National Library of Energy BETA

Sample records for low-flow sampling method

  1. ACL monitoring using a low-flow sampling technique: A case study

    SciTech Connect (OSTI)

    Hurley, D.F.; Whitehouse, J.M.

    1995-12-31

    A dedicated low-flow groundwater sample collection system was designed for implementation in a post-closure ACL monitoring program at the Yaworski Lagoon NPL site in Canterbury, Connecticut. The system includes dedicated bladder pumps with intake ports located in the screened interval of the monitoring wells. This sampling technique was implemented in the spring of 1993. The system was designed to simultaneously obtain samples directly from the screened interval of nested wells in three distinct water bearing zones. Sample collection is begun upon stabilization of field parameters. Other than line volume, no prior purging of the well is required. It was found that dedicated low-flow sampling from the screened interval provides a method of representative sample collection without the bias of suspended solids introduced by traditional techniques of pumping and bailing. Analytical data indicate that measured chemical constituents are representative of groundwater migrating through the screened interval. Upon implementation of the low-flow monitoring system, analytical results exhibited a decrease in concentrations of some organic compounds and metals. The system has also proven to be a cost effective alternative to pumping and bailing which generate large volumes of purge water requiring containment and disposal.

  2. Sampling system and method

    DOE Patents [OSTI]

    Decker, David L.; Lyles, Brad F.; Purcell, Richard G.; Hershey, Ronald Lee

    2013-04-16

    The present disclosure provides an apparatus and method for coupling conduit segments together. A first pump obtains a sample and transmits it through a first conduit to a reservoir accessible by a second pump. The second pump further conducts the sample from the reservoir through a second conduit.

  3. Sampling system and method

    DOE Patents [OSTI]

    Decker, David L; Lyles, Brad F; Purcell, Richard G; Hershey, Ronald Lee

    2014-05-20

    An apparatus and method for supporting a tubing bundle during installation or removal. The apparatus includes a clamp for securing the tubing bundle to an external wireline. The method includes deploying the tubing bundle and wireline together, The tubing bundle is periodically secured to the wireline using a clamp.

  4. Fluid sampling apparatus and method

    DOE Patents [OSTI]

    Yeamans, David R.

    1998-01-01

    Incorporation of a bellows in a sampling syringe eliminates ingress of contaminants, permits replication of amounts and compression of multiple sample injections, and enables remote sampling for off-site analysis.

  5. Fluid sampling apparatus and method

    DOE Patents [OSTI]

    Yeamans, D.R.

    1998-02-03

    Incorporation of a bellows in a sampling syringe eliminates ingress of contaminants, permits replication of amounts and compression of multiple sample injections, and enables remote sampling for off-site analysis. 3 figs.

  6. Duplex sampling apparatus and method

    DOE Patents [OSTI]

    Brown, Paul E.; Lloyd, Robert

    1992-01-01

    An improved apparatus is provided for sampling a gaseous mixture and for measuring mixture components. The apparatus includes two sampling containers connected in series serving as a duplex sampling apparatus. The apparatus is adapted to independently determine the amounts of condensable and noncondensable gases in admixture from a single sample. More specifically, a first container includes a first port capable of selectively connecting to and disconnecting from a sample source and a second port capable of selectively connecting to and disconnecting from a second container. A second container also includes a first port capable of selectively connecting to and disconnecting from the second port of the first container and a second port capable of either selectively connecting to and disconnecting from a differential pressure source. By cooling a mixture sample in the first container, the condensable vapors form a liquid, leaving noncondensable gases either as free gases or dissolved in the liquid. The condensed liquid is heated to drive out dissolved noncondensable gases, and all the noncondensable gases are transferred to the second container. Then the first and second containers are separated from one another in order to separately determine the amount of noncondensable gases and the amount of condensable gases in the sample.

  7. Apparatus and method for handheld sampling

    DOE Patents [OSTI]

    Staab, Torsten A.

    2005-09-20

    The present invention includes an apparatus, and corresponding method, for taking a sample. The apparatus is built around a frame designed to be held in at least one hand. A sample media is used to secure the sample. A sample media adapter for securing the sample media is operated by a trigger mechanism connectively attached within the frame to the sample media adapter.

  8. Soil sampling kit and a method of sampling therewith

    DOE Patents [OSTI]

    Thompson, Cyril V.

    1991-01-01

    A soil sampling device and a sample containment device for containing a soil sample is disclosed. In addition, a method for taking a soil sample using the soil sampling device and soil sample containment device to minimize the loss of any volatile organic compounds contained in the soil sample prior to analysis is disclosed. The soil sampling device comprises two close fitting, longitudinal tubular members of suitable length, the inner tube having the outward end closed. With the inner closed tube withdrawn a selected distance, the outer tube can be inserted into the ground or other similar soft material to withdraw a sample of material for examination. The inner closed end tube controls the volume of the sample taken and also serves to eject the sample. The soil sample containment device has a sealing member which is adapted to attach to an analytical apparatus which analyzes the volatile organic compounds contained in the sample. The soil sampling device in combination with the soil sample containment device allow an operator to obtain a soil sample containing volatile organic compounds and minimizing the loss of the volatile organic compounds prior to analysis of the soil sample for the volatile organic compounds.

  9. Soil sampling kit and a method of sampling therewith

    DOE Patents [OSTI]

    Thompson, C.V.

    1991-02-05

    A soil sampling device and a sample containment device for containing a soil sample is disclosed. In addition, a method for taking a soil sample using the soil sampling device and soil sample containment device to minimize the loss of any volatile organic compounds contained in the soil sample prior to analysis is disclosed. The soil sampling device comprises two close fitting, longitudinal tubular members of suitable length, the inner tube having the outward end closed. With the inner closed tube withdrawn a selected distance, the outer tube can be inserted into the ground or other similar soft material to withdraw a sample of material for examination. The inner closed end tube controls the volume of the sample taken and also serves to eject the sample. The soil sample containment device has a sealing member which is adapted to attach to an analytical apparatus which analyzes the volatile organic compounds contained in the sample. The soil sampling device in combination with the soil sample containment device allows an operator to obtain a soil sample containing volatile organic compounds and minimizing the loss of the volatile organic compounds prior to analysis of the soil sample for the volatile organic compounds. 11 figures.

  10. Method and apparatus for data sampling

    DOE Patents [OSTI]

    Odell, D.M.C.

    1994-04-19

    A method and apparatus for sampling radiation detector outputs and determining event data from the collected samples is described. The method uses high speed sampling of the detector output, the conversion of the samples to digital values, and the discrimination of the digital values so that digital values representing detected events are determined. The high speed sampling and digital conversion is performed by an A/D sampler that samples the detector output at a rate high enough to produce numerous digital samples for each detected event. The digital discrimination identifies those digital samples that are not representative of detected events. The sampling and discrimination also provides for temporary or permanent storage, either serially or in parallel, to a digital storage medium. 6 figures.

  11. Method and apparatus for data sampling

    DOE Patents [OSTI]

    Odell, Daniel M. C.

    1994-01-01

    A method and apparatus for sampling radiation detector outputs and determining event data from the collected samples. The method uses high speed sampling of the detector output, the conversion of the samples to digital values, and the discrimination of the digital values so that digital values representing detected events are determined. The high speed sampling and digital conversion is performed by an A/D sampler that samples the detector output at a rate high enough to produce numerous digital samples for each detected event. The digital discrimination identifies those digital samples that are not representative of detected events. The sampling and discrimination also provides for temporary or permanent storage, either serially or in parallel, to a digital storage medium.

  12. Systems and methods for sample analysis

    DOE Patents [OSTI]

    Cooks, Robert Graham; Li, Guangtao; Li, Xin; Ouyang, Zheng

    2015-01-13

    The invention generally relates to systems and methods for sample analysis. In certain embodiments, the invention provides a system for analyzing a sample that includes a probe including a material connected to a high voltage source, a device for generating a heated gas, and a mass analyzer.

  13. Systems and methods for sample analysis

    SciTech Connect (OSTI)

    Cooks, Robert Graham; Li, Guangtao; Li, Xin; Ouyang, Zheng

    2015-10-20

    The invention generally relates to systems and methods for sample analysis. In certain embodiments, the invention provides a system for analyzing a sample that includes a probe including a material connected to a high voltage source, a device for generating a heated gas, and a mass analyzer.

  14. Method and apparatus for sampling atmospheric mercury

    DOE Patents [OSTI]

    Trujillo, Patricio E.; Campbell, Evan E.; Eutsler, Bernard C.

    1976-01-20

    A method of simultaneously sampling particulate mercury, organic mercurial vapors, and metallic mercury vapor in the working and occupational environment and determining the amount of mercury derived from each such source in the sampled air. A known volume of air is passed through a sampling tube containing a filter for particulate mercury collection, a first adsorber for the selective adsorption of organic mercurial vapors, and a second adsorber for the adsorption of metallic mercury vapor. Carbon black molecular sieves are particularly useful as the selective adsorber for organic mercurial vapors. The amount of mercury adsorbed or collected in each section of the sampling tube is readily quantitatively determined by flameless atomic absorption spectrophotometry.

  15. Flow cytometric detection method for DNA samples

    DOE Patents [OSTI]

    Nasarabadi, Shanavaz; Langlois, Richard G.; Venkateswaran, Kodumudi S.

    2006-08-01

    Disclosed herein are two methods for rapid multiplex analysis to determine the presence and identity of target DNA sequences within a DNA sample. Both methods use reporting DNA sequences, e.g., modified conventional Taqman.RTM. probes, to combine multiplex PCR amplification with microsphere-based hybridization using flow cytometry means of detection. Real-time PCR detection can also be incorporated. The first method uses a cyanine dye, such as, Cy3.TM., as the reporter linked to the 5' end of a reporting DNA sequence. The second method positions a reporter dye, e.g., FAM, on the 3' end of the reporting DNA sequence and a quencher dye, e.g., TAMRA, on the 5' end.

  16. Flow cytometric detection method for DNA samples

    DOE Patents [OSTI]

    Nasarabadi,Shanavaz; Langlois, Richard G.; Venkateswaran, Kodumudi S.

    2011-07-05

    Disclosed herein are two methods for rapid multiplex analysis to determine the presence and identity of target DNA sequences within a DNA sample. Both methods use reporting DNA sequences, e.g., modified conventional Taqman.RTM. probes, to combine multiplex PCR amplification with microsphere-based hybridization using flow cytometry means of detection. Real-time PCR detection can also be incorporated. The first method uses a cyanine dye, such as, Cy3.TM., as the reporter linked to the 5' end of a reporting DNA sequence. The second method positions a reporter dye, e.g., FAM.TM. on the 3' end of the reporting DNA sequence and a quencher dye, e.g., TAMRA.TM., on the 5' end.

  17. Well purge and sample apparatus and method

    DOE Patents [OSTI]

    Schalla, R.; Smith, R.M.; Hall, S.H.; Smart, J.E.; Gustafson, G.S.

    1995-10-24

    The present invention specifically permits purging and/or sampling of a well but only removing, at most, about 25% of the fluid volume compared to conventional methods and, at a minimum, removing none of the fluid volume from the well. The invention is an isolation assembly with a packer, pump and exhaust, that is inserted into the well. The isolation assembly is designed so that only a volume of fluid between the outside diameter of the isolation assembly and the inside diameter of the well over a fluid column height from the bottom of the well to the top of the active portion (lower annulus) is removed. The packer is positioned above the active portion thereby sealing the well and preventing any mixing or contamination of inlet fluid with fluid above the packer. Ports in the wall of the isolation assembly permit purging and sampling of the lower annulus along the height of the active portion. 8 figs.

  18. Well purge and sample apparatus and method

    DOE Patents [OSTI]

    Schalla, Ronald; Smith, Ronald M.; Hall, Stephen H.; Smart, John E.; Gustafson, Gregg S.

    1995-01-01

    The present invention specifically permits purging and/or sampling of a well but only removing, at most, about 25% of the fluid volume compared to conventional methods and, at a minimum, removing none of the fluid volume from the well. The invention is an isolation assembly with a packer, pump and exhaust, that is inserted into the well. The isolation assembly is designed so that only a volume of fluid between the outside diameter of the isolation assembly and the inside diameter of the well over a fluid column height from the bottom of the well to the top of the active portion (lower annulus) is removed. The packer is positioned above the active portion thereby sealing the well and preventing any mixing or contamination of inlet fluid with fluid above the packer. Ports in the wall of the isolation assembly permit purging and sampling of the lower annulus along the height of the active portion.

  19. System and method for extracting a sample from a surface

    SciTech Connect (OSTI)

    Van Berkel, Gary; Covey, Thomas

    2015-06-23

    A system and method is disclosed for extracting a sample from a sample surface. A sample is provided and a sample surface receives the sample which is deposited on the sample surface. A hydrophobic material is applied to the sample surface, and one or more devices are configured to dispense a liquid on the sample, the liquid dissolving the sample to form a dissolved sample material, and the one or more devices are configured to extract the dissolved sample material from the sample surface.

  20. Modified electrokinetic sample injection method in chromatography and electrophoresis analysis

    DOE Patents [OSTI]

    Davidson, J. Courtney; Balch, Joseph W.

    2001-01-01

    A sample injection method for horizontal configured multiple chromatography or electrophoresis units, each containing a number of separation/analysis channels, that enables efficient introduction of analyte samples. This method for loading when taken in conjunction with horizontal microchannels allows much reduced sample volumes and a means of sample stacking to greatly reduce the concentration of the sample. This reduction in the amount of sample can lead to great cost savings in sample preparation, particularly in massively parallel applications such as DNA sequencing. The essence of this method is in preparation of the input of the separation channel, the physical sample introduction, and subsequent removal of excess material. By this method, sample volumes of 100 nanoliter to 2 microliters have been used successfully, compared to the typical 5 microliters of sample required by the prior separation/analysis method.

  1. Microfluidic DNA sample preparation method and device

    DOE Patents [OSTI]

    Krulevitch, Peter A.; Miles, Robin R.; Wang, Xiao-Bo; Mariella, Raymond P.; Gascoyne, Peter R. C.; Balch, Joseph W.

    2002-01-01

    Manipulation of DNA molecules in solution has become an essential aspect of genetic analyses used for biomedical assays, the identification of hazardous bacterial agents, and in decoding the human genome. Currently, most of the steps involved in preparing a DNA sample for analysis are performed manually and are time, labor, and equipment intensive. These steps include extraction of the DNA from spores or cells, separation of the DNA from other particles and molecules in the solution (e.g. dust, smoke, cell/spore debris, and proteins), and separation of the DNA itself into strands of specific lengths. Dielectrophoresis (DEP), a phenomenon whereby polarizable particles move in response to a gradient in electric field, can be used to manipulate and separate DNA in an automated fashion, considerably reducing the time and expense involved in DNA analyses, as well as allowing for the miniaturization of DNA analysis instruments. These applications include direct transport of DNA, trapping of DNA to allow for its separation from other particles or molecules in the solution, and the separation of DNA into strands of varying lengths.

  2. Methods for characterizing, classifying, and identifying unknowns in samples

    DOE Patents [OSTI]

    Grate, Jay W [West Richland, WA; Wise, Barry M [Manson, WA

    2002-01-01

    Disclosed is a method for taking the data generated from an array of responses from a multichannel instrument, and determining the characteristics of a chemical in the sample without the necessity of calibrating or training the instrument with known samples containing the same chemical. The characteristics determined by the method are then used to classify and identify the chemical in the sample. The method can also be used to quantify the concentration of the chemical in the sample.

  3. Methods for characterizing, classifying, and identifying unknowns in samples

    DOE Patents [OSTI]

    Grate, Jay W.; Wise, Barry M.

    2003-08-12

    Disclosed is a method for taking the data generated from an array of responses from a multichannel instrument, and determining the characteristics of a chemical in the sample without the necessity of calibrating or training the instrument with known samples containing the same chemical. The characteristics determined by the method are then used to classify and identify the chemical in the sample. The method can also be used to quantify the concentration of the chemical in the sample.

  4. Method for sampling sub-micron particles

    DOE Patents [OSTI]

    Gay, Don D.; McMillan, William G.

    1985-01-01

    Apparatus and method steps for collecting sub-micron sized particles include a collection chamber and cryogenic cooling. The cooling is accomplished by coil tubing carrying nitrogen in liquid form, with the liquid nitrogen changing to the gas phase before exiting from the collection chamber in the tubing. Standard filters are used to filter out particles of diameter greater than or equal to 0.3 microns; however the present invention is used to trap particles of less than 0.3 micron in diameter. A blower draws air to said collection chamber through a filter which filters particles with diameters greater than or equal to 0.3 micron. The air is then cryogenically cooled so that moisture and sub-micron sized particles in the air condense into ice on the coil. The coil is then heated so that the ice melts, and the liquid is then drawn off and passed through a Buchner funnel where the liquid is passed through a Nuclepore membrane. A vacuum draws the liquid through the Nuclepore membrane, with the Nuclepore membrane trapping sub-micron sized particles therein. The Nuclepore membrane is then covered on its top and bottom surfaces with sheets of Mylar.RTM. and the assembly is then crushed into a pellet. This effectively traps the sub-micron sized particles for later analysis.

  5. Soil Separator and Sampler and Method of Sampling - Energy Innovation

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Portal Soil Separator and Sampler and Method of Sampling Fluidized Bed system Idaho National Laboratory Contact INL About This Technology Technology Marketing Summary INL has developed a method for sampling soil to determine the presence of extremely fine particles such as asbestos. Description The apparatus uses a fluidized bed for receiving a soil sample, which is connected to a vacuum for drawing air through the bed and suspends particulate matter of the soil sample in the air, and draws

  6. Photoacoustic sample vessel and method of elevated pressure operation

    DOE Patents [OSTI]

    Autrey, Tom; Yonker, Clement R.

    2004-05-04

    An improved photoacoustic vessel and method of photoacoustic analysis. The photoacoustic sample vessel comprises an acoustic detector, an acoustic couplant, and an acoustic coupler having a chamber for holding the acoustic couplant and a sample. The acoustic couplant is selected from the group consisting of liquid, solid, and combinations thereof. Passing electromagnetic energy through the sample generates an acoustic signal within the sample, whereby the acoustic signal propagates through the sample to and through the acoustic couplant to the acoustic detector.

  7. DOE methods for evaluating environmental and waste management samples.

    SciTech Connect (OSTI)

    Goheen, S C; McCulloch, M; Thomas, B L; Riley, R G; Sklarew, D S; Mong, G M; Fadeff, S K

    1994-04-01

    DOE Methods for Evaluating Environmental and Waste Management Samples (DOE Methods) provides applicable methods in use by. the US Department of Energy (DOE) laboratories for sampling and analyzing constituents of waste and environmental samples. The development of DOE Methods is supported by the Laboratory Management Division (LMD) of the DOE. This document contains chapters and methods that are proposed for use in evaluating components of DOE environmental and waste management samples. DOE Methods is a resource intended to support sampling and analytical activities that will aid in defining the type and breadth of contamination and thus determine the extent of environmental restoration or waste management actions needed, as defined by the DOE, the US Environmental Protection Agency (EPA), or others.

  8. Method and apparatus for imaging a sample on a device

    DOE Patents [OSTI]

    Trulson, Mark; Stern, David; Fiekowsky, Peter; Rava, Richard; Walton, Ian; Fodor, Stephen P. A.

    2001-01-01

    A method and apparatus for imaging a sample are provided. An electromagnetic radiation source generates excitation radiation which is sized by excitation optics to a line. The line is directed at a sample resting on a support and excites a plurality of regions on the sample. Collection optics collect response radiation reflected from the sample I and image the reflected radiation. A detector senses the reflected radiation and is positioned to permit discrimination between radiation reflected from a certain focal plane in the sample and certain other planes within the sample.

  9. Engineering Study of 500 ML Sample Bottle Transportation Methods

    SciTech Connect (OSTI)

    BOGER, R.M.

    1999-08-25

    This engineering study reviews and evaluates all available methods for transportation of 500-mL grab sample bottles, reviews and evaluates transportation requirements and schedules and analyzes and recommends the most cost-effective method for transporting 500-mL grab sample bottles.

  10. Method for using polarization gating to measure a scattering sample

    SciTech Connect (OSTI)

    Baba, Justin S.

    2015-08-04

    Described herein are systems, devices, and methods facilitating optical characterization of scattering samples. A polarized optical beam can be directed to pass through a sample to be tested. The optical beam exiting the sample can then be analyzed to determine its degree of polarization, from which other properties of the sample can be determined. In some cases, an apparatus can include a source of an optical beam, an input polarizer, a sample, an output polarizer, and a photodetector. In some cases, a signal from a photodetector can be processed through attenuation, variable offset, and variable gain.

  11. Method and sample spinning apparatus for measuring the NMR spectrum of an orientationally disordered sample

    DOE Patents [OSTI]

    Pines, Alexander; Samoson, Ago

    1990-01-01

    An improved NMR apparatus and method are described which substantially improve the resolution of NMR measurements made on powdered or amorphous or otherwise orientationally disordered samples. The apparatus spins the sample about an axis. The angle of the axis is mechanically varied such that the time average of two or more Legendre polynomials are zero.

  12. DOE methods for evaluating environmental and waste management samples

    SciTech Connect (OSTI)

    Goheen, S.C.; McCulloch, M.; Thomas, B.L.; Riley, R.G.; Sklarew, D.S.; Mong, G.M.; Fadeff, S.K.

    1994-10-01

    DOE Methods for Evaluating Environmental and Waste Management Samples (DOE Methods) is a resource intended to support sampling and analytical activities for the evaluation of environmental and waste management samples from U.S. Department of Energy (DOE) sites. DOE Methods is the result of extensive cooperation from all DOE analytical laboratories. All of these laboratories have contributed key information and provided technical reviews as well as significant moral support leading to the success of this document. DOE Methods is designed to encompass methods for collecting representative samples and for determining the radioisotope activity and organic and inorganic composition of a sample. These determinations will aid in defining the type and breadth of contamination and thus determine the extent of environmental restoration or waste management actions needed, as defined by the DOE, the U.S. Environmental Protection Agency, or others. The development of DOE Methods is supported by the Analytical Services Division of DOE. Unique methods or methods consolidated from similar procedures in the DOE Procedures Database are selected for potential inclusion in this document. Initial selection is based largely on DOE needs and procedure applicability and completeness. Methods appearing in this document are one of two types, {open_quotes}Draft{close_quotes} or {open_quotes}Verified{close_quotes}. {open_quotes}Draft{close_quotes} methods that have been reviewed internally and show potential for eventual verification are included in this document, but they have not been reviewed externally, and their precision and bias may not be known. {open_quotes}Verified{close_quotes} methods in DOE Methods have been reviewed by volunteers from various DOE sites and private corporations. These methods have delineated measures of precision and accuracy.

  13. Method and apparatus for imaging a sample on a device

    DOE Patents [OSTI]

    Trulson, Mark; Stern, David; Fiekowsky, Peter; Rava, Richard; Walton, Ian; Fodor, Stephen P. A.

    1996-01-01

    The present invention provides methods and systems for detecting a labeled marker on a sample located on a support. The imaging system comprises a body for immobilizing the support, an excitation radiation source and excitation optics to generate and direct the excitation radiation at the sample. In response, labeled material on the sample emits radiation which has a wavelength that is different from the excitation wavelength, which radiation is collected by collection optics and imaged onto a detector which generates an image of the sample.

  14. Soil separator and sampler and method of sampling

    DOE Patents [OSTI]

    O'Brien, Barry H. [Idaho Falls, ID; Ritter, Paul D. [Idaho Falls, ID

    2010-02-16

    A soil sampler includes a fluidized bed for receiving a soil sample. The fluidized bed may be in communication with a vacuum for drawing air through the fluidized bed and suspending particulate matter of the soil sample in the air. In a method of sampling, the air may be drawn across a filter, separating the particulate matter. Optionally, a baffle or a cyclone may be included within the fluidized bed for disentrainment, or dedusting, so only the finest particulate matter, including asbestos, will be trapped on the filter. The filter may be removable, and may be tested to determine the content of asbestos and other hazardous particulate matter in the soil sample.

  15. System and method for measuring fluorescence of a sample

    DOE Patents [OSTI]

    Riot, Vincent J

    2015-03-24

    The present disclosure provides a system and a method for measuring fluorescence of a sample. The sample may be a polymerase-chain-reaction (PCR) array, a loop-mediated-isothermal amplification array, etc. LEDs are used to excite the sample, and a photodiode is used to collect the sample's fluorescence. An electronic offset signal is used to reduce the effects of background fluorescence and the noises from the measurement system. An integrator integrates the difference between the output of the photodiode and the electronic offset signal over a given period of time. The resulting integral is then converted into digital domain for further processing and storage.

  16. Beryllium Wipe Sampling (differing methods - differing exposure potentials)

    SciTech Connect (OSTI)

    Kerr, Kent

    2005-03-09

    This research compared three wipe sampling techniques currently used to test for beryllium contamination on room and equipment surfaces in Department of Energy facilities. Efficiencies of removal of beryllium contamination from typical painted surfaces were tested by wipe sampling without a wetting agent, with water-moistened wipe materials, and by methanol-moistened wipes. Analysis indicated that methanol-moistened wipe sampling removed about twice as much beryllium/oil-film surface contamination as water-moistened wipes, which removed about twice as much residue as dry wipes. Criteria at 10 CFR 850.30 and .31 were established on unspecified wipe sampling method(s). The results of this study reveal a need to identify criteria-setting method and equivalency factors. As facilities change wipe sampling methods among the three compared in this study, these results may be useful for approximate correlations. Accurate decontamination decision-making depends on the selection of appropriate wetting agents for the types of residues and surfaces. Evidence for beryllium sensitization via skin exposure argues in favor of wipe sampling with wetting agents that provide enhanced removal efficiency such as methanol when surface contamination includes oil mist residue.

  17. Examination of Hydrate Formation Methods: Trying to Create Representative Samples

    SciTech Connect (OSTI)

    Kneafsey, T.J.; Rees, E.V.L.; Nakagawa, S.; Kwon, T.-H.

    2011-04-01

    Forming representative gas hydrate-bearing laboratory samples is important so that the properties of these materials may be measured, while controlling the composition and other variables. Natural samples are rare, and have often experienced pressure and temperature changes that may affect the property to be measured [Waite et al., 2008]. Forming methane hydrate samples in the laboratory has been done a number of ways, each having advantages and disadvantages. The ice-to-hydrate method [Stern et al., 1996], contacts melting ice with methane at the appropriate pressure to form hydrate. The hydrate can then be crushed and mixed with mineral grains under controlled conditions, and then compacted to create laboratory samples of methane hydrate in a mineral medium. The hydrate in these samples will be part of the load-bearing frame of the medium. In the excess gas method [Handa and Stupin, 1992], water is distributed throughout a mineral medium (e.g. packed moist sand, drained sand, moistened silica gel, other porous media) and the mixture is brought to hydrate-stable conditions (chilled and pressurized with gas), allowing hydrate to form. This method typically produces grain-cementing hydrate from pendular water in sand [Waite et al., 2004]. In the dissolved gas method [Tohidi et al., 2002], water with sufficient dissolved guest molecules is brought to hydrate-stable conditions where hydrate forms. In the laboratory, this is can be done by pre-dissolving the gas of interest in water and then introducing it to the sample under the appropriate conditions. With this method, it is easier to form hydrate from more soluble gases such as carbon dioxide. It is thought that this method more closely simulates the way most natural gas hydrate has formed. Laboratory implementation, however, is difficult, and sample formation is prohibitively time consuming [Minagawa et al., 2005; Spangenberg and Kulenkampff, 2005]. In another version of this technique, a specified quantity of gas

  18. Self-contained cryogenic gas sampling apparatus and method

    DOE Patents [OSTI]

    McManus, Gary J.; Motes, Billy G.; Bird, Susan K.; Kotter, Dale K.

    1996-01-01

    Apparatus for obtaining a whole gas sample, composed of: a sample vessel having an inlet for receiving a gas sample; a controllable valve mounted for controllably opening and closing the inlet; a valve control coupled to the valve for opening and closing the valve at selected times; a portable power source connected for supplying operating power to the valve control; and a cryogenic coolant in thermal communication with the vessel for cooling the interior of the vessel to cryogenic temperatures. A method of obtaining an air sample using the apparatus described above, by: placing the apparatus at a location at which the sample is to be obtained; operating the valve control to open the valve at a selected time and close the valve at a selected subsequent time; and between the selected times maintaining the vessel at a cryogenic temperature by heat exchange with the coolant.

  19. Self-contained cryogenic gas sampling apparatus and method

    DOE Patents [OSTI]

    McManus, G.J.; Motes, B.G.; Bird, S.K.; Kotter, D.K.

    1996-03-26

    Apparatus for obtaining a whole gas sample, is composed of: a sample vessel having an inlet for receiving a gas sample; a controllable valve mounted for controllably opening and closing the inlet; a valve control coupled to the valve for opening and closing the valve at selected times; a portable power source connected for supplying operating power to the valve control; and a cryogenic coolant in thermal communication with the vessel for cooling the interior of the vessel to cryogenic temperatures. A method is described for obtaining an air sample using the apparatus described above, by: placing the apparatus at a location at which the sample is to be obtained; operating the valve control to open the valve at a selected time and close the valve at a selected subsequent time; and between the selected times maintaining the vessel at a cryogenic temperature by heat exchange with the coolant. 3 figs.

  20. Fluidics platform and method for sample preparation and analysis

    DOE Patents [OSTI]

    Benner, W. Henry; Dzenitis, John M.; Bennet, William J.; Baker, Brian R.

    2014-08-19

    Herein provided are fluidics platform and method for sample preparation and analysis. The fluidics platform is capable of analyzing DNA from blood samples using amplification assays such as polymerase-chain-reaction assays and loop-mediated-isothermal-amplification assays. The fluidics platform can also be used for other types of assays and analyzes. In some embodiments, a sample in a sealed tube can be inserted directly. The following isolation, detection, and analyzes can be performed without a user's intervention. The disclosed platform may also comprises a sample preparation system with a magnetic actuator, a heater, and an air-drying mechanism, and fluid manipulation processes for extraction, washing, elution, assay assembly, assay detection, and cleaning after reactions and between samples.

  1. Method and apparatus for sampling low-yield wells

    DOE Patents [OSTI]

    Last, George V.; Lanigan, David C.

    2003-04-15

    An apparatus and method for collecting a sample from a low-yield well or perched aquifer includes a pump and a controller responsive to water level sensors for filling a sample reservoir. The controller activates the pump to fill the reservoir when the water level in the well reaches a high level as indicated by the sensor. The controller deactivates the pump when the water level reaches a lower level as indicated by the sensors. The pump continuously activates and deactivates the pump until the sample reservoir is filled with a desired volume, as indicated by a reservoir sensor. At the beginning of each activation cycle, the controller optionally can select to purge an initial quantity of water prior to filling the sample reservoir. The reservoir can be substantially devoid of air and the pump is a low volumetric flow rate pump. Both the pump and the reservoir can be located either inside or outside the well.

  2. A flexible importance sampling method for integrating subgrid processes

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Raut, E. K.; Larson, V. E.

    2016-01-29

    Numerical models of weather and climate need to compute grid-box-averaged rates of physical processes such as microphysics. These averages are computed by integrating subgrid variability over a grid box. For this reason, an important aspect of atmospheric modeling is spatial integration over subgrid scales. The needed integrals can be estimated by Monte Carlo integration. Monte Carlo integration is simple and general but requires many evaluations of the physical process rate. To reduce the number of function evaluations, this paper describes a new, flexible method of importance sampling. It divides the domain of integration into eight categories, such as the portion that containsmore » both precipitation and cloud, or the portion that contains precipitation but no cloud. It then allows the modeler to prescribe the density of sample points within each of the eight categories. The new method is incorporated into the Subgrid Importance Latin Hypercube Sampler (SILHS). The resulting method is tested on drizzling cumulus and stratocumulus cases. In the cumulus case, the sampling error can be considerably reduced by drawing more sample points from the region of rain evaporation.« less

  3. A flexible importance sampling method for integrating subgrid processes

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Raut, E. K.; Larson, V. E.

    2015-10-22

    Numerical models of weather and climate need to compute grid-box-averaged rates of physical processes such as microphysics. These averages are computed by integrating subgrid variability over a grid box. For this reason, an important aspect of atmospheric modeling is integration. The needed integrals can be estimated by Monte Carlo integration. Monte Carlo integration is simple and general but requires many evaluations of the physical process rate. To reduce the number of function evaluations, this paper describes a new, flexible method of importance sampling. It divides the domain of integration into eight categories, such as the portion that contains bothmoreprecipitation and cloud, or the portion that contains precipitation but no cloud. It then allows the modeler to prescribe the density of sample points within each of the eight categories. The new method is incorporated into the Subgrid Importance Latin Hypercube Sampler (SILHS). The resulting method is tested on drizzling cumulus and stratocumulus cases. In the cumulus case, the sampling error can be considerably reduced by drawing more sample points from the region of rain evaporation.less

  4. Performance evaluation of a gasoline vapor sampling method

    SciTech Connect (OSTI)

    Russo, P.J.; Florky, G.R.; Agopsowicz, D.E.

    1987-06-01

    A study has been conducted to evaluate the performance of the method used by Exxon to monitor worker exposures to gasoline vapors. The study specifically addresses the effects of temperature and humidity on breakthrough volume as an indicator of performance limits. Results indicate that a 600 mg charcoal tube will yield excellent results if sample flow rate is adjusted properly with regard to absolute humidity. In order to aid the field hygienist in applying the study results, charts that relate sampling parameters to environmental conditions are presented.

  5. RAPID SEPARATION METHOD FOR ACTINIDES IN EMERGENCY SOIL SAMPLES

    SciTech Connect (OSTI)

    Maxwell, S.; Culligan, B.; Noyes, G.

    2009-11-09

    A new rapid method for the determination of actinides in soil and sediment samples has been developed at the Savannah River Site Environmental Lab (Aiken, SC, USA) that can be used for samples up to 2 grams in emergency response situations. The actinides in soil method utilizes a rapid sodium hydroxide fusion method, a lanthanum fluoride soil matrix removal step, and a streamlined column separation process with stacked TEVA, TRU and DGA Resin cartridges. Lanthanum was separated rapidly and effectively from Am and Cm on DGA Resin. Vacuum box technology and rapid flow rates are used to reduce analytical time. Alpha sources are prepared using cerium fluoride microprecipitation for counting by alpha spectrometry. The method showed high chemical recoveries and effective removal of interferences. This new procedure was applied to emergency soil samples received in the NRIP Emergency Response exercise administered by the National Institute for Standards and Technology (NIST) in April, 2009. The actinides in soil results were reported within 4-5 hours with excellent quality.

  6. RAPID SEPARATION METHOD FOR ACTINIDES IN EMERGENCY AIR FILTER SAMPLES

    SciTech Connect (OSTI)

    Maxwell, S.; Noyes, G.; Culligan, B.

    2010-02-03

    A new rapid method for the determination of actinides and strontium in air filter samples has been developed at the Savannah River Site Environmental Lab (Aiken, SC, USA) that can be used in emergency response situations. The actinides and strontium in air filter method utilizes a rapid acid digestion method and a streamlined column separation process with stacked TEVA, TRU and Sr Resin cartridges. Vacuum box technology and rapid flow rates are used to reduce analytical time. Alpha emitters are prepared using cerium fluoride microprecipitation for counting by alpha spectrometry. The purified {sup 90}Sr fractions are mounted directly on planchets and counted by gas flow proportional counting. The method showed high chemical recoveries and effective removal of interferences. This new procedure was applied to emergency air filter samples received in the NRIP Emergency Response exercise administered by the National Institute for Standards and Technology (NIST) in April, 2009. The actinide and {sup 90}Sr in air filter results were reported in {approx}4 hours with excellent quality.

  7. Hand held sample tube manipulator, system and method

    DOE Patents [OSTI]

    Kenny, Donald V. [Liberty Township, OH; Smith, Deborah L. [Liberty Township, OH; Severance, Richard A. [late of Columbus, OH

    2001-01-01

    A manipulator apparatus, system and method for measuring analytes present in sample tubes. The manipulator apparatus includes a housing having a central bore with an inlet end and outlet end; a plunger mechanism with at least a portion thereof slideably disposed for reciprocal movement within the central bore, the plunger mechanism having a tubular gas channel with an inlet end and an outlet end, the gas channel inlet end disposed in the same direction as said inlet end of the central bore, wherein the inlet end of said plunger mechanism is adapted for movement so as to expel a sample tube inserted in the bore at the outlet end of the housing, the inlet end of the plunger mechanism is adapted for connection to gas supply; a first seal is disposed in the housing for sealing between the central bore and the plunger mechanism; a second seal is disposed at the outlet end of the housing for sealing between the central bore and a sample tube; a holder mounted on the housing for holding the sample tube; and a biasing mechanism for returning the plunger mechanism to a starting position.

  8. A Novel Method for Sampling Alpha-Helical Protein Backbones

    DOE R&D Accomplishments [OSTI]

    Fain, Boris; Levitt, Michael

    2001-01-01

    We present a novel technique of sampling the configurations of helical proteins. Assuming knowledge of native secondary structure, we employ assembly rules gathered from a database of existing structures to enumerate the geometrically possible 3-D arrangements of the constituent helices. We produce a library of possible folds for 25 helical protein cores. In each case the method finds significant numbers of conformations close to the native structure. In addition we assign coordinates to all atoms for 4 of the 25 proteins. In the context of database driven exhaustive enumeration our method performs extremely well, yielding significant percentages of structures (0.02%--82%) within 6A of the native structure. The method's speed and efficiency make it a valuable contribution towards the goal of predicting protein structure.

  9. Well fluid isolation and sample apparatus and method

    DOE Patents [OSTI]

    Schalla, Ronald; Smith, Ronald M.; Hall, Stephen H.; Smart, John E.

    1995-01-01

    The present invention specifically permits purging and/or sampling of a well but only removing, at most, about 25% of the fluid volume compared to conventional methods and, at a minimum, removing none of the fluid volume from the well. The invention is an isolation assembly that is inserted into the well. The isolation assembly is designed so that only a volume of fluid between the outside diameter of the isolation assembly and the inside diameter of the well over a fluid column height from the bottom of the well to the top of the active portion (lower annulus) is removed. A seal may be positioned above the active portion thereby sealing the well and preventing any mixing or contamination of inlet fluid with fluid above the packer. Purged well fluid is stored in a riser above the packer. Ports in the wall of the isolation assembly permit purging and sampling of the lower annulus along the height of the active portion.

  10. Drum plug piercing and sampling device and method

    DOE Patents [OSTI]

    Counts, Kevin T.

    2011-04-26

    An apparatus and method for piercing a drum plug of a drum in order to sample and/or vent gases that may accumulate in a space of the drum is provided. The drum is not damaged and can be reused since the pierced drum plug can be subsequently replaced. The apparatus includes a frame that is configured for engagement with the drum. A cylinder actuated by a fluid is mounted to the frame. A piercer is placed into communication with the cylinder so that actuation of the cylinder causes the piercer to move in a linear direction so that the piercer may puncture the drum plug of the drum.

  11. Method for testing earth samples for contamination by organic contaminants

    DOE Patents [OSTI]

    Schabron, John F.

    1996-01-01

    Provided is a method for testing earth samples for contamination by organic contaminants, and particularly for aromatic compounds such as those found in diesel fuel and other heavy fuel oils, kerosene, creosote, coal oil, tars and asphalts. A drying step is provided in which a drying agent is contacted with either the earth sample or a liquid extract phase to reduce to possibility of false indications of contamination that could occur when humic material is present in the earth sample. This is particularly a problem when using relatively safe, non-toxic and inexpensive polar solvents such as isopropyl alcohol since the humic material tends to be very soluble in those solvents when water is present. Also provided is an ultraviolet spectroscopic measuring technique for obtaining an indication as to whether a liquid extract phase contains aromatic organic contaminants. In one embodiment, the liquid extract phase is subjected to a narrow and discrete band of radiation including a desired wave length and the ability of the liquid extract phase to absorb that wavelength of ultraviolet radiation is measured to provide an indication of the presence of aromatic organic contaminants.

  12. Method for testing earth samples for contamination by organic contaminants

    DOE Patents [OSTI]

    Schabron, J.F.

    1996-10-01

    Provided is a method for testing earth samples for contamination by organic contaminants, and particularly for aromatic compounds such as those found in diesel fuel and other heavy fuel oils, kerosene, creosote, coal oil, tars and asphalts. A drying step is provided in which a drying agent is contacted with either the earth sample or a liquid extract phase to reduce to possibility of false indications of contamination that could occur when humic material is present in the earth sample. This is particularly a problem when using relatively safe, non-toxic and inexpensive polar solvents such as isopropyl alcohol since the humic material tends to be very soluble in those solvents when water is present. Also provided is an ultraviolet spectroscopic measuring technique for obtaining an indication as to whether a liquid extract phase contains aromatic organic contaminants. In one embodiment, the liquid extract phase is subjected to a narrow and discrete band of radiation including a desired wave length and the ability of the liquid extract phase to absorb that wavelength of ultraviolet radiation is measured to provide an indication of the presence of aromatic organic contaminants. 2 figs.

  13. A comparison of methods for representing sparsely sampled random quantities.

    SciTech Connect (OSTI)

    Romero, Vicente Jose; Swiler, Laura Painton; Urbina, Angel; Mullins, Joshua

    2013-09-01

    This report discusses the treatment of uncertainties stemming from relatively few samples of random quantities. The importance of this topic extends beyond experimental data uncertainty to situations involving uncertainty in model calibration, validation, and prediction. With very sparse data samples it is not practical to have a goal of accurately estimating the underlying probability density function (PDF). Rather, a pragmatic goal is that the uncertainty representation should be conservative so as to bound a specified percentile range of the actual PDF, say the range between 0.025 and .975 percentiles, with reasonable reliability. A second, opposing objective is that the representation not be overly conservative; that it minimally over-estimate the desired percentile range of the actual PDF. The presence of the two opposing objectives makes the sparse-data uncertainty representation problem interesting and difficult. In this report, five uncertainty representation techniques are characterized for their performance on twenty-one test problems (over thousands of trials for each problem) according to these two opposing objectives and other performance measures. Two of the methods, statistical Tolerance Intervals and a kernel density approach specifically developed for handling sparse data, exhibit significantly better overall performance than the others.

  14. MARKOV CHAIN MONTE CARLO POSTERIOR SAMPLING WITH THE HAMILTONIAN METHOD

    SciTech Connect (OSTI)

    K. HANSON

    2001-02-01

    The Markov Chain Monte Carlo technique provides a means for drawing random samples from a target probability density function (pdf). MCMC allows one to assess the uncertainties in a Bayesian analysis described by a numerically calculated posterior distribution. This paper describes the Hamiltonian MCMC technique in which a momentum variable is introduced for each parameter of the target pdf. In analogy to a physical system, a Hamiltonian H is defined as a kinetic energy involving the momenta plus a potential energy {var_phi}, where {var_phi} is minus the logarithm of the target pdf. Hamiltonian dynamics allows one to move along trajectories of constant H, taking large jumps in the parameter space with relatively few evaluations of {var_phi} and its gradient. The Hamiltonian algorithm alternates between picking a new momentum vector and following such trajectories. The efficiency of the Hamiltonian method for multidimensional isotropic Gaussian pdfs is shown to remain constant at around 7% for up to several hundred dimensions. The Hamiltonian method handles correlations among the variables much better than the standard Metropolis algorithm. A new test, based on the gradient of {var_phi}, is proposed to measure the convergence of the MCMC sequence.

  15. Photoacoustic spectroscopy sample array vessels and photoacoustic spectroscopy methods for using the same

    DOE Patents [OSTI]

    Amonette, James E.; Autrey, S. Thomas; Foster-Mills, Nancy S.

    2006-02-14

    Methods and apparatus for simultaneous or sequential, rapid analysis of multiple samples by photoacoustic spectroscopy are disclosed. Particularly, a photoacoustic spectroscopy sample array vessel including a vessel body having multiple sample cells connected thereto is disclosed. At least one acoustic detector is acoustically positioned near the sample cells. Methods for analyzing the multiple samples in the sample array vessels using photoacoustic spectroscopy are provided.

  16. Photoacoustic spectroscopy sample array vessel and photoacoustic spectroscopy method for using the same

    DOE Patents [OSTI]

    Amonette, James E.; Autrey, S. Thomas; Foster-Mills, Nancy S.; Green, David

    2005-03-29

    Methods and apparatus for analysis of multiple samples by photoacoustic spectroscopy are disclosed. Particularly, a photoacoustic spectroscopy sample array vessel including a vessel body having multiple sample cells connected thereto is disclosed. At least one acoustic detector is acoustically coupled with the vessel body. Methods for analyzing the multiple samples in the sample array vessels using photoacoustic spectroscopy are provided.

  17. Analytical instrument with apparatus and method for sample concentrating

    DOE Patents [OSTI]

    Zaromb, S.

    1986-08-04

    A system for analysis of trace concentrations of contaminants in air includes a portable liquid chromatograph and a preconcentrator for the contaminants to be analyzed. The preconcentrator includes a sample bag having an inlet valve and an outlet valve for collecting an air sample. When the sample is collected the sample bag is connected in series with a sorbing apparatus in a recirculation loop. The sorbing apparatus has an inner gas-permeable container containing a sorbent material and an outer gas-impermeable container. The sample is circulated through the outer container and around the inner container for trapping and preconcentrating the contaminants in the sorbent material. The sorbent material may be a liquid having the same composition as the mobile phase of the chromatograph for direct injection thereinto. Alternatively, the sorbent material may be a porous, solid body, to which mobile phase liquid is added after preconcentration of the contaminants for dissolving the contaminants, the liquid solution then being withdrawn for injection into the chromatograph.

  18. Method for preconcentrating a sample for subsequent analysis

    DOE Patents [OSTI]

    Zaromb, Solomon (Hinsdale, IL)

    1990-01-01

    A system for analysis of trace concentration of contaminants in air includes a portable liquid chromatograph and a preconcentrator for the contaminants to be analyzed. The preconcentrator includes a sample bag having an inlet valve and an outlet valve for collecting an air sample. When the sample is collected the sample bag is connected in series with a sorbing apparatus in a recirculation loop. The sorbing apparatus has an inner gas-permeable container containing a sorbent material and an outer gas-impermeable container. The sample is circulated through the outer container and around the inner container for trapping and preconcentrating the contaminants in the sorbent material. The sorbent material may be a liquid having the same composition as the mobile phase of the chromatograph for direct injection thereinto. Alternatively, the sorbent material may be a porous, solid body, to which mobile phase liquid is added after preconcentration of the contaminants for dissolving the contaminants, the liquid solution then being withdrawn for injection into the chromatograph.

  19. Statistical Methods and Tools for Hanford Staged Feed Tank Sampling

    SciTech Connect (OSTI)

    Fountain, Matthew S.; Brigantic, Robert T.; Peterson, Reid A.

    2013-10-01

    This report summarizes work conducted by Pacific Northwest National Laboratory to technically evaluate the current approach to staged feed sampling of high-level waste (HLW) sludge to meet waste acceptance criteria (WAC) for transfer from tank farms to the Hanford Waste Treatment and Immobilization Plant (WTP). The current sampling and analysis approach is detailed in the document titled Initial Data Quality Objectives for WTP Feed Acceptance Criteria, 24590-WTP-RPT-MGT-11-014, Revision 0 (Arakali et al. 2011). The goal of this current work is to evaluate and provide recommendations to support a defensible, technical and statistical basis for the staged feed sampling approach that meets WAC data quality objectives (DQOs).

  20. [DOE method for evaluating environmental and waste management samples: Revision 1, Addendum 1

    SciTech Connect (OSTI)

    Goheen, S.C.

    1995-04-01

    The US Dapartment of Energy`s (DOE`s) environmental and waste management (EM) sampling and analysis activities require that large numbers of samples be analyzed for materials characterization, environmental surveillance, and site-remediation programs. The present document, DOE Methods for Evaluating Environmental and Waste Management Samples (DOE Methods), is a supplemental resource for analyzing many of these samples.

  1. High-throughput liquid-absorption preconcentrator sampling methods

    DOE Patents [OSTI]

    Zaromb, S.

    1994-07-12

    A system for detecting trace concentrations of an analyte in air includes a preconcentrator for the analyte and an analyte detector. The preconcentrator includes an elongated tubular container comprising a wettable material. The wettable material is continuously wetted with an analyte-sorbing liquid which flows from one part of the container to a lower end. Sampled air flows through the container in contact with the wetted material with a swirling motion which results in efficient transfer of analyte vapors or aerosol particles to the sorbing liquid and preconcentration of traces of analyte in the liquid. The preconcentrated traces of analyte may be either detected within the container or removed therefrom for injection into a separate detection means or for subsequent analysis. 12 figs.

  2. High-throughput liquid-absorption preconcentrator sampling methods

    DOE Patents [OSTI]

    Zaromb, Solomon (95706 William Dr., Hinsdale, IL 60521)

    1994-01-01

    A system for detecting trace concentrations of an analyte in air includes a preconcentrator for the analyte and an analyte detector. The preconcentrator includes an elongated tubular container comprising a wettable material. The wettable material is continuously wetted with an analyte-sorbing liquid which flows from one part of the container to a lower end. Sampled air flows through the container in contact with the wetted material with a swirling motion which results in efficient transfer of analyte vapors or aerosol particles to the sorbing liquid and preconcentration of traces of analyte in the liquid. The preconcentrated traces of analyte may be either detected within the container or removed therefrom for injection into a separate detection means or for subsequent analysis.

  3. Method and apparatus for processing a test sample to concentrate an analyte in the sample from a solvent in the sample

    DOE Patents [OSTI]

    Turner, T.D.; Beller, L.S.; Clark, M.L.; Klingler, K.M.

    1997-10-14

    A method of processing a test sample to concentrate an analyte in the sample from a solvent in the sample includes: (a) boiling the test sample containing the analyte and solvent in a boiling chamber to a temperature greater than or equal to the solvent boiling temperature and less than the analyte boiling temperature to form a rising sample vapor mixture; (b) passing the sample vapor mixture from the boiling chamber to an elongated primary separation tube, the separation tube having internal sidewalls and a longitudinal axis, the longitudinal axis being angled between vertical and horizontal and thus having an upper region and a lower region; (c) collecting the physically transported liquid analyte on the internal sidewalls of the separation tube; and (d) flowing the collected analyte along the angled internal sidewalls of the separation tube to and pass the separation tube lower region. The invention also includes passing a turbulence inducing wave through a vapor mixture to separate physically transported liquid second material from vaporized first material. Apparatus is also disclosed for effecting separations. Further disclosed is a fluidically powered liquid test sample withdrawal apparatus for withdrawing a liquid test sample from a test sample container and for cleaning the test sample container. 8 figs.

  4. Method and apparatus for processing a test sample to concentrate an analyte in the sample from a solvent in the sample

    DOE Patents [OSTI]

    Turner, Terry D.; Beller, Laurence S.; Clark, Michael L.; Klingler, Kerry M.

    1997-01-01

    A method of processing a test sample to concentrate an analyte in the sample from a solvent in the sample includes: a) boiling the test sample containing the analyte and solvent in a boiling chamber to a temperature greater than or equal to the solvent boiling temperature and less than the analyte boiling temperature to form a rising sample vapor mixture; b) passing the sample vapor mixture from the boiling chamber to an elongated primary separation tube, the separation tube having internal sidewalls and a longitudinal axis, the longitudinal axis being angled between vertical and horizontal and thus having an upper region and a lower region; c) collecting the physically transported liquid analyte on the internal sidewalls of the separation tube; and d) flowing the collected analyte along the angled internal sidewalls of the separation tube to and pass the separation tube lower region. The invention also includes passing a turbulence inducing wave through a vapor mixture to separate physically transported liquid second material from vaporized first material. Apparatus are also disclosed for effecting separations. Further disclosed is a fluidically powered liquid test sample withdrawal apparatus for withdrawing a liquid test sample from a test sample container and for cleaning the test sample container.

  5. Method for sequential injection of liquid samples for radioisotope separations

    DOE Patents [OSTI]

    Egorov, Oleg B.; Grate, Jay W.; Bray, Lane A.

    2000-01-01

    The present invention is a method of separating a short-lived daughter isotope from a longer lived parent isotope, with recovery of the parent isotope for further use. Using a system with a bi-directional pump and one or more valves, a solution of the parent isotope is processed to generate two separate solutions, one of which contains the daughter isotope, from which the parent has been removed with a high decontamination factor, and the other solution contains the recovered parent isotope. The process can be repeated on this solution of the parent isotope. The system with the fluid drive and one or more valves is controlled by a program on a microprocessor executing a series of steps to accomplish the operation. In one approach, the cow solution is passed through a separation medium that selectively retains the desired daughter isotope, while the parent isotope and the matrix pass through the medium. After washing this medium, the daughter is released from the separation medium using another solution. With the automated generator of the present invention, all solution handling steps necessary to perform a daughter/parent radionuclide separation, e.g. Bi-213 from Ac-225 "cow" solution, are performed in a consistent, enclosed, and remotely operated format. Operator exposure and spread of contamination are greatly minimized compared to the manual generator procedure described in U.S. patent application Ser. No. 08/789,973, now U.S. Pat. No. 5,749,042, herein incorporated by reference. Using 16 mCi of Ac-225 there was no detectable external contamination of the instrument components.

  6. Installation of a Low Flow Unit at the Abiquiu Hydroelectric Facility

    SciTech Connect (OSTI)

    Jack Q. Richardson

    2012-06-28

    Final Technical Report for the Recovery Act Project for the Installation of a Low Flow Unit at the Abiquiu Hydroelectric Facility. The Abiquiu hydroelectric facility existed with two each 6.9 MW vertical flow Francis turbine-generators. This project installed a new 3.1 MW horizontal flow low flow turbine-generator. The total plant flow range to capture energy and generate power increased from between 250 and 1,300 cfs to between 75 and 1,550 cfs. Fifty full time equivalent (FTE) construction jobs were created for this project - 50% (or 25 FTE) were credited to ARRA funding due to the ARRA 50% project cost match. The Abiquiu facility has increased capacity, increased efficiency and provides for an improved aquatic environment owing to installed dissolved oxygen capabilities during traditional low flow periods in the Rio Chama. A new powerhouse addition was constructed to house the new turbine-generator equipment.

  7. Methods for point-of-care detection of nucleic acid in a sample...

    Office of Scientific and Technical Information (OSTI)

    Provided herein are methods and apparatus for detecting a target nucleic acid in a sample ... Sponsoring Org: USDOE Country of Publication: United States Language: English Subject: 59 ...

  8. ASTM sampling methods and analytical validation for lead in paint, dust, soil, and air

    SciTech Connect (OSTI)

    Ashley, K.; Schlecht, P.C.; Song, R.; Feng, A.; DeWalt, G.; McKnight, M.E.

    1996-12-31

    ASTM Subcommittee E06.23 on Abatement/Mitigation of Lead Hazards has developed a number of standards that are concerned with the sampling of leas in environmental media, namely paint, dust, soil and airborne particulate. An ASTM practice for the collection of airborne particulate lead in the workplace has been published. New ASTM standards for the collection of dry paint film samples, surface soil samples, and surface dust wipe samples for subsequent lead analysis have also been promulgated. Other draft standards pertinent to lead sampling are under development. The ASTM standards concerned with lead sample collection are accompanied by separate sample preparation standard practices and a standard analysis method. Sample preparation and analytical methods have been evaluated by interlaboratory testing; such analyses may be used to assess the efficacy of sampling protocols.

  9. Rapid method for the determination of 226Ra in hydraulic fracturing wastewater samples

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Maxwell, Sherrod L.; Culligan, Brian K.; Warren, Richard A.; McAlister, Daniel R.

    2016-03-24

    A new method that rapidly preconcentrates and measures 226Ra from hydraulic fracturing wastewater samples was developed in the Savannah River Environmental Laboratory. The method improves the quality of 226Ra measurements using gamma spectrometry by providing up to 100x preconcentration of 226Ra from this difficult sample matrix, which contains very high levels of calcium, barium, strontium, magnesium and sodium. The high chemical yield, typically 80-90%, facilitates a low detection limit, important for lower level samples, and indicates method ruggedness. Ba-133 tracer is used to determine chemical yield and correct for geometry-related counting issues. The 226Ra sample preparation takes < 2 hours.

  10. Optical method and system for the characterization of laterally-patterned samples in integrated circuits

    DOE Patents [OSTI]

    Maris, Humphrey J.

    2011-02-22

    Disclosed is a method for characterizing a sample having a structure disposed on or within the sample, comprising the steps of applying a first pulse of light to a surface of the sample for creating a propagating strain pulse in the sample, applying a second pulse of light to the surface so that the second pulse of light interacts with the propagating strain pulse in the sample, sensing from a reflection of the second pulse a change in optical response of the sample, and relating a time of occurrence of the change in optical response to at least one dimension of the structure.

  11. Optical method for the characterization of laterally-patterned samples in integrated circuits

    DOE Patents [OSTI]

    Maris, Humphrey J.

    2001-01-01

    Disclosed is a method for characterizing a sample having a structure disposed on or within the sample, comprising the steps of applying a first pulse of light to a surface of the sample for creating a propagating strain pulse in the sample, applying a second pulse of light to the surface so that the second pulse of light interacts with the propagating strain pulse in the sample, sensing from a reflection of the second pulse a change in optical response of the sample, and relating a time of occurrence of the change in optical response to at least one dimension of the structure.

  12. Optical method for the characterization of laterally patterned samples in integrated circuits

    DOE Patents [OSTI]

    Maris, Humphrey J.

    2009-03-17

    Disclosed is a method for characterizing a sample having a structure disposed on or within the sample, comprising the steps of applying a first pulse of light to a surface of the sample for creating a propagating strain pulse in the sample, applying a second pulse of light to the surface so that the second pulse of light interacts with the propagating strain pulse in the sample, sensing from a reflection of the second pulse a change in optical response of the sample, and relating a time of occurrence of the change in optical response to at least one dimension of the structure.

  13. Optical method and system for the characterization of laterally-patterned samples in integrated circuits

    DOE Patents [OSTI]

    Maris, Humphrey J.

    2008-03-04

    Disclosed is a method for characterizing a sample having a structure disposed on or within the sample, comprising the steps of applying a first pulse of light to a surface of the sample for creating a propagating strain pulse in the sample, applying a second pulse of light to the surface so that the second pulse of light interacts with the propagating strain pulse in the sample, sensing from a reflection of the second pulse a change in optical response of the sample, and relating a time of occurrence of the change in optical response to at least one dimension of the structure.

  14. Optical method for the characterization of laterally-patterned samples in integrated circuits

    DOE Patents [OSTI]

    Maris, Humphrey J.

    2010-08-24

    Disclosed is a method for characterizing a sample having a structure disposed on or within the sample, comprising the steps of applying a first pulse of light to a surface of the sample for creating a propagating strain pulse in the sample, applying a second pulse of light to the surface so that the second pulse of light interacts with the propagating strain pulse in the sample, sensing from a reflection of the second pulse a change in optical response of the sample, and relating a time of occurrence of the change in optical response to at least one dimension of the structure.

  15. Quantitative method of determining beryllium or a compound thereof in a sample

    DOE Patents [OSTI]

    McCleskey, T. Mark; Ehler, Deborah S.; John, Kevin D.; Burrell, Anthony K.; Collis, Gavin E.; Minogue, Edel M.; Warner, Benjamin P.

    2006-10-31

    A method of determining beryllium or a beryllium compound thereof in a sample, includes providing a sample suspected of comprising beryllium or a compound thereof, extracting beryllium or a compound thereof from the sample by dissolving in a solution, adding a fluorescent indicator to the solution to thereby bind any beryllium or a compound thereof to the fluorescent indicator, and determining the presence or amount of any beryllium or a compound thereof in the sample by measuring fluorescence.

  16. Quantitative method of determining beryllium or a compound thereof in a sample

    DOE Patents [OSTI]

    McCleskey, T. Mark; Ehler, Deborah S.; John, Kevin D.; Burrell, Anthony K.; Collis, Gavin E.; Minogue, Edel M.; Warner, Benjamin P.

    2010-08-24

    A method of determining beryllium or a beryllium compound thereof in a sample, includes providing a sample suspected of comprising beryllium or a compound thereof, extracting beryllium or a compound thereof from the sample by dissolving in a solution, adding a fluorescent indicator to the solution to thereby bind any beryllium or a compound thereof to the fluorescent indicator, and determining the presence or amount of any beryllium or a compound thereof in the sample by measuring fluorescence.

  17. Universal nucleic acids sample preparation method for cells, spores and their mixture

    DOE Patents [OSTI]

    Bavykin, Sergei

    2011-01-18

    The present invention relates to a method for extracting nucleic acids from biological samples. More specifically the invention relates to a universal method for extracting nucleic acids from unidentified biological samples. An advantage of the presently invented method is its ability to effectively and efficiently extract nucleic acids from a variety of different cell types including but not limited to prokaryotic or eukaryotic cells and/or recalcitrant organisms (i.e. spores). Unlike prior art methods which are focused on extracting nucleic acids from vegetative cell or spores, the present invention effectively extracts nucleic acids from spores, multiple cell types or mixtures thereof using a single method. Important that the invented method has demonstrated an ability to extract nucleic acids from spores and vegetative bacterial cells with similar levels effectiveness. The invented method employs a multi-step protocol which erodes the cell structure of the biological sample, isolates, labels, fragments nucleic acids and purifies labeled samples from the excess of dye.

  18. RAPID FUSION METHOD FOR DETERMINATION OF PLUTONIUM ISOTOPES IN LARGE RICE SAMPLES

    SciTech Connect (OSTI)

    Maxwell, S.

    2013-03-01

    A new rapid fusion method for the determination of plutonium in large rice samples has been developed at the Savannah River National Laboratory (Aiken, SC, USA) that can be used to determine very low levels of plutonium isotopes in rice. The recent accident at Fukushima Nuclear Power Plant in March, 2011 reinforces the need to have rapid, reliable radiochemical analyses for radionuclides in environmental and food samples. Public concern regarding foods, particularly foods such as rice in Japan, highlights the need for analytical techniques that will allow very large sample aliquots of rice to be used for analysis so that very low levels of plutonium isotopes may be detected. The new method to determine plutonium isotopes in large rice samples utilizes a furnace ashing step, a rapid sodium hydroxide fusion method, a lanthanum fluoride matrix removal step, and a column separation process with TEVA Resin� cartridges. The method can be applied to rice sample aliquots as large as 5 kg. Plutonium isotopes can be determined using alpha spectrometry or inductively-coupled plasma mass spectrometry (ICP-MS). The method showed high chemical recoveries and effective removal of interferences. The rapid fusion technique is a rugged sample digestion method that ensures that any refractory plutonium particles are effectively digested. The MDA for a 5 kg rice sample using alpha spectrometry is 7E-5 mBq g{sup -1}. The method can easily be adapted for use by ICP-MS to allow detection of plutonium isotopic ratios.

  19. DEVELOPMENT AND FIELD IMPLEMENTATION OF AN IMPROVED METHOD FOR HEADSPACE GAS SAMPLING OF TRANSURANIC WASTE DRUMS

    SciTech Connect (OSTI)

    Polley, M.; Ankrom, J.; Wickland, T.; Warren, J.

    2003-02-27

    A fast, safe, and cost-effective method for obtaining headspace gas samples has been developed and implemented at Los Alamos National Laboratory (LANL). A sample port is installed directly into a drum lid using a pneumatic driver, allowing sampling with a side-port needle. Testing has shown that the sample port can be installed with no release of radioactive material. Use of this system at LANL has significantly reduced the time required for sampling, and eliminates the need for many safety precautions previously used. The system has significantly improved productivity and lowered radiation exposure and cost.

  20. Rapid method to determine actinides and 89/90Sr in limestone and marble samples

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Maxwell, Sherrod L.; Culligan, Brian; Hutchison, Jay B.; Utsey, Robin C.; Sudowe, Ralf; McAlister, Daniel R.

    2016-04-12

    A new method for the determination of actinides and radiostrontium in limestone and marble samples has been developed that utilizes a rapid sodium hydroxide fusion to digest the sample. Following rapid pre-concentration steps to remove sample matrix interferences, the actinides and 89/90Sr are separated using extraction chromatographic resins and measured radiometrically. The advantages of sodium hydroxide fusion versus other fusion techniques will be discussed. Lastly, this approach has a sample preparation time for limestone and marble samples of <4 hours.

  1. Apparatus and method for maintaining multi-component sample gas constituents in vapor phase during sample extraction and cooling

    DOE Patents [OSTI]

    Felix, Larry Gordon; Farthing, William Earl; Irvin, James Hodges; Snyder, Todd Robert

    2010-05-11

    A dilution apparatus for diluting a gas sample. The apparatus includes a sample gas conduit having a sample gas inlet end and a diluted sample gas outlet end, and a sample gas flow restricting orifice disposed proximate the sample gas inlet end connected with the sample gas conduit and providing fluid communication between the exterior and the interior of the sample gas conduit. A diluted sample gas conduit is provided within the sample gas conduit having a mixing end with a mixing space inlet opening disposed proximate the sample gas inlet end, thereby forming an annular space between the sample gas conduit and the diluted sample gas conduit. The mixing end of the diluted sample gas conduit is disposed at a distance from the sample gas flow restricting orifice. A dilution gas source connected with the sample gas inlet end of the sample gas conduit is provided for introducing a dilution gas into the annular space, and a filter is provided for filtering the sample gas. The apparatus is particularly suited for diluting heated sample gases containing one or more condensable components.

  2. Method and apparatus for measuring the NMR spectrum of an orientationally disordered sample

    DOE Patents [OSTI]

    Pines, Alexander; Samoson, Ago

    1990-01-01

    An improved NMR probe and method are described which substantially improve the resolution of NMR measurements made on powdered or amorphous or otherwise oreintationally disordered samples. The apparatus mechanically varies the orientation of the sample such that the time average of two or more sets of spherical harmonic functions is zero.

  3. Sample preparation method for glass welding by ultrashort laser pulses yields higher seam strength

    SciTech Connect (OSTI)

    Cvecek, K.; Miyamoto, I.; Strauss, J.; Wolf, M.; Frick, T.; Schmidt, M.

    2011-05-01

    Glass welding by ultrashort laser pulses allows joining without the need of an absorber or a preheating and postheating process. However, cracks generated during the welding process substantially impair the joining strength of the welding seams. In this paper a sample preparation method is described that prevents the formation of cracks. The measured joining strength of samples prepared by this method is substantially higher than previously reported values.

  4. Systems and methods for laser assisted sample transfer to solution for chemical analysis

    SciTech Connect (OSTI)

    Van Berkel, Gary J.; Kertesz, Vilmos; Ovchinnikova, Olga S.

    2015-09-29

    Systems and methods are described for laser ablation of an analyte from a specimen and capturing of the analyte in a dispensed solvent to form a testing solution. A solvent dispensing and extraction system can form a liquid microjunction with the specimen. The solvent dispensing and extraction system can include a surface sampling probe. The laser beam can be directed through the surface sampling probe. The surface sampling probe can also serve as an atomic force microscopy probe. The surface sampling probe can form a seal with the specimen. The testing solution including the analyte can then be analyzed using an analytical instrument or undergo further processing.

  5. Systems and methods for laser assisted sample transfer to solution for chemical analysis

    DOE Patents [OSTI]

    Van Berkel, Gary J; Kertesz, Vilmos; Ovchinnikova, Olga S

    2013-08-27

    Systems and methods are described for laser ablation of an analyte from a specimen and capturing of the analyte in a dispensed solvent to form a testing solution. A solvent dispensing and extraction system can form a liquid microjunction with the specimen. The solvent dispensing and extraction system can include a surface sampling probe. The laser beam can be directed through the surface sampling probe. The surface sampling probe can also serve as an atomic force microscopy probe. The surface sampling probe can form a seal with the specimen. The testing solution including the analyte can then be analyzed using an analytical instrument or undergo further processing.

  6. Systems and methods for laser assisted sample transfer to solution for chemical analysis

    SciTech Connect (OSTI)

    Van Berkel, Gary J.; Kertesz, Vilmos; Ovchinnikova, Olga S.

    2014-06-03

    Systems and methods are described for laser ablation of an analyte from a specimen and capturing of the analyte in a dispensed solvent to form a testing solution. A solvent dispensing and extraction system can form a liquid microjunction with the specimen. The solvent dispensing and extraction system can include a surface sampling probe. The laser beam can be directed through the surface sampling probe. The surface sampling probe can also serve as an atomic force microscopy probe. The surface sampling probe can form a seal with the specimen. The testing solution including the analyte can then be analyzed using an analytical instrument or undergo further processing.

  7. Method and apparatus for the preparation of liquid samples for determination of boron

    DOE Patents [OSTI]

    Siemer, D.D.

    A method and apparatus are described for the preparation of a liquid sample for the quantitative determination of boron by flame photometry. The sample is combined in a vessel with sulfuric acid, and an excess of methanol is added thereto. The methanol reacts with any boron present in the sample to form trimethyl borate which is volatilized by the heat of reaction between the excess methanol and sulfuric acid. The volatilized trimethyl borate is withdrawn from the vessel by either a partial vacuum or a positive pressure and is rapidly transferred to a standard flame photometer. The method is free of interference from typical boron concomitants.

  8. Method and apparatus for the preparation of liquid samples for determination of boron

    DOE Patents [OSTI]

    Siemer, Darryl D.

    1986-01-01

    A method and apparatus for the preparation of a liquid sample for the quantitative determination of boron by flame photometry. The sample is combined in a vessel with sulfuric acid, and an excess of methanol is added thereto. The methanol reacts with any boron present in the sample to form trimethyl borate which is volatilized by the heat of reaction between the excess methanol and sulfuric acid. The volatilized trimethyl borate is withdrawn from the vessel by either a partial vacuum or a positive pressure and is rapidly transferred to a standard flame photometer. The method is free of interference from typical boron concomitants.

  9. Method for determining the octane rating of gasoline samples by observing corresponding acoustic resonances therein

    DOE Patents [OSTI]

    Sinha, D.N.; Anthony, B.W.

    1997-02-25

    A method is described for determining the octane rating of gasoline samples by observing corresponding acoustic resonances therein. A direct correlation between the octane rating of gasoline and the frequency of corresponding acoustic resonances therein has been experimentally observed. Therefore, the octane rating of a gasoline sample can be directly determined through speed of sound measurements instead of by the cumbersome process of quantifying the knocking quality of the gasoline. Various receptacle geometries and construction materials may be employed. Moreover, it is anticipated that the measurements can be performed on flowing samples in pipes, thereby rendering the present method useful in refineries and distilleries. 3 figs.

  10. Method for determining the octane rating of gasoline samples by observing corresponding acoustic resonances therein

    DOE Patents [OSTI]

    Sinha, Dipen N.; Anthony, Brian W.

    1997-01-01

    A method for determining the octane rating of gasoline samples by observing corresponding acoustic resonances therein. A direct correlation between the octane rating of gasoline and the frequency of corresponding acoustic resonances therein has been experimentally observed. Therefore, the octane rating of a gasoline sample can be directly determined through speed of sound measurements instead of by the cumbersome process of quantifying the knocking quality of the gasoline. Various receptacle geometries and construction materials may be employed. Moreover, it is anticipated that the measurements can be performed on flowing samples in pipes, thereby rendering the present method useful in refineries and distilleries.

  11. Method for Operating a Sensor to Differentiate Between Analytes in a Sample

    DOE Patents [OSTI]

    Kunt, Tekin; Cavicchi, Richard E; Semancik, Stephen; McAvoy, Thomas J

    1998-07-28

    Disclosed is a method for operating a sensor to differentiate between first and second analytes in a sample. The method comprises the steps of determining a input profile for the sensor which will enhance the difference in the output profiles of the sensor as between the first analyte and the second analyte; determining a first analyte output profile as observed when the input profile is applied to the sensor; determining a second analyte output profile as observed when the temperature profile is applied to the sensor; introducing the sensor to the sample while applying the temperature profile to the sensor, thereby obtaining a sample output profile; and evaluating the sample output profile as against the first and second analyte output profiles to thereby determine which of the analytes is present in the sample.

  12. Rapid fusion method for the determination of refractory thorium and uranium isotopes in soil samples

    SciTech Connect (OSTI)

    Maxwell, Sherrod L.; Hutchison, Jay B.; McAlister, Daniel R.

    2015-02-14

    Recently, approximately 80% of participating laboratories failed to accurately determine uranium isotopes in soil samples in the U.S Department of Energy Mixed Analyte Performance Evaluation Program (MAPEP) Session 30, due to incomplete dissolution of refractory particles in the samples. Failing laboratories employed acid dissolution methods, including hydrofluoric acid, to recover uranium from the soil matrix. The failures illustrate the importance of rugged soil dissolution methods for the accurate measurement of analytes in the sample matrix. A new rapid fusion method has been developed by the Savannah River National Laboratory (SRNL) to prepare 1-2 g soil sample aliquots very quickly, with total dissolution of refractory particles. Soil samples are fused with sodium hydroxide at 600 C in zirconium crucibles to enable complete dissolution of the sample. Uranium and thorium are separated on stacked TEVA and TRU extraction chromatographic resin cartridges, prior to isotopic measurements by alpha spectrometry on cerium fluoride microprecipitation sources. Plutonium can also be separated and measured using this method. Batches of 12 samples can be prepared for measurement in <5 hours.

  13. Rapid fusion method for the determination of refractory thorium and uranium isotopes in soil samples

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Maxwell, Sherrod L.; Hutchison, Jay B.; McAlister, Daniel R.

    2015-02-14

    Recently, approximately 80% of participating laboratories failed to accurately determine uranium isotopes in soil samples in the U.S Department of Energy Mixed Analyte Performance Evaluation Program (MAPEP) Session 30, due to incomplete dissolution of refractory particles in the samples. Failing laboratories employed acid dissolution methods, including hydrofluoric acid, to recover uranium from the soil matrix. The failures illustrate the importance of rugged soil dissolution methods for the accurate measurement of analytes in the sample matrix. A new rapid fusion method has been developed by the Savannah River National Laboratory (SRNL) to prepare 1-2 g soil sample aliquots very quickly, withmore » total dissolution of refractory particles. Soil samples are fused with sodium hydroxide at 600 ºC in zirconium crucibles to enable complete dissolution of the sample. Uranium and thorium are separated on stacked TEVA and TRU extraction chromatographic resin cartridges, prior to isotopic measurements by alpha spectrometry on cerium fluoride microprecipitation sources. Plutonium can also be separated and measured using this method. Batches of 12 samples can be prepared for measurement in <5 hours.« less

  14. Rapid fusion method for the determination of refractory thorium and uranium isotopes in soil samples

    SciTech Connect (OSTI)

    Maxwell, Sherrod L.; Hutchison, Jay B.; McAlister, Daniel R.

    2015-02-14

    Recently, approximately 80% of participating laboratories failed to accurately determine uranium isotopes in soil samples in the U.S Department of Energy Mixed Analyte Performance Evaluation Program (MAPEP) Session 30, due to incomplete dissolution of refractory particles in the samples. Failing laboratories employed acid dissolution methods, including hydrofluoric acid, to recover uranium from the soil matrix. The failures illustrate the importance of rugged soil dissolution methods for the accurate measurement of analytes in the sample matrix. A new rapid fusion method has been developed by the Savannah River National Laboratory (SRNL) to prepare 1-2 g soil sample aliquots very quickly, with total dissolution of refractory particles. Soil samples are fused with sodium hydroxide at 600 ºC in zirconium crucibles to enable complete dissolution of the sample. Uranium and thorium are separated on stacked TEVA and TRU extraction chromatographic resin cartridges, prior to isotopic measurements by alpha spectrometry on cerium fluoride microprecipitation sources. Plutonium can also be separated and measured using this method. Batches of 12 samples can be prepared for measurement in <5 hours.

  15. Field sampling and selecting on-site analytical methods for explosives in soil

    SciTech Connect (OSTI)

    Crockett, A.B.; Craig, H.D.; Jenkins, T.F.; Sisk, W.E.

    1996-12-01

    A large number of defense-related sites are contaminated with elevated levels of secondary explosives. Levels of contamination range from barely detectable to levels above 10% that need special handling because of the detonation potential. Characterization of explosives-contaminated sites is particularly difficult because of the very heterogeneous distribution of contamination in the environment and within samples. To improve site characterization, several options exist including collecting more samples, providing on-site analytical data to help direct the investigation, compositing samples, improving homogenization of the samples, and extracting larger samples. This publication is intended to provide guidance to Remedial Project Managers regarding field sampling and on-site analytical methods for detecting and quantifying secondary explosive compounds in soils, and is not intended to include discussions of the safety issues associated with sites contaminated with explosive residues.

  16. Methods for point-of-care detection of nucleic acid in a sample

    DOE Patents [OSTI]

    Bearinger, Jane P.; Dugan, Lawrence C.

    2015-12-29

    Provided herein are methods and apparatus for detecting a target nucleic acid in a sample and related methods and apparatus for diagnosing a condition in an individual. The condition is associated with presence of nucleic acid produced by certain pathogens in the individual.

  17. RAPID SEPARATION METHOD FOR 237NP AND PU ISOTOPES IN LARGE SOIL SAMPLES

    SciTech Connect (OSTI)

    Maxwell, S.; Culligan, B.; Noyes, G.

    2010-07-26

    A new rapid method for the determination of {sup 237}Np and Pu isotopes in soil and sediment samples has been developed at the Savannah River Site Environmental Lab (Aiken, SC, USA) that can be used for large soil samples. The new soil method utilizes an acid leaching method, iron/titanium hydroxide precipitation, a lanthanum fluoride soil matrix removal step, and a rapid column separation process with TEVA Resin. The large soil matrix is removed easily and rapidly using this two simple precipitations with high chemical recoveries and effective removal of interferences. Vacuum box technology and rapid flow rates are used to reduce analytical time.

  18. Method for producing a thin sample band in a microchannel device

    DOE Patents [OSTI]

    Griffiths, Stewart K.; Nilson, Robert H.

    2004-08-03

    The present invention improves the performance of microchannel systems for chemical and biological synthesis and analysis by providing a method and apparatus for producing a thin band of a species sample. Thin sample bands improve the resolution of microchannel separation processes, as well as many other processes requiring precise control of sample size and volume. The new method comprises a series of steps in which a species sample is manipulated by controlled transport through a junction formed at the intersection of four or more channels. A sample is first inserted into the end of one of these channels in the vicinity of the junction. Next, this sample is thinned by transport across the junction one or more times. During these thinning steps, flow enters the junction through one of the channels and exists through those remaining, providing a divergent flow field that progressively stretches and thins the band with each traverse of the junction. The thickness of the resulting sample band may be smaller than the channel width. Moreover, the thickness of the band may be varied and controlled by altering the method alone, without modification to the channel or junction geometries. The invention is applicable to both electroosmotic and electrophoretic transport, to combined electrokinetic transport, and to some special cases in which bulk fluid transport is driven by pressure gradients. It is further applicable to channels that are open, filled with a gel or filled with a porous or granular material.

  19. Rapid fusion method for the determination of Pu, Np, and Am in large soil samples

    SciTech Connect (OSTI)

    Maxwell, Sherrod L.; Culligan, Brian; Hutchison, Jay B.; McAlister, Daniel R.

    2015-02-14

    A new rapid sodium hydroxide fusion method for the preparation of 10-20 g soil samples has been developed by the Savannah River National Laboratory (SRNL). The method enables lower detection limits for plutonium, neptunium, and americium in environmental soil samples. The method also significantly reduces sample processing time and acid fume generation compared to traditional soil digestion techniques using hydrofluoric acid. Ten gram soil aliquots can be ashed and fused using the new method in 1-2 hours, completely dissolving samples, including refractory particles. Pu, Np and Am are separated using stacked 2mL cartridges of TEVA and DGA Resin and measured using alpha spectrometry. The method can be adapted for measurement by inductively-coupled plasma mass spectrometry (ICP-MS). Two 10 g soil aliquots of fused soil may be combined prior to chromatographic separations to further improve detection limits. Total sample preparation time, including chromatographic separations and alpha spectrometry source preparation, is less than 8 hours.

  20. Rapid fusion method for the determination of Pu, Np, and Am in large soil samples

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Maxwell, Sherrod L.; Culligan, Brian; Hutchison, Jay B.; McAlister, Daniel R.

    2015-02-14

    A new rapid sodium hydroxide fusion method for the preparation of 10-20 g soil samples has been developed by the Savannah River National Laboratory (SRNL). The method enables lower detection limits for plutonium, neptunium, and americium in environmental soil samples. The method also significantly reduces sample processing time and acid fume generation compared to traditional soil digestion techniques using hydrofluoric acid. Ten gram soil aliquots can be ashed and fused using the new method in 1-2 hours, completely dissolving samples, including refractory particles. Pu, Np and Am are separated using stacked 2mL cartridges of TEVA and DGA Resin and measuredmore » using alpha spectrometry. The method can be adapted for measurement by inductively-coupled plasma mass spectrometry (ICP-MS). Two 10 g soil aliquots of fused soil may be combined prior to chromatographic separations to further improve detection limits. Total sample preparation time, including chromatographic separations and alpha spectrometry source preparation, is less than 8 hours.« less

  1. Apparatus and methods for high resolution separation of sample components on microfabricated channel devices

    DOE Patents [OSTI]

    Mathies, Richard A.; Paegel, Brian; Simpson, Peter C.; Hutt, Lester

    2005-07-05

    Sample component separation apparatus and methods are described. An exemplary sample component separation apparatus includes a separation channel having a turn portion configured to reduce band-broadening caused by passage of a sample through the turn portion. To reduce band broadening caused by passage of a sample through a turn portion, the turn portion may be constructed and arranged to have a sample transport characteristic that is different from the corresponding sample transport characteristic of a substantially straight portion of the separation channel. For example, the turn portion may be configured with an effective channel width that is smaller than the effective channel widths of the substantially straight portion of the separation channel. The actual channel width of the turn portion may be smaller than the channel widths of the substantially straight portion; the effective channel width of the turn portion may be reduced by placing one or more sample transport barriers or constrictions in the turn portion of the channel. Alternatively, the sample velocity through the turn portion may be controlled so as to reduce band broadening. For example, sample transport barriers may be disposed in the turn portion so that sample components of a given band travel through the turn portion at substantially the same effective rate, whereby the band orientation remains substantially aligned along radial directions characteristic of the turn portion. Other a sample transport characteristics, such as electrical resistance or fluid flow resistance, of the turn portion may be adapted to reduce band broadening caused by passage of the sample through the turn portion.

  2. Method for the concentration and separation of actinides from biological and environmental samples

    DOE Patents [OSTI]

    Horwitz, E.P.; Dietz, M.L.

    1989-05-30

    A method and apparatus for the quantitative recover of actinide values from biological and environmental sample by passing appropriately prepared samples in a mineral acid solution through a separation column of a dialkyl(phenyl)-N,N-dialylcarbamoylmethylphosphine oxide dissolved in tri-n-butyl phosphate on an inert substrate which selectively extracts the actinide values. The actinide values can be eluted either as a group or individually and their presence quantitatively detected by alpha counting. 3 figs.

  3. Method for the concentration and separation of actinides from biological and environmental samples

    DOE Patents [OSTI]

    Horwitz, E. Philip; Dietz, Mark L.

    1989-01-01

    A method and apparatus for the quantitative recover of actinide values from biological and environmental sample by passing appropriately prepared samples in a mineral acid solution through a separation column of a dialkyl(phenyl)-N,N-dialylcarbamoylmethylphosphine oxide dissolved in tri-n-butyl phosphate on an inert substrate which selectively extracts the actinide values. The actinide values can be eluted either as a group or individually and their presence quantitatively detected by alpha counting.

  4. Assembly for collecting samples for purposes of identification or analysis and method of use

    DOE Patents [OSTI]

    Thompson, Cyril V. [Knoxville, TN; Smith, Rob R. [Knoxville, TN

    2010-02-02

    An assembly and an associated method for collecting a sample of material desired to be characterized with diagnostic equipment includes or utilizes an elongated member having a proximal end with which the assembly is manipulated by a user and a distal end. In addition, a collection tip which is capable of being placed into contact with the material to be characterized is supported upon the distal end. The collection tip includes a body of chemically-inert porous material for binding a sample of material when the tip is placed into contact with the material and thereby holds the sample of material for subsequent introduction to the diagnostic equipment.

  5. Method and apparatus for measuring the gas permeability of a solid sample

    DOE Patents [OSTI]

    Carstens, D.H.W.

    1984-01-27

    The disclosure is directed to an apparatus and method for measuring the permeability of a gas in a sample. The gas is allowed to reach a steady flow rate through the sample. A measurable amount of the gas is collected during a given time period and then delivered to a sensitive quadrupole. The quadrupole signal, adjusted for background, is proportional to the amount of gas collected during the time period. The quadrupole can be calibrated with a standard helium leak. The gas can be deuterium and the sample can be polyvinyl alcohol.

  6. Electrodeposition as an alternate method for preparation of environmental samples for iodide by AMS

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Adamic, M. L.; Lister, T. E.; Dufek, E. J.; Jenson, D. D.; Olson, J. E.; Vockenhuber, C.; Watrous, M. G.

    2015-03-25

    This paper presents an evaluation of an alternate method for preparing environmental samples for 129I analysis by accelerator mass spectrometry (AMS) at Idaho National Laboratory. The optimal sample preparation method is characterized by ease of preparation, capability of processing very small quantities of iodide, and ease of loading into a cathode. Electrodeposition of iodide on a silver wire was evaluated using these criteria. This study indicates that the electrochemically-formed silver iodide deposits produce ion currents similar to those from precipitated silver iodide for the same sample mass. Furthermore, precipitated silver iodide samples are usually mixed with niobium or silver powdermore » prior to loading in a cathode. Using electrodeposition, the silver is already mixed with the sample and can simply be picked up with tweezers, placed in the sample die, and pressed into a cathode. The major advantage of this method is that the silver wire/electrodeposited silver iodide is much easier to load into a cathode.« less

  7. Analytical Chemistry Laboratory (ACL) procedure compendium. Volume 2, Sample preparation methods

    SciTech Connect (OSTI)

    Not Available

    1993-08-01

    This volume contains the interim change notice for sample preparation methods. Covered are: acid digestion for metals analysis, fusion of Hanford tank waste solids, water leach of sludges/soils/other solids, extraction procedure toxicity (simulate leach in landfill), sample preparation for gamma spectroscopy, acid digestion for radiochemical analysis, leach preparation of solids for free cyanide analysis, aqueous leach of solids for anion analysis, microwave digestion of glasses and slurries for ICP/MS, toxicity characteristic leaching extraction for inorganics, leach/dissolution of activated metal for radiochemical analysis, extraction of single-shell tank (SST) samples for semi-VOC analysis, preparation and cleanup of hydrocarbon- containing samples for VOC and semi-VOC analysis, receiving of waste tank samples in onsite transfer cask, receipt and inspection of SST samples, receipt and extrusion of core samples at 325A shielded facility, cleaning and shipping of waste tank samplers, homogenization of solutions/slurries/sludges, and test sample preparation for bioassay quality control program.

  8. Final LDRD report : development of sample preparation methods for ChIPMA-based imaging mass spectrometry of tissue samples.

    SciTech Connect (OSTI)

    Maharrey, Sean P.; Highley, Aaron M.; Behrens, Richard, Jr.; Wiese-Smith, Deneille

    2007-12-01

    The objective of this short-term LDRD project was to acquire the tools needed to use our chemical imaging precision mass analyzer (ChIPMA) instrument to analyze tissue samples. This effort was an outgrowth of discussions with oncologists on the need to find the cellular origin of signals in mass spectra of serum samples, which provide biomarkers for ovarian cancer. The ultimate goal would be to collect chemical images of biopsy samples allowing the chemical images of diseased and nondiseased sections of a sample to be compared. The equipment needed to prepare tissue samples have been acquired and built. This equipment includes an cyro-ultramicrotome for preparing thin sections of samples and a coating unit. The coating unit uses an electrospray system to deposit small droplets of a UV-photo absorbing compound on the surface of the tissue samples. Both units are operational. The tissue sample must be coated with the organic compound to enable matrix assisted laser desorption/ionization (MALDI) and matrix enhanced secondary ion mass spectrometry (ME-SIMS) measurements with the ChIPMA instrument Initial plans to test the sample preparation using human tissue samples required development of administrative procedures beyond the scope of this LDRD. Hence, it was decided to make two types of measurements: (1) Testing the spatial resolution of ME-SIMS by preparing a substrate coated with a mixture of an organic matrix and a bio standard and etching a defined pattern in the coating using a liquid metal ion beam, and (2) preparing and imaging C. elegans worms. Difficulties arose in sectioning the C. elegans for analysis and funds and time to overcome these difficulties were not available in this project. The facilities are now available for preparing biological samples for analysis with the ChIPMA instrument. Some further investment of time and resources in sample preparation should make this a useful tool for chemical imaging applications.

  9. Method of analyzing multiple sample simultaneously by detecting absorption and systems for use in such a method

    DOE Patents [OSTI]

    Yeung, Edward S.; Gong, Xiaoyi

    2004-09-07

    The present invention provides a method of analyzing multiple samples simultaneously by absorption detection. The method comprises: (i) providing a planar array of multiple containers, each of which contains a sample comprising at least one absorbing species, (ii) irradiating the planar array of multiple containers with a light source and (iii) detecting absorption of light with a detetion means that is in line with the light source at a distance of at leaat about 10 times a cross-sectional distance of a container in the planar array of multiple containers. The absorption of light by a sample indicates the presence of an absorbing species in it. The method can further comprise: (iv) measuring the amount of absorption of light detected in (iii) indicating the amount of the absorbing species in the sample. Also provided by the present invention is a system for use in the abov metho.The system comprises; (i) a light source comrnpising or consisting essentially of at leaat one wavelength of light, the absorption of which is to be detected, (ii) a planar array of multiple containers, and (iii) a detection means that is in line with the light source and is positioned in line with and parallel to the planar array of multiple contiainers at a distance of at least about 10 times a cross-sectional distance of a container.

  10. An efficient and cost-effective method for preparing transmission electron microscopy samples from powders

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Wen, Haiming; Lin, Yaojun; Seidman, David N.; Schoenung, Julie M.; van Rooyen, Isabella J.; Lavernia, Enrique J.

    2015-09-09

    The preparation of transmission electron microcopy (TEM) samples from powders with particle sizes larger than ~100 nm poses a challenge. The existing methods are complicated and expensive, or have a low probability of success. Herein, we report a modified methodology for preparation of TEM samples from powders, which is efficient, cost-effective, and easy to perform. This method involves mixing powders with an epoxy on a piece of weighing paper, curing the powder–epoxy mixture to form a bulk material, grinding the bulk to obtain a thin foil, punching TEM discs from the foil, dimpling the discs, and ion milling the dimpledmore » discs to electron transparency. Compared with the well established and robust grinding–dimpling–ion-milling method for TEM sample preparation for bulk materials, our modified approach for preparing TEM samples from powders only requires two additional simple steps. In this article, step-by-step procedures for our methodology are described in detail, and important strategies to ensure success are elucidated. Furthermore, our methodology has been applied successfully for preparing TEM samples with large thin areas and high quality for many different mechanically milled metallic powders.« less

  11. Device and method for automated separation of a sample of whole blood into aliquots

    DOE Patents [OSTI]

    Burtis, Carl A.; Johnson, Wayne F.

    1989-01-01

    A device and a method for automated processing and separation of an unmeasured sample of whole blood into multiple aliquots of plasma. Capillaries are radially oriented on a rotor, with the rotor defining a sample chamber, transfer channels, overflow chamber, overflow channel, vent channel, cell chambers, and processing chambers. A sample of whole blood is placed in the sample chamber, and when the rotor is rotated, the blood moves outward through the transfer channels to the processing chambers where the blood is centrifugally separated into a solid cellular component and a liquid plasma component. When the rotor speed is decreased, the plasma component backfills the capillaries resulting in uniform aliquots of plasma which may be used for subsequent analytical procedures.

  12. Rapid Column Extraction Method for Actinides and Sr-89/90 in Water Samples

    SciTech Connect (OSTI)

    MAXWELL III, SHERROD L.

    2005-06-15

    The SRS Environmental Laboratory analyzes water samples for environmental monitoring, including river water and ground water samples. A new, faster actinide and strontium 89/90 separation method has been developed and implemented to improve productivity, reduce labor costs and add capacity to this laboratory. This method uses stacked TEVA Resin{reg_sign}, TRU Resin{reg_sign} and Sr-Resin{reg_sign} cartridges from Eichrom Technologies (Darien, IL, USA) that allows the rapid separation of plutonium (Pu), neptunium (Np), uranium (U), americium (Am), curium (Cm) and thorium (Th) using a single multi-stage column combined with alpha spectrometry. By using vacuum box cartridge technology with rapid flow rates, sample preparation time is minimized. The method can be used for routine analysis or as a rapid method for emergency preparedness. Thorium and curium are often analyzed separately due to the interference of the daughter of Th-229 tracer, actinium (Ac)-225, on curium isotopes when measured by alpha spectrometry. This new method also adds a separation step using DGA Resin{reg_sign}, (Diglycolamide Resin, Eichrom Technologies) to remove Ac-225 and allow the separation and analysis of thorium isotopes and curium isotopes at the same time.

  13. Electrical network method for the thermal or structural characterization of a conducting material sample or structure

    DOE Patents [OSTI]

    Ortiz, M.G.

    1993-06-08

    A method for modeling a conducting material sample or structure system, as an electrical network of resistances in which each resistance of the network is representative of a specific physical region of the system. The method encompasses measuring a resistance between two external leads and using this measurement in a series of equations describing the network to solve for the network resistances for a specified region and temperature. A calibration system is then developed using the calculated resistances at specified temperatures. This allows for the translation of the calculated resistances to a region temperature. The method can also be used to detect and quantify structural defects in the system.

  14. Electrical network method for the thermal or structural characterization of a conducting material sample or structure

    DOE Patents [OSTI]

    Ortiz, Marco G.

    1993-01-01

    A method for modeling a conducting material sample or structure system, as an electrical network of resistances in which each resistance of the network is representative of a specific physical region of the system. The method encompasses measuring a resistance between two external leads and using this measurement in a series of equations describing the network to solve for the network resistances for a specified region and temperature. A calibration system is then developed using the calculated resistances at specified temperatures. This allows for the translation of the calculated resistances to a region temperature. The method can also be used to detect and quantify structural defects in the system.

  15. Method of extruding and packaging a thin sample of reactive material, including forming the extrusion die

    DOE Patents [OSTI]

    Lewandowski, E.F.; Peterson, L.L.

    1981-11-30

    This invention teaches a method of cutting a narrow slot in an extrusion die with an electrical discharge machine by first drilling spaced holes at the ends of where the slot will be, whereby the oil can flow through the holes and slot to flush the material eroded away as the slot is being cut. The invention further teaches a method of extruding a very thin ribbon of solid highly reactive material such as lithium or sodium through the die in an inert atmosphere of nitrogen, argon, or the like as in a glovebox. The invention further teaches a method of stamping out sample discs from the ribbon and of packaging each disc by sandwiching it between two aluminum sheets and cold welding the sheets together along an annular seam beyond the outer periphery of the disc. This provides a sample of high purity reactive material that can have a long shelf life.

  16. Method of extruding and packaging a thin sample of reactive material including forming the extrusion die

    DOE Patents [OSTI]

    Lewandowski, Edward F.; Peterson, Leroy L.

    1985-01-01

    This invention teaches a method of cutting a narrow slot in an extrusion die with an electrical discharge machine by first drilling spaced holes at the ends of where the slot will be, whereby the oil can flow through the holes and slot to flush the material eroded away as the slot is being cut. The invention further teaches a method of extruding a very thin ribbon of solid highly reactive material such as lithium or sodium through the die in an inert atmosphere of nitrogen, argon or the like as in a glovebox. The invention further teaches a method of stamping out sample discs from the ribbon and of packaging each disc by sandwiching it between two aluminum sheets and cold welding the sheets together along an annular seam beyond the outer periphery of the disc. This provides a sample of high purity reactive material that can have a long shelf life.

  17. Rapid method to determine 89Sr/90Sr in large concrete samples

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Maxwell, Sherrod L.; Culligan, Brian; Hutchison, Jay B.; Utsey, Robin C.; Sudowe, Ralf; McAlister, Daniel R.

    2016-03-24

    Here, a new rapid method has been developed that provides high quality low-level measurements of 89,90Sr in concrete samples with an MDA (Minimum Detectable Activity) of <1 mBq g-1. The new method is fast, meets new decommissioning regulatory limits and is robust even if refractory particles are present. The method utilizes a rapid fusion to ensure total dissolution of samples and rapid preconcentration and separation of 89,90Sr from 5-10 g concrete samples. When, the 89Sr/90Sr ratio is high, Sr can be isolated from up to 5g concrete samples, total 89/90Sr measured, and then 90Sr determined via 90Y separated after amore » period of ingrowth. Another approach allows the immediate determination of 90Sr in 10 g concrete aliquots without waiting for 90Y ingrowth, in instances where the shorter lived 89Sr is unlikely to be encountered.« less

  18. Simple method for highlighting the temperature distribution into a liquid sample heated by microwave power field

    SciTech Connect (OSTI)

    Surducan, V.; Surducan, E.; Dadarlat, D.

    2013-11-13

    Microwave induced heating is widely used in medical treatments, scientific and industrial applications. The temperature field inside a microwave heated sample is often inhomogenous, therefore multiple temperature sensors are required for an accurate result. Nowadays, non-contact (Infra Red thermography or microwave radiometry) or direct contact temperature measurement methods (expensive and sophisticated fiber optic temperature sensors transparent to microwave radiation) are mainly used. IR thermography gives only the surface temperature and can not be used for measuring temperature distributions in cross sections of a sample. In this paper we present a very simple experimental method for temperature distribution highlighting inside a cross section of a liquid sample, heated by a microwave radiation through a coaxial applicator. The method proposed is able to offer qualitative information about the heating distribution, using a temperature sensitive liquid crystal sheet. Inhomogeneities as smaller as 1°-2°C produced by the symmetry irregularities of the microwave applicator can be easily detected by visual inspection or by computer assisted color to temperature conversion. Therefore, the microwave applicator is tuned and verified with described method until the temperature inhomogeneities are solved.

  19. RAPID METHOD FOR PLUTONIUM, AMERICIUM AND CURIUM IN VERY LARGE SOIL SAMPLES

    SciTech Connect (OSTI)

    Maxwell, S

    2007-01-08

    The analysis of actinides in environmental soil and sediment samples is very important for environmental monitoring. There is a need to measure actinide isotopes with very low detection limits. A new, rapid actinide separation method has been developed and implemented that allows the measurement of plutonium, americium and curium isotopes in very large soil samples (100-200 g) with high chemical recoveries and effective removal of matrix interferences. This method uses stacked TEVA Resin{reg_sign}, TRU Resin{reg_sign} and DGA-Resin{reg_sign} cartridges from Eichrom Technologies (Darien, IL, USA) that allows the rapid separation of plutonium (Pu), americium (Am), and curium (Cm) using a single multistage column combined with alpha spectrometry. The method combines an acid leach step and innovative matrix removal using cerium fluoride precipitation to remove the difficult soil matrix. This method is unique in that it provides high tracer recoveries and effective removal of interferences with small extraction chromatography columns instead of large ion exchange resin columns that generate large amounts of acid waste. By using vacuum box cartridge technology with rapid flow rates, sample preparation time is minimized.

  20. Photothermal method for in situ microanalysis of the chemical composition of coal samples

    DOE Patents [OSTI]

    Amer, N.M.

    1983-10-25

    Successive minute regions along a scan path on a coal sample are individually analyzed, at a series of different depths if desired, to determine chemical composition including the locations, sizes and distributions of different maceral inclusions. A sequence of infrared light pulses of progressively changing wavelengths is directed into each minute region and a probe light beam is directed along the sample surface adjacent the region. Infrared wavelengths at which strong absorption occurs in the region are identified by detecting the resulting deflections of the probe beam caused by thermally induced index of refraction changes in the air or other medium adjacent the region. The detected peak absorption wavelengths are correlated with known characteristic peak absorption wavelengths of specific coal constituents to identify the composition of each such minute region of the sample. The method enables rapid, convenient and non-destructive analyses of coal specimens to facilitate mining, processing and utilization of coals. 2 figures.

  1. Survey of sampling-based methods for uncertainty and sensitivity analysis.

    SciTech Connect (OSTI)

    Johnson, Jay Dean; Helton, Jon Craig; Sallaberry, Cedric J. PhD.; Storlie, Curt B. (Colorado State University, Fort Collins, CO)

    2006-06-01

    Sampling-based methods for uncertainty and sensitivity analysis are reviewed. The following topics are considered: (1) Definition of probability distributions to characterize epistemic uncertainty in analysis inputs, (2) Generation of samples from uncertain analysis inputs, (3) Propagation of sampled inputs through an analysis, (4) Presentation of uncertainty analysis results, and (5) Determination of sensitivity analysis results. Special attention is given to the determination of sensitivity analysis results, with brief descriptions and illustrations given for the following procedures/techniques: examination of scatterplots, correlation analysis, regression analysis, partial correlation analysis, rank transformations, statistical tests for patterns based on gridding, entropy tests for patterns based on gridding, nonparametric regression analysis, squared rank differences/rank correlation coefficient test, two dimensional Kolmogorov-Smirnov test, tests for patterns based on distance measures, top down coefficient of concordance, and variance decomposition.

  2. System and method for laser assisted sample transfer to solution for chemical analysis

    SciTech Connect (OSTI)

    Van Berkel, Gary J; Kertesz, Vilmos

    2014-01-28

    A system and method for laser desorption of an analyte from a specimen and capturing of the analyte in a suspended solvent to form a testing solution are described. The method can include providing a specimen supported by a desorption region of a specimen stage and desorbing an analyte from a target site of the specimen with a laser beam centered at a radiation wavelength (.lamda.). The desorption region is transparent to the radiation wavelength (.lamda.) and the sampling probe and a laser source emitting the laser beam are on opposite sides of a primary surface of the specimen stage. The system can also be arranged where the laser source and the sampling probe are on the same side of a primary surface of the specimen stage. The testing solution can then be analyzed using an analytical instrument or undergo further processing.

  3. Method for the thermal characterization, visualization, and integrity evaluation of conducting material samples or complex structures

    DOE Patents [OSTI]

    Ortiz, Marcos G.

    1992-01-01

    A method for modeling a conducting material sample or structure (herein called a system) as at least two regions which comprise an electrical network of resistances, for measuring electric resistance between at least two selected pairs of external leads attached to the surface of the system, wherein at least one external lead is attached to the surface of each of the regions, and, using basic circuit theory, for translating measured resistances into temperatures or thermophysical properties in corresponding regions of the system.

  4. Comparison of SW-846 method 3051 and SW-846 method 7471A for the preparation of solid waste samples for mercury determination

    SciTech Connect (OSTI)

    Giaquinto, J.M.; Essling, A.M.; Keller, J.M.

    1996-08-01

    This report describes experimental studies to evaluate the use of EPA SW-846 method 3051 for preparation and dissolution of solid samples for Hg analysis. The study showed that the method is effective in dissolution of four sample types without significant loss of Hg. Based on results of this study, method 3051 was used for analysis of high radioactive waste samples to obtain results for a number of RCRA regulated metals without the need to utilize a separate sample preparation method (EPA SW-846 method 7471A) specific only for Hg.

  5. Rapid Method for Ra-226 and Ra-228 in Water Samples

    SciTech Connect (OSTI)

    Maxwell, Sherrod, L. III

    2006-02-10

    The measurement of radium isotopes in natural waters is important for oceanographic studies and for public health reasons. Ra-226 (1620 year half-life) is one of the most toxic of the long-lived alpha emitters present in the environment due to its long life and its tendency to concentrate in bones, which increases the internal radiation dose of individuals. The analysis of radium-226 and radium-228 in natural waters can be tedious and time-consuming. Different sample preparation methods are often required to prepare Ra-226 and Ra-228 for separate analyses. A rapid method has been developed at the Savannah River Environmental Laboratory that effectively separates both Ra-226 and Ra-228 (via Ac-228) for assay. This method uses MnO{sub 2} Resin from Eichrom Technologies (Darien, IL, USA) to preconcentrate Ra-226 and Ra-228 rapidly from water samples, along with Ba-133 tracer. DGA Resin{reg_sign} (Eichrom) and Ln-Resin{reg_sign} (Eichrom) are employed in tandem to prepare Ra-226 for assay by alpha spectrometry and to determine Ra-228 via the measurement of Ac-228 by gas proportional counting. After preconcentration, the manganese dioxide is dissolved from the resin and passed through stacked Ln-Resin-DGA Resin cartridges that remove uranium and thorium interferences and retain Ac-228 on DGA Resin. The eluate that passed through this column is evaporated, redissolved in a lower acidity and passed through Ln-Resin again to further remove interferences before performing a barium sulfate microprecipitation. The Ac-228 is stripped from the resin, collected using cerium fluoride microprecipitation and counted by gas proportional counting. By using vacuum box cartridge technology with rapid flow rates, sample preparation time is minimized.

  6. Method for the thermal characterization, visualization, and integrity evaluation of conducting material samples or complex structures

    DOE Patents [OSTI]

    Ortiz, M.G.

    1992-11-24

    Disclosed is a method for modeling a conducting material sample or structure (herein called a system) as at least two regions which comprise an electrical network of resistances, for measuring electric resistance between at least two selected pairs of external leads attached to the surface of the system, wherein at least one external lead is attached to the surface of each of the regions, and, using basic circuit theory, for translating measured resistances into temperatures or thermophysical properties in corresponding regions of the system. 16 figs.

  7. Systems For Column-Based Separations, Methods Of Forming Packed Columns, And Methods Of Purifying Sample Components

    DOE Patents [OSTI]

    Egorov, Oleg B.; O'Hara, Matthew J.; Grate, Jay W.; Chandler, Darrell P.; Brockman, Fred J.; Bruckner-Lea, Cynthia J.

    2006-02-21

    The invention encompasses systems for column-based separations, methods of packing and unpacking columns and methods of separating components of samples. In one aspect, the invention includes a method of packing and unpacking a column chamber, comprising: a) packing a matrix material within a column chamber to form a packed column; and b) after the packing, unpacking the matrix material from the column chamber without moving the column chamber. In another aspect, the invention includes a system for column-based separations, comprising: a) a fluid passageway, the fluid passageway comprising a column chamber and a flow path in fluid communication with the column chamber, the flow path being obstructed by a retaining material permeable to a carrier fluid and impermeable to a column matrix material suspended in the carrier fluid, the flow path extending through the column chamber and through the retaining material, the flow path being configured to form a packed column within the column chamber when a suspension of the fluid and the column matrix material is flowed along the flow path; and b) the fluid passageway extending through a valve intermediate the column chamber and the retaining material.

  8. Systems for column-based separations, methods of forming packed columns, and methods of purifying sample components

    DOE Patents [OSTI]

    Egorov, Oleg B.; O'Hara, Matthew J.; Grate, Jay W.; Chandler, Darrell P.; Brockman, Fred J.; Bruckner-Lea, Cynthia J.

    2000-01-01

    The invention encompasses systems for column-based separations, methods of packing and unpacking columns and methods of separating components of samples. In one aspect, the invention includes a method of packing and unpacking a column chamber, comprising: a) packing a matrix material within a column chamber to form a packed column; and b) after the packing, unpacking the matrix material from the column chamber without moving the column chamber. In another aspect, the invention includes a system for column-based separations, comprising: a) a fluid passageway, the fluid passageway comprising a column chamber and a flow path in fluid communication with the column chamber, the flow path being obstructed by a retaining material permeable to a carrier fluid and impermeable to a column matrix material suspended in the carrier fluid, the flow path extending through the column chamber and through the retaining material, the flow path being configured to form a packed column within the column chamber when a suspension of the fluid and the column matrix material is flowed along the flow path; and b) the fluid passageway extending through a valve intermediate the column chamber and the retaining material.

  9. Systems For Column-Based Separations, Methods Of Forming Packed Columns, And Methods Of Purifying Sample Components.

    DOE Patents [OSTI]

    Egorov, Oleg B.; O'Hara, Matthew J.; Grate, Jay W.; Chandler, Darrell P.; Brockman, Fred J.; Bruckner-Lea, Cynthia J.

    2004-08-24

    The invention encompasses systems for column-based separations, methods of packing and unpacking columns and methods of separating components of samples. In one aspect, the invention includes a method of packing and unpacking a column chamber, comprising: a) packing a matrix material within a column chamber to form a packed column; and b) after the packing, unpacking the matrix material from the column chamber without moving the column chamber. In another aspect, the invention includes a system for column-based separations, comprising: a) a fluid passageway, the fluid passageway comprising a column chamber and a flow path in fluid communication with the column chamber, the flow path being obstructed by a retaining material permeable to a carrier fluid and impermeable to a column matrix material suspended in the carrier fluid, the flow path extending through the column chamber and through the retaining material, the flow path being configured to form a packed column within the column chamber when a suspension of the fluid and the column matrix material is flowed along the flow path; and b) the fluid passageway extending through a valve intermediate the column chamber and the retaining material.

  10. Method and apparatus for automated processing and aliquoting of whole blood samples for analysis in a centrifugal fast analyzer

    DOE Patents [OSTI]

    Burtis, C.A.; Johnson, W.F.; Walker, W.A.

    1985-08-05

    A rotor and disc assembly for use in a centrifugal fast analyzer. The assembly is designed to process multiple samples of whole blood followed by aliquoting of the resultant serum into precisely measured samples for subsequent chemical analysis. The assembly requires minimal operator involvement with no mechanical pipetting. The system comprises: (1) a whole blood sample disc; (2) a serum sample disc; (3) a sample preparation rotor; and (4) an analytical rotor. The blood sample disc and serum sample disc are designed with a plurality of precision bore capillary tubes arranged in a spoked array. Samples of blood are loaded into the blood sample disc by capillary action and centrifugally discharged into cavities of the sample preparation rotor where separation of serum and solids is accomplished. The serum is loaded into the capillaries of the serum sample disc by capillary action and subsequently centrifugally expelled into cuvettes of the analyticaly rotor for conventional methods. 5 figs.

  11. Method and apparatus for automated processing and aliquoting of whole blood samples for analysis in a centrifugal fast analyzer

    DOE Patents [OSTI]

    Burtis, Carl A.; Johnson, Wayne F.; Walker, William A.

    1988-01-01

    A rotor and disc assembly for use in a centrifugal fast analyzer. The assembly is designed to process multiple samples of whole blood followed by aliquoting of the resultant serum into precisely measured samples for subsequent chemical analysis. The assembly requires minimal operator involvement with no mechanical pipetting. The system comprises (1) a whole blood sample disc, (2) a serum sample disc, (3) a sample preparation rotor, and (4) an analytical rotor. The blood sample disc and serum sample disc are designed with a plurality of precision bore capillary tubes arranged in a spoked array. Samples of blood are loaded into the blood sample disc in capillary tubes filled by capillary action and centrifugally discharged into cavities of the sample preparation rotor where separation of serum and solids is accomplished. The serum is loaded into the capillaries of the serum sample disc by capillary action and subsequently centrifugally expelled into cuvettes of the analytical rotor for analysis by conventional methods.

  12. Method and apparatus for maintaining multi-component sample gas constituents in vapor phase during sample extraction and cooling

    DOE Patents [OSTI]

    Farthing, William Earl [Pinson, AL; Felix, Larry Gordon [Pelham, AL; Snyder, Todd Robert [Birmingham, AL

    2008-02-12

    An apparatus and method for diluting and cooling that is extracted from high temperature and/or high pressure industrial processes. Through a feedback process, a specialized, CFD-modeled dilution cooler is employed along with real-time estimations of the point at which condensation will occur within the dilution cooler to define a level of dilution and diluted gas temperature that results in a gas that can be conveyed to standard gas analyzers that contains no condensed hydrocarbon compounds or condensed moisture.

  13. Method and apparatus maintaining multi-component sample gas constituents in vapor phase during sample extraction and cooling

    DOE Patents [OSTI]

    Farthing, William Earl; Felix, Larry Gordon; Snyder, Todd Robert

    2009-12-15

    An apparatus and method for diluting and cooling that is extracted from high temperature and/or high pressure industrial processes. Through a feedback process, a specialized, CFD-modeled dilution cooler is employed along with real-time estimations of the point at which condensation will occur within the dilution cooler to define a level of dilution and diluted gas temperature that results in a gas that can be conveyed to standard gas analyzers that contains no condensed hydrocarbon compounds or condensed moisture.

  14. Photothermal method for in situ microanalysis of the chemical composition of coal samples

    DOE Patents [OSTI]

    Amer, Nabil M.

    1986-01-01

    Successive minute regions (13) along a scan path on a coal sample (11) are individually analyzed, at a series of different depths if desired, to determine chemical composition including the locations, sizes and distributions of different maceral inclusions (12). A sequence of infrared light pulses (17) of progressively changing wavelengths is directed into each minute region (13) and a probe light beam (22) is directed along the sample surface (21) adjacent the region (13). Infrared wavelengths at which strong absorption occurs in the region (13) are identified by detecting the resulting deflections (.phi.) of the probe beam (22) caused by thermally induced index of refraction changes in the air or other medium (19) adjacent the region (13). The detected peak absorption wavelengths are correlated with known characteristic peak absorption wavelengths of specific coal constituents to identify the composition of each such minute region (13) of the sample (11). The method enables rapid, convenient and non-destructive analyses of coal specimens to facilitate mining, processing and utilization of coals.

  15. Method Evaluation And Field Sample Measurements For The Rate Of Movement Of The Oxidation Front In Saltstone

    SciTech Connect (OSTI)

    Almond, P. M.; Kaplan, D. I.; Langton, C. A.; Stefanko, D. B.; Spencer, W. A.; Hatfield, A.; Arai, Y.

    2012-08-23

    The objective of this work was to develop and evaluate a series of methods and validate their capability to measure differences in oxidized versus reduced saltstone. Validated methods were then applied to samples cured under field conditions to simulate Performance Assessment (PA) needs for the Saltstone Disposal Facility (SDF). Four analytical approaches were evaluated using laboratory-cured saltstone samples. These methods were X-ray absorption spectroscopy (XAS), diffuse reflectance spectroscopy (DRS), chemical redox indicators, and thin-section leaching methods. XAS and thin-section leaching methods were validated as viable methods for studying oxidation movement in saltstone. Each method used samples that were spiked with chromium (Cr) as a tracer for oxidation of the saltstone. The two methods were subsequently applied to field-cured samples containing chromium to characterize the oxidation state of chromium as a function of distance from the exposed air/cementitious material surface.

  16. Markov Chain Monte Carlo Sampling Methods for 1D Seismic and EM Data Inversion

    Energy Science and Technology Software Center (OSTI)

    2008-09-22

    This software provides several Markov chain Monte Carlo sampling methods for the Bayesian model developed for inverting 1D marine seismic and controlled source electromagnetic (CSEM) data. The current software can be used for individual inversion of seismic AVO and CSEM data and for joint inversion of both seismic and EM data sets. The structure of the software is very general and flexible, and it allows users to incorporate their own forward simulation codes and rockmore » physics model codes easily into this software. Although the softwae was developed using C and C++ computer languages, the user-supplied codes can be written in C, C++, or various versions of Fortran languages. The software provides clear interfaces for users to plug in their own codes. The output of this software is in the format that the R free software CODA can directly read to build MCMC objects.« less

  17. Sampling and analytical methods development at the HGP-a generator facility

    SciTech Connect (OSTI)

    Thomas, D.M.

    1982-10-01

    During shakedown operations for the HGP-A generator plant sampling and analytical problems were encountered during the process chemistry monitoring effort. Acid-preservation of brine for cation analysis required the use of nitrous oxideacetylene flame for accurate A-A analysis of calcium. Analysis of gases for carbonate and sulfide was by specific ion electrode and alkalinity titration, respectively. Sulfide caused substantial interferences with the alkalinity method and corrections for sulfide were required. Sulfide also interfered with chloride analyses in the steam phase requiring removal of the sulfide by boiling. Analysis of dissolved silica in the brine was complicated by the presence of colloidal silica which produced erratic analytical results. An accurate evaluation of the hydrogen sulfide abatement system was possible only when the hydrogen sulfide concentrations in the treated and untreated steam were compared with a second component in the steam phase that was unaffected by caustic injection.

  18. Flow through in situ reactors with suction lysimeter sampling capability and methods of using

    DOE Patents [OSTI]

    Radtke, Corey W. (Idaho Falls, ID) [Idaho Falls, ID; Blackwelder, D. Brad (Blackfoot, ID) [Blackfoot, ID; Hubbell, Joel M. (Idaho Falls, ID) [Idaho Falls, ID

    2009-11-17

    An in situ reactor for use in a geological strata includes a liner defining a centrally disposed passageway and a sampling conduit received within the passageway. The sampling conduit may be used to receive a geological speciment derived from geological strata therein and a lysimeter is disposed within the sampling conduit in communication with the geological specimen. Fluid may be added to the geological specimen through the passageway defined by the liner, between an inside surface of the liner and an outside surface of the sampling conduit. A distal portion of the sampling conduit may be in fluid communication with the passageway.

  19. Method for detection of long-lived radioisotopes in small biochemical samples

    DOE Patents [OSTI]

    Turteltaub, K.W.; Vogel, J.S.; Felton, J.S.; Gledhill, B.L.; Davis, J.C.

    1994-11-22

    Disclosed is a method for detection of long-lived radioisotopes in small biochemical samples, comprising: a. selecting a biological host in which radioisotopes are present in concentrations equal to or less than those in the ambient biosphere, b. preparing a long-lived radioisotope labeled reactive chemical specie, c. administering the chemical specie to the biologist host in doses sufficiently low to avoid significant overt damage to the biological system, d. allowing a period of time to elapse sufficient for dissemination and interaction of the chemical specie with the host throughout the biological system of the host, e. isolating a reacted fraction of the biological substance from the host in a manner sufficient to avoid contamination of the substance from extraneous sources, f. converting the fraction of biological substance by suitable means to a material which efficiently produces charged ions in at least one of several possible ion sources without introduction of significant isotopic fractionation, and, g. measuring the radioisotope concentration in the material by means of direct isotopic counting. 5 figs.

  20. Method for detection of long-lived radioisotopes in small biochemical samples

    DOE Patents [OSTI]

    Turteltaub, Kenneth W.; Vogel, John S.; Felton, James S.; Gledhill, Barton L.; Davis, Jay C.

    1994-01-01

    Disclosed is a method for detection of long-lived radioisotopes in small bio-chemical samples, comprising: a. selecting a biological host in which radioisotopes are present in concentrations equal to or less than those in the ambient biosphere, b. preparing a long-lived radioisotope labeled reactive chemical specie, c. administering said chemical specie to said biologist host in doses sufficiently low to avoid significant overt damage to the biological system thereof, d. allowing a period of time to elapse sufficient for dissemination and interaction of said chemical specie with said host throughout said biological system of said host, e. isolating a reacted fraction of the biological substance from said host in a manner sufficient to avoid contamination of said substance from extraneous sources, f. converting said fraction of biological substance by suitable means to a material which efficiently produces charged ions in at least one of several possible ion sources without introduction of significant isotopic fractionation, and, g. measuring the radioisotope concentration in said material by means of direct isotopic counting.

  1. The SAGES Legacy Unifying Globulars and Galaxies survey (SLUGGS): sample definition, methods, and initial results

    SciTech Connect (OSTI)

    Brodie, Jean P.; Romanowsky, Aaron J.; Jennings, Zachary G.; Pota, Vincenzo; Kader, Justin; Roediger, Joel C.; Villaume, Alexa; Arnold, Jacob A.; Woodley, Kristin A.; Strader, Jay; Forbes, Duncan A.; Pastorello, Nicola; Usher, Christopher; Blom, Christina; Kartha, Sreeja S.; Foster, Caroline; Spitler, Lee R.

    2014-11-20

    We introduce and provide the scientific motivation for a wide-field photometric and spectroscopic chemodynamical survey of nearby early-type galaxies (ETGs) and their globular cluster (GC) systems. The SAGES Legacy Unifying Globulars and GalaxieS (SLUGGS) survey is being carried out primarily with Subaru/Suprime-Cam and Keck/DEIMOS. The former provides deep gri imaging over a 900 arcmin{sup 2} field-of-view to characterize GC and host galaxy colors and spatial distributions, and to identify spectroscopic targets. The NIR Ca II triplet provides GC line-of-sight velocities and metallicities out to typically ?8 R {sub e}, and to ?15 R {sub e} in some cases. New techniques to extract integrated stellar kinematics and metallicities to large radii (?2-3 R {sub e}) are used in concert with GC data to create two-dimensional (2D) velocity and metallicity maps for comparison with simulations of galaxy formation. The advantages of SLUGGS compared with other, complementary, 2D-chemodynamical surveys are its superior velocity resolution, radial extent, and multiple halo tracers. We describe the sample of 25 nearby ETGs, the selection criteria for galaxies and GCs, the observing strategies, the data reduction techniques, and modeling methods. The survey observations are nearly complete and more than 30 papers have so far been published using SLUGGS data. Here we summarize some initial results, including signatures of two-phase galaxy assembly, evidence for GC metallicity bimodality, and a novel framework for the formation of extended star clusters and ultracompact dwarfs. An integrated overview of current chemodynamical constraints on GC systems points to separate, in situ formation modes at high redshifts for metal-poor and metal-rich GCs.

  2. Device for high spatial resolution chemical analysis of a sample and method of high spatial resolution chemical analysis

    SciTech Connect (OSTI)

    Van Berkel, Gary J.

    2015-10-06

    A system and method for analyzing a chemical composition of a specimen are described. The system can include at least one pin; a sampling device configured to contact a liquid with a specimen on the at least one pin to form a testing solution; and a stepper mechanism configured to move the at least one pin and the sampling device relative to one another. The system can also include an analytical instrument for determining a chemical composition of the specimen from the testing solution. In particular, the systems and methods described herein enable chemical analysis of specimens, such as tissue, to be evaluated in a manner that the spatial-resolution is limited by the size of the pins used to obtain tissue samples, not the size of the sampling device used to solubilize the samples coupled to the pins.

  3. Method and system having ultrasonic sensor movable by translation device for ultrasonic profiling of weld samples

    DOE Patents [OSTI]

    Panyard, James; Potter, Timothy; Charron, William; Hopkins, Deborah; Reverdy, Frederic

    2010-04-06

    A system for ultrasonic profiling of a weld sample includes a carriage movable in opposite first and second directions. An ultrasonic sensor is coupled to the carriage to move over the sample as the carriage moves. An encoder determines the position of the carriage to determine the position of the sensor. A spring is connected at one end of the carriage. Upon the carriage being moved in the first direction toward the spring such that the carriage and the sensor are at a beginning position and the spring is compressed the spring decompresses to push the carriage back along the second direction to move the carriage and the sensor from the beginning position to an ending position. The encoder triggers the sensor to take the ultrasonic measurements of the sample when the sensor is at predetermined positions while the sensor moves over the sample between the beginning and positions.

  4. Chapter 11, Sample Design Cross-Cutting Protocols: The Uniform Methods Project: Methods for Determining Energy Efficiency Savings for Specific Measures

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    1: Sample Design Cross-Cutting Protocols M. Sami Khawaja, Josh Rushton, and Josh Keeling, The Cadmus Group, Inc. Subcontract Report NREL/SR-7A30-53827 April 2013 The Uniform Methods Project: Methods for Determining Energy Efficiency Savings for Specific Measures 11 - 1 Chapter 11 - Table of Contents 1 Introduction ............................................................................................................................ 3 1.1 Chapter Organization

  5. Method for detection of Stachybotrys chartarum in pure culture and field samples using quantitative polymerase chain reaction

    DOE Patents [OSTI]

    Cruz-Perez, Patricia; Buttner, Mark P.

    2004-05-11

    A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.

  6. Method and apparatus for reducing sample dispersion in turns and junctions of microchannel systems

    DOE Patents [OSTI]

    Griffiths, Stewart K.; Nilson, Robert H.

    2001-01-01

    The performance of microchannel devices is improved by providing turns, wyes, tees, and other junctions that produce little dispersions of a sample as it traverses the turn or junction. The reduced dispersion results from contraction and expansion regions that reduce the cross-sectional area over some portion of the turn or junction. By carefully designing the geometries of these regions, sample dispersion in turns and junctions is reduced to levels comparable to the effects of ordinary diffusion. A numerical algorithm was employed to evolve low-dispersion geometries by computing the electric or pressure field within candidate configurations, sample transport through the turn or junction, and the overall effective dispersion. These devices should greatly increase flexibility in the design of microchannel devices by permitting the use of turns and junctions that do not induce large sample dispersion. In particular, the ability to fold electrophoretic and electrochrornatographic separation columns will allow dramatic improvements in the miniaturization of these devices. The low-lispersion devices are particularly suited to electrochromatographic and electrophoretic separations, as well as pressure-driven chromatographic separation. They are further applicable to microfluidic systems employing either electroosrnotic or pressure-driven flows for sample transport, reaction, mixing, dilution or synthesis.

  7. Method And Apparatus For Reducing Sample Dispersion In Turns And Junctions Of Micro-Channel Systems

    DOE Patents [OSTI]

    Griffiths, Stewart K. , Nilson, Robert H.

    2004-05-11

    What is disclosed pertains to improvement in the performance of microchannel devices by providing turns, wyes, tees, and other junctions that produce little dispersion of a sample as it traverses the turn or junction. The reduced dispersion results from contraction and expansion regions that reduce the cross-sectional area over some portion of the turn or junction. By carefully designing the geometries of these regions, sample dispersion in turns and junctions is reduced to levels comparable to the effects of ordinary diffusion. The low dispersion features are particularly suited for microfluidic devices and systems using either electromotive force, pressure, or combinations thereof as the principle of fluid transport. Such microfluidic devices and systems are useful for separation of components, sample transport, reaction, mixing, dilution or synthesis, or combinations thereof.

  8. Tensiometer, drive probe for use with environmental testing equipment, and methods of inserting environmental testing equipment into a sample

    DOE Patents [OSTI]

    Hubbell, Joel M.; Sisson, James B.

    2005-07-26

    A method of inserting a tensiometer into a sample, comprises providing a drive probe configured to be engaged by direct push equipment; supporting a porous member from the drive probe; and driving the drive probe into the sample using a cone penetrometer. A tensiometer comprises a drive probe configured to be engaged by direct push equipment or a cone penetrometer; a porous member supported by the drive probe; and a pressure sensor in pressure sensing relation to the porous member.

  9. Method of retrieving a liquid sample, a suction lysimeter, a portable suction lysimeter, a lysimeter system, and a deep lysimeter

    DOE Patents [OSTI]

    Hubbell, Joel M.; Sisson, James B.

    2003-08-26

    A method of retrieving a liquid sample comprises providing a portable lysimeter including a semi-permeable membrane and a chamber in fluid communication with the semi-permeable membrane; making a hole at a site from which a liquid sample is desired; evacuating the chamber by applying a vacuum to the chamber; lowering the portable lysimeter into the hole; obtaining a sample in the chamber; and retrieving the lysimeter from the bore; wherein it is not necessary to backfill the bore. A portable lysimeter includes a semi-permeable member and a chamber in fluid communication with the semi-permeable membrane.

  10. Method of characterizing void volume headspace in vented transuranic waste sludge drums using limited sampling data

    SciTech Connect (OSTI)

    Liekhus, K.J.; Connolly, M.J.; Arnold, P.M.; O`Leary, G.A.

    1995-01-01

    The Department of Energy must demonstrate to the Environmental Protection Agency that a drum headspace sample is representative of the volatile organic compounds (VOCs) within the entire void space of the waste container in order to demonstrate compliance in the future when drums could be directly emplaced in the Waste Isolation Pilot Plant in New Mexico. A test program is underway at the Idaho National Engineering Laboratory to determine if the drum headspace VOC concentration is representative of the concentration in the entire drum void space and demonstrate that the VOC concentration in the void space of each layer of confinement can be estimated using a model incorporating diffusive and permeative transport principles and limited waste drum sampling data. A comparison of model predictions of VOC concentration in the innermost layer of confinement with actual measurement from transuranic waste sludge drums demonstrate that the model may be useful in characterizing VOC concentration throughout entire drum void volume.

  11. VERIFICATION OF THE DEFENSE WASTE PROCESSING FACILITY'S (DWPF) PROCESS DIGESTION METHOD FOR THE SLUDGE BATCH 7A QUALIFICATION SAMPLE

    SciTech Connect (OSTI)

    Click, D.; Edwards, T.; Jones, M.; Wiedenman, B.

    2011-03-14

    For each sludge batch that is processed in the Defense Waste Processing Facility (DWPF), the Savannah River National Laboratory (SRNL) performs confirmation of the applicability of the digestion method to be used by the DWPF lab for elemental analysis of Sludge Receipt and Adjustment Tank (SRAT) receipt samples and SRAT product process control samples. DWPF SRAT samples are typically dissolved using a room temperature HF-HNO{sub 3} acid dissolution (i.e., DWPF Cold Chem Method, see DWPF Procedure SW4-15.201) and then analyzed by inductively coupled plasma - atomic emission spectroscopy (ICP-AES). This report contains the results and comparison of data generated from performing the Aqua Regia (AR), Sodium peroxide/Hydroxide Fusion (PF) and DWPF Cold Chem (CC) method digestions of Sludge Batch 7a (SB7a) SRAT Receipt and SB7a SRAT Product samples. The SB7a SRAT Receipt and SB7a SRAT Product samples were prepared in the SRNL Shielded Cells, and the SRAT Receipt material is representative of the sludge that constituates the SB7a Batch or qualification composition. This is the sludge in Tank 51 that is to be transferred into Tank 40, which will contain the heel of Sludge Batch 6 (SB6), to form the Sb7a Blend composition.

  12. METHODS FOR DETERMINING AGITATOR MIXING REQUIREMENTS FOR A MIXING & SAMPLING FACILITY TO FEED WTP (WASTE TREATMENT PLANT)

    SciTech Connect (OSTI)

    GRIFFIN PW

    2009-08-27

    The following report is a summary of work conducted to evaluate the ability of existing correlative techniques and alternative methods to accurately estimate impeller speed and power requirements for mechanical mixers proposed for use in a mixing and sampling facility (MSF). The proposed facility would accept high level waste sludges from Hanford double-shell tanks and feed uniformly mixed high level waste to the Waste Treatment Plant. Numerous methods are evaluated and discussed, and resulting recommendations provided.

  13. Apparatus and method for quantitatively evaluating total fissile and total fertile nuclide content in samples

    DOE Patents [OSTI]

    Caldwell, John T.; Kunz, Walter E.; Cates, Michael R.; Franks, Larry A.

    1985-01-01

    Simultaneous photon and neutron interrogation of samples for the quantitative determination of total fissile nuclide and total fertile nuclide material present is made possible by the use of an electron accelerator. Prompt and delayed neutrons produced from resulting induced fissions are counted using a single detection system and allow the resolution of the contributions from each interrogating flux leading in turn to the quantitative determination sought. Detection limits for .sup.239 Pu are estimated to be about 3 mg using prompt fission neutrons and about 6 mg using delayed neutrons.

  14. Laminated metal composite formed from low flow stress layers and high flow stress layers using flow constraining elements and making same

    DOE Patents [OSTI]

    Syn, C.K.; Lesuer, D.R.

    1995-07-04

    A laminated metal composite of low flow stress layers and high flow stress layers is described which is formed using flow constraining elements, preferably in the shape of rings, individually placed around each of the low flow stress layers while pressure is applied to the stack to bond the layers of the composite together, to thereby restrain the flow of the low flow stress layers from the stack during the bonding. The laminated metal composite of the invention is made by the steps of forming a stack of alternate layers of low flow stress layers and high flow stress layers with each layer of low flow stress material surrounded by an individual flow constraining element, such as a ring, and then applying pressure to the top and bottom surfaces of the resulting stack to bond the dissimilar layers together, for example, by compression rolling the stack. In a preferred embodiment, the individual flow constraining elements surrounding the layers of low flow stress material are formed of a material which may either be the same material as the material comprising the high flow stress layers, or have similar flow stress characteristics to the material comprising the high flow stress layers. Additional sacrificial layers may be added to the top and bottom of the stack to avoid damage to the stack during the bonding step; and these additional layers may then be removed after the bonding step. 5 figs.

  15. Laminated metal composite formed from low flow stress layers and high flow stress layers using flow constraining elements and making same

    DOE Patents [OSTI]

    Syn, Chol K.; Lesuer, Donald R.

    1995-01-01

    A laminated metal composite of low flow stress layers and high flow stress layers is described which is formed using flow constraining elements, preferably in the shape of rings, individually placed around each of the low flow stress layers while pressure is applied to the stack to bond the layers of the composite together, to thereby restrain the flow of the low flow stress layers from the stack during the bonding. The laminated metal composite of the invention is made by the steps of forming a stack of alternate layers of low flow stress layers and high flow stress layers with each layer of low flow stress material surrounded by an individual flow constraining element, such as a ring, and then applying pressure to the top and bottom surfaces of the resulting stack to bond the dissimilar layers together, for example, by compression rolling the stack. In a preferred embodiment, the individual flow constraining elements surrounding the layers of low flow stress material are formed of a material which may either be the same material as the material comprising the high flow stress layers, or have similar flow stress characteristics to the material comprising the high flow stress layers. Additional sacrificial layers may be added to the top and bottom of the stack to avoid damage to the stack during the bonding step; and these additional layers may then be removed after the bonding step.

  16. Method for ultra-trace cesium isotope ratio measurements from environmental samples using thermal ionization mass spectrometry

    SciTech Connect (OSTI)

    Snow, Mathew S.; Snyder, Darin C.; Mann, Nick R.; White, Byron M.

    2015-05-01

    135Cs/137Cs isotope ratios can provide the age, origin and history of environmental Cs contamination. Relatively high precision 135Cs/137Cs isotope ratio measurements from samples containing femtogram quantities of 137Cs are needed to accurately track contamination resuspension and redistribution following environmental 137Cs releases; however, mass spectrometric analyses of environmental samples are limited by the large quantities of ionization inhibitors and isobaric interferences which are present at relatively high concentrations in the environment. We report a new approach for Cs purification from environmental samples. An initial ammonium molybdophosphate-polyacrylonitrile (AMP-PAN) column provides a robust method for extracting Cs under a wide variety of sample matrices and mass loads. Cation exchange separations using a second AMP-PAN column result in more than two orders of magnitude greater Cs/Rb separation factors than commercially available strong cation exchangers. Coupling an AMP-PAN cation exchanging step to a microcation column (AG50W resin) enables consistent 2-4% (2?) measurement errors for samples containing 3-6,000 fg 137Cs, representing the highest precision 135Cs/137Cs ratio measurements currently reported for soil samples at the femtogram level.

  17. Method for measuring the rate of cell reproduction by analysis of nanoliter cell samples

    DOE Patents [OSTI]

    Gourley, Paul L.

    2005-04-26

    A method of detecting cancer using a laser biocavity having a semiconductor laser including a microchannel through which cells in fluid traverse, comprising determining the laser wavelength of the laser biocavity with only fluid in the microchannel; determining the wavelength shift of the biocavity when each cell passes through the microchannel; and determining the percentage of cells in G2 phase from the wavelength shift of the cells; wherein an increased percentage of G2 phase cells is an indication of cancer.

  18. High-throughput liquid-absorption air-sampling apparatus and methods

    DOE Patents [OSTI]

    Zaromb, Solomon

    2000-01-01

    A portable high-throughput liquid-absorption air sampler [PHTLAAS] has an asymmetric air inlet through which air is drawn upward by a small and light-weight centrifugal fan driven by a direct current motor that can be powered by a battery. The air inlet is so configured as to impart both rotational and downward components of motion to the sampled air near said inlet. The PHTLAAS comprises a glass tube of relatively small size through which air passes at a high rate in a swirling, highly turbulent motion, which facilitates rapid transfer of vapors and particulates to a liquid film covering the inner walls of the tube. The pressure drop through the glass tube is <10 cm of water, usually <5 cm of water. The sampler's collection efficiency is usually >20% for vapors or airborne particulates in the 2-3.mu. range and >50% for particles larger than 4.mu.. In conjunction with various analyzers, the PHTLAAS can serve to monitor a variety of hazardous or illicit airborne substances, such as lead-containing particulates, tritiated water vapor, biological aerosols, or traces of concealed drugs or explosives.

  19. A New On-the-Fly Sampling Method for Incoherent Inelastic Thermal Neutron Scattering Data in MCNP6

    SciTech Connect (OSTI)

    Pavlou, Andrew Theodore; Brown, Forrest B.; Ji, Wei

    2014-09-02

    At thermal energies, the scattering of neutrons in a system is complicated by the comparable velocities of the neutron and target, resulting in competing upscattering and downscattering events. The neutron wavelength is also similar in size to the target's interatomic spacing making the scattering process a quantum mechanical problem. Because of the complicated nature of scattering at low energies, the thermal data files in ACE format used in continuous-energy Monte Carlo codes are quite large { on the order of megabytes for a single temperature and material. In this paper, a new storage and sampling method is introduced that is orders of magnitude less in size and is used to sample scattering parameters at any temperature on-the-fly. In addition to the reduction in storage, the need to pre-generate thermal scattering data tables at fine temperatures has been eliminated. This is advantageous for multiphysics simulations which may involve temperatures not known in advance. A new module was written for MCNP6 that bypasses the current S(?,?) table lookup in favor of the new format. The new on-the-fly sampling method was tested for graphite for two benchmark problems at ten temperatures: 1) an eigenvalue test with a fuel compact of uranium oxycarbide fuel homogenized into a graphite matrix, 2) a surface current test with a \\broomstick" problem with a monoenergetic point source. The largest eigenvalue difference was 152pcm for T= 1200K. For the temperatures and incident energies chosen for the broomstick problem, the secondary neutron spectrum showed good agreement with the traditional S(?,?) sampling method. These preliminary results show that sampling thermal scattering data on-the-fly is a viable option to eliminate both the storage burden of keeping thermal data at discrete temperatures and the need to know temperatures before simulation runtime.

  20. Method and system for selecting data sampling phase for self timed interface logic

    DOE Patents [OSTI]

    Hoke, Joseph Michael; Ferraiolo, Frank D.; Lo, Tin-Chee; Yarolin, John Michael

    2005-01-04

    An exemplary embodiment of the present invention is a method for transmitting data among processors over a plurality of parallel data lines and a clock signal line. A receiver processor receives both data and a clock signal from a sender processor. At the receiver processor a bit of the data is phased aligned with the transmitted clock signal. The phase aligning includes selecting a data phase from a plurality of data phases in a delay chain and then adjusting the selected data phase to compensate for a round-off error. Additional embodiments include a system and storage medium for transmitting data among processors over a plurality of parallel data lines and a clock signal line.

  1. Verification Of The Defense Waste Processing Facility's (DWPF) Process Digestion Methods For The Sludge Batch 8 Qualification Sample

    SciTech Connect (OSTI)

    Click, D. R.; Edwards, T. B.; Wiedenman, B. J.; Brown, L. W.

    2013-03-18

    This report contains the results and comparison of data generated from inductively coupled plasma – atomic emission spectroscopy (ICP-AES) analysis of Aqua Regia (AR), Sodium Peroxide/Sodium Hydroxide Fusion Dissolution (PF) and Cold Chem (CC) method digestions and Cold Vapor Atomic Absorption analysis of Hg digestions from the DWPF Hg digestion method of Sludge Batch 8 (SB8) Sludge Receipt and Adjustment Tank (SRAT) Receipt and SB8 SRAT Product samples. The SB8 SRAT Receipt and SB8 SRAT Product samples were prepared in the SRNL Shielded Cells, and the SRAT Receipt material is representative of the sludge that constitutes the SB8 Batch or qualification composition. This is the sludge in Tank 51 that is to be transferred into Tank 40, which will contain the heel of Sludge Batch 7b (SB7b), to form the SB8 Blend composition.

  2. Reexamination of Basal Plane Thermal Conductivity of Suspended Graphene Samples Measured by Electro-Thermal Micro-Bridge Methods

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Jo, Insun; Pettes, Michael; Lindsay, Lucas R.; Ou, Eric; Weathers, Annie; Moore, Arden; Yao, Zhen; Shi, Li

    2015-05-18

    Thermal transport in suspended graphene samples has been measured in prior works and this work with the use of a suspended electro-thermal micro-bridge method. These measurement results are analyzed here to evaluate and eliminate the errors caused by the extrinsic thermal contact resistance. It is noted that the thermal resistance measured in a recent work increases linearly with the suspended length of the single-layer graphene samples synthesized by chemical vapor deposition (CVD), and that such a feature does not reveal the failure of Fourier s law despite the increase in the apparent thermal conductivity with length. The re-analyzed thermal conductivitymore » of a single-layer CVD graphene sample reaches about ( 1680 180 )Wm-1K-1 at room temperature, which is close to the highest value reported for highly oriented pyrolytic graphite. In comparison, the thermal conductivity values measured for two suspended exfoliated bi-layer graphene samples are about ( 880 60 ) and ( 730 60 ) Wm-1K-1 at room temperature, and approach that of the natural graphite source above room temperature. However, the low-temperature thermal conductivities of these suspended graphene samples are still considerably lower than the graphite values, with the peak thermal conductivities shifted to much higher temperatures. Analysis of the thermal conductivity data reveals that the low temperature behavior is dominated by phonon scattering by polymer residue instead of by the lateral boundary.« less

  3. Reexamination of Basal Plane Thermal Conductivity of Suspended Graphene Samples Measured by Electro-Thermal Micro-Bridge Methods

    SciTech Connect (OSTI)

    Jo, Insun; Pettes, Michael; Lindsay, Lucas R; Ou, Eric; Weathers, Annie; Moore, Arden; Yao, Zhen; Shi, Li

    2015-01-01

    Thermal transport in suspended graphene samples has been measured in prior works and this work with the use of a suspended electro-thermal micro-bridge method. These measurement results are analyzed here to evaluate and eliminate the errors caused by the extrinsic thermal contact resistance. It is noted that the thermal resistance measured in a recent work increases linearly with the suspended length of the single-layer graphene samples synthesized by chemical vapor deposition (CVD), and that such a feature does not reveal the failure of Fourier s law despite the increase in the apparent thermal conductivity with length. The re-analyzed thermal conductivity of a single-layer CVD graphene sample reaches about ( 1680 180 )Wm-1K-1 at room temperature, which is close to the highest value reported for highly oriented pyrolytic graphite. In comparison, the thermal conductivity values measured for two suspended exfoliated bi-layer graphene samples are about ( 880 60 ) and ( 730 60 ) Wm-1K-1 at room temperature, and approach that of the natural graphite source above room temperature. However, the low-temperature thermal conductivities of these suspended graphene samples are still considerably lower than the graphite values, with the peak thermal conductivities shifted to much higher temperatures. Analysis of the thermal conductivity data reveals that the low temperature behavior is dominated by phonon scattering by polymer residue instead of by the lateral boundary.

  4. False negative rate and other performance measures of a sponge-wipe surface sampling method for low contaminant concentrations.

    SciTech Connect (OSTI)

    Einfeld, Wayne; Krauter, Paula A.; Boucher, Raymond M.; Tezak, Mathew; Amidan, Brett G.; Piepel, Greg F.

    2011-05-01

    Recovery of spores from environmental surfaces is known to vary due to sampling methodology, techniques, spore size and characteristics, surface materials, and environmental conditions. A series of tests were performed to evaluate a new, validated sponge-wipe method. Specific factors evaluated were the effects of contaminant concentrations and surface materials on recovery efficiency (RE), false negative rate (FNR), limit of detection (LOD) - and the uncertainties of these quantities. Ceramic tile and stainless steel had the highest mean RE values (48.9 and 48.1%, respectively). Faux leather, vinyl tile, and painted wood had mean RE values of 30.3, 25.6, and 25.5, respectively, while plastic had the lowest mean RE (9.8%). Results show a roughly linear dependence of surface roughness on RE, where the smoothest surfaces have the highest mean RE values. REs were not influenced by the low spore concentrations tested (3 x 10{sup -3} to 1.86 CFU/cm{sup 2}). The FNR data were consistent with RE data, showing a trend of smoother surfaces resulting in higher REs and lower FNRs. Stainless steel generally had the lowest mean FNR (0.123) and plastic had the highest mean FNR (0.479). The LOD{sub 90} varied with surface material, from 0.015 CFU/cm{sup 2} on stainless steel up to 0.039 on plastic. Selecting sampling locations on the basis of surface roughness and using roughness to interpret spore recovery data can improve sampling. Further, FNR values, calculated as a function of concentration and surface material, can be used pre-sampling to calculate the numbers of samples for statistical sampling plans with desired performance, and post-sampling to calculate the confidence in characterization and clearance decisions.

  5. VERIFICATION OF THE DEFENSE WASTE PROCESSING FACILITY PROCESS DIGESTION METHOD FOR THE SLUDGE BATCH 6 QUALIFICATION SAMPLE

    SciTech Connect (OSTI)

    Click, D.; Jones, M.; Edwards, T.

    2010-06-09

    For each sludge batch that is processed in the Defense Waste Processing Facility (DWPF), the Savannah River National Laboratory (SRNL) confirms applicability of the digestion method to be used by the DWPF lab for elemental analysis of Sludge Receipt and Adjustment Tank (SRAT) receipt samples and SRAT product process control samples.1 DWPF SRAT samples are typically dissolved using a room temperature HF-HNO3 acid dissolution (i.e., DWPF Cold Chem (CC) Method, see DWPF Procedure SW4-15.201) and then analyzed by inductively coupled plasma - atomic emission spectroscopy (ICPAES). In addition to the CC method confirmation, the DWPF lab's mercury (Hg) digestion method was also evaluated for applicability to SB6 (see DWPF procedure 'Mercury System Operating Manual', Manual: SW4-15.204. Section 6.1, Revision 5, Effective date: 12-04-03). This report contains the results and comparison of data generated from performing the Aqua Regia (AR), Sodium Peroxide/Hydroxide Fusion (PF) and DWPF Cold Chem (CC) method digestion of Sludge Batch 6 (SB6) SRAT Receipt and SB6 SRAT Product samples. For validation of the DWPF lab's Hg method, only SRAT receipt material was used and compared to AR digestion results. The SB6 SRAT Receipt and SB6 SRAT Product samples were prepared in the SRNL Shielded Cells, and the SRAT Receipt material is representative of the sludge that constitutes the SB6 Batch or qualification composition. This is the sludge in Tank 51 that is to be transferred into Tank 40, which will contain the heel of Sludge Batch 5 (SB5), to form the SB6 Blend composition. In addition to the 16 elements currently measured by the DWPF, this report includes Hg and thorium (Th) data (Th comprising {approx}2.5 - 3 Wt% of the total solids in SRAT Receipt and SRAT Product, respectively) and provides specific details of ICP-AES analysis of Th. Thorium was found to interfere with the U 367.007 nm emission line, and an inter-element correction (IEC) had to be applied to U data, which is also

  6. Sub-micron particle sampler apparatus and method for sampling sub-micron particles

    DOE Patents [OSTI]

    Gay, D.D.; McMillan, W.G.

    1984-04-12

    Apparatus and method steps for collecting sub-micron sized particles include a collection chamber and cryogenic cooling. The cooling is accomplished by coil tubing carrying nitrogen in liquid form, with the liquid nitrogen changing to the gas phase before exiting from the collection chamber in the tubing. Standard filters are used to filter out particles of diameter greater than or equal to 0.3 microns; however, the present invention is used to trap particles of less than 0.3 micron in diameter. A blower draws air to said collection chamber through a filter which filters particles with diameters greater than or equal to 0.3 micron. The air is then cryogenically cooled so that moisture and sub-micron sized particles in the air condense into ice on the coil. The coil is then heated so that the ice melts, and the liquid is then drawn off and passed through a Buchner funnel where the liquid is passed through a Nuclepore membrane. A vacuum draws the liquid through the Nuclepore membrane, with the Nuclepore membrane trapping sub-micron sized particles therein. The Nuclepore membrane is then covered on its top and bottom surfaces with sheets of Mylar and the assembly is then crushed into a pellet. This effectively traps the sub-micron sized particles for later analysis. 6 figures.

  7. System and method for measuring particles in a sample stream of a flow cytometer or the like

    DOE Patents [OSTI]

    Graves, Steven W.; Habberset, Robert C.

    2010-11-16

    A system and method for analyzing a particle in a sample stream of a flow cytometer or the like. The system has a light source, such as a laser pointer module, for generating a low powered light beam and a fluidics apparatus which is configured to transport particles in the sample stream at substantially low velocity through the light beam for interrogation. Detectors, such as photomultiplier tubes, are configured to detect optical signals generated in response to the light beam impinging the particles. Signal conditioning circuitry is connected to each of the detectors to condition each detector output into electronic signals for processing and is designed to have a limited frequency response to filter high frequency noise from the detector output signals.

  8. System and method for measuring particles in a sample stream of a flow cytometer using low-power laser source

    DOE Patents [OSTI]

    Graves, Steven W.; Habbersett, Robert C.

    2014-07-01

    A system and method for analyzing a particle in a sample stream of a flow cytometer or the like. The system has a light source, such as a laser pointer module, for generating a low powered light beam and a fluidics apparatus which is configured to transport particles in the sample stream at substantially low velocity through the light beam for interrogation. Detectors, such as photomultiplier tubes, are configured to detect optical signals generated in response to the light beam impinging the particles. Signal conditioning circuitry is connected to each of the detectors to condition each detector output into electronic signals for processing and is designed to have a limited frequency response to filter high frequency noise from the detector output signals.

  9. System and method for measuring particles in a sample stream of a flow cytometer using a low power laser source

    DOE Patents [OSTI]

    Graves, Steven W; Habbersett, Robert C

    2013-10-22

    A system and method for analyzing a particle in a sample stream of a flow cytometer or the like. The system has a light source, such as a laser pointer module, for generating a low powered light beam and a fluidics apparatus which is configured to transport particles in the sample stream at substantially low velocity through the light beam for interrogation. Detectors, such as photomultiplier tubes, are configured to detect optical signals generated in response to the light beam impinging the particles. Signal conditioning circuitry is connected to each of the detectors to condition each detector output into electronic signals for processing and is designed to have a limited frequency response to filter high frequency noise from the detector output signals.

  10. Low flow fume hood

    DOE Patents [OSTI]

    Bell, Geoffrey C.; Feustel, Helmut E.; Dickerhoff, Darryl J.

    2002-01-01

    A fume hood is provided having an adequate level of safety while reducing the amount of air exhausted from the hood. A displacement flow fume hood works on the principal of a displacement flow which displaces the volume currently present in the hood using a push-pull system. The displacement flow includes a plurality of air supplies which provide fresh air, preferably having laminar flow, to the fume hood. The displacement flow fume hood also includes an air exhaust which pulls air from the work chamber in a minimally turbulent manner. As the displacement flow produces a substantially consistent and minimally turbulent flow in the hood, inconsistent flow patterns associated with contaminant escape from the hood are minimized. The displacement flow fume hood largely reduces the need to exhaust large amounts of air from the hood. It has been shown that exhaust air flow reductions of up to 70% are possible without a decrease in the hood's containment performance. The fume hood also includes a number of structural adaptations which facilitate consistent and minimally turbulent flow within a fume hood.

  11. SU-E-I-45: Reconstruction of CT Images From Sparsely-Sampled Data Using the Logarithmic Barrier Method

    SciTech Connect (OSTI)

    Xu, H

    2014-06-01

    Purpose: To develop and investigate whether the logarithmic barrier (LB) method can result in high-quality reconstructed CT images using sparsely-sampled noisy projection data Methods: The objective function is typically formulated as the sum of the total variation (TV) and a data fidelity (DF) term with a parameter ? that governs the relative weight between them. Finding the optimized value of ? is a critical step for this approach to give satisfactory results. The proposed LB method avoid using ? by constructing the objective function as the sum of the TV and a log function whose augment is the DF term. Newton's method was used to solve the optimization problem. The algorithm was coded in MatLab2013b. Both Shepp-Logan phantom and a patient lung CT image were used for demonstration of the algorithm. Measured data were simulated by calculating the projection data using radon transform. A Poisson noise model was used to account for the simulated detector noise. The iteration stopped when the difference of the current TV and the previous one was less than 1%. Results: Shepp-Logan phantom reconstruction study shows that filtered back-projection (FBP) gives high streak artifacts for 30 and 40 projections. Although visually the streak artifacts are less pronounced for 64 and 90 projections in FBP, the 1D pixel profiles indicate that FBP gives noisier reconstructed pixel values than LB does. A lung image reconstruction is presented. It shows that use of 64 projections gives satisfactory reconstructed image quality with regard to noise suppression and sharp edge preservation. Conclusion: This study demonstrates that the logarithmic barrier method can be used to reconstruct CT images from sparsely-amped data. The number of projections around 64 gives a balance between the over-smoothing of the sharp demarcation and noise suppression. Future study may extend to CBCT reconstruction and improvement on computation speed.

  12. Method of characterizing VOC concentration in vented waste drums with multiple layers of confinement using limited sampling data

    SciTech Connect (OSTI)

    Liekhus, K.J.; Vaughn, M.E.; Jensen, B.A.; Connolly, M.J.

    1994-11-01

    Characterization of transuranic waste destined for the Waste Isolation Pilot Plant currently requires detailed characterization of the volatile organic compound (VOC) concentration in the void volume headspaces (drum headspace, the large polymer bag headspace, and the innermost layers of confinement headspace) of the waste drums. A test program is underway at the Idaho National Engineering Laboratory (INEL) to determine if the drum headspace VOC concentration is representative of the concentration in the entire drum void space and demonstrate that the VOC concentration in the innermost layer of confinement can be estimated using a model incorporating diffusion and permeation transport principles and limited waste drum sampling data. A comparison of model predictions of VOC concentration in the innermost layer of confinement with actual measurement from transuranic waste drums demonstrate that this method may be useful in characterizing VOC concentration in a vented waste drum.

  13. Statistical assessment of fish behavior from split-beam hydro-acoustic sampling

    SciTech Connect (OSTI)

    McKinstry, Craig A.; Simmons, Mary Ann; Simmons, Carver S.; Johnson, Robert L.

    2005-04-01

    Statistical methods are presented for using echo-traces from split-beam hydro-acoustic sampling to assess fish behavior in response to a stimulus. The data presented are from a study designed to assess the response of free-ranging, lake-resident fish, primarily kokanee (Oncorhynchus nerka) and rainbow trout (Oncorhynchus mykiss) to high intensity strobe lights, and was conducted at Grand Coulee Dam on the Columbia River in Northern Washington State. The lights were deployed immediately upstream from the turbine intakes, in a region exposed to daily alternating periods of high and low flows. The study design included five down-looking split-beam transducers positioned in a line at incremental distances upstream from the strobe lights, and treatments applied in randomized pseudo-replicate blocks. Statistical methods included the use of odds-ratios from fitted loglinear models. Fish-track velocity vectors were modeled using circular probability distributions. Both analyses are depicted graphically. Study results suggest large increases of fish activity in the presence of the strobe lights, most notably at night and during periods of low flow. The lights also induced notable bimodality in the angular distributions of the fish track velocity vectors. Statistical summaries are presented along with interpretations on fish behavior.

  14. Apparatus and method for quantitatively evaluating total fissile and total fertile nuclide content in samples. [Patent application

    DOE Patents [OSTI]

    Caldwell, J.T.; Kunz, W.E.; Cates, M.R.; Franks, L.A.

    1982-07-07

    Simultaneous photon and neutron interrogation of samples for the quantitative determination of total fissile nuclide and total fertile nuclide material present is made possible by the use of an electron accelerator. Prompt and delayed neutrons produced from resulting induced fission are counted using a single detection system and allow the resolution of the contributions from each interrogating flux leading in turn to the quantitative determination sought. Detection limits for /sup 239/Pu are estimated to be about 3 mg using prompt fission neutrons and about 6 mg using delayed neutrons.

  15. Method and apparatus for transport, introduction, atomization and excitation of emission spectrum for quantitative analysis of high temperature gas sample streams containing vapor and particulates without degradation of sample stream temperature

    DOE Patents [OSTI]

    Eckels, David E.; Hass, William J.

    1989-05-30

    A sample transport, sample introduction, and flame excitation system for spectrometric analysis of high temperature gas streams which eliminates degradation of the sample stream by condensation losses.

  16. A high sensitivity fiber optic macro-bend based gas flow rate transducer for low flow rates: Theory, working principle, and static calibration

    SciTech Connect (OSTI)

    Schena, Emiliano; Saccomandi, Paola; Silvestri, Sergio

    2013-02-15

    A novel fiber optic macro-bend based gas flowmeter for low flow rates is presented. Theoretical analysis of the sensor working principle, design, and static calibration were performed. The measuring system consists of: an optical fiber, a light emitting diode (LED), a Quadrant position sensitive Detector (QD), and an analog electronic circuit for signal processing. The fiber tip undergoes a deflection in the flow, acting like a cantilever. The consequent displacement of light spot center is monitored by the QD generating four unbalanced photocurrents which are function of fiber tip position. The analog electronic circuit processes the photocurrents providing voltage signal proportional to light spot position. A circular target was placed on the fiber in order to increase the sensing surface. Sensor, tested in the measurement range up to 10 l min{sup -1}, shows a discrimination threshold of 2 l min{sup -1}, extremely low fluid dynamic resistance (0.17 Pa min l{sup -1}), and high sensitivity, also at low flow rates (i.e., 33 mV min l{sup -1} up to 4 l min{sup -1} and 98 mV min l{sup -1} from 4 l min{sup -1} up to 10 l min{sup -1}). Experimental results agree with the theoretical predictions. The high sensitivity, along with the reduced dimension and negligible pressure drop, makes the proposed transducer suitable for medical applications in neonatal ventilation.

  17. Stopping Power of Different Ions in Si Measured with a Bulk Sample Method and Bayesian Inference Data Analysis

    SciTech Connect (OSTI)

    Barradas, N. P.; Alves, E.; Siketic, Z.; Radovic, I. Bogdanovic

    2009-03-10

    The accuracy of ion beam analysis experiments depends critically on the stopping power values available. While for H and He ions accuracies normally better than 5% are achieved by usual interpolative schemes such as SRIM, for heavier ions the accuracy is worse. One of the main reasons is that the experimental data bases are very sparse, even for important materials such as Si. New measurements are therefore needed. Measurement of stopping power is often made with transmission in thin films, with the usual problems of film thickness homogeneity. We have previously developed an alternative method based on measuring bulk spectra, and fitting the yield by treating the stopping power as a fit parameter in a Bayesian inference Markov chain Monte Carlo procedure included in the standard IBA code NDF. We report on improvements of the method and on its application to the determination of the stopping power of {sup 7}Li in Si. To validate the method, we also apply it to the stopping of {sup 4}He in Si, which is known with 2% accuracy.

  18. Apparatus and method for quantitative assay of samples of transuranic waste contained in barrels in the presence of matrix material

    DOE Patents [OSTI]

    Caldwell, J.T.; Herrera, G.C.; Hastings, R.D.; Shunk, E.R.; Kunz, W.E.

    1987-08-28

    Apparatus and method for performing corrections for matrix material effects on the neutron measurements generated from analysis of transuranic waste drums using the differential-dieaway technique. By measuring the absorption index and the moderator index for a particular drum, correction factors can be determined for the effects of matrix materials on the ''observed'' quantity of fissile and fertile material present therein in order to determine the actual assays thereof. A barrel flux monitor is introduced into the measurement chamber to accomplish these measurements as a new contribution to the differential-dieaway technology. 9 figs.

  19. Development testing of the chemical analysis automation polychlorinated biphenyl standard analysis method during surface soils sampling at the David Witherspoon 1630 site

    SciTech Connect (OSTI)

    Hunt, M.A.; Klatt, L.N.; Thompson, D.H.

    1998-02-01

    The Chemical Analysis Automation (CAA) project is developing standardized, software-driven, site-deployable robotic laboratory systems with the objective of lowering the per-sample analysis cost, decreasing sample turnaround time, and minimizing human exposure to hazardous and radioactive materials associated with DOE remediation projects. The first integrated system developed by the CAA project is designed to determine polychlorinated biphenyls (PCB) content in soil matrices. A demonstration and development testing of this system was conducted in conjuction with surface soil characterization activities at the David Witherspoon 1630 Site in Knoxville, Tennessee. The PCB system consists of five hardware standard laboratory modules (SLMs), one software SLM, the task sequence controller (TSC), and the human-computer interface (HCI). Four of the hardware SLMs included a four-channel Soxhlet extractor, a high-volume concentrator, a column cleanup, and a gas chromatograph. These SLMs performed the sample preparation and measurement steps within the total analysis protocol. The fifth hardware module was a robot that transports samples between the SLMs and the required consumable supplies to the SLMs. The software SLM is an automated data interpretation module that receives raw data from the gas chromatograph SLM and analyzes the data to yield the analyte information. The TSC is a software system that provides the scheduling, management of system resources, and the coordination of all SLM activities. The HCI is a graphical user interface that presents the automated laboratory to the analyst in terms of the analytical procedures and methods. Human control of the automated laboratory is accomplished via the HCI. Sample information required for processing by the automated laboratory is entered through the HCI. Information related to the sample and the system status is presented to the analyst via graphical icons.

  20. Implementation and testing of the on-the-fly thermal scattering Monte Carlo sampling method for graphite and light water in MCNP6

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Pavlou, Andrew T.; Ji, Wei; Brown, Forrest B.

    2016-01-23

    Here, a proper treatment of thermal neutron scattering requires accounting for chemical binding through a scattering law S(α,β,T). Monte Carlo codes sample the secondary neutron energy and angle after a thermal scattering event from probability tables generated from S(α,β,T) tables at discrete temperatures, requiring a large amount of data for multiscale and multiphysics problems with detailed temperature gradients. We have previously developed a method to handle this temperature dependence on-the-fly during the Monte Carlo random walk using polynomial expansions in 1/T to directly sample the secondary energy and angle. In this paper, the on-the-fly method is implemented into MCNP6 andmore » tested in both graphite-moderated and light water-moderated systems. The on-the-fly method is compared with the thermal ACE libraries that come standard with MCNP6, yielding good agreement with integral reactor quantities like k-eigenvalue and differential quantities like single-scatter secondary energy and angle distributions. The simulation runtimes are comparable between the two methods (on the order of 5–15% difference for the problems tested) and the on-the-fly fit coefficients only require 5–15 MB of total data storage.« less

  1. Apparatus and method for quantitative measurement of small differences in optical absorptivity between two samples using differential interferometry and the thermooptic effect

    DOE Patents [OSTI]

    Cremers, David A.; Keller, Richard A.

    1984-01-01

    An apparatus and method for the measurement of small differences in optical absorptivity of weakly absorbing solutions using differential interferometry and the thermooptic effect has been developed. Two sample cells are placed in each arm of an interferometer and are traversed by colinear probe and heating laser beams. The interrogation probe beams are recombined forming a fringe pattern, the intensity of which can be related to changes in optical pathlength of these laser beams through the cells. This in turn can be related to small differences in optical absorptivity which results in different amounts of sample heating when the heating laser beams are turned on, by the fact that the index of refraction of a liquid is temperature dependent. A critical feature of this invention is the stabilization of the optical path of the probe beams against drift. Background (solvent) absorption can then be suppressed by a factor of approximately 400. Solute absorptivities of about 10.sup.-5 cm.sup.-1 can then be determined in the presence of background absorptions in excess of 10.sup.-3 cm.sup.-1. In addition, the smallest absorption measured with the instant apparatus and method is about 5.times. 10.sup.-6 cm.sup.-1.

  2. Apparatus and method for quantitative measurement of small differences in optical absorptivity between two samples using differential interferometry and the thermooptic effect

    DOE Patents [OSTI]

    Cremers, D.A.; Keller, R.A.

    1984-05-08

    An apparatus and method for the measurement of small differences in optical absorptivity of weakly absorbing solutions using differential interferometry and the thermooptic effect have been developed. Two sample cells are placed in each arm of an interferometer and are traversed by colinear probe and heating laser beams. The interrogation probe beams are recombined forming a fringe pattern, the intensity of which can be related to changes in optical path length of these laser beams through the cells. This in turn can be related to small differences in optical absorptivity which results in different amounts of sample heating when the heating laser beams are turned on, by the fact that the index of refraction of a liquid is temperature dependent. A critical feature of this invention is the stabilization of the optical path of the probe beams against drift. Background (solvent) absorption can then be suppressed by a factor of approximately 400. Solute absorptivities of about 10[sup [minus]5] cm[sup [minus]1] can then be determined in the presence of background absorptions in excess of 10[sup [minus]3] cm[sup [minus]1]. In addition, the smallest absorption measured with the instant apparatus and method is about 5 [times] 10[sup [minus]6] cm[sup [minus]1]. 6 figs.

  3. Apparatus and method for quantitative measurement of small differences in optical absorptivity between two samples using differential interferometry and the thermooptic effect

    DOE Patents [OSTI]

    Cremers, D.A.; Keller, R.A.

    1982-06-08

    An apparatus and method for the measurement of small differences in optical absorptivity of weakly absorbing solutions using differential interferometry and the thermooptic effect has been developed. Two sample cells are placed in each arm of an interferometer and are traversed by colinear probe and heating laser beams. The interrogation probe beams are recombined forming a fringe pattern, the intensity of which can be related to changes in optical pathlength of these laser beams through the cells. This in turn can be related to small differences in optical absorptivity which results in different amounts of sample heating when the heating laser beams are turned on, by the fact that the index of refraction of a liquid is temperature dependent. A critical feature of this invention is the stabilization of the optical path of the probe beams against drift. Background (solvent) absorption can then be suppressed by a factor of approximately 400. Solute absorptivities of about 10/sup -5/ cm/sup -1/ can then be determined in the presence of background absorptions in excess of 10/sup -3/ cm/sup -1/. In addition, the smallest absorption measured with the instant apparatus and method is about 5 x 10/sup -6/ cm/sup -1/.

  4. Study on critical heat flux enhancement in flow boiling of SiC nano-fluids under low pressure and low flow conditions

    SciTech Connect (OSTI)

    Lee, S. W.; Park, S. D.; Kang, S.; Kim, S. M.; Seo, H.; Lee, D. W.; Bang, I. C.

    2012-07-01

    Critical heat flux (CHF) is the thermal limit of a phenomenon in which a phase change occurs during heating (such as bubbles forming on a metal surface used to heat water), which suddenly decreases the heat transfer efficiency, thus causing localized overheating of the heating surface. The enhancement of CHF can increase the safety margins and allow operation at higher heat fluxes; thus, it can increase the economy. A very interesting characteristics of nano-fluids is their ability to significantly enhance the CHF. nano-fluids are nano-technology-based colloidal dispersions engineered through stable suspending of nanoparticles. All experiments were performed in round tubes with an inner diameter of 0.01041 m and a length of 0.5 m under low pressure and low flow (LPLF) conditions at a fixed inlet temperature using water, 0.01 vol. % Al{sub 2}O{sub 3}/water and SiC/water nano-fluids. It was found that the CHF of the nano-fluids was enhanced and the CHF of the SiC/water nano-fluid was more enhanced than that of the Al{sub 2}O{sub 3}/water nano-fluid. (authors)

  5. False Negative Rates of a Macrofoam-Swab Sampling Method with Low Surface Concentrations of Two Bacillus anthracis Surrogates via Real-Time PCR

    SciTech Connect (OSTI)

    Hutchison, Janine R.; Piepel, Gregory F.; Amidan, Brett G.; Sydor, Michael A.; Deatherage Kaiser, Brooke L

    2015-05-01

    Surface sampling for Bacillus anthracis spores has traditionally relied on detection via bacterial cultivation methods. Although effective, this approach does not provide the level of organism specificity that can be gained through molecular techniques. False negative rates (FNR) and limits of detection (LOD) were determined for two B. anthracis surrogates with modified rapid viability-polymerase chain reaction (mRV-PCR) following macrofoam-swab sampling. This study was conducted in parallel with a previously reported study that analyzed spores using a plate-culture method. B. anthracis Sterne (BAS) or B. atrophaeus Nakamura (BG) spores were deposited onto four surface materials (glass, stainless steel, vinyl tile, and plastic) at nine target concentrations (2 to 500 spores/coupon; 0.078 to 19.375 colony-forming units [CFU] per cm²). Mean FNR values for mRV-PCR analysis ranged from 0 to 0.917 for BAS and 0 to 0.875 for BG and increased as spore concentration decreased (over the concentrations investigated) for each surface material. FNRs based on mRV-PCR data were not statistically different for BAS and BG, but were significantly lower for glass than for vinyl tile. FNRs also tended to be lower for the mRV-PCR method compared to the culture method. The mRV-PCR LOD₉₅ was lowest for glass (0.429 CFU/cm² with BAS and 0.341 CFU/cm² with BG) and highest for vinyl tile (0.919 CFU/cm² with BAS and 0.917 CFU/cm² with BG). These mRV-PCR LOD₉₅ values were lower than the culture values (BAS: 0.678 to 1.023 CFU/cm² and BG: 0.820 to 1.489 CFU/cm²). The FNR and LOD₉₅ values reported in this work provide guidance for environmental sampling of Bacillus spores at low concentrations.

  6. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... The gross alpha, gross beta, radium-226, and radium-228 method blank results were below the DLC. Inductively Coupled Plasma (ICP) Interference Check Sample (ICS) Analysis ICP ...

  7. Hazard surveillance for workplace magnetic fields. 1: Walkaround sampling method for measuring ambient field magnitude; 2: Field characteristics from waveform measurements

    SciTech Connect (OSTI)

    Methner, M.M.; Bowman, J.D.

    1998-03-01

    Recent epidemiologic research has suggested that exposure to extremely low frequency (ELF) magnetic fields (MF) may be associated with leukemia, brain cancer, spontaneous abortions, and Alzheimer`s disease. A walkaround sampling method for measuring ambient ELF-MF levels was developed for use in conducting occupational hazard surveillance. This survey was designed to determine the range of MF levels at different industrial facilities so they could be categorized by MF levels and identified for possible subsequent personal exposure assessments. Industries were selected based on their annual electric power consumption in accordance with the hypothesis that large power consumers would have higher ambient MFs when compared with lower power consumers. Sixty-two facilities within thirteen 2-digit Standard Industrial Classifications (SIC) were selected based on their willingness to participate. A traditional industrial hygiene walkaround survey was conducted to identify MF sources, with a special emphasis on work stations.

  8. Recovery Efficiency, False Negative Rate, and Limit of Detection Performance of a Validated Macrofoam-Swab Sampling Method with Low Surface Concentrations of Two Bacillus anthracis Surrogates

    SciTech Connect (OSTI)

    Piepel, Gregory F.; Hutchison, Janine R.; Deatherage Kaiser, Brooke L; Amidan, Brett G.; Sydor, Michael A.; Barrett, Christopher A.

    2015-03-31

    The performance of a macrofoam-swab sampling method was evaluated using Bacillus anthracis Sterne (BAS) and Bacillus atrophaeus Nakamura (BG) spores applied at nine low target amounts (2-500 spores) to positive-control plates and test coupons (2 in. × 2 in.) of four surface materials (glass, stainless steel, vinyl tile, and plastic). Test results from cultured samples were used to evaluate the effects of surrogate, surface concentration, and surface material on recovery efficiency (RE), false negative rate (FNR), and limit of detection. For RE, surrogate and surface material had statistically significant effects, but concentration did not. Mean REs were the lowest for vinyl tile (50.8% with BAS, 40.2% with BG) and the highest for glass (92.8% with BAS, 71.4% with BG). FNR values ranged from 0 to 0.833 for BAS and 0 to 0.806 for BG, with values increasing as concentration decreased in the range tested (0.078 to 19.375 CFU/cm2, where CFU denotes ‘colony forming units’). Surface material also had a statistically significant effect. A FNR-concentration curve was fit for each combination of surrogate and surface material. For both surrogates, the FNR curves tended to be the lowest for glass and highest for vinyl title. The FNR curves for BG tended to be higher than for BAS at lower concentrations, especially for glass. Results using a modified Rapid Viability-Polymerase Chain Reaction (mRV-PCR) analysis method were also obtained. The mRV-PCR results and comparisons to the culture results will be discussed in a subsequent report.

  9. Stochastic Engine Final Report: Applying Markov Chain Monte Carlo Methods with Importance Sampling to Large-Scale Data-Driven Simulation

    SciTech Connect (OSTI)

    Glaser, R E; Johannesson, G; Sengupta, S; Kosovic, B; Carle, S; Franz, G A; Aines, R D; Nitao, J J; Hanley, W G; Ramirez, A L; Newmark, R L; Johnson, V M; Dyer, K M; Henderson, K A; Sugiyama, G A; Hickling, T L; Pasyanos, M E; Jones, D A; Grimm, R J; Levine, R A

    2004-03-11

    Accurate prediction of complex phenomena can be greatly enhanced through the use of data and observations to update simulations. The ability to create these data-driven simulations is limited by error and uncertainty in both the data and the simulation. The stochastic engine project addressed this problem through the development and application of a family of Markov Chain Monte Carlo methods utilizing importance sampling driven by forward simulators to minimize time spent search very large state spaces. The stochastic engine rapidly chooses among a very large number of hypothesized states and selects those that are consistent (within error) with all the information at hand. Predicted measurements from the simulator are used to estimate the likelihood of actual measurements, which in turn reduces the uncertainty in the original sample space via a conditional probability method called Bayesian inferencing. This highly efficient, staged Metropolis-type search algorithm allows us to address extremely complex problems and opens the door to solving many data-driven, nonlinear, multidimensional problems. A key challenge has been developing representation methods that integrate the local details of real data with the global physics of the simulations, enabling supercomputers to efficiently solve the problem. Development focused on large-scale problems, and on examining the mathematical robustness of the approach in diverse applications. Multiple data types were combined with large-scale simulations to evaluate systems with {approx}{sup 10}20,000 possible states (detecting underground leaks at the Hanford waste tanks). The probable uses of chemical process facilities were assessed using an evidence-tree representation and in-process updating. Other applications included contaminant flow paths at the Savannah River Site, locating structural flaws in buildings, improving models for seismic travel times systems used to monitor nuclear proliferation, characterizing the source

  10. Protections: Sampling

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Protections: Sampling Protections: Sampling Protection #3: Sampling for known and unexpected contaminants August 1, 2013 Monitoring stormwater in Los Alamos Canyon Monitoring stormwater in Los Alamos Canyon The Environmental Sampling Board, a key piece of the Strategy, ensures that LANL collects relevant and appropriate data to answer questions about the protection of human and environmental health, and to satisfy regulatory requirements. LANL must demonstrate the data are technically justified

  11. Protections: Sampling

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Protection 3: Sampling for known and unexpected contaminants August 1, 2013 Monitoring stormwater in Los Alamos Canyon Monitoring stormwater in Los Alamos Canyon The Environmental ...

  12. Protections: Sampling

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    and unexpected contaminants August 1, 2013 Monitoring stormwater in Los Alamos Canyon Monitoring stormwater in Los Alamos Canyon The Environmental Sampling Board, a key piece...

  13. Development and Evaluation of an Externally Air-Cooled Low-Flow torch and the Attenuation of Space Charge and Matrix Effects in Inductively Coupled Plasma Mass Spectrometry

    SciTech Connect (OSTI)

    Praphairaksit, N.

    2000-09-12

    An externally air-cooled low-flow torch has been constructed and successfully demonstrated for applications in inductively coupled plasma mass spectrometry (ICP-MS). The torch is cooled by pressurized air flowing at {approximately}70 L/min through a quartz air jacket onto the exterior of the outer tube. The outer gas flow rate and operating RF forward power are reduced considerably. Although plasmas can be sustained at the operating power as low as 400 W with a 2 L/min of outer gas flow, somewhat higher power and outer gas flows are advisable. A stable and analytical useful plasma can be obtained at 850 W with an outer gas flow rate of {approximately}4 L/min. Under these conditions, the air-cooled plasma produces comparable sensitivities, doubly charged ion ratios, matrix effects and other analytical merits as those produced by a conventional torch while using significantly less argon and power requirements. Metal oxide ion ratios are slightly higher with the air-cooled plasma but can be mitigated by reducing the aerosol gas flow rate slightly with only minor sacrifice in analyte sensitivity. A methodology to alleviate the space charge and matrix effects in ICP-MS has been developed. A supplemental electron source adapted from a conventional electron impact ionizer is added to the base of the skimmer. Electrons supplied from this source downstream of the skimmer with suitable amount and energy can neutralize the positive ions in the beam extracted from the plasma and diminish the space charge repulsion between them. As a result, the overall ion transmission efficiency and consequent analyte ion sensitivities are significantly improved while other important analytical aspects, such as metal oxide ion ratio, doubly charged ion ratio and background ions remain relatively unchanged with the operation of this electron source. This technique not only improves the ion transmission efficiency but also minimizes the matrix effects drastically. The matrix-induced suppression

  14. Sample Proficiency Test exercise

    SciTech Connect (OSTI)

    Alcaraz, A; Gregg, H; Koester, C

    2006-02-05

    The current format of the OPCW proficiency tests has multiple sets of 2 samples sent to an analysis laboratory. In each sample set, one is identified as a sample, the other as a blank. This method of conducting proficiency tests differs from how an OPCW designated laboratory would receive authentic samples (a set of three containers, each not identified, consisting of the authentic sample, a control sample, and a blank sample). This exercise was designed to test the reporting if the proficiency tests were to be conducted. As such, this is not an official OPCW proficiency test, and the attached report is one method by which LLNL might report their analyses under a more realistic testing scheme. Therefore, the title on the report ''Report of the Umpteenth Official OPCW Proficiency Test'' is meaningless, and provides a bit of whimsy for the analyses and readers of the report.

  15. SAMPLING SYSTEM

    DOE Patents [OSTI]

    Hannaford, B.A.; Rosenberg, R.; Segaser, C.L.; Terry, C.L.

    1961-01-17

    An apparatus is given for the batch sampling of radioactive liquids such as slurries from a system by remote control, while providing shielding for protection of operating personnel from the harmful effects of radiation.

  16. Sampling box

    DOE Patents [OSTI]

    Phillips, Terrance D.; Johnson, Craig

    2000-01-01

    An air sampling box that uses a slidable filter tray and a removable filter cartridge to allow for the easy replacement of a filter which catches radioactive particles is disclosed.

  17. SAMPLING OSCILLOSCOPE

    DOE Patents [OSTI]

    Sugarman, R.M.

    1960-08-30

    An oscilloscope is designed for displaying transient signal waveforms having random time and amplitude distributions. The oscilloscopc is a sampling device that selects for display a portion of only those waveforms having a particular range of amplitudes. For this purpose a pulse-height analyzer is provided to screen the pulses. A variable voltage-level shifter and a time-scale rampvoltage generator take the pulse height relative to the start of the waveform. The variable voltage shifter produces a voltage level raised one step for each sequential signal waveform to be sampled and this results in an unsmeared record of input signal waveforms. Appropriate delay devices permit each sample waveform to pass its peak amplitude before the circuit selects it for display.

  18. Sampling apparatus

    DOE Patents [OSTI]

    Gordon, Norman R.; King, Lloyd L.; Jackson, Peter O.; Zulich, Alan W.

    1989-01-01

    A sampling apparatus is provided for sampling substances from solid surfaces. The apparatus includes first and second elongated tubular bodies which telescopically and sealingly join relative to one another. An absorbent pad is mounted to the end of a rod which is slidably received through a passageway in the end of one of the joined bodies. The rod is preferably slidably and rotatably received through the passageway, yet provides a selective fluid tight seal relative thereto. A recess is formed in the rod. When the recess and passageway are positioned to be coincident, fluid is permitted to flow through the passageway and around the rod. The pad is preferably laterally orientable relative to the rod and foldably retractable to within one of the bodies. A solvent is provided for wetting of the pad and solubilizing or suspending the material being sampled from a particular surface.

  19. Sampling apparatus

    DOE Patents [OSTI]

    Gordon, N.R.; King, L.L.; Jackson, P.O.; Zulich, A.W.

    1989-07-18

    A sampling apparatus is provided for sampling substances from solid surfaces. The apparatus includes first and second elongated tubular bodies which telescopically and sealingly join relative to one another. An absorbent pad is mounted to the end of a rod which is slidably received through a passageway in the end of one of the joined bodies. The rod is preferably slidably and rotatably received through the passageway, yet provides a selective fluid tight seal relative thereto. A recess is formed in the rod. When the recess and passageway are positioned to be coincident, fluid is permitted to flow through the passageway and around the rod. The pad is preferably laterally orientable relative to the rod and foldably retractable to within one of the bodies. A solvent is provided for wetting of the pad and solubilizing or suspending the material being sampled from a particular surface. 15 figs.

  20. Method and apparatus utilizing ionizing and microwave radiation for saturation determination of water, oil and a gas in a core sample

    DOE Patents [OSTI]

    Maerefat, N.L.; Parmeswar, R.; Brinkmeyer, A.D.; Honarpour, M.

    1994-08-23

    A system is described for determining the relative permeabilities of gas, water and oil in a core sample has a microwave emitter/detector subsystem and an X-ray emitter/detector subsystem. A core holder positions the core sample between microwave absorbers which prevent diffracted microwaves from reaching a microwave detector where they would reduce the signal-to-noise ratio of the microwave measurements. The microwave emitter/detector subsystem and the X-ray emitter/detector subsystem each have linear calibration characteristics, allowing one subsystem to be calibrated with respect to the other subsystem. The dynamic range of microwave measurements is extended through the use of adjustable attenuators. This also facilitates the use of core samples with wide diameters. The stratification characteristics of the fluids may be observed with a windowed cell separator at the outlet of the core sample. The condensation of heavy hydrocarbon gas and the dynamic characteristics of the fluids are observed with a sight glass at the outlet of the core sample. 11 figs.

  1. Method and apparatus utilizing ionizing and microwave radiation for saturation determination of water, oil and a gas in a core sample

    DOE Patents [OSTI]

    Maerefat, Nicida L.; Parmeswar, Ravi; Brinkmeyer, Alan D.; Honarpour, Mehdi

    1994-01-01

    A system for determining the relative permeabilities of gas, water and oil in a core sample has a microwave emitter/detector subsystem and an X-ray emitter/detector subsystem. A core holder positions the core sample between microwave absorbers which prevent diffracted microwaves from reaching a microwave detector where they would reduce the signal-to-noise ratio of the microwave measurements. The microwave emitter/detector subsystem and the X-ray emitter/detector subsystem each have linear calibration characteristics, allowing one subsystem to be calibrated with respect to the other subsystem. The dynamic range of microwave measurements is extended through the use of adjustable attenuators. This also facilitates the use of core samples with wide diameters. The stratification characteristics of the fluids may be observed with a windowed cell separator at the outlet of the core sample. The condensation of heavy hydrocarbon gas and the dynamic characteristics of the fluids are observed with a sight glass at the outlet of the core sample.

  2. Method for determination of .sup.18 O/.sup.16 O and .sup.2 H/.sup.1 H ratios and .sup.3 H (tritium) concentrations of xylem waters and subsurface waters using time series sampling

    DOE Patents [OSTI]

    Smith, Brian; Menchaca, Leticia

    1999-01-01

    A method for determination of .sup.18 O/.sup.16 O and .sup.2 H/.sup.1 H ratios and .sup.3 H concentrations of xylem and subsurface waters using time series sampling, insulating sampling chambers, and combined .sup.18 O/.sup.16 O, .sup.2 H/.sup.1 H and .sup.3 H concentration data on transpired water. The method involves collecting water samples transpired from living plants and correcting the measured isotopic compositions of oxygen (.sup.18 O/.sup.16 O) and hydrogen (.sup.2 H/.sup.1 H and/or .sup.3 H concentrations) to account for evaporative isotopic fractionation in the leafy material of the plant.

  3. Measurement of the top quark mass at CDF using the `neutrino phi weighting' template method on a lepton plus isolated track sample

    SciTech Connect (OSTI)

    Aaltonen, T.; Adelman, J.; Akimoto, T.; Alvarez Gonzalez, B.; Amerio, S.; Amidei, D.; Anastassov, A.; Annovi, A.; Antos, J.; Apollinari, G.; Apresyan, A.; /Purdue U. /Waseda U.

    2009-01-01

    We present a measurement of the top quark mass with t{bar t} dilepton events produced in p{bar p} collisions at the Fermilab Tevatron ({radical}s = 1.96 TeV) and collected by the CDF II detector. A sample of 328 events with a charged electron or muon and an isolated track, corresponding to an integrated luminosity of 2.9 fb{sup -1}, are selected as t{bar t} candidates. To account for the unconstrained event kinematics, we scan over the phase space of the azimuthal angles ({phi}{sub {nu}1}, {phi}{sub {nu}2}) of neutrinos and reconstruct the top quark mass for each {phi}{sub {nu}1}, {phi}{sub {nu}2} pair by minimizing a {chi}{sup 2} function in the t{bar t} dilepton hypothesis. We assign {chi}{sup 2}-dependent weights to the solutions in order to build a preferred mass for each event. Preferred mass distributions (templates) are built from simulated t{bar t} and background events, and parameterized in order to provide continuous probability density functions. A likelihood fit to the mass distribution in data as a weighted sum of signal and background probability density functions gives a top quark mass of 165.5{sub -3.3}{sup +3.4}(stat.){+-}3.1(syst.) GeV/c{sup 2}.

  4. Ball assisted device for analytical surface sampling

    SciTech Connect (OSTI)

    ElNaggar, Mariam S; Van Berkel, Gary J; Covey, Thomas R

    2015-11-03

    A system for sampling a surface includes a sampling probe having a housing and a socket, and a rolling sampling sphere within the socket. The housing has a sampling fluid supply conduit and a sampling fluid exhaust conduit. The sampling fluid supply conduit supplies sampling fluid to the sampling sphere. The sampling fluid exhaust conduit has an inlet opening for receiving sampling fluid carried from the surface by the sampling sphere. A surface sampling probe and a method for sampling a surface are also disclosed.

  5. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Salmon, Mississippi, Site, Water Sampling Location Map .........5 Water Sampling Field Activities Verification ...

  6. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........1 Water Sampling Locations at the Rulison, .........3 Water Sampling Field Activities Verification ...

  7. September 2004 Water Sampling

    Office of Legacy Management (LM)

    4 Groundwater and Surface Water Sampling at the Slick Rock, Colorado, Processing Sites .........7 Water Sampling Field Activities Verification ...

  8. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Green River, Utah, Disposal Site August 2014 LMSGRN.........7 Water Sampling Field Activities Verification ...

  9. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and May 2014 Groundwater and Surface Water Sampling at the Shiprock, New Mexico, Disposal .........9 Water Sampling Field Activities Verification ...

  10. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Rio Blanco, Colorado, Site October 2014 LMSRBLS00514 .........5 Water Sampling Field Activities Verification ...

  11. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Natural Gas and Produced Water Sampling at the Rulison, Colorado, Site November 2014 LMS.........3 Water Sampling Field Activities Verification ...

  12. September 2004 Water Sampling

    Office of Legacy Management (LM)

    5 Groundwater and Surface Water Sampling at the Rulison, Colorado, Site October 2015 LMS.........5 Water Sampling Field Activities Verification ...

  13. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Monticello, Utah, Processing Site July 2015 LMSMNT.........7 Water Sampling Field Activities Verification ...

  14. September 2004 Water Sampling

    Office of Legacy Management (LM)

    2015 Groundwater and Surface Water Sampling at the Shiprock, New Mexico, Disposal Site .........9 Water Sampling Field Activities Verification ...

  15. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Rio Blanco, Colorado, Site October 2015 LMSRBLS00515 .........5 Water Sampling Field Activities Verification ...

  16. September 2004 Water Sampling

    Office of Legacy Management (LM)

    5 Produced Water Sampling at the Rulison, Colorado, Site May 2015 LMSRULS00115 Available .........3 Water Sampling Field Activities Verification ...

  17. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Natural Gas and Produced Water Sampling at the Gasbuggy, New Mexico, Site December 2013 .........5 Water Sampling Field Activities Verification ...

  18. September 2004 Water Sampling

    Office of Legacy Management (LM)

    Produced Water Sampling at the Rulison, Colorado, Site January 2016 LMSRULS00915 .........3 Water Sampling Field Activities Verification ...

  19. September 2004 Water Sampling

    Office of Legacy Management (LM)

    3 Groundwater and Surface Water Sampling at the Monument Valley, Arizona, Processing Site .........7 Water Sampling Field Activities Verification ...

  20. September 2004 Water Sampling

    Office of Legacy Management (LM)

    July 2015 Groundwater and Surface Water Sampling at the Gunnison, Colorado, Processing .........5 Water Sampling Field Activities Verification ...

  1. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Monticello, Utah, Processing Site July 2014 LMSMNT.........7 Water Sampling Field Activities Verification ...

  2. September 2004 Water Sampling

    Office of Legacy Management (LM)

    3 Water Sampling at the Monticello, Utah, Processing Site January 2014 LMSMNTS01013 This .........7 Water Sampling Field Activities Verification ...

  3. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Naturita, Colorado Processing Site October 2013 LMSNAP.........5 Water Sampling Field Activities Verification ...

  4. September 2004 Water Sampling

    Office of Legacy Management (LM)

    4 Groundwater and Surface Water Sampling at the Gunnison, Colorado, Processing Site .........5 Water Sampling Field Activities Verification ...

  5. September 2004 Water Sampling

    Office of Legacy Management (LM)

    and Surface Water Sampling at the Tuba City, Arizona, Disposal Site November 2013 LMSTUB.........9 Water Sampling Field Activities Verification ...

  6. September 2004 Water Sampling

    Office of Legacy Management (LM)

    5 Groundwater and Surface Water Sampling at the Monticello, Utah, Processing Site January .........7 Water Sampling Field Activities Verification ...

  7. Pulsed field sample neutralization

    DOE Patents [OSTI]

    Appelhans, Anthony D.; Dahl, David A.; Delmore, James E.

    1990-01-01

    An apparatus and method for alternating voltage and for varying the rate of extraction during the extraction of secondary particles, resulting in periods when either positive ions, or negative ions and electrons are extracted at varying rates. Using voltage with alternating charge during successive periods to extract particles from materials which accumulate charge opposite that being extracted causes accumulation of surface charge of opposite sign. Charge accumulation can then be adjusted to a ratio which maintains a balance of positive and negative charge emission, thus maintaining the charge neutrality of the sample.

  8. LCLS Sample Preparation Laboratory | Sample Preparation Laboratories

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    LCLS Sample Preparation Laboratory Kayla Zimmerman | (650) 926-6281 Lisa Hammon, LCLS Lab Coordinator Welcome to the LCLS Sample Preparation Laboratory. This small general use wet lab is located in Rm 109 of the Far Experimental Hall near the MEC, CXI, and XCS hutches. It conveniently serves all LCLS hutches and is available for final stage sample preparation. Due to space limitations, certain types of activities may be restricted and all access must be scheduled in advance. User lab bench

  9. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... Inductively Coupled Plasma (ICP) Interference Check Sample (ICS) Analysis ICP interference check samples ICSA and ICSAB were analyzed at the required frequency to verify the ...

  10. Visual Sample Plan Flyer

    Office of Energy Efficiency and Renewable Energy (EERE)

    This flyer better explains that VSP is a free, easy-to-use software tool that supports development of optimal sampling plans based on statistical sampling theory.

  11. September 2004 Water Sampling

    Office of Legacy Management (LM)

    5 Groundwater and Surface Water Sampling at the Tuba City, Arizona Disposal Site June 2015 .........7 Water Sampling Field Activities Verification ...

  12. Principles for Sampling Airborne Radioactivity from Stacks

    SciTech Connect (OSTI)

    Glissmeyer, John A.

    2010-10-18

    This book chapter describes the special processes involved in sampling the airborne effluents from nuclear faciities. The title of the book is Radioactive Air Sampling Methods. The abstract for this chapter was cleared as PNNL-SA-45941.

  13. Acceptance sampling using judgmental and randomly selected samples

    SciTech Connect (OSTI)

    Sego, Landon H.; Shulman, Stanley A.; Anderson, Kevin K.; Wilson, John E.; Pulsipher, Brent A.; Sieber, W. Karl

    2010-09-01

    We present a Bayesian model for acceptance sampling where the population consists of two groups, each with different levels of risk of containing unacceptable items. Expert opinion, or judgment, may be required to distinguish between the high and low-risk groups. Hence, high-risk items are likely to be identifed (and sampled) using expert judgment, while the remaining low-risk items are sampled randomly. We focus on the situation where all observed samples must be acceptable. Consequently, the objective of the statistical inference is to quantify the probability that a large percentage of the unsampled items in the population are also acceptable. We demonstrate that traditional (frequentist) acceptance sampling and simpler Bayesian formulations of the problem are essentially special cases of the proposed model. We explore the properties of the model in detail, and discuss the conditions necessary to ensure that required samples sizes are non-decreasing function of the population size. The method is applicable to a variety of acceptance sampling problems, and, in particular, to environmental sampling where the objective is to demonstrate the safety of reoccupying a remediated facility that has been contaminated with a lethal agent.

  14. Fluid sampling tool

    DOE Patents [OSTI]

    Garcia, Anthony R.; Johnston, Roger G.; Martinez, Ronald K.

    2000-01-01

    A fluid-sampling tool for obtaining a fluid sample from a container. When used in combination with a rotatable drill, the tool bores a hole into a container wall, withdraws a fluid sample from the container, and seals the borehole. The tool collects fluid sample without exposing the operator or the environment to the fluid or to wall shavings from the container.

  15. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Equipment Blank Data ...

  16. The Sample Preparation Laboratories | Sample Preparation Laboratories

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Cynthia Patty 1 Sam Webb 2 John Bargar 3 Arizona 4 Chemicals 5 Team Work 6 Bottles 7 Glass 8 Plan Ahead! See the tabs above for Laboratory Access and forms you'll need to complete. Equipment and Chemicals tabs detail resources already available on site. Avoid delays! Hazardous materials use may require a written Standard Operating Procedure (SOP) before you work. Check the Chemicals tab for more information. The Sample Preparation Laboratories The Sample Preparation Laboratories provide wet lab

  17. Rain sampling device

    DOE Patents [OSTI]

    Nelson, D.A.; Tomich, S.D.; Glover, D.W.; Allen, E.V.; Hales, J.M.; Dana, M.T.

    1991-05-14

    The present invention constitutes a rain sampling device adapted for independent operation at locations remote from the user which allows rainfall to be sampled in accordance with any schedule desired by the user. The rain sampling device includes a mechanism for directing wet precipitation into a chamber, a chamber for temporarily holding the precipitation during the process of collection, a valve mechanism for controllably releasing samples of the precipitation from the chamber, a means for distributing the samples released from the holding chamber into vessels adapted for permanently retaining these samples, and an electrical mechanism for regulating the operation of the device. 11 figures.

  18. Rain sampling device

    DOE Patents [OSTI]

    Nelson, Danny A.; Tomich, Stanley D.; Glover, Donald W.; Allen, Errol V.; Hales, Jeremy M.; Dana, Marshall T.

    1991-01-01

    The present invention constitutes a rain sampling device adapted for independent operation at locations remote from the user which allows rainfall to be sampled in accordance with any schedule desired by the user. The rain sampling device includes a mechanism for directing wet precipitation into a chamber, a chamber for temporarily holding the precipitation during the process of collection, a valve mechanism for controllably releasing samples of said precipitation from said chamber, a means for distributing the samples released from the holding chamber into vessels adapted for permanently retaining these samples, and an electrical mechanism for regulating the operation of the device.

  19. Selection of Sampling Pumps Used for Groundwater Monitoring at the Hanford Site

    SciTech Connect (OSTI)

    Schalla, Ronald; Webber, William D.; Smith, Ronald M.

    2001-11-05

    The variable frequency drive centrifugal submersible pump, Redi-Flo2a made by Grundfosa, was selected for universal application for Hanford Site groundwater monitoring. Specifications for the selected pump and five other pumps were evaluated against current and future Hanford groundwater monitoring performance requirements, and the Redi-Flo2 was selected as the most versatile and applicable for the range of monitoring conditions. The Redi-Flo2 pump distinguished itself from the other pumps considered because of its wide range in output flow rate and its comparatively moderate maintenance and low capital costs. The Redi-Flo2 pump is able to purge a well at a high flow rate and then supply water for sampling at a low flow rate. Groundwater sampling using a low-volume-purging technique (e.g., low flow, minimal purge, no purge, or micropurgea) is planned in the future, eliminating the need for the pump to supply a high-output flow rate. Under those conditions, the Well Wizard bladder pump, manufactured by QED Environmental Systems, Inc., may be the preferred pump because of the lower capital cost.

  20. Analysis procedure for americium in environmental samples

    SciTech Connect (OSTI)

    Holloway, R.W.; Hayes, D.W.

    1982-01-01

    Several methods for the analysis of /sup 241/Am in environmental samples were evaluated and a preferred method was selected. This method was modified and used to determine the /sup 241/Am content in sediments, biota, and water. The advantages and limitations of the method are discussed. The method is also suitable for /sup 244/Cm analysis.

  1. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... 100, 17B, 1A, 72, and 81 were classified as Category II. The sample results were qualified with a "Q" flag, indicating the data are qualitative because of the sampling technique. ...

  2. Water and Sediment Sampling

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    MDC Blank 7222014 Below MDC Below MDC Water Sampling Results Location Sample Date WIPP ... Tut Tank 3132014 Below MDC Below MDC Fresh Water Tank 3122014 Below MDC Below MDC Hill ...

  3. September 2004 Water Sampling

    Office of Legacy Management (LM)

    ... the applicable MDL. Inductively Coupled Plasma Interference Check Sample Analysis ... and background correction factors for all inductively coupled plasma instruments. ...

  4. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........7 Water Sampling Field Activities Verification ... Groundwater Quality Data Static Water Level Data Time-Concentration Graphs ...

  5. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........9 Water Sampling Field Activities Verification ... Data Durango Processing Site Surface Water Quality Data Equipment Blank Data Static ...

  6. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........3 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Natural Gas Analysis Data ...

  7. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Static Water Level Data Hydrographs Time-Concentration ...

  8. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Static Water Level Data Hydrograph Time-Concentration ...

  9. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Groundwater Quality Data Surface Water Quality Data Time-Concentration Graph ...

  10. September 2004 Water Sampling

    Office of Legacy Management (LM)

    .........5 Water Sampling Field Activities Verification ... Quality Data Equipment Blank Data Static Water Level Data Time-Concentration Graphs ...