameters), and minor (slight memory change, undetectable by computer). Results: Hard errors were not observed. For the older ICD model, the incidences of severe, moderate, and minor soft errors at 18 MV were 0.75, 0.5, and 0.83/50 Gy at the isocenter. The corresponding data for 10 MV were 0.094, 0.063, and 0 /50 Gy. For the newer ICD model at 18 MV, these data were 0.083, 2.3, and 5.8 /50 Gy. Moderate and minor errors occurred at 18 MV in control ICDs placed 140 cm from the isocenter. The error incidences were 0, 1, and 0 /600 Gy at the isocenter for the newer model, and 0, 1, and 6 /600Gy for the older model. At 10 MV, no errors occurred in control ICDs. Conclusions: ICD errors occurred more frequently at 18 MV irradiation, which suggests that the errors were mainly caused by secondary neutrons. Soft errors of ICDs were observed with high energy photon beams, but most were not critical in the newer model. These errors may occur even when the device is far from the irradiation field.

Hashii, Haruko, E-mail: haruko@pmrc.tsukuba.ac.jp [Department of Radiation Oncology, University of Tsukuba, Tsukuba, Ibaraki (Japan)] [Department of Radiation Oncology, University of Tsukuba, Tsukuba, Ibaraki (Japan); Hashimoto, Takayuki; Okawa, Ayako; Shida, Koichi; Isobe, Tomonori [Department of Radiation Oncology, University of Tsukuba, Tsukuba, Ibaraki (Japan)] [Department of Radiation Oncology, University of Tsukuba, Tsukuba, Ibaraki (Japan); Hanmura, Masahiro; Nishimura, Tetsuo [Department of Radiation Oncology, Shizuoka Cancer Center Hospital, Nagaizumi, Shizuoka (Japan)] [Department of Radiation Oncology, Shizuoka Cancer Center Hospital, Nagaizumi, Shizuoka (Japan); Aonuma, Kazutaka [Department of Cardiovascular Medicine, University of Tsukuba, Tsukuba, Ibaraki (Japan)] [Department of Cardiovascular Medicine, University of Tsukuba, Tsukuba, Ibaraki (Japan); Sakae, Takeji; Sakurai, Hideyuki [Department of Radiation Oncology, University of Tsukuba, Tsukuba, Ibaraki (Japan)] [Department of Radiation Oncology, University of Tsukuba, Tsukuba, Ibaraki (Japan)

2013-03-01T23:59:59.000Z

449

A Phase I Study of Chemoradiotherapy With Use of Involved-Field Conformal Radiotherapy and Accelerated Hyperfractionation for Stage III Non-Small Cell Lung Cancer: WJTOG 3305  

SciTech Connect (OSTI)

Purpose: A Phase I study to determine a recommended dose of thoracic radiotherapy using accelerated hyperfractionation for unresectable non-small-cell lung cancer was conducted. Methods and Materials: Patients with unresectable Stage III non-small-cell lung cancer were treated intravenously with carboplatin (area under the concentration curve 2) and paclitaxel (40 mg/m{sup 2}) on Days 1, 8, 15, and 22 with concurrent twice-daily thoracic radiotherapy (1.5 Gy per fraction) beginning on Day 1 followed by two cycles of consolidation chemotherapy using carboplatin (area under the concentration curve 5) and paclitaxel (200 mg/m{sup 2}). Total doses were 54 Gy in 36 fractions, 60 Gy in 40 fractions, 66 Gy in 44 fractions, and 72 Gy in 48 fractions at Levels 1 to 4. The dose-limiting toxicity, defined as Grade {>=}4 esophagitis and neutropenic fever and Grade {>=}3 other nonhematologic toxicities, was monitored for 90 days. Results: Of 26 patients enrolled, 22 patients were assessable for response and toxicity. When 4 patients entered Level 4, enrollment was closed to avoid severe late toxicities. Dose-limiting toxicities occurred in 3 patients. They were Grade 3 neuropathy at Level 1 and Level 3 and Grade 3 infection at Level 1. However, the maximum tolerated dose was not reached. The median survival time was 28.6 months for all patients. Conclusions: The maximum tolerated dose was not reached, although the dose of radiation was escalated to 72 Gy in 48 fractions. However, a dose of 66 Gy in 44 fractions was adopted for this study because late toxicity data were insufficient.

Tada, Takuhito, E-mail: tada@msic.med.osaka-cu.ac.jp [Department of Radiology, Osaka City University Graduate School of Medicine, Osaka (Japan); Department of Radiology, Izumi Municipal Hospital, Izumi (Japan); Chiba, Yasutaka [Department of Environmental Medicine and Behavioural Science, Kinki University Faculty of Medicine, Osaka-sayama (Japan); Tsujino, Kayoko [Department of Radiation Oncology, Hyogo Cancer Center, Akashi (Japan); Fukuda, Haruyuki [Department of Radiology, Osaka Prefectural Medical Center for Respiratory and Allergic Diseases, Habikino (Japan); Nishimura, Yasumasa [Department of Radiation Oncology, Kinki University Faculty of Medicine, Osaka-sayama (Japan); Kokubo, Masaki [Division of Radiation Oncology, Institute of Biomedical Research and Innovation, Kobe (Japan); Negoro, Shunichi [Department of Medical Oncology, Hyogo Cancer Center, Akashi (Japan); Kudoh, Shinzoh [Department of Respiratory Medicine, Osaka City University Graduate School of Medicine, Osaka (Japan); Fukuoka, Masahiro [Department of Medical Oncology, Izumi Municipal Hospital, Izumi (Japan); Nakagawa, Kazuhiko [Department of Medical Oncology, Kinki University Faculty of Medicine, Osaka-sayama (Japan); Nakanishi, Yoichi [Research Institute for Disease of the Chest, Graduate School of Medical Science, Kyusyu University, Fukuoka (Japan)

2012-05-01T23:59:59.000Z

450

Duodenal and Other Gastrointestinal Toxicity in Cervical and Endometrial Cancer Treated With Extended-Field Intensity Modulated Radiation Therapy to Paraaortic Lymph Nodes  

SciTech Connect (OSTI)

Purpose: To characterize the rates of acute and late duodenal and other gastrointestinal (GI) toxicities among patients treated for cervical and endometrial cancers with extended-field intensity modulated radiation therapy (EF-IMRT) to the paraaortic nodes and to analyze dose-volume relationships of GI toxicities. Methods and Materials: Fifty-three patients with endometrial or cervical cancer underwent EF-IMRT to the paraaortic nodes, of whom 46 met the inclusion criteria for GI toxicity and 45 for duodenal toxicity analysis. The median prescribed dose to the paraaortic nodes was 54 Gy (range, 41.4-65 Gy). The 4 duodenal segments, whole duodenum, small bowel loops, peritoneum, and peritoneum plus retroperitoneal segments of colon were contoured retrospectively, and dosimetric analysis was performed to identify dose-volume relationships to grade ?3 acute (<90 day) and late (?90 day) GI toxicity. Results: Only 3/46 patients (6.5%) experienced acute grade ?3 GI toxicity and 3/46 patients (6.5%) experienced late grade ?3 GI toxicity. The median dose administered to these 6 patients was 50.4 Gy. One of 12 patients who received 63 to 65 Gy at the level of the renal hilum experienced grade 3 GI toxicity. Dosimetric analysis of patients with and without toxicity revealed no differences between the mean absolute or fractional volumes at any 5-Gy interval between 5 Gy and the maximum dose. None of the patients experienced duodenal toxicity. Conclusions: Treatment of paraaortic nodes with IMRT is associated with low rates of GI toxicities and no duodenal-specific toxicity, including patients treated with concurrent chemotherapy. This technique may allow sufficient dose sparing of the bowel to enable safe dose escalation to at least 65 Gy.

Poorvu, Philip D. [Department of Radiation Oncology, Brigham and Women's Hospital and Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Brigham and Women's Hospital and Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts (United States); Sadow, Cheryl A. [Department of Radiology, Brigham and Women's Hospital, and Harvard Medical School, Boston, Massachusetts (United States)] [Department of Radiology, Brigham and Women's Hospital, and Harvard Medical School, Boston, Massachusetts (United States); Townamchai, Kanokpis; Damato, Antonio L. [Department of Radiation Oncology, Brigham and Women's Hospital and Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Brigham and Women's Hospital and Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts (United States); Viswanathan, Akila N., E-mail: aviswanathan@lroc.harvard.edu [Department of Radiation Oncology, Brigham and Women's Hospital and Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts (United States)

2013-04-01T23:59:59.000Z

451

Intensity Modulated Radiation Therapy With Dose Painting to Treat Rhabdomyosarcoma  

SciTech Connect (OSTI)

Purpose: To examine local control and patterns of failure in rhabdomyosarcoma patients treated with intensity modulated radiation therapy (RT) with dose painting (DP-IMRT). Patients and Methods: A total of 41 patients underwent DP-IMRT with chemotherapy for definitive treatment. Nineteen also underwent surgery with or without intraoperative RT. Fifty-six percent had alveolar histologic features. The median interval from beginning chemotherapy to RT was 17 weeks (range, 4-25). Very young children who underwent second-look procedures with or without intraoperative RT received reduced doses of 24-36 Gy in 1.4-1.8-Gy fractions. Young adults received 50.4 Gy to the primary tumor and lower doses of 36 Gy in 1.8-Gy fractions to at-risk lymph node chains. Results: With 22 months of median follow-up, the actuarial local control rate was 90%. Patients aged {<=}7 years who received reduced overall and fractional doses had 100% local control, and young adults had 79% (P=.07) local control. Three local failures were identified in young adults whose primary target volumes had received 50.4 Gy in 1.8-Gy fractions. Conclusions: DP-IMRT with lower fractional and cumulative doses is feasible for very young children after second-look procedures with or without intraoperative RT. DP-IMRT is also feasible in adolescents and young adults with aggressive disease who would benefit from prophylactic RT to high-risk lymph node chains, although dose escalation might be warranted for improved local control. With limited follow-up, it appears that DP-IMRT produces local control rates comparable to those of sequential IMRT in patients with rhabdomyosarcoma.

Yang, Joanna C.; Dharmarajan, Kavita V. [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, New York (United States)] [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Wexler, Leonard H. [Department of Pediatrics, Memorial Sloan-Kettering Cancer Center, New York, New York (United States)] [Department of Pediatrics, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); La Quaglia, Michael P. [Department of Surgery, Memorial Sloan-Kettering Cancer Center, New York, New York (United States)] [Department of Surgery, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Happersett, Laura [Department of Medical Physics, Memorial Sloan-Kettering Cancer Center, New York, New York (United States)] [Department of Medical Physics, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Wolden, Suzanne L., E-mail: woldens@mskcc.org [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, New York (United States)

2012-11-01T23:59:59.000Z

452

Correlation of Osteoradionecrosis and Dental Events With Dosimetric Parameters in Intensity-Modulated Radiation Therapy for Head-and-Neck Cancer  

SciTech Connect (OSTI)

Purpose: Osteoradionecrosis (ORN) is a known complication of radiation therapy to the head and neck. However, the incidence of this complication with intensity-modulated radiation therapy (IMRT) and dental sequelae with this technique have not been fully elucidated. Methods and Materials: From December 2000 to July 2007, 168 patients from our institution have been previously reported for IMRT of the oral cavity, nasopharynx, larynx/hypopharynx, sinus, and oropharynx. All patients underwent pretreatment dental evaluation, including panoramic radiographs, an aggressive fluoride regimen, and a mouthguard when indicated. The median maximum mandibular dose was 6,798 cGy, and the median mean mandibular dose was 3,845 cGy. Patient visits were retrospectively reviewed for the incidence of ORN, and dental records were reviewed for the development of dental events. Univariate analysis was then used to assess the effect of mandibular and parotid gland dosimetric parameters on dental endpoints. Results: With a median clinic follow-up of 37.4 months (range, 0.8-89.6 months), 2 patients, both with oral cavity primaries, experienced ORN. Neither patient had preradiation dental extractions. The maximum mandibular dose and mean mandibular dose of the 2 patients were 7,183 and 6,828 cGy and 5812 and 5335 cGy, respectively. In all, 17% of the patients (n = 29) experienced a dental event. A mean parotid dose of >26 Gy was predictive of a subsequent dental caries, whereas a maximum mandibular dose >70 Gy and a mean mandibular dose >40 Gy were correlated with dental extractions after IMRT. Conclusions: ORN is rare after head-and-neck IMRT, but is more common with oral cavity primaries. Our results suggest different mechanisms for radiation-induced caries versus extractions.

Gomez, Daniel R., E-mail: dgomez@mdanderson.org [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Estilo, Cherry L. [Dental Service, Department of Surgery, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Wolden, Suzanne L.; Zelefsky, Michael J. [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Kraus, Dennis H.; Wong, Richard J.; Shaha, Ashok R.; Shah, Jatin P. [Department of Head and Neck Surgery, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Mechalakos, James G.; Lee, Nancy Y. [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States)

2011-11-15T23:59:59.000Z

453

Risk of Radiation Retinopathy in Patients With Orbital and Ocular Lymphoma  

SciTech Connect (OSTI)

Purpose: Radiation retinopathy is a potential long-term complication of radiation therapy to the orbit. The risk of developing this adverse effect is dose dependent; however, the threshold is unclear. The aim of this study was to identify the risk of developing radiation retinopathy at increasing radiation doses. Methods and Materials: A 40-year retrospective review was performed of patients who received external beam radiation therapy for ocular/orbital non-Hodgkin lymphoma (NHL). Results: Sixty-seven patients who had at least one ophthalmic follow-up examination were included in this study. Most patients (52%) were diagnosed with NHL involving the orbit. Patients received external beam radiation therapy at doses between 1886 and 5400 cGy (mean, 3033 {+-} 782 cGy). Radiation retinopathy developed in 12% of patients, and the median time to diagnosis was 27 months (range, 15-241months). The mean prescribed radiation dose in patients with retinopathy was 3309 {+-} 585 cGy, and the estimated retinal dose (derived by reviewing the dosimetry) was 3087 {+-} 1030 cGy. The incidence of retinopathy increased with dose. The average prescribed daily fractionated dose was higher in patients who developed retinopathy than in patients who did not (mean, 202 cGy vs 180 cGy, respectively; P = .04). More patients with radiation retinopathy had comorbid diabetes mellitus type 2 than patients without retinopathy (P = .015). In our study, the mean visual acuity of the eyes that received radiation was worse than that of the eyes that did not (P = .027). Other postradiotherapy ocular findings included keratitis (6%), dry eyes (39%), and cataract (33%). Conclusions: Radiation retinopathy, a known complication of radiotherapy for orbital tumors, relates to vascular comorbidities and dose. Higher total doses and larger daily fractions (>180 cGy) appear to be related to higher rates of retinopathy. Future larger studies are required to identify a statistically significant threshold for the development of retinopathy.

Kaushik, Megha; Pulido, Jose S. [Department of Ophthalmology, Mayo Clinic, Rochester, Minnesota (United States)] [Department of Ophthalmology, Mayo Clinic, Rochester, Minnesota (United States); Schild, Steven E. [Division of Radiation Oncology, Mayo Clinic, Scottsdale, Arizona (United States)] [Division of Radiation Oncology, Mayo Clinic, Scottsdale, Arizona (United States); Stafford, Scott, E-mail: stafford.scott@mayo.edu [Division of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States)] [Division of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States)

2012-12-01T23:59:59.000Z

454

Stimulation of Hepatoma Cell Invasiveness and Metastatic Potential by Proteins Secreted From Irradiated Nonparenchymal Cells  

SciTech Connect (OSTI)

Purpose: To determine whether factors secreted by irradiated liver nonparenchymal cells (NPCs) may influence invasiveness and/or metastatic potential of hepatocellular carcinoma (HCC) cells and to elucidate a possible mechanism for such effect. Methods and Materials: Primary rat NPCs were cultured and divided into irradiated (10-Gy X-ray) and nonirradiated groups. Forty-eight hours after irradiation, conditioned medium from irradiated (SR) or nonirradiated (SnonR) cultures were collected and added to sublethally irradiated cultures of the hepatoma McA-RH7777 cell line. Then, hepatoma cells were continuously passaged for eight generations (RH10Gy-SR and RH10Gy-SnonR). The invasiveness and metastatic potential of McA-RH7777, RH10Gy-SnonR, and RH10Gy-SR cells were evaluated using an in vitro gelatinous protein (Matrigel) invasion and an in vivo metastasis assay. In addition, SR and SnonR were tested using rat cytokine antibody arrays and enzyme-linked immunosorbent assay (ELISA). Results: In vitro gelatinous protein invasion assay indicated that the numbers of invading cells was significantly higher in RH10Gy-SR (40 {+-} 4.74) than in RH10Gy-SnonR (30.6 {+-} 3.85) cells, and lowest in McA-RH7777 (11.4 {+-} 3.56) cells. The same pattern was observed in vivo in a lung metastasis assay, as evaluated by number of metastatic lung nodules seen with RH10Gy-SR (28.83 {+-} 5.38), RH10Gy-SnonR (22.17 {+-} 4.26), and McA-RH7777 (8.3 {+-} 3.8) cells. Rat cytokine antibody arrays and ELISA demonstrated that metastasis-promoting cytokines (tumor necrosis factor-{alpha} and interleukin-6), circulating growth factors (vascular endothelial growth factor and epidermal growth factor), and metalloproteinases (MMP-2 and MMP-9) were upregulated in SR compared with SnonR. Conclusions: Radiation can increase invasiveness and metastatic potential of sublethally irradiated hepatoma cells, and soluble mediators released from irradiated NPCs promote this potential. Increased secretion of metastasis-related cytokines and factors from NPCs after irradiation may be a possible mechanism for the radiation-induced invasiveness and metastatic potential of HCC.

Zhou Leyuan [Department of Radiation Oncology, Zhongshan Hospital, Fudan University, Shanghai (China)] [Department of Radiation Oncology, Zhongshan Hospital, Fudan University, Shanghai (China); Wang Zhiming [Department of Medical Oncology, Zhongshan Hospital, Fudan University, Shanghai (China)] [Department of Medical Oncology, Zhongshan Hospital, Fudan University, Shanghai (China); Gao Yabo [Department of Radiation Oncology, Zhongshan Hospital, Fudan University, Shanghai (China)] [Department of Radiation Oncology, Zhongshan Hospital, Fudan University, Shanghai (China); Wang Lingyan [Experimental Research Center, Zhongshan Hospital, Fudan University, Shanghai (China)] [Experimental Research Center, Zhongshan Hospital, Fudan University, Shanghai (China); Zeng Zhaochong, E-mail: zeng.zhaochong@zs-hospital.sh.cn [Department of Radiation Oncology, Zhongshan Hospital, Fudan University, Shanghai (China)

2012-11-01T23:59:59.000Z

455

Dosimetric Comparison of 6 MV and 15 MV Single Arc Rapidarc to Helical TomoTherapy for the Treatment of Pancreatic Cancer  

SciTech Connect (OSTI)

We conducted a planning study to compare Varian's RapidArc (RA) and helical TomoTherapy (HT) for the treatment of pancreatic cancer. Three intensity-modulated radiotherapy (IMRT) plans were generated for 8 patients with pancreatic cancer: one using HT with 6-MV beam (Plan{sub HT6}), one using single-arc RA with 6-MV beam (Plan{sub RA6}), and one using single-arc RA with 15-MV beam (Plan{sub RA15}). Dosimetric indices including high/low conformality index (CI{sub 100%}/CI{sub 50%}), heterogeneity index (HI), monitor units (MUs), and doses to organs at risk (OARs) were compared. The mean CI{sub 100%} was statistically equivalent with respect to the 2 treatment techniques, as well as beam energy (0.99, 1.01, and 1.02 for Plan{sub HT6}, Plan{sub RA6}, and Plan{sub RA156,} respectively). The CI{sub 50%} and HI were improved in both RA plans over the HT plan. The RA plans significantly reduced MU (MU{sub RA6} = 697, MU{sub RA15} = 548) compared with HT (MU{sub HT6} = 6177, p = 0.008 in both cases). The mean maximum cord dose was decreased from 29.6 Gy in Plan{sub HT6} to 21.6 Gy (p = 0.05) in Plan{sub RA6} and 21.7 Gy (p = 0.04) in Plan{sub RA15}. The mean bowel dose decreased from 17.2 Gy in Plan{sub HT6} to 15.2 Gy (p = 0.03) in Plan{sub RA6} and 15.0 Gy (p = 0.03) Plan{sub RA15}. The mean liver dose decreased from 8.4 Gy in Plan{sub HT6} to 6.3 Gy (p = 0.04) in Plan{sub RA6} and 6.2 Gy in Plan{sub RA15}. Variations of the mean dose to the duodenum, kidneys, and stomach were statistically insignificant. RA and HT can both deliver conformal dose distributions to target volumes while limiting the dose to surrounding OARs in the treatment of pancreatic cancer. Dosimetric advantages might be gained by using RA over HT by reducing the dose to OARs and total MUs used for treatment.

Cai Jing, E-mail: jing.cai@duke.edu [Department of Radiation Oncology, Duke University Medical Center, Durham, NC (United States); Department of Radiation Oncology, University of Virginia, Charlottesville, VA (United States); Yue Jinbo [Department of Radiation Oncology, Duke University Medical Center, Durham, NC (United States); Department of Radiation Oncology, Shandong Cancer Hospital, Jinan, Shandong (China); McLawhorn, Robert; Yang Wensha; Wijesooriya, Krishni; Dunlap, Neal E.; Sheng Ke [Department of Radiation Oncology, University of Virginia, Charlottesville, VA (United States); Yin Fangfang [Department of Radiation Oncology, Duke University Medical Center, Durham, NC (United States); Benedict, Stanley H. [Department of Radiation Oncology, University of Virginia, Charlottesville, VA (United States)

2011-10-01T23:59:59.000Z

456

N-Terminal Pro-B-Type Natriuretic Peptide Plasma Levels as a Potential Biomarker for Cardiac Damage After Radiotherapy in Patients With Left-Sided Breast Cancer  

SciTech Connect (OSTI)

Purpose: Adjuvant radiotherapy (RT) after breast-conserving surgery has been associated with increased cardiovascular mortality. Cardiac biomarkers may aid in identifying patients with radiation-mediated cardiac dysfunction. We evaluated the correlation between N-terminal pro-B-type natriuretic peptide (NT-proBNP) and troponin (TnI) and the dose of radiation to the heart in patients with left-sided breast cancer. Methods and Materials: NT-proBNP and TnI plasma concentrations were measured in 30 left-sided breast cancer patients (median age, 55.0 years) 5 to 22 months after RT (Group I) and in 30 left-sided breast cancer patients (median age, 57.0 years) before RT as control group (Group II). Dosimetric and geometric parameters of heart and left ventricle were determined in all patients of Group I. Seventeen patients underwent complete two-dimensional echocardiography. Results: NT-proBNP levels were significantly higher (p = 0.03) in Group I (median, 90.0 pg/ml; range, 16.7-333.1 pg/ml) than in Group II (median, 63.2 pg/ml; range, 11.0-172.5 pg/ml). TnI levels remained below the cutoff threshold of 0.07 ng/ml in both groups. In patients with NT-proBNP values above the upper limit of 125 pg/ml, there were significant correlations between plasma levels and V{sub 3Gy}(%) (p = 0.001), the ratios D{sub 15cm{sup 3}}(Gy)/D{sub mean}(Gy) (p = 0.01), the ratios D{sub 15cm}{sup 3}/D{sub 50%} (Gy) (p = 0.008) for the heart and correlations between plasma levels and V{sub 2Gy} (%) (p = 0.002), the ratios D{sub 1cm{sup 3}}(Gy)/D{sub mean}(Gy) (p = 0.03), and the ratios D{sub 0.5cm{sup 3}}(Gy)/D{sub 50%}(Gy) (p = 0.05) for the ventricle. Conclusions: Patients with left-sided breast cancer show higher values of NT-pro BNP after RT when compared with non-RT-treated matched patients, increasing in correlation with high doses in small volumes of heart and ventricle. The findings of this study show that the most important parameters are not the mean doses but instead the small percentage of organ volumes (heart or ventricle) receiving high dose levels, supporting the notion that the heart behaves as a serial organ.

D'Errico, Maria P., E-mail: patderrico@libero.it [Department of Laboratory Medicine, 'A. Perrino' Hospital, Brindisi (Italy); Grimaldi, Luca [Department of Medical Physics, 'A. Perrino' Hospital, Brindisi (Italy); Petruzzelli, Maria F. [Department of Radiation Oncology, 'A. Perrino' Hospital, Brindisi (Italy); Gianicolo, Emilio A.L. [Clinical Physiology Institute, National Research Council (IFC-CNR), Pisa-Lecce (Italy); Tramacere, Francesco [Department of Radiation Oncology, 'A. Perrino' Hospital, Brindisi (Italy); Monetti, Antonio; Placella, Roberto [Department of Laboratory Medicine, 'A. Perrino' Hospital, Brindisi (Italy); Pili, Giorgio [Department of Medical Physics, 'A. Perrino' Hospital, Brindisi (Italy); Andreassi, Maria Grazia; Sicari, Rosa; Picano, Eugenio [Clinical Physiology Institute, National Research Council (IFC-CNR), Pisa-Lecce (Italy); Portaluri, Maurizio [Department of Radiation Oncology, 'A. Perrino' Hospital, Brindisi (Italy); Clinical Physiology Institute, National Research Council (IFC-CNR), Pisa-Lecce (Italy)

2012-02-01T23:59:59.000Z

457

Harnessing a radiation inducible promoter of Deinococcus radiodurans for enhanced precipitation of uranium  

Science Journals Connector (OSTI)

Abstract Bioremediation is an attractive option for the treatment of radioactive waste. We provide a proof of principle for augmentation of uranium bioprecipitation using the radiation inducible promoter, Pssb from Deinococcus radiodurans. Recombinant cells of D. radiodurans carrying acid phosphatase gene, phoN under the regulation of Pssb when exposed to 7kGy gamma radiation at two different dose rates of 56.8Gy/min and 4Gy/min, showed 89 fold increase in acid phosphatase activity. Highest whole cell PhoN activity was obtained after 2h in post irradiation recovery following 8kGy of high dose rate radiation. Such cells showed faster removal of high concentrations of uranium than recombinant cells expressing PhoN under a radiation non-inducible deinococcal promoter, PgroESL and could precipitate uranium even after continuous exposure to 0.6Gy/min gamma radiation for 10 days. Radiation induced recombinant D. radiodurans cells when lyophilized retained high levels of PhoN activity and precipitated uranium efficiently. These results highlight the importance of using a suitable promoter for removal of radionuclides from solution.

Chitra Seetharam Misra; Rita Mukhopadhyaya; Shree Kumar Apte

2014-01-01T23:59:59.000Z

458

Effect of Cisplatin on Parotid Gland Function in Concomitant Radiochemotherapy  

SciTech Connect (OSTI)

Purpose: To determine the influence of concomitant radiochemotherapy with cisplatin on parotid gland tissue complication probability. Methods and Materials: Patients treated with either radiotherapy (n = 61) or concomitant radiochemotherapy with cisplatin (n = 36) for head-and-neck cancer were prospectively evaluated. The dose and volume distributions of the parotid glands were noted in dose-volume histograms. Stimulated salivary flow rates were measured before, during the 2nd and 6th weeks and at 4 weeks and 6 months after the treatment. The data were fit using the normal tissue complication probability model of Lyman. Complication was defined as a reduction of the salivary flow rate to less than 25% of the pretreatment flow rate. Results: The normal tissue complication probability model parameter TD{sub 50} (the dose leading to a complication probability of 50%) was found to be 32.2 Gy at 4 weeks and 32.1 Gy at 6 months for concomitant radiochemotherapy and 41.1 Gy at 4 weeks and 39.6 Gy at 6 months for radiotherapy. The tolerated dose for concomitant radiochemotherapy was at least 7 to 8 Gy lower than for radiotherapy alone at TD{sub 50}. Conclusions: In this study, the concomitant radiochemotherapy tended to cause a higher probability of parotid gland tissue damage. Advanced radiotherapy planning approaches such as intensity-modulated radiotherapy may be partiticularly important for parotid sparing in radiochemotherapy because of cisplatin-related increased radiosensitivity of glands.

Hey, Jeremias; Setz, Juergen [Department of Prosthetic Dentistry, University School of Dental Medicine, Martin- Luther- University, Halle (Germany); Gerlach, Reinhard; Vordermark, Dirk [Department of Radiotherapy, University Clinic, Martin-Luther-University, Halle (Germany); Gernhardt, Christian R. [Department of Operative Dentistry and Periodontology, University School of Dental Medicine, Martin-Luther-University, Halle (Germany); Kuhnt, Thomas, E-mail: thomas.kuhnt@medizin.uni-halle.d [Department of Radiotherapy, University Clinic, Martin-Luther-University, Halle (Germany)

2009-12-01T23:59:59.000Z

459

Nanocrystalline BaSO{sub 4}:Eu For Dosimetry of Proton Beams  

SciTech Connect (OSTI)

Nanocrystalline BaSO{sub 4} doped with Eu, was prepared by the Chemical Co-precipitation method. The particle size was calculated by the broadening of the XRD peaks using Scherrer's formula with particle size around 45 nm. Samples in the form of pellets were irradiated by 150 MeV proton beam with dose range of 0.1 Gy to 325 Gy. Thermoluminescence (TL) glow curves of the irradiated samples were recorded and studied. It has been found that there are two prominent TL glow peaks at 460 K and 495 K. The TL response is sublinear below 1 Gy, linear in the range 1 Gy to 200 Gy and then becomes supralinear for higher doses. The wider linear TL response of nanocrystalline BaSO{sub 4}:Eu and low fading makes it a superior candidate as a dosimeter to be used for detecting the doses of protons for its various applications in the field of space, therapy and research.

Bahl, Shaila; Kumar, Pratik [Medical Physics Unit, IRCH, AIIMS, New Delhi-110029 (India); Lochab, S. P. [Inter-University Accelerator Center, Aruna Asaf Ali Marg, New Delhi - 110067 (India); Pandey, Anant [Department of Physics, Sri Venkateswara College, New Delhi-110021 (India); Aleynikov, V. E.; Molokanov, A. [Joint Institute for Nuclear Research, Dubna - 141980 (Russian Federation)

2011-07-15T23:59:59.000Z

460

I I  

Office of Legacy Management (LM)

. . . *" I I , * . I i 1 c . .I ,:i "3-' " ' . -2 " t 3 . I --G;ig !L. r . . *, VJ! :.l*fJcJ Jr) I.AW ro ' *Ii ' Jf!l Wltli tl Nfl Nl!E \:' I !,l' fJ' .IOO. flf.VJ JEl1l.t' y f;'l>!J&r,.:.?u/' ,TCLT.X I:$.: oJitIlrIi.try 31, I.! . J+lr. ..J. (J. $l:i*~li.llil 1.~3.usl11 ll$, n:t:\.; ycr,.d< L1365 - __.. .: ..,, . . I)l~il~,' III' . StCl)i llil : . A 11c;i3.1-11 l%?,.si cs SI.II-vcy W;I.C' co~lt?~~i:tc-' d at $m:. facility in 1:)lp cj ntlf~l- I.)] oc-!c lItl-i.1 di lip; ?lOiIsi I!:; tllcl lIi'lltl,ecJIl o ~fr~I~<*I-iit:ol- on J.TIILI,CW~ ' . 22, 3.5' 7::. ' ]' ]]p iITc' ;l \x' ;lS InC1~Ti~' O]:("i[ rr?l* j'l.'!i!lJ\?il!1~f.' :Yl:i.t'i LIltI COl:tc?!n-j liation by I1Ictll!ds llJ;J. I. , 3 J '0'1'~' i iltl? fijr tll;~t JK1l.t i.ci1.I;l.r Ilwl.jdv.

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Low and Room Temperature X-ray Structures of Protein Kinase A Ternary Complexes Shed New Light on Its Activity  

SciTech Connect (OSTI)

Posttranslational protein phosphorylation by protein kinase A (PKA) is a ubiquitous signaling mechanism which regulates many cellular processes. A low temperature X-ray structure of the PKA catalytic subunit (PKAc) ternary complex with ATP and a 20-residue peptidic inhibitor (IP20) at the physiological Mg2+ concentration of < 0.5mM revealed a single metal ion in the active site. The lack of a second metal in the low-temperature LT-PKAc-MgATP-IP20 renders the and phosphoryl groups of ATP to be very flexibile, with high thermal B-factors. Thus, the second metal is crucial for tight positioning of the terminal phosphoryl for transfer to a substrate, as demonstrated by comparison of the former structure with LT-PKAc- Mg2ATP-IP20 complex. In addition to the kinase activity, PKAc is also able to slowly catalyze the hydrolysis of ATP using a water molecule as a substrate. We found that at room temperature under X-ray irradiation ATP can be readily and completely hydrolyzed into ATP and a free phosphate ion in the crystals of the ternary complex LT-PKAc- Mg2ATP-IP20. The cleavage of ATP may be aided by X-ray-born free hydroxyl radicals, a very reactive chemical species, that move quickly through the crystal at room temperature. The phosphate anion is clearly visible in the electron density maps; it remains in the active site, but slides about 2 from its position in ATP toward Ala21 of IP20 that mimics the phosphorylation site. The phosphate, thus, pushes the peptidic inhibitor away from the product ADP, while resulting in dramatic conformational changes of IP20 terminal residues 24 and 25. X-ray structures of PKAc in complex with non-hydrolyzable ATP analog, AMPPNP, at both room and low temperatures demonstrated no temperature effects on the conformation and position of IP20.

Fisher, Zoe [Los Alamos National Laboratory (LANL); Hanson, Leif [University of Toledo, Toledo, OH; Kovalevsky, Andrey [Los Alamos National Laboratory (LANL); Langan, Paul [ORNL

2012-01-01T23:59:59.000Z

462

Engineering development of coal-fired high-performance power systems  

SciTech Connect (OSTI)

In Phase I of the project, a conceptual design of a coal-fired high performance power system was developed, and small scale R&D was done in critical areas of the design. The current Phase Of the project includes development through the pilot plant stage, and design of a prototype plant that would be built in Phase 3. Foster Wheeler Development Corporation is leading a team of companies in this effort: AlliedSignal Aerospace Equipment Systems, Bechtel Corporation, University of Tennessee Space Institute (UTSI), and Westinghouse Electric Corporation. The power generating system being developed in this project will be an improvement over current coal-fired systems. The following goals have been identified that relate to the efficiency,emissions, costs and general operation of the system: total station efficiency of at least 4 percent on a higher heating value basis; emissions--NOx {lt} 0.06 lb/MMBtu, SOx {lt} 0.06 lb/MMBtu, particulates {lt} 0.003 lb/MMBtu; all solid wastes must be benign with regard to disposal; over 95 percent of the total heat input is ultimately from coal, with initial systems capable of using coal for at least 65 percent of the heat input; 10 percent lower cost of electricity relative to a modern coal-fired plant conforming to NSPS. The base case arrangement of the HIPPS cycle is a combined cycle plant, and is referred to as the All Coal HIPPS because it does not require any other fuels for normal operation. An alternative HIPPS cycle uses a ceramic air heater to heat the air to temperatures above what can be achieved with alloy tubes. This arrangement is referred to as the 35 percent natural gas HIPPS. 2 refs., 11 figs. 3 tabs.

NONE

1996-06-01T23:59:59.000Z

463

On a recent preliminary study for the measurement of the Lense-Thirring effect with the Galileo satellites  

E-Print Network [OSTI]

It has been recently proposed to combine the node drifts of the future constellation of 27 Galileo spacecraft together with those of the existing LAGEOS-type satellites to improve the accuracy of the past and ongoing tests of the Lense-Thirring (LT) effect by removing the bias of a larger number of even zonal harmonics $J_{\\ell}$ than either done or planned so far. Actually, it seems a difficult goal to be realistically achieved for a number of reasons. First, the LT range signature of a Galileo-type satellite is as little as $0.5$ mm over 3-days arcs, corresponding to a node rate of just $\\dot\\Omega_{\\rm LT}=2$ milliarcseconds per year (mas yr$^{-1}$). Some tesseral and sectorial ocean tides such as $K_1,K_2$ induce long-period harmonic node perturbations with frequencies which are integer multiples of the extremely slow Galileo's node rate $\\dot\\Omega$ completing a full cycle in about 40 yr. Thus, over time spans $T$ of some years they would act as superimposed semi-secular aliasing trends. Since the coefficients of the $J_{\\ell}$-free multisatellite linear combinations are determined only by the semimajor axis $a$, the eccentricity $e$ and the inclination $I$, which are nominally equal for all the Galileo satellites, it is not possible to include all of them. Even by using only one Galileo spacecraft together with the LAGEOS family would be unfeasible because the resulting Galileo coefficient would be $\\gtrsim 1$, thus enhancing the aliasing impact of the uncancelled non-conservative and tidal perturbations.

Lorenzo Iorio

2013-11-24T23:59:59.000Z

464

Final Technical Report: Response of Mediterranean-Type Ecosystems to Elevated Atmospheric CO2 and Associated Climate Change  

SciTech Connect (OSTI)

This research incorporated an integrated hierarchical approach in space, time, and levels of biological/ecological organization to help understand and predict ecosystem response to elevated CO{sub 2} and concomitant environmental change. The research utilized a number of different approaches, and collaboration of both PER and non-PER investigators to arrive at a comprehensive, integrative understanding. Central to the work were the CO{sub 2}-controlled, ambient Lit, Temperature controlled (CO{sub 2}LT) null-balance chambers originally developed in the arctic tundra, which were re-engineered for the chaparral with treatment CO{sub 2} concentrations of from 250 to 750 ppm CO{sub 2} in 100 ppm increments, replicated twice to allow for a regression analysis. Each chamber was 2 meters on a side and 2 meters tall, which were installed over an individual shrub reprouting after a fire. This manipulation allowed study of the response of native chaparral to varying levels of CO{sub 2}, while regenerating from an experimental burn. Results from these highly-controlled manipulations were compared against Free Air CO{sub 2} Enrichment (FACE) manipulations, in an area adjacent to the CO{sub 2}LT null balance greenhouses. These relatively short-term results (5-7 years) were compared to long-term results from Mediterranean-type ecosystems (MTEs) surrounding natural CO{sub 2} springs in northern Italy, near Laiatico, Italy. The springs lack the controlled experimental rigor of our CO{sub 2}LT and FACE manipulation, but provide invaluable validation of our long-term predictions.

Oechel, Walter C

2002-08-15T23:59:59.000Z

465

Steam driven large multi effect MVC (SD MVC) desalination process for lower energy consumption and desalination costs  

Science Journals Connector (OSTI)

It has been published and demonstrated in operating plants that the low-temperature multi effect desalination process (LT MED) when operated on turbine backpressure steam requires minimal energy consumption yielding specific desalination energy costs approaching values of optimal RO energy costs. However due to variations in electricity demand, the operation of large steam turbines at base load is in most cases impractical. As a result, in order to allow variations in electricity supply and full capacity of the desalination extraction, steam extracted from the turbines at higher pressures than the back pressure is commonly used. The extraction steam pressure of these turbines is in the range of 1.54.5 barg. (Typically as required for process steam at refineries and for MSF desalination plants). The LT MED process when utilizing such extraction steam incorporates thermo compressors (steam ejectors) in order to take advantage of the excessive extraction steam pressure, thereby increasing the economy ratio of the MED (decreasing energy consumption). Thermo compressors (ejectors) as a rule have a relatively low adiabatic efficiency, thus limiting the potential of the MED to increase the economy ratio even more. In this paper an approach of using a novel large centrifugal compressor driven by an auxiliary steam turbine utilizing the extraction steam is incorporated instead of the thermo compressor for large LT MED plants. The centrifugal compressor and auxiliary turbine having a much higher efficiency than the thermo compressor results in significant energy savings, thus lowering the desalination costs. This paper will also describe the thermodynamic advantages, the specific investment and desalination costs comparison, and the resulting desalination cost reduction potential of the steam-driven multi effect MVC process.

A. Ophir; A. Gendel

2007-01-01T23:59:59.000Z

466

 

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

ØPhotoshop 3.08BIM%8BIMê!ß ØPhotoshop 3.08BIM%8BIMê!ß&lt;?xml version="1.0" encoding="UTF-8"?> com.apple.print.PageFormat.FormattingPrinter com.apple.print.ticket.creator com.apple.printingmanager com.apple.print.ticket.itemArray com.apple.print.PageFormat.FormattingPrinter _222_A112_HPZ6100PSC com.apple.print.ticket.client com.apple.printingmanager

467

 

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Photoshop 3.08BIM%8BIMê!ß Photoshop 3.08BIM%8BIMê!ß&lt;?xml version="1.0" encoding="UTF-8"?> com.apple.print.PageFormat.FormattingPrinter com.apple.print.ticket.creator com.apple.printingmanager com.apple.print.ticket.itemArray com.apple.print.PageFormat.FormattingPrinter _222_A112_HPZ6100PSC com.apple.print.ticket.client com.apple.printingmanager

468

 

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

ÔPhotoshop 3.08BIM%8BIMê!ß ÔPhotoshop 3.08BIM%8BIMê!ß&lt;?xml version="1.0" encoding="UTF-8"?> com.apple.print.PageFormat.FormattingPrinter com.apple.print.ticket.creator com.apple.printingmanager com.apple.print.ticket.itemArray com.apple.print.PageFormat.FormattingPrinter _222_A112_HPZ6100PSC com.apple.print.ticket.client com.apple.printingmanager

469

 

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

ðÿíD†Photoshop 3.08BIM%8BIMê!ß ðÿíD†Photoshop 3.08BIM%8BIMê!ß&lt;?xml version="1.0" encoding="UTF-8"?> com.apple.print.PageFormat.FormattingPrinter com.apple.print.ticket.creator com.apple.printingmanager com.apple.print.ticket.itemArray com.apple.print.PageFormat.FormattingPrinter _222_A112_HPZ6100PSC com.apple.print.ticket.client com.apple.printingmanager

470

 

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

™ÿí>úPhotoshop 3.08BIM%8BIMê!ß ™ÿí>úPhotoshop 3.08BIM%8BIMê!ß&lt;?xml version="1.0" encoding="UTF-8"?> com.apple.print.PageFormat.FormattingPrinter com.apple.print.ticket.creator com.apple.printingmanager com.apple.print.ticket.itemArray com.apple.print.PageFormat.FormattingPrinter _222_A112_HPZ6100PSC com.apple.print.ticket.client com.apple.printingmanager

471

Microsoft Word - Coverpage.doc  

Broader source: Energy.gov (indexed) [DOE]

Securing Cyberspace Securing Cyberspace for the 44 th Presidency A Report of the CSIS Commission on Cybersecurity for the 44 th Presidency Cochairs: Representative James R. Langevin Representative Michael T. McCaul Scott Charney Lt. General Harry Raduege, USAF (Ret) Project Director: James A. Lewis Center for Strategic and International Studies Washington, DC December 2008 About CSIS In an era of ever-changing global opportunities and challenges, the Center for Strategic and International Studies (CSIS) provides strategic insights and practical policy solutions to decisionmakers. CSIS conducts research and analysis and develops policy initiatives that look into the future and anticipate change. Founded by David M. Abshire and Admiral Arleigh Burke at

472

 

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

PPhotoshop 3.08BIM%8BIMê!ß PPhotoshop 3.08BIM%8BIMê!ß&lt;?xml version="1.0" encoding="UTF-8"?> com.apple.print.PageFormat.FormattingPrinter com.apple.print.ticket.creator com.apple.printingmanager com.apple.print.ticket.itemArray com.apple.print.PageFormat.FormattingPrinter _222_A112_HPZ6100PSC com.apple.print.ticket.client com.apple.printingmanager

473

 

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

DjPhotoshop 3.08BIM%8BIMê!ß DjPhotoshop 3.08BIM%8BIMê!ß&lt;?xml version="1.0" encoding="UTF-8"?> com.apple.print.PageFormat.FormattingPrinter com.apple.print.ticket.creator com.apple.printingmanager com.apple.print.ticket.itemArray com.apple.print.PageFormat.FormattingPrinter _222_A112_HPZ6100PSC com.apple.print.ticket.client com.apple.printingmanager

474

MHK Projects/NPI 016A | Open Energy Information  

Open Energy Info (EERE)

< MHK Projects &lt; MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}

475

untitled  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

7, as submitted by 7, as submitted by center offices and selected by the division offices. Each citation is followed by the center numbers of centers that contributed most directly to the effort described. An acronym after each accomplishment indicates which of Sandia's strategic management units (SMUs) or strategic management groups (SMGs) the work most directly supported. The SMG/SMU acronyms are: NW: Nuclear Weapons SMG & SMU ITS: Integrated Technologies & Systems SMG LT: Laboratory Transformation SMG DS&A: Defense Systems & Assessments SMU ER&N: Energy, Resources, & Nonproliferation SMU HS&D: Homeland Security & Defense SMU ST&E: Science, Technology, & Engineering SMU IES: Integrated Enabling Services SMU Sandia National Laboratories

476

 

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

˜Photoshop 3.08BIM%8BIMê!ß ˜Photoshop 3.08BIM%8BIMê!ß&lt;?xml version="1.0" encoding="UTF-8"?> com.apple.print.PageFormat.FormattingPrinter com.apple.print.ticket.creator com.apple.printingmanager com.apple.print.ticket.itemArray com.apple.print.PageFormat.FormattingPrinter _222_A112_HPZ6100PSC com.apple.print.ticket.client com.apple.printingmanager

477

I,  

Office of Legacy Management (LM)

. . co. 1-3 \ /j ' I ' I, /\ <)y l,T. , li l ' \ .; li. ,\, ( ; i ' F,' ' , I! \,,i.' ,;, " 1 FORMERLY UTILIZED SITES REMEDIAL ACTION PROGRAM ELIMINATION REPORT FOR COLORADO SCHOOL OF MINES GOLDEN, COLORADO Department of Energy Office of Nuclear Energy Office of Remedial Action and Waste Technology Division of Facility and Site Decomrbiissioning Projects _- .__.. . . CONTENTS INTRODUCTION BACKGROUND Site Function Site Description Radiological History and Status ELIMINATION ANALYSIS REFERENCES ii Page 1 2 4 -- -.-- ---.l__ - ~----.~--~.- _.._ -._-,-_- ___.___.. ELIMINATION REPORT COLORADO SCHOOL OF MINES GOLDEN, COLORADO INTRODUCTION The Department of Energy (DOE), Office of huclear Energy, Office of Terminal Waste Disposal and Remedial Action, Division of Remedial

478

 

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

lPhotoshop 3.08BIM8BIM%èñ\ó/Á¡¢{g-ÅdÕº8BIMê° lPhotoshop 3.08BIM8BIM%èñ\ó/Á¡¢{g-ÅdÕº8BIMê°&lt;?xml version="1.0" encoding="UTF-8"?> com.apple.print.PageFormat.PMHorizontalRes com.apple.print.ticket.creator com.apple.printingmanager com.apple.print.ticket.itemArray com.apple.print.PageFormat.PMHorizontalRes 72 com.apple.print.ticket.client com.apple.printingmanager

479

 

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

ŠPhotoshop 3.08BIM%8BIMê!ß ŠPhotoshop 3.08BIM%8BIMê!ß&lt;?xml version="1.0" encoding="UTF-8"?> com.apple.print.PageFormat.FormattingPrinter com.apple.print.ticket.creator com.apple.printingmanager com.apple.print.ticket.itemArray com.apple.print.PageFormat.FormattingPrinter _222_A112_HPZ6100PSC com.apple.print.ticket.client com.apple.printingmanager

480

MHK Projects/NPI 023 | Open Energy Information  

Open Energy Info (EERE)

< MHK Projects &lt; MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}

Note: This page contains sample records for the topic "lt lesotho gy" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

MHK Projects/NPI 055 | Open Energy Information  

Open Energy Info (EERE)

< MHK Projects &lt; MHK Projects Jump to: navigation, search << Return to the MHK database homepage Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"500px","height":"350px","centre":false,"title":"","label":"","icon":"File:Aquamarine-marker.png","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[]}

482

 

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

AØPhotoshop 3.08BIM%8BIMê!ß AØPhotoshop 3.08BIM%8BIMê!ß&lt;?xml version="1.0" encoding="UTF-8"?> com.apple.print.PageFormat.FormattingPrinter com.apple.print.ticket.creator com.apple.printingmanager com.apple.print.ticket.itemArray com.apple.print.PageFormat.FormattingPrinter _222_A112_HPZ6100PSC com.apple.print.ticket.client com.apple.printingmanager

483

 

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

BPhotoshop 3.08BIM%8BIMê!ß BPhotoshop 3.08BIM%8BIMê!ß&lt;?xml version="1.0" encoding="UTF-8"?> com.apple.print.PageFormat.FormattingPrinter com.apple.print.ticket.creator com.apple.printingmanager com.apple.print.ticket.itemArray com.apple.print.PageFormat.FormattingPrinter _222_A112_HPZ6100PSC com.apple.print.ticket.client com.apple.printingmanager

484

A comparative study of vibrational relaxation models for the aeroassisted orbital transfer vehicle flight regime  

E-Print Network [OSTI]

across the shock-wave from freestream temperature to Tv~?yielding a slip boundary condition expression for Tv~ in terms of BTv /Bn. 19 CONSERVATION EQUATIONS While the vibrational relaxation process is of primary interest to this research... Il. The shape factors h, and h, are given by Equation (30). 20 s-Momentum Conservation: uBu Bu ~Bu uvBA uw Bh Bh 1Bp p ( ? ? +v ? + ? ? + ? ? + ? ? ? ? ) h, Bs Bn h, Q h, Bn h, h, Q h, h, Bs h, Bs + e' ? [h, ? ( ? ) )t] + e'( ? ? '+ ? ? ')h, lt...

Green, Derek Scott

2012-06-07T23:59:59.000Z

485

Strength and failure characteristics of sandstones under moderate pore and confining pressures  

E-Print Network [OSTI]

- AXIAL IlkD RESULTING FROM APPLIED PRESSURE 30 15000 A 3 0 D CONFINING & PORE PRESSURE 0 0 5000 2500 10000 5000 15000 7500 I qil 0 . 005 . 0 PISTON DEFLECTION (Inches) I. f 015 FIGURE 8- PISTON DEFIECTION AS A FUNCTION OF APPLIED LOAD... 2t 22 2/, STR&III PAIUEIT SHOR/EHIID / A I I? I/ 16 lt 2tt 22 2/ 67H/IIN - JIJICENI SJDHTSNIHO la 25 20 SAHJIE 17 D 2 6 8 ID 12 14 16 \\ 0 ? '/ 81'It&IN - PUHCBRt UHOHTSNING D I / T/IAIN PKIII *ID S IORISIISIO AIHI I IIUH 2 HUN 3 A/Hl 4...

Neathery, Orphie

2012-06-07T23:59:59.000Z

486

two year. accordi ng to the heaJ of Virginia Institute of Manne SCience  

E-Print Network [OSTI]

IJlak. dre.1. the hanc.,t \\\\as I h mlll\\(ln anJ soo ()()() p('und.,. re.,pee- ti\\el) ThL "-(Idlak. drea k.lng 111 thL \\\\ L\\t (hignlk. dl.,tnd. ThL ((It.tI k.lng Lrdh catch hlr the ~(lut h Penln.,ula .I rea :'vla\\ through Publ cations In thL nala...k.a area the 24 Jay I.:lng Lrah ...ed\\On proJuceJ gooJ l1...h

487

Mark Twain's despair: a comparison of the deterministic ideas of the Old Man in What is man: And Satan in The mysterious stranger.  

E-Print Network [OSTI]

there is no longer to be' seen the Mark Twain who had a coherent development up to A Connecticut Yankee. 19 Th g yh ' t ITh I t dh d d~RM lt is gone. As DeVoto says, "There is. a new Mark Twain, ?ZO th tl IWh tl M . d Th ~Mt I ~gt 17 Clemens, Clemens, 19...'s disillusionment in A Connecticut Yankee in K~in Arthur's Court (1889) when the narrator Hank Morgan speaks out of character to voice a deterministic philosophy and to blame man's weaknesses on training. This developing pessimism, Smith contends, gradually...

Hord, Larry Dean

2012-06-07T23:59:59.000Z

488

The development of external sanitary facilities aboard ships of the fifteenth to nineteenth centuries  

E-Print Network [OSTI]

and aft) which had lightweight, small scale addit1ons of platforms or deck1ng at either or both ends, the average sailing ships of the 13th and 14th centuries evolved by the 15th century into vessels with dist1nct, characteristic bu1lt-up features... and descriptive accounts of voyages, secondary h1stor1c treatments of voyages; general works on seafar1ng, ships and the1r construction, and 11fe at sea; h1stories of medicine and sanitation, nautical medicine, and naval hygiene; and archaeological reports...

Simmons, Joe J

1985-01-01T23:59:59.000Z

489

A diagnosis of the sea breeze surge and its inland penetration over Texas  

E-Print Network [OSTI]

, it is of iamediate interest to the meteorologist. The influ- ence of th's phenomenon on the form tion of cloudiness, showers, and thunderstorms has been brought out by various aut'oors, viz. , Rainey (19ltB), i, eopold (19~:-9). Malkus et al. (1951), Wallington... edge of the circulation also is possible. In fact, Clarke (1961) has showed the possibility of existence of more than one cell in the sea-breeze circulation. Such pulsa- tory character of the sea breeze has been shown by Wallington (1960...

Bose, Banwari Lal

2012-06-07T23:59:59.000Z

490

A market study of the frozen fruit and vegetable industry  

E-Print Network [OSTI]

. The librsrtee of the Qoper~lt af C~IO sad the DepertaecA ef lgrieu1tslro ia DOX1ee, Tasse, fsraiehs4 soqy gorsra. aoat psblieotioas shish sided ia ~osad aeterde1 oad tehlee ueod ia this surrey. The gsroou of lgrhmlturo ~eo ia luotia, Tease, furnish ~ 4... enough ospitsl to surrey un s prograa af edusating tbs houaovifb. la 1%4 ~ new nonpayer@) wae famed ond oeagassd of clarence sisde Sj%s & fiah dietribntce's a ehsadets and ea7sral pezaoBs wbo ?chhlrtooh e large Pert of tbe financing. Thin mv ~ waa...

Bradley, James Russell

2012-06-07T23:59:59.000Z

491

Hausaufgabe 6: Aufgabe 3-20: Ein 0,12 m-Tank enthlt gesttigtes R-134a bei 800 kPa. Zu Beginn sind  

E-Print Network [OSTI]

Hausaufgabe 6: Aufgabe 3-20: Ein 0,12 m³-Tank enthält gesättigtes R-134a bei 800 kPa. Zu Beginn sind 25% des Tanks mit flüssigem R-134a gefüllt. Der Rest mit gasförmigem R-134a. Ein Ventil am Boden des Tanks wird geöffnet und flüssiges Kühlmittel tritt aus. Von au?en wird dem Kühlmittel Wärme

Peters, Norbert

492

Aufgabe 3-17: Ein 2 m-Tank enthlt zu Beginn Luft (RL = 0,287 kJ/kgK) im Zustand 1 (22C, 100 kPa, u1 = 210,49 kJ/kg). Der Tank ist ber ein Ventil mit einer Leitung verbunden.  

E-Print Network [OSTI]

?bung 6: Aufgabe 3-17: Ein 2 m³-Tank enthält zu Beginn Luft (RL = 0,287 kJ/kgK) im Zustand 1 (22°C, 100 kPa, u1 = 210,49 kJ/kg). Der Tank ist über ein Ventil mit einer Leitung verbunden. In dieser. Die Luft strömt solange in den Tank, bis im Tank derselbe Druck herrscht wie in der Leitung. Dann wird

Peters, Norbert

493

The effects of gamma irradiation on the growth, development and nitrogen metabolism of rice  

E-Print Network [OSTI]

are reported to have deleterious effects on plant growth (51). But stimulatory effects have also been noted. Sax (51) observed no significant stimulatory effects on five species of crop plants when irradiated with low levels of X-rays but observed a signif...- t lt fl 4 gi Gldtl ft bib z-yd tth 4000 r, Shull and Mitchell (54) reported stimulatory effects on the growth of certain cereals following the irradiation of germinating seeds with low doses of X-rays. Haskins and Moore (25) observed early flowering...

Gunawardena, Irwin Elston

1963-01-01T23:59:59.000Z

494

Implications of the 1100 UT March 22, 1979 CDAW 6 substorm event for the role of magnetic reconnection in the geomagnetic tail  

SciTech Connect (OSTI)

The event of March 22, 1979 has been the object of a concentrated study effort as a part of the Coordinated Data Analysis Workshop activity designated CDAW-6. Energetic electron and magnetic field measurements from a set of four satellites aligned from 6.6 to 13 R/sub E/ at the 0200 LT meridian at the time of the magnetospheric substorm event of 1100 UT are presented. These data are used to show that a magnetic X-line formed spontaneously in the vicinity of 7 R/sub E/ in response to a steady build-up of magnetic stress in the geomagnetic tail.

Fritz, T.A.; Baker, D.N.; McPherron, R.L.; Lennartsson, W.

1983-01-01T23:59:59.000Z

495

Precipitation of the ions of the heavy metals with aqueous triethylamine hydrosulfide  

E-Print Network [OSTI]

, though. the latter'have a worse re'putation. The advantages 'of. the 'sulfide 'system, are that the . Sul. f Mes, of the heavy metals are guantitatively . insolub'1'e and oan easily' bs' separated'; , X Grasp . I. 6'rmp' II Hj' G'~ - Hi+&', xi.... wii s pun lusind, the' sohims of ", analysis outliried in . F'lpurlis IV', V. , " and 'VI lt 8, 7), , ' T'hi: o'nly' 8 if'fe ranee' between' thii soheme 'and the soheme, found, 'in'many ltextp:dsl that tnriethylamins hydro- s'ulfids riiplaoei...

Hill, John Howard

2012-06-07T23:59:59.000Z

496

Trek Encore Issue 3  

E-Print Network [OSTI]

Spack, "cCoy f.lt rllponllbl. for thll cold, lillnt lin. H. knl. hi didn't count Spack al I frllnd - It Mil only b.caul. of th.lr Ihlrld pallion for ani Jalll T. Kirk that their paths had IVlr crolsld. Nlth hil gonl, thosl pathl had quickly partld... th. IlOoth functioning of I Itlrlhip. You IDUld g.t tranlferrld out of hlr. 10 ??? ? It .11 thtn thlt NeCoy Ixplodld. All th. I ?? ks of tlnlion tori 1001. YII'S of silllfinl f,ultrltionl an. hurtl. All thai' tilll hi hid .Itch.d Kirk turn to Spack...

1985-01-01T23:59:59.000Z

497

Effect of different levels of technology upon expected yields, costs, and returns for major crops in Diamante Departamento, Entre Rios province, Argentina  

E-Print Network [OSTI]

and ass'stance in carrying out and analyzing tnis thesis work, and to Dr. C. R. Harston and Dr. R. L. Ehrich for their cooperation in improving its presenta- tion. IIr. Zames McGrann assisted in the early stages of the fieId work. Dr. Zohn Steele revie...), Di:nants Departs~onto, Entre Hlos ) Jzge'lt inay 1969 ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ 77 Early land preparation a d e;rly seeding tine:~ thod for corn: osti. -. !ated cost per hectare {level 5), Diaaante Departa-, . . ento, Entre H(os, Argentina~ 1969...

Albarracin, Ernesto Oscar

2012-06-07T23:59:59.000Z

498

A diallel analysis of six components of partial resistance to Leptosphaeria nodorum in seedlings of six winter wheats  

E-Print Network [OSTI]

Components of Partial Resistance to ~ht h ' d ' g dl' g f g'* W' t llh (May 1987) Hans Henning Bruno, B. A, , University of Goettingen; Co-Chairs of Advisory Committee: Dr. Lloyd R. Nelson Dr. Norman E. Borlaug A diallel analysis was conducted...-based approach to disease protection has been emphasized because of economic and/or environmental reasons. One of the major diseases of wheat, Triticum aestivum (L. em Shit. ), 'Sp'dbl hdby~Lt h'd E. M 1 )*, ph ~St d (B k )B . k *L. . d present on all five...

Bruno, Hans Henning

2012-06-07T23:59:59.000Z

499

Measured and predicted response for 100 piles  

E-Print Network [OSTI]

)CH N BACKI Le. BUTT DIAOI6 7 ER WEIGHT I SIZE NO OF F BLOttS 0 21 22 23 24 NO. I' F BI DIOS NO OF BLOWS 61 62 63 ltO. OF BLOIYS C cl Ibf b. LJ J G W Cb Cb Cb t IAATERIAL LLASTIC PHU FRTIE) CONDITION AT ENO OF ORIVINC...Donald (Head of Department) December 1985 ABSTRACT Measured and Predicted Response for 100 Piles. (Dec. 1985) Joseph Stephen Andeson, B. S. , Texas AAM University Chairman of Advisory Committee: Dr. Jean-Louis Briaud This report deals with the prediction...

Anderson, Joseph Stephen

2012-06-07T23:59:59.000Z

500

Termszet Vilga, 2011 december, 571.o. Amat r kibertudomny  

E-Print Network [OSTI]

- Francois Grey, az új részleg vezet je a CERN Courier- ben cikket közölt, az OAI7 konferencián pedig el, polgári kibertudománynak nevezték el az új jelenséget. A CERN Citizen Cyberscience Centre- t állított fel a szoftverfejlesztést, tesztelést is. A CERN- ben kifejlesztett CernVM virtuális gép olyan technológia, ami lehet vé

Holl, András