Powered by Deep Web Technologies
Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Guyana REDD+ Investment Fund (GRIF) | Open Energy Information  

Open Energy Info (EERE)

Guyana REDD+ Investment Fund (GRIF) Guyana REDD+ Investment Fund (GRIF) Jump to: navigation, search Name Guyana REDD+ Investment Fund (GRIF) Agency/Company /Organization Government of Norway, Government of Guyana Partner World Bank Sector Land Focus Area Forestry Topics Finance, Background analysis Website http://opnew.op.gov.gy/index.p Program Start 2010 Country Guyana, Norway South America, Northern Europe References Guyana REDD+ Investment Fund (GRIF)[1] Overview "Norway will be the first contributor to the GRIF, and will pay US$30 million into the fund when it is established, planned at the end of this month. The payment is in recognition of Guyana's efforts to protect its 16 million hectare rainforest, and follows the memorandum of understanding signed by the two countries in November last year. Norway intends to pay up

2

MEMORANDUM GY  

Office of Legacy Management (LM)

GY GY DATE--- -- __-______-__ II II s7 /L SITE NAME: CITY:--~~~&L%J _________ ------STATE:-&!=- "";::;:'KA;~+ jqjuM..wti current: ~~~--_~---___-~~~----~~--- Owner contacted q yes if yes, date contacted-- TYPE OF OPERATION ----------------- fl&search & Development 0 Production scale testing 0 Pilot Scale q Bench Scale Process 0 Theoretical Studies 0 s ample & Analysis IX Cny t;-.e i)r&&.h 0 Production 0 Disposal/Storage 0 Prime 0 Subcantractbr Cl Purchase Order 0 Facility Type 0 Manufacturing 0 University 0 Research Organization a Government Sponsored Facility q Other ~~~~~~~~~---~~------~ 0 Other information (i.e., coat + fixed fee, unit price, time 88 material, gtc) ------_ Contract/Purchase Order # ---------------------------------

3

Lesotho: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Lesotho: Energy Resources Lesotho: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":-29.5,"lon":28.25,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

4

Preparing Guyana's REDD+ Participation: Developing Capacities for  

Open Energy Info (EERE)

Guyana's REDD+ Participation: Developing Capacities for Guyana's REDD+ Participation: Developing Capacities for Monitoring, Reporting and Verification Jump to: navigation, search Name Preparing Guyana's REDD+ Participation: Developing Capacities for Monitoring, Reporting and Verification Agency/Company /Organization Guyana Forestry Commission, The Government of Norway Sector Land Focus Area Forestry Topics Implementation, Policies/deployment programs, Background analysis Resource Type Workshop, Guide/manual Website http://unfccc.int/files/method Country Guyana UN Region Latin America and the Caribbean References Preparing Guyana's REDD+ Participation[1] Overview "In this context, the overall goal of the activities reported here are to develop a road map for the establishment of a MRV system for REDD+

5

Preparing Guyana's REDD+ Participation: Developing Capacities...  

Open Energy Info (EERE)

AgencyCompany Organization Guyana Forestry Commission, The Government of Norway Sector Land Focus Area Forestry Topics Implementation, Policiesdeployment programs,...

6

Study in South Africa and Lesotho A Curriculum Development Project  

E-Print Network [OSTI]

Teachers Study in South Africa and Lesotho A Curriculum Development Project Integrating Visual Arts about the cultures and history of the Basotho people of southern Africa Participate in seminars-Hays award, graduate credit and/or CEUs Visit non-malarial and low risk areas in southern Africa and enjoy

Viola, Ronald

7

Guyana: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Guyana: Energy Resources Guyana: Energy Resources Jump to: navigation, search Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"TERRAIN","zoom":5,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"390px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":5,"lon":-59,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

8

Guyana-Caribbean Community (CARICOM) Sustainable Energy Roadmap and  

Open Energy Info (EERE)

Guyana-Caribbean Community (CARICOM) Sustainable Energy Roadmap and Guyana-Caribbean Community (CARICOM) Sustainable Energy Roadmap and Strategy Jump to: navigation, search Name Guyana-Caribbean Community (CARICOM) Sustainable Energy Roadmap and Strategy Agency/Company /Organization Inter-American Development Bank, World Watch Institute (WWI) Sector Climate, Energy Focus Area Renewable Energy, Economic Development, Energy Efficiency, Greenhouse Gas, Grid Assessment and Integration, Industry, People and Policy, Transportation Topics Background analysis, Baseline projection, Finance, GHG inventory, Implementation, Low emission development planning, -Roadmap, Market analysis, Policies/deployment programs, Resource assessment, Technology characterizations Program Start 2012 Program End 2012 Country Guyana South America

9

Guyana's Low Carbon Development Strategy | Open Energy Information  

Open Energy Info (EERE)

Guyana's Low Carbon Development Strategy Guyana's Low Carbon Development Strategy Jump to: navigation, search Tool Summary Name: Guyana's Low Carbon Development Strategy Agency/Company /Organization: Guyana Office of Climate Change Topics: Low emission development planning, Background analysis Resource Type: Publications, Case studies/examples Country: Guyana South America Coordinates: 4.860416°, -58.93018° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":4.860416,"lon":-58.93018,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

10

Guyana-Regional Implementation Plan for CARICOM's Climate Change  

Open Energy Info (EERE)

Guyana-Regional Implementation Plan for CARICOM's Climate Change Guyana-Regional Implementation Plan for CARICOM's Climate Change Resilience Framework Jump to: navigation, search Name Guyana-Regional Implementation Plan for CARICOM's Climate Change Resilience Framework Agency/Company /Organization Climate and Development Knowledge Network (CDKN), United Kingdom Department for International Development, Caribbean Community Climate Change Centre (CCCCC) Partner Caribbean Community Climate Change Centre (CCCCC), Caribbean Community Heads of State (CARICOM) Sector Climate, Energy, Land Topics Adaptation, Background analysis, Low emission development planning, -LEDS, Market analysis, Pathways analysis Website http://cdkn.org/project/planni Program Start 2009 Program End 2015 Country Guyana South America References CDKN-CARICOM-A Regional Implementation Plan for CARICOM's Regional Climate Change Resilience Framework[1]

11

NEGATION IN GUIANESE LOKONO/ARAWAK Guianese Lokono/Arawak is spoken in the lowlands of the Guianas, Guyana,  

E-Print Network [OSTI]

of the Guianas, Guyana, Suriname, the French Overseas department of Guiana, and Venezuelan Guayana. Some speakers

Boyer, Edmond

12

Loanwords in Kali'na, a Cariban language of French Guyana Odile Renault-Lescure  

E-Print Network [OSTI]

. It is constituted by the five Guianas: Venezuelan Guiana, (formerly British) Guyana, Suriname, French Guiana distributed in these countries. 11.141 live in Venezuela, 3000 in Guyana (Forte 2000), 3000 in Suriname (Boven% in Suriname; there is no precise data for French Guiana, but the rate is high). The Kali'na people speak

Boyer, Edmond

13

CHECKLIST OF THE PLANTS OF THE GUIANAS (Guyana, Surinam, French Guiana)  

E-Print Network [OSTI]

CHECKLIST OF THE PLANTS OF THE GUIANAS (Guyana, Surinam, French Guiana) 2nd Edition J. Boggan, V;#12;CHECKLIST OF THE PLANTS OF THE GUIANAS (Guyana, Surinam, French Guiana) 2nd Edition J. Boggan, V. Funk, C, Surinam, French Guiana) 2nd Edition 1st Edition: December 1992 2nd Edition: February 1997 Published

Mathis, Wayne N.

14

RenGyS | Open Energy Information  

Open Energy Info (EERE)

RenGyS RenGyS Jump to: navigation, search Name RenGyS Place Shanghai, China Sector Renewable Energy Product RenGyS is an independent renewable energy developer focused on the Chinese energy market. Coordinates 31.247709°, 121.472618° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":31.247709,"lon":121.472618,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

15

Guyana-ClimateWorks Low Carbon Growth Planning Support | Open Energy  

Open Energy Info (EERE)

Guyana-ClimateWorks Low Carbon Growth Planning Support Guyana-ClimateWorks Low Carbon Growth Planning Support Jump to: navigation, search Name Guyana-Low Carbon Growth Planning Support Agency/Company /Organization ClimateWorks, Project Catalyst, McKinsey and Company Sector Energy, Land Topics Background analysis, Low emission development planning, Policies/deployment programs Country Guyana South America References LCGP support[1] Low Carbon Growth Plans Advancing Good Practice, August 2009[2] Overview "Achieving development goals depends on enabling poorer countries to accelerate or maintain robust economic growth despite the disproportionate impacts of climate change which they face. The central challenge is to enable all countries to strengthen delivery of their own development visions and goals through low-carbon, climate-resilient, or 'climate

16

2008 Building Energy2008 Building Energyg gy Efficiency Standards  

E-Print Network [OSTI]

Buildings p , p g , Luminaire Power, etc. for Nonresidential Buildings 4 #12;What is New for 2008? R d l B ld What is New for 2008? R d l B ldResidential BuildingsResidential Buildings Mandatory Measures2008 Building Energy2008 Building Energyg gy Efficiency Standards g gy Efficiency Standardsfficie

17

2008 Residential2008 Residential Energy Plan ReviewEnergy Plan Reviewe gy la eviewe gy la eview  

E-Print Network [OSTI]

2008 Residential2008 Residential Energy Plan ReviewEnergy Plan Reviewe gy la eviewe gy la eview #12;2008 Residential Energy Plan2008 Residential Energy Plan Review ChecklistReview Checklist Simplification 2005 Residential Energy Plan Review2005 Residential Energy Plan Review 2005 and 2008 Nonresidential

18

First records of 10 bat species in Guyana and comments on diversity of bats in Iwokrama Forest  

E-Print Network [OSTI]

.g., Eisenberg, 1989) from mammals reported in Venezuela (e.g ., Handley, 1976) and Suriname (e.g., Husson, 1978). Two recent publications (Parker et al., 1993; Smith and Kerry, 1996) reported on separate, small single-site collections from Guyana.... In the Guianan subregion, this species was known by one specimen from Venezuela (McCarthy and Ochoa, 1991), two from Suriname (Husson, 1962; Williams et a/., 1983), and one from French Guiana (Simmons and Handley, 1998). Previously, the genus was considered...

Lim, Burton K.; Engstrom, Mark D.; Timm, Robert M.; Anderson, Robert P.; Watson, L. Cynthia

1999-12-01T23:59:59.000Z

19

"Diffusion of Innovation: Solar Oven Use in Lesotho (Africa)." Grundy, William and Roy Grundy. Advances in Solar Cooking: Proceedings of the 2nd International Conference on Solar Cooker Use and Technology. Shyam S. Nandwani, ed. July 12-15, 1994.  

E-Print Network [OSTI]

"Diffusion of Innovation: Solar Oven Use in Lesotho (Africa)." Grundy, William and Roy Grundy. Advances in Solar Cooking: Proceedings of the 2nd International Conference on Solar Cooker Use and Technology. Shyam S. Nandwani, ed. July 12-15, 1994. pp. 240-247. 1 DIFFUSION OF INNOVATION: SOLAR OVEN USE

Noble, William Stafford

20

Hypofractionated Radiation Therapy (66 Gy in 22 Fractions at 3 Gy per Fraction) for Favorable-Risk Prostate Cancer: Long-term Outcomes  

SciTech Connect (OSTI)

Purpose: To report long-term outcomes of low- and intermediate-risk prostate cancer patients treated with high-dose hypofractionated radiation therapy (HypoRT). Methods and Materials: Patients with low- and intermediate-risk prostate cancer were treated using 3-dimensional conformal radiation therapy to a dose of 66 Gy in 22 daily fractions of 3 Gy without hormonal therapy. A uniform 7-mm margin was created around the prostate for the planning target volume, and treatment was prescribed to the isocenter. Treatment was delivered using daily ultrasound image-guided radiation therapy. Common Terminology Criteria for Adverse Events, version 3.0, was used to prospectively score toxicity. Biochemical failure was defined as the nadir prostate-specific antigen level plus 2 ng/mL. Results: A total of 129 patients were treated between November 2002 and December 2005. With a median follow-up of 90 months, the 5- and 8-year actuarial biochemical control rates were 97% and 92%, respectively. The 5- and 8-year actuarial overall survival rates were 92% and 88%, respectively. Only 1 patient died from prostate cancer at 92 months after treatment, giving an 8-year actuarial cancer-specific survival of 98%. Radiation therapy was well tolerated, with 57% of patients not experiencing any acute gastrointestinal (GI) or genitourinary (GU) toxicity. For late toxicity, the worst grade ?2 rate for GI and GU toxicity was 27% and 33%, respectively. There was no grade >3 toxicity. At last follow-up, the rate of grade ?2 for both GI and GU toxicity was only 1.5%. Conclusions: Hypofractionation with 66 Gy in 22 fractions prescribed to the isocenter using 3-dimensional conformal radiation therapy produces excellent biochemical control rates, with moderate toxicity. However, this regimen cannot be extrapolated to the intensity modulated radiation therapy technique.

Patel, Nita [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada)] [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada); Faria, Sergio, E-mail: sergio.faria@muhc.mcgill.ca [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada)] [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada); Cury, Fabio; David, Marc; Duclos, Marie; Shenouda, George; Ruo, Russell; Souhami, Luis [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada)] [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada)

2013-07-01T23:59:59.000Z

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

Figure 1:Energy Consumption in USg gy p 1E Roberts, Energy in US  

E-Print Network [OSTI]

Fluctuations and Global Events 14E Roberts, Energy in US DOE: 2011 Vehicle Technology Market Report #12;Figure 15: Effect of Oil Prices on US Economy 15E Roberts, Energy in US DOE: 2011 Vehicle Technology MarketFigure 1:Energy Consumption in USg gy p 2008 1E Roberts, Energy in US Source: www.eia.gov #12

Sutton, Michael

22

L NATJDNAL BNII?GY TiEHMOLOGY LIBOCAYOlY V.0. DEPARTMENT OF  

Broader source: Energy.gov (indexed) [DOE]

NATJDNAL BNII?GY TiEHMOLOGY LIBOCAYOlY NATJDNAL BNII?GY TiEHMOLOGY LIBOCAYOlY V.0. DEPARTMENT OF Albany, OR .Morgantown, WV s Plllsburgh, PA @ENERGY Januaty 27,201 1 MEMORANDUM FOR MAXI( J. MATARRESE DIRECTOR, OFFICE OF ENVIRONMENT, SECURITY, SAFETY AND HEALTH l c ? FROM: \ DIVISION SUBJECT: Amual Natioilal Enviro~l~neiltal Policy Act (NEPA) Planning Summary for 2011 The attached documents conlprise the 201 1 Allnual NEPA Planning Summary for the National Enexgy TechnologyLaboratory. The infoimation is presented according to the guidance and fonnats provided by DOE'SNEPA office. As required by the Order 451.1B, the Annual NEPA Pla~lning Siimmary will be made available to the public. Please contact nte for any additional info~.mation regarding r\lETL,'s NEPA plans. Distribution: A. Chlgini

23

ULTRACAM photometry of the eclipsing cataclysmic variables GY Cnc, IR Com and HT Cas  

E-Print Network [OSTI]

We present high-speed, three-colour photometry of the eclipsing cataclysmic variables GY Cnc, IR Com and HT Cas. We find that the sharp eclipses in GY Cnc and IR Com are due to eclipses of the white dwarf. There is some evidence for a bright spot on the edge of the accretion disc in GY Cnc, but not in IR Com. Eclipse mapping of HT Cas is presented which shows changes in the structure of the quiescent accretion disc. Observations in 2002 show the accretion disc to be invisible except for the presence of a bright spot at the disc edge. 2003 observations, however, clearly show a bright inner disc and the bright spot to be much fainter than in 2002. Although no outburst was associated with either set of quiescent observations, the system was ~0.6 mJy brighter in 2003, mainly due to the enhanced emission from the inner disc. We propose that these changes are due to variations in the mass transfer rate from the secondary star and through the disc. The disc colours indicate that it is optically thin in both its inner and outer regions. We estimate the white dwarf temperature of HT Cas to be 15 000 +/- 1000 K in 2002 and 14 000 +/- 1000 K in 2003.

W. J. Feline; V. S. Dhillon; T. R. Marsh; C. A. Watson; S. P. Littlefair

2005-10-14T23:59:59.000Z

24

GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIPIENT:County of Escambia. FL  

Broader source: Energy.gov (indexed) [DOE]

, , ... ~. u.s. DEPAR n-IENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIPIENT:County of Escambia. FL PROJECT TITLE: Road Prison Geothermal Earth Coupled HVAC Upgrade Page 1 of2 STATE: FL Funding Opportunity Announcement Numbtr Procurement Instrument Number NEPA Control Number CID Number DE-FOA-OOOOO13 DE-EEOOOO764.oo1 0 Based on my review of the information concerning the proposed action. as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination; ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply

25

U.S. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION  

Broader source: Energy.gov (indexed) [DOE]

ENER ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION Page 1 of2 RECIPI[NT:Oklahoma Municipal Powwer Authority STATE: OK PROJECT TITLE: OKLAHOMA SEP ARRA· OMPA Large Systems Request AI Funding Opportunity Announcement Number Proc:urtmtnt Instrument Number NEPA Control Number CIO Number DE-FOA-OOOOO52 DE·EE0133 GF0-000133-062 Based on my review orlbe information concerning the proposed action, as NEPA Compliance Officer (authoriHd UDder DOE Order 451.IA), I have made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: B5.19 Ground source heat pumps The installation, mocMcabon, operation and removal of commercially available smallscale ground source heat pumps to support operatloos In single facilities (suCh as a school Of community center) or contiguous facilities

26

DEPARTMENT OF ENER GY EERE PROJECT M~~AGEMENT CE"lTER  

Broader source: Energy.gov (indexed) [DOE]

ENER ENER GY EERE PROJECT M~~AGEMENT CE"lTER NEPA DETERMINATION RECIPIENT: Youngstown State University PROJECT TITLE: Center for Efficiency in Sustainable Energy Systems Page 1 of2 STATE : OH Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-EEOOOO366 GFQ-10-143 0 Based on my review arlhe information concerning tbe proposed action, as NEPA Compliance Offictr (authorized under DOE O rder 4SI.lA), I have made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: A9 Infonnation galhenng (including, but oot limited to, literature surveys, inventones, audits), data analYSIs (induding computer modeling), document preparation (such as cooceptual design or feasibility studies, analytical energy supply

27

T OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERlIIINATION  

Broader source: Energy.gov (indexed) [DOE]

.0I0J. .0I0J. u .s . DEPARnvIEN T OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERlIIINATION RECIPIENT:Town of Irmo PROJECT TITLE: Irma Charing Cross Sidewalk Project ARRA·EECBG Page I of2 STATE: SC Funding Opportunity Announcement Number Procur ement Instrument Number NEPA Control Number CID Number EEOOOO950/000 DE-EEOO00950 0 Based OD my review ortbe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45I.1A), I have made the following determination : ex, EA, EIS APPENDIX AND NUMBER: Description: 8 5.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical

28

U.S. DEPARTI\IENT OF ENER GY EE RE PROJECT MANAG EMENT CENT  

Broader source: Energy.gov (indexed) [DOE]

ENER ENER GY EE RE PROJECT MANAG EMENT CENT ER NEPA DETERl\lINATION RECIPIENT:AA Solar Products PROJECT TITLE: AA Solar Tracking System Factory Page 1 of2 STATE: IL Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number em Number DE-FOA-OOOOOS2 EEOOOO119 GFO-1O-331 EE119 Based on my review of the information concerning the proposed action, as NEPA Compliance Omen (authorized under DOE Order 451.1A), I ban made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description : 81 .31 Relocation of machinery and equipment, such as analytical laboratory apparatus, electronic hardware, maintenance equipment, and health and safety equipment, including minor construction necessary for removal and installation, where uses of the relocated items will be similar to their former uses and consistent with the general missions of the

29

P,OU)JI U.S. DEPARTIIIEN T OF ENER GY EERE PROJECT MANAGEMENT CENTER  

Broader source: Energy.gov (indexed) [DOE]

OU)JI OU)JI U.S. DEPARTIIIEN T OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DE TERlVlINATION RECIPIENT:City of St Petersburg PROJECT TITLE: EECBG Gir( of St. Petersburg· Commercial Energy Efficiency Audit Program Page 1 0[2 STATE: FL Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000013 DE-EE00007BO 0 Based on my review or the infonnation concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45t.IA), I have made th l~ (ollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited 10, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply

30

RECIPIENT:NREL U.S. DEPARTUENT OF ENER GY EERE PROJECT M ANAGEMENT CENT  

Broader source: Energy.gov (indexed) [DOE]

DEPARTUENT OF ENER DEPARTUENT OF ENER GY EERE PROJECT M ANAGEMENT CENT ER NEPA DETERl\IINATION PROJECT TITLE: NREL Bus Service to Off-Site Parking lot; NREL Tracking No. 10-016 Page 1 of2 STATE: CO FUnding Opportunity Announcement Number Procurcmtntlnstrumtnt Number NEPA Control Number CIO Number NREl-10-016 G01 0337 Based on my review orlhe information concerning the proposed action, as N[PA Compliance Offi<:er (authoriud under DOE Order 4Sl.IA), I have made the following determination: ex, EA, [IS APPENDIX AND NUMBER: Description: DOE/EA· 1440-5·1 .7 Final Supplement to Final Site-Wide Environmental Assessment of the National Renewable Energy Laboratory's (NREL) South Table Mountain Complex (May 2008) Transfer, lease, disposition , or acquisition of interests in personal property (e.g., equipment and materials) or

31

T OF ENER GY EERE PROJECT MAN Au EMENT CENTER NEPA DE TERl\IINATION  

Broader source: Energy.gov (indexed) [DOE]

IEN IEN T OF ENER GY EERE PROJECT MAN Au EMENT CENTER NEPA DE TERl\IINATION RECIPIENT:$acramenio Municipal Utility District PROJECT TITLE : CRED - SMUD: Van Warmerdam Dairy Page 1 of2 STATE: CA Funding Opportunity Announcement Number DE-FOA-OOOO122 Procurement Instrument Number DE-EE0003070 NEPA Control Number CID Number o Based on my review of the info r mation concerning the proposed action, as NEPA Compliance Officer (authorized undu DOE Order 451.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including , but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling). document preparation (such as conceptual design or feasibility studies, analytical energy supply

32

RECIPIENT:Louisvilie Metro u.s. DEPARTMENT OF ENER GY EE RE PROJECT MANAG  

Broader source: Energy.gov (indexed) [DOE]

Louisvilie Metro Louisvilie Metro u.s. DEPARTMENT OF ENER GY EE RE PROJECT MANAG EM ENT CENTER NEPA DETERl\lINATION PROJECT TITLE: Green Jobs Revolving Loan Fund Page 1 01'2 STATE: KY Funding Opportunity Announcement Number 09EE003966 Procurement Instrument Number DE-EEOOOO729.001 NEPA Control Number em Number o Based on my review orthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase tI1e indoor concentrations of potentially harmful substances. These actions may involve financial and technical

33

U.S. DEPARTI'vIENT OF ENER GY EERE PROJECT MANAGEMENT CENTER  

Broader source: Energy.gov (indexed) [DOE]

DEPARTI'vIENT OF ENER DEPARTI'vIENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DEIER1\IINATION RECIPIENT:City of Fort Wayne Page 1 of2 STATE: IN PROJECf TITLE: EECBG Fort Wayne , Indiana ARRA-EECBG (S) (SOW for Revised Activity #1 and Activity #3) Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-OOOOO13 DE-EEOO00825 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination: ex, EA, EIS APPENDIX AND NUMBER: Description: B5.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical

34

u.s. DEPARUvlllNT OF ENER GY EE RE PROJECT MANAG EM ENT CENTER  

Broader source: Energy.gov (indexed) [DOE]

DEPARUvlllNT OF ENER DEPARUvlllNT OF ENER GY EE RE PROJECT MANAG EM ENT CENTER NEPA DETERl\IlNATION RECIPIENT:MI Department of Energy, Labor & Economic Growth PROJECT TITL E : SEP - Green Chemistry - CEAM Phase 3 - KTM Industries Page 1 oI2 STATE: Ml Funding Opportunity Announcement Number DE-FOA-OOOOO52 Procurement Instrument Number DE-EEOOOO166 NEPA Control Number em Num ber GFO-OOOO166-032 GOO Based on my review of the information concerning the proposed ac tion, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination : ex, EA, [IS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical

35

GY EE RE PROJECT MANAG EMENT CENTER NEPA DETERlvIINATION  

Broader source: Energy.gov (indexed) [DOE]

n-IENT OF ENER n-IENT OF ENER GY EE RE PROJECT MANAG EMENT CENTER NEPA DETERlvIINATION Page 1 01'2 RECIPIENT:COUNTY OF MONTEREY, DEPARTMENT OF PUBLIC WORKS STATE: CO PROJECf TITLE: RECOVERY ACT: COUNTY OF MONTEREY, CA ENERGY EFFICI ENCY AND CONSERVATION BLOCK GRANT Funding Opportunity Announcement Numi>t'r Procurement Instrumcnt Number NEPA Control Number em Number DE-FOA-OOOOO 13 OE-EEOOOO897.001 0 Based on my review of the inronnation concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the (ollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: B5.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financia

36

RECIPIENT:MRC Polymers U.S. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMDIT  

Broader source: Energy.gov (indexed) [DOE]

MRC Polymers MRC Polymers U.S. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMDIT CENTER NEPA DETERMrNATION PROJECf TITLE: MRC PET Recycling Facility Page 1 of2 STATE: IL Funding Opportunity Announcement Numbu Procurement Instrument Number NEPA Control Number elD Number DE-FOA-OCX)()()52 EEOOOO119 EE119 Based on my review of the inronnation conenning the proposed action, as NEPA Compliance Offker (authorized undu DOE Order 45I.1A), I have made the rollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners

37

U.S. DEPARTU E NT OF ENER GY EERE PROJECT MANAGEM ENT CENTER  

Broader source: Energy.gov (indexed) [DOE]

DEPARTU DEPARTU E NT OF ENER GY EERE PROJECT MANAGEM ENT CENTER NEPA DETERl\lINATION RECIPIENT:lllinois Department of Commerce & Economic Opportunity PROJECT TITLE: Joliet Junior College; Joliet Junior College Facilities Building Page 1 of2 STATE: IL Funding Opportunity Announcement Numbtr Procurement Instrument Number NEPA Control Number CID Number DE-FOA-OOOOOS2 EE119 Based on my review orlbe information concerning tbe proposed action, 8S NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following detennination: ex, EA, [IS APPENDIX AND NUMBER: Description : 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical

38

u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION  

Broader source: Energy.gov (indexed) [DOE]

Peoria Peoria u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION PROJECT TITLE: Storage Tanks and Dispensers for E85 and Biodiesel (IL) Page 1 of2 STATE: Il Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE·EE

39

u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION  

Broader source: Energy.gov (indexed) [DOE]

U)~) U)~) u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIPIENT:Arizona Governor's Office of Energy Policy PROJECT TITLE : Arizona Rooftop Challenge (ARC) Page 1 of2 STATE: AZ Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number cm Number DE-FOA-Q000549 DE-EEOOO5693 GFO-OOOO5693-001 0 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 45 1.1A),1 have made the following determination: CX, EA, EIS APPENDIX AND NUMBE R: Description: A 11 Technical advice and assistance to organizations Technica! advice and planning assistance to international , national, state, and local organizations. A9 Information gathering, analysis, and dissemination

40

U.S. DEPARTlVIENT OF ENER GY EERE PROJECT M ANAGEM ENT CENTER  

Broader source: Energy.gov (indexed) [DOE]

0I.0 ~ \ 0I.0 ~ \ U.S. DEPARTlVIENT OF ENER GY EERE PROJECT M ANAGEM ENT CENTER NEPA DETERMINATION RECIPIENT:ldaho Office of Energy Resources - City of Nampa PROJECT TITLE: SEP ARRA REEZ Nampa Wastewater Treatment Plant Biogas Boiler Project Page 1 of2 STATE: 10 Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number elD Number DE-FOA-OOOOOS2 DE-EEOO0141 GFO-09-156-007 0 Based on my review orlhe information concerning tbe proposed action, as NEPA Compliance Officer (author ized under DOE Order 4SI. IA), I have made the (ollowing determination: ex, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do nol increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

U.S. DEPARTIlIENT OF ENER GY EERE PROJECT MANAGEMENT CENTER  

Broader source: Energy.gov (indexed) [DOE]

ENER ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION RECIPIENT: Hi-Q Geophysical Inc Page I of2 STATE: NV PROJECT TITLE: Phase 3 - Seismic Fracture Characterization Methodologies for Enhanced Geothermal Systems .' unding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-PS36-08G09800B DE-FG36-08G018191 GFO-G018191-003 G018191 Based on my review of the information concerning the proposed action, as NEP A Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: ex. EA, EIS APPENDIX AND NUMBER: Description: A9 Information gathering (including, but not limited to, literature surveys, inventories, audits), data analysis (including computer modeling), document preparation (such as conceptual design or feasibility studies, analytical energy supply

42

Guyana Francesa 1. Introduction  

E-Print Network [OSTI]

dense et le reste de mangroves, savanes, forêts secondaires et cultures sur la côte, entre le Surinam Maroni . Là, un bac permet de passer le fleuve Maroni, et de gagner Paramaribo, capitale du Surinam. A l particulièrement soutenue par l'immigration en provenance du Surinam. 3. Données politiques et régionales et

Paris-Sud XI, Université de

43

eGY-Africa: Addressing the Digital Divide for Science in Africa  

SciTech Connect (OSTI)

Adoption of information and communication technologies and access to the Internet is expanding in Africa, but because of the rapid growth elsewhere, a Digital Divide between Africa and the rest of the world exists, and the gap is growing. In many sub-Saharan African countries, education and research sector suffers some of the worst deficiencies in access to the Internet, despite progress in development of NRENs - National Research and Education (cyber) Networks. By contrast, it is widely acknowledged in policy statements from the African Union, the UN, and others that strength in this very sector provides the key to meeting and sustaining Millennium Development Goals. Developed countries with effective cyber-capabilities proclaim the benefits to rich and poor alike arising from the Information Revolution. This is but a dream for many scientists in African institutions. As the world of science becomes increasingly Internet-dependent, so they become increasingly isolated. eGY-Africa is a bottom-up initiative by African scientists and their collaborators to try to reduce this Digital Divide by a campaign of advocacy for better institutional facilities. Four approaches are being taken. The present status of Internet services, problems, and plans are being mapped via a combination of direct measurement of Internet performance (the PingER Project) and a questionnaire-based survey. Information is being gathered on policy statements and initiatives aimed at reducing the Digital Divide, which can be used for arguing the case for better Internet facilities. Groups of concerned scientists are being formed at the national, regional levels in Africa, building on existing networks as much as possible. Opinion in the international science community is being mobilized. Finally, and perhaps most important of all, eGY-Africa is seeking to engage with the many other programs, initiatives, and bodies that share the goal of reducing the Digital Divide - either as a direct policy objective, or indirectly as a means to an end, such as the development of an indigenous capability in science and technology for national development. The expectation is that informed opinion from the scientific community at the institutional, national, and international levels can be used to influence the decision makers and donors who are in a position to deliver better Internet capabilities.

Barton, C.E.; /Australian Natl. U., Canberra; Amory-Mazaudier, C.; /Lab.Phys.Plasmas, Saint Maur des Fosses; Barry, B.; /Assoc.African Univ., Accra; Chukwuma; /Olabisi Onabanjo U.; Cottrell, R.L.; /SLAC; Kalim, U.; /Pakistan Natl. U.; Mebrahtu, A.; /Mekelle U.; Petitdidier, M.; /Lab. d'Atmos., Velizy; Rabiu, B.; /Federal Tech. U., Akure; Reeves, C.; /Earthworks bv, Delft; ,

2010-06-16T23:59:59.000Z

44

Inference of Causal Networks from Time-course Transcription Data in Response to a2 Gy Challenge Dose of Ionizing Radiation with or without a 10 cGy Priming Dose  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Causal Networks from Time-course Transcription Data in Response to a Causal Networks from Time-course Transcription Data in Response to a 2 Gy Challenge Dose of Ionizing Radiation with or without a 10 cGy Priming Dose Kai Zhang, Ju Han, Torsten Groesser, Priscilla Cooper, and Bahram Parvin Lawrence Berkeley National Laboratory Goal: To elucidate temporal-dependent gene templates, causal networks, and underlying biological processes that can be inferred in response to a 10 cGy priming dose with or without a later higher challenged dose. Background and significance: Mechanistic inference of regulatory network can provide new insights into radiation systems biology. The main challenge continues to be high dimensionality of data, complex network architecture and limited knowledge of biological processes.

45

Set To Save *and* AB 811Set To Save and AB 811 Energy Independence Program (EIP)gy p g ( )  

E-Print Network [OSTI]

Set To Save *and* AB 811Set To Save and AB 811 Energy Independence Program (EIP)gy p g ( ) Lessons Learned (IOW How to avoid scar tissue) April 24, 2009 #12;Program StatusProgram Status · Set to Save goal: Save 30% citywide in 5 years. · 30% savings = 214 7 M kWh; 48 748 kW peak demand30% savings 214.7 M k

Kammen, Daniel M.

46

Thermoluminescence (TL) Analysis and Fading Studies of Naturally Occurring Salt Irradiated by 500 mGy Gamma Rays  

SciTech Connect (OSTI)

The aim of the present study was to investigate the potential of the naturally occurring salt for the dosimetry purposes, using TL. The fine powder samples (20 mg) were irradiated by {gamma}- rays from 500 mGy to 2500 mGy by using Theratron-780C Cobalt-60 source, however, this paper discusses about 500 mGy only. The TL glow curve peak parameters were studied by using Chen's peak shape equation. TL glow curves were compared with fitted curves using glow curve deconvolution (GCD) method by using Kitis expression. The kinetic parameter values (E, b and s) so calculated, are in good agreement with those available in literature. The calculated energy values were also verified by using various heating rate (VHR) method. {chi}{sup 2} test and figure of merit (FOM) calculation was done to accept the goodness of fit between the curves. Fading studies of the sample showed a good fitting between the curves. The analysis suggests that natural salt should be considered for dosimetry purposes.

Tiwari, Ramesh Chandra; Pau, Kham Suan [Department of Physics, Mizoram University: Tanhril Campus, Aizawl-796004, Mizoram (India)

2011-10-20T23:59:59.000Z

47

Bovine babesiosis in Guyana: a comparison of the indirect fluorescent antibody (IFA) and complement-fixation (CF) tests in determining the prevalence of Babesia bigemina and Babesia bovis infections  

E-Print Network [OSTI]

BOVINE BABESIOSIS IN GUYANA: A COMPARISON OF THE INDIREC T FLUORESCENT ANTIBODY (IFA) AND COMPLEMENT-FIXATION (CF) TESTS IN DETERMINING THE PREVALENCF. OF BABESIA BIGEMINA AND BABESIA BOVIS INFECTIONS A Thesis by LENNOX MORTIMER APPLEWHAITE... FLUORESCENT ANTIBODY (IFA) AND COMPLE1YIENT-FIXATION (CF ) TES TS IN DETERMINING THE PREVAI ENCE OF BABES IA B1GEMINA AND BABESIA BOVIS INFECTIONS A Thesis by LENNOX MORTIMER APPLErJHAITE Appro red as to sty1e and content by: (Chairman of Committee...

Applewhaite, Lennox Mortimer

2012-06-07T23:59:59.000Z

48

RECIPI ENT;Kitsap County u.s. DEPARTlvIENT OF ENER GY EERE PROJECT MANAGEMENT CENT  

Broader source: Energy.gov (indexed) [DOE]

ENT;Kitsap County ENT;Kitsap County u.s. DEPARTlvIENT OF ENER GY EERE PROJECT MANAGEMENT CENT ER NEPA DETERlVITNATION PROJECT TITLE: EECBG * Energy Service Corps (SOW) Page 1 01'2 STATE: WA Funding Opportunity Announcem ent Number DE-FOA..QOOOO13 Procurement Instrument Number NEPA Control Number CID Number DE-EEOOOO853 '1t;..o -6ObC>g5~- 0(.::)\ EE81128 Based on my review of the information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the foUowing determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Aclions 10 conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase Ihe indoor concentrations of potentially harmful substances, These actions may involve financial and technical

49

QUARTER SH OR T-T ER M EN ER GY OU TL OO K QUAR TERL Y PROJ  

Gasoline and Diesel Fuel Update (EIA)

1 1 2 QUARTER SH OR T-T ER M EN ER GY OU TL OO K QUAR TERL Y PROJ ECTIO NS ENERGY INFORMA TION ADMINIST RATION May 1991 This publication may be purchased from the Superintendent of Documents, U.S. Government Printing Office. Purchasing in formation for this or other Energy Information Administration (EIA) publications may be obtained from the Government Printing Office or ElA's National Energy Information Center. Questions on energy statistics should be directed to the Center by mail, telephone, or telecommunications device for the hearing impaired. Addresses, telephone numbers, and hours are as follows: National Energy Information Center, El-231 Energy Information Administration Forrestal Building, Room 1F-048 Washington, DC 20585 (202) 586-8800 Telecommunications Device for the

50

Gene expression analysis of human primary prostate epithelial and fibroblast cell cultures to an acute dose of 10cGy  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

26, 2011 26, 2011 Gene expression analysis of human primary prostate epithelial and fibroblast cell cultures to an acute dose of 10cGy J. Tyson McDonald, Julia Fox, Heather Szelag, Annie Kang, Heiko Enderling, Peter Nowd, Douglas Scheinder, Giannoula Lakka Klement, Ingolf Tuerk, and Lynn Hlatky Center of Cancer Systems Biology, Steward St. Elizabeth's Medical Center, 736 Cambridge Street, Boston, Massachusetts 02135. Primary tissue represents a better model for studies than immortalized cell lines that are adapted

51

Alanine-EPR dosimetry for measurements of ionizing radiation absorbed doses in the range 0.5-10 kGy  

E-Print Network [OSTI]

The usefulness of two, easy accessible alanine dosimeters (ALANPOL from IChTJ and foil dosimeter from Gamma Service, Radeberg, Germany) to radiation dose measurement in the range of 0.5-10 kGy, were investigated. In both cases, the result of the test was positive. The foil dosemeter from Gamma Service is recommended for dose distribution measurements in fantoms or products, ALANPOL - for routine measurements. The EPR-alanine method based on the described dosimeters can be successfully used, among others, in the technology of radiation protection of food.

Peimel-Stuglik, Z

2001-01-01T23:59:59.000Z

52

External Beam Accelerated Partial-Breast Irradiation Using 32 Gy in 8 Twice-Daily Fractions: 5-Year Results of a Prospective Study  

SciTech Connect (OSTI)

Purpose: External beam accelerated partial breast irradiation (APBI) is an increasingly popular technique for treatment of patients with early stage breast cancer following breast-conserving surgery. Here we present 5-year results of a prospective trial. Methods and Materials: From October 2003 through November 2005, 98 evaluable patients with stage I breast cancer were enrolled in the first dose step (32 Gy delivered in 8 twice-daily fractions) of a prospective, multi-institutional, dose escalation clinical trial of 3-dimensional conformal external beam APBI (3D-APBI). Median age was 61 years; median tumor size was 0.8 cm; 89% of tumors were estrogen receptor positive; 10% had a triple-negative phenotype; and 1% had a HER-2-positive subtype. Median follow-up was 71 months (range, 2-88 months; interquartile range, 64-75 months). Results: Five patients developed ipsilateral breast tumor recurrence (IBTR), for a 5-year actuarial IBTR rate of 5% (95% confidence interval [CI], 1%-10%). Three of these cases occurred in patients with triple-negative disease and 2 in non-triple-negative patients, for 5-year actuarial IBTR rates of 33% (95% CI, 0%-57%) and 2% (95% CI, 0%-6%; P<.0001), respectively. On multivariable analysis, triple-negative phenotype was the only predictor of IBTR, with borderline statistical significance after adjusting for tumor grade (P=.0537). Conclusions: Overall outcomes were excellent, particularly for patients with estrogen receptor-positive disease. Patients in this study with triple-negative breast cancer had a significantly higher IBTR rate than patients with other receptor phenotypes when treated with 3D-APBI. Larger, prospective 3D-APBI clinical trials should continue to evaluate the effect of hormone receptor phenotype on IBTR rates.

Pashtan, Itai M. [Harvard Radiation Oncology Program, Boston, Massachusetts (United States)] [Harvard Radiation Oncology Program, Boston, Massachusetts (United States); Recht, Abram [Department of Radiation Oncology, Beth Israel Deaconess Medical Center, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Beth Israel Deaconess Medical Center, Boston, Massachusetts (United States); Ancukiewicz, Marek [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); Brachtel, Elena [Department of Pathology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Pathology, Massachusetts General Hospital, Boston, Massachusetts (United States); Abi-Raad, Rita F. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); D'Alessandro, Helen A. [Department of Radiology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiology, Massachusetts General Hospital, Boston, Massachusetts (United States); Levy, Antonin; Wo, Jennifer Y. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); Hirsch, Ariel E. [Department of Radiation Oncology, Boston Medical Center, Boston University School of Medicine, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Boston Medical Center, Boston University School of Medicine, Boston, Massachusetts (United States); Kachnic, Lisa A. [Department of Surgery, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Surgery, Massachusetts General Hospital, Boston, Massachusetts (United States); Goldberg, Saveli [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); Specht, Michelle; Gadd, Michelle; Smith, Barbara L. [Department of Surgery, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Surgery, Massachusetts General Hospital, Boston, Massachusetts (United States); Powell, Simon N. [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States); Taghian, Alphonse G., E-mail: ataghian@partners.org [Department of Radiation Oncology, Massachusetts General Hospital, Boston, Massachusetts (United States)

2012-11-01T23:59:59.000Z

53

E F F I C I E N CY A N D R E N E W A B L E E N E R GY D IV I S I O N CALIFORNIA ENERGY COMMISSION  

E-Print Network [OSTI]

. If this system is not installed properly, it not only wastes energy, but money as well. To prevent this, do two of the conditioned air into the attic or crawl space. Leaky ducts waste energy and make energy bills higher thanBLUEPRI NT E F F I C I E N CY A N D R E N E W A B L E E N E R GY D IV I S I O N CALIFORNIA ENERGY

54

Slide23 | OSTI, US Dept of Energy, Office of Scientific and Technical  

Office of Scientific and Technical Information (OSTI)

Slide23 Slide23 Slide23 Developing Country Access Afghanistan Guatemala Nigeria Albania Guinea Pakistan Algeria Guinea-Bissau Palestinian Territories (West Bank/ Gaza) Angola Guyana Papua New Guinea Armenia Haiti Paraguay Azerbaijan Honduras Peru Bangladesh Indonesia Philippines Belize Iraq Rwanda Benin Jordan Samoa Bhutan Kenya Sao Tome and Principe Bolivia Kiribati Senegal Burkina Faso Kyrgyzstan Sierra Leone Burundi Lao People's Democratic Republic Solomon Islands Cambodia Lesotho Somalia Cameroon Liberia Sri Lanka Cape Verde Macedonia, The Former Yugoslav Republic of Swaziland Central African Republic Madagascar Tajikistan Chad Malawi Tanzania, United Republic of Colombia Maldives Thailand Comoros Mali Timor-Leste Congo Marshall Islands Togo Congo, The Democratic Republic of Mauritania Tonga

55

Diciembre 2012 Cuando el manglar  

E-Print Network [OSTI]

cientifica Actualité scientifique Los manglares de las Guyanas --Guyana francesa, Surinam y Guyana--, que se

56

Diversification of the Core Bromelioids with a focus on the genus Aechmea: phylogeny, morphology, and climate tolerance  

E-Print Network [OSTI]

French Guiana, Guyana, Suriname, 15) Caribbean, 16)14) Venezuela, Guyane, Guyana, Suriname, 15) Caribbean, 16)

Sass, Chodon

2011-01-01T23:59:59.000Z

57

School of Art & Design Postgraduate International Scholarship Opportunities 2014 / 15  

E-Print Network [OSTI]

, Venezuela, Guyana, Suriname, French Guyana, Brazil, Ecuador, Peru, Bolivia, Paraguay, Uruguay, Argentina

Evans, Paul

58

School of Architecture, Design and the Built Environment Postgraduate International Scholarship Opportunities 2014 / 15  

E-Print Network [OSTI]

, Venezuela, Guyana, Suriname, French Guyana, Brazil, Ecuador, Peru, Bolivia, Paraguay, Uruguay, Argentina

Evans, Paul

59

December 2012 When mangroves  

E-Print Network [OSTI]

cientifica Actualité scientifique The mangrove forests in the Guyanas (French Guiana, Surinam and Guyana

60

Reply to comment | OSTI, US Dept of Energy, Office of Scientific and  

Office of Scientific and Technical Information (OSTI)

Reply to comment Reply to comment Slide23 Submitted by gibsone on Fri, 2013-08-30 06:22 FY2011-hitson Slide23 Developing Country Access Afghanistan Guatemala Nigeria Albania Guinea Pakistan Algeria Guinea-Bissau Palestinian Territories (West Bank/ Gaza) Angola Guyana Papua New Guinea Armenia Haiti Paraguay Azerbaijan Honduras Peru Bangladesh Indonesia Philippines Belize Iraq Rwanda Benin Jordan Samoa Bhutan Kenya Sao Tome and Principe Bolivia Kiribati Senegal Burkina Faso Kyrgyzstan Sierra Leone Burundi Lao People's Democratic Republic Solomon Islands Cambodia Lesotho Somalia Cameroon Liberia Sri Lanka Cape Verde Macedonia, The Former Yugoslav Republic of Swaziland Central African Republic Madagascar Tajikistan Chad Malawi Tanzania, United Republic of Colombia Maldives Thailand Comoros Mali Timor-Leste

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

Impact of Pacific and Atlantic sea surface temperatures on interannual and decadal variations of GRACE land water storage in tropical South America  

E-Print Network [OSTI]

in French Guyana, Suriname, in the Essequibo River Basin (areas (coastal Guyana and Suriname, Magdalena River basin,

de Linage, Caroline; Kim, Hyungjun; Famiglietti, James S; Yu, Jin-Yi

2013-01-01T23:59:59.000Z

62

u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION  

Broader source: Energy.gov (indexed) [DOE]

RECIPIENT: RECIPIENT: Govemor's Office of Energy Independence and Security PROJECT TITL.E: State Energy Program Year 2012 Fonnula Grant Page 1 of2 STATE: ME Funding Opportunity Announcement Number Procurement Instrument Number N[PA Control Number CID Number DE-FOA-0000643 R130272 GF0-0130272-OO1 Based on my ~view oftht information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the following determination: ex, EA, tiS APPENDIX AND NUMBER: Description: A11 Technical advice and assistance to organizations A9 Information gathering, analysis, and dissemination Rational for determination: Technical adVice and planning assistance to International. nabonal state and local organtzatlons InfOOTlaboo gathenng (indudlng. but not limited to, literature surveys InventOrieS. Site visits and

63

u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION  

Broader source: Energy.gov (indexed) [DOE]

Page 1 of2 Page 1 of2 RECIPIENT:Hudson Valley Community College sub: Mohaw k Valley Community College STATE: NY PROJECT TITLE: Northeast Photovaltaic Regional Training Provider Funding Opportunity Announc~mtnl Number Procu~mtnt Instrument Number NEPA Control Number CID Number DE-EE-O:Xl2087 OE-EEOOO2087 GF().{)()()2087-OO7 Based on my review orthe inform ation concerning the proPOSH action, as NEPA Compliance Officer (authorized under DOE Order 451.IA), I have made the (oUowinli': determination: ex, EA, EIS APPENDIX AND NUMBER: Description: A91nfonnation Information gathering (indudlng, but not limited to, literature surveys, Inventones, site Visits, and audits), gathering, analysis, data analysis (including, but not limited to, computer modeling), document preparation (induding, but

64

u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA DETERMINATION  

Broader source: Energy.gov (indexed) [DOE]

REClPIENT:Optony Inc. REClPIENT:Optony Inc. PROJECf Southwest Solar Transformation Initiative TITLE: Page 1 of2 STATE: CA Funding Opportunity Announcement Number Procuremrnt Instrument Number NEPA Control Number CID Number DOE·FQA.Q()()()549 DE-EEOOO5682 GF0-0005682-OO1 0 Based on my review of the information concerning the proposw action, as NEPA Compliance Offic:er (authorized under DOE Order 451.IA),1 have made the follOwing determination : ex, EA, [IS APPENDIX AND NUMBER: Ocscription : A11 Technical advice a nd as s istance to organizations Technical advice and planning assistance to international, national, state, and local organizabons A91nf ormation gathering. analysis, and dissemination Informabon gathenng (indudlng, but not limited 10, literature surveys, inventories, site VISits, and audits), data analysis

65

Autumn 2014 YoRK'S neW ReSeARCH StRAteGY  

E-Print Network [OSTI]

; Environmental Sustainability and Resilience; Health and Wellbeing; Justice and Equality; Risk, Evidence College ­ 4 a new student community Transforming the treatment 5 of cancer patients Pigs' unhappy balloon

66

ENE-.R:GY ORNL/Sub/80-61601/2 Research and Development of  

E-Print Network [OSTI]

~Supermarket Refrigeration Systems .~~~~E ~Volume 2 -- &i Supplementary Laboratory Testing William M. Toscano ENERGY-EFFICIENT SUPERMARKET REFRIGERATION SYSTEMS VOLUME 2 SUPPLEMENTAL LABORATORY TESTING JUNE, 1983 and development of a new, highly energy-efficient, supermarket refrigeration system: a. Investigate

Oak Ridge National Laboratory

67

u.s. DEPARTMENT OF ENER GY EERE PROJECT MANAGEMENT CENTER NEPA...  

Broader source: Energy.gov (indexed) [DOE]

individuals (such as builders, owners, consultan ts, designers), organizations (such as utilities), and state and local governments. Covered actions include, but are not limited...

68

Analysis of AGS E880 polarimeter data at Gy = 12.5.  

SciTech Connect (OSTI)

Data were collected with the AGS internal (E880) polarimeter at G{gamma} = 12.5 during the FY04 polarized proton run. Measurements were made with forward scintillation counters in coincidence with recoil counter telescopes, permitting an absolute calibration of the polarimeter for both nylon and carbon targets. The results are summarized and they will also be useful for an absolute calibration of the AGS CNI polarimeter at G{gamma} = 12.5.

Cadman, R.; Huang, H.; Krueger, K.; Spinka, H.; Underwood, D. (High Energy Physics); (Brookhaven National Laboratory)

2012-02-23T23:59:59.000Z

69

Inn vati ns at EECS: Techn l gy f r a gl bal future  

E-Print Network [OSTI]

of Society Invention Lab 141/143 Sutardja Dai Hall Center for Research in Energy Systems Transformation 406 - Peter Bailis, AMPLab (Algorithms, Machines, and People Laboratory) · Raven: An Energy Wireless Research Center) & E3S (Center for Energy Efficient Electronics Science) · Occupant Detection

California at Irvine, University of

70

The Sugar-Coated Path to Economic Inequality. A Comparative Study of Guyana and Suriname, ca. 1600-present.  

E-Print Network [OSTI]

??In terms of economic development, since at least the second half of the twentieth century Suriname (former Dutch Guiana) is doing significantly and persistently better (more)

Slagter, Y.

2011-01-01T23:59:59.000Z

71

Aluminum across the Americas: Caribbean Mobilities and Transnational American Studies  

E-Print Network [OSTI]

ore mined largely in Suriname, Guyana and Jamaica for muchtwentieth century. Suriname, in the Netherlands Antilles,the United States with Suriname, Guyana and Jamaica, and

Sheller, Mimi

2013-01-01T23:59:59.000Z

72

E-Print Network 3.0 - amapa brazil aplicacao Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Avery recent account of land conflict garnering much... COLUMBIA VENEZUELA GUYANA SURINAME FRENCH GUYANA Amapa Amazonas Par Mato Grasso Tocantins Bahia ... Source: Simmons,...

73

NETHERLANDS SWITZERLAND  

E-Print Network [OSTI]

PERU BRAZIL SOUTH AFRICA FRENCH GUIANA SURINAME GUYANA ETHIOPIA KENYA ERITREA EGYPTLIBYA NIGER MALI ECUADOR VENEZUELA PERU BRAZIL SOUTH AFRICA FRENCH GUIANA SURINAME GUYANA ETHIOPIA KENYA ERITREA EGYPTLIBYA

74

The Big Trees Were Kings: Challenges for Global Response to Climate Change and Tropical Forests Loss  

E-Print Network [OSTI]

Brazil Guyana Mexico Suriname India Vietnam Gabon ThailandMalaysia France Laos Guyana Suriname Thailand MadagascarLeone, Solomon Islands, Suriname, Thailand, Uruguay, Uganda,

Irland, Lloyd C.

2010-01-01T23:59:59.000Z

75

data: Improving the use of information from museum specimens: Using Google Earth to georeference Guiana Shield specimens in the US National Herbarium  

E-Print Network [OSTI]

We used Gazetteers for Guyana, Suriname, French Guiana andby Maguire to Tafelberg, Suriname, in 1944. Tafel- berg isFrench Guiana Guyana Suriname Amazonas Bolivar Venezuela

Garcia-Milagros, Eduardo; Funk, Vicki A.

2010-01-01T23:59:59.000Z

76

Parallel worlds: empirical region and place  

E-Print Network [OSTI]

Western) Guyana. - Suriname. - Brazil. - Bolivia. - Chile.intelligible except those of Suriname. Holm cites EdwardGuyana, Haiti, Jamaica, Suriname, and Trinidad and Tobago,

Ford, Of The

2013-01-01T23:59:59.000Z

77

The More Things Stay the Same the More They Change : : Measuring Changing Levels of Human Rights Using Computational Methods  

E-Print Network [OSTI]

IRAQ SYRIA MAURITIUS SURINAME MALI GUYANA GERMAN FEDERALBRAZZAVILLE) DOMINICAN REP SURINAME TRINIDAD AND TOBAGO

Fariss, Christopher J.

78

Journal of species lists and distribution ISSN 1809-127X (online edition)  

E-Print Network [OSTI]

, French Guyana, Peru, Suriname and Venezuela. In Brazil, Amazon includes Tropical Rain Forest areas

Ribera, Ignacio

79

Florida Arbovirus Surveillance Week 23: June 3-9, 2012  

E-Print Network [OSTI]

, Ecuador, Ghana, Guyana, Haiti (4), Jamaica, Mexico, Suriname, and Turks & Caicos. Counties reporting cases

Watson, Craig A.

80

165 150 135 120 105 90 75 60 45 30 15 0 30 45 60 75 90 105 120 135 150 165 180  

E-Print Network [OSTI]

ZIMBABWE BOTSWANA UGANDA URUGUAY PARAGUAY GUYANA SURINAME PERU VENEZUELA ECUADOR HONDURAS CUBA BELIZE

Tomforde, Mark

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

in die Forschung Mitteilungen der Universitt Bayreuth  

E-Print Network [OSTI]

Venezuela Paraguay Ecuador Uruguay Guyana Suriname ragua #12;Blick in die Forschung Mitteilungen der

Ullmann, G. Matthias

82

8, 1190911965, 2008 Reactive Trace Gas  

E-Print Network [OSTI]

compounds (VOC) in the boundary layer over French Guyana and Suriname during the October 2005 GABRIEL

Paris-Sud XI, Université de

83

Habitat Specialization by Birds in Western Amazonian White-sand Forests Jose Alvarez Alonso1,4  

E-Print Network [OSTI]

. 1990). In northern Amazonia, WSFs are known from Venezuela, Suriname, Guyana, Brazil, and Colombia

Fine, Paul V.A.

84

C. L. Staines. 2011. Catalog of the hispines of the World (Coleoptera: Chrysomelidae: Cassidinae). http:// entomology.si.edu/Collections_Coleoptera-Hispines.html 1  

E-Print Network [OSTI]

); Papp 1953: 51 (catalog). Distribution. Bolivia, Brazil (Amazonas), French Guyana, Suriname. Food plants

Mathis, Wayne N.

85

A Statistical Approach Towards The Recognition of Hindi Language Words  

E-Print Network [OSTI]

in several other countries like Nepal, Mauritius, Singapore, Fiji, Guyana, Suriname, Trinidad, UAE, etc. can

Paris-Sud XI, Université de

86

Studies on Neotropical Fauna und Environment Vol. 43, No. 3, December 2008, 177-180  

E-Print Network [OSTI]

crashes". We here report on two populations of Atelopus hoogmoedi from Suriname and Guyana which show

Hödl, Walter

87

AIMMP signs TTAP MOU The Association of Wood and  

E-Print Network [OSTI]

bringing forests and factories to legality verification in China, Brazil, Guyana, Gabon and the Republic

88

School of Civil and Environmental Engineering GE O RGIA IN S TITU TE O F TE CHN O LO GY  

E-Print Network [OSTI]

ENVIRONMENTAL ENGINEERING · Environmental biotechnology · Water quality and treatment · Wastewater reclamation in chemostat vessels. EnvE #12;CEE @ GT EFM&WR ENVIRONMENTAL FLUID MECHANICS & WATER RESOURCES . Science & engineering applications of environmental transport processes . Sustainable resource management . Innovative

Jacobs, Laurence J.

89

E-Print Network 3.0 - african ivory nut Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Cameroon... Lesotho Sierra Leone Cape Verde Liberia Somalia Central African Rep Libya South Africa Chad Source: Grant, James D.E. - Fakultt fr Mathematik, Universitt Wien...

90

Brochure front(2-09)  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Latvia Lesotho Libyan Arab Jamahiriya Lithuania Madagascar Malawi Mauritius Mexico Nepal The Netherlands New Zealand Nicaragua Nigeria Norway Philippines Poland Portugal...

91

American Journal of Botany 86(7): 907922. 1999. THE ARCHITECTURE OF MOURERA FLUVIATILIS  

E-Print Network [OSTI]

Vene- zuela, Guyana, Surinam, French Guiana, and northern Brazil (van Royen, 1953; Velasquez, 1994 in Guyana and Surinam, from July to February in northern Brazil (van Royen, 1953). Grubert (1974) observed

Zürich, Universität

92

(page intentionally blank) CENTRE FOR THE STUDY OF BIOLOGICAL DIVERSITY  

E-Print Network [OSTI]

in developing Kaieteur National Park, Guyana for ecotourism and conservation by Carol L. Kelloff edited Institution. The use of biodiversity data in developing Kaieteur National Park, Guyana for ecotourism

Mathis, Wayne N.

93

Introduction Unsurprisingly, insectplant interactions in  

E-Print Network [OSTI]

), Suriname and Guyana (Mabura Hill: ter Steege et al., 1996) rarely had the oppor- tunity to generate) in the rainforests of the Guianas (French Guiana, Suriname and Guyana). Other plant resources used by insects

Basset, Yves

94

Agreements --South America 163 SOUTH AMERICA  

E-Print Network [OSTI]

.66 Guyana 5,200 0.09 Suriname 20 0.00 Amazon River ship (left); sawmill; Amazon tributary. Photo credits; Brazil; Colombia; Ecuador; Guyana; Peru; Surinam; Venezuela Treaty for Amazonian cooperation May 22, 1944

Wolf, Aaron

95

Marine Fisheries On the cover: Recreational  

E-Print Network [OSTI]

Guiana, Surinam, and Guyana, 1978-79 Alexander Dragovich and Essie M. Coleman 1 Moving Out the Learning

96

MFR PAPER 1087 Trap Fishing Explorations for Snapper  

E-Print Network [OSTI]

, north of Hispaniola , and off Venezuela , Guyana, and Surinam. Higher catch rates of about 40 pounds per

97

Conservation priorities under global change : protected areas, threatened biodiversity and research trends  

E-Print Network [OSTI]

Islands Sierra Leone Somalia Suriname Slovakia EU SA AF AFGuiana Guyana Peru Paraguay Suriname Venezuela TTO Trinidad

Lee, Tien Ming

2011-01-01T23:59:59.000Z

98

SIT Workshops 1995 2011 Page 1 of 17  

E-Print Network [OSTI]

Guyana Haiti Jamaica Saint Kitts and Nevis Saint Lucia Suriname Trinidad & Tobago 12. US-India Workshop

99

Amrique latine et Carabes  

E-Print Network [OSTI]

P?ROU ?QUATEUR COLOMBIE VENEZUELA GUYANA SURINAME GUYANE FRAN?AISE MEXIQUE MARTINIQUE GUADELOUPE SAINT

100

730 | 146 | 20% 102 | 16 | 16%  

E-Print Network [OSTI]

| 12 | 21% Guyana 4 | 0 | 0% Suriname 2 | 0 | 0% Brazil 109 | 25 | 23% Ecuador 45 | 11 | 24% Peru 50

Yener, Aylin

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Extreme polymorphism in a Y-linked sexually selected trait  

E-Print Network [OSTI]

-chromosome. Field surveys from 1999 to 2002 of nine populations in Guyana and Suriname, South America, indicate

102

PAESE ESTERO Personale docente e  

E-Print Network [OSTI]

ESTERI D Suriname D Trinidad e Tobago D Venezuela D Brasile D Guyana D Lussemburgo D Belgio D Laos D

Genova, Università degli Studi di

103

International Student and Scholar Enrollment & Statistical Report  

E-Print Network [OSTI]

Suriname 1 Ghana 18 Swaziland 1 Greece 19 Sweden 8 Grenada 1 Switzerland 8 Guatemala 21 Syria 4 Guyana 2

Ginzel, Matthew

104

2013, Latin American Public Opinion Project www.AmericasBarometer.org  

E-Print Network [OSTI]

Suriname Guatemala Guyana 0 10 20 30 40 50 Trust in Iranian Government 95% Confidence Interval (Design

Bordenstein, Seth

105

BIBLIOGRAPHIE 243 Bibliographie  

E-Print Network [OSTI]

. Mass, and E.W.F. De Roever. Igneous and metamorphic complexes of the Guyana Shield in Surinam. Geologie

Sailhac, Pascal

106

JOURNAL OF GEOPHYSICAL RESEARCH, VOL. 106, NO. 12, PAGES 30,82130,835, DECEMBER 10, 2001 Upper-mantle S-velocity structure of central and western South  

E-Print Network [OSTI]

AmericanPrecambrianshieldsarefoundinBrazil, Venezuela, Guyana, Surinam and French Guiana, with edges in Bolivia and Colombia. The shield regions

van der Lee, Suzan

107

Isotope Biogeochemistry of Diagenesis caused by a Black  

E-Print Network [OSTI]

the coasts of Surinam and French Guyana #12;µ Black shales in Leg 207 sediments and pore water response depth

108

J. Bot. Res. Inst.Texas 3(2): 799 814. 2009 CHECKLIST OF THE PLANTS OF THE GUIANA SHIELD  

E-Print Network [OSTI]

= French Guiana; GU = Guyana; SU = Surinam). Names of species in italics are to be edited or deleted

Mathis, Wayne N.

109

Climate Change and the Macroeconomy in the Caribbean Basin: Analysis...  

Open Energy Info (EERE)

publicaci Country Aruba, Barbados, Dominican Republic, Guyana, Jamaica, Montserrat, Netherlands Antilles, Saint Lucia, Trinidad and Tobago Caribbean, Caribbean, Caribbean, South...

110

Project of Aerosol Optical Depth Change in South America  

E-Print Network [OSTI]

AerosolDepth Brazil Bolivia French Guiana Suriname Guyana Venezuela Colombia Ecuador Peru Chile Argentina Suriname Guyana Venezuela Colombia Ecuador Peru Chile Argentina Paraguay Uruguay #12;Statistics of Aerosol M ean D ec 01 to 06 Mean Month AerosolDepth Brazil Bolivia French Guiana Suriname Guyana Venezuela

Frank, Thomas D.

111

REVIEW Open Access Land cover, land use and malaria in the Amazon  

E-Print Network [OSTI]

, Brazil, Colombia, Ecuador, France (French Guiana), Guyana, Peru, Suriname and Venezuela. The subregion in the Americas [3]. The three Guyanas (Guyana, Suriname and French Guiana) have the highest annual parasite index (Bolivia, Ecuador, French Guiana and Suriname) in this subregion have seen malaria incidence rates re

Boyer, Edmond

112

E3NE3R'GY ORNL/Sub/80-13817/1&20 RD&D Opportunities for Large Air  

E-Print Network [OSTI]

by TRW Energy Engineering Division 800 Oak Ridge Turnpike Oak Ridge, Tennessee 37830 under Subcontract 62X-13817C, Letter Release 62X-20 JN -sf2;~~~~~~~~~for Oak Ridge National Laboratory Oak Ridge by TRW Energy Engineering Division 800 Oak Ridge Turnpike Oak Ridge, Tennessee 37830 Under Subcontract 62

Oak Ridge National Laboratory

113

Cell Cycle Disturbances and Mitotic Catastrophes in HeLa Hep2 Cells following 2.5 to 10 Gy of Ionizing Radiation  

Science Journals Connector (OSTI)

...death (2-5). Radiation is known to exert...molecules involved in this radiation-induced cellular safety machinery is p53...different doses of radiation at the molecular and...using the CellQuest software program, setting...

David Eriksson; Per-Olov Lfroth; Lennart Johansson; Katrine hlstrm Riklund; and Torgny Stigbrand

2007-09-15T23:59:59.000Z

114

Newsletter Signup Form  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

EETD NEWSLETTER - MANAGE SUBSCRIPTIONS EETD NEWSLETTER - MANAGE SUBSCRIPTIONS (red fields are required) Manage subscriptions: Subscribe Unsubscribe Name E-Mail Affiliation Address Address (line 2) City State/Province Zip/Postal Code Country (please select a country) none Afghanistan Albania Algeria American Samoa Andorra Angola Anguilla Antarctica Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bhutan Bolivia Bosnia and Herzegowina Botswana Bouvet Island Brazil British Indian Ocean Territory Brunei Darussalam Bulgaria Burkina Faso Burundi Cambodia Cameroon Canada Cape Verde Cayman Islands Central African Republic Chad Chile China Christmas Island Cocos (Keeling) Islands Colombia Comoros Congo Congo, the Democratic Republic of the Cook Islands Costa Rica Cote d'Ivoire Croatia (Hrvatska) Cuba Cyprus Czech Republic Denmark Djibouti Dominica Dominican Republic East Timor Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Falkland Islands (Malvinas) Faroe Islands Fiji Finland France France, Metropolitan French Guiana French Polynesia French Southern Territories Gabon Gambia Georgia Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guam Guatemala Guinea Guinea-Bissau Guyana Haiti Heard and Mc Donald Islands Holy See (Vatican City State) Honduras Hong Kong Hungary Iceland India Indonesia Iran (Islamic Republic of) Iraq Ireland Israel Italy Jamaica Japan Jordan Kazakhstan Kenya Kiribati Korea, Democratic People's Republic of Korea, Republic of Kuwait Kyrgyzstan Lao People's Democratic Republic Latvia Lebanon Lesotho Liberia Libyan Arab Jamahiriya Liechtenstein Lithuania Luxembourg Macau Macedonia, The Former Yugoslav Republic of Madagascar Malawi Malaysia Maldives Mali Malta Marshall Islands Martinique Mauritania Mauritius Mayotte Mexico Micronesia, Federated States of Moldova, Republic of Monaco Mongolia Montserrat Morocco Mozambique Myanmar Namibia Nauru Nepal Netherlands Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norfolk Island Northern Mariana Islands Norway Oman Pakistan Palau Panama Papua New Guinea Paraguay Peru Philippines Pitcairn Poland Portugal Puerto Rico Qatar Reunion Romania Russian Federation Rwanda Saint Kitts and Nevis Saint LUCIA Saint Vincent and the Grenadines Samoa San Marino Sao Tome and Principe Saudi Arabia Senegal Seychelles Sierra Leone Singapore Slovakia (Slovak Republic) Slovenia Solomon Islands Somalia South Africa South Georgia and the South Sandwich Islands Spain Sri Lanka St. Helena St. Pierre and Miquelon Sudan Suriname Svalbard and Jan Mayen Islands Swaziland Sweden Switzerland Syrian Arab Republic Taiwan, Province of China Tajikistan Tanzania, United Republic of Thailand Togo Tokelau Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Tuvalu Uganda Ukraine United Arab Emirates United Kingdom United States United States Minor Outlying Islands Uruguay Uzbekistan Vanuatu Venezuela Viet Nam Virgin Islands (British) Virgin Islands (U.S.) Wallis and Futuna Islands Western Sahara Yemen Yugoslavia Zambia Zimbabwe

115

Agriculture and food systems in sub-Saharan Africa in a 4C+ world  

Science Journals Connector (OSTI)

...data needed (maximum and minimum temperature, rainfall and solar radiation) for each grid cell using MarkSim, a third-order...Djibouti, Eritrea, Ethiopia, Kenya, Rwanda, Somalia, Sudan, Tanzania, Uganda. Southern: Angola, Botswana, Lesotho, Madagascar...

2011-01-01T23:59:59.000Z

116

IndIvIdual and Inter-populatIon varIatIon In afrIcan rock pIpIt Anthus crenAtus songs  

E-Print Network [OSTI]

2007 (Fig. 1). In these areas,ARPs occur on rocky hills with large boulders, surrounded by flat and Lesotho where it prefers rocky outcrops with open grass patches on mountain hillsides with scattered trees

de Villiers, Marienne

117

Governing Climate Change Post-2012: The Role of Global Cities -Melbourne  

E-Print Network [OSTI]

science and policy Renewable energy Resource conservation Sustainable agriculture Sustainable developmentRyan Corey `12 Electrical Engineering Ryan created a more energy efficient mid- infrared LED from China Ecuador Ethiopia Finland France Ghana India Italy Kenya Lesotho Liberia Madagascar Mexico

Watson, Andrew

118

Overleven in een grensgebied. Veranderingsprocessen bij de Wayana in Suriname en Frans-Guayana.  

E-Print Network [OSTI]

??The Wayana, who belong to the group of Caribbean speaking peoples, live dispersed over three countries: Brazil, French Guyana and Suriname. Wayana is in fact (more)

Boven, K.M.

2006-01-01T23:59:59.000Z

119

E-Print Network 3.0 - american caesalpiniaceae vi Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

2011 Terry W Henkel Summary: associated with Dicymbe (Caesalpiniaceae) in Guyana. Advisor: Rytas Vilgalys. 1988 MS (Botany), University... to Armillaria (Physalacriaceae,...

120

E-Print Network 3.0 - algeria australia austria Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Guinea Guinea Bissau Guyana Haiti Afghanistan Albania Algeria Andorra Romania Russia Rwanda Samoa Source: Alechina, Natasha - School of Computer Science, University of...

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

E-Print Network 3.0 - amazon central brazil Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and distribution ISSN 1809-127X (online edition) Summary: , French Guyana, Peru, Suriname and Venezuela. In Brazil, Amazon includes Tropical Rain Forest areas... stictoides...

122

"Calling the Magician": The Metamorphic Indo-Caribbean  

E-Print Network [OSTI]

group in Guyana and Suriname and about half the populationGuiana became postcolonial Suriname in 1975; French Guiananeighboring country of Suriname (Dutch Guiana). People have

Khan, Aliyah Ryhaan

2012-01-01T23:59:59.000Z

123

E-Print Network 3.0 - acari eriophyidae em Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

along the southern border between Guyana and Suri... - name), to the interior of Suriname and French Guiana, southto near Manaus, Brazil and south- em Amapl... near the mouth...

124

E-Print Network 3.0 - amazonian chocolate tree Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

(Davis 1975). Fur of neck and shoulders is paler than body... Venezuela), Guyana, Suriname, French Guiana, and eastern Amazonian Ecuador (Albuja V. 1999; Anderson 1997......

125

E-Print Network 3.0 - amazon region brazil Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

new data, the number of species in the Amazon region rise... , French Guyana, Peru, Suriname and Venezuela. In Brazil, Amazon includes Tropical Rain Forest areas... localities in...

126

E-Print Network 3.0 - acari em turdus Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

along the southern border between Guyana and Suri... - name), to the interior of Suriname and French Guiana, southto near Manaus, Brazil and south- em Amapl... near the mouth...

127

Accepted by S. Carranza: 29 Sept. 2013; published: 23 Oct. 2013 ISSN 1175-5326 (print edition)  

E-Print Network [OSTI]

) previously masquerading as C. lemniscatus from southeastern Venezuela, Amazonian Brazil, Suriname, and French. Markezich et al. (1997) assigned specimens from Guyana, Suriname, and Bolivar, Venezuela, to C. l

Hedges, Blair

128

733 | 165 | 23% 97 | 13 | 13%  

E-Print Network [OSTI]

51 | 7 | 14% Guyana 4 | 0 | 0% Suriname 2 | 0 | 0% Brazil 99 | 13 | 13% Ecuador 38 | 5 | 13% Peru 49

129

E-Print Network 3.0 - agudo maracaibo venezuela Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

that the eastern Venezuela... in northeastern South America (Venezuela, Guyana, and Suriname) and the adjacent Lesser Antilles islands... to glacial cycles. The Serrania del...

130

639 | 162 | 25% 84 | 11 | 13%  

E-Print Network [OSTI]

| 15% Guyana 6 | 2 | 33% Suriname 2 | 0 | 0% Brazil 82 | 11 | 13% Ecuador 29 | 3 | 10% Peru 44 | 4 | 9

Lee, Dongwon

131

E-Print Network 3.0 - acari tenuipalpidae em Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

along the southern border between Guyana and Suri... - name), to the interior of Suriname and French Guiana, southto near Manaus, Brazil and south- em Amapl... near the mouth...

132

E-Print Network 3.0 - amazon parrots amazona Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

is used in this work based in Mittermeier et al. (2003... , French Guyana, Peru, Suriname and Venezuela. In Brazil, Amazon includes ... Source: Ribera, Ignacio - Institut de...

133

U.S. Department of the Interior U.S. Geological Survey  

E-Print Network [OSTI]

such as those in the VENEZUELA BRAZIL COLOMBIA SURINAME GUYANA 0 50 100 200 MILES 0 50 100 200 KILOMETERS ST

Laughlin, Robert B.

134

International Student and Scholar Enrollment & Statistical Report  

E-Print Network [OSTI]

SURINAME 1 GUATEMALA AND36 SWAZIL 1 GUYANA 1 SWEDEN 16 HAITI 2 SWITZERLAND 2 HONDURAS 9 SYRIA 1 HONG KONG

Ginzel, Matthew

135

QUELQUES ASPECTS DE LA NGATION DANS TROIS LANGUES ARAWAK DU NORD  

E-Print Network [OSTI]

statut de langue minoritaire dans les pays où il est parlé : le Guyana, le Surinam et le département de

Boyer, Edmond

136

Herv Thveniaut BRGM, Service Gologie  

E-Print Network [OSTI]

» Guyanes coloniales que sont le Guyana (britannique), le Suriname (néerlandais) et la Guyane française. Le

Paris-Sud XI, Université de

137

4, 35653606, 2004 Spatial and temporal  

E-Print Network [OSTI]

. The MBL aerosol size distribution some 50­100 km of the coast of French Guyana and Suriname showed a bi

Paris-Sud XI, Université de

138

Langues amrindiennes : localisation des familles  

E-Print Network [OSTI]

Bolivie Pérou Colombie Venezuela Brésil Suriname Guyana Guyane française caribe tupi-guarani arawak océan

Paris-Sud XI, Université de

139

8, 11591190, 2008 Halocarbons over the  

E-Print Network [OSTI]

rainforest in Suriname and French Guyana (3­6 N, 51­59 W) in October 2005. In the boundary layer (0­1.4 km

Paris-Sud XI, Université de

140

International Student and Scholar Enrollment & Statistical Report  

E-Print Network [OSTI]

SURINAM 1 GHANA 12 SWAZILAND 2 GREECE 21 SWEDEN 14 GUATEMALA ND22 SWITZERLA 6 GUYANA 1 SYRIA 1 HAITI 2

Ginzel, Matthew

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

BIBLIOGRAPHIE 243 Bibliographie  

E-Print Network [OSTI]

of the Guyana Shield in Surinam. Geologie en Mijnbouw, 62:241--54, 1983. [Bla95] R. J. Blakely. Potential Theory

Sailhac, Pascal

142

Atmos. Chem. Phys., 8, 31853197, 2008 www.atmos-chem-phys.net/8/3185/2008/  

E-Print Network [OSTI]

tropical rainforest in Suriname and French Guyana (3­6 N, 51­59 W) in October 2005. In the boundary layer

Meskhidze, Nicholas

143

Profits Over People: Tobacco Industry Activities to Market Cigarettes and Undermine Public Health in Latin America and the Caribbean  

E-Print Network [OSTI]

Tobacco Co. Ltd. Suriname [Re: Regional initiatives].to Keith Dunt Subject: Suriname. British- American TobaccoMarket Colombia Panama Suriname Guyana Ecuador Peru Bolivia

Aguinaga Bialous, Stella MPH; Shatenstein, Stan

2002-01-01T23:59:59.000Z

144

E-Print Network 3.0 - agroforest sulawesi indonesia Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

- Aceh, Papua, Central Sulawesi, Maluku Kenya Kuwait Liberia Myanmar (former Burma) Nepal Nigeria... Former USSR - Azerbaijan Kyrgystan Tajikistan Turkmenistan Guatemala Guyana...

145

SMITHSONIAN INSTITUTION Contributions from the United States National Herbarium  

E-Print Network [OSTI]

of the Guiana Shield (VENEZUELA: Amazonas, Bolivar, Delta Amacuro; GUYANA, SURINAM, FRENCH GUIANA) by V. Funk, DeltaAmacuro; Guyana, Surinam, French Guiana). Contributions from the United States National Herbarium and Surinam, French Guiana (a part of France) and the Venezuelan states of Amazonas, Bolivar, and Delta

Mathis, Wayne N.

146

E F F I C I E N CY A N D R E N E W A B L E E N E R GY D IV I S I O N CALIFORNIA ENERGY COMMISSION  

E-Print Network [OSTI]

to helping contractors and others comply with the Building Energy Efficiency Standards. The website received and timely technical information on how to comply with the Building Energy Efficiency Standards Schwarzenegger Governor California Energy Commission June 2010 CEC-400-2010-006 Minimum Best Practices Guide

147

E F F I C I E N CY A N D R E N E W A B L E E N E R GY D IV I S I O N CALIFORNIA ENERGY COMMISSION  

E-Print Network [OSTI]

COMMISSION Residential Indoor Air Quality under the 2008 Building Energy Efficiency Standards ASHRAE 62. Requirements The ASHRAE Standard requires a minimum level of ventilation in two areas: (1) whole-building for Residential Low- Rise Buildings (ASHRAE Standard) and various ways to meet this standard are described

148

ARAWAK VS. LOKONO. WHAT'S IN A NAME ? Denomination of one of the largest and geographically most extensive family of  

E-Print Network [OSTI]

of the Columbian era to a specific Amerindian group living in the Guianese coastal area in Guyana, Suriname, French,000; in Suriname, the 1980 census gives the figures of 700 speakers out of 2,051 individuals; in the French

Boyer, Edmond

149

E-Print Network 3.0 - affecting northeastern brazil Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

and Guy- ana, known as the Guianas-Brazil... of northeastern Brazil, French Guiana, Suriname and Guyana (1975-77). In A. C. Jones and L. Villegas (Editors... working group met in...

150

Malaria resurgence: a systematic review and assessment of its causes  

E-Print Network [OSTI]

for the; 2002. 134. PAHO: Suriname. Cartagena, Colombia: The1996 [131] Costa Rica Belize Suriname Ecuador Panama PacificNi Nicaragua P Peru Suriname P Panama Mexico Haiti Guyana

2012-01-01T23:59:59.000Z

151

Ocean Drilling Program (ODP) Leg 207 recently cored sediments on the Demerara Rise at ~9N  

E-Print Network [OSTI]

Rise,north of Suriname and French Guyana, South America,is an ideal drilling target because expanded of Suriname,and is ~220 km wide from the shelf break to the northeastern escarpment. Most of the plateau lies

Bice, Karen L.

152

POSTER PRESENTATION Open Access Highlighting the genetic and epidemiologic  

E-Print Network [OSTI]

and the Grena- dines, Suriname, Trinidad and Tobago, Turks and Cai- cos. Analysis of "de-identified" patient and Tobago, Guyana, and Suriname where there is a large population of East Indians brought during

Boyer, Edmond

153

Visa Students by Country of Citizenship -November 2013 Region Undergraduate Graduate Total  

E-Print Network [OSTI]

(Malvinas) 0 0 0 Guinea (French) 0 0 0 Guyana 11 0 11 Paraguay 0 0 0 Peru 3 3 6 Suriname 1 0 1 Uruguay 0 0 0

154

Characterization of resistance to the Mexican spittlebug complex Aeneolamia albofasciata (Lallemand) and Prosapia simulans (Walker) in selected buffelgrass genotypes  

E-Print Network [OSTI]

- zuela, Guyana, Surinam, Trinidad, Tobago, Grenada, Brazil and Argen- tina. Borrer and DeLong (1976) placed the Homoptera among those insects that undergo incomplete metamorphosis. The spittlebug conforms, pass- ing through egg, nymph and adult stages...

Head, Henry Wesley

2012-06-07T23:59:59.000Z

155

An investigation of the probability of occurrence of dry periods during the rainy season in the grassy highlands of Western Venezuela  

E-Print Network [OSTI]

, such as the Grassy Western Highlands. Griffiths et al. (1967), after analyzing northern and central areas of South America - Venezuela, Colombia, Guyana, Suriname, Ecuador, Peru and parts of Brazil and Bolivia - suggested a technique to demonstrate the monthly...

Quintana Gomez, Ramon Alfonso

2012-06-07T23:59:59.000Z

156

The world of geography: Visualizing a knowledge domain with cartographic means  

Science Journals Connector (OSTI)

...russia nascar hawaii access gender energy floods gender canada gender coffee mexico ethnic guyana mexico hawaii hawaii gender energy novels border empire filter floods...climatology nationalism climatology land reform immigration immigration demographic...

Andr Skupin

2004-01-01T23:59:59.000Z

157

Climate change mitigation through livestock system transitions  

Science Journals Connector (OSTI)

...external energy models are used to drive the bioenergy supply. In this paper, bioenergy demand projections the POLES model (32) were...Lucia, St Vincent, Trinidad and Tobago RSAM Argentina, Bolivia, Chile, Colombia, Ecuador, Guyana...

Petr Havlk; Hugo Valin; Mario Herrero; Michael Obersteiner; Erwin Schmid; Mariana C. Rufino; Aline Mosnier; Philip K. Thornton; Hannes Bttcher; Richard T. Conant; Stefan Frank; Steffen Fritz; Sabine Fuss; Florian Kraxner; An Notenbaert

2014-01-01T23:59:59.000Z

158

MOLECULAR PLANT PATHOLOGY (2008) 9(5), 577588 DOI: 10.1111/J.1364-3703.2008.00496.X 2008 BLACKWELL PUBLISHING LTD 577  

E-Print Network [OSTI]

. PEREIRA2 1 Sustainable Perennial Crops Laboratory, USDA­ARS, 10300 Baltimore Ave., Bldg. 001, Beltsville subsequently arrived in Surinam in 1895. WBD moved rapidly, spreading to Guyana in 1906, Ecuador in 1918

Griffith, Gareth

159

A preliminary analysis of geographic variation in the neotropical teiid lizard, Cnemidophorus lemniscatus (Sauria: Teiidae), from Mainland Central and South America  

E-Print Network [OSTI]

= Puerto Cortes, Honduras; g4 = Surinam; T";5 = i~laturin, Venezuela; 66 Falcon, Venezuela; g7 = Bolivar, Venezuela; g8 = Camatagua, Venezuela; P9 = Guyana; $1G Baranquilla, Colombia; $11 = Yaviza, Panama; 514 = Apure, Venezuela; f16 = Villavicencio... from all others. This grouping differs from the UPG:IA where the sexes were lumped because samples 4 and 9, from Guyana and Surinam, respectively, are coupled together. These are subgrouped with sample 16, and then with sample 18. The s cond split...

McCrystal, Hugh Kreyer

2012-06-07T23:59:59.000Z

160

ROYAL SOCIETY OF SOUTH AFRICA  

E-Print Network [OSTI]

ROYAL SOCIETY OF SOUTH AFRICA http://www.royalsocietysa.org.za ACADEMY OF SCIENCE OF SOUTH AFRICA and distribution of butterflies in the atlas region (South Africa, Lesotho and Swaziland), thereby providing-ordinator of Africa's first butterfly atlas, entitled `The metamorphosis of the butterfly atlas' The Southern African

de Villiers, Marienne

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

2nd Edition Nov. 2011 CampusFrance South Africa Newsletter  

E-Print Network [OSTI]

2nd Edition Nov. 2011 CampusFrance South Africa Newsletter Table of contents : o Current Bursary offered by the French Embassy aim to respond to South Africa and Lesotho's need to train and equip French per country) for Honours and Masters students from South Korea, Mexico, India, USA, South Africa

Wagner, Stephan

162

Call for projects GUYAMAZON 2013 / Contact: aird.guyamaz@ird.fr 1/6 GUYAMAZON 2013  

E-Print Network [OSTI]

-ecology - Theme 5: Renewable Energies - Theme 6: Humanities and Social Sciences related to regional challenges in Brazil, the Inter-establishment Agency for Research and Development (AIRD), the French Region of Guyana.guyamaz@ird.fr 2/6 The Inter-establishment Agency for Research and Development (AIRD), the France Embassy in Brazil

163

Walsh et al.:Cluster A&G October 2010 Vol. 51 5.33  

E-Print Network [OSTI]

, an Ariane 501 rocket carrying the four Clus- ter spacecraft exploded soon after lift off from Kourou, French in the tail, open mag- netic flux and energy builds up in the magneto- tail until it reaches a critical point Guyana. ESA decided to rebuild the spacecraft and, just four years later on 16 July 2000, the first pair

California at Berkeley, University of

164

MFR PAPER 1082 Exploratory Fishing Activities of the  

E-Print Network [OSTI]

and to the coastal shelves of eastern Venezuela, Guyana, Surinam, and French Guiana . Experiments were conducted South America, and is concentrated off Surinam. A seasonal increase in availability of skipjack tuna . A small resource of tilefish was found in deep water off the edge of the Surinam continental shelf

165

L'identit gomtrie variable des jeunes hommes Kali'na de Mana (Guyane franaise) : sur quelle mesure ?  

E-Print Network [OSTI]

disperse au Brésil, au Surinam, jusqu'au Guyana et au Venezuela (Ethnies 1985 :14). En 1958, la population, conséquence de la guerre civile du Surinam. Aujourd'hui, les Kali'na sont entre de 2800 et 4000 individus

Paris-Sud XI, Université de

166

For Immediate Release --Thursday, March 7, 2013 University of Lethbridge technology aboard Herschel  

E-Print Network [OSTI]

research device on a 1.5 million kilometre trip into deep space aboard the end of the project for the research team. Dr. David Naylor (Physics Guyana, very quickly began to shed new light on stars and galaxies by measuring

Morris, Joy

167

Characters and phylogenetic relationships of nectar-feeding bats, with descriptions of new Lonchophylla from western South America (Mammalia: Chiroptera: Phyllostomidae: Lonchophyllini)  

E-Print Network [OSTI]

. thomasi, we carried out principal compo- nents analyses (PCA) using 115 individu- als from Bolivia (n 5 3), Brazil (19), Colombia (5), Ecuador (4), French Gui- ana (5), Guyana (9), Panama (11), Peru (36), Suriname (10), and Venezuela (13). We then plotted...

Woodman, Neal; Timm, Robert M.

2006-12-01T23:59:59.000Z

168

Journal of Tropical Ecology (2005) 21:329336. Copyright 2005 Cambridge University Press doi:10.1017/S0266467405002300 Printed in the United Kingdom  

E-Print Network [OSTI]

(Coleoptera: Chrysomelidae) in two forest types in Panama Elroy Charles1 and Yves Basset University of Guyana Institute, Apartado 2072, Balboa, Ancon, Panama City, Republic of Panama (Accepted 17 October 2004) Abstract and one dry forest in Panama. Samples included in total 4615 individuals representing 253 species

Basset, Yves

169

Drought and Precipitation Monitoring for Enhanced Integrated Water Resources Management in the Caribbean  

E-Print Network [OSTI]

Drought and Precipitation Monitoring for Enhanced Integrated Water Resources Management for water resource management in Jamaica, Grenada and Guyana. A key element to ensuring the success for Water Resources Management, McGill University, Macdonald Campus, 21111 Lakeshore Rd., Ste. Anne de

Barthelat, Francois

170

THE UNITED STATES SHRIMP FISHERY OFF NORTHEASTERN SOUTH AMERICA (1972-74)1  

E-Print Network [OSTI]

; pink shrimp, P. notialis; and white shrimp, P. schmitti. The areas offGuyana, Surinam, and western sustainable yield to be 28.7 million pounds and a linear model estimated the maximum sustainable yield Brazil and Barbados, Surinam, and Trinidad and Tobago. SOURCES OF DATA AND METHODS Catch data for U

171

National Action Programmes on Desertification | Open Energy Information  

Open Energy Info (EERE)

Programmes on Desertification Programmes on Desertification Jump to: navigation, search Name National Action Programmes on Desertification Agency/Company /Organization United Nations Convention to Combat Desertification Sector Land Focus Area Forestry, Agriculture Topics Co-benefits assessment, GHG inventory, Policies/deployment programs, Background analysis Resource Type Publications Website http://www.unccd.int/actionpro Country Algeria, Benin, Botswana, Burkina Faso, Burundi, Cameroon, Cape Verde, Chad, Democratic Republic of Congo, Djibouti, Egypt, Equatorial Guinea, Eritrea, Ethiopia, Gabon, Gambia, Ghana, Guinea, Kenya, Lesotho, Madagascar, Malawi, Mali, Mauritania, Morocco, Mozambique, Namibia, Niger, Nigeria, Senegal, South Africa, Sudan, Swaziland, Tanzania, Togo, Tunisia, Uganda, Zambia, Zimbabwe

172

Shattuck Lecture: Chronic Infectious Disease and the Future of Health Care Delivery  

Science Journals Connector (OSTI)

...does or does not happen and how to improve it may now represent medicine's most important task. In settings of poverty, the delivery gap can be a gulf, especially in the case of chronic illness. In the rural villages and small towns in Rwanda, Malawi, and Lesotho, where the nongovernmental organization... Work that has been done in low-income countries to build health systems that can respond to AIDS and TB (as well as other acute and chronic diseases) shows that with adequate resources, we can improve care delivery, sharply reducing morbidity and mortality.

Farmer P.E.

2013-12-19T23:59:59.000Z

173

Solar radiation on variously oriented sloping surfaces  

SciTech Connect (OSTI)

Monthly average daily irradiation on surfaces tilted towards the equator and also inclined at various azimuth angles are estimated for two locations in Lesotho and the results are presented. The isotropic model suggested by Liu and Jordan (Trans. of Ashrae, 526, 1962) along with the modified equation of Klein (Solar Energy, 19, 4, 1977) are employed for the estimation purposes. Surface orientations are selected at three inclinations for six different azimuth angles. Conclusions are reached for optimum tilt and orientation for summer, winter and annual collection. Total annual radiation values are computed for all the slopes and orientations.

Gopinathan, K.K. (National Univ. of Lesotho, Roma (South Africa))

1991-01-01T23:59:59.000Z

174

E-Print Network 3.0 - absorption-biological reduction integrated...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

UOW Environment ManagementUOW Environment Management Summary: responses)gy g ( p ) Energy consumption reduction (205) RenewableAlternative energy Carbon (135)gy... ( ) -...

175

RPARTITION GOGRAPHIQUE En Guyane dans la rgion ctire, commune  

E-Print Network [OSTI]

amérindiennes à être parlée sur le territoire de cinq ?tats différents : Venezuela, Guyana, Suriname, Guyane % de locuteurs; et 3000 au Suriname, dont 50% de locuteurs (J. Forte, 2000). Une trentaine de locuteurs de l'Est du Suriname se désignent ainsi par opposition aux Kali'na du Centre et de l'Ouest du

Paris-Sud XI, Université de

176

Revision of the cleptoparasitic bee genus Cleptommation (Hymenoptera: Halictidae)  

E-Print Network [OSTI]

. chibchani n. sp. Distribution: Presently, individuals of the various species are recorded from Cos- ta Rica and Panama in Central America, from Andean Ecuador and Bolivia, across Amazonian Peru and Brazil, and in French Guiana, Guyana, and Suriname along...32. Photomicrographs of female of Cleptommation minutum (Friese), new combina- tion, from Suriname. 30. Lateral habitus. 31. Dorsal habitus. 32. Facial view. ish brown (yellow areas more reddish brown in much older, faded specimens), basal quarter to third...

Engel, Michael S.

2013-11-04T23:59:59.000Z

177

Latin American vertebrate systematic collections: status and management procedures  

E-Print Network [OSTI]

as the Neotropical areas where Spanish and Portuguese are the official languages (Pefaur, 1987) . In this case, the concept was followed, but Guyana, Suriname and Trinidad, in spite of their different languages, were also considered as part as this survey because.... 0 100. 0 Paraguay Peru Puerto Rico Surinam Trinidad Uruguay Venezuela 10 50. 0 100. 0 50. 0 50. 0 TOTAL 94 50 53. 2 14 RESULTS AND DISCUSSION Responses were received from 50 institutions (127 collections), which represent a 53. 2...

Arrizabalaga, M. Begona

2012-06-07T23:59:59.000Z

178

South America, Central America, the Caribbean, and Mexico  

SciTech Connect (OSTI)

Summaries of oil and gas drillings, well completions, production, exploratory wells, exploration activity and wildcat drilling were given for South America, Central America, the Caribbean, and Mexico. The countries, islands, etc. included Argentina, Bahamas, Barbados, Belize, Bolivia, Brazil, Colombia, Costa Rica, Cuba, Dominican Republic, Ecuador, French Guiana, Guatemala, Guyana, Haiti, Honduras, Jamaica, Leeward and Windward Islands, Mexico, Netherlands Antilles, Nicaragua, Panama, Paraguay, Peru, Puerto Rico, El Salvador, Surinam, Trinidad and Venezuela. 16 figures, 120 tables. (DP)

Deal, C.

1981-10-01T23:59:59.000Z

179

LESSONS LEARNED FROM EVENTS NOTIFIED TO THE FRENCH NUCLEAR SAFETY AUTHORITY DURING THE PERIOD 200713 IN THE MEDICAL FIELD  

Science Journals Connector (OSTI)

......led to very high dose levels, to several organs in particular. The doses ranged from 4 to 60 Gy to the skin, 15 Gy to the brain (a few cubic centimetres), from 1 to 8 Gy to the lung and 2 Gy to the heart. Among events concerning medical staff, seven......

Carole Rousse; Paul Cillard; Aurelie Isambert; Marc Valero

2014-10-01T23:59:59.000Z

180

SAFARI 2000 Data Set Released  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Set Released Set Released The ORNL DAAC announces the release of the data set "SAFARI 2000 MISR Level 2 Data, Southern Africa, Dry Season 2000". This data set is a product of the Southern African Regional Science Initiative containing 240 HDF-EOS formatted MISR Level 2 Top-of-Atmosphere/Cloud and Aerosol/Surface Products focused in a southern African study area which includes: Botswana, Lesotho, Malawi, Mozambique, Namibia, South Africa, Swaziland, Zambia, and Zimbabwe. The MISR Level 2 Products are geophysical measurements derived from the Level 1B2 data which consists of parameters that have been geometrically corrected and projected to a standard map grid. The products are in swaths, each derived from a single MISR orbit, where the imagery is 360 km wide and

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Investigation of Radiation-Induced Free Radicals and Luminescence Properties in Fresh Pomegranate Fruits  

Science Journals Connector (OSTI)

Radiation-induced free radicals and luminescence properties were investigated in ?-irradiated (03 kGy) pomegranate (Punica granatum L.) fruits. Photostimulated luminescence (PSL) analysis showed limited applicability, and only 3 kGy-irradiated ...

Hafiz M. Shahbaz; Kashif Akram; Jae-Jun Ahn; Joong-Ho Kwon

2013-04-09T23:59:59.000Z

182

Improved Technique of Hydrogen Content Analysis by Slow Neutron Scattering  

DOE R&D Accomplishments [OSTI]

A slow-neutron-transmission method fro determining the H content of fluorcarbons is described (G.Y.)

Rainwater, L. J.; Havens, W. W. Jr.

1945-02-28T23:59:59.000Z

183

Tenure in REDD | Open Energy Information  

Open Energy Info (EERE)

in REDD in REDD Jump to: navigation, search Name Tenure in REDD Agency/Company /Organization International Institute for Environment and Development Sector Land Focus Area Forestry Topics Implementation, Policies/deployment programs, Resource assessment, Background analysis Resource Type Presentation Website http://www.cbd.int/doc/meeting Country Brazil, Cameroon, Democratic Republic of Congo, Guyana, Indonesia, Malaysia, Papua New Guinea South America, Middle Africa, Middle Africa, South America, South-Eastern Asia, South-Eastern Asia, Melanesia References Tenure in REDD[1] Tenure in REDD Screenshot Background "This report aims to take the debate forward by identifying: a typology of tenure regimes in rainforest countries and some of the challenges they

184

Regional Implementation Plan for CARICOM's Climate Change Resilience  

Open Energy Info (EERE)

Jump to: navigation, search Jump to: navigation, search Name Regional Implementation Plan for CARICOM's Climate Change Resilience Framework Agency/Company /Organization Climate and Development Knowledge Network (CDKN), United Kingdom Department for International Development, Caribbean Community Climate Change Centre (CCCCC) Partner Caribbean Community Climate Change Centre (CCCCC), Caribbean Community Heads of State (CARICOM) Sector Climate, Energy, Land Topics Background analysis, Low emission development planning, Market analysis, Pathways analysis Website http://cdkn.org/project/planni Program Start 2009 Program End 2015 Country Antigua and Barbuda, Bahamas, Barbados, Belize, Dominica, Grenada, Guyana, Haiti, Jamaica, Montserrat, Saint Lucia, Saint Vincent and the Grenadines, St. Kitts and Nevis, Suriname, Trinidad and Tobago

185

An Analysis of New World Mangrove Avifaunas Diversity, Endemism, and Conservation  

E-Print Network [OSTI]

, shrubs, arboreal, or aerial). Water preference: This category indicates if a species has a particular preference for an micro-aquatic environment: fresh water lakes or rivers, salt water estuaries, or areas where they mix (brackish water). 8 As a... 1998). For other localities, the authors worked for at least a year in situ (e.g., Jess Mara river, Juan Diaz, Suriname, French Guyana). If I obtained good asymptotic curves within a week of work, then it seems that their surveys are closed...

Escalona-Segura, Griselda

1999-08-27T23:59:59.000Z

186

An Analysis of Toponymic Homonyms in Gazetteers: Country-Level Duplicate Names in the National Geospatial-Intelligence Agencys Geographic Names Data Base  

E-Print Network [OSTI]

that over half of the countries have more than 13.5 as the maximum count of their unique names having multiple occurrences. Page 9 Country Antigua And Barbuda Macau Andorra Maldives Bahrain No Man?s Land Botswana Nauru Cayman Islands Suriname..., this is bordered by a region of extremely low values in northeastern South America in Suriname and Guyana. Other high value areas include a belt across Europe and Asia, countries of the Middle East, and a small belt across south central Africa. Not surprisingly...

Caldwell, Douglas R.

2008-08-20T23:59:59.000Z

187

A taxonomic revision of the Liophis lineatus complex (Reptilia:Colubridae) of Central and South America  

E-Print Network [OSTI]

t * b*dy f ~Lh' ll e t . AMttH 36121, Guyana 10. Pattern illustrations of the anterior and p* te o 6 dy f L~ih ~ 1' *t . AMNH 97711, Surinam. 11. 8 pl*s f L~*h ~d'1* 1 ~ d t* s intraspecific variation, 12. Pattern illustrations of the anterior... in the eastern portion of their range. In Surinam and the Guiana'sy the lateral stripes occupy less than one quarter of a scale row. In the past, this type of variation has led investigators (Peters and Orejas- Miranda, 1970) to place individuals at opposite...

Michaud, Edward Joseph

2012-06-07T23:59:59.000Z

188

REDD Country Activity Database | Open Energy Information  

Open Energy Info (EERE)

REDD Country Activity Database REDD Country Activity Database Jump to: navigation, search Tool Summary Name: REDD Country Activity Database Agency/Company /Organization: Global Canopy Programme, Forum on Readiness for REDD Sector: Land Focus Area: Forestry Topics: Background analysis Resource Type: Dataset, Case studies/examples User Interface: Website Website: www.theredddesk.org/countries Country: Brazil, Cameroon, Vietnam, Guyana, Tanzania, Indonesia Cost: Free UN Region: Southern Africa, South America, South-Eastern Asia REDD Country Activity Database Screenshot References: REDD Country Activity Database[1] Logo: REDD Country Activity Database The REDD Countries Database is a centralised and collaborative database of the diverse and rapidly evolving range of ongoing REDD activities in

189

Forest Carbon Partnership Facility | Open Energy Information  

Open Energy Info (EERE)

Forest Carbon Partnership Facility Forest Carbon Partnership Facility Jump to: navigation, search Logo: Forest Carbon Partnership Facility Name Forest Carbon Partnership Facility Agency/Company /Organization World Bank Sector Land Focus Area Forestry Topics Co-benefits assessment, Finance Resource Type Lessons learned/best practices, Training materials Website http://www.forestcarbonpartner Country Argentina, Bolivia, Cambodia, Cameroon, Central African Republic, Chile, Colombia, Costa Rica, Democratic Republic of Congo, El Salvador, Equatorial Guinea, Ethiopia, Gabon, Ghana, Guatemala, Guyana, Honduras, Indonesia, Kenya, Laos, Laos, Liberia, Madagascar, Mexico, Moldova, Mozambique, Nepal, Nicaragua, Panama, Papua New Guinea, Paraguay, Peru, Republic of the Congo, Suriname, Tanzania, Thailand, Uganda, Vanuatu, Vietnam

190

ClimateWorks Low Carbon Growth Planning Support | Open Energy Information  

Open Energy Info (EERE)

Jump to: navigation, search Jump to: navigation, search Name Low Carbon Growth Planning Support Agency/Company /Organization ClimateWorks, Project Catalyst, McKinsey and Company Sector Energy, Land Topics Background analysis, Low emission development planning, Policies/deployment programs Country Brazil, China, Democratic Republic of Congo, Egypt, Ethiopia, Guyana, India, Indonesia, Kenya, Malaysia, Mexico, Papua New Guinea South America, Eastern Asia, Middle Africa, Northern Africa, Eastern Africa, South America, Southern Asia, South-Eastern Asia, Eastern Africa, South-Eastern Asia, Central America, Melanesia References LCGP support[1] Low Carbon Growth Plans Advancing Good Practice, August 2009[2] Overview "Achieving development goals depends on enabling poorer countries to

191

Banach-Semikategorien III SitzUngsbcrichtco dct Ostcm:i<:hlsehen Akaderoie dcr Wiasensc:haften  

E-Print Network [OSTI]

ist leicht einzusehen, daB der Teilraum aller spalten- und zeilenendliehen Matrizen [gyX] (d. h. flir in 8.1, dann be trachten wir den NormabsehluB des Teilraumes aller Matrizen [gyX], flir die gyX "" 0 nur flir endlich viele (X, Y) gilt (spater gemeinhin endliche Matrizen genannt), in [[G

Michor, Peter W.

192

Dosimetric Comparison of High-Dose-Rate Brachytherapy and Intensity-Modulated Radiation Therapy as a Boost to the Prostate  

SciTech Connect (OSTI)

Purpose: We compared the dose conformity of two radiation modalities: high-dose-rate brachytherapy (HDR BT) and intensity-modulated radiation therapy (IMRT) to deliver a boost to the prostate after external beam radiotherapy (EBRT). Methods and Materials: Ten successive patients with prostate adenocarcinoma treated with a single 10-Gy HDR BT boost after EBRT were investigated. Four theoretical IMRT plans were computed: (a) 32.85 Gy IMRT and (b) 26 Gy IMRT with CTV-PTV expansions, doses corresponding to the equivalent dose in 2-Gy fractions (EQD2) of one 10-Gy fraction calculated with a prostate alpha/beta ratio of respectively 1.5 and 3 Gy; and (c) 32.85 Gy IMRT and (d) 26 Gy IMRT without CTV-PTV expansions. The dose-volume histogram values converted in EQD2 with an alpha/beta ratio of 3 Gy for the organs at risk were compared. Results: The HDR BT plan delivered higher mean doses to the PTV compared with IMRT plans. In all, 33% of the rectal volume received a mean dose of 5.32 +- 0.65 Gy and 20% of bladder volume received 4.61 +- 1.24 Gy with HDR BT. In comparison, doses delivered with IMRT were respectively 13.4 +- 1.49 Gy and 10.81 +- 4 Gy, even if only 26 Gy was prescribed to the PTV with no CTV-PTV expansion (p < 0.0001). The hot spots inside the urethra were greater with HDR BT but acceptable. Conclusions: Use of HDR BT produced a more conformal plan for the boost to the prostate than IMRT even without CTV-PTV expansions.

Hermesse, Johanne, E-mail: jhermesse@chu.ulg.ac.b [Department of Radiation Oncology, Liege University Hospital, Liege (Belgium); Biver, Sylvie; Jansen, Nicolas [Department of Radiation Oncology, Liege University Hospital, Liege (Belgium); Lenaerts, Eric [Department of Medical Physics, Liege University Hospital, Liege (Belgium); Nickers, Philippe [Department of Radiation Oncology, Oscar Lambret Center, Lille (France)

2010-01-15T23:59:59.000Z

193

Validation and Routine monitoring of Electron Beam sterilization  

E-Print Network [OSTI]

;2 Absorbed dose: Energy absorbed per unit mass 1 Gray (Gy) = 1 J/kg dose range for sterilization: 10-50 k after irradiation #12;5 Dosimeter examples #12;6 Calorimeter for dose measurement at high energy (Me Measures change in temperature Dose range: 1.5 kGy ­50 kGy Range based on : Tmax = 500C Tmin = 20C Stable

194

A Novel Unified Approach to Invariance in Control  

E-Print Network [OSTI]

May 20, 2014 ... Category 3: Applications -- Science and Engineering (Control Applications ) ... Gy?r, Hungary Department of Industrial and Systems Engineering,...

Zoltn Horvth

2014-05-20T23:59:59.000Z

195

E-Print Network 3.0 - applied high energy Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

with high ener- gy efficiency. This is highly relevant to buildings... ), and gross energy consumption in buildings ... Source: Ris National Laboratory Collection:...

196

arXiv:nucl-th/0412037v110Dec2004 Transport Theories for Heavy Ion Collisions in the 1 AGeV  

E-Print Network [OSTI]

. Danielewicz8 , C. Fuchs9 , T. Gaitanos10 , C.M. Ko6 , A. Larionov5 , M. Reiter4 , Gy. Wolf11 , J. Aichelin2 1

Heger, Alexander

197

Caribbean Community (CARICOM) Sustainable Energy Roadmap and Strategy |  

Open Energy Info (EERE)

Caribbean Community (CARICOM) Sustainable Energy Roadmap and Strategy Caribbean Community (CARICOM) Sustainable Energy Roadmap and Strategy Jump to: navigation, search Name Caribbean Community (CARICOM) Sustainable Energy Roadmap and Strategy Agency/Company /Organization Inter-American Development Bank, World Watch Institute (WWI) Sector Climate, Energy Focus Area Renewable Energy, Economic Development, Energy Efficiency, Greenhouse Gas, Grid Assessment and Integration, Industry, People and Policy, Transportation Topics Background analysis, Baseline projection, Finance, GHG inventory, Implementation, Low emission development planning, -Roadmap, Market analysis, Policies/deployment programs, Resource assessment, Technology characterizations Program Start 2012 Program End 2012 Country Antigua and Barbuda, Bahamas, Barbados, Belize, Dominica, Grenada, Guyana, Haiti, Jamaica, Montserrat, St. Lucia, St. Vincent and the Grenadines, St. Kitts and Nevis, Suriname, Trinidad and Tobago

198

Energy-Economic Information System (SIEE) | Open Energy Information  

Open Energy Info (EERE)

Energy-Economic Information System (SIEE) Energy-Economic Information System (SIEE) Jump to: navigation, search Tool Summary LAUNCH TOOL Name: Energy-Economic Information System (SIEE) Database Agency/Company /Organization: Latin American Energy Organization Sector: Energy Topics: Baseline projection, GHG inventory, Background analysis Resource Type: Dataset Website: www.olade.org/sieeEn.html Country: Costa Rica, El Salvador, Guatemala, Honduras, Nicaragua, Panama, Mexico, Argentina, Bolivia, Brazil, Chile, Colombia, Ecuador, Guyana, Paraguay, Peru, Suriname, Uruguay, Venezuela, Barbados, Cuba, Grenada, Haiti, Jamaica, Trinidad & Tobago, Dominican Republic Central America, Central America, Central America, Central America, Central America, Central America, Central America, South America, South America, South America, South America, South America, South America, South America, South America, South America, South America, South America, South America, Caribbean, Caribbean, Caribbean, Caribbean, Caribbean, Caribbean, Caribbean

199

OLADE-Latin American and Caribbean Energy Efficiency Seminar | Open Energy  

Open Energy Info (EERE)

OLADE-Latin American and Caribbean Energy Efficiency Seminar OLADE-Latin American and Caribbean Energy Efficiency Seminar Jump to: navigation, search Tool Summary LAUNCH TOOL Name: OLADE-Latin American and Caribbean Energy Efficiency Seminar Agency/Company /Organization: Latin America Energy Organization Sector: Energy Focus Area: Energy Efficiency Topics: Implementation, Technology characterizations Resource Type: Presentation, Webinar, Workshop, Lessons learned/best practices Website: www.olade.org/eficiencia/indexEn.html Country: Costa Rica, El Salvador, Guatemala, Honduras, Nicaragua, Panama, Mexico, Argentina, Bolivia, Brazil, Chile, Colombia, Ecuador, Guyana, Paraguay, Peru, Suriname, Uruguay, Venezuela, Barbados, Cuba, Grenada, Haiti, Jamaica, Trinidad & Tobago, Dominican Republic Central America, Central America, Central America, Central America, Central America, Central America, Central America, South America, South America, South America, South America, South America, South America, South America, South America, South America, South America, South America, South America, Caribbean, Caribbean, Caribbean, Caribbean, Caribbean, Caribbean, Caribbean

200

REDD+ Country Readiness Preparation Proposals | Open Energy Information  

Open Energy Info (EERE)

form form View source History View New Pages Recent Changes All Special Pages Semantic Search/Querying Get Involved Help Apps Datasets Community Login | Sign Up Search Page Edit with form History Facebook icon Twitter icon » REDD+ Country Readiness Preparation Proposals Jump to: navigation, search Tool Summary LAUNCH TOOL Name: REDD+ Country Readiness Preparation Proposals Agency/Company /Organization: World Resources Institute Focus Area: Forestry Topics: Implementation, Policies/deployment programs, Pathways analysis Resource Type: Publications, Guide/manual Website: www.wri.org/publication/getting-ready Country: Democratic Republic of Congo, Ghana, Guyana, Indonesia, Madagascar, Mexico, Suriname, Panama Middle Africa, Western Africa, South America, South-Eastern Asia, Eastern Africa, Central America, South America, Central America

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Category:LEDS Example | Open Energy Information  

Open Energy Info (EERE)

Example Example Jump to: navigation, search This page displays examples of country-scale low emission development strategies Pages in category "LEDS Example" The following 12 pages are in this category, out of 12 total. B Bangladesh Climate Change Strategy and Action Plan Brazil National Plan on Climate Change (PNMC) C China's National Climate Change Programme E ESMAP-South Africa-Low Carbon Growth Strategy G Guyana's Low Carbon Development Strategy I India National Action Plan on Climate Change Indonesia National Action Plan Addressing Climate Change J Japan-Action Plan for Achieving a Low-Carbon Society M Mexico's Special Program on Climate Change S Singapore National Climate Change Strategy T Thailand-National Energy Policy and Development Plan U United Kingdom Low Carbon Transition Plan

202

Climate Change and the Macroeconomy in the Caribbean Basin: Analysis and  

Open Energy Info (EERE)

Macroeconomy in the Caribbean Basin: Analysis and Macroeconomy in the Caribbean Basin: Analysis and Projections to 2099 Jump to: navigation, search Name Climate Change and the Macroeconomy in the Caribbean Basin: Analysis and Projections to 2099 Agency/Company /Organization United Nations Economic Commission for Latin America and the Caribbean Sector Energy, Land, Climate Topics GHG inventory, Policies/deployment programs, Co-benefits assessment, - Macroeconomic, Background analysis Resource Type Publications Website http://www.eclac.org/publicaci Country Aruba, Barbados, Dominican Republic, Guyana, Jamaica, Montserrat, Netherlands Antilles, Saint Lucia, Trinidad and Tobago Caribbean, Caribbean, Caribbean, South America, Caribbean, Caribbean, Caribbean, Caribbean, Caribbean References Climate Change and the Macroeconomy in the Caribbean Basin: Analysis and Projections to 2099[1]

203

OLADE Sustainable Energy Planning Manual | Open Energy Information  

Open Energy Info (EERE)

OLADE Sustainable Energy Planning Manual OLADE Sustainable Energy Planning Manual Jump to: navigation, search Tool Summary Name: OLADE Sustainable Energy Planning Manual Agency/Company /Organization: Latin American Energy Organization Sector: Energy Focus Area: Energy Efficiency, Renewable Energy Topics: Implementation, Background analysis Website: www.olade.org/proyectoPlanificacionEnergetica.html Country: Costa Rica, El Salvador, Guatemala, Honduras, Nicaragua, Panama, Mexico, Argentina, Bolivia, Brazil, Chile, Colombia, Ecuador, Guyana, Paraguay, Peru, Suriname, Uruguay, Venezuela, Barbados, Cuba, Grenada, Haiti, Jamaica, Trinidad & Tobago, Dominican Republic Central America, Central America, Central America, Central America, Central America, Central America, Central America, South America, South America, South America, South America, South America, South America, South America, South America, South America, South America, South America, South America, Caribbean, Caribbean, Caribbean, Caribbean, Caribbean, Caribbean, Caribbean

204

Legal Energy Information System (SIEL) Database | Open Energy Information  

Open Energy Info (EERE)

Legal Energy Information System (SIEL) Database Legal Energy Information System (SIEL) Database Jump to: navigation, search Tool Summary Name: Legal Energy Information System (SIEL) Database Agency/Company /Organization: Latin American Energy Organization Sector: Energy Focus Area: Renewable Energy Topics: Policies/deployment programs, Background analysis Resource Type: Dataset Website: www.olade.org/sielEn.html Country: Costa Rica, El Salvador, Guatemala, Honduras, Nicaragua, Panama, Mexico, Argentina, Bolivia, Brazil, Chile, Colombia, Ecuador, Guyana, Paraguay, Peru, Suriname, Uruguay, Venezuela, Barbados, Cuba, Grenada, Haiti, Jamaica, Trinidad & Tobago, Dominican Republic Central America, Central America, Central America, Central America, Central America, Central America, Central America, South America, South America, South America, South America, South America, South America, South America, South America, South America, South America, South America, South America, Caribbean, Caribbean, Caribbean, Caribbean, Caribbean, Caribbean, Caribbean

205

Regional Implementation Plan for CARICOM's Climate Change Resilience  

Open Energy Info (EERE)

(Redirected from CDKN-CARICOM-Trinidad and Tobago-A Regional Implementation (Redirected from CDKN-CARICOM-Trinidad and Tobago-A Regional Implementation Plan for CARICOM's Regional Climate Change Resilience Framework) Jump to: navigation, search Name Regional Implementation Plan for CARICOM's Climate Change Resilience Framework Agency/Company /Organization Climate and Development Knowledge Network (CDKN), United Kingdom Department for International Development, Caribbean Community Climate Change Centre (CCCCC) Partner Caribbean Community Climate Change Centre (CCCCC), Caribbean Community Heads of State (CARICOM) Sector Climate, Energy, Land Topics Background analysis, Low emission development planning, Market analysis, Pathways analysis Website http://cdkn.org/project/planni Program Start 2009 Program End 2015 Country Antigua and Barbuda, Bahamas, Barbados, Belize, Dominica, Grenada, Guyana, Haiti, Jamaica, Montserrat, Saint Lucia, Saint Vincent and the Grenadines, St. Kitts and Nevis, Suriname, Trinidad and Tobago

206

Office of Educational Programs | FaST Professor Profiles  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Sharon Lall-Ramnarine Sharon Lall-Ramnarine Assistant Professor Queensborough Community College, CUNY Chemistry Department Contact Information: 222-05 56th Avenue Bayside, NY 11364 (718) 281-5572 slallramnarine@qcc.cuny.edu Education University of Guyana B.Sc. Chemistry 1995 Chemistry w/ minor in Biology Queens College, CUNY M.A. 1998 Chemistry The Graduate Center, City University of NY M. Phil 2003 Chemistry The Graduate Center, City University of NY Ph.D. 2003 Analytical Chemistry Positions & Employment 2004 - Present Assistant Professor of Chemistry, Queensborough Community College, CUNY 2001 - Present Research Collaborator / Guest in Chemistry, Brookhaven Nat. Lab 2/2003 - 5/2003 Adjunct Lecturer in Chemistry, Queens College, CUNY 8/2001 - 5/2002 Graduate Assistant in Chemistry, Queens College, CUNY

207

CDKN-CARICOM-A Regional Implementation Plan for CARICOM's Regional  

Open Energy Info (EERE)

CARICOM-A Regional Implementation Plan for CARICOM's Regional CARICOM-A Regional Implementation Plan for CARICOM's Regional Climate Change Resilience Framework Jump to: navigation, search Name CDKN-CARICOM-A Regional Implementation Plan for CARICOM's Regional Climate Change Resilience Framework Agency/Company /Organization Climate and Development Knowledge Network (CDKN), United Kingdom Department for International Development Partner Caribbean Community Climate Change Centre (CCCCC), Caribbean Community Heads of State (CARICOM) Sector Climate, Energy, Land Topics Background analysis, Market analysis, Pathways analysis Website http://cdkn.org/project/planni Program Start 2010 Country Antigua and Barbuda, The Bahamas, Barbados, Belize, Dominica, Grenada, Guyana, Haiti, Jamaica, Montserrat, Saint Lucia, St. Kitts and Nevis, St. Vincent and the Grenadines, Suriname, Trinidad and Tobago

208

Revisiting Low-Dose Total Skin Electron Beam Therapy in Mycosis Fungoides  

SciTech Connect (OSTI)

Purpose: Total skin electron beam therapy (TSEBT) is a highly effective treatment for mycosis fungoides (MF). The standard course consists of 30 to 36 Gy delivered over an 8- to 10-week period. This regimen is time intensive and associated with significant treatment-related toxicities including erythema, desquamation, anhydrosis, alopecia, and xerosis. The aim of this study was to identify a lower dose alternative while retaining a favorable efficacy profile. Methods and Materials: One hundred two MF patients were identified who had been treated with an initial course of low-dose TSEBT (5-<30 Gy) between 1958 and 1995. Patients had a T stage classification of T2 (generalized patch/plaque, n = 51), T3 (tumor, n = 29), and T4 (erythrodermic, n = 22). Those with extracutaneous disease were excluded. Results: Overall response (OR) rates (>50% improvement) were 90% among patients with T2 to T4 disease receiving 5 to <10 Gy (n = 19). In comparison, OR rates between the 10 to <20 Gy and 20 to <30 Gy subgroups were 98% and 97%, respectively. There was no significant difference in median progression free survival (PFS) in T2 and T3 patients when stratified by dose group, and PFS in each was comparable to that of the standard dose. Conclusions: OR rates associated with low-dose TSEBT in the ranges of 10 to <20 Gy and 20 to <30 Gy are comparable to that of the standard dose ({>=} 30 Gy). Efficacy measures including OS, PFS, and RFS are also favorable. Given that the efficacy profile is similar between 10 and <20 Gy and 20 and <30 Gy, the utility of TSEBT within the lower dose range of 10 to <20 Gy merits further investigation, especially in the context of combined modality treatment.

Harrison, Cameron, E-mail: cameronh@stanford.edu [Department of Dermatology, Stanford Cancer Center, Stanford, California (United States); Young, James; Navi, Daniel [Department of Dermatology, Stanford Cancer Center, Stanford, California (United States); Riaz, Nadeem [Department of Radiation Oncology, Stanford Cancer Center, Stanford, California (United States); Lingala, Bharathi; Kim, Youn [Department of Dermatology, Stanford Cancer Center, Stanford, California (United States); Hoppe, Richard [Department of Radiation Oncology, Stanford Cancer Center, Stanford, California (United States)

2011-11-15T23:59:59.000Z

209

Experimental investigation of the 100 keV X-ray dose response of the high-temperature thermoluminescence in LiF:Mg,Ti (TLD-100): theoretical interpretation using the unified interaction model  

Science Journals Connector (OSTI)

......measured from 1 to 50 000 Gy using 100 keV X rays at the European Synchroton Radiation Facility. Glow curves were deconvoluted into component...from 1 to 50,000 Gy using 100 keV X rays at the European Synchroton Radiation Facility. Glow curves were deconvoluted into component......

J. Livingstone; Y. S. Horowitz; L. Oster; H. Datz; M. Lerch; A. Rosenfeld; A. Horowitz

2010-03-01T23:59:59.000Z

210

Dose-Response Effect of Charged Carbon Beam on Normal Rat Retina Assessed by Electroretinography  

SciTech Connect (OSTI)

Purpose: To compare the effects of carbon beam irradiation with those of proton beam irradiation on the physiology of the retina of rats. Methods and Materials: Eight-week-old Wister rats were used. The right eyes were irradiated with carbon beam (1, 2, 4, 8, and 16 Gy) or proton beam (4, 8, 16, and 24 Gy) with the rats under general anesthesia. Electroretinograms were recorded 1, 3, 6, and 12 months after the irradiation, and the amplitudes of the a and b waves were compared with those of control rats. Results: The amplitude of b waves was reduced more than that of a waves at lower irradiation doses with both types of irradiation. With carbon ion irradiation, the amplitudes of the b wave were significantly reduced after radiation doses of 8 and 16 Gy at 6 months and by radiation doses of 4, 8, and 16 Gy at 12 months. With proton beam irradiation, the b-wave amplitudes were significantly reduced after 16 and 24 Gy at 6 months and with doses of 8 Gy or greater at 12 months. For the maximum b-wave amplitude, a significant difference was observed in rats irradiated with carbon beams of 4 Gy or more and with proton beams of 8 Gy or more at 12 months after irradiation. Conclusions: These results indicate that carbon beam irradiation is about two times more damaging than proton beam irradiation on the rat retina at the same dose.

Mizota, Atsushi, E-mail: mizota-a@med.teikyo-u.ac.j [Department of Ophthalmology, Teikyo University School of Medicine, Tokyo (Japan); Department of Ophthalmology, Juntendo University Urayasu Hospital, Urayasu (Japan); Tanaka, Minoru [Department of Ophthalmology, Juntendo University Urayasu Hospital, Urayasu (Japan); Kubota, Mariko; Negishi, Hisanari [Department of Ophthalmology, National Hospital Organization Chiba Medical Center, Chiba (Japan); Watanabe, Emiko [Department of Ophthalmology, Teikyo University School of Medicine, Tokyo (Japan); Tsuji, Hiroshi; Miyahara, Nobuyuki; Furusawa, Yoshiya [National Institute of Radiological Sciences, Chiba (Japan)

2010-12-01T23:59:59.000Z

211

Angiotensin Converting Enzyme Inhibitors Mitigate Collagen Synthesis Induced by a Single Dose of Radiation to the Whole Thorax  

Science Journals Connector (OSTI)

......pneumonitis after whole-thoracic irradiation (WTI) even when therapy is started up to one...compared to those of animals receiving 13 Gy WTI alone. Based upon directives from the IACUC...after 13 Gy whole- thoracic irradiation (WTI). Drugs were started 1 week after irradia......

Lakhan Kma; Feng Gao; Brian L. Fish; John E. Moulder; Elizabeth R. Jacobs; Meetha Medhora

2012-01-01T23:59:59.000Z

212

Effects of High Dietary Iron and Gamma Radiation on Oxidative Stress and Bone  

E-Print Network [OSTI]

. Male Sprague-Dawley rats (15-weeks old, n=32) were randomized to receive an adequate (45 mg Fe/kg diet) or high (650 mg Fe/kg diet) Fe diet for 4 weeks and either 3 Gy (8 fractions, 0.375 Gy each) of 137Cs radiation (?RAD) or sham exposure every other...

Yuen, Evelyn P

2013-04-19T23:59:59.000Z

213

New Centers and Training Programs atNew Centers and Training Programs at the interface of nanotechnology and  

E-Print Network [OSTI]

on integration of nanotechnology and biology/medicine � World Fastest Transistor Transistor Laser 2 g p g gy gy of nanotechnology and biology Rashid Bashir Electrical and Computer Engineering & Bioengineeringp g g g g Director, Micro and Nanotechnology Laboratory University of Illinois at Urbana-Champaign, IL. USA 1 #12;Micro

Bashir, Rashid

214

Inhibition of Potential Lethal Damage Repair and Related Gene Expression after Carbon-ion Beam Irradiation to Human Lung Cancer Grown in Nude Mice  

Science Journals Connector (OSTI)

......Gy for X-ray and 5 Gy for car- bon-ion beam because each...after exposure to X-ray or car- bon-ion beams was reported...GCAGCCGCTATTACCGTATC TGTGCCAGTGTCATCATCAA Genes defective in diseases associated with...after exposure to X-ray or car- bon-ion beams has been observed......

Tomoyasu Yashiro; Kumiko Koyama-Saegusa; Takashi Imai; Takehiko Fujisawa; Tadaaki Miyamoto

2007-09-01T23:59:59.000Z

215

Cell cycle responses to low-dose ionizing radiation.  

Science Journals Connector (OSTI)

...47, 2006] 5178 Low-dose hyper-radiosensitivity...radiosensitivity of cells to doses of ionizing radiation less than 0.5 Gy...connection between low-dose HRS survival, Ataxia...the low dose radiation range (0-1 Gy). MR4 cells...

Sarah A. Krueger; George D. Wilson; Michael C. Joiner; and Brian Marples

2006-04-15T23:59:59.000Z

216

Ionizing Radiation-induced, Mitochondria-dependent Generation of Reactive Oxygen/Nitrogen  

Science Journals Connector (OSTI)

...exposing cells to ionizing radiation. In the 1-10 Gy dose range, the amount...demonstrated that ionizing radiation in the therapeutic dose range stimulates a...exposing cells to ionizing radiation. In the 1-10 Gy dose range, the amount...

J. Kevin Leach; Glenn Van Tuyle; Peck-Sun Lin; Rupert Schmidt-Ullrich; and Ross B. Mikkelsen

2001-05-15T23:59:59.000Z

217

Activation of mitogen-activated protein kinase pathway by extremely low-dose ionizing radiation  

Science Journals Connector (OSTI)

X-ray irradiation at very low doses, between 2 and 5 cGy, stimulated activity of a member of the mitogen-activated protein (MAP) kinase, the extracellular signal-regulated kinase (ERK) 1/2 in normal human diploid cells. Higher doses of irradiation at more than 1 Gy induced phosphorylation of ERK1/2 and accumulated p53 protein. Phosphorylation of ERK1/2 decreased with doses down to 50 cGy, however, doses of between 2 and 5 cGy phosphorylated ERK1/2 as efficiently as higher doses of X-rays, while the p53 protein level was no longer changed by doses below 50 cGy. Ataxia telangiectasia-mutated (ATM)-dependent phosphorylation of p53 protein at Ser15 and histone H2AX at Ser139 was only observed at higher doses of more than 10 cGy of X-rays. We found that the MEK1 inhibitor, PD98059, and the specific epidermal growth factor receptor tyrosine kinase inhibitor, AG1478, decreased phosphorylation of the ERK1/2 proteins induced by 2 cGy or 6 Gy of X-rays. These results indicate that a limited range of low-dose ionizing radiation differentially activates ERK1/2 kinases via activation of the epidermal growth factor receptor and MAP kinaseERK kinase, which mediates various effects of cells receiving very low doses of ionizing radiation.

Keiji Suzuki; Seiji Kodama; Masami Watanabe

2003-01-01T23:59:59.000Z

218

p53-Mediated Regulation of Proliferating Cell Nuclear Antigen Expression in Cells Exposed to Ionizing Radiation  

Science Journals Connector (OSTI)

...exposed to increasing doses of IR at 24 h posttransfection...cellular response to ionizing radiation in which p53-mediated...IR at 12 Gy, a dose that induced maximal...the 1- to 4-Gy range does not effectively...because a high radiation dose is used and the...

Jin Xu; Gilbert F. Morris

1999-01-01T23:59:59.000Z

219

Inactivation of 14-3-3? Influences Telomere Behavior and Ionizing Radiation-Induced Chromosomal Instability  

Science Journals Connector (OSTI)

...per dish was chosen to ensure that about 50 colonies would survive a particular radiation dose treatment. Cells were exposed to ionizing radiation in the dose range of 0 to 8 Gy at room temperature using a 137Cs ray at a dose rate of 1.1 Gy...

Sonu Dhar; Jeremy A. Squire; M. Prakash Hande; Raymund J. Wellinger; Tej K. Pandita

2000-10-01T23:59:59.000Z

220

Secondary neutron doses in proton therapy treatments of ocular melanoma and craniopharyngioma  

Science Journals Connector (OSTI)

......as the non-treated eye, the healthy brain tissue etc. and these should be taken...Non-treated eye 11.42 10.64 121.5 Brain 4.55 8.09 36.8 Thyroid 3.33 8...neutron absorbed doses received by the brain (1.5 microGy Gy1) and three times lower......

J. Farah; R. Sayah; F. Martinetti; L. Donadille; V. Lacoste; J. Hrault; S. Delacroix; C. Nauraye; I. Vabre; C. Lee; W. E. Bolch; I. Clairand

2014-10-01T23:59:59.000Z

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Dosimetric performance evaluation regarding proton beam incident angles of a lithium-based AB-BNCT design  

Science Journals Connector (OSTI)

......suitable for the treatments of deep-seated brain tumours, such as glioblastoma multiforme...large energy deposition in the skin and the brain surface. The use of beryllium target with...60.0 RBE-Gy, (e) maximum healthy brain dose 12.5 RBE-Gy and (f) maximum......

Pei-Yi Lee; Yuan-Hao Liu; Shiang-Huei Jiang

2014-10-01T23:59:59.000Z

222

AFRRI Form 331 (12/2007) Page 1 of 6Patient's service number: Biodosimetry Worksheet  

E-Print Network [OSTI]

) Estimated time post-exposure (h) Dose (Gy) Reference radiation quality and dose rate (Gy/min) Time onset Record of Radiation Dose, Contamination, and Acute Radiation Sickness Response) Reporting Authority-mail: Country of origin: Date dose assessed (yymmdd): Time dose assessed: Place: Nature of exposure: radiation

223

The Estimation of Molecular and Cytogenetic Effects in Mice Exposed to Chronic Low Dose-Rate Gamma-Radiation  

Science Journals Connector (OSTI)

Molecular and cytogenetic parameters were estimated in male CBA/lac mice exposed to chronic low dose-rate ?-radiation (62 cGy/year) for 40, 80, 120, 210, and 365 days. After 40 days of exposure (6.7 cGy), sple...

A. N. Osipov; A. L. Elakov; P. V. Puchkov

2002-10-01T23:59:59.000Z

224

Lack of Radiation Maculopathy After Palladium-103 Plaque Radiotherapy for Iris Melanoma  

SciTech Connect (OSTI)

Purpose: To report on the risk of radiation maculopathy for iris and iridociliary melanomas treated by {sup 103}Pd plaque radiotherapy. Methods and Materials: This is a retrospective clinical case series of 30 eyes in 30 patients with melanomas limited to the iris or invading the ciliary body. The main outcome measures included demographic information, laterality, tumor size, location, visual acuity, radiation dose, local control, retinal evaluation, and duration of follow-up. Results: Thirty patients were followed for a median 36 months (range, 12-90 months). Sixteen of 30 tumors (53%) were pure iris melanomas, and 14 (47%) were primary iris melanomas extending into the ciliary body. Radiation dosimetry showed that the median tumor apex dose was 85 Gy (range, 75-100 Gy), lens dose 43.5 Gy (range, 17.8-60 Gy), fovea dose 1.8 Gy (range, 1.3-5 Gy), and central optic disc dose 1.7 Gy (range, 1.3-4.7 Gy). Cataracts developed in 20 of the 28 phakic eyes (71.4%). No patient in this series developed radiation maculopathy or radiation optic neuropathy. Last best-corrected visual acuity was {>=}20/25 in 28 patients (93%) at a median 36 months' follow-up. Conclusion: Though visual acuities were transiently affected by radiation cataract, no radiation maculopathy or optic neuropathy has been noted after {sup 103}Pd treatment of iris and iridociliary melanomas.

Yousef, Yacoub A. [New York Eye Cancer Center, New York Eye and Ear Infirmary, and New York University School of Medicine, New York, NY (United States); Finger, Paul T., E-mail: pfinger@eyecancer.com [New York Eye Cancer Center, New York Eye and Ear Infirmary, and New York University School of Medicine, New York, NY (United States)

2012-07-15T23:59:59.000Z

225

ESI_CS_Zirkle 1.6.indd  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Zirkle Fruit case study ZIRKLE FRUIT Utility Benton PUD ProJect Refrigeration, compressed air, door, and lighting upgrades eNerGy SAViNGS 3,441,532 kWhy eNerGy coSt SAViNGS...

226

Radiochromic film for medical radiation dosimetry Martin J. Butsona,b  

E-Print Network [OSTI]

Cheunga , Peter Metcalfeb a Department of Physics and Materials Science, City University of Hong Kong, Tat, which have accurate dose measurement ranges from less than 1 Gy up to many kGy. A relatively energy independent dose response combined with automatic development of radiochromic film products has made

Yu, K.N.

227

SCH66336 (Sarasar), an oral farnesyl transferase inhibitor, synergizes with temozolomide and radiation therapy for orthotopic malignant gliomas  

Science Journals Connector (OSTI)

...completed prior to and at RT completion, and skin toxicity was assessed at week 3 and RT completion. We recorded patient demographics, body mass index (BMI), disease and treatment...Gy + 10 Gy boost. At RT completion, all patients had ST...

Jessica W. Barnes; Claire Sauvageot; Naren Ramakrishna; Jamie L. Dellagatta; Deviney Chaponis; Patrick Wen; Charles Stiles; Andrew Kung; and Mark W. Kieran

2006-04-15T23:59:59.000Z

228

Prospective Studies of Body Mass Index with Head and Neck Cancer Incidence and Mortality  

Science Journals Connector (OSTI)

...completed prior to and at RT completion, and skin toxicity was assessed at week 3 and RT completion. We recorded patient demographics, body mass index (BMI), disease and treatment...50 Gy 10 Gy boost. At RT completion, all patients had ST...

Mia M. Gaudet; Alpa V. Patel; Juzhong Sun; Janet S. Hildebrand; Marjorie L. McCullough; Amy Y. Chen; and Susan M. Gapstur

2012-03-01T23:59:59.000Z

229

Gene Expression Analysis of Apoptosis and Oxidative Stress in Mouse Brain  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Analysis of Apoptosis and Oxidative Stress in Mouse Brain Analysis of Apoptosis and Oxidative Stress in Mouse Brain After Low-dose and Acute Radiation Exposure Daila Gridley Loma Linda University & Medical Center Abstract Purpose: 1) To examine the induction of oxidative stress and apoptosis-associated gene expression profiles in brain after whole-body irradiation with low-dose/low-dose-rate (LDR) photons and acute exposure to photons 2) to compare these radiation-induced effects with those produced by LDR and acute exposure to protons. Material and Methods: C57BL/6 mice were exposed to 2 Gy of photons or protons at 0.8 Gy/min and 0.9 Gy/min, respectively, both with and without pre-exposure to 0.01 Gy LDR γ-rays (57Co) at 0.03 cGy/h. Brain tissues were harvested and quick-frozen for analyses by quantitative RTPCR at 56

230

Weekly Dose-Volume Parameters of Mucosa and Constrictor Muscles Predict the Use of Percutaneous Endoscopic Gastrostomy During Exclusive Intensity-Modulated Radiotherapy for Oropharyngeal Cancer  

SciTech Connect (OSTI)

Purpose: To define predictors of percutaneous endoscopic gastrostomy (PEG) use during intensity-modulated radiotherapy (IMRT) for oropharyngeal cancer. Methods and Materials: Data for 59 consecutive patients treated with exclusive IMRT at a single institution were recovered. Of 59 patients, 25 were treated with hyperfractionation (78 Gy, 1.3 Gy per fraction, twice daily; 'HYPER'); and 34 of 59 were treated with a once-daily fractionation schedule (66 Gy, 2.2 Gy per fraction, or 70 Gy, 2 Gy per fraction; 'no-HYPER'). On the basis of symptoms during treatment, a PEG tube could have been placed as appropriate. A number of clinical/dosimetric factors, including the weekly dose-volume histogram of oral mucosa (OM DVHw) and weekly mean dose to constrictors and larynx, were considered. The OM DVHw of patients with and without PEG were compared to assess the most predictive dose-volume combinations. Results: Of 59 patients, 22 needed a PEG tube during treatment (for 15 of 22, {>=}3 months). The best cutoff values for OM DVHw were V9.5 Gy/week <64 cm{sup 3} and V10 Gy/week <54 cm{sup 3}. At univariate analysis, fractionation, mean weekly dose to OM and superior and middle constrictors, and OM DVHw were strongly correlated with the risk of PEG use. In a stepwise multivariate logistic analysis, OM V9.5 Gy/week ({>=}64 vs. <64 cm{sup 3}) was the most predictive parameter (odds ratio 30.8, 95% confidence interval 3.7-254.2, p = 0.0015), confirmed even in the no-HYPER subgroup (odds ratio 21, 95% CI 2.1 confidence interval 210.1, p = 0.01). Conclusions: The risk of PEG use is drastically reduced when OM V9.5-V10 Gy/week is <50-60 cm{sup 3}. These data warrant prospective validation.

Sanguineti, Giuseppe, E-mail: gsangui1@jhmi.ed [Department of Radiation Oncology, University of Texas Medical Branch, Galveston, TX (United States); Department of Radiation Oncology and Molecular Radiation Sciences, Johns Hopkins University, Baltimore, MD (United States); Gunn, G. Brandon; Parker, Brent C.; Endres, Eugene J. [Department of Radiation Oncology, University of Texas Medical Branch, Galveston, TX (United States); Zeng Jing [Department of Radiation Oncology and Molecular Radiation Sciences, Johns Hopkins University, Baltimore, MD (United States); Fiorino, Claudio [Department of Medical Physics, San Raffaele Scientific Institute, Milano (Italy)

2011-01-01T23:59:59.000Z

231

Low Dose Suppression of Neoplastic Transformation in Vitro  

SciTech Connect (OSTI)

This grant was to study the low dose suppression of neoplastic transformation in vitro and the shape of the dose-response curve at low doses and dose-rates of ionizing radiation. Previous findings had indicated a suppression of transformation at dose <10cGy of low-LET radiation when delivered at high dose-rate. The present study indicates that such suppression extends out to doses in excess of 100cGy when the dose (from I-125 photons) is delivered at dose-rates as low as 0.2 mGy/min and out to in excess of {approx}25cGy the highest dose studied at the very low dose-rate of 0.5 mGy/day. We also examined dose-rate effects for high energy protons (which are a low-LET radiation) and suppression was evident below {approx}10cGy for high dose-rate delivery and at least out to 50cGy for low dose-rate (20cGy/h) delivery. Finally, we also examined the effect of low doses of 1 GeV/n iron ions (a high-LET radiation) delivered at high dose-rate on transformation at low doses and found a suppression below {approx}10cGy that could be attributable to an adaptive response in bystander cells induced by the associated low-LET delta rays. These results have implications for cancer risk assessment at low doses.

John Leslie Redpath

2012-05-01T23:59:59.000Z

232

Dose-Effect Relationships for the Submandibular Salivary Glands and Implications for Their Sparing by Intensity Modulated Radiotherapy  

SciTech Connect (OSTI)

Purpose: Submandibular salivary glands (SMGs) dysfunction contributes to xerostomia after radiotherapy (RT) of head-and-neck (HN) cancer. We assessed SMG dose-response relationships and their implications for sparing these glands by intensity-modulated radiotherapy (IMRT). Methods and Materials: A total of 148 HN cancer patients underwent unstimulated and stimulated SMG salivary flow rate measurements selectively from Wharton's duct orifices, before RT and periodically through 24 months after RT. Correlations of flow rates and mean SMG doses were modeled throughout all time points. IMRT replanning in 8 patients whose contralateral level I was not a target incorporated the results in a new cost function aiming to spare contralateral SMGs. Results: Stimulated SMG flow rates decreased exponentially by (1.2%){sup Gy} as mean doses increased up to 39 Gy threshold, and then plateaued near zero. At mean doses {<=}39 Gy, but not higher, flow rates recovered over time at 2.2%/month. Similarly, the unstimulated salivary flow rates decreased exponentially by (3%){sup Gy} as mean dose increased and recovered over time if mean dose was <39 Gy. IMRT replanning reduced mean contralateral SMG dose by average 12 Gy, achieving {<=}39 Gy in 5 of 8 patients, without target underdosing, increasing the mean doses to the parotid glands and swallowing structures by average 2-3 Gy. Conclusions: SMG salivary flow rates depended on mean dose with recovery over time up to a threshold of 39 Gy. Substantial SMG dose reduction to below this threshold and without target underdosing is feasible in some patients, at the expense of modestly higher doses to some other organs.

Murdoch-Kinch, Carol-Anne [Department of Oral Medicine/Hospital Dentistry, University of Michigan, Ann Arbor, MI (United States); Kim, Hyugnjin M. [Department of Biostatistics, University of Michigan, Ann Arbor, MI (United States); Vineberg, Karen A. [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States); Ship, Jonathan [Department of Oral Medicine/Hospital Dentistry, University of Michigan, Ann Arbor, MI (United States); Eisbruch, Avraham [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States)], E-mail: eisbruch@umich.edu

2008-10-01T23:59:59.000Z

233

Translationally Controlled Tumor Protein Protects against DNA Damage in Low  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Translationally Controlled Tumor Protein Protects against DNA Damage in Low Translationally Controlled Tumor Protein Protects against DNA Damage in Low Dose γ-Irradiated Cells Edouard Azzam New Jersey Medical School Cancer Center Abstract We have previously shown that exposure to low dose/low dose rate γ-rays can protect normal human and rodent cells against oxidative/clastogenic damages induced spontaneously or by a subsequent challenge dose of ionizing radiation. To gain insight into the mechanisms underlying these effects, we used amine-specific isobaric tags for relative and absolute quantitation (iTRAQ)-based approach to identify induced proteolytic events. Intriguingly, the Translationally Controlled Tumor Protein (TCTP) was significantly up-regulated after 10cGy (0.2cGy/h) but not after 4 Gy (1 Gy/min) in several strains of normal human fibroblasts maintained in 2- or

234

Effect of Irradiation on DNA Synthetic Period of the Mitotic Cycle in Cells  

Science Journals Connector (OSTI)

Kinetics of DNA synthesis in mitotic cycle of mouse corneal epithelial cells after single ?-irradiation (4Gy) at the end of S period was studied by the method of radioautography. Normally, S period of corneal...

I. P. Shabalkin; E. Yu. Grigoreva

2012-05-01T23:59:59.000Z

235

Detection of ?-Irradiated Sesame Seeds before and after Roasting by Analyzing Photostimulated Luminescence, Thermoluminescence, and Electron Spin Resonance  

Science Journals Connector (OSTI)

Sesame seeds were irradiated using a 60Co irradiator (0?4 kGy) and then roasted (220 C for 10 min). To identify the irradiation treatment, physical detection methods like photostimulated luminescence (PSL), thermoluminescence (TL), and electron spin ...

Jeongeun Lee; Tusneem Kausar; Byeong-Keun Kim; Joong-Ho Kwon

2008-07-26T23:59:59.000Z

236

AAAS Council Meeting, 1983  

Science Journals Connector (OSTI)

...interests of the governments of Zaire, Tanzania, and the United States were engaged...from affiliation. The International Solar Ener-gy Society, American Section, has changed its name to American Solar En-ergy Society. As new affiliates...

Catherine Borras

1983-07-29T23:59:59.000Z

237

E-Print Network 3.0 - aquatic exposure assessment Sample Search...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

of aquatic biota (1 rad d-1 or 10 mGy d... risks to humans from exposures to unreclaimed uranium mining ... Source: Yucca Mountain Project, US EPA Collection: Environmental...

238

E-Print Network 3.0 - assess fish secondary Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

fish secondary Search Powered by Explorit Topic List Advanced Search Sample search results for: assess fish secondary Page: << < 1 2 3 4 5 > >> 1 (Bi*ol"o*gy) n. Gr. life + -logy:...

239

Radiosensitization Strategies for Enhanced E-beam Irradiation Treatment of Fresh Produce  

E-Print Network [OSTI]

necessary to develop treatments that will reduce their prevalence and numbers on fresh produce. Irradiation is a penetrating nonthermal treatment that effectively eliminates bacteria. Irradiated baby spinach leaves up to 1.0 kGy showed negligible (P>0...

Gomes, Carmen

2011-08-08T23:59:59.000Z

240

Implications for preserving neural stem cells in whole brain radiotherapy and prophylactic cranial irradiation: a review of 2270 metastases in 488 patients  

Science Journals Connector (OSTI)

......oligometastatic patients (WBRT plan) and extensive SCLC...to chemotherapy (PCI plan). Plans will be conducted in...in 10 fractions) and standard WBRT (30 Gy in 10 fractions...CONCLUSIONS Our retrospective review of 2270 metastases in......

Jue-Feng Wan; Sheng-Jian Zhang; Lu Wang; Kuai-Le Zhao

2013-03-01T23:59:59.000Z

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Molecular Pathways: Targeted ?-Particle Radiation Therapy  

Science Journals Connector (OSTI)

...and profibrotic cytokines. Radiation-induced malignancy can...1-5 Gy). Kyoji Furukawa (Radiation Effect Research Foundation, Hiroshima, Japan) reviewed the Japanese atomic...late effects of ionizing radiation exposure at low/moderate...

Kwamena E. Baidoo; Kwon Yong; and Martin W. Brechbiel

2013-02-01T23:59:59.000Z

242

Numerical calculation of Green's functions  

E-Print Network [OSTI]

have: lim $ (x) represents E~O E (7+6 p dG lim) ( ? ( ) d. qG )dx = ? 1 E Then r '+' a ( ? (~) ? qG)d? = ? 1 and by direct integration ix= ad+6 6~0 x= g ? 6 The condition expressed by equation (1. 2. 6) is known as the jump condition.... Let 1 + x = y; then g(y) = e 1 I ( y I ) 2 = e y ( 2 - y ) 0 & y & 2 g(y) = o y & 0; then 23 ~d( ) ( ~d( ) ( &, ~tl ? (0) x=-1 y=0 y~ If y& 0 then g(y) = 0 and lim g-Z ? = 0, =1 I f y & 0 use z = ? in the expression then 1 lim ? g(y) = lim...

Urrea-Beltran, Julian

2012-06-07T23:59:59.000Z

243

:' , -_ i '; f~;--~', \\'?<;'~/}{.!T~':~'~'\\~:~~{J:~':;:;,-""," ~  

E-Print Network [OSTI]

: 'gy in Europe. Ready to Power j I o ABORDARE GLOBALA ENERGO-ECOLOGICA. ~I SINTE A PROBLEMEI Energetic Stage I. sourse". ETSUR-R-99. (1997). ecasting Application". EWEA, UK Wind Energy Resourse

Baica, Malvina

244

Secondary Sewage Treatment Versus Ocean Outfalls: An Assessment  

Science Journals Connector (OSTI)

...stable. The membrane will overheat and be de-stroyed...W. A. Beckman, in Solar Ener-gy Thermal Processes (Wiley, New...was supported by a Solar Energy Traineeship grant...have sufficient daytime solar insolation and sufficiently...

Charles B. Officer; John H. Ryther

1977-09-09T23:59:59.000Z

245

Hydrogen- and Oxygen from Water  

Science Journals Connector (OSTI)

...DUFFIE, J.A., SOLAR ENERGY THERMAL 178 ( 1974 ). FUNK...4, in which the thermal effects of operation...curve, QH, is the net solar heat flow into the...A. Beckman, in Solar Ener-gy Thermal Processes (Wiley...

Edward A. Fletcher; Roger L. Moen

1977-09-09T23:59:59.000Z

246

Electron beam induced modifications in crystalline structure of polyvinylidene fluoride/nanoclay composites  

Science Journals Connector (OSTI)

Abstract PVDF/nanoclay nanocomposites were prepared via melt mixing method. The intercalated dispersion of the nanoclay in PVDF matrix was confirmed by XRD. According to FTIR, DSC and XRD results, the presence of nanoclay facilitated transition from ?-to-? crystalline phase. Electron beam irradiation decreased the melting point of the nanocomposites. The decrease in melting point of the nanocomposites was about 11C at 500kGy. The crystallinity of nanocomposites increased at an irradiation dose of 100kGy and decreased at higher irradiation doses. The extent of crosslinking of the nanocomposites increased significantly with irradiation up to 300kGy. The nanoclay intensified the increase in yield strength with irradiation doses up to 300kGy. The combination of nanoclay and irradiation had a synergistic effect on the increase of yield strength.

Peyman Rahmani; Susan Dadbin; Masoud Frounchi

2014-01-01T23:59:59.000Z

247

GAOH Offshore | Open Energy Information  

Open Energy Info (EERE)

GAOH Offshore Jump to: navigation, search Name: GAOH Offshore Place: St Peter Port, United Kingdom Zip: GY1 4EE Sector: Wind energy Product: Intends to become the preferred...

248

Trial Production of Examination Gloves from Irradiated Natural Rubber Latex on a Factory Scale  

Science Journals Connector (OSTI)

TRIAL PRODUCTION OF EXAMINATION GLOVES FROM IRRADIATED NATURAL RUBBER LATEX IN FACTORY SCALE: The production of irradiated latex by gamma rays from60...Co at 20 kGy dose in the presence of 1 phr (part hundred rat...

Marga Utama

1994-01-01T23:59:59.000Z

249

Proteasome Structures Affected by Ionizing Radiation  

Science Journals Connector (OSTI)

...Effect of ionizing radiation on 26S but...radiation doses, and immediately...the dose range 1 to 20 Gy...ionizing radiation induced a...38), ionizing radiation (39...over a wide range of radiation doses and further...

Milena Pervan; Keisuke S. Iwamoto; and William H. McBride

2005-07-01T23:59:59.000Z

250

The effect of ionizing radiation on dielectric properties of bovine achilles tendon collagen in the temperature range of thermal denaturation  

Science Journals Connector (OSTI)

The effect of ?-irradiation, with doses from 102?2103 kGy, on the dielectric properties of solid-state collagen was studied. The temperature dependence of the constants ?? and ??' revealed a decrease in the dena...

F. Jaroszyk; E. Marzec

1994-10-15T23:59:59.000Z

251

Human Heterochromatin Protein 1 Isoforms HP1Hs? and HP1Hs? Interfere with hTERT-Telomere Interactions and Correlate with Changes in Cell Growth and Response to Ionizing Radiation  

Science Journals Connector (OSTI)

...subsequently exposed to ionizing radiation (IR). The...a particular dose of radiation. The cells...to IR in the dose range of 0 to 8 Gy...treatment. Dose response curves...treated with ionizing radiation while growing...

Girdhar G. Sharma; Kyu-kye Hwang; Raj K. Pandita; Arun Gupta; Sonu Dhar; Julie Parenteau; Manjula Agarwal; Howard J. Worman; Raymund J. Wellinger; Tej K. Pandita

2003-11-01T23:59:59.000Z

252

Extremely Low Dose Ionizing Radiation Up-regulates CXC Chemokines in Normal Human Fibroblasts  

Science Journals Connector (OSTI)

...with radiation exposure (1). Ionizing radiation at moderate and higher doses (0.1-10 Gy) can produce DNA strand...death. Studies of mutants sensitive to ionizing radiation at this range of doses have revealed that the responsible genes...

Akira Fujimori; Ryuichi Okayasu; Hiroshi Ishihara; Satoshi Yoshida; Kiyomi Eguchi-Kasai; Kumie Nojima; Satoru Ebisawa; and Sentaro Takahashi

2005-11-15T23:59:59.000Z

253

Dosimetry of Y-90 Liquid Brachytherapy in a Dog with Osteosarcoma Using PET/CT  

E-Print Network [OSTI]

receive a total dose of over 1000 Gy. Y-90 liquid brachytherapy has the potential to be used as an adjuvant therapy or for palliation purposes. Future work includes evaluation of pharmacokinetics of the Y-90 radiopharmaceutical, calibration of PET...

Zhou, Jingjie

2011-08-08T23:59:59.000Z

254

7Li Cross Section  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

, X) (Current as of 05142012) NSR Reaction E (MeV) Cross Section File X4 Dataset Date Added 2004GY02 7Li(, ): deduced absolute resonance strengths 810 - 820 keV X4 02...

255

Therapeutic potential of atmospheric neutrons Cyril Voyant1,2*  

E-Print Network [OSTI]

(BNCT) - which exploits the interaction between Boron-10 atoms (introduced by vector molecules) and low containing Boron-10. Results The doses produced (an average of Gy in a 1g tumour) are not sufficient

Boyer, Edmond

256

Induction by ionizing radiation of the gadd45 gene in cultured human cells: lack of mediation by protein kinase C.  

Science Journals Connector (OSTI)

...coordinately induced by UV radiation and alkylating agents...rapidly after X rays at doses as low as 2 Gy. After...isolation & purification radiation effects DNA Damage Dose-Response Relationship, Radiation Genes radiation effects...

M A Papathanasiou; N C Kerr; J H Robbins; O W McBride; I Alamo Jr; S F Barrett; I D Hickson; A J Fornace Jr

1991-02-01T23:59:59.000Z

257

SEP Program Notice 10-006C  

Energy Savers [EERE]

the A American Re ecovery and Reinvestme ent Act of f 2009 (Reco overy Act; P Pub. L. No. 1 111-5) and S SEP formula a awards und der the Energ gy Policy y and Cons servation Ac...

258

Download  

Science Journals Connector (OSTI)

Jun 15, 1979 ... Abstract. The energy consumption of 4th instar larvae of Chaoborus triuittatus of two different ages was determined in a respirometer. Measurements included enel gy consumption of fed larvae ... unit costs could be estimated.

2000-01-12T23:59:59.000Z

259

PAPERS PUBLISHED / 2005-2006 Progress in Research / Cyclotron...  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

C. Hartnack, H.W. Barz, M. Bleicher, E. Bratkovskaya, W. Cassing, L.W. Chen, P. Danielewicz, C. Fuchs, T. Gaitanos, C.M. Ko, A. Larionov, M. Reiter, Gy. Wolf, and J. Aichelin,...

260

Australasian Physical & Engineering Sciences in Medicine Volume 27 Number 4, 2004 LETTER TO THE EDITOR  

E-Print Network [OSTI]

within the 0.1 cGy range. Some radiochromic films have a relatively energy independent dose, N.S.W, 2500, Australia Tsang Cheung, and Peter K. N. Yu Dept. of Physics and Materials Science, City

Yu, K.N.

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Effect of ?-Irradiation on Agaritine, ?-Glutaminyl-4-hydroxybenzene (GHB), Antioxidant Capacity, and Total Phenolic Content of Mushrooms (Agaricus bisporus)  

Science Journals Connector (OSTI)

Isolde Sommer , Heidi Schwartz , Sonja Solar * and Gerhard Sontag ... Sample irradiation was performed using a Cobalt-60-?-ray irradiator type Gammacell 220 (Nordion International, Inc., Kanata, Ontario, Canada) at a dose rate of 34 Gy/min. ...

Isolde Sommer; Heidi Schwartz; Sonja Solar; Gerhard Sontag

2009-06-08T23:59:59.000Z

262

E-Print Network 3.0 - av sammenhengen mellom Sample Search Results  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Geosciences 4 Strling og Helse Vi lever i et hav av strling. Det er g-strling fra bakken, kosmisk strling ovenfra, radon i luften og radioaktiv- Summary: Gy og mer) kan gi...

263

Individualized 3D Reconstruction of Normal Tissue Dose for Patients With Long-term Follow-up: A Step Toward Understanding Dose Risk for Late Toxicity  

SciTech Connect (OSTI)

Purpose: Understanding the relationship between normal tissue dose and delayed radiation toxicity is an important component of developing more effective radiation therapy. Late outcome data are generally available only for patients who have undergone 2-dimensional (2D) treatment plans. The purpose of this study was to evaluate the accuracy of 3D normal tissue dosimetry derived from reconstructed 2D treatment plans in Hodgkin's lymphoma (HL) patients. Methods and Materials: Three-dimensional lung, heart, and breast volumes were reconstructed from 2D planning radiographs for HL patients who received mediastinal radiation therapy. For each organ, a reference 3D organ was modified with patient-specific structural information, using deformable image processing software. Radiation therapy plans were reconstructed by applying treatment parameters obtained from patient records to the reconstructed 3D volumes. For each reconstructed organ mean dose (D{sub mean}) and volumes covered by at least 5 Gy (V{sub 5}) and 20Gy (V{sub 20}) were calculated. This process was performed for 15 patients who had both 2D and 3D planning data available to compare the reconstructed normal tissue doses with those derived from the primary CT planning data and also for 10 historically treated patients with only 2D imaging available. Results: For patients with 3D planning data, the normal tissue doses could be reconstructed accurately using 2D planning data. Median differences in D{sub mean} between reconstructed and actual plans were 0.18 Gy (lungs), -0.15 Gy (heart), and 0.30 Gy (breasts). Median difference in V{sub 5} and V{sub 20} were less than 2% for each organ. Reconstructed 3D dosimetry was substantially higher in historical mantle-field treatments than contemporary involved-field mediastinal treatments: average D{sub mean} values were 15.2 Gy vs 10.6 Gy (lungs), 27.0 Gy vs 14.3 Gy (heart), and 8.0 Gy vs 3.2 Gy (breasts). Conclusions: Three-dimensional reconstruction of absorbed dose to organs at risk can be estimated accurately many years after exposure by using limited 2D data. Compared to contemporary involved-field treatments, normal tissue doses were significantly higher in historical mantle-field treatments. These methods build capacity to quantify the relationship between 3D normal tissue dose and observed late effects.

Ng, Angela [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada)] [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada); Brock, Kristy K.; Sharpe, Michael B. [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada) [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada); Department of Radiation Oncology, University of Toronto, Toronto, Ontario (Canada); Moseley, Joanne L. [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada)] [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada); Craig, Tim [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada) [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada); Department of Radiation Oncology, University of Toronto, Toronto, Ontario (Canada); Hodgson, David C., E-mail: David.Hodgson@rmp.uhn.on.ca [Radiation Medicine Program, Princess Margaret Hospital, Toronto, Ontario (Canada); Department of Radiation Oncology, University of Toronto, Toronto, Ontario (Canada)

2012-11-15T23:59:59.000Z

264

Treatment of left sided breast cancer for a patient with funnel chest: Volumetric-modulated arc therapy vs. 3D-CRT and intensity-modulated radiotherapy  

SciTech Connect (OSTI)

This case study presents a rare case of left-sided breast cancer in a patient with funnel chest, which is a technical challenge for radiation therapy planning. To identify the best treatment technique for this case, 3 techniques were compared: conventional tangential fields (3D conformal radiotherapy [3D-CRT]), intensity-modulated radiotherapy (IMRT), and volumetric-modulated arc therapy (VMAT). The plans were created for a SynergyS (Elekta, Ltd, Crawley, UK) linear accelerator with a BeamModulator head and 6-MV photons. The planning system was Oncentra Masterplan v3.3 SP1 (Nucletron BV, Veenendal, Netherlands). Calculations were performed with collapsed cone algorithm. Dose prescription was 50.4 Gy to the average of the planning target volume (PTV). PTV coverage and homogeneity was comparable for all techniques. VMAT allowed reducing dose to the ipsilateral organs at risk (OAR) and the contralateral breast compared with IMRT and 3D-CRT: The volume of the left lung receiving 20 Gy was 19.3% for VMAT, 26.1% for IMRT, and 32.4% for 3D-CRT. In the heart, a D{sub 15%} of 9.7 Gy could be achieved with VMAT compared with 14 Gy for IMRT and 46 Gy for 3D-CRT. In the contralateral breast, D{sub 15%} was 6.4 Gy for VMAT, 8.8 Gy for IMRT, and 10.2 Gy for 3D-CRT. In the contralateral lung, however, the lowest dose was achieved with 3D-CRT with D{sub 10%} of 1.7 Gy for 3D-CRT, and 6.7 Gy for both IMRT and VMAT. The lowest number of monitor units (MU) per 1.8-Gy fraction was required by 3D-CRT (192 MU) followed by VMAT (518 MU) and IMRT (727 MU). Treatment time was similar for 3D-CRT (3 min) and VMAT (4 min) but substantially increased for IMRT (13 min). VMAT is considered the best treatment option for the presented case of a patient with funnel chest. It allows reducing dose in most OAR without compromising target coverage, keeping delivery time well below 5 minutes.

Haertl, Petra M., E-mail: petra.haertl@klinik.uni-regensburg.de [Department of Radiotherapy, Regensburg University Medical Center, Regensburg (Germany); Pohl, Fabian; Weidner, Karin; Groeger, Christian; Koelbl, Oliver; Dobler, Barbara [Department of Radiotherapy, Regensburg University Medical Center, Regensburg (Germany)

2013-04-01T23:59:59.000Z

265

Intensity-Modulated Proton Therapy Versus Helical Tomotherapy in Nasopharynx Cancer: Planning Comparison and NTCP Evaluation  

SciTech Connect (OSTI)

Purpose: To compare intensity-modulated proton therapy (IMPT) and helical tomotherapy (HT) treatment plans for nasopharynx cancer using a simultaneous integrated boost approach. Methods and Materials: The data from 6 patients who had previously been treated with HT were used. A three-beam IMPT technique was optimized in the Hyperion treatment planning system, simulating a 'beam scanning' technique. HT was planned using the tomotherapy treatment planning system. Both techniques were optimized to simultaneously deliver 66 Gy in 30 fractions to planning target volume (PTV1; GTV and enlarged nodes) and 54 Gy to PTV2 subclinical, electively treated nodes. Normal tissue complication probability calculation was performed for the parotids and larynx. Results: Very similar PTVs coverage and homogeneity of the target dose distribution for IMPT and HT were found. The conformity index was significantly lower for protons than for photons (1.19 vs. 1.42, respectively). The mean dose to the ipsilateral and contralateral parotid glands decreased by 6.4 Gy and 5.6 Gy, respectively, with IMPT. The volume of mucosa and esophagus receiving {>=}20 Gy and {>=}30 Gy with IMPT was significantly lower than with HT. The average volume of larynx receiving {>=}50 Gy was significantly lower with HT, while for thyroid, it was comparable. The volume receiving {>=}30, {>=}20, and {>=}10 Gy in total body volume decreased with IMPT by 14.5%, 19.4%, and 23.1%, respectively. The normal tissue complication probability for the parotid glands was significantly lower with IMPT for all sets of parameters; however, we also estimated an almost full recovery of the contralateral parotid with HT. The normal tissue complication probability for the larynx was not significantly different between the two irradiation techniques. Conclusion: Excellent target coverage, homogeneity within the PTVs, and sparing of the organs at risk were reached with both modalities. IMPT allows for better sparing of most organs at risk at medium-to-low doses.

Widesott, Lamberto [ATreP-Provincial Agency for Proton Therapy, Trento (Italy)], E-mail: widesott@atrep.it; Pierelli, Alessio; Fiorino, Claudio [Department of Medical Physics, H.S. Raffaele, Milano (Italy); Dell'Oca, Italo [Department of Radiotherapy, H.S. Raffaele, Milano (Italy); Broggi, Sara; Cattaneo, Giovanni Mauro [Department of Medical Physics, H.S. Raffaele, Milano (Italy); Di Muzio, Nadia [Department of Radiotherapy, H.S. Raffaele, Milano (Italy); Fazio, Ferruccio [Department of Radiotherapy, H.S. Raffaele, Milano (Italy); IBFM-CNR, Milano (Italy); Calandrino, Riccardo [Department of Medical Physics, H.S. Raffaele, Milano (Italy); Schwarz, Marco [ATreP-Provincial Agency for Proton Therapy, Trento (Italy)

2008-10-01T23:59:59.000Z

266

Long-term Cardiac Mortality After Hypofractionated Radiation Therapy in Breast Cancer  

SciTech Connect (OSTI)

Purpose: To explore very-long-term mortality from ischemic heart disease (IHD) after locoregional radiation therapy of breast cancer (BC) in relation to degree of hypofractionation and other treatment variables. Methods and Materials: Two hypofractionated regimens used for locoregional radiation therapy for BC from 1975 to 1991 were considered. Patients received 4.3 Gy 2/week (10 fractions; target dose 43 Gy; n=1107) or 2.5 Gy 5/week (20 fractions; target dose 50 Gy; n=459). To estimate cardiac doses, radiation fields were reconstructed in a planning system. Time to death from IHD was the endpoint, comparing the groups with each other and with age-matched, cancer-free control individuals, modeled with the Cox proportional hazards model. Results: Patients given 4.3 Gy 10 had an increased risk of dying of IHD compared with both the 2.5 Gy group (hazard ratio [HR] = 2.37; 95% confidence interval [CI]: 1.06-5.32; P=.036) and the control group (HR = 1.59; 95% CI: 1.13-2.23; P=.008). Photon beams for parasternal fields gave an increased risk of dying of IHD compared with electron beams (HR = 2.56; 95% CI: 1.12-5.84; P=.025). Multivariate analysis gave an increased risk for the 4.3-Gy versus 2.5-Gy regimen with borderline significance (HR = 2.90; 95% CI: 0.97-8.79; P=.057) but not for parasternal irradiation. Conclusions: The degree of hypofractionation and parasternal photon beams contributed to increased cardiac mortality in this patient cohort. Differences emerged after 12 to 15 years, indicating the need of more studies with observation time of 2 decades.

Tjessem, Kristin Holm, E-mail: krtjes@ous-hf.no [Department of Oncology, Oslo University Hospital, National Resource Centre for Late Effects after Cancer Treatment, Oslo (Norway); Johansen, Safora [Department of Oncology, Oslo University Hospital-Radium Hospital, and Division of Radiotherapy/Radiography, College of Oslo and Akershus, Faculty of Health, Oslo (Norway); Malinen, Eirik [Department of Medical Physics, Oslo University Hospital, Oslo (Norway); Reinertsen, Kristin V. [Department of Oncology, Oslo University Hospital, National Resource Centre for Late Effects after Cancer Treatment, Oslo (Norway); Danielsen, Turi [Department of Medical Physics, Oslo University Hospital, Oslo (Norway); Foss, Sophie D.; Foss, Alexander [Department of Oncology, Oslo University Hospital, National Resource Centre for Late Effects after Cancer Treatment, Oslo (Norway)

2013-10-01T23:59:59.000Z

267

Risk Factors and Dose-Effect Relationship for Mandibular Osteoradionecrosis in Oral and Oropharyngeal Cancer Patients  

SciTech Connect (OSTI)

Purpose: To analyze risk factors and the dose-effect relationship for osteoradionecrosis (ORN) of the mandible after radiotherapy of oral and oropharyngeal cancers. Materials and Methods: One-hundred ninety-eight patients with oral (45%) and oropharyngeal cancer (55%) who had received external radiotherapy between 1990 and 2000 were retrospectively reviewed. All patients had a dental evaluation before radiotherapy. The median radiation dose was 60 Gy (range, 16-75 Gy), and the median biologically effective dose for late effects (BED{sub late}) in bone was 114 Gy{sub 2} (range, 30-167 Gy{sub 2}). Results: The frequency of ORN was 13 patients (6.6%). Among patients with mandibular surgery, eight had ORN at the surgical site. Among patients without mandibular surgery, five patients had ORN on the molar area of the mandible. The median time to ORN was 22 months (range, 1-69 months). Univariate analysis revealed that mandibular surgery and Co-60 were significant risk factors for ORN (p = 0.01 and 0.04, respectively). In multivariate analysis, mandibular surgery was the most important factor (p = 0.001). High radiation doses over BED 102.6 Gy{sub 2} (conventional dose of 54 Gy at 1.8 Gy/fraction) were also a significant factor for ORN (p = 0.008) and showed a positive dose-effect relationship in logistic regression (p = 0.04) for patients who had undergone mandibular surgery. Conclusions: Mandibular surgery was the most significant risk factor for ORN of mandible in oral and oropharyngeal cancers patients. A BED of 102.6 Gy{sub 2} or higher to the mandible also significantly increases the risk of ORN.

Lee, Ik Jae; Koom, Woong Sub [Department of Radiation Oncology, Yonsei University College of Medicine, Seoul (Korea, Republic of); Lee, Chang Geol, E-mail: cglee1023@yuhs.a [Department of Radiation Oncology, Yonsei University College of Medicine, Seoul (Korea, Republic of); Kim, Yong Bae; Yoo, Sei Whan; Keum, Ki Chang; Kim, Gwi Eon [Department of Radiation Oncology, Yonsei University College of Medicine, Seoul (Korea, Republic of); Choi, Eun Chang [Department of Otolaryngology, Yonsei University College of Medicine, Seoul (Korea, Republic of); Cha, In Ho [Department of Oral and Maxillofacial Surgery, Yonsei University College of Dentistry, Seoul (Korea, Republic of)

2009-11-15T23:59:59.000Z

268

Carbon Ion Radiation Therapy Improves the Prognosis of Unresectable Adult Bone and Soft-Tissue Sarcoma of the Head and Neck  

SciTech Connect (OSTI)

Purpose: To evaluate the safety and efficacy of carbon ion radiotherapy (C-ion RT) with 70.4 GyE for unresectable bone and soft-tissue sarcoma of the adult head and neck. Methods and Materials: Twenty-seven patients (mean age, 46.2 years) were enrolled in this prospective study on C-ion RT with 70.4 GyE/16 fractions (fr) between April 2001 and February 2008. The primary end points were acute and late reactions of normal tissues, local control rate, and overall survival rate. The secondary end point was efficacy of the treatment in comparison to historical results with 57.6 or 64.0 GyE/16 fr. Results: The 3-year local control rate and overall survival rate for all patients were 91.8% (95% confidence interval [CI] = 81.0-100%) and 74.1% (95% CI = 57.5-90.6%), respectively. Acute reaction of Grade 3 or more was observed in only 1 patient. With regard to late reactions, visual loss was observed in 1 patient and a Grade 3 reaction of the maxillary bone was observed in 4 patients. A comparison with historical results revealed that the local control rate with 70.4 GyE was significantly higher than that with 57.6 or 64.0 GyE (3-year, 91.8% vs. 23.6%, p < 0.0001). Furthermore, the overall survival with 70.4 GyE tended to be higher than that with 57.6 or 64.0 GyE (3-year, 74.1% vs. 42.9%, p = 0.09). Conclusion: C-ion RT with 70.4 GyE/16 fr for bone and soft-tissue sarcoma of the adult head and neck appears to be effective with acceptable toxicities in comparison to conventional RT and C-ion RT with lower doses.

Jingu, Keiichi [Research Center for Charged Particle Therapy, National Institute of Radiological Sciences (NIRS), Chiba (Japan); Department of Radiation Oncology, Tohoku University School of Medicine, Sendai (Japan); Tsujii, Hirohiko, E-mail: tsujii@nirs.go.jp [Research Center for Charged Particle Therapy, National Institute of Radiological Sciences (NIRS), Chiba (Japan); Mizoe, Jun-Etsu; Hasegawa, Azusa; Bessho, Hiroki; Takagi, Ryo; Morikawa, Takamichi [Research Center for Charged Particle Therapy, National Institute of Radiological Sciences (NIRS), Chiba (Japan); Tonogi, Morio [Department of Oral Medicine, Tokyo Dental College, Ichihara (Japan); Tsuji, Hiroshi; Kamada, Tadashi [Research Center for Charged Particle Therapy, National Institute of Radiological Sciences (NIRS), Chiba (Japan); Yamada, Shogo [Department of Radiation Oncology, Tohoku University School of Medicine, Sendai (Japan)

2012-04-01T23:59:59.000Z

269

EPA 402-R-99-003 ESTIMATING RADIOGENIC CANCER RISKS  

E-Print Network [OSTI]

of ionizing radiation. Using this methodology, numerical estimates of the risk per unit dose were derived the Agency's methodology for deriving estimates of excess cancer morbidity and mortality due to low doses-body radiation: the low-LET nominal estimate increased from 5.1?10-2 Gy-1 to 5.75?10-2 Gy-1 . In this document

270

Feasibility of IMRT to Cover Pelvic Nodes While Escalating the Dose to the Prostate Gland: Dosimetric Data on 35 Consecutive Patients  

SciTech Connect (OSTI)

Utilizing available dosimetric and acute toxicity data, we confirm the feasibility of intensity modulated radiotherapy (IMRT) to include treatment of the pelvic nodes (PN) while escalating the dose to the prostate. Data were obtained from 35 consecutive patients with prostate cancer with {>=}15% risk of PN involvement. Patients received an initial boost to the prostate, delivering 16 Gy over 8 fractions using a 6-field conformal technique, followed by an 8-field coplanar inverse planning IMRT technique delivering an additional 60 Gy over 30 fractions to the prostate (76 Gy total) and 54 Gy over 30 fractions to the seminal vesicles (SV) and PN. Dose-volume histogram analysis was performed for planning target volumes and organs at risk. Acute toxicity (RTOG/EORTC scale) was prospectively and independently scored weekly for each patient. The maximum, mean, minimum dose, and D95 to each planning target volume is provided: prostate (82.2, 78.2, 72.6, 75.2 Gy), SV (79.0, 72.5, 56.9, 61.1 Gy), and PN (80.4, 59.7, 46.5, 53.3 Gy), respectively. The percent volume receiving a dose at or above 'x' Gy (Vx) was recorded for V75, V70, V65, V60, and V50 as: bladder (14%, 24%, 32%, 39%, and 54%) and rectum (3%, 18%, 26%, 34%, and 51%), respectively. Acute toxicity was as follows: 54% grade 2+ GI (n = 19), 25% grade 2+ GU (n = 9). IMRT enables treatment of pelvic nodes while escalating dose to the prostate and is clinically feasible with acute toxicity within expected ranges.

Bayouth, John E. [Department of Radiation Oncology, University of Iowa Health Care, Iowa City, IA (United States)], E-mail: john-bayouth@uiowa.edu; Pena, John [Department of Medical Physics, University of Texas Medical Branch, Galveston, TX (United States); Culp, Laura [Department of Radiation Oncology, University of Texas Medical Branch, Galveston, TX (United States); Brack, Collin [Department of Medical Physics, University of Texas Medical Branch, Galveston, TX (United States); Sanguineti, Giuseppe [Department of Radiation Oncology, University of Texas Medical Branch, Galveston, TX (United States)

2008-10-01T23:59:59.000Z

271

Is there a 'mucosa-sparing' benefit of IMRT for head-and-neck cancer?  

SciTech Connect (OSTI)

Purpose: To investigate whether intensity-modulated radiation therapy (IMRT) allows more mucosal sparing than standard three-field technique (3FT) radiotherapy for early oropharyngeal cancer. Methods and Materials: Whole-field IMRT plans were generated for 5 patients with early-stage oropharyngeal cancer according to Radiation Therapy Oncology Group 0022 (66 Gy/30 fractions/6 weeks) guidelines with and without a dose objective on the portion of mucosa not overlapping any PTV. 3FT plans were also generated for the same 5 patients with two fractionation schedules: conventional fractionation (CF) to 70 Gy/35 fractions/7 weeks and concomitant boost (CB) to 72 Gy/40 fractions/6 weeks. Cumulative dose volume histograms (DVHs) of the overall mucosal volume (as per in-house definition) from all trials were compared after transformation into the linear quadratic equivalent dose at 2 Gy per fraction with a time factor correction. Results: Compared with IMRT without dose objective on the mucosa, a 30-Gy maximum dose objective on the mucosa allows {approx}20% and {approx}12% mean absolute reduction in the percentage of mucosa volume exposed to a dose equivalent to 30 Gy (p < 0.01) and 70 Gy (p < 0.01) at 2 Gy in 3 and 7 weeks, respectively, without detrimental effect on the coverage of other regions of interest. Without mucosal dose objective, IMRT is associated with a larger amount of mucosa exposed to clinically relevant doses compared with both concomitant boost and conventional fractionation; however, if a dose objective is placed, the reverse is true, with up to {approx}30% reduction in the volume of the mucosa in the high-dose region compared with both concomitant boost and conventional fractionation (p < 0.01). Conclusions: Intensity-modulated radiation therapy can be potentially provide more mucosal sparing than traditional approaches.

Sanguineti, Giuseppe [Department of Radiation Oncology, University of Texas Medical Branch, Galveston, TX (United States)]. E-mail: gisangui@utmb.edu; Endres, Eugene [Department of Medical Physics, University of Texas Medical Branch, Galveston, TX (United States); Gunn, Brandon G. [Department of Radiation Oncology, University of Texas Medical Branch, Galveston, TX (United States); Parker, Brent [Department of Medical Physics, University of Texas Medical Branch, Galveston, TX (United States)

2006-11-01T23:59:59.000Z

272

Radiation Dose-Volume Effects in the Brain  

SciTech Connect (OSTI)

We have reviewed the published data regarding radiotherapy (RT)-induced brain injury. Radiation necrosis appears a median of 1-2 years after RT; however, cognitive decline develops over many years. The incidence and severity is dose and volume dependent and can also be increased by chemotherapy, age, diabetes, and spatial factors. For fractionated RT with a fraction size of <2.5 Gy, an incidence of radiation necrosis of 5% and 10% is predicted to occur at a biologically effective dose of 120 Gy (range, 100-140) and 150 Gy (range, 140-170), respectively. For twice-daily fractionation, a steep increase in toxicity appears to occur when the biologically effective dose is >80 Gy. For large fraction sizes (>=2.5 Gy), the incidence and severity of toxicity is unpredictable. For single fraction radiosurgery, a clear correlation has been demonstrated between the target size and the risk of adverse events. Substantial variation among different centers' reported outcomes have prevented us from making toxicity-risk predictions. Cognitive dysfunction in children is largely seen for whole brain doses of >=18 Gy. No substantial evidence has shown that RT induces irreversible cognitive decline in adults within 4 years of RT.

Lawrence, Yaacov Richard, E-mail: richard.lawrence@jefferson.ed [Department of Radiation Oncology, Thomas Jefferson University, Philadelphia, PA (United States); Li, X. Allen [Department of Radiation Oncology, Medical College of Wisconsin, Milwaukee, WI (United States); El Naqa, Issam [Department of Radiation Oncology, Washington University School of Medicine, St. Louis, MO (United States); Hahn, Carol A. [Department of Radiation Oncology, Duke University Medical Center, Durham, NC (United States); Marks, Lawrence B. [Department of Radiation Oncology, University of North Carolina, Chapel Hill, NC (United States); Merchant, Thomas E. [Department of Radiation Oncology, St. Jude Children's Research Hospital, Memphis, TN (United States); Dicker, Adam P. [Department of Radiation Oncology, Thomas Jefferson University, Philadelphia, PA (United States)

2010-03-01T23:59:59.000Z

273

Specific gene expression by extremely low-dose ionizing radiation which related to enhance proliferation of normal human diploid cells  

Science Journals Connector (OSTI)

We demonstrated that X-ray irradiation at low doses of between 2 and 5 cGy stimulated proliferation of a normal human diploid. At low doses of between 2 and 5 cGy, ERK1/2 was phosphorylated as efficiently as at higher doses between 50 and 100 cGy of X-rays, while the p53 protein level was not increased by doses below 50 cGy. On the other hand, the p53 protein was efficiently accumulated at higher doses of X-ray more than 100 cGy. ERK1/2 was phosphorylated by doses over 50 cGy with increasing doses. We found that activated ERK1/2 augmented phosphorylation of the Elk-1 protein. Furthermore, over expression of ERK2 in NCI-H1299, and human lung carcinoma cells, potentiated enhanced proliferation, while down-regulation of ERK2 using the anti-sense ERK2 gene abrogated the stimulative effect of low-dose irradiation. These results indicate that a limited range of low-dose ionizing radiation differentially activate ERK1/2 kinases, which causes enhanced proliferation of cells receiving very low doses of ionizing radiation.

Masami Watanabe; Keiji Suzuki; Seiji Kodama

2002-01-01T23:59:59.000Z

274

Consolidative Involved-Node Proton Therapy for Stage IA-IIIB Mediastinal Hodgkin Lymphoma: Preliminary Dosimetric Outcomes From a Phase II Study  

SciTech Connect (OSTI)

Purpose: To compare the dose reduction to organs at risk (OARs) with proton therapy (PT) versus three-dimensional conformal radiotherapy (3D-CRT) and intensity-modulated radiotherapy (IMRT) in patients with mediastinal Hodgkin lymphoma (HL) enrolled on a Phase II study of involved-node radiotherapy (INRT). Methods and Materials: Between June 2009 and October 2010, 10 patients were enrolled on a University of Florida institutional review board-approved protocol for de novo 'classical' Stage IA-IIIB HL with mediastinal (bulky or nonbulky) involvement after chemotherapy. INRT was planned per European Organization for Research and Treatment of Cancer guidelines. Three separate optimized plans were developed for each patient: 3D-CRT, IMRT, and PT. The primary end point was a 50% reduction in the body V4 with PT compared with 3D-CRT or IMRT. Results: The median relative reduction with PT in the primary end point, body V4, was 51% compared with 3D-CRT (p = 0.0098) and 59% compared with IMRT (p = 0.0020), thus all patients were offered treatment with PT. PT provided the lowest mean dose to the heart, lungs, and breasts for all 10 patients compared with either 3D-CRT or IMRT. The median difference in the OAR mean dose reduction with PT compared with 3D-CRT were 10.4 Gy/CGE for heart; 5.5 Gy/CGE for lung; 0.9 Gy/CGE for breast; 8.3 Gy/CGE for esophagus; and 4.1 Gy/CGE for thyroid. The median differences for mean OAR dose reduction for PT compared with IMRT were 4.3 Gy/CGE for heart, 3.1 Gy/CGE for lung, 1.4 Gy/CGE for breast, 2.8 Gy/CGE for esophagus, and 2.7 Gy/CGE for thyroid. Conclusions: All 10 patients benefitted from dose reductions to OARs with PT compared with either 3D-CRT or IMRT. It is anticipated that these reductions in dose to OAR will translate into lower rates of late complications, but long-term follow-up on this Phase II INRT study is needed.

Hoppe, Bradford S., E-mail: bhoppe@floridaproton.org [University of Florida Proton Therapy Institute, Jacksonville, FL (United States); Flampouri, Stella; Su Zhong; Morris, Christopher G. [University of Florida Proton Therapy Institute, Jacksonville, FL (United States); Latif, Naeem [University of Florida Hematology/Oncology, Jacksonville, FL (United States); Dang, Nam H.; Lynch, James [University of Florida Hematology/Oncology, Gainesville, FL (United States); Li Zuofeng; Mendenhall, Nancy P. [University of Florida Proton Therapy Institute, Jacksonville, FL (United States)

2012-05-01T23:59:59.000Z

275

Policies for Low Carbon Growth | Open Energy Information  

Open Energy Info (EERE)

Policies for Low Carbon Growth Policies for Low Carbon Growth Jump to: navigation, search Tool Summary Name: Policies for Low Carbon Growth Agency/Company /Organization: Overseas Development Institute Sector: Energy, Land Focus Area: Renewable Energy Topics: Low emission development planning, Policies/deployment programs, Background analysis Resource Type: Lessons learned/best practices Website: www.odi.org.uk/resources/download/4542-full-report.pdf Country: Brazil, Ethiopia, Guyana, Nigeria, China, Germany, Mexico, United Kingdom, Bangladesh South America, Eastern Africa, South America, Western Africa, Eastern Asia, Western Europe, Central America, Northern Europe, Southern Asia Coordinates: 27.5996962°, -98.4107943° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":27.5996962,"lon":-98.4107943,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

276

Comparison of the Effects of High-Energy Photon Beam Irradiation (10 and 18 MV) on 2 Types of Implantable Cardioverter-Defibrillators  

SciTech Connect (OSTI)

Purpose: Radiation therapy for cancer may be required for patients with implantable cardiac devices. However, the influence of secondary neutrons or scattered irradiation from high-energy photons (?10 MV) on implantable cardioverter-defibrillators (ICDs) is unclear. This study was performed to examine this issue in 2 ICD models. Methods and Materials: ICDs were positioned around a water phantom under conditions simulating clinical radiation therapy. The ICDs were not irradiated directly. A control ICD was positioned 140 cm from the irradiation isocenter. Fractional irradiation was performed with 18-MV and 10-MV photon beams to give cumulative in-field doses of 600 Gy and 1600 Gy, respectively. Errors were checked after each fraction. Soft errors were defined as severe (change to safety back-up mode), moderate (memory interference, no changes in device parameters), and minor (slight memory change, undetectable by computer). Results: Hard errors were not observed. For the older ICD model, the incidences of severe, moderate, and minor soft errors at 18 MV were 0.75, 0.5, and 0.83/50 Gy at the isocenter. The corresponding data for 10 MV were 0.094, 0.063, and 0 /50 Gy. For the newer ICD model at 18 MV, these data were 0.083, 2.3, and 5.8 /50 Gy. Moderate and minor errors occurred at 18 MV in control ICDs placed 140 cm from the isocenter. The error incidences were 0, 1, and 0 /600 Gy at the isocenter for the newer model, and 0, 1, and 6 /600Gy for the older model. At 10 MV, no errors occurred in control ICDs. Conclusions: ICD errors occurred more frequently at 18 MV irradiation, which suggests that the errors were mainly caused by secondary neutrons. Soft errors of ICDs were observed with high energy photon beams, but most were not critical in the newer model. These errors may occur even when the device is far from the irradiation field.

Hashii, Haruko, E-mail: haruko@pmrc.tsukuba.ac.jp [Department of Radiation Oncology, University of Tsukuba, Tsukuba, Ibaraki (Japan)] [Department of Radiation Oncology, University of Tsukuba, Tsukuba, Ibaraki (Japan); Hashimoto, Takayuki; Okawa, Ayako; Shida, Koichi; Isobe, Tomonori [Department of Radiation Oncology, University of Tsukuba, Tsukuba, Ibaraki (Japan)] [Department of Radiation Oncology, University of Tsukuba, Tsukuba, Ibaraki (Japan); Hanmura, Masahiro; Nishimura, Tetsuo [Department of Radiation Oncology, Shizuoka Cancer Center Hospital, Nagaizumi, Shizuoka (Japan)] [Department of Radiation Oncology, Shizuoka Cancer Center Hospital, Nagaizumi, Shizuoka (Japan); Aonuma, Kazutaka [Department of Cardiovascular Medicine, University of Tsukuba, Tsukuba, Ibaraki (Japan)] [Department of Cardiovascular Medicine, University of Tsukuba, Tsukuba, Ibaraki (Japan); Sakae, Takeji; Sakurai, Hideyuki [Department of Radiation Oncology, University of Tsukuba, Tsukuba, Ibaraki (Japan)] [Department of Radiation Oncology, University of Tsukuba, Tsukuba, Ibaraki (Japan)

2013-03-01T23:59:59.000Z

277

A Phase I Study of Chemoradiotherapy With Use of Involved-Field Conformal Radiotherapy and Accelerated Hyperfractionation for Stage III Non-Small Cell Lung Cancer: WJTOG 3305  

SciTech Connect (OSTI)

Purpose: A Phase I study to determine a recommended dose of thoracic radiotherapy using accelerated hyperfractionation for unresectable non-small-cell lung cancer was conducted. Methods and Materials: Patients with unresectable Stage III non-small-cell lung cancer were treated intravenously with carboplatin (area under the concentration curve 2) and paclitaxel (40 mg/m{sup 2}) on Days 1, 8, 15, and 22 with concurrent twice-daily thoracic radiotherapy (1.5 Gy per fraction) beginning on Day 1 followed by two cycles of consolidation chemotherapy using carboplatin (area under the concentration curve 5) and paclitaxel (200 mg/m{sup 2}). Total doses were 54 Gy in 36 fractions, 60 Gy in 40 fractions, 66 Gy in 44 fractions, and 72 Gy in 48 fractions at Levels 1 to 4. The dose-limiting toxicity, defined as Grade {>=}4 esophagitis and neutropenic fever and Grade {>=}3 other nonhematologic toxicities, was monitored for 90 days. Results: Of 26 patients enrolled, 22 patients were assessable for response and toxicity. When 4 patients entered Level 4, enrollment was closed to avoid severe late toxicities. Dose-limiting toxicities occurred in 3 patients. They were Grade 3 neuropathy at Level 1 and Level 3 and Grade 3 infection at Level 1. However, the maximum tolerated dose was not reached. The median survival time was 28.6 months for all patients. Conclusions: The maximum tolerated dose was not reached, although the dose of radiation was escalated to 72 Gy in 48 fractions. However, a dose of 66 Gy in 44 fractions was adopted for this study because late toxicity data were insufficient.

Tada, Takuhito, E-mail: tada@msic.med.osaka-cu.ac.jp [Department of Radiology, Osaka City University Graduate School of Medicine, Osaka (Japan); Department of Radiology, Izumi Municipal Hospital, Izumi (Japan); Chiba, Yasutaka [Department of Environmental Medicine and Behavioural Science, Kinki University Faculty of Medicine, Osaka-sayama (Japan); Tsujino, Kayoko [Department of Radiation Oncology, Hyogo Cancer Center, Akashi (Japan); Fukuda, Haruyuki [Department of Radiology, Osaka Prefectural Medical Center for Respiratory and Allergic Diseases, Habikino (Japan); Nishimura, Yasumasa [Department of Radiation Oncology, Kinki University Faculty of Medicine, Osaka-sayama (Japan); Kokubo, Masaki [Division of Radiation Oncology, Institute of Biomedical Research and Innovation, Kobe (Japan); Negoro, Shunichi [Department of Medical Oncology, Hyogo Cancer Center, Akashi (Japan); Kudoh, Shinzoh [Department of Respiratory Medicine, Osaka City University Graduate School of Medicine, Osaka (Japan); Fukuoka, Masahiro [Department of Medical Oncology, Izumi Municipal Hospital, Izumi (Japan); Nakagawa, Kazuhiko [Department of Medical Oncology, Kinki University Faculty of Medicine, Osaka-sayama (Japan); Nakanishi, Yoichi [Research Institute for Disease of the Chest, Graduate School of Medical Science, Kyusyu University, Fukuoka (Japan)

2012-05-01T23:59:59.000Z

278

Duodenal and Other Gastrointestinal Toxicity in Cervical and Endometrial Cancer Treated With Extended-Field Intensity Modulated Radiation Therapy to Paraaortic Lymph Nodes  

SciTech Connect (OSTI)

Purpose: To characterize the rates of acute and late duodenal and other gastrointestinal (GI) toxicities among patients treated for cervical and endometrial cancers with extended-field intensity modulated radiation therapy (EF-IMRT) to the paraaortic nodes and to analyze dose-volume relationships of GI toxicities. Methods and Materials: Fifty-three patients with endometrial or cervical cancer underwent EF-IMRT to the paraaortic nodes, of whom 46 met the inclusion criteria for GI toxicity and 45 for duodenal toxicity analysis. The median prescribed dose to the paraaortic nodes was 54 Gy (range, 41.4-65 Gy). The 4 duodenal segments, whole duodenum, small bowel loops, peritoneum, and peritoneum plus retroperitoneal segments of colon were contoured retrospectively, and dosimetric analysis was performed to identify dose-volume relationships to grade ?3 acute (<90 day) and late (?90 day) GI toxicity. Results: Only 3/46 patients (6.5%) experienced acute grade ?3 GI toxicity and 3/46 patients (6.5%) experienced late grade ?3 GI toxicity. The median dose administered to these 6 patients was 50.4 Gy. One of 12 patients who received 63 to 65 Gy at the level of the renal hilum experienced grade 3 GI toxicity. Dosimetric analysis of patients with and without toxicity revealed no differences between the mean absolute or fractional volumes at any 5-Gy interval between 5 Gy and the maximum dose. None of the patients experienced duodenal toxicity. Conclusions: Treatment of paraaortic nodes with IMRT is associated with low rates of GI toxicities and no duodenal-specific toxicity, including patients treated with concurrent chemotherapy. This technique may allow sufficient dose sparing of the bowel to enable safe dose escalation to at least 65 Gy.

Poorvu, Philip D. [Department of Radiation Oncology, Brigham and Women's Hospital and Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Brigham and Women's Hospital and Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts (United States); Sadow, Cheryl A. [Department of Radiology, Brigham and Women's Hospital, and Harvard Medical School, Boston, Massachusetts (United States)] [Department of Radiology, Brigham and Women's Hospital, and Harvard Medical School, Boston, Massachusetts (United States); Townamchai, Kanokpis; Damato, Antonio L. [Department of Radiation Oncology, Brigham and Women's Hospital and Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts (United States)] [Department of Radiation Oncology, Brigham and Women's Hospital and Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts (United States); Viswanathan, Akila N., E-mail: aviswanathan@lroc.harvard.edu [Department of Radiation Oncology, Brigham and Women's Hospital and Dana-Farber Cancer Institute, Harvard Medical School, Boston, Massachusetts (United States)

2013-04-01T23:59:59.000Z

279

Intensity Modulated Radiation Therapy With Dose Painting to Treat Rhabdomyosarcoma  

SciTech Connect (OSTI)

Purpose: To examine local control and patterns of failure in rhabdomyosarcoma patients treated with intensity modulated radiation therapy (RT) with dose painting (DP-IMRT). Patients and Methods: A total of 41 patients underwent DP-IMRT with chemotherapy for definitive treatment. Nineteen also underwent surgery with or without intraoperative RT. Fifty-six percent had alveolar histologic features. The median interval from beginning chemotherapy to RT was 17 weeks (range, 4-25). Very young children who underwent second-look procedures with or without intraoperative RT received reduced doses of 24-36 Gy in 1.4-1.8-Gy fractions. Young adults received 50.4 Gy to the primary tumor and lower doses of 36 Gy in 1.8-Gy fractions to at-risk lymph node chains. Results: With 22 months of median follow-up, the actuarial local control rate was 90%. Patients aged {<=}7 years who received reduced overall and fractional doses had 100% local control, and young adults had 79% (P=.07) local control. Three local failures were identified in young adults whose primary target volumes had received 50.4 Gy in 1.8-Gy fractions. Conclusions: DP-IMRT with lower fractional and cumulative doses is feasible for very young children after second-look procedures with or without intraoperative RT. DP-IMRT is also feasible in adolescents and young adults with aggressive disease who would benefit from prophylactic RT to high-risk lymph node chains, although dose escalation might be warranted for improved local control. With limited follow-up, it appears that DP-IMRT produces local control rates comparable to those of sequential IMRT in patients with rhabdomyosarcoma.

Yang, Joanna C.; Dharmarajan, Kavita V. [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, New York (United States)] [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Wexler, Leonard H. [Department of Pediatrics, Memorial Sloan-Kettering Cancer Center, New York, New York (United States)] [Department of Pediatrics, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); La Quaglia, Michael P. [Department of Surgery, Memorial Sloan-Kettering Cancer Center, New York, New York (United States)] [Department of Surgery, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Happersett, Laura [Department of Medical Physics, Memorial Sloan-Kettering Cancer Center, New York, New York (United States)] [Department of Medical Physics, Memorial Sloan-Kettering Cancer Center, New York, New York (United States); Wolden, Suzanne L., E-mail: woldens@mskcc.org [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, New York (United States)

2012-11-01T23:59:59.000Z

280

Correlation of Osteoradionecrosis and Dental Events With Dosimetric Parameters in Intensity-Modulated Radiation Therapy for Head-and-Neck Cancer  

SciTech Connect (OSTI)

Purpose: Osteoradionecrosis (ORN) is a known complication of radiation therapy to the head and neck. However, the incidence of this complication with intensity-modulated radiation therapy (IMRT) and dental sequelae with this technique have not been fully elucidated. Methods and Materials: From December 2000 to July 2007, 168 patients from our institution have been previously reported for IMRT of the oral cavity, nasopharynx, larynx/hypopharynx, sinus, and oropharynx. All patients underwent pretreatment dental evaluation, including panoramic radiographs, an aggressive fluoride regimen, and a mouthguard when indicated. The median maximum mandibular dose was 6,798 cGy, and the median mean mandibular dose was 3,845 cGy. Patient visits were retrospectively reviewed for the incidence of ORN, and dental records were reviewed for the development of dental events. Univariate analysis was then used to assess the effect of mandibular and parotid gland dosimetric parameters on dental endpoints. Results: With a median clinic follow-up of 37.4 months (range, 0.8-89.6 months), 2 patients, both with oral cavity primaries, experienced ORN. Neither patient had preradiation dental extractions. The maximum mandibular dose and mean mandibular dose of the 2 patients were 7,183 and 6,828 cGy and 5812 and 5335 cGy, respectively. In all, 17% of the patients (n = 29) experienced a dental event. A mean parotid dose of >26 Gy was predictive of a subsequent dental caries, whereas a maximum mandibular dose >70 Gy and a mean mandibular dose >40 Gy were correlated with dental extractions after IMRT. Conclusions: ORN is rare after head-and-neck IMRT, but is more common with oral cavity primaries. Our results suggest different mechanisms for radiation-induced caries versus extractions.

Gomez, Daniel R., E-mail: dgomez@mdanderson.org [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Estilo, Cherry L. [Dental Service, Department of Surgery, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Wolden, Suzanne L.; Zelefsky, Michael J. [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Kraus, Dennis H.; Wong, Richard J.; Shaha, Ashok R.; Shah, Jatin P. [Department of Head and Neck Surgery, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Mechalakos, James G.; Lee, Nancy Y. [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States)

2011-11-15T23:59:59.000Z

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Risk of Radiation Retinopathy in Patients With Orbital and Ocular Lymphoma  

SciTech Connect (OSTI)

Purpose: Radiation retinopathy is a potential long-term complication of radiation therapy to the orbit. The risk of developing this adverse effect is dose dependent; however, the threshold is unclear. The aim of this study was to identify the risk of developing radiation retinopathy at increasing radiation doses. Methods and Materials: A 40-year retrospective review was performed of patients who received external beam radiation therapy for ocular/orbital non-Hodgkin lymphoma (NHL). Results: Sixty-seven patients who had at least one ophthalmic follow-up examination were included in this study. Most patients (52%) were diagnosed with NHL involving the orbit. Patients received external beam radiation therapy at doses between 1886 and 5400 cGy (mean, 3033 {+-} 782 cGy). Radiation retinopathy developed in 12% of patients, and the median time to diagnosis was 27 months (range, 15-241months). The mean prescribed radiation dose in patients with retinopathy was 3309 {+-} 585 cGy, and the estimated retinal dose (derived by reviewing the dosimetry) was 3087 {+-} 1030 cGy. The incidence of retinopathy increased with dose. The average prescribed daily fractionated dose was higher in patients who developed retinopathy than in patients who did not (mean, 202 cGy vs 180 cGy, respectively; P = .04). More patients with radiation retinopathy had comorbid diabetes mellitus type 2 than patients without retinopathy (P = .015). In our study, the mean visual acuity of the eyes that received radiation was worse than that of the eyes that did not (P = .027). Other postradiotherapy ocular findings included keratitis (6%), dry eyes (39%), and cataract (33%). Conclusions: Radiation retinopathy, a known complication of radiotherapy for orbital tumors, relates to vascular comorbidities and dose. Higher total doses and larger daily fractions (>180 cGy) appear to be related to higher rates of retinopathy. Future larger studies are required to identify a statistically significant threshold for the development of retinopathy.

Kaushik, Megha; Pulido, Jose S. [Department of Ophthalmology, Mayo Clinic, Rochester, Minnesota (United States)] [Department of Ophthalmology, Mayo Clinic, Rochester, Minnesota (United States); Schild, Steven E. [Division of Radiation Oncology, Mayo Clinic, Scottsdale, Arizona (United States)] [Division of Radiation Oncology, Mayo Clinic, Scottsdale, Arizona (United States); Stafford, Scott, E-mail: stafford.scott@mayo.edu [Division of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States)] [Division of Radiation Oncology, Mayo Clinic, Rochester, Minnesota (United States)

2012-12-01T23:59:59.000Z

282

Stimulation of Hepatoma Cell Invasiveness and Metastatic Potential by Proteins Secreted From Irradiated Nonparenchymal Cells  

SciTech Connect (OSTI)

Purpose: To determine whether factors secreted by irradiated liver nonparenchymal cells (NPCs) may influence invasiveness and/or metastatic potential of hepatocellular carcinoma (HCC) cells and to elucidate a possible mechanism for such effect. Methods and Materials: Primary rat NPCs were cultured and divided into irradiated (10-Gy X-ray) and nonirradiated groups. Forty-eight hours after irradiation, conditioned medium from irradiated (SR) or nonirradiated (SnonR) cultures were collected and added to sublethally irradiated cultures of the hepatoma McA-RH7777 cell line. Then, hepatoma cells were continuously passaged for eight generations (RH10Gy-SR and RH10Gy-SnonR). The invasiveness and metastatic potential of McA-RH7777, RH10Gy-SnonR, and RH10Gy-SR cells were evaluated using an in vitro gelatinous protein (Matrigel) invasion and an in vivo metastasis assay. In addition, SR and SnonR were tested using rat cytokine antibody arrays and enzyme-linked immunosorbent assay (ELISA). Results: In vitro gelatinous protein invasion assay indicated that the numbers of invading cells was significantly higher in RH10Gy-SR (40 {+-} 4.74) than in RH10Gy-SnonR (30.6 {+-} 3.85) cells, and lowest in McA-RH7777 (11.4 {+-} 3.56) cells. The same pattern was observed in vivo in a lung metastasis assay, as evaluated by number of metastatic lung nodules seen with RH10Gy-SR (28.83 {+-} 5.38), RH10Gy-SnonR (22.17 {+-} 4.26), and McA-RH7777 (8.3 {+-} 3.8) cells. Rat cytokine antibody arrays and ELISA demonstrated that metastasis-promoting cytokines (tumor necrosis factor-{alpha} and interleukin-6), circulating growth factors (vascular endothelial growth factor and epidermal growth factor), and metalloproteinases (MMP-2 and MMP-9) were upregulated in SR compared with SnonR. Conclusions: Radiation can increase invasiveness and metastatic potential of sublethally irradiated hepatoma cells, and soluble mediators released from irradiated NPCs promote this potential. Increased secretion of metastasis-related cytokines and factors from NPCs after irradiation may be a possible mechanism for the radiation-induced invasiveness and metastatic potential of HCC.

Zhou Leyuan [Department of Radiation Oncology, Zhongshan Hospital, Fudan University, Shanghai (China)] [Department of Radiation Oncology, Zhongshan Hospital, Fudan University, Shanghai (China); Wang Zhiming [Department of Medical Oncology, Zhongshan Hospital, Fudan University, Shanghai (China)] [Department of Medical Oncology, Zhongshan Hospital, Fudan University, Shanghai (China); Gao Yabo [Department of Radiation Oncology, Zhongshan Hospital, Fudan University, Shanghai (China)] [Department of Radiation Oncology, Zhongshan Hospital, Fudan University, Shanghai (China); Wang Lingyan [Experimental Research Center, Zhongshan Hospital, Fudan University, Shanghai (China)] [Experimental Research Center, Zhongshan Hospital, Fudan University, Shanghai (China); Zeng Zhaochong, E-mail: zeng.zhaochong@zs-hospital.sh.cn [Department of Radiation Oncology, Zhongshan Hospital, Fudan University, Shanghai (China)

2012-11-01T23:59:59.000Z

283

Dosimetric Comparison of 6 MV and 15 MV Single Arc Rapidarc to Helical TomoTherapy for the Treatment of Pancreatic Cancer  

SciTech Connect (OSTI)

We conducted a planning study to compare Varian's RapidArc (RA) and helical TomoTherapy (HT) for the treatment of pancreatic cancer. Three intensity-modulated radiotherapy (IMRT) plans were generated for 8 patients with pancreatic cancer: one using HT with 6-MV beam (Plan{sub HT6}), one using single-arc RA with 6-MV beam (Plan{sub RA6}), and one using single-arc RA with 15-MV beam (Plan{sub RA15}). Dosimetric indices including high/low conformality index (CI{sub 100%}/CI{sub 50%}), heterogeneity index (HI), monitor units (MUs), and doses to organs at risk (OARs) were compared. The mean CI{sub 100%} was statistically equivalent with respect to the 2 treatment techniques, as well as beam energy (0.99, 1.01, and 1.02 for Plan{sub HT6}, Plan{sub RA6}, and Plan{sub RA156,} respectively). The CI{sub 50%} and HI were improved in both RA plans over the HT plan. The RA plans significantly reduced MU (MU{sub RA6} = 697, MU{sub RA15} = 548) compared with HT (MU{sub HT6} = 6177, p = 0.008 in both cases). The mean maximum cord dose was decreased from 29.6 Gy in Plan{sub HT6} to 21.6 Gy (p = 0.05) in Plan{sub RA6} and 21.7 Gy (p = 0.04) in Plan{sub RA15}. The mean bowel dose decreased from 17.2 Gy in Plan{sub HT6} to 15.2 Gy (p = 0.03) in Plan{sub RA6} and 15.0 Gy (p = 0.03) Plan{sub RA15}. The mean liver dose decreased from 8.4 Gy in Plan{sub HT6} to 6.3 Gy (p = 0.04) in Plan{sub RA6} and 6.2 Gy in Plan{sub RA15}. Variations of the mean dose to the duodenum, kidneys, and stomach were statistically insignificant. RA and HT can both deliver conformal dose distributions to target volumes while limiting the dose to surrounding OARs in the treatment of pancreatic cancer. Dosimetric advantages might be gained by using RA over HT by reducing the dose to OARs and total MUs used for treatment.

Cai Jing, E-mail: jing.cai@duke.edu [Department of Radiation Oncology, Duke University Medical Center, Durham, NC (United States); Department of Radiation Oncology, University of Virginia, Charlottesville, VA (United States); Yue Jinbo [Department of Radiation Oncology, Duke University Medical Center, Durham, NC (United States); Department of Radiation Oncology, Shandong Cancer Hospital, Jinan, Shandong (China); McLawhorn, Robert; Yang Wensha; Wijesooriya, Krishni; Dunlap, Neal E.; Sheng Ke [Department of Radiation Oncology, University of Virginia, Charlottesville, VA (United States); Yin Fangfang [Department of Radiation Oncology, Duke University Medical Center, Durham, NC (United States); Benedict, Stanley H. [Department of Radiation Oncology, University of Virginia, Charlottesville, VA (United States)

2011-10-01T23:59:59.000Z

284

N-Terminal Pro-B-Type Natriuretic Peptide Plasma Levels as a Potential Biomarker for Cardiac Damage After Radiotherapy in Patients With Left-Sided Breast Cancer  

SciTech Connect (OSTI)

Purpose: Adjuvant radiotherapy (RT) after breast-conserving surgery has been associated with increased cardiovascular mortality. Cardiac biomarkers may aid in identifying patients with radiation-mediated cardiac dysfunction. We evaluated the correlation between N-terminal pro-B-type natriuretic peptide (NT-proBNP) and troponin (TnI) and the dose of radiation to the heart in patients with left-sided breast cancer. Methods and Materials: NT-proBNP and TnI plasma concentrations were measured in 30 left-sided breast cancer patients (median age, 55.0 years) 5 to 22 months after RT (Group I) and in 30 left-sided breast cancer patients (median age, 57.0 years) before RT as control group (Group II). Dosimetric and geometric parameters of heart and left ventricle were determined in all patients of Group I. Seventeen patients underwent complete two-dimensional echocardiography. Results: NT-proBNP levels were significantly higher (p = 0.03) in Group I (median, 90.0 pg/ml; range, 16.7-333.1 pg/ml) than in Group II (median, 63.2 pg/ml; range, 11.0-172.5 pg/ml). TnI levels remained below the cutoff threshold of 0.07 ng/ml in both groups. In patients with NT-proBNP values above the upper limit of 125 pg/ml, there were significant correlations between plasma levels and V{sub 3Gy}(%) (p = 0.001), the ratios D{sub 15cm{sup 3}}(Gy)/D{sub mean}(Gy) (p = 0.01), the ratios D{sub 15cm}{sup 3}/D{sub 50%} (Gy) (p = 0.008) for the heart and correlations between plasma levels and V{sub 2Gy} (%) (p = 0.002), the ratios D{sub 1cm{sup 3}}(Gy)/D{sub mean}(Gy) (p = 0.03), and the ratios D{sub 0.5cm{sup 3}}(Gy)/D{sub 50%}(Gy) (p = 0.05) for the ventricle. Conclusions: Patients with left-sided breast cancer show higher values of NT-pro BNP after RT when compared with non-RT-treated matched patients, increasing in correlation with high doses in small volumes of heart and ventricle. The findings of this study show that the most important parameters are not the mean doses but instead the small percentage of organ volumes (heart or ventricle) receiving high dose levels, supporting the notion that the heart behaves as a serial organ.

D'Errico, Maria P., E-mail: patderrico@libero.it [Department of Laboratory Medicine, 'A. Perrino' Hospital, Brindisi (Italy); Grimaldi, Luca [Department of Medical Physics, 'A. Perrino' Hospital, Brindisi (Italy); Petruzzelli, Maria F. [Department of Radiation Oncology, 'A. Perrino' Hospital, Brindisi (Italy); Gianicolo, Emilio A.L. [Clinical Physiology Institute, National Research Council (IFC-CNR), Pisa-Lecce (Italy); Tramacere, Francesco [Department of Radiation Oncology, 'A. Perrino' Hospital, Brindisi (Italy); Monetti, Antonio; Placella, Roberto [Department of Laboratory Medicine, 'A. Perrino' Hospital, Brindisi (Italy); Pili, Giorgio [Department of Medical Physics, 'A. Perrino' Hospital, Brindisi (Italy); Andreassi, Maria Grazia; Sicari, Rosa; Picano, Eugenio [Clinical Physiology Institute, National Research Council (IFC-CNR), Pisa-Lecce (Italy); Portaluri, Maurizio [Department of Radiation Oncology, 'A. Perrino' Hospital, Brindisi (Italy); Clinical Physiology Institute, National Research Council (IFC-CNR), Pisa-Lecce (Italy)

2012-02-01T23:59:59.000Z

285

Harnessing a radiation inducible promoter of Deinococcus radiodurans for enhanced precipitation of uranium  

Science Journals Connector (OSTI)

Abstract Bioremediation is an attractive option for the treatment of radioactive waste. We provide a proof of principle for augmentation of uranium bioprecipitation using the radiation inducible promoter, Pssb from Deinococcus radiodurans. Recombinant cells of D. radiodurans carrying acid phosphatase gene, phoN under the regulation of Pssb when exposed to 7kGy gamma radiation at two different dose rates of 56.8Gy/min and 4Gy/min, showed 89 fold increase in acid phosphatase activity. Highest whole cell PhoN activity was obtained after 2h in post irradiation recovery following 8kGy of high dose rate radiation. Such cells showed faster removal of high concentrations of uranium than recombinant cells expressing PhoN under a radiation non-inducible deinococcal promoter, PgroESL and could precipitate uranium even after continuous exposure to 0.6Gy/min gamma radiation for 10 days. Radiation induced recombinant D. radiodurans cells when lyophilized retained high levels of PhoN activity and precipitated uranium efficiently. These results highlight the importance of using a suitable promoter for removal of radionuclides from solution.

Chitra Seetharam Misra; Rita Mukhopadhyaya; Shree Kumar Apte

2014-01-01T23:59:59.000Z

286

Effect of Cisplatin on Parotid Gland Function in Concomitant Radiochemotherapy  

SciTech Connect (OSTI)

Purpose: To determine the influence of concomitant radiochemotherapy with cisplatin on parotid gland tissue complication probability. Methods and Materials: Patients treated with either radiotherapy (n = 61) or concomitant radiochemotherapy with cisplatin (n = 36) for head-and-neck cancer were prospectively evaluated. The dose and volume distributions of the parotid glands were noted in dose-volume histograms. Stimulated salivary flow rates were measured before, during the 2nd and 6th weeks and at 4 weeks and 6 months after the treatment. The data were fit using the normal tissue complication probability model of Lyman. Complication was defined as a reduction of the salivary flow rate to less than 25% of the pretreatment flow rate. Results: The normal tissue complication probability model parameter TD{sub 50} (the dose leading to a complication probability of 50%) was found to be 32.2 Gy at 4 weeks and 32.1 Gy at 6 months for concomitant radiochemotherapy and 41.1 Gy at 4 weeks and 39.6 Gy at 6 months for radiotherapy. The tolerated dose for concomitant radiochemotherapy was at least 7 to 8 Gy lower than for radiotherapy alone at TD{sub 50}. Conclusions: In this study, the concomitant radiochemotherapy tended to cause a higher probability of parotid gland tissue damage. Advanced radiotherapy planning approaches such as intensity-modulated radiotherapy may be partiticularly important for parotid sparing in radiochemotherapy because of cisplatin-related increased radiosensitivity of glands.

Hey, Jeremias; Setz, Juergen [Department of Prosthetic Dentistry, University School of Dental Medicine, Martin- Luther- University, Halle (Germany); Gerlach, Reinhard; Vordermark, Dirk [Department of Radiotherapy, University Clinic, Martin-Luther-University, Halle (Germany); Gernhardt, Christian R. [Department of Operative Dentistry and Periodontology, University School of Dental Medicine, Martin-Luther-University, Halle (Germany); Kuhnt, Thomas, E-mail: thomas.kuhnt@medizin.uni-halle.d [Department of Radiotherapy, University Clinic, Martin-Luther-University, Halle (Germany)

2009-12-01T23:59:59.000Z

287

Nanocrystalline BaSO{sub 4}:Eu For Dosimetry of Proton Beams  

SciTech Connect (OSTI)

Nanocrystalline BaSO{sub 4} doped with Eu, was prepared by the Chemical Co-precipitation method. The particle size was calculated by the broadening of the XRD peaks using Scherrer's formula with particle size around 45 nm. Samples in the form of pellets were irradiated by 150 MeV proton beam with dose range of 0.1 Gy to 325 Gy. Thermoluminescence (TL) glow curves of the irradiated samples were recorded and studied. It has been found that there are two prominent TL glow peaks at 460 K and 495 K. The TL response is sublinear below 1 Gy, linear in the range 1 Gy to 200 Gy and then becomes supralinear for higher doses. The wider linear TL response of nanocrystalline BaSO{sub 4}:Eu and low fading makes it a superior candidate as a dosimeter to be used for detecting the doses of protons for its various applications in the field of space, therapy and research.

Bahl, Shaila; Kumar, Pratik [Medical Physics Unit, IRCH, AIIMS, New Delhi-110029 (India); Lochab, S. P. [Inter-University Accelerator Center, Aruna Asaf Ali Marg, New Delhi - 110067 (India); Pandey, Anant [Department of Physics, Sri Venkateswara College, New Delhi-110021 (India); Aleynikov, V. E.; Molokanov, A. [Joint Institute for Nuclear Research, Dubna - 141980 (Russian Federation)

2011-07-15T23:59:59.000Z

288

A Systems Genetics Approach to Evaluate Serum Cytokine Expression Profiles  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Evaluate Serum Cytokine Expression Profiles Evaluate Serum Cytokine Expression Profiles in 10 cGy-Irradiated Mice: Possible Connection to Susceptibility/Resistance to Cancer E.A. Blakely Lawrence Berkeley National Laboratory Abstract Goal: To use a systems-genetics approach to evaluate serum cytokine expression profiles in 10 cGy-whole-body-irradiated mice (BALB/c and Spret/EiJ parental strains, and their F1 offspring backcrossed (F1Bx) to female BALB/c). Background and Significance: Even low doses of ionizing radiation (∼10 cGy) can alter the composition of the tissue microenvironment by rapidly affecting cytokine production and activities, extracellular matrix (ECM) composition, and the expression of receptors that mediate cell-to-cell interactions (1). The stroma in mammary glands is constantly changing

289

C AIR O EN ROC CHICA RPORT  

Broader source: Energy.gov (indexed) [DOE]

AIR AIR O EN ROC CHICA RPORT Office o NVIRON CKFO AGO RO T, WIN U.S f Energ D NMEN ORD S PRO OCKFO NNEBA . Depar gy Efficie Golden SEPT DRAFT NTAL A FOR SOLA OJEC ORD IN AGO C tment o ency and Field O TEMBER 20 ASSESS AR EN CT NTERN OUNT of Energ d Renew Office 011 SMENT NERG NATIO TY, ILL gy wable E DOE/EA- T GY ONAL LINOIS Energy -1823 S DOE/EA-1823 DRAFT ENVIRONMENTAL ASSESSMENT FOR ROCKFORD SOLAR ENERGY PROJECT CHICAGO ROCKFORD INTERNATIONAL AIRPORT, WINNEBAGO COUNTY, ILLINOIS U.S. Department of Energy Office of Energy Efficiency and Renewable Energy Golden Field Office SEPTEMBER 2011 DOE/EA-1823 (DRAFT) iii September 2011 COVER SHEET RESPONSIBLE AGENCY: U.S. Department of Energy TITLE: Draft Environmental Assessment: Rockford Solar Energy Project, Chicago-Rockford Airport,

290

Low-dose Photons Modify CD4+ T Cell Signaling Response to Simulated Solar  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Photons Modify CD4+ T Cell Signaling Response to Simulated Solar Photons Modify CD4+ T Cell Signaling Response to Simulated Solar Particle Event Protons Daila Gridley Loma Linda University and Medical Center Abstract Purpose: Astronauts on missions are exposed to low-dose/low-dose (LDR) radiation and could receive high doses during solar particle events (SPE). This study investigated T cell function in response to LDR radiation and simulated SPE (sSPE) protons, alone and in combination. Materials and methods: C57BL/6 mice received LDR γ-radiation (57Co) to a total dose of 0.01 Gray (Gy) at 0.0179 cGy/h, either with or without subsequent exposure to 1.7 Gy simulated SPE (sSPE) protons delivered over 36 h. On days 4 and 21 post-exposure, three functional pathways were studied using negatively isolated/anti-CD3 activated splenic CD4+ T cells:

291

Optimizing the dynamic range extension of a radiochromic film dosimetry system  

SciTech Connect (OSTI)

The authors present a radiochromic film dosimetry protocol for a multicolor channel radiochromic film dosimetry system consisting of the external beam therapy (EBT) model GAFCHROMIC film and the Epson Expression 1680 flat-bed document scanner. Instead of extracting only the red color channel, the authors are using all three color channels in the absorption spectrum of the EBT film to extend the dynamic dose range of the radiochromic film dosimetry system. By optimizing the dose range for each color channel, they obtained a system that has both precision and accuracy below 1.5%, and the optimized ranges are 0-4 Gy for the red channel, 4-50 Gy for the green channel, and above 50 Gy for the blue channel.

Devic, Slobodan; Tomic, Nada; Soares, Christopher G.; Podgorsak, Ervin B. [Medical Physics Department, McGill University Health Centre, Montreal, Quebec H3G 1A4 (Canada); Department of Radiation Oncology, Jewish General Hospital, McGill University, Montreal, Quebec H3T 1E2 (Canada); Ionizing Radiation Division, National Institute of Standards and Technology, Gaithersburg, Maryland 20899 (United States); Medical Physics Department, McGill University Health Centre, Montreal, Quebec H3G 1A4 (Canada)

2009-02-15T23:59:59.000Z

292

Inference of Causal Networks from Time-course Transcription Data in  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

Inference of Causal Networks from Time-course Transcription Data in Inference of Causal Networks from Time-course Transcription Data in Response to a 2 Gy Challenge Dose of Ionizing Radiation with or without a 10 cGy Priming Dose Kai Zhang Lawrence Berkeley National Laboratory Abstract Goal: To elucidate temporal-dependent gene templates, causal networks, and underlying biological processes that can be inferred in response to a 10 cGy priming dose with or without a later higher challenged dose. Background and significance: Mechanistic inference of regulatory network can provide new insights into radiation systems biology. The main challenge continues to be high dimensionality of data, complex network architecture and limited knowledge of biological processes. Approach: Our approach is to develop a novel computational method that

293

Influence of X-ray Irradiation on the Properties of the Hamamatsu Silicon Photomultiplier S10362-11-050C  

E-Print Network [OSTI]

We have investigated the effects of X-ray irradiation to doses of 0, 200 Gy, 20 kGy, 2 MGy, and 20 MGy on the Hamamatsu silicon-photomultiplier (SiPM) S10362-11-050C. The SiPMs were irradiated without applied bias voltage. From current-voltage, capacitance/conductance-voltage, -frequency, pulse-shape, and pulse-area measurements, the SiPM characteristics below and above breakdown voltage were determined. Significant changes of some SiPM parameters are observed. Up to a dose of 20 kGy the performance of the SiPMs is hardly affected by X-ray radiation damage. For doses of 2 and 20 MGy the SiPMs operate with hardly any change in gain, but with a significant increase in dark-count rate and cross-talk probability.

Chen Xu; Robert Klanner; Erika Garutti; Wolf-Lukas Hellweg

2014-06-11T23:59:59.000Z

294

SU?FF?T?174: Dose Rate Dependence of Film Dosimetry in Radiation Treatment: Study of Reciprocity Law  

Science Journals Connector (OSTI)

Purpose: Film has become an important tool for dose verification in individualized IMRTtreatment fields. The optical density (OD) is related to dose rate also known as reciprocity law; (D= Dr*t). However for modern films (EDR and XV) reciprocity law has not been investigated which is presented in this study. Method and Materials: Using a Varian linear accelerator dose rate dependence was studied for Kodak films (XV and EDR). The dose rate on this unit could be varied in the range of 80400 MU/min for both (6 MV and 15 MV) photons beams. A large dose rate range; 5 cGy/min ?1100 cGy/min was achieved in conjunction with distance (14 meters) and machine dose rate. This was verified using ion chamber. At each dose rate films were exposed in a solid phantom at a depth of dmax for 300 cGy and 50 cGy for EDR and XV films respectively. Calibration curves (dose vs. OD) were also established during this experiment in a standard condition. The measured dose through film and ion chamber were compared and analyzed. Results: Reciprocity law holds good in the dose rate range of 20400 cGy/min for both energies but deviates at low and high dose rates. The effect is more pronounced at dose rate beyond 400 cGy/min where deviation up to 7.5% was noted for both the films. At low dose rate the deviation is ?3.5% for both films and energies. Conclusion: Low and high dose regions are created in the same time of exposure in IMRT and hence reciprocity law becomes critical for film dosimetry. The reciprocity law failure is due to the interaction of ion pairs to form latent image which could be suppressed at extreme dose rates. The dosimetric impact is noted to be up to 7.5% for both films.

S Srivastava; I Das

2006-01-01T23:59:59.000Z

295

Radiation Pneumonitis After Hypofractionated Radiotherapy: Evaluation of the LQ(L) Model and Different Dose Parameters  

SciTech Connect (OSTI)

Purpose: To evaluate the linear quadratic (LQ) model for hypofractionated radiotherapy within the context of predicting radiation pneumonitis (RP) and to investigate the effect if a linear (L) model in the high region (LQL model) is used. Methods and Materials: The radiation doses used for 128 patients treated with hypofractionated radiotherapy were converted to the equivalent doses given in fractions of 2 Gy for a range of {alpha}/{beta} ratios (1 Gy to infinity) according to the LQ(L) model. For the LQL model, different cut-off values between the LQ model and the linear component were used. The Lyman model parameters were fitted to the events of RP grade 2 or higher to derive the normal tissue complication probability (NTCP). The lung dose was calculated as the mean lung dose and the percentage of lung volume (V) receiving doses higher than a threshold dose of xGy (V{sub x}). Results: The best NTCP fit was found if the mean lung dose, or V{sub x}, was calculated with an {alpha}/{beta} ratio of 3 Gy. The NTCP fit of other {alpha}/{beta} ratios and the LQL model were worse but within the 95% confidence interval of the NTCP fit of the LQ model with an {alpha}/{beta} ratio of 3 Gy. The V{sub 50} NTCP fit was better than the NTCP fit of lower threshold doses. Conclusions: For high fraction doses, the LQ model with an {alpha}/{beta} ratio of 3 Gy was the best method for converting the physical lung dose to predict RP.

Borst, Gerben R. [Department of Radiation Oncology, Netherlands Cancer Institute-Antoni van Leeuwenhoek Hospital, Amsterdam (Netherlands); Ishikawa, Masayori [Department of Radiology, Hokkaido University School of Medicine, Sapporo (Japan); Nijkamp, Jasper [Department of Radiation Oncology, Netherlands Cancer Institute-Antoni van Leeuwenhoek Hospital, Amsterdam (Netherlands)

2010-08-01T23:59:59.000Z

296

Impact of intra-arterial administration of boron compounds on dose-volume histograms in boron neutron capture therapy for recurrent head-and-neck tumors  

SciTech Connect (OSTI)

Purpose: To analyze the dose-volume histogram (DVH) of head-and-neck tumors treated with boron neutron capture therapy (BNCT) and to determine the advantage of the intra-arterial (IA) route over the intravenous (IV) route as a drug delivery system for BNCT. Methods and Materials: Fifteen BNCTs for 12 patients with recurrent head-and-neck tumors were included in the present study. Eight irradiations were done after IV administration of boronophenylalanine and seven after IA administration. The maximal, mean, and minimal doses given to the gross tumor volume were assessed using a BNCT planning system. Results: The results are reported as median values with the interquartile range. In the IA group, the maximal, mean, and minimal dose given to the gross tumor volume was 68.7 Gy-Eq (range, 38.8-79.9), 45.0 Gy-Eq (range, 25.1-51.0), and 13.8 Gy-Eq (range, 4.8-25.3), respectively. In the IV group, the maximal, mean, and minimal dose given to the gross tumor volume was 24.2 Gy-Eq (range, 21.5-29.9), 16.4 Gy-Eq (range, 14.5-20.2), and 7.8 Gy-Eq (range, 6.8-9.5), respectively. Within 1-3 months after BNCT, the responses were assessed. Of the 6 patients in the IV group, 2 had a partial response, 3 no change, and 1 had progressive disease. Of 4 patients in the IA group, 1 achieved a complete response and 3 a partial response. Conclusion: Intra-arterial administration of boronophenylalanine is a promising drug delivery system for head-and-neck BNCT.

Suzuki, Minoru [Particle Oncology Research Center, Research Reactor Institute, Kyoto University, Osaka (Japan)]. E-mail: msuzuki@rri.kyoto-u.ac.jp; Sakurai, Yoshinori [Division of Medical Physics, Department of Radiation Life Science, Research Reactor Institute, Kyoto University, Osaka (Japan); Nagata, Kenji [Particle Oncology Research Center, Research Reactor Institute, Kyoto University, Osaka (Japan); Kinashi, Yuko [Particle Oncology Research Center, Research Reactor Institute, Kyoto University, Osaka (Japan); Masunaga, Shinichiro [Particle Oncology Research Center, Research Reactor Institute, Kyoto University, Osaka (Japan); Ono, Koji [Particle Oncology Research Center, Research Reactor Institute, Kyoto University, Osaka (Japan); Maruhashi, Akira [Division of Medical Physics, Department of Radiation Life Science, Research Reactor Institute, Kyoto University, Osaka (Japan); Kato, Ituro [Department of Oral and Maxillofacial Surgery II, Osaka University Graduate School of Dentistry, Osaka (Japan); Fuwa, Nobukazu [Department of Radiation Oncology, Aichi Cancer Center, Aichi (Japan); Hiratsuka, Junichi [Department of Radiation Oncology, Kawasaki Medical School, Okayama (Japan); Imahori, Yoshio [Cancer Intelligence Care Systems, Inc., Tokyo (Japan)

2006-12-01T23:59:59.000Z

297

Chest Wall Toxicity After Stereotactic Body Radiotherapy for Malignant Lesions of the Lung and Liver  

SciTech Connect (OSTI)

Purpose: To quantify the frequency of rib fracture and chest wall (CW) pain and identify the dose-volume parameters that predict CW toxicity after stereotactic body radiotherapy (SBRT). Methods and Materials: The records of patients treated with SBRT between 2000 and 2008 were reviewed, and toxicity was scored according to Common Terminology Criteria for Adverse Events v3.0 for pain and rib fracture. Dosimetric data for CW and rib were analyzed and related to the frequency of toxicity. The risks of CW toxicity were then further characterized according to the median effective concentration (EC{sub 50}) dose-response model. Results: A total of 347 lesions were treated with a median follow-up of 19 months. Frequency of Grade I and higher CW pain and/or fracture for CW vs. non-CW lesions was 21% vs. 4%, respectively (p < 0.0001). A dose of 50 Gy was the cutoff for maximum dose (Dmax) to CW and rib above which there was a significant increase in the frequency of any grade pain and fracture (p = 0.03 and p = 0.025, respectively). Volume of CW receiving 15 Gy - 40 Gy was highly predictive of toxicity (R{sup 2} > 0.9). According to the EC{sub 50} model, 5 cc and 15 cc of CW receiving 40 Gy predict a 10% and 30% risk of CW toxicity, respectively. Conclusion: Adequate tumor coverage remains the primary objective when treating lung or liver lesions with SBRT. To minimize toxicity when treating lesions in close proximity to the CW, Dmax of the CW and/or ribs should remain <50 Gy, and <5 cc of CW should receive {>=}40 Gy.

Andolino, David L., E-mail: dandolin@iupui.edu [Department of Radiation Oncology, Indiana University School of Medicine, Indianapolis, IN (United States); Forquer, Jeffrey A.; Henderson, Mark A.; Barriger, Robert B.; Shapiro, Ronald H.; Brabham, Jeffrey G.; Johnstone, Peter A.S.; Cardenes, Higinia R.; Fakiris, Achilles J. [Department of Radiation Oncology, Indiana University School of Medicine, Indianapolis, IN (United States)

2011-07-01T23:59:59.000Z

298

Retrospective Cohort Study of Bronchial Doses and Radiation-Induced Atelectasis After Stereotactic Body Radiation Therapy of Lung Tumors Located Close to the Bronchial Tree  

SciTech Connect (OSTI)

Purpose: To evaluate the doseresponse relationship between radiation-induced atelectasis after stereotactic body radiation therapy (SBRT) and bronchial dose. Methods and Materials: Seventy-four patients treated with SBRT for tumors close to main, lobar, or segmental bronchi were selected. The association between incidence of atelectasis and bronchial dose parameters (maximum point-dose and minimum dose to the high-dose bronchial volume [ranging from 0.1 cm{sup 3} up to 2.0 cm{sup 3}]) was statistically evaluated with survival analysis models. Results: Prescribed doses varied between 4 and 20 Gy per fraction in 2-5 fractions. Eighteen patients (24.3%) developed atelectasis considered to be radiation-induced. Statistical analysis showed a significant correlation between the incidence of radiation-induced atelectasis and minimum dose to the high-dose bronchial volumes, of which 0.1 cm{sup 3} (D{sub 0.1cm3}) was used for further analysis. The median value of D{sub 0.1cm3} (?/? = 3 Gy) was EQD{sub 2,LQ} = 147 Gy{sub 3} (range, 20-293 Gy{sub 3}). For patients who developed atelectasis the median value was EQD{sub 2,LQ} = 210 Gy{sub 3}, and for patients who did not develop atelectasis, EQD{sub 2,LQ} = 105 Gy{sub 3}. Median time from treatment to development of atelectasis was 8.0 months (range, 1.1-30.1 months). Conclusion: In this retrospective study a significant doseresponse relationship between the incidence of atelectasis and the dose to the high-dose volume of the bronchi is shown.

Karlsson, Kristin, E-mail: kristin.karlsson@karolinska.se [Department of Medical Physics, Karolinska University Hospital, Stockholm (Sweden); Department of Oncology-Pathology, Karolinska Institute, Stockholm (Sweden); Nyman, Jan [Department of Oncology, Sahlgrenska University Hospital, Gothenburg (Sweden); Baumann, Pia; Wersll, Peter [Department of Oncology, Radiumhemmet, Karolinska University Hospital, Stockholm (Sweden); Department of Oncology-Pathology, Karolinska Institute, Stockholm (Sweden); Drugge, Ninni [Department of Radiation Physics, Sahlgrenska University Hospital, Gothenburg (Sweden); Gagliardi, Giovanna [Department of Medical Physics, Karolinska University Hospital, Stockholm (Sweden); Department of Oncology-Pathology, Karolinska Institute, Stockholm (Sweden); Johansson, Karl-Axel [Department of Radiation Physics, Sahlgrenska University Hospital, Gothenburg (Sweden); Persson, Jan-Olov [Statistical Research Group, Mathematical Statistics, Stockholm University, Stockholm (Sweden); Rutkowska, Eva [Physics Department, Clatterbridge Cancer Centre, Wirral (United Kingdom); Tullgren, Owe [Department of Oncology, Radiumhemmet, Karolinska University Hospital, Stockholm (Sweden); Department of Oncology-Pathology, Karolinska Institute, Stockholm (Sweden); Lax, Ingmar [Department of Medical Physics, Karolinska University Hospital, Stockholm (Sweden); Department of Oncology-Pathology, Karolinska Institute, Stockholm (Sweden)

2013-11-01T23:59:59.000Z

299

{sup 106}Ruthenium Plaque Therapy (RPT) for Retinoblastoma  

SciTech Connect (OSTI)

Purpose: To evaluate the effectiveness of episcleral {sup 106}ruthenium plaque therapy (RPT) in the management of retinoblastoma. Methods and Materials: One hundred one RPTs were retrospectively analyzed that were performed in 90 eyes of 85 patients with retinoblastoma at National Cancer Center Hospital between 1998 and 2008. Each RPT had a corresponding tumor and 101 tumors were considered in the analysis of local control. Median follow-up length was 72.8 months. Median patient age at the RPT was 28 months. Median prescribed doses at reference depth and outer surface of the sclera were 47.4 Gy and 162.3 Gy, respectively. Results: Local control rate (LCR) and ocular retention rate (ORR) at 2 years were 33.7% and 58.7%, respectively. Unilateral disease, International Classification of Retinoblastoma group C or more advanced at the first presentation or at the time of RPT, vitreous and/or subretinal seeding, tumor size greater than 5 disc diameter (DD), reference depth greater than 5 mm, dose rate at reference depth lower than 0.7 Gy/hour, dose at the reference depth lower than 35 Gy, and (biologically effective dose with an {alpha}/{beta} ratio of 10 Gy) at the reference depth lower than 40 Gy{sub 10} were associated with unfavorable LCR. Two patients died of metastatic disease. Radiation complications included retinal detachment in 12 eyes (13.3%), proliferative retinopathy in 6 (6.7%), rubeosis iris in 2 (2.2%), and posterior subcapsular cataract in 23 (25.6%). Conclusion: RPT is an effective eye-preserving treatment for retinoblastoma.

Murakami, Naoya, E-mail: namuraka@ncc.go.jp [Department of Radiation Oncology, National Cancer Center Hospital, Tokyo (Japan)] [Department of Radiation Oncology, National Cancer Center Hospital, Tokyo (Japan); Suzuki, Shigenobu [Department of Ophthalmic Oncology, National Cancer Center Hospital, Tokyo (Japan)] [Department of Ophthalmic Oncology, National Cancer Center Hospital, Tokyo (Japan); Ito, Yoshinori [Department of Radiation Oncology, National Cancer Center Hospital, Tokyo (Japan)] [Department of Radiation Oncology, National Cancer Center Hospital, Tokyo (Japan); Yoshimura, Ryoichi [Department of Diagnostic Radiology and Oncology, Head and Neck Reconstruction Division, Graduate School, Tokyo Medical and Dental University, Tokyo (Japan)] [Department of Diagnostic Radiology and Oncology, Head and Neck Reconstruction Division, Graduate School, Tokyo Medical and Dental University, Tokyo (Japan); Inaba, Koji; Kuroda, Yuki; Morota, Madoka; Mayahara, Hiroshi; Sakudo, Mototake; Wakita, Akihisa; Okamoto, Hiroyuki; Sumi, Minako; Kagami, Yoshikazu [Department of Radiation Oncology, National Cancer Center Hospital, Tokyo (Japan)] [Department of Radiation Oncology, National Cancer Center Hospital, Tokyo (Japan); Nakagawa, Keiichi; Ohtomo, Kuni [Department of Radiology, University of Tokyo Hospital, Tokyo (Japan)] [Department of Radiology, University of Tokyo Hospital, Tokyo (Japan); Itami, Jun [Department of Radiation Oncology, National Cancer Center Hospital, Tokyo (Japan)] [Department of Radiation Oncology, National Cancer Center Hospital, Tokyo (Japan)

2012-09-01T23:59:59.000Z

300

Hypofractionation vs Conventional Radiation Therapy for Newly Diagnosed Diffuse Intrinsic Pontine Glioma: A Matched-Cohort Analysis  

SciTech Connect (OSTI)

Purpose: Despite conventional radiation therapy, 54 Gy in single doses of 1.8 Gy (54/1.8 Gy) over 6 weeks, most children with diffuse intrinsic pontine glioma (DIPG) will die within 1 year after diagnosis. To reduce patient burden, we investigated the role of hypofractionation radiation therapy given over 3 to 4 weeks. A 1:1 matched-cohort analysis with conventional radiation therapy was performed to assess response and survival. Methods and Materials: Twenty-seven children, aged 3 to 14, were treated according to 1 of 2 hypofractionation regimens over 3 to 4 weeks (39/3 Gy, n=16 or 44.8/2.8 Gy, n=11). All patients had symptoms for {<=}3 months, {>=}2 signs of the neurologic triad (cranial nerve deficit, ataxia, long tract signs), and characteristic features of DIPG on magnetic resonance imaging. Twenty-seven patients fulfilling the same diagnostic criteria and receiving at least 50/1.8 to 2.0 Gy were eligible for the matched-cohort analysis. Results: With hypofractionation radiation therapy, the overall survival at 6, 9, and 12 months was 74%, 44%, and 22%, respectively. Progression-free survival at 3, 6, and 9 months was 77%, 43%, and 12%, respectively. Temporary discontinuation of steroids was observed in 21 of 27 (78%) patients. No significant difference in median overall survival (9.0 vs 9.4 months; P=.84) and time to progression (5.0 vs 7.6 months; P=.24) was observed between hypofractionation vs conventional radiation therapy, respectively. Conclusions: For patients with newly diagnosed DIPG, a hypofractionation regimen, given over 3 to 4 weeks, offers equal overall survival with less treatment burden compared with a conventional regimen of 6 weeks.

Janssens, Geert O., E-mail: g.janssens@rther.umcn.nl [Department of Radiation Oncology, Radboud University Nijmegen Medical Centre, Nijmegen (Netherlands); Jansen, Marc H. [Pediatric Oncology/Hematology, VU University Medical Center, Amsterdam (Netherlands)] [Pediatric Oncology/Hematology, VU University Medical Center, Amsterdam (Netherlands); Lauwers, Selmer J. [Department of Radiation Oncology, Radboud University Nijmegen Medical Centre, Nijmegen (Netherlands)] [Department of Radiation Oncology, Radboud University Nijmegen Medical Centre, Nijmegen (Netherlands); Nowak, Peter J. [Department of Radiation Oncology, Erasmus Medical Centre, Rotterdam (Netherlands)] [Department of Radiation Oncology, Erasmus Medical Centre, Rotterdam (Netherlands); Oldenburger, Foppe R. [Department of Radiation Oncology, Academic Medical Centre, Amsterdam (Netherlands)] [Department of Radiation Oncology, Academic Medical Centre, Amsterdam (Netherlands); Bouffet, Eric [Department of Hematology/Oncology, The Hospital for Sick Children, University of Toronto, Toronto (Canada)] [Department of Hematology/Oncology, The Hospital for Sick Children, University of Toronto, Toronto (Canada); Saran, Frank [Department of Pediatric Oncology, The Royal Marsden NHS Foundation Trust, Sutton (United Kingdom)] [Department of Pediatric Oncology, The Royal Marsden NHS Foundation Trust, Sutton (United Kingdom); Kamphuis-van Ulzen, Karin [Department of Radiology, Radboud University Nijmegen Medical Centre, Nijmegen (Netherlands)] [Department of Radiology, Radboud University Nijmegen Medical Centre, Nijmegen (Netherlands); Lindert, Erik J. van [Department of Neurosurgery, Radboud University Nijmegen Medical Centre, Nijmegen (Netherlands)] [Department of Neurosurgery, Radboud University Nijmegen Medical Centre, Nijmegen (Netherlands); Schieving, Jolanda H. [Department of Neurology, Radboud University Nijmegen Medical Centre, Nijmegen (Netherlands)] [Department of Neurology, Radboud University Nijmegen Medical Centre, Nijmegen (Netherlands); Boterberg, Tom [Department of Radiation Oncology, Ghent University Hospital, Ghent (Belgium)] [Department of Radiation Oncology, Ghent University Hospital, Ghent (Belgium); Kaspers, Gertjan J. [Pediatric Oncology/Hematology, VU University Medical Center, Amsterdam (Netherlands)] [Pediatric Oncology/Hematology, VU University Medical Center, Amsterdam (Netherlands); Span, Paul N.; Kaanders, Johannes H. [Department of Radiation Oncology, Radboud University Nijmegen Medical Centre, Nijmegen (Netherlands)] [Department of Radiation Oncology, Radboud University Nijmegen Medical Centre, Nijmegen (Netherlands); Gidding, Corrie E. [Department of Pediatric Oncology, Radboud University Nijmegen Medical Centre, Nijmegen (Netherlands)] [Department of Pediatric Oncology, Radboud University Nijmegen Medical Centre, Nijmegen (Netherlands); Hargrave, Darren [Department of Oncology, Great Ormond Street Hospital, London (United Kingdom)] [Department of Oncology, Great Ormond Street Hospital, London (United Kingdom)

2013-02-01T23:59:59.000Z

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

High-Dose-Rate Interstitial Brachytherapy as Monotherapy for Clinically Localized Prostate Cancer: Treatment Evolution and Mature Results  

SciTech Connect (OSTI)

Purpose: To report the clinical outcome of high-dose-rate (HDR) interstitial (IRT) brachytherapy (BRT) as sole treatment (monotherapy) for clinically localized prostate cancer. Methods and Materials: Between January 2002 and December 2009, 718 consecutive patients with clinically localized prostate cancer were treated with transrectal ultrasound (TRUS)-guided HDR monotherapy. Three treatment protocols were applied; 141 patients received 38.0 Gy using one implant in 4 fractions of 9.5 Gy with computed tomography-based treatment planning; 351 patients received 38.0 Gy in 4 fractions of 9.5 Gy, using 2 implants (2 weeks apart) and intraoperative TRUS real-time treatment planning; and 226 patients received 34.5 Gy, using 3 single-fraction implants of 11.5 Gy (3 weeks apart) and intraoperative TRUS real-time treatment planning. Biochemical failure was defined according to the Phoenix consensus, and toxicity was evaluated using Common Toxicity Criteria for Adverse Events version 3. Results: The median follow-up time was 52.8 months. The 36-, 60-, and 96-month biochemical control and metastasis-free survival rates for the entire cohort were 97%, 94%, and 90% and 99%, 98%, and 97%, respectively. Toxicity was scored per event, with 5.4% acute grade 3 genitourinary and 0.2% acute grade 3 gastrointestinal toxicity. Late grade 3 genitourinary and gastrointestinal toxicities were 3.5% and 1.6%, respectively. Two patients developed grade 4 incontinence. No other instance of grade 4 or greater acute or late toxicity was reported. Conclusion: Our results confirm IRT-HDR-BRT is safe and effective as monotherapy for clinically localized prostate cancer.

Zamboglou, Nikolaos [Department of Radiation Oncology, Klinikum Offenbach, Offenbach (Germany)] [Department of Radiation Oncology, Klinikum Offenbach, Offenbach (Germany); Tselis, Nikolaos, E-mail: ntselis@hotmail.com [Department of Radiation Oncology, Klinikum Offenbach, Offenbach (Germany)] [Department of Radiation Oncology, Klinikum Offenbach, Offenbach (Germany); Baltas, Dimos [Department of Medical Physics and Engineering, Klinikum Offenbach, Offenbach (Germany)] [Department of Medical Physics and Engineering, Klinikum Offenbach, Offenbach (Germany); Buhleier, Thomas [Department of Radiation Oncology, Klinikum Offenbach, Offenbach (Germany)] [Department of Radiation Oncology, Klinikum Offenbach, Offenbach (Germany); Martin, Thomas [Department of Radiation Oncology, Klinikum Bremen-Mitte, Bremen (Germany)] [Department of Radiation Oncology, Klinikum Bremen-Mitte, Bremen (Germany); Milickovic, Natasa; Papaioannou, Sokratis [Department of Medical Physics and Engineering, Klinikum Offenbach, Offenbach (Germany)] [Department of Medical Physics and Engineering, Klinikum Offenbach, Offenbach (Germany); Ackermann, Hanns [Institute of Biostatistics, J.W. Goethe University of Frankfurt, Frankfurt (Germany)] [Institute of Biostatistics, J.W. Goethe University of Frankfurt, Frankfurt (Germany); Tunn, Ulf W. [Department of Urology, Klinikum Offenbach, Offenbach (Germany)] [Department of Urology, Klinikum Offenbach, Offenbach (Germany)

2013-03-01T23:59:59.000Z

302

Response of intracerebral human glioblastoma xenografts to multifraction radiation exposures  

SciTech Connect (OSTI)

Purpose: We investigated the effects of fractionated radiation treatments on the life spans of athymic rats bearing intracerebral brain tumors. Methods and Materials: U-251 MG or U-87 MG human glioblastoma cells were implanted into the brains of athymic rats, and the resulting tumors were irradiated once daily with various doses of ionizing radiation for 5 consecutive days or for 10 days with a 2-day break after Day 5. Results: Five daily doses of 1 and 1.5 Gy, and 10 doses of 0.75 and 1 Gy, cured some U-251 MG tumors. However, five daily doses of 0.5 Gy increased the survival time of animals bearing U-251 MG tumors 5 days without curing any animals of their tumors. Ten doses of 0.3 Gy given over 2 weeks extended the lifespan of the host animals 9 days without curing any animals. For U-87 MG tumors, 5 daily doses of 3 Gy produced an increased lifespan of 8 days without curing any animals, and 10 doses of 1 Gy prolonged lifespan 5.5 days without curing any animals. The differences in extension of life span between the 5- and 10-fraction protocols were minor for either tumor type. Conclusion: The finding that the U-251 MG tumors are more sensitive than U-87 MG tumors, despite the fact that U-251 MG tumors contain many more hypoxic cells than U-87 MG tumors, suggests the intrinsic cellular radiosensitivities of these cell lines are more important than hypoxia in determining their in vivo radiosensitivities.

Ozawa, Tomoko [Brain Tumor Research Center, Department of Neurological Surgery, University of California San Francisco, San Francisco, CA (United States); Faddegon, Bruce A. [Department of Radiation Oncology, University of California San Francisco, San Francisco, CA (United States); Hu, Lily J. [Brain Tumor Research Center, Department of Neurological Surgery, University of California San Francisco, San Francisco, CA (United States); Bollen, Andrew W. [Department of Pathology, University of California San Francisco, San Francisco, CA (United States); Lamborn, Kathleen R. [Brain Tumor Research Center, Department of Neurological Surgery, University of California San Francisco, San Francisco, CA (United States); Deen, Dennis F. [Brain Tumor Research Center, Department of Neurological Surgery, University of California San Francisco, San Francisco, CA (United States) and Department of Radiation Oncology, University of California San Francisco, San Francisco, CA (United States)]. E-mail: ddeen@itsa.ucsf.edu

2006-09-01T23:59:59.000Z

303

Variation of carrier concentration and interface trap density in 8MeV electron irradiated c-Si solar cells  

SciTech Connect (OSTI)

The capacitance and conductance measurements were carried out for c-Si solar cells, irradiated with 8 MeV electrons with doses ranging from 5kGy 100kGy in order to investigate the anomalous degradation of the cells in the radiation harsh environments. Capacitance Voltage measurements indicate that there is a slight reduction in the carrier concentration upon electron irradiation due to the creation of radiation induced defects. The conductance measurement results reveal that the interface state densities and the trap time constant increases with electron dose due to displacement damages in c-Si solar cells.

Bhat, Sathyanarayana, E-mail: asharao76@gmail.com; Rao, Asha, E-mail: asharao76@gmail.com [Department of Physics, Mangalore Institute of Technology and Engineering, Moodabidri, Mangalore-574225 (India); Krishnan, Sheeja [Department of Physics, Sri Devi Institute of Technology, Kenjar, Mangalore-574142 (India); Sanjeev, Ganesh [Microtron Centre, Department of Physics, Mangalore University, Mangalagangothri-574199 (India); Suresh, E. P. [Solar Panel Division, ISRO Satellite Centre, Bangalore-560017 (India)

2014-04-24T23:59:59.000Z

304

Patient dosimetry and a novel approach to establishing Diagnostic Reference Levels in dental radiology  

Science Journals Connector (OSTI)

Diagnostic Reference Levels provide a method of ensuring that patient doses in medical procedures are kept at acceptable levels. Their application in dentistry can provide an indication of current dose levels and can assist in potentially significant dose reduction in Ireland given the number of patients screened annually. This study involved retrospective analyses of entrance surface dose and dose-width-product measurements obtained in Irish Dental Practices for both Intra-Oral and Panoramic units respectively, followed by comparisons with Monte-Carlo generated computer models of these procedures. Analysis was performed on data from 33 Intra-Oral units for an Adult Mandibular Molar entrance surface dose, 198 readings for a proposed mGy/mAs reference level and 50 Panoramic machines for a dose-width product investigation. The third quartile value of the entrance surface dose for a standard Adult Mandibular Molar Intra-Oral radiograph is (2.400.92)mGy, compared to a computer-modelled value of 2.60mGy. The third quartile mGy/mAs value for Intra-Oral procedures is (1.030.38)mGy/mAs, compared to a computer-modelled value of 0.75 mGy/mAs. The third quartile dose width product for an Adult Panoramic radiograph is (59.8920.97)mGymm, compared to a computer-modeled value of 62.40mGymm. It is proposed to introduce Diagnostic Reference Levels of 2.4mGy for an Adult Mandibular Molar Intra-Oral radiograph and 60mGymm for an Adult Panoramic radiograph. The use of a new reference quantity in Intra-Oral radiology is also suggested. This has a value of 1 mGy/mAs and may be introduced alongside established procedures. These levels can be taken as guides to acceptable doses, but it should be noted that further reductions are practical under ALARA principles.

Christopher Walker; Wil van der Putten

2012-01-01T23:59:59.000Z

305

Mu suM national d'Histoire naturelle 57 rue Cuvier -75005 Paris -+33 (0)1 40 79 56 01 / 54 79 -www.mnhn.fr  

E-Print Network [OSTI]

- www.mnhn.fr 26 Hectares of galleries, greenHouses, laboratories, learning facilities and a zoo GrandeColoGy, sustainable develoPment and enerGy Cover Photos: Cypraea sp Or «COWZry», raDIOGrapHy © asT-rX/MNHN VIGNeNCHOT/MNHN. LarGe INsIDe pHOTOs LeFT TO rIGHT: Lys © MNHN ; BuTTerFLy arGeMa MIMOsae, MOZaMBIQue © XaVIer Des

306

High contrast radiography using a small dense plasma focus  

Science Journals Connector (OSTI)

Radiographs are obtained with a small ( 4.6 kJ ) dense plasma focus machine using the x-rays which cross a 300 ? m aluminum window on the axis. Contrast is improved by inserting an iron needle on the tip of the electrode. Measurements with TLD-100 dosimeters have shown the average dose to increase from 0.077 0.006 mGy /shot when a hollow cathode is used to 0.11 0.01 mGy /shot with the needle. The spectrum is estimated using aluminum filters and the effective equivalent energy is found to be in the range of 20 25 keV .

F. Castillo; I. Gamboa-deBuen; J. J. E. Herrera; J. Rangel; S. Villalobos

2008-01-01T23:59:59.000Z

307

Assessment of dedicated low-dose cardiac micro-CT reconstruction algorithms using the left ventricular volume of small rodents as a performance measure  

SciTech Connect (OSTI)

Purpose: Phase-correlated microcomputed tomography (micro-CT) imaging plays an important role in the assessment of mouse models of cardiovascular diseases and the determination of functional parameters as the left ventricular volume. As the current gold standard, the phase-correlated Feldkamp reconstruction (PCF), shows poor performance in case of low dose scans, more sophisticated reconstruction algorithms have been proposed to enable low-dose imaging. In this study, the authors focus on the McKinnon-Bates (MKB) algorithm, the low dose phase-correlated (LDPC) reconstruction, and the high-dimensional total variation minimization reconstruction (HDTV) and investigate their potential to accurately determine the left ventricular volume at different dose levels from 50 to 500 mGy. The results were verified in phantom studies of a five-dimensional (5D) mathematical mouse phantom. Methods: Micro-CT data of eight mice, each administered with an x-ray dose of 500 mGy, were acquired, retrospectively gated for cardiac and respiratory motion and reconstructed using PCF, MKB, LDPC, and HDTV. Dose levels down to 50 mGy were simulated by using only a fraction of the projections. Contrast-to-noise ratio (CNR) was evaluated as a measure of image quality. Left ventricular volume was determined using different segmentation algorithms (Otsu, level sets, region growing). Forward projections of the 5D mouse phantom were performed to simulate a micro-CT scan. The simulated data were processed the same way as the real mouse data sets. Results: Compared to the conventional PCF reconstruction, the MKB, LDPC, and HDTV algorithm yield images of increased quality in terms of CNR. While the MKB reconstruction only provides small improvements, a significant increase of the CNR is observed in LDPC and HDTV reconstructions. The phantom studies demonstrate that left ventricular volumes can be determined accurately at 500 mGy. For lower dose levels which were simulated for real mouse data sets, the HDTV algorithm shows the best performance. At 50 mGy, the deviation from the reference obtained at 500 mGy were less than 4%. Also the LDPC algorithm provides reasonable results with deviation less than 10% at 50 mGy while PCF and MKB reconstruction show larger deviations even at higher dose levels. Conclusions: LDPC and HDTV increase CNR and allow for quantitative evaluations even at dose levels as low as 50 mGy. The left ventricular volumes exemplarily illustrate that cardiac parameters can be accurately estimated at lowest dose levels if sophisticated algorithms are used. This allows to reduce dose by a factor of 10 compared to today's gold standard and opens new options for longitudinal studies of the heart.

Maier, Joscha, E-mail: joscha.maier@dkfz.de [Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany)] [Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg (Germany); Sawall, Stefan; Kachelrie, Marc [Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg, Germany and Institute of Medical Physics, University of ErlangenNrnberg, 91052 Erlangen (Germany)] [Medical Physics in Radiology, German Cancer Research Center (DKFZ), Im Neuenheimer Feld 280, 69120 Heidelberg, Germany and Institute of Medical Physics, University of ErlangenNrnberg, 91052 Erlangen (Germany)

2014-05-15T23:59:59.000Z

308

Total All Countries Exports of Crude Oil and Petroleum Products by  

U.S. Energy Information Administration (EIA) Indexed Site

Destination: Total All Countries Afghanistan Albania Algeria Andora Angola Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahama Islands Bahrain Barbados Belarus Belgium Belize Benin Bolivia Bosnia and Herzegovina Brazil Brunei Bulgaria Burma Bermuda Cambodia Cameroon Canada Cayman Islands Chad Chile China Colombia Congo (Brazzaville) Congo (Kinshasa) Costa Rica Croatia Cyprus Czech Republic Denmark Djbouti Dominica Dominican Republic Ecuador Egypt El Salvador Equatorial Guinea Eritrea Estonia Ethiopia Fiji Finland France French Guiana French Pacific Islands Gabon Georgia, Republic of Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guatemala Guinea Guyana Haiti Honduras Hong Kong Hungary Iceland India Indonesia Iran Iraq Ireland Israel Italy Ivory Coast Jamaica Japan Jordon Kazakhstan Kenya Korea, South Korea, North Kyrgyzstan Kutubu Kuwait Latvia Lebanon Liberia Libya Lithuania Macau S.A.R. Macedonia Madagascar Malaysia Maldives Mali Malta Marshall Islands Mauritania Mauritius Mexico Micronesia, Federated States of Midway Islands Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Namibia Nepal Netherlands Netherlands/Antilles New Caledonia New Zealand Nicaragua Niger Nigeria Niue Norway Oman Pakistan Panama Papau New Guinea Paracel Islands Paraguay Peru Philippines Poland Portugal Puerto Rico Qatar Romania Russia St. Kitts and Nevis St. Lucia St. Pierre and Miquelon St. Vincent and the Grenadines Samoa San Marino Saudi Arabia Senegal Serbia and Montenegro Seychelles Sierra Leone Singapore Slovakia Slovenia Soloman Islands South Africa Spain Spratly Islands Sri Lanka Sudan Suriname Swaziland Sweden Switzerland Syria Taiwan Tanzania Thailand Tonga Togo Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Uganda Ukraine United Arab Emirates United Kingdom Uruguay Uzbekistan Vanuatu Venezuela Vietnam Virgin Islands (British) Virgin Islands (U.S.) Yemen Yugoslavia Zambia Period-Unit: Monthly-Thousand Barrels Monthly-Thousand Barrels per Day Annual-Thousand Barrels Annual-Thousand Barrels per Day

309

Total Net Imports of Crude Oil and Petroleum Products into the U.S.  

U.S. Energy Information Administration (EIA) Indexed Site

Country: Total All Countries Persian Gulf OPEC Algeria Angola Ecuador Iran Iraq Kuwait Libya Nigeria Qatar Saudi Arabia United Arab Emirates Venezuela Non OPEC Afghanistan Albania Andora Anguilla Antigua and Barbuda Argentina Armenia Aruba Australia Austria Azerbaijan Bahamas Bahrain Bangladesh Barbados Belarus Belgium Belize Benin Bermuda Bolivia Bosnia and Herzegovina Brazil Brunei Bulgaria Burma Cambodia Cameroon Canada Cayman Islands Chad Chile China Colombia Congo (Brazzaville) Congo (Kinshasa) Cook Islands Costa Rica Croatia Cyprus Czech Republic Denmark Djbouti Dominica Dominican Republic Egypt El Salvador Equatorial Guinea Ethiopia Eritrea Estonia Fiji Finland France French Pacific Islands French Guiana Gabon Georgia, Republic of Germany Ghana Gibraltar Greece Greenland Grenada Guadeloupe Guatemala Guinea Guyana Haiti Honduras Hong Kong Hungary Iceland India Indonesia Ireland Israel Italy Ivory Coast Jamaica Japan Jordan Kazakhstan Kenya Korea, South Kutubu Kyrgyzstan Latvia Lebanon Liberia Lithuania Macau S.A.R. Macedonia Madagascar Malaysia Maldives Mali Malta Marshall Islands Mauritania Mauritius Mexico Micronesia, Federated States of Midway Islands Moldova Monaco Mongolia Montenegro Montserrat Morocco Mozambique Namibia Nepal Netherlands Netherlands Antilles New Caledonia New Zealand Nicaragua Niger Niue Norway Oman Pakistan Panama Papau New Guinea Paracel Islands Paraguay Peru Philippines Poland Portugal Puerto Rico Romania Russia St. Kitts and Nevis St. Lucia St. Pierre and Miquelon St. Vincent and the Grenadines Samoa San Marino Senegal Serbia and Montenegro Sierra Leone Singapore Slovakia Slovenia South Africa Spain Spratly Islands Sri Lanka Suriname Swaziland Sweden Switzerland Syria Taiwan Tanzania Thailand Togo Tonga Trinidad and Tobago Tunisia Turkey Turkmenistan Turks and Caicos Islands Uganda Ukraine United Kingdom Uruguay Uzbekistan Vanuatu Vietnam Virgin Islands (British) Virgin Islands (U.S.) Yemen Yugoslavia Other Non OPEC Period-Unit: Monthly-Thousand Barrels per Day Annual-Thousand Barrels per Day

310

DOE-STD-1153-2002; A Graded Approach for Evaluating Radiation Doses to Aquatic and Terrestrial Biota  

Broader source: Energy.gov (indexed) [DOE]

3 3 METHODS DERIVATION MODULE 3: METHODS DERIVATION DOE-STD-1153-2002 INTENTIONALLY BLANK DOE-STD-1153-2002 M3-1 1 Introduction and Basis for the Approach The Department of Energy (DOE) currently has in place a radiation dose limit of 1 rad/d (10 mGy/d) for the protection of aquatic organisms (DOE Order 5400.5), and has proposed dose limits for both aquatic and terrestrial organisms. These limits are: 1 rad/d (10 mGy/d) for aquatic animals; 1 rad/d (10 mGy/d) for terrestrial plants; and 0.1 rad/d (1 mGy/d) for terrestrial animals. Because the biota protection limits are dose-based, a calculational method is needed to demonstrate compliance. In theory, derived radionuclide concentration limits for environmental media (e.g., Biota Concentration Guides, BCGs, for water, sediment, or soil) provide a relatively straightforward and simple means to do so. However, because of the

311

HyMotion GEN 2 Fact Sheet - backup.pdf  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

1.6 seconds 1.6 seconds Acceleration 1/4 Mile Time: 19.3 seconds Maximum Speed: 78.9 MPH Acceleration 1 Mile Maximum Speed: 106.5 MPH Charge Sustaining: Acceleration 0-60 MPH Time: 12.4 seconds Acceleration 1/4 Mile Time: 19.8 seconds Maximum Speed: 76.7 MPH Acceleration 1 Mile Maximum Speed: 107.0 MPH Brake Test @ 60 MPH Distance Required: 153.0 ft UDDS Fuel Economy 6 HWFET Fuel Economy 6 Distance (miles) Fuel Economy (mpg) AC Energy Consumed gy gy (kWh) 7 Distance (miles) Fuel Economy (mpg) AC Energy Consumed gy gy (kWh) 7 10 157.8 2.03 10 92.0 1.57 20 164.4 4.03 20 102.3 3.10 40 119.0 4.95 40 91.3 4.66 60 97.6 4.98 60 79.0 4.66 80 87.0 4.98 80 73.0 4.66 100 80.7 4.98 100 69.5 4.66 200 68.0 4.98 200 62.4 4.66 Fuel Economy with A/C Off 1 Cold Start Charge Depleting 2 : Fuel Economy: 155.2 MPG A AC kWh Consumed 7 : 0.204 kWh/mi Charge Depleting

312

Guillemin and Schally: A Race Spurred by Rivalry  

Science Journals Connector (OSTI)

...brain's'hormones spans a period of at least 21 years. The marathon started in 1955, when each discovered that the in-teraction...them on the Citicorp board are directors of Mobil and Standard Oil of California, plus directors of a number of other ener-gy-related...

NICHOLAS WADE

1978-05-05T23:59:59.000Z

313

Postimplant Dosimetry Using a Monte Carlo Dose Calculation Engine: A New Clinical Standard  

SciTech Connect (OSTI)

Purpose: To use the Monte Carlo (MC) method as a dose calculation engine for postimplant dosimetry. To compare the results with clinically approved data for a sample of 28 patients. Two effects not taken into account by the clinical calculation, interseed attenuation and tissue composition, are being specifically investigated. Methods and Materials: An automated MC program was developed. The dose distributions were calculated for the target volume and organs at risk (OAR) for 28 patients. Additional MC techniques were developed to focus specifically on the interseed attenuation and tissue effects. Results: For the clinical target volume (CTV) D{sub 90} parameter, the mean difference between the clinical technique and the complete MC method is 10.7 Gy, with cases reaching up to 17 Gy. For all cases, the clinical technique overestimates the deposited dose in the CTV. This overestimation is mainly from a combination of two effects: the interseed attenuation (average, 6.8 Gy) and tissue composition (average, 4.1 Gy). The deposited dose in the OARs is also overestimated in the clinical calculation. Conclusions: The clinical technique systematically overestimates the deposited dose in the prostate and in the OARs. To reduce this systematic inaccuracy, the MC method should be considered in establishing a new standard for clinical postimplant dosimetry and dose-outcome studies in a near future.

Carrier, Jean-Francois [Departement de Radio-Oncologie, et Centre de Recherche du CHUM, Hopital Notre-Dame du CHUM, Montreal, Quebec (Canada) and Departement de Radio-Oncologie et Centre de Recherche en Cancerologie de Universite Laval, CHUQ Pavillon Hotel-Dieu de Quebec, Quebec (Canada)]. E-mail: jean-francois.carrier.chum@ssss.gouv.qc.ca; D'Amours, Michel [Departement de Radio-Oncologie et Centre de Recherche en Cancerologie de Universite Laval, CHUQ Pavillon Hotel-Dieu de Quebec, Quebec (Canada); Verhaegen, Frank [Medical Physics Unit, McGill University, Montreal, Quebec (Canada); Reniers, Brigitte [Medical Physics Unit, McGill University, Montreal, Quebec (Canada); Martin, Andre-Guy [Departement de Radio-Oncologie et Centre de Recherche en Cancerologie de Universite Laval, CHUQ Pavillon Hotel-Dieu de Quebec, Quebec (Canada); Vigneault, Eric [Departement de Radio-Oncologie et Centre de Recherche en Cancerologie de Universite Laval, CHUQ Pavillon Hotel-Dieu de Quebec, Quebec (Canada); Beaulieu, Luc [Departement de Radio-Oncologie et Centre de Recherche en Cancerologie de Universite Laval, CHUQ Pavillon Hotel-Dieu de Quebec, Quebec (Canada)

2007-07-15T23:59:59.000Z

314

Names and Faces Tamara L. Berg  

E-Print Network [OSTI]

Monochromatic Hamiltonian 3-Tight Berge Cycles in 2-Colored 4-Uniform Hypergraphs Andr´as Gy.). Journal of Graph Theory 2009 Wiley Periodicals, Inc. 288 #12;3-TIGHT BERGE CYCLES IN 2-COLORED 4-UNIFORM such that for nn0 in every 2-coloring of the edges of K(4) n there is a monochromatic Hamiltonian 3-tight Berge

Berg, Tamara L.

315

Cross-species comparison of site-specific evolutionary-rate variation in influenza haemagglutinin  

Science Journals Connector (OSTI)

...sufficient to predict that the site...after the Fort Dix outbreak) and 2008 (before the 2009 flu pandemic). H1N1...codon-evolution models becomes prohibitively...codon-evolution model (GY94 [22...omega-slopes in our model, and the parameter...

2013-01-01T23:59:59.000Z

316

Study of Photostimulated- and Thermo-luminescence Characteristics for Detecting Irradiated Kiwifruit  

Science Journals Connector (OSTI)

Photostimulated luminescence (PSL) and thermo-luminescence (TL) analyses were conducted to detect irradiated kiwifruits. Samples were irradiated with Co-60 ?-rays at 02 kGy. The freeze-dried kiwifruit peel showed 309 photon counts (PCs) for nonirradiated ...

Deokjo Jo; Byeong-Keun Kim; Tusneem Kausar; Joong-Ho Kwon

2008-02-02T23:59:59.000Z

317

Fusion Energy in Context: Its Fitness for the Long Term  

Science Journals Connector (OSTI)

...pel-let equal to the laser energy incident on the...handle tens of thousands of laser pulses of dev-astating...instru-mentation and control technology, ener-gy...neces-sary (20). In the laser approach, convert-ing...solar-thermal-electric conver-sion, wind, hydropower, and combus-tion...

John P. Holdren

1978-04-14T23:59:59.000Z

318

CALIFORNIA ENERGY COMMISSIONCOMMISSION  

E-Print Network [OSTI]

Commission$ gy 0% rate loans and technical assistance grants · $3M: California Workforce Investment Board· $3M: California Workforce Investment Board Competitive grants for community-based and workforce requests for planning projects and energy expenditure plans #12;CHAPTER 2: LOCAL EDUCATIONAL AGENCY AWARD

319

Role of Whole-Body Hyperthermia in the Treatment of Neoplastic Disease: Its Current Status and Future Prospects  

Science Journals Connector (OSTI)

...cGy/day (Cae- satron Model E irradiator; Atomic Energy of Canada, Ltd.) and ~41.0 WBH, 1 hr/day (attained by using...1978. OCTOBER 1984 4881s H. I. Robins 27. Bull, J. M., Leed, D., Schuetter, W., Whang-Peng, J., Smith, R...

H. Ian Robins

1984-10-01T23:59:59.000Z

320

Dating and context of three middle stone age sites with bone points in the Upper Semliki Valley, Zaire  

Science Journals Connector (OSTI)

...HOMO-SAPIENS CRANIA FROM LAKE EYASI, TANZANIA, JOURNAL OF ARCHAEOLOGICAL SCIENCE 14...dated MSA occur-rences are at Mumba (Tanzania) (2) in association with uranium decay...170 10 Gy. This result assumes that the solar bleaching of the sediment at deposition...

AS Brooks; DM Helgren; JS Cramer; A Franklin; W Hornyak; JM Keating; RG Klein; WJ Rink; H Schwarcz; JN Smith; al. et

1995-04-28T23:59:59.000Z

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

ElEctricAl EnginEEring College of Engineering and Mines  

E-Print Network [OSTI]

(groundwater and air monitoring) applications is an important research area for Alaska. Electric power systems, instrumentation and microwave circuit design, electric power and ener- gy systems, digital and computer hybrid electric power systems, electric power system design and analyses, electric power quality

Hartman, Chris

322

Effects of an acute dose of gamma radiation exposure on stem diameter growth, carbon gain, and biomass partitioning in Helianthus annuus  

SciTech Connect (OSTI)

Nineteen-day-old dwarf sunflower plants (Helianthus annuus, variety NK894) received a variable dose (0-40 Gy) from a cobalt-60 gamma source. A very sensitive stem monitoring device, developed at Battelle's Pacific Northwest Laboratories, Richland, Washington was used to measure real-time changes in stem diameter. Exposure of plants caused a significant reduction in stem growth and root biomass. Doses as low as 5 Gy resulted in a significant increase in leaf density, suggesting that nonreversible morphological growth changes could be induced by very low doses of radiation. Carbohydrate analysis of 40-Gy irradiated plants demonstrated significantly more starch content in leaves and significantly less starch content in stems 18 days after exposure than did control plants. In contrast, the carbohydrate content in roots of 40-Gy irradiated plants were not significantly different from unirradiated plants 18 days after exposure. These results indicate that radiation either decreased phloem transport or reduced the availability of sugar reducing enzymes in irradiated plants. 44 refs., 12 figs.

Thiede, M.E.

1988-05-25T23:59:59.000Z

323

Study on great northern beans (Phaseolus vulgaris): effect of drum drying process on bean flour properties and effect on gamma radiation on bean starch properties  

SciTech Connect (OSTI)

Great Northern bean (Phaseolus vulgaris L.) drum dried flours at native pH of 6.54, pH 6 and 7 showed reduced activities of trypsin inhibitor, ..cap alpha..-amylase inhibitor, hemagglutinating titer, and nitrogen solubility. Electrophoretic analyses showed a slight modification of the native bean proteins, and the presence of at least four trypsin inhibitors. The study of the effect of 2.5-20 kGy irradiation doses on Great Northern beans showed essentially no modification of the electrophoretic mobility of the storage proteins or the trypsin inhibitors. Nitrogen solubility and hemagglutinating activity were essentially unchanged. With the 20 kGy dose, decrease in ..cap alpha..-amylase inhibitor activity, decrease reactive/available lysine content, and decrease cooking time of the irradiated beans after 11 months of storage were observed. Taste panel results indicated that the control and 20 kGy irradiated bean were significantly different at 5% level. At 20 kGy dose, the beans developed a partially water soluble brown color.

Rayas-Solis, P.

1988-01-01T23:59:59.000Z

324

AAAS Annual Elections  

Science Journals Connector (OSTI)

...me. Radical decisioo *.a'e to cut Nick on science that egoig o a im yean bhence...elected). Robert M. Berne Doris H. Merritt Robert M. Berne (cardiovascular physiolo-gy...Memorial Award Committees, APS. Doris H. Merritt (medicine), 1923; B.A., Hunter...

1980-08-22T23:59:59.000Z

325

Entrance surface dose in cerebral interventional radiology procedures  

SciTech Connect (OSTI)

At the Instituto Nacional de Neurologia y Neurocirugia (INNN) diagnostic as well as therapeutic procedures of interventional radiology are carried out. Since the procedures can last from some minutes to several hours, the absorbed dose for the patient could increase dangerously. An investigation had begun in order to determine the entrance surface dose (ESD) using 25 thermoluminiscent dosimeters TLD-100 and 8 strips of 15 Multiplication-Sign 1 cm{sup 2} of Gafchromic XR-QA2 film bound in a holder of 15 Multiplication-Sign 15 cm{sup 2} in the posteroanterior (PA) and lateral (LAT) positions during all the procedure. The results show that maximum ESD could be from 0.9 to 2.9 Gy for the PA position and between 1.6 and 2.5 Gy for the lateral position. The average ESD was between 0.7 and 1.3 Gy for the PA position, and from 0.44 to 1.1 Gy for the lateral position in a therapeutic procedure.

Barrera-Rico, M.; Lopez-Rendon, X.; Rivera-Ordonez, C. E.; Gamboa-deBuen, I. [Instituto de Ciencias Nucleares, Universidad Nacional Autonoma de Mexico, 04510 DF (Mexico); Instituto Nacional de Neurologia y Neurocirugia Manuel Velasco Suarez, 14269 DF (Mexico); Instituto de Ciencias Nucleares, Universidad Nacional Autonoma de Mexico, 04510 DF (Mexico)

2012-10-23T23:59:59.000Z

326

Models of the Earth's Core  

Science Journals Connector (OSTI)

...the freezing point of water). However, this...iron in any plausible condensation from the solar nebula...theory) Parameter atmospheric P = 1.5 Mbar, P...continental geology, atmospheric chemistry, meteorology...continental geol-ogy, atmospheric chemistry, meteorolo-gy...

D. J. Stevenson

1981-11-06T23:59:59.000Z

327

Much has been written about J. Robert Oppen-heimer. The substance of his life, his intellect, his  

E-Print Network [OSTI]

Advisory Committee of the Atomic Energy Commission (AEC), from 1947 through 1952. Born Julius Robert. In 1921, Oppenheimer graduated from the Ethical Culture School of New York at the top of his class a world center for the development of high ener- gy physics and field the

328

The Path to Magnetic Fusion Energy  

E-Print Network [OSTI]

1 The Path to Magnetic Fusion Energy: Crossing the Next Frontier Rob Goldston, Jon Menard with contributions from J. Brooks, R. Doerner, D. Gates, J. Harris, G.-Y. Fu, N. Gorelenkov, R. Kaita, S. Kaye, M. Kotschenreuther, G. Kramer, H. Kugel, R. Maingi, R. Majeski, C. Neumeyer, R. Nygren, M. Ono, D. Ruzic, S. Sabbagh

Princeton Plasma Physics Laboratory

329

Prediction of radiation-induced liver disease by Lyman normal-tissue complication probability model in three-dimensional conformal radiation therapy for primary liver carcinoma  

SciTech Connect (OSTI)

Purpose: To describe the probability of RILD by application of the Lyman-Kutcher-Burman normal-tissue complication (NTCP) model for primary liver carcinoma (PLC) treated with hypofractionated three-dimensional conformal radiotherapy (3D-CRT). Methods and Materials: A total of 109 PLC patients treated by 3D-CRT were followed for RILD. Of these patients, 93 were in liver cirrhosis of Child-Pugh Grade A, and 16 were in Child-Pugh Grade B. The Michigan NTCP model was used to predict the probability of RILD, and then the modified Lyman NTCP model was generated for Child-Pugh A and Child-Pugh B patients by maximum-likelihood analysis. Results: Of all patients, 17 developed RILD in which 8 were of Child-Pugh Grade A, and 9 were of Child-Pugh Grade B. The prediction of RILD by the Michigan model was underestimated for PLC patients. The modified n, m, TD{sub 5} (1) were 1.1, 0.28, and 40.5 Gy and 0.7, 0.43, and 23 Gy for patients with Child-Pugh A and B, respectively, which yielded better estimations of RILD probability. The hepatic tolerable doses (TD{sub 5}) would be MDTNL of 21 Gy and 6 Gy, respectively, for Child-Pugh A and B patients. Conclusions: The Michigan model was probably not fit to predict RILD in PLC patients. A modified Lyman NTCP model for RILD was recommended.

Xu ZhiYong [Department of Radiation Oncology, Fudan University Cancer Hospital, Shanghai (China); Department of Oncology, Shanghai Medical School, Fudan University, Shanghai (China); Liang Shixiong [Department of Radiation Oncology, Fudan University Cancer Hospital, Shanghai (China); Department of Radiation Oncology, Cancer Hospital, Guangxi Medical University, Nanning (China); Zhu Ji [Department of Radiation Oncology, Fudan University Cancer Hospital, Shanghai (China); Department of Oncology, Shanghai Medical School, Fudan University, Shanghai (China); Zhu Xiaodong [Department of Radiation Oncology, Cancer Hospital, Guangxi Medical University, Nanning (China); Zhao Jiandong [Department of Radiation Oncology, Fudan University Cancer Hospital, Shanghai (China); Department of Oncology, Shanghai Medical School, Fudan University, Shanghai (China); Lu Haijie [Department of Radiation Oncology, Cancer Hospital, Guangxi Medical University, Nanning (China); Yang Yunli [Department of Radiation Oncology, Cancer Hospital, Guangxi Medical University, Nanning (China); Chen Long [Department of Radiation Oncology, Cancer Hospital, Guangxi Medical University, Nanning (China); Wang Anyu [Department of Radiation Oncology, Cancer Hospital, Guangxi Medical University, Nanning (China); Fu Xiaolong [Department of Radiation Oncology, Fudan University Cancer Hospital, Shanghai (China); Department of Oncology, Shanghai Medical School, Fudan University, Shanghai (China); Jiang Guoliang [Department of Radiation Oncology, Fudan University Cancer Hospital, Shanghai (China) and Department of Oncology, Shanghai Medical School, Fudan University, Shanghai (China)]. E-mail: jianggl@21cn.com

2006-05-01T23:59:59.000Z

330

May2011|CountryProfile|GerMany|1 ataGlanCe:GerMany'SGloBal  

E-Print Network [OSTI]

Cooperation and Development 2009 oVerVieW Germany's engagement in global health has increased steadily over), and the rest was channeled through multilateral organizations. About half of Germany's multilateral health aidBalHealtHPrioritieSanDStrateGy Germany's overall global health strategy is guided by a human rights-based approach, which aims

Klein, Ophir

331

Safety Assurance of Pecans by Irradiation without a Detrimental Effect on Quality  

E-Print Network [OSTI]

-packed. Moreover, accelerated shelf life studies (4 weeks at 48.9oC) showed that vacuum-packed (VP) pecans can be stored at -25 degrees C up to three years, while irradiated (at 3.0 kGy) VP pecans can be stored only for eight months, without the detrimental effects...

Karagoz, Isin 1983-

2012-08-28T23:59:59.000Z

332

Cultivar and E-Beam irradiation effects on phytochemical content and antioxidant properties of pecan kernels  

E-Print Network [OSTI]

. Kernels from the same cultivar but different location differed in their fatty acid composition but had similar TP. Irradiation of Kanza and Desirable kernels with 1.5 and 3.0 kGy had no detrimental effects on AC and TP by the end of experiments...

Villarreal Lozoya, Jose Emilio

2009-05-15T23:59:59.000Z

333

Antimicrobial packaging system for optimization of electron beam irradiation of fresh produce  

E-Print Network [OSTI]

This study evaluated the potential use of an antimicrobial packaging system in combination with electron beam irradiation to enhance quality of fresh produce. Irradiated romaine lettuce up to 3.2 kGy showed negligible (p > 0.05) changes in color...

Han, Jaejoon

2006-10-30T23:59:59.000Z

334

Effect of electron beam irradiation on quality and shelf-life of Tommy Atkins mango (Mangifera indica l.) and blueberry (Vaccinium corymbsum l.)  

E-Print Network [OSTI]

less acceptability for overall quality, color, texture and aroma. Irradiation of blueberries at 1.1 kGy had no significant (p > 0.05) effect on the fruits' physicochemical characteristics with the exception of ascorbic acid which decreased by 17% after...

Moreno Tinjaca, Maria Alexandra

2007-04-25T23:59:59.000Z

335

Radiation Protection Dosimetry Vol. 100, Nos 14, pp. 207209 (2002)  

E-Print Network [OSTI]

207 Radiation Protection Dosimetry Vol. 100, Nos 1­4, pp. 207­209 (2002) Nuclear Technology, Ship Research Institute, Tokyo, Japan §Institute of General and Inorganic Chemistry, Moscow, Russia. The dependence of the TL efficiency on the radiation dose was found to be linear up to 6 kGy for the 3 at.% Pr3

Chen, Reuven

336

Novel Parameter Predicting Grade 2 Rectal Bleeding After Iodine-125 Prostate Brachytherapy Combined With External Beam Radiation Therapy  

SciTech Connect (OSTI)

Purpose: To propose a novel parameter predicting rectal bleeding on the basis of generalized equivalent uniform doses (gEUD) after {sup 125}I prostate brachytherapy combined with external beam radiation therapy and to assess the predictive value of this parameter. Methods and Materials: To account for differences among radiation treatment modalities and fractionation schedules, rectal dosevolume histograms (DVHs) of 369 patients with localized prostate cancer undergoing combined therapy retrieved from corresponding treatment planning systems were converted to equivalent dose-based DVHs. The gEUDs for the rectum were calculated from these converted DVHs. The total gEUD (gEUD{sub sum}) was determined by a summation of the brachytherapy and external-beam radiation therapy components. Results: Thirty-eight patients (10.3%) developed grade 2+ rectal bleeding. The grade 2+ rectal bleeding rate increased as the gEUD{sub sum} increased: 2.0% (2 of 102 patients) for <70 Gy, 10.3% (15 of 145 patients) for 70-80 Gy, 15.8% (12 of 76 patients) for 80-90 Gy, and 19.6% (9 of 46 patients) for >90 Gy (P=.002). Multivariate analysis identified age (P=.024) and gEUD{sub sum} (P=.000) as risk factors for grade 2+ rectal bleeding. Conclusions: Our results demonstrate gEUD to be a potential predictive factor for grade 2+ late rectal bleeding after combined therapy for prostate cancer.

Shiraishi, Yutaka, E-mail: shiraishi@rad.med.keio.ac.jp [Department of Radiology, Keio University School of Medicine, Tokyo (Japan); Hanada, Takashi; Ohashi, Toshio [Department of Radiology, Keio University School of Medicine, Tokyo (Japan); Yorozu, Atsunori; Toya, Kazuhito [Department of Radiology, National Hospital Organization Tokyo Medical Center, Tokyo (Japan); Saito, Shiro [Department of Urology, National Hospital Organization Tokyo Medical Center, Tokyo (Japan); Shigematsu, Naoyuki [Department of Radiology, Keio University School of Medicine, Tokyo (Japan)

2013-09-01T23:59:59.000Z

337

Four-point probe characterization of 4H silicon carbide N. Chandra a,  

E-Print Network [OSTI]

Four-point probe characterization of 4H silicon carbide N. Chandra a, , V. Sharma a , G.Y. Chung b carbide Four-point probe Thermionic-field emission Contact resistance a b s t r a c t We report on four

Schroder, Dieter K.

338

Physical Oceanography: What it is and why we should care  

E-Print Network [OSTI]

observing and modeling · Red tide· Red tide · Hurricanes and Storm Surge · Fresh water managementFresh water Oceanography. Why? The Earth receives more energy then it radiates in the tropics,gy p , whereas it radiates more energy than it receives at the poles. Ocean currents and winds result from this imbalance. Winds

Meyers, Steven D.

339

Representative Doses to Members of the Public from Atmospheric Releases of 131I at the Mayak Production Association Facilities from 1948 through 1972  

SciTech Connect (OSTI)

Scoping epidemiologic studies performed by researchers from the Southern Urals Biophysics Institute revealed an excess prevalence of thyroid nodules and an increased incidence of thyroid cancer among residents of Ozersk, Russia, who were born in the early 1950s. Ozersk is located about 5 km from the facilities where the Mayak Production Association produced nuclear materials for the Russian weapons program. Reactor operations began in June 1948 and chemical separation of plutonium from irradiated fuel began in February 1949. The U.S.Russia Joint Coordinating Committee on Radiation Effects Research conducted a series of projects over a 10-year period to assess the radiation risks in the Southern Urals. This paper uses data collected under Committee projects to reconstruct individual time-dependent thyroid doses to reference individuals living in Ozersk from 131I released to the atmosphere. Between 3.221016 and 4.311016 Bq of 131I released may have been released during the 19481972 time period, and a best estimate is 3.761016 Bq. A child born in 1947 is estimated to have received a cumulative thyroid dose of 2.3 Gy for 19481972, with a 95% confidence interval of 0.517.3 Gy. Annual doses were the highest in 1949 and a child who was 5 years old in 1949 is estimated to have a received an annual thyroid dose of 0.93 Gy with a 95% confidence interval of 0.193.5 Gy.

Eslinger, Paul W.; Napier, Bruce A.; Anspaugh, Lynn R.

2014-04-03T23:59:59.000Z

340

Control of Yersinia enterocolitica in raw pork and pork products by ?-irradiation  

Science Journals Connector (OSTI)

?-Radiation response of Y. enterocolitica 5692 and 152 was studied at 0C and at ?40C in phosphate buffer (pH 7.00) as well as in 10% raw meat/salami homogenate. The strains investigated did not differ in their response and were found to be sensitive to ?-radiation but exhibited a tailing phenomenon in the survival curve. The D10 in homogenate was 0.25 kGy at 0C. This response was not affected at ?40C. Storage studies of packs, inoculated artificially with heavy inoculum of Y. enterocolitica (106 cfu/g) showed that while samples of salami and cooked ham could be decontaminated at doses of 4 and 3 kGy respectively; cells could not be eliminated from raw pork meat even at the higher dose of 6 kGy. The role of different treatments given prior to irradiation for revival of Y. enterocolitica after irradiation storage was also studied. The dose of 1 kGy at ?40C was efficient in eradicating low numbers (naturally occuring Y. enterocolitica from raw pork meat without any revival during storage at refrigeration temperature.

A.S. Kamat; S. Khare; T. Doctor; P.M. Nair

1997-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

The effects of diet and ionizing radiation on azoxymethane induced colon carcinogenesis  

E-Print Network [OSTI]

cancer, by suppressing apoptosis and upregulating proliferation in colonocytes. Diets contained a combination of fish oil or corn oil and either pectin or cellulose. We exposed 40 male Sprague-Dawley rats to 1 Gy ionizing radiation (1 GeV Fe) 10 d prior...

Mann, John Clifford

2006-10-30T23:59:59.000Z

342

Regional patterns and controls of ecosystem salinization with grassland afforestation along a rainfall gradient  

E-Print Network [OSTI]

salinization with grassland afforestation along a rainfall gradient, Global Biogeochem. Cycles, 22, GB2015, doiRegional patterns and controls of ecosystem salinization with grassland afforestation along a rainfall gradient M. D. Nosetto,1,2 E. G. Jobba´gy,1 T. To´th,3 and R. B. Jackson4,5 Received 25 April 2007

Jackson, Robert B.

343

Network of Centers for Very Small Entities (VSEs)  

E-Print Network [OSTI]

-electric, wind, geothermal, solar or biomass-related energy.g gy � Company established 10 years ago, � Over 260 of activities since last meeting B il C d M i J� Brazil, Canada, Mexico, Japan. 2 #12;L E i i C 1 Pilot Project

Québec, Université du

344

In the mIdst of an energy revolutIon, Purdue's world-class researchers lead the charge. we collaborate across a broad range of dIscIPlInes --to develoP  

E-Print Network [OSTI]

rechargIng IndIana's renewable energy revolutIon #12;enerGY solutions solar The U.S. Department of Energy expects that 10-15 percent of the nation's energy should be generated from solar sources by 2030. The target of the Purdue projects: · Researchersaredevelopingthinfilm solar cells that would have greater

Holland, Jeffrey

345

A modified Phase I trial of radiation dose escalation in 3D conformal radiation therapy with concurrent vinorelbine and carboplatin chemotherapy for non-small-cell lung cancer  

Science Journals Connector (OSTI)

......system (VENUS 5014 software, Shanghai Tuoneng Co.) used to design the radiation plan. The convolution...stopped. Grade III radiation pneumonia was defined...DLT. To examine the safety of the 70 Gy dose level...Case Case Case (%) Radiation pneumonia 11 (61......

Qiang Lin; Yue'e Liu; Na Wang; Yuehua Huang; Xiaohui Ge; Xiaocang Ren; Xueji Chen; Jing Hu; Zhijun Guo; Yannan Zhao; Junichi Asaumi

2013-01-01T23:59:59.000Z

346

Combination Bcl-2 Antisense and Radiation Therapy for Nasopharyngeal Cancer  

Science Journals Connector (OSTI)

...G3139 has a favorable safety profile, its efficacy...survival and inhibit radiation-induced apoptosis...either 0, 3, or 6 Gy radiation. Fresh medium containing...3, or 6 hours after radiation. Twenty-four hours...analyzed using CellQuest software (Becton Dickinson...

Kenneth W. Yip; Joseph D. Mocanu; P.Y. Billie Au; Gillian T. Sleep; Dolly Huang; Pierre Busson; Wen-Chen Yeh; Ralph Gilbert; Brian O'Sullivan; Patrick Gullane; Carlo Bastianutto; and Fei-Fei Liu

2005-11-15T23:59:59.000Z

347

Resistance of Glioblastoma-Initiating Cells to Radiation Mediated by the Tumor Microenvironment Can Be Abolished by Inhibiting Transforming Growth Factor-?  

Science Journals Connector (OSTI)

...moment using CometScore software. Immunofluorescence...24 hours before 2 Gy radiation. GL261-derived neurospheres...significantly decreased radiation-induced phosphorylation...development have shown safety and efficacy in fibrotic...harvested 1 h after radiation was reduced in mice...

Matthew E. Hardee; Ariel E. Marciscano; Christina M. Medina-Ramirez; David Zagzag; Ashwatha Narayana; Scott M. Lonning; and Mary Helen Barcellos-Hoff

2012-08-15T23:59:59.000Z

348

Trial Production of Condoms from Irradiated Natural Rubber Latex on a Factory Scale  

Science Journals Connector (OSTI)

TRIAL PRODUCTION OF CONDOM FROM IRRADIATED NATURAL RUBBER LATEX IN FACTORY SCALE: Irradiation of latex...60Co at 20 kGy in the presence of 1 phr (part hundred ratio of rubber) of normal bu til acrylate (nBA)...4....

Marga Utama

1994-01-01T23:59:59.000Z

349

Absence of Symptom and Intact Liver Function Are Positive Prognosticators for Patients Undergoing Radiotherapy for Lymph Node Metastasis From Hepatocellular Carcinoma  

SciTech Connect (OSTI)

Purpose: The positive role of radiotherapy for patients with lymph node (LN) metastasis from hepatocellular carcinoma has recently been reported. The outcome and prognostic factors for these patients were analyzed. Methods and Materials: Between May 2004 and October 2007, 38 patients with LN metastases from hepatocellular carcinoma underwent radiotherapy. The median age was 59 years (range, 42-81). The radiation dose was 35-56 Gy with a fraction size of 1.8-3 Gy, for a biologically effective dose of 43.75-67.2 Gy{sub 10} (median, 59.0). The median follow-up period was 8 months. Results: The median survival time was 10 months. On univariate analysis, Child-Pugh class B (p = .0006), distant metastasis (p = .0095), symptoms related to metastatic LNs (p <.0001), and a biologically effective dose <60 Gy{sub 10} (p = .0042) were significant prognostic factors predicting for poor overall survival. On multivariate analysis after adjustment using the Benjamini and Hochberg (false discovery rate) method, Child-Pugh class B (p = .04095) and the presence of symptoms (p = .04095) were associated with inferior overall survival. When patients were divided into three groups according to these two risk factors, the median survival for patients with no, either, or both risk factors was 20, 7, and 4 months, respectively (p <.0001). Conclusion: Patients with intact liver function and without related symptoms had the best prognosis when undergoing radiotherapy for LN metastasis from hepatocellular carcinoma.

Kim, Kyubo [Department of Radiation Oncology, Seoul National University College of Medicine, Seoul (Korea, Republic of); Chie, Eui Kyu, E-mail: ekchie93@snu.ac.k [Department of Radiation Oncology, Seoul National University College of Medicine, Seoul (Korea, Republic of); Kim, Won; Kim, Yoon Jun; Yoon, Jung Hwan; Lee, Hyo-Suk [Department of Internal Medicine, Seoul National University College of Medicine, Seoul (Korea, Republic of); Ha, Sung W. [Department of Radiation Oncology, Seoul National University College of Medicine, Seoul (Korea, Republic of); Institute of Radiation Medicine, Medical Research Center, Seoul National University, Seoul (Korea, Republic of)

2010-11-01T23:59:59.000Z

350

Experimental setup for studying the effects of alpha particles on zebrafish embryos  

E-Print Network [OSTI]

doses corresponding to the abnormally developed embryos ranged from 0.41 to 2.3 mGy, which response to ionizing radiation have emerged. For example, Bladen et al. [3] studied the DNA damage response to ionizing radiation in these studi

Yu, K.N.

351

Molecular signatures of low dose radiation exposure in human subjects  

Science Journals Connector (OSTI)

...Molecular signatures of low dose radiation exposure in human subjects...Volume 46, 2005] 3096 Low dose ionizing radiation (LDIR) in the 1-10 cGy range has largely unknown biological...the effect and risk at low dose by extrapolation from measured...

Zelanna Goldberg; Chad W. Schwietert; Maggie Isbell; Joerg Lehmann; Robin Stern; Christine Hartmann Siantar; and David M. Rocke

2005-05-01T23:59:59.000Z

352

Human In vivo Dose-Response to Controlled, Low-Dose Low Linear Energy Transfer Ionizing Radiation Exposure  

Science Journals Connector (OSTI)

...effects of low-dose low-linear energy transfer ionizing radiation (LDIR) in humans...direct evidence that doses in the range of 1 to 10 cGy...the intentional radiation of healthy tissue...the response to ionizing radiation. Attempts...

Zelanna Goldberg; David M. Rocke; Chad Schwietert; Susanne R. Berglund; Alison Santana; Angela Jones; Jrg Lehmann; Robin Stern; Ruixiao Lu; and Christine Hartmann Siantar

2006-06-15T23:59:59.000Z

353

Ionizing Radiation Causes a Dose-Dependent Release of Transforming Growth Factor ? In vitro from Irradiated Xenografts and during Palliative Treatment of Hormone-Refractory Prostate Carcinoma  

Science Journals Connector (OSTI)

...Preclinical Pharmacology Ionizing Radiation Causes a Dose-Dependent Release of...linear function of the radiation dose over the range 0-10 Gy with r2 0...20: 91-5, 2000. Ionizing radiation causes a dose-dependent release of...

Michael Hagan; Adly Yacoub; and Paul Dent

2004-09-01T23:59:59.000Z

354

Extensive Diversity of Ionizing-Radiation-Resistant Bacteria Recovered from Sonoran Desert Soil and Description of Nine New Species of the Genus Deinococcus Obtained from a Single Soil Sample  

Science Journals Connector (OSTI)

...ionizing radiation on Earth...the acute doses to which...damage of ionizing radiation but rather...from a wide range of environments...showing the range of morphological...to various doses of gamma ionizing radiation Dose (kGy...

Fred A. Rainey; Keren Ray; Margarida Ferreira; Bridget Z. Gatz; M. Fernanda Nobre; Danielle Bagaley; Brian A. Rash; Mie-Jung Park; Ashlee M. Earl; Nicole C. Shank; Alanna M. Small; Margaret C. Henk; John R. Battista; Peter Kmpfer; Milton S. da Costa

2005-09-01T23:59:59.000Z

355

Retinal Degeneration and Ionizing Radiation Hypersensitivity in a Mouse Model for Cockayne Syndrome  

Science Journals Connector (OSTI)

...sensitive to a single dose of ionizing radiation at doses up to 10 Gy. In marked...least within the age range investigated, the...photoreceptor cells for ionizing radiation. This finding underscores...experiment (cumulative dose, 35 kJ/m2). The...

Theo G. M. F. Gorgels; Ingrid van der Pluijm; Renata M. C. Brandt; George A. Garinis; Harry van Steeg; Gerard van den Aardweg; Gerard H. Jansen; Jan M. Ruijter; Arthur A. B. Bergen; Dirk van Norren; Jan H. J. Hoeijmakers; Gijsbertus T. J. van der Horst

2006-12-04T23:59:59.000Z

356

Sensitivity of aflatoxin b1 to ionizing radiation.  

Science Journals Connector (OSTI)

...activity with respective doses of 2.5, 5, 10...irradiation aflatoxin B1 dose of: in upper layediteionre...in foodstuffs may range from levels of 0...with an irradiation dose of10 kGy (the maximum...its sensitivity to ionizing radiation. When aflatoxin...

P J Van Dyck; P Tobback; M Feyes; H van de Voorde

1982-06-01T23:59:59.000Z

357

The Arabidopsis RGA Gene Encodes a Transcriptional Regulator Repressing the Gibberellin Signal Transduction Pathway  

Science Journals Connector (OSTI)

...and occur in a diverse range of proteins (). However...bombardment (at the dose 60 Gy) by H. Brunner...Veen J.H. EMS- and radiation-induced mutation frequencies...Goodman H.M. Effects of ionizing radiation on a plant genomeAnalysis...

Aron L. Silverstone; Charles N. Ciampaglio; Tai-ping Sun

358

Chromosome translocations and cosmic sources of ionizing radiation: The NIOSH-NCI airline pilot biomarker study  

Science Journals Connector (OSTI)

...and cosmic sources of ionizing radiation: The NIOSH-NCI airline...are exposed to cosmic ionizing radiation, an efficient inducer...bone marrow absorbed dose in cGy from personal...SD; 46.7 5.3, range 37-55 vs. 45.8...

Lee Yong; Alice Sigurdson; Elizabeth Ward; Martha Waters; Elizabeth Whelan; Martin Petersen; Elaine Ron; Marilyn Ramsey; Parveen Bhatti; and James Tucker

2007-05-01T23:59:59.000Z

359

Use of the Tetrazolium Assay in Measuring the Response of Human Tumor Cells to Ionizing Radiation  

Science Journals Connector (OSTI)

...irradiation dose rate was...demonstrated a range of absorbance...RESPONSE TO IONIZING RADIATION with 1 mg...with graded doses of irradiation...each with a range of seeded...MGHU1 0 5 10 DOSE (Gy) RT112...RESPONSE TO IONIZING RADIATION 150000 FF...

Patricia Price and Trevor J. McMillan

1990-03-01T23:59:59.000Z

360

Effects of Mn and Fe Levels on Bacillus subtilis Spore Resistance and Effects of Mn2+, Other Divalent Cations, Orthophosphate, and Dipicolinic Acid on Protein Resistance to Ionizing Radiation  

Science Journals Connector (OSTI)

...exposed to ionizing radiation in vitro display...response to dose, with increasing...doses of gamma radiation increase...within a narrow range of Mn concentrations...from gamma ray doses (15 kGy...resistance to ionizing radiation, desiccation...

Amanda C. Granger; Elena K. Gaidamakova; Vera Y. Matrosova; Michael J. Daly; Peter Setlow

2010-11-05T23:59:59.000Z

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Enhancement of Antitumor Activity of Ionizing Radiation by Combined Treatment with the Selective Epidermal Growth Factor Receptor-Tyrosine Kinase Inhibitor ZD1839 (Iressa)  

Science Journals Connector (OSTI)

...Table 1 Effect of ionizing radiation or of ZD1839 treatment on the...were calculated by performing dose-response experiments. Cancer cells were exposed to different doses of ionizing radiation (range, 10-250 cGy) or to different...

Cataldo Bianco; Giampaolo Tortora; Roberto Bianco; Roberta Caputo; Bianca Maria Veneziani; Rosa Caputo; Vincenzo Damiano; Teresa Troiani; Gabriella Fontanini; David Raben; Stefano Pepe; A. Raffaele Bianco; and Fortunato Ciardiello

2002-10-01T23:59:59.000Z

362

Radiation Physics and Chemistry 71 (2004) 363368 A study of the alanine dosimeter irradiation temperature  

E-Print Network [OSTI]

. Puhla , Anna L. McBainb , Glenn W. Calvertb a Ionizing Radiation Division, Physics Laboratory, National. Since the temperature coefficient is known to be dose dependent [Radiat. Phys. Chem. 57 (2000) 1], a series of dose response studies were conducted over a dose range of 0.5­100 kGy. The study revealed

363

Altered Telomere Nuclear Matrix Interactions and Nucleosomal Periodicity in Ataxia Telangiectasia Cells before and after Ionizing Radiation Treatment  

Science Journals Connector (OSTI)

...mean P/mean S Mean () Range () Mean () Range () RKO 71 67-75 29 25-33...significant. Influence of ionizing radiation on telomere-nuclear matrix...cells were treated with a dose of 5 Gy of ionizing radiation, and proportions of S...

Lubomir B. Smilenov; Sonu Dhar; Tej K. Pandita

1999-10-01T23:59:59.000Z

364

ATR Regulates a G2-Phase Cell-Cycle Checkpoint in Arabidopsis thaliana  

Science Journals Connector (OSTI)

...sterile, produce a range of silique sizes...UV-B (chronic dose), or left untreated...Doses of gamma-Radiation but Proficient...recover from gamma-radiation doses as low as 80 Gy...are sensitive to ionizing radiation and defective...

Kevin Culligan; Alain Tissier; Anne Britt

2004-04-09T23:59:59.000Z

365

BJR doi: 10.1259/bjr.20130629 7 October 2013  

E-Print Network [OSTI]

examinations such as dental or chest examinations (organ doses typically ,0.5 mGy) and higher radiological November 2013 © 2014 The Authors. Published by the British Institute of Radiology under the terms with radiation doses from radiological imaging. Br J Radiol 2014;87:20130629. RADIOBIOLOGY SPECIAL FEATURE

Brenner, David Jonathan

366

The Applicability of the International Classification of Functioning, Disability, and Health to Study Lifestyle and Quality of Life of Colorectal Cancer Survivors  

Science Journals Connector (OSTI)

...mice is radiation quality dependent Kamal Datta...Purpose: Radiation quality depends on loss of energy in tissues per unit...iron (56-Fe) ion (energy: 1 GeV/nucleon...Gy determined using a quality factor 1.25 and 1...

Eline H. van Roekel; Martijn J.L. Bours; Carin P.M. de Brouwer; Huib Ten Napel; Silvia Sanduleanu; Geerard L. Beets; IJmert Kant; and Matty P. Weijenberg

2014-07-01T23:59:59.000Z

367

Abstract 4422: Activation of beta-catenin/TCF-4 signaling leading to intestinal tumorigenesis in APCMin/+ mice is radiation quality dependent  

Science Journals Connector (OSTI)

...mice is radiation quality dependent Kamal Datta...Purpose: Radiation quality depends on loss of energy in tissues per unit...iron (56-Fe) ion (energy: 1 GeV/nucleon...Gy determined using a quality factor 1.25 and 1...

Kamal Datta; Shubankar Suman; Daniela Trani; and Albert J. Fornace

2012-04-15T23:59:59.000Z

368

Applied Mathematical Sciences, Vol. 3, 2009, no. 54, 2703 -2706 The Limit of the Statistic R/P in Models  

E-Print Network [OSTI]

Classification: 86A99, 86A32 Keywords: modeling, oil production 1 Introduction When assessing the oil reserves the cumulative oil discovered GX(t) and the cumulative oil produced GY (t) is called the proven reserves; see [5/P in Models of Oil Discovery and Production Dudley Stark School of Mathematical Sciences Queen Mary

Stark, Dudley

369

Properties of very young brown dwarfs 50 Years of Brown Dwarfs, Ringberg castle, Oct. 21-24, 2012  

E-Print Network [OSTI]

: emission lines (H, CaII, UV excess, veiling, ...) Comerón et al. (2010) H CaII GY11, 30 Mjup, Oph Herczeg #12;Features of youth: emission lines (H) Using plenty of data (H emission and infrared flux excesses Mjup and older than ~300 Myr burn lithium. Smaller-mass brown dwarfs never burn lithium (see

Joergens, Viki

370

IEEE TRANSACTIONS ON NUCLEAR SCIENCE, VOL. 52, NO. 5, OCTOBER 2005 1271 Measurement of Centi-Gray X-Ray Dose  

E-Print Network [OSTI]

IEEE TRANSACTIONS ON NUCLEAR SCIENCE, VOL. 52, NO. 5, OCTOBER 2005 1271 Measurement of Centi-Gray X- bination of single sheet higher film sensitivity to low energy X-rays along with a layered film dosimetryGy if required. Index Terms--Absorption spectra, gafchromic XR type T, low dose, radiation dosimetry

Yu, K.N.

371

Summary of the D&D Engineering Operations  

E-Print Network [OSTI]

mandatory! · Clear responsibility and accountability! ! #12;Conduct of Operations WORK CONTROL CENTER DKeith Rule Summary of the D&D Engineering Operations Princeton Plasma Physics Laboratory #12&D operations ! Maximum single individual external dose of 573 mRem (5.73 mGy) attributed to the sheer

372

Refreshments will be served For more information contact Kim Coleman at kcole@wustl.edu  

E-Print Network [OSTI]

, Calcium Looping, Syngas and Coal- Direct Chemical Looping Processes. These processes control sulfur The concept of chemical loop- ing reactions has been widely applied in chemical industries. Fundamental research on chemical looping reactions has also been applied to ener- gy systems. Fossil fuel chemi- cal

Subramanian, Venkat

373

Effects of low-dose heavy ions on embryonic development in mice and on melanocyte differentiation in the epidermis and hair bulb  

Science Journals Connector (OSTI)

......melanocytes and hair bulb melanocytes in the dorsal...relative humidity and 12 h of fluorescent light/day. Female mice...melanocytes and ventral hair bulb melanocytes did not necessarily...irradiation; 0.1 Gy led to a significant frequency...melanocytes and hair bulb melanocytes, and these......

Tomohisa Hirobe; Kiyomi Eguchi-Kasai; Kimihiko Sugaya; Masahiro Murakami

2013-05-01T23:59:59.000Z

374

Portunes: Privacy-Preserving Fast Authentication for Dynamic Electric Vehicle Charging  

E-Print Network [OSTI]

University of Illinois Urbana-Champaign hli52@illinois.edu Gy¨orgy D´an KTH Royal Institute of Technology gyuri@kth.se Klara Nahrstedt University of Illinois Urbana-Champaign klara@illinois.edu Abstract. In order to allow a significant amount of energy to be transmitted to an EV in a charging section

Nahrstedt, Klara

375

An Iterative Solver-Based Long-Step Infeasible Primal-Dual Path ...  

E-Print Network [OSTI]

29 ???. 2005 ... ... t N00014-05-1-0183. tSc hoo l of Indus tr ial and Sys te ms Engin eer ing, G eor gia Ins t it u te of Te c h n o lo gy, A t lan t a, G eor gia 30332-.

376

For personal use only. Not to be reproduced without permission of The Lancet. THE LANCET Vol 355 June 10, 2000 2071  

E-Print Network [OSTI]

radiation dose of 2 Gy (an upper-end estimate of the average contralateral breast dose)4 to the breast The relative risks for radiation versus no radiation were estimated using Mantel-Haenszel Poisson models in the radiotherapy group. The mean radiation doses to the contralateral breast are probably comparable in the EORTC1

Brenner, David Jonathan

377

Radiation-induced bystander effect and adaptive response in mammalian cells  

E-Print Network [OSTI]

responses at low doses of radiation and have the potential to impact the shape of the dose the actual target and radiation dose effect and can contribute to our current understanding in radiation risk provide the best estimate of cancer risk over the dose range from 20 to 250 cGy. The cancer risk at doses

378

Physiological Responses of the Hyperthermophilic Archaeon Pyrococcus abyssi to DNA Damage Caused by Ionizing Radiation  

Science Journals Connector (OSTI)

...before and after radiation and was in good...performed at a sublethal dose of 2,000 Gy to...our preliminary estimation reveals that 0...been observed for radiation-resistant Chroococcidiopsis...caused by ionizing radiation. | The mechanisms...furiosus, survive high doses of ionizing gamma...

Edmond Jolivet; Fujihiko Matsunaga; Yoshizumi Ishino; Patrick Forterre; Daniel Prieur; Hannu Myllykallio

2003-07-01T23:59:59.000Z

379

Custom Device for Low-Dose Gamma Irradiation of Biological Samples  

E-Print Network [OSTI]

, the structural material is efficient to absorb most of the cosmic-ray energy and reduce the interior dose rate to below 1.2 mGy per day. However, the biological effects of prolonged exposure to low-dose radiation are not well understood. The purpose...

Bi, Ruoming

2012-02-14T23:59:59.000Z

380

8th International Workshop on Microbeam Probes of Cellular Radiation Response  

Science Journals Connector (OSTI)

......and Intracellular Energy-deposited Sites...irradiation diagnostics. Home developed software...reduced glutathione consumption. RESULTS AND DISCUSSION...exclude such low-energy particle components...The electron beam energy is 30keV and the...system produced an average dose rate of 5Gy......

Yoshiya Furusawa; Katsumi Kobayashi; Yasuhiko Kobayashi; Takashi Nakano; Shunichi Yamashita

2009-03-01T23:59:59.000Z

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Housing Requirements and National Resources  

Science Journals Connector (OSTI)

...private household per unit of its...describe the demands for ur-ban...the levels of GDP and growth rates...capital. If real per capita income remains...increases in GDP per capita (possibly reflecting...of competing demands for ener-gy...

T. R. Lakshmanan; Lata Chatterjee; P. Roy

1976-06-04T23:59:59.000Z

382

Dating Pleistocene Archeological Sites by Protein Diagenesis in Ostrich Eggshell  

Science Journals Connector (OSTI)

...Holocene 4C-dated samples from the east-ern Sahara (Egypt and Sudan) and from South Africa yields an activation ener-gy, Ea...temperature in this region today, as measured directly with thermal sensors, averages 26.4 C. Several samples with known A...

A. S. Brooks; P. E. Hare; J. E. Kokis; G. H. Miller; R. D. Ernst; F. Wendorf

1990-04-06T23:59:59.000Z

383

he global energy crisis has increased awareness of the  

E-Print Network [OSTI]

) resistance to motion; (ii) cost of control; and (iii) kinetic energy reduction. For small amplitude actuation and tidal ener- gy harvesting as well as fuel-effi- cient and environmentally friendly vehicles half of the fuel re- quired to maintain the aircraft at cruise conditions is used to over- come

Jovanovic, Mihailo

384

Energy Efficiency & Renewable Energy  

E-Print Network [OSTI]

.S. Energy Consumption U.S. Primary Energy Consumption by Source and Sector Share of Energy Consumed byEnergy Efficiency & Renewable Energy 2010 Fuel Cell Project Kick-off Dr. Dimitrios Papageorgopoulos Fuel Cells Team Leader U.S. Department of Energy gy Fuel Cell Technologies Program September 28

385

Cofinal types of directed orders  

E-Print Network [OSTI]

, ) directed partial orders #12;Cofinal types (P, ), (Q, ) directed partial orders Tukey reducibility: (P orders Tukey reducibility: (P, ) T (Q, ) if f : P Q X P unbounded = f [X] Q unbounded g : Q P Y Q cofinal = g[Y ] P cofinal #12;Cofinal types (P, ), (Q, ) directed partial orders Tukey reducibility: (P

Mátrai, Tamás

386

Safety regulations of food and water implemented in the first year following the Fukushima nuclear accident  

Science Journals Connector (OSTI)

......horizontally in the rice field since rice crops...conducted to minimize production of radioactively...used to extract oil or to pickle vegetables...that a lifetime cumulative effective dose of...that exposure to a cumulative dose of 500-mGy...To minimize the production of contaminated......

Nobuyuki Hamada; Haruyuki Ogino; Yuki Fujimichi

2012-09-01T23:59:59.000Z

387

Luffa fibers and gamma radiation as improvement tools of polymer Gonzalo Martnez-Barrera a,  

E-Print Network [OSTI]

, 4200-465 Porto, Portugal c Institute of Mechanical Engineering and Industrial Management (INEGI. The highest bending deformation is obtained with 0.9 wt% of fibers and 100 kGy of radiation dose. ? 2013, silica fume, silica sand; the last one the most used due to size distribution, ranging from 0.6 to 4.0 mm

North Texas, University of

388

Les Energies Renouvelables au Service de l'Humanit, Paris, 3.11.2013 George Kariniotakis  

E-Print Network [OSTI]

-2012 225,000 wind turbines 4670,000 The number of people employed worldwide by the wind industry in 2011 #12;Wind Energy: Where are we now?gy Size evolution of wind turbinesSize evolution of wind turbines,079 in 2030 (62 % of jobs in the offshore sector) The amount of people expected to be employed by the wind

Canet, Léonie

389

Patterns of Failure and Treatment-Related Toxicity in Advanced Cervical Cancer Patients Treated Using Extended Field Radiotherapy With Curative Intent  

SciTech Connect (OSTI)

Purpose: The purpose of this study was to evaluate the patterns of failure and overall survival (OS) and disease-free survival (DFS) rates in cervical cancer patients who had metastatic disease in common iliac or para-aortic lymph nodes and were treated with curative intent, using extended field radiotherapy (EFRT). Methods and Materials: This was a retrospective study involving 39 patients treated from January 1996 to June 2007, using EFRT with concurrent chemotherapy and intracavitary brachytherapy. EFRT consisted of 45 Gy in 1.8-Gy fractions. Radiation to involved nodes was boosted to a total dose of 50.4 to 54 Gy. Primary tumor radiation was boosted to a dose of 80 Gy using brachytherapy. Results: Overall, 30 patients (77%) have relapsed. The 5-year OS rate was 26% (95% confidence interval [CI], 11-44). The 5-year DFS rate was 19.4% (95% CI, 8-35). Only 3 patients (7.5%) experienced treatment failure exclusively within the treatment field, and 2 patients underwent salvage treatment. Grade 3 to 4 acute bone marrow and gastrointestinal toxicities were observed in 10 (26%) and 7 (18%) patients, respectively. Conclusions: Concurrent chemotherapy and EFRT treatment was well tolerated. Most patients showed failure at multiple sites and outside the treatment field. Only 3/39 patients had failures exclusively within the treatment field, and 2 underwent salvage treatment.

Rajasooriyar, Chrishanthi, E-mail: rchrishanthi@hotmail.co [Division of Oncology, Teaching Hospital, Batticaloa (Sri Lanka); Van Dyk, Sylvia; Bernshaw, David [Division of Radiation Oncology, Peter MacCallum Cancer Centre, Melbourne (Australia); Kondalsamy-Chennakesavan, Srinivas [Queensland Centre for Gynaecological Cancer, Royal Brisbane and Women's Hospital, Queensland, and School of Medicine, University of Queensland (Australia); Barkati, Maroie; Narayan, Kailash [Division of Radiation Oncology, Peter MacCallum Cancer Centre, Melbourne (Australia)

2011-06-01T23:59:59.000Z

390

Radon lung dosimetry models  

Science Journals Connector (OSTI)

......and specifies the breathing cycle times within a given breath...Reineking(28) 9.0 (working+diesel) 6.7 (without working Harley...20. bAerosols produced by diesel combustion and mining processes...2.041 Gy at R2 (24). In general, about 10 % of the total bifurcation......

W. Hofmann; R. Winkler-Heil

2011-05-01T23:59:59.000Z

391

The Energy Balance of Cosmic Rays  

Science Journals Connector (OSTI)

......14) Rossi B. High-Energy Particles (1952) New York. 15) Camerini , Lock...Rochester Conference on High Energy Nuclear Physics, 25-27th...High-EnC"gy Particles (New York, 1952). 15) Camerini...Rochester Conference on High Energy Nuclear Physics, 25-27......

Hiroo Komori

1955-02-01T23:59:59.000Z

392

August 2009 phase one final recommendations  

E-Print Network [OSTI]

of the following long-term technologies and tools: --Single employee Web interface/portal/intranet --Single social and access --Internal newsletters --Brief --Blogs --Lyris --Intranets, myU, and other internal Web sites Reinventing Internal Communications #12;--Use of vendors and external resources 2. technoloGy n Develop

Minnesota, University of

393

Hydrogen atom in crossed electric and magnetic fields: Phase space topology and torus quantization via periodic orbits  

E-Print Network [OSTI]

Hydrogen atom in crossed electric and magnetic fields: Phase space topology and torus quantization for the periodic orbits in a strongly coupled multidimen- sional Hamiltonian system, namely the hydrogen atom.15.Gy, 05.45.-a, 45.20.Jj I. INTRODUCTION The hydrogen atom in crossed electric and magnetic fields

394

Carter Energy Message: How Stiff a Prescription?  

Science Journals Connector (OSTI)

...but the alternative ener-gy sources-solar, geothermal, and fu-sion-were not seen as providing a sig-nificant...electricity along with industrial-process steam, "district heating" (piping hot wa-ter from power plants to nearby...

LUTHER J. CARTER

1977-05-06T23:59:59.000Z

395

High energy electron beam curing of epoxy resin systems incorporating cationic photoinitiators  

DOE Patents [OSTI]

A mixture of epoxy resins such as a semi-solid triglycidyl ether of tris (hydroxyphenyl) methane and a low viscosity bisphenol A glycidyl ether and a cationic photoinitiator such as a diaryliodonium salt is cured by irradiating with a dosage of electron beams from about 50 to about 150 kGy, forming a cross-linked epoxy resin polymer.

Janke, Christopher J. (Powell, TN); Lopata, Vincent J. (Manitoba, CA); Havens, Stephen J. (Knoxville, TN); Dorsey, George F. (Farragut, TN); Moulton, Richard J. (Lafayette, CA)

1999-01-01T23:59:59.000Z

396

I M E M O R A N D U M T O  

Office of Legacy Management (LM)

c1 P u r c h a s e O r d e r cl O th e r information (i.e., cost + fixe d fe e , unit price, tim e & m a terial, Ftc) w------ --gy- e n - 1 6 - 0 5 9 8 - e * - 9...

397

Effects of N-Asterisk(1440) Resonance on Particle-Production in Heavy-Ion Collisions at Subthreshold Energies  

E-Print Network [OSTI]

. Bauer, and G.F. Bertsch, Phys. Rev. C 44, 2095 (1991). [19]Gy. Wolf et al. , Nucl. Phys. A517, 615 (1990). [20] P. Danielewicz and G.F. Bertsch, Nucl. Phys. A533, 712 (1991). [21] P. Danielewicz, Report No. MSUCL-946, 1994. [22] B.J. VerWest and R...

Li, Ba; Ko, Che Ming; LI, GQ.

1994-01-01T23:59:59.000Z

398

Proceedings of the AmericanControlConference Arlington, VA June 25-27, 2001  

E-Print Network [OSTI]

of the response curve. This is typically achieved by matching drive and sense resonant frequencies (Fig. 2c is extremely narrow. For example, a 1% fluctuation in frequency matching between drive and sense modes Variable Gain Amplifier Figure 1: Illustration of the proposed micromachined gy- roscope with control

Tang, William C

399

Effects of non-lethal doses of ionising radiation on the instrumental behaviour of rats  

Science Journals Connector (OSTI)

The dose-effect dependence of the instrumental behaviour of white rats after a single total ?-exposure (60Co) in the dosage range of 0.05 to 7.0 Gy was studied. Generalised results of seven years of our studies of post-radiation changes of operant behaviour in shuttle (active avoidance of shock ?? negative reinforcement) and in Skinner (drinking reward ?? positive reinforcement) boxes were evaluated weekly for a two-month period after exposure. The dose dependence, obtained using these two behavioural paradigms, displays a non-linear pattern. Three regions with different characteristic patterns of the observed effects were found: performance declines relative to control animals after exposure to doses up to 1.0 Gy; performance increases at doses in the range from 1.0 to 3.0 Gy; and again declines with dose increases up to 7.0 Gy. Possible underlying mechanisms, particularly the role of additional stress caused by animal testing, are discussed.

Eugene V. Tukalenko; Vyacheslav V. Varetsky; Olexander G. Rakochi; Inna R. Dmitrieva; Mikola U. Makarchuk

2007-01-01T23:59:59.000Z

400

Anatomic and Dosimetric Changes During the Treatment Course of Intensity-Modulated Radiotherapy for Locally Advanced Nasopharyngeal Carcinoma  

SciTech Connect (OSTI)

Many patients with nasopharyngeal carcinoma (NPC) have marked anatomic change during intensity-modulated radiation therapy (IMRT). In this study, the magnitude of anatomic changes and its dosimetric effects were quantified. Fifteen patients with locally advanced NPC treated with IMRT had repeated computed tomography (CT) after 18 fractions. A hybrid plan was made to the anatomy of the second computed tomography scan. The dose of the original plan, hybrid plan, and new plan were compared. The mean volume of left and right parotid decreased 6.19 mL and 6.44 mL, respectively. The transverse diameters of the upper bound of odontoid process, the center of odontoid process, and the center of C2 vertebral body slices contracted with the mean contraction of 8.2 mm, 9.4 mm, and 7.6 mm. Comparing the hybrid plan with the treatment plan, the coverage of target was maintained while the maximum dose to the brain stem and spinal cord increased by 0.08 to 6.51 Gy and 0.05 to 7.8 Gy. The mean dose to left and right parotid increased by 2.97 Gy and 2.57 Gy, respectively. A new plan reduced the dose of spinal cord, brain stem, and parotids. Measurable anatomic changes occurring during the IMRT for locally advanced NPC maintained the coverage of targets but increased the dose to critical organs. Those patients might benefit from replanning.

Wang Xin [Department of Radiation Oncology, Cancer Hospital, Shanghai Medical College, Fudan University, Shanghai (China); Department of Radiation Oncology, Huashan Hospital, Shanghai Medical College, Fudan University, Shanghai (China); Lu Jiade [Department of Radiation Oncology, Cancer Hospital, Shanghai Medical College, Fudan University, Shanghai (China); Department of Radiation Oncology, National University Hospital (Singapore); Xiong Xiaopeng; Zhu Guopei; Ying Hongmei; He Shaoqin; Hu Weigang [Department of Radiation Oncology, Cancer Hospital, Shanghai Medical College, Fudan University, Shanghai (China); Hu Chaosu [Department of Radiation Oncology, Cancer Hospital, Shanghai Medical College, Fudan University, Shanghai (China)], E-mail: Hucsu62@yahoo.com

2010-07-01T23:59:59.000Z

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Determining Chlorine Concentrations in Air and Water Samples for Scrubbing Studies Using Ion Chromatography  

Science Journals Connector (OSTI)

......References 2. J.L. Morrison. Recovery scrubber for waste chlorine gas. Tappi 51(12): 124A25A (1968). 3. G.Y. Pan, J.F. DeGraw, and J.J. Renard. Tappi Proceedings, 1982 Pulping Conference, pp. 36570. 4. I.F. Rees. Bleach......

William C. Askew; Stephen J. Morisani

1989-01-01T23:59:59.000Z

402

Segmented crystalline scintillators: An initial investigation of high quantum efficiency detectors for megavoltage x-ray imaging  

E-Print Network [OSTI]

and dose delivery in external beam radiotherapy. However, current AMFPI EPIDs, which are based on powdered by infusing crystalline CsI Tl in a 2 mm thick tungsten matrix, and the signal response was measured under exhibited less than 15% reduction in light output after 2500 cGy equivalent dose. The prototype CsI Tl

Cunningham, Ian

403

Assessment of Radiogenic Cancer Initiation Frequency per Clonogenic Rat Mammary Cell in Vivo  

Science Journals Connector (OSTI)

...X-rays from a General Electric Maxitron 300 with 3 mm Al...first and subsequent mammary car cinomas are not independent...D0 = 127 cGy low linear energy transfer irradiation and...differences in latencies of car cinomas from grafted cells...

Kelly H. Clifton; Martin A. Tanner; and Michael N. Gould

1986-05-01T23:59:59.000Z

404

The impact of groundwater-land surface interactions on hydrologic persistence in macroscale Elizabeth A. Clark and Dennis P. Lettenmaier  

E-Print Network [OSTI]

= layer depth z = depth to water table Commonalities: 1)Forcings: Precipitation, Tmax, Tmin, Wind 2)Sub-grid9.08 The impact of groundwater-land surface interactions on hydrologic persistence in macroscale and Energy Fluxes for GSMs, J. Geophys. Res., 99(D7), 14,415-14,428. Niu, G.-Y., Z.-L. Yang, R.E. Dickinson

Washington at Seattle, University of

405

Explicit Communication and Synchronization in SARC  

E-Print Network [OSTI]

· Communication using a 64bit, 5port bufferless crossbar switch · Three Diverse applications Jacobi, Bitonic cores · 2x4x reduced network traffic · 35%70% Energy reduction · 50%90% Energy Delay Product (EDP) gy y ( ) reduction · 15%30% Power consumption reduction Computer Architecture and VLSI Systems Laboratory (CARV

Katevenis, Manolis G.H.

406

Cellular Consequences of Overproduction of DNA Topoisomerase II in an Ataxia-Telangiectasia Cell Line  

Science Journals Connector (OSTI)

...stored at " 20 Cas a 10 mM stock solution in dimethyl sulfoxide...33) which gave 5.5 F units/Gy for each fibroblast...Thacker, MRC Radiobiology Unit, Harwell, UK). Crithidia...mAMSA-dependent cross-linking in keeping with an over- expression...DNA topoisomerase II per unit protein extracted. However...

P. J. Smith and T. A. Makinson

1989-03-01T23:59:59.000Z

407

Quantifying dose to the reconstructed breast: Can we adequately treat?  

SciTech Connect (OSTI)

To evaluate how immediate reconstruction (IR) impacts postmastectomy radiotherapy (PMRT) dose distributions to the reconstructed breast (RB), internal mammary nodes (IMN), heart, and lungs using quantifiable dosimetric end points. 3D conformal plans were developed for 20 IR patients, 10 autologous reconstruction (AR), and 10 expander-implant (EI) reconstruction. For each reconstruction type, 5 right- and 5 left-sided reconstructions were selected. Two plans were created for each patient, 1 with RB coverage alone and 1 with RB + IMN coverage. Left-sided EI plans without IMN coverage had higher heart Dmean than left-sided AR plans (2.97 and 0.84 Gy, p = 0.03). Otherwise, results did not vary by reconstruction type and all remaining metrics were evaluated using a combined AR and EI dataset. RB coverage was adequate regardless of laterality or IMN coverage (Dmean 50.61 Gy, D95 45.76 Gy). When included, IMN Dmean and D95 were 49.57 and 40.96 Gy, respectively. Mean heart doses increased with left-sided treatment plans and IMN inclusion. Right-sided treatment plans and IMN inclusion increased mean lung V{sub 20}. Using standard field arrangements and 3D planning, we observed excellent coverage of the RB and IMN, regardless of laterality or reconstruction type. Our results demonstrate that adequate doses can be delivered to the RB with or without IMN coverage.

Chung, Eugene; Marsh, Robin B.; Griffith, Kent A.; Moran, Jean M. [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States); Pierce, Lori J., E-mail: ljpierce@umich.edu [Department of Radiation Oncology, University of Michigan, Ann Arbor, MI (United States)

2013-04-01T23:59:59.000Z

408

Rationale for and Preliminary Results of Proton Beam Therapy for Mediastinal Lymphoma  

SciTech Connect (OSTI)

Purpose: To evaluate the potential of three-dimensional proton beam therapy (3D-PBT) for reducing doses to normal structures in patients with mediastinal lymphomas compared with conventional photon radiation therapy (RT). Methods and Materials: We treated 10 consecutive patients with mediastinal masses from lymphomas with 3D-PBT between July 2007 and February 2009 to 30.6-50.4 cobalt-Gray equivalents (CGE). Of those patients, 7 had primary refractory or recurrent disease, and 8 had Hodgkin lymphoma. Dosimetric endpoints were compared with those from conventional RT plans. Results: PBT delivered lower mean doses to the lung (6.2 vs. 9.5 Gy), esophagus (9.5 vs. 22.3 Gy), and heart (8.8 vs. 17.7 Gy) but not the breasts (5.9 vs. 6.1 Gy) than did conventional RT. Percentages of lung, esophagus, heart, and coronary artery (particularly the left anterior descending artery) volumes receiving radiation were consistently lower in the 3D-PBT plans over a wide range of radiation doses. Of the 7 patients who had residual disease on positron emission tomography before PBT, 6 (86%) showed a complete metabolic response. Conclusions: In patients with mediastinal lymphomas, 3D-PBT produced significantly lower doses to the lung, esophagus, heart, and coronary arteries than did the current conventional RT. These lower doses would be expected to reduce the risk of late toxicities in these major organs.

Li Jing; Dabaja, Bouthaina; Reed, Valerie; Allen, Pamela K.; Cai, Haihong; Amin, Mayankkumar V.; Garcia, John A. [Department of Radiation Oncology, University of Texas M. D. Anderson Cancer Center, Houston, Texas (United States); Cox, James D., E-mail: jcox@mdanderson.org [Department of Radiation Oncology, University of Texas M. D. Anderson Cancer Center, Houston, Texas (United States)

2011-09-01T23:59:59.000Z

409

Brazil: Energy Options and Current Outlook  

Science Journals Connector (OSTI)

...4.1 1.6 0.1 Alagoas 0.9 0.6 Offshore 5.9 4.7 Total 60.2 35.8 12.6...per year. The possible utilization of wind ener-gy, thermal gradient of oceans...fast-mov-ing streams (16). Costs of these turbines compete favorably with the conventional...

J. Goldemberg

1978-04-14T23:59:59.000Z

410

A comparison of Monte Carlo and Fermi-Eyges-Hogstrom estimates of heart and lung dose from breast electron boost treatment  

SciTech Connect (OSTI)

Purpose: Electrons are commonly used in the treatment of breast cancer primarily to deliver a tumor bed boost. We compared the use of the Monte Carlo (MC) method and the Fermi-Eyges-Hogstrom (FEH) algorithm to calculate the dose distribution of electron treatment to normal tissues. Methods and materials: Ten patients with left-sided breast cancer treated with breast-conservation therapy at the University of California, San Francisco, were included in this study. Each patient received an electron boost to the surgical bed to a dose of 1,600 cGy in 200 cGy fractions prescribed to 80% of the maximum. Doses to the left ventricle (LV) and the ipsilateral lung (IL) were calculated using the EGS4 MC system and the FEH algorithm implemented on the commercially available Pinnacle treatment planning system. An anthromorphic phantom was irradiated with radiochromic film in place to verify the accuracy of the MC system. Results: Dose distributions calculated with the MC algorithm agreed with the film measurements within 3% or 3 mm. For all patients in the study, the dose to the LV and IL was relatively low as calculated by MC. That is, the maximum dose received by up to 98% of the LV volume was < 100 cGy/day. Less than half of the IL received a dose in excess of 30 cGy/day. When compared with MC, FEH tended to show reduced penetration of the electron beam in lung, and FEH tended to overestimate the bremsstrahlung dose in regions well beyond the electron practical range. These differences were clinically likely to be of little significance, comprising differences of less than one-tenth of the LV and IL volume at doses > 30 cGy and differences in maximum dose of < 35 cGy/day to the LV and 80 cGy/day to the IL. Conclusions: From our series, using clinical judgment to prescribe the boost to the surgical bed after breast-conserving treatment results in low doses to the underlying LV and IL. When calculated dose distributions are desired, MC is the most accurate, but FEH can still be used.

Coleman, Joy [Department of Radiation Oncology, University of California, San Francisco, San Francisco, CA (United States); Park, Catherine [Department of Radiation Oncology, University of California, San Francisco, San Francisco, CA (United States); Villarreal-Barajas, J. Eduardo [Department of Radiation Oncology, University of California, San Francisco, San Francisco, CA (United States); Petti, Paula [Department of Radiation Oncology, University of California, San Francisco, San Francisco, CA (United States); Faddegon, Bruce [Department of Radiation Oncology, University of California, San Francisco, San Francisco, CA (United States)]. E-mail: faddegon@radonc17.ucsf.edu

2005-02-01T23:59:59.000Z

411

Comparison of Heart and Coronary Artery Doses Associated With Intensity-Modulated Radiotherapy Versus Three-Dimensional Conformal Radiotherapy for Distal Esophageal Cancer  

SciTech Connect (OSTI)

Purpose: To compare heart and coronary artery radiation exposure using intensity-modulated radiotherapy (IMRT) vs. four-field three-dimensional conformal radiotherapy (3D-CRT) treatment plans for patients with distal esophageal cancer undergoing chemoradiation. Methods and Materials: Nineteen patients with distal esophageal cancers treated with IMRT from March 2007 to May 2008 were identified. All patients were treated to 50.4 Gy with five-field IMRT plans. Theoretical 3D-CRT plans with four-field beam arrangements were generated. Dose-volume histograms of the planning target volume, heart, right coronary artery, left coronary artery, and other critical normal tissues were compared between the IMRT and 3D-CRT plans, and selected parameters were statistically evaluated using the Wilcoxon rank-sum test. Results: Intensity-modulated radiotherapy treatment planning showed significant reduction (p < 0.05) in heart dose over 3D-CRT as assessed by average mean dose (22.9 vs. 28.2 Gy) and V30 (24.8% vs. 61.0%). There was also significant sparing of the right coronary artery (average mean dose, 23.8 Gy vs. 35.5 Gy), whereas the left coronary artery showed no significant improvement (mean dose, 11.2 Gy vs. 9.2 Gy), p = 0.11. There was no significant difference in percentage of total lung volume receiving at least 10, 15, or 20 Gy or in the mean lung dose between the planning methods. There were also no significant differences observed for the kidneys, liver, stomach, or spinal cord. Intensity-modulated radiotherapy achieved a significant improvement in target conformity as measured by the conformality index (ratio of total volume receiving 95% of prescription dose to planning target volume receiving 95% of prescription dose), with the mean conformality index reduced from 1.56 to 1.30 using IMRT. Conclusions: Treatment of patients with distal esophageal cancer using IMRT significantly decreases the exposure of the heart and right coronary artery when compared with 3D-CRT. Long-term studies are necessary to determine how this will impact on development of coronary artery disease and other cardiac complications.

Kole, Thomas P.; Aghayere, Osarhieme; Kwah, Jason [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States)] [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Yorke, Ellen D. [Department of Medical Physics, Memorial Sloan-Kettering Cancer Center, New York, NY (United States)] [Department of Medical Physics, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Goodman, Karyn A., E-mail: goodmank@mskcc.org [Department of Radiation Oncology, Memorial Sloan-Kettering Cancer Center, New York, NY (United States)

2012-08-01T23:59:59.000Z

412

A Comprehensive Analysis of Cardiac Dose in Balloon-Based High-Dose-Rate Brachytherapy for Left-Sided Breast Cancer  

SciTech Connect (OSTI)

Purpose: To investigate radiation dose to the heart in 60 patients with left-sided breast cancer who were treated with balloon-based high-dose-rate brachytherapy using MammoSite or Contura applicators. Methods and Materials: We studied 60 consecutive women with breast cancer who were treated with 34 Gy in 10 twice-daily fractions using MammoSite (n = 37) or Contura (n = 23) applicators. The whole heart and the left and right ventricles were retrospectively delineated, and dose-volume histograms were analyzed. Multiple dosimetrics were reported, such as mean dose (D{sub mean}); relative volume receiving 1.7, 5, 10, and 20 Gy (V1.7, V5, V10, and V20, respectively); dose to 1 cc (D{sub 1cc}); and maximum point dose (D{sub max}). Biologic metrics, biologically effective dose and generalized equivalent uniform dose were computed. The impact of lumpectomy cavity location on cardiac dose was investigated. Results: The average {+-} standard deviation of D{sub mean} was 2.45 {+-} 0.94 Gy (range, 0.56-4.68) and 3.29 {+-} 1.28 Gy (range, 0.77-6.35) for the heart and the ventricles, respectively. The average whole heart V5 and V10 values were 10.2% and 1.3%, respectively, and the heart D{sub max} was >20 Gy in 7 of 60 (11.7%) patients and >25 Gy in 3 of 60 (5%) patients. No cardiac tissue received {>=}30 Gy. The V1.7, V5, V10, V20, and D{sub mean} values were all higher for the ventricles than for the whole heart. For balloons located in the upper inner quadrant of the breast, the average whole heart D{sub mean} was highest. The D{sub mean}, biologically effective dose, and generalized equivalent uniform dose values for heart and ventricles decreased with increasing minimal distance from the surface of the balloon. Conclusions: On the basis of these comprehensive cardiac dosimetric data, we recommend that cardiac dose be routinely reported and kept as low as possible in balloon-based high-dose-rate brachytherapy treatment planning for patients with left-sided breast cancer so the correlation with future cardiac toxicity data can be investigated.

Valakh, Vladimir, E-mail: vladimir@valakh.com [Department of Radiation Oncology, Allegheny General Hospital, Pittsburgh, PA (United States); Kim, Yongbok; Werts, E. Day; Trombetta, Mark G. [Department of Radiation Oncology, Allegheny General Hospital, Pittsburgh, PA (United States); Drexel University College of Medicine, Allegheny Campus, Pittsburgh, PA (United States)

2012-04-01T23:59:59.000Z

413

Modality comparison for small animal radiotherapy: A simulation study  

SciTech Connect (OSTI)

Purpose: Small animal radiation therapy has advanced significantly in recent years. Whereas in the past dose was delivered using a single beam and a lead shield for sparing of healthy tissue, conformal doses can be now delivered using more complex dedicated small animal radiotherapy systems with image guidance. The goal of this paper is to investigate dose distributions for three small animal radiation treatment modalities. Methods: This paper presents a comparison of dose distributions generated by the three approachesa single-field irradiator with a 200?kV beam and no image guidance, a small animal image-guided conformal system based on a modified microCT scanner with a 120 kV beam developed at Stanford University, and a dedicated conformal system, SARRP, using a 220 kV beam developed at Johns Hopkins University. The authors present a comparison of treatment plans for the three modalities using two cases: a mouse with a subcutaneous tumor and a mouse with a spontaneous lung tumor. A 5 Gy target dose was calculated using the EGSnrc Monte Carlo codes. Results: All treatment modalities generated similar dose distributions for the subcutaneous tumor case, with the highest mean dose to the ipsilateral lung and bones in the single-field plan (0.4 and 0.4 Gy) compared to the microCT (0.1 and 0.2 Gy) and SARRP (0.1 and 0.3 Gy) plans. The lung case demonstrated that due to the nine-beam arrangements in the conformal plans, the mean doses to the ipsilateral lung, spinal cord, and bones were significantly lower in the microCT plan (2.0, 0.4, and 1.9 Gy) and the SARRP plan (1.5, 0.5, and 1.8 Gy) than in single-field irradiator plan (4.5, 3.8, and 3.3 Gy). Similarly, the mean doses to the contralateral lung and the heart were lowest in the microCT plan (1.5 and 2.0 Gy), followed by the SARRP plan (1.7 and 2.2 Gy), and they were highest in the single-field plan (2.5 and 2.4?Gy). For both cases, dose uniformity was greatest in the single-field irradiator plan followed by the SARRP plan due to the sensitivity of the lower energy microCT beam to target heterogeneities and image noise. Conclusions: The two treatment planning examples demonstrate that modern small animal radiotherapy techniques employing image guidance, variable collimation, and multiple beam angles deliver superior dose distributions to small animal tumors as compared to conventional treatments using a single-field irradiator. For deep-seated mouse tumors, however, higher-energy conformal radiotherapy could result in higher doses to critical organs compared to lower-energy conformal radiotherapy. Treatment planning optimization for small animal radiotherapy should therefore be developed to take full advantage of the novel conformal systems.

Bazalova, Magdalena, E-mail: bazalova@stanford.edu; Nelson, Geoff; Noll, John M.; Graves, Edward E. [Department of Radiation Oncology, Molecular Imaging Program at Stanford, Stanford University, Stanford, California 94305 (United States)] [Department of Radiation Oncology, Molecular Imaging Program at Stanford, Stanford University, Stanford, California 94305 (United States)

2014-01-15T23:59:59.000Z

414

Hypofractionated Radiation Therapy for Breast Ductal Carcinoma In Situ  

SciTech Connect (OSTI)

Purpose: Conventional radiation therapy (RT) administered in 25 fractions after breast-conserving surgery (BCS) is the standard treatment for ductal carcinoma in situ (DCIS) of the breast. Although accelerated hypofractionated regimens in 16 fractions have been shown to be equivalent to conventional RT for invasive breast cancer, few studies have reported results of using hypofractionated RT in DCIS. Methods and Materials: In this multicenter collaborative effort, we retrospectively reviewed the records of all women with DCIS at 3 institutions treated with BCS followed by hypofractionated whole-breast RT (WBRT) delivered in 16 fractions. Results: Between 2003 and 2010, 440 patients with DCIS underwent BCS followed by hypofractionated WBRT in 16 fractions for a total dose of 42.5 Gy (2.66 Gy per fraction). Boost RT to the surgical bed was given to 125 patients (28%) at a median dose of 10 Gy in 4 fractions (2.5 Gy per fraction). After a median follow-up time of 4.4 years, 14 patients had an ipsilateral local relapse, resulting in a local recurrence-free survival of 97% at 5 years. Positive surgical margins, high nuclear grade, age less than 50 years, and a premenopausal status were all statistically associated with an increased occurrence of local recurrence. Tumor hormone receptor status, use of adjuvant hormonal therapy, and administration of additional boost RT did not have an impact on local control in our cohort. On multivariate analysis, positive margins, premenopausal status, and nuclear grade 3 tumors had a statistically significant worse local control rate. Conclusions: Hypofractionated RT using 42.5 Gy in 16 fractions provides excellent local control for patients with DCIS undergoing BCS.

Hathout, Lara [Department of Radiation Oncology, Hpital Maisonneuve-Rosemont, Centre affili l'Universit de Montral, Montreal, Quebec (Canada); Hijal, Tarek [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada); Thberge, Valrie [Department of Radiation Oncology, Centre hospitalier universitaire de Qubec, L'Htel-Dieu de Qubec, Quebec (Canada); Centre des maladies du sein Deschnes-Fabia, Quebec (Canada); Fortin, Bernard [Department of Radiation Oncology, Hpital Maisonneuve-Rosemont, Centre affili l'Universit de Montral, Montreal, Quebec (Canada); Vulpe, Horia [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada); Hogue, Jean-Charles [Centre des maladies du sein Deschnes-Fabia, Quebec (Canada); Centre hospitalier universitaire de Qubec, Hpital St-Sacrement, Quebec (Canada); Lambert, Christine [Department of Radiation Oncology, McGill University Health Centre, Montreal, Quebec (Canada); Bahig, Houda [Department of Radiation Oncology, Hpital Maisonneuve-Rosemont, Centre affili l'Universit de Montral, Montreal, Quebec (Canada); and others

2013-12-01T23:59:59.000Z

415

Effect of Radiotherapy Volume and Dose on Secondary Cancer Risk in Stage I Testicular Seminoma  

SciTech Connect (OSTI)

Purpose: To estimate and compare the secondary cancer risk (SCR) due to para-aortic (PA), dogleg field (DLF), or extensive field (EF) radiotherapy (RT) at different dose levels for Stage I testicular seminoma. Methods and Materials: The organ equivalent dose concept with a linear, plateau, and linear-exponential dose-response model was applied to the dose distributions to estimate the SCR. The dose distributions were calculated in a voxel-based anthropomorphic phantom. Three different three-dimensional plans were computed: PA, DLF, and EF. The plans were calculated with 6-MV photons and two opposed fields, using 20 Gy in 10 fractions. Results: The estimated cumulative SCR for a 75-year-old patient treated with PA-RT at age 35 was 23.3% (linear model), 20.9% (plateau model), and 20.8% (linear-exponential model) compared with 19.8% for the general population. Dependent on the model, PA-RT compared with DLF-RT reduced the SCR by 48-63% or 64-69% when normalized to EF-RT. For PA-RT, the linear dose-response model predicted a decrease of 45% in the SCR, using 20 Gy instead of 30 Gy; the linear-exponential dose-response model predicted no change in SCR. Conclusion: Our model suggested that the SCR after PA-RT for Stage I testicular seminoma is reduced by approximately one-half to two-thirds compared with DLF-RT, independent of the dose-response model. The SCR is expected to be equal or lower with 20 Gy than with 30 Gy. In the absence of mature patient data, the organ equivalent dose concept offers the best potential method of estimating the SCR when discussing treatment options with patients.

Zwahlen, Daniel R. [Department of Radiation Oncology, University Hospital Zurich, Zurich (Switzerland); William Buckland Radiotherapy Centre, Alfred Hospital, Melbourne, Victoria (Australia)], E-mail: daniel.zwahlen@gmx.ch; Martin, Jarad M. [Radiation Oncology Queensland, St. Andrews Hospital, Toowoomba, Queensland (Australia); Millar, Jeremy L. [William Buckland Radiotherapy Centre, Alfred Hospital, Melbourne, Victoria (Australia); Schneider, Uwe [Division of Medical Physics, Department of Radiation Oncology and Nuclear Medicine, Triemli Hospital Zurich, Zurich (Switzerland)

2008-03-01T23:59:59.000Z

416

Is It Time to Tailor the Prediction of Radio-Induced Toxicity in Prostate Cancer Patients? Building the First Set of Nomograms for Late Rectal Syndrome  

SciTech Connect (OSTI)

Purpose: Development of user-friendly tools for the prediction of single-patient probability of late rectal toxicity after conformal radiotherapy for prostate cancer. Methods and Materials: This multicenter protocol was characterized by the prospective evaluation of rectal toxicity through self-assessed questionnaires (minimum follow-up, 36 months) by 718 adult men in the AIROPROS 0102 trial. Doses were between 70 and 80 Gy. Nomograms were created based on multivariable logistic regression analysis. Three endpoints were considered: G2 to G3 late rectal bleeding (52/718 events), G3 late rectal bleeding (24/718 events), and G2 to G3 late fecal incontinence (LINC, 19/718 events). Results: Inputs for the nomogram for G2 to G3 late rectal bleeding estimation were as follows: presence of abdominal surgery before RT, percentage volume of rectum receiving >75 Gy (V75Gy), and nomogram-based estimation of the probability of G2 to G3 acute gastrointestinal toxicity (continuous variable, which was estimated using a previously published nomogram). G3 late rectal bleeding estimation was based on abdominal surgery before RT, V75Gy, and NOMACU. Prediction of G2 to G3 late fecal incontinence was based on abdominal surgery before RT, presence of hemorrhoids, use of antihypertensive medications (protective factor), and percentage volume of rectum receiving >40 Gy. Conclusions: We developed and internally validated the first set of nomograms available in the literature for the prediction of radio-induced toxicity in prostate cancer patients. Calculations included dosimetric as well as clinical variables to help radiation oncologists predict late rectal morbidity, thus introducing the possibility of RT plan corrections to better tailor treatment to the patient's characteristics, to avoid unnecessary worsening of quality of life, and to provide support to the patient in selecting the best therapeutic approach.

Valdagni, Riccardo [Prostate Program, Scientific Directorate, Fondazione IRCCS-Istituto Nazionale Tumori, Milan (Italy); Radiotherapy, Fondazione IRCCS - Istituto Nazionale dei Tumori, Milan (Italy); Kattan, Michael W. [Department of Quantitative Health Sciences, Cleveland Clinic Lerner College of Medicine of Case Western Reserve University, Cleveland, OH (United States); Rancati, Tiziana, E-mail: tiziana.rancati@istitutotumori.mi.it [Prostate Program, Scientific Directorate, Fondazione IRCCS-Istituto Nazionale Tumori, Milan (Italy); Yu Changhong [Department of Quantitative Health Sciences, Cleveland Clinic Lerner College of Medicine of Case Western Reserve University, Cleveland, OH (United States); Vavassori, Vittorio [Radiotherapy and Medical Physics, Ospedale di Circolo, Varese (Italy); Department of Radiotherapy, Humanitas - Gavazzeni, Bergamo (Italy); Fellin, Giovanni [Radiotherapy and Medical Physics, Ospedale Santa Chiara, Trento (Italy); Cagna, Elena [Department of Radiotherapy and Medical Physics, Ospedale Sant'Anna, Como (Italy); Gabriele, Pietro [Department of Radiotherapy and Medical Physics, Institute for Cancer Research and Treatment, Candiolo (Italy); Mauro, Flora Anna; Baccolini, Micaela [Department of Radiotherapy and Medical Physics, Ospedale Villa Maria Cecilia, Lugo (Italy); Bianchi, Carla [Radiotherapy and Medical Physics, Ospedale di Circolo, Varese (Italy); Menegotti, Loris [Radiotherapy and Medical Physics, Ospedale Santa Chiara, Trento (Italy); Monti, Angelo F. [Department of Radiotherapy and Medical Physics, Ospedale Sant'Anna, Como (Italy); Stasi, Michele [Department of Radiotherapy and Medical Physics, Institute for Cancer Research and Treatment, Candiolo (Italy); Giganti, Maria Olga [Prostate Program, Scientific Directorate, Fondazione IRCCS-Istituto Nazionale Tumori, Milan (Italy); Dept. of Oncology, Ospedale Niguarda, Milan (Italy); and others

2012-04-01T23:59:59.000Z

417

Stereotactic Body Radiotherapy for Patients With Unresectable Primary Hepatocellular Carcinoma: Dose-Volumetric Parameters Predicting the Hepatic Complication  

SciTech Connect (OSTI)

Purpose: To identify the parameters that predict hepatic toxicity and deterioration of hepatic function. Materials and Methods: A total of 47 patients with small unresectable primary hepatocellular carcinoma received hypofractionated stereotactic body radiotherapy (SBRT) using the CyberKnife. Of those, 36 patients received no other local treatments that could influence hepatic toxicity at least for 3 months after the completion of SBRT. The gross tumor volume (GTV) was 18.3 {+-} 15.9 cm{sup 3} (range, 3.0-81.3 cm{sup 3}), and the total dose administered was 30-39 Gy (median, 36 Gy). To assess the deterioration of hepatic function, we evaluated the presence or absence of the progression of Child-Pugh class (CP class). To identify the parameters of predicting the radiation-induced hepatic toxicity and deterioration of the hepatic function, several clinical and dose-volumetric parameters were evaluated. Results: Of 36 patients, 12 (33%) developed Grade 2 or higher hepatic toxicity and 4 (11%) developed progression of CP class. The multivariate analysis showed that the only significant parameter associated with the progression of CP class was the total liver volume receiving a dose less than 18 Gy (<18 Gy). Conclusions: The progression of CP class after SBRT limits other additional local treatments and also reflects the deterioration of hepatic function. Therefore, it would be important to note that the presence or absence of the progression of CP class is a dose-limiting factor. The total liver volume receiving <18 Gy should be greater than 800 cm{sup 3} to reduce the risk of the deterioration of hepatic function.

Son, Seok Hyun; Choi, Byung Ock; Ryu, Mi Ryeong; Kang, Young Nam; Jang, Ji Sun [Department of Radiation Oncology, College of Medicine, the Catholic University of Korea, Seoul (Korea, Republic of); Bae, Si Hyun; Yoon, Seung Kew [Department of Internal Medicine, College of Medicine, the Catholic University of Korea, Seoul (Korea, Republic of); Choi, Ihl Bohng [Cyberknife Center of Gimpo Wooridul Spine Hospital, Seoul (Korea, Republic of); Kang, Ki Mun [Department of Radiation Oncology, College of Medicine, Gyeongsang National University, Jinju (Korea, Republic of); Jang, Hong Seok, E-mail: hsjang11@catholic.ac.k [Department of Radiation Oncology, College of Medicine, the Catholic University of Korea, Seoul (Korea, Republic of)

2010-11-15T23:59:59.000Z

418

Dosimetric and Late Radiation Toxicity Comparison Between Iodine-125 Brachytherapy and Stereotactic Radiation Therapy for Juxtapapillary Choroidal Melanoma  

SciTech Connect (OSTI)

Purpose: To compare the dose distributions and late radiation toxicities for {sup 125}I brachytherapy (IBT) and stereotactic radiation therapy (SRT) in the treatment of juxtapapillary choroidal melanoma. Methods: Ninety-four consecutive patients with juxtapapillary melanoma were reviewed: 30 have been treated with IBT and 64 with SRT. Iodine-125 brachytherapy cases were modeled with plaque simulator software for dosimetric analysis. The SRT dosimetric data were obtained from the Radionics XKnife RT3 software. Mean doses at predetermined intraocular points were calculated. Kaplan-Meier estimates determined the actuarial rates of late toxicities, and the logrank test compared the estimates. Results: The median follow-up was 46 months in both cohorts. The 2 cohorts were balanced with respect to pretreatment clinical and tumor characteristics. Comparisons of radiation toxicity rates between the IBT and SRT cohorts yielded actuarial rates at 50 months for cataracts of 62% and 75% (P=.1), for neovascular glaucoma 8% and 47% (P=.002), for radiation retinopathy 59% and 89% (P=.0001), and for radiation papillopathy 39% and 74% (P=.003), respectively. Dosimetric comparisons between the IBT and SRT cohorts yielded mean doses of 12.8 and 14.1 Gy (P=.56) for the lens center, 17.6 and 19.7 Gy (P=.44) for the lens posterior pole, 13.9 and 10.8 Gy (P=.30) for the ciliary body, 61.9 and 69.7 Gy (P=.03) for optic disc center, and 48.9 and 60.1 Gy (P<.0001) for retina at 5-mm distance from tumor margin, respectively. Conclusions: Late radiation-induced toxicities were greater with SRT, which is secondary to the high-dose exposure inherent to the technique as compared with IBT. When technically feasible, IBT is preferred to treat juxtapapillary choroidal melanoma.

Krema, Hatem, E-mail: htmkrm19@yahoo.com [Department of Ocular Oncology, Princess Margaret Hospital/University Health Network, University of Toronto, Toronto, Ontario (Canada)] [Department of Ocular Oncology, Princess Margaret Hospital/University Health Network, University of Toronto, Toronto, Ontario (Canada); Heydarian, Mostafa [Department of Radiation Medicine, Princess Margaret Hospital/University Health Network, University of Toronto, Toronto, Ontario (Canada)] [Department of Radiation Medicine, Princess Margaret Hospital/University Health Network, University of Toronto, Toronto, Ontario (Canada); Beiki-Ardakani, Akbar [Department of Radiation Oncology, Princess Margaret Hospital/University Health Network, University of Toronto, Toronto, Ontario (Canada)] [Department of Radiation Oncology, Princess Margaret Hospital/University Health Network, University of Toronto, Toronto, Ontario (Canada); Weisbrod, Daniel [Department of Ocular Oncology, Princess Margaret Hospital/University Health Network, University of Toronto, Toronto, Ontario (Canada)] [Department of Ocular Oncology, Princess Margaret Hospital/University Health Network, University of Toronto, Toronto, Ontario (Canada); Xu, Wei [Department of Biostatistics, Princess Margaret Hospital/University Health Network, University of Toronto, Toronto, Ontario (Canada)] [Department of Biostatistics, Princess Margaret Hospital/University Health Network, University of Toronto, Toronto, Ontario (Canada); Laperriere, Normand J.; Sahgal, Arjun [Department of Radiation Oncology, Princess Margaret Hospital/University Health Network, University of Toronto, Toronto, Ontario (Canada)] [Department of Radiation Oncology, Princess Margaret Hospital/University Health Network, University of Toronto, Toronto, Ontario (Canada)

2013-07-01T23:59:59.000Z

419

Radiation dose to the internal pudendal arteries from permanent-seed prostate brachytherapy as determined by time-of-flight MR angiography  

SciTech Connect (OSTI)

Purpose: To determine the feasibility of time-of-flight magnetic resonance (MR) angiography to visualize the internal pudendal arteries (IPAs) in potent men undergoing permanent-seed prostate brachytherapy and to calculate the radiation dose received by these arteries. Methods and Materials: Prostate brachytherapy is performed at the University Health Network/Princess Margaret Hospital by use of transrectal ultrasound (TRUS) preplanning and preloaded needles. All patients received {sup 125}I, with a mean seed activity of 0.32 mCi/seed (0.41 U). Postplan evaluation is performed at 1 month by magnetic resonance-computed tomography fusion. Twenty consecutive potent men had time-of-flight MR angiography as part of their postplan evaluation. Results: The mean V100 was 96.5%, and the mean D90 was171.5 Gy. The IPAs were easily visualized for 18 of the 20 men. The mean peak dose received by the IPA was 17 Gy. The highest peak dose received by any patient was 38.2 Gy, with only 1 other patient receiving a peak dose greater than 30 Gy. Eleven of 18 had a measurable portion of at least 1 IPA that received 10% of the prescribed dose (V10 = 14.5 Gy). Only 2 patients had nonzero values for V25. The distal third of the IPA received the highest dose for 16 of the 18 patients. Conclusions: The IPAs can be well visualized in the majority of potent men by use of time-of-flight MR angiography 1 month after brachytherapy. The IPAs receive a low but calculable dose from permanent-seed {sup 125}I brachytherapy. Further research is needed to determine if this outcome has any correlation with subsequent potency.

Gillan, Caitlin [Department of Radiation Medicine, University Health Network, Princess Margaret Hospital, Toronto (Canada); Kirilova, Anna [Department of Radiation Physics, University Health Network, Princess Margaret Hospital, Toronto (Canada); Landon, Angela [Department of Radiation Medicine, University Health Network, Princess Margaret Hospital, Toronto (Canada); Yeung, Ivan [Department of Radiation Physics, University Health Network, Princess Margaret Hospital, Toronto (Canada); Pond, Gregory [Department of Biostatistics, University Health Network, Princess Margaret Hospital, Toronto (Canada); Crook, Juanita [Department of Radiation Oncology, University Health Network, Princess Margaret Hospital, Toronto (Canada)]. E-mail: juanita.crook@rmp.uhn.on.ca

2006-07-01T23:59:59.000Z

420

Lack of Osteoradionecrosis of the Mandible After Intensity-Modulated Radiotherapy for Head and Neck Cancer: Likely Contributions of Both Dental Care and Improved Dose Distributions  

SciTech Connect (OSTI)

Purpose: To assess the prevalence and dosimetric and clinical predictors of mandibular osteoradionecrosis (ORN) in patients with head and neck cancer who underwent a pretherapy dental evaluation and prophylactic treatment according to a uniform policy and were treated with intensity-modulated radiotherapy (IMRT). Methods and Materials: Between 1996 and 2005, all patients with head-and-neck cancer treated with parotid gland-sparing IMRT in prospective studies underwent a dental examination and prophylactic treatment according to a uniform policy that included extractions of high-risk, periodontally involved, and nonrestorable teeth in parts of the mandible expected to receive high radiation doses, fluoride supplements, and the placement of guards aiming to reduce electron backscatter off metal teeth restorations. The IMRT plans included dose constraints for the maximal mandibular doses and reduced mean parotid gland and noninvolved oral cavity doses. A retrospective analysis of Grade 2 or worse (clinical) ORN was performed. Results: A total of 176 patients had a minimal follow-up of 6 months. Of these, 31 (17%) had undergone teeth extractions before RT and 13 (7%) after RT. Of the 176 patients, 75% and 50% had received {>=}65 Gy and {>=}70 Gy to {>=}1% of the mandibular volume, respectively. Falloff across the mandible characterized the dose distributions: the average gradient (in the axial plane containing the maximal mandibular dose) was 11 Gy (range, 1-27 Gy; median, 8 Gy). At a median follow-up of 34 months, no cases of ORN had developed (95% confidence interval, 0-2%). Conclusion: The use of a strict prophylactic dental care policy and IMRT resulted in no case of clinical ORN. In addition to the dosimetric advantages offered by IMRT, meticulous dental prophylactic care is likely an essential factor in reducing ORN risk.

Ben-David, Merav A. [Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Diamante, Maximiliano [Department of Oral and Maxillofacial Surgery/Hospital Dentistry, University of Michigan Medical School, Ann Arbor, MI (United States); Radawski, Jeffrey D. [Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Vineberg, Karen A. [Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Stroup, Cynthia [Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States); Murdoch-Kinch, Carol-Anne [Department of Oral and Maxillofacial Surgery/Hospital Dentistry, University of Michigan Medical School, Ann Arbor, MI (United States); Zwetchkenbaum, Samuel R. [Department of Oral and Maxillofacial Surgery/Hospital Dentistry, University of Michigan Medical School, Ann Arbor, MI (United States); Eisbruch, Avraham [Department of Radiation Oncology, University of Michigan Medical School, Ann Arbor, MI (United States)]. E-mail: eisbruch@med.umich.edu

2007-06-01T23:59:59.000Z

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Quantifying murine bone marrow and blood radiation dose response following 18F-FDG PET with DNA damage biomarkers  

Science Journals Connector (OSTI)

Abstract The purpose of this study was to quantify the poorly understood radiation doses to murine bone marrow and blood from whole-body fluorine 18 (18F)-fluorodeoxyglucose (FDG) positron emission tomography (PET), by using specific biomarkers and comparing with whole body external low dose exposures. Groups of 35 mice were randomly assigned to 10 groups, each receiving either a different activity of 18F-FDG: 037MBq or whole body irradiated with corresponding doses of 0300mGy X-rays. Blood samples were collected at 24h and at 43h for reticulocyte micronucleus assays and QPCR analysis of gene expression in peripheral blood leukocytes. Blood and bone marrow dose estimates were calculated from injected activities of 18F-FDG and were based on a recommended ICRP model. Doses to the bone marrow corresponding to 33.43mGy and above for internal 18F-FDG exposure and to 25mGy and above for external X-ray exposure, showed significant increases in radiation-induced MN-RET formation relative to controls (Pdoseresponses at 24h for Bbc3 and Cdkn1 were similar for 18F-FDG and X-ray exposures, with significant modifications occurring for doses over 300mGy for Bbc3 and at the lower dose of 150mGy for Cdkn1a. Both leucocyte gene expression and quantification of MN-RET are highly sensitive biomarkers for reliable estimation of the low doses delivered in vivo to, respectively, blood and bone marrow, following 18F-FDG PET.

Grainne Manning; Kristina Taylor; Paul Finnon; Jennifer A. Lemon; Douglas R. Boreham; Christophe Badie

2014-01-01T23:59:59.000Z

422

Impact of Gastric Filling on Radiation Dose Delivered to Gastroesophageal Junction Tumors  

SciTech Connect (OSTI)

Purpose: This study examined the impact of gastric filling variation on target coverage of gastroesophageal junction (GEJ) tumors in three-dimensional conformal radiation therapy (3DCRT), intensity-modulated radiation therapy (IMRT), or IMRT with simultaneous integrated boost (IMRT-SIB) plans. Materials and Methods: Eight patients previously receiving radiation therapy for esophageal cancer had computed tomography (CT) datasets acquired with full stomach (FS) and empty stomach (ES). We generated treatment plans for 3DCRT, IMRT, or IMRT-SIB for each patient on the ES-CT and on the FS-CT datasets. The 3DCRT and IMRT plans were planned to 50.4 Gy to the clinical target volume (CTV), and the same for IMRT-SIB plus 63.0 Gy to the gross tumor volume (GTV). Target coverage was evaluated using dose-volume histogram data for patient treatments simulated with ES-CT sets, assuming treatment on an FS for the entire course, and vice versa. Results: FS volumes were a mean of 3.3 (range, 1.7-7.5) times greater than ES volumes. The volume of the GTV receiving >=50.4 Gy (V{sub 50.4Gy}) was 100% in all situations. The planning GTV V{sub 63Gy} became suboptimal when gastric filling varied, regardless of whether simulation was done on the ES-CT or the FS-CT set. Conclusions: Stomach filling has a negligible impact on prescribed dose delivered to the GEJ GTV, using either 3DCRT or IMRT planning. Thus, local relapses are not likely to be related to variations in gastric filling. Dose escalation for GEJ tumors with IMRT-SIB may require gastric filling monitoring.

Bouchard, Myriam, E-mail: mybouchard@gmail.co [Department of Radiation Physics, University of Texas M. D. Anderson Cancer Center, Houston, TX (United States); McAleer, Mary Frances [Department of Radiation Oncology, University of Texas M. D. Anderson Cancer Center, Houston, TX (United States); Starkschall, George, E-mail: gstarksc@mdanderson.or [Department of Radiation Physics, University of Texas M. D. Anderson Cancer Center, Houston, TX (United States)

2010-05-01T23:59:59.000Z

423

High-Dose and Extended-Field Intensity Modulated Radiation Therapy for Early-Stage NK/T-Cell Lymphoma of Waldeyer's Ring: Dosimetric Analysis and Clinical Outcome  

SciTech Connect (OSTI)

Purpose: To assess the dosimetric benefit, treatment outcome, and toxicity of high-dose and extended-field intensity modulated radiation therapy (IMRT) in patients with early-stage NK/T-cell lymphoma of Waldeyer's ring (WR-NKTCL). Methods and Materials: Thirty patients with early-stage WR-NKTCL who received extended-field IMRT were retrospectively reviewed. The prescribed dose was 50 Gy to the primary involved regions and positive cervical lymph nodes (planning target volume requiring radical irradiation [PTV{sub 50}]) and 40 Gy to the negative cervical nodes (PTV{sub 40}). Dosimetric parameters for the target volume and critical normal structures were evaluated. Locoregional control (LRC), overall survival (OS), and progression-free survival (PFS) were calculated using the Kaplan-Meier method. Results: The median mean doses to the PTV{sub 50} and PTV{sub 40} were 53.2 Gy and 43.0 Gy, respectively. Only 1.4% of the PTV{sub 50} and 0.9% of the PTV{sub 40} received less than 95% of the prescribed dose, indicating excellent target coverage. The average mean doses to the left and right parotid glands were 27.7 and 28.4 Gy, respectively. The 2-year OS, PFS, and LRC rates were 71.2%, 57.4%, and 87.8%. Most acute toxicities were grade 1 to 2, except for grade ?3 dysphagia and mucositis. The most common late toxicity was grade 1-2 xerostomia, and no patient developed any ?grade 3 late toxicities. A correlation between the mean dose to the parotid glands and the degree of late xerostomia was observed. Conclusions: IMRT achieves excellent target coverage and dose conformity, as well as favorable survival and locoregional control rates with acceptable toxicities in patients with WR-NKTCL.

Bi, Xi-Wen; Li, Ye-Xiong, E-mail: yexiong@yahoo.com; Fang, Hui; Jin, Jing; Wang, Wei-Hu; Wang, Shu-Lian; Liu, Yue-Ping; Song, Yong-Wen; Ren, Hua; Dai, Jian-Rong

2013-12-01T23:59:59.000Z

424

Impact of ?-irradiation on antioxidant capacity of mango (Mangifera indica L.) wine from eight Indian cultivars and the protection of mango wine against DNA damage caused by irradiation  

Science Journals Connector (OSTI)

Abstract The present study aims to evaluate the effect of gamma-irradiation on the total phenolic content (TPC), total flavonoid content (TFC), antioxidant and radioprotective properties of the mango wine. ?-Irradiation resulted in an increase in TPC and TFC in a dose dependent manner and their concentrations were in the range of 226.8555.3mg/L and 68.6165.1mg/L, respectively, in 3kGy irradiated wine samples. There was a significant increase in the concentration of certain polyphenolic compounds with the exception of ellagic acid, which was unaltered and a significant decrease in the ferulic and synapic acids as measured by HPLC. Treatment with ?-irradiation resulted in overall reduction in microbial loads; further, no microbe was detected with a dose of 3kGy in all wine samples, indicating improvement in the quality of mango wine. The DPPH radical scavenging activity of mango wine varied from 97.14 (Sindhura) to 83.64% (Mulgoa) and the DMPD scavenging capacity varied from 95.27 (Banginapalli) to 77.8% (Mulgoa) at 100?L and 3kGy dose. However, the FRAP activity of mango wine varied from 33.96 (Sindhura) to 27.38mM/L (Mulgoa), and the NO scavenging capacity from 88.2 (Banginapalli) to 74.44% (Mulgoa) at 500?L and 3kGy dose. These scavenging activities were significantly increased with the irradiation dose and also with concentration. Mango wine was also demonstrated to protect DNA against UV+H2O2 and ?-irradiation (500Gy) induced DNA damage, confirming its protective actions in vitro and thus could be a valuable source of antioxidants.

Naresh Kondapalli; Varakumar Sadineni; Prasad Shekhar Variyar; Arun Sharma; Vijaya Sarathi Reddy Obulam

2014-01-01T23:59:59.000Z

425

Phase II Trial of Hypofractionated IMRT With Temozolomide for Patients With Newly Diagnosed Glioblastoma Multiforme  

SciTech Connect (OSTI)

Purpose: To report toxicity and overall survival (OS) in patients with newly diagnosed glioblastoma multiforme (GBM) treated with hypofractionated intensity-modulated radiotherapy (hypo-IMRT) with concurrent and adjuvant temozolomide (TMZ). Methods and Materials: Patients with newly diagnosed GBM after biopsy or resection and with adequate performance status and organ or bone marrow function were eligible for this study. Patients received postoperative hypo-IMRT to the surgical cavity and residual tumor seen on T1-weighted brain MRI with a 5-mm margin to a total dose of 60 Gy in 10 fractions (6 Gy/fraction) and to the T2 abnormality on T2-weighted MRI with 5-mm margin to 30 Gy in 10 fractions (3 Gy/fraction). Concurrent TMZ was given at 75 mg/m{sup 2}/day for 28 consecutive days. Adjuvant TMZ was given at 150 to 200 mg/m{sup 2}/day for 5 days every 28 days. Toxicities were defined using Common Terminology Criteria for Adverse Events version 3.0. Results: Twenty-four patients were treated, consisting of 14 men, 10 women; a median age of 60.5 years old (range, 27-77 years); and a median Karnofsky performance score of 80 (range, 60-90). All patients received hypo-IMRT and concurrent TMZ according to protocol, except for 2 patients who received only 14 days of concurrent TMZ. The median number of adjuvant TMZ cycles was 6.5 (range, 0-14).With a median follow-up of 14.8 months (range, 2.7-34.2 months) for all patients and a minimum follow-up of 20.6 months for living patients, no instances of grade 3 or higher nonhematologic toxicity were observed. The median OS was 16.6 months (range, 4.1-35.9 months). Six patients underwent repeated surgery for suspected tumor recurrence; necrosis was found in 50% to 100% of the resected specimens. Conclusion: In selected GBM patients, 60 Gy hypo-IMRT delivered in 6-Gy fractions over 2 weeks with concurrent and adjuvant TMZ is safe. OS in this small cohort of patients was comparable to that treated with current standard of care therapy.

Reddy, Krishna [Department of Radiation Oncology, University of Colorado School of Medicine, Aurora, Colorado (United States)] [Department of Radiation Oncology, University of Colorado School of Medicine, Aurora, Colorado (United States); Damek, Denise [Department of Neurology, University of Colorado School of Medicine, Aurora, Colorado (United States)] [Department of Neurology, University of Colorado School of Medicine, Aurora, Colorado (United States); Gaspar, Laurie E. [Department of Radiation Oncology, University of Colorado School of Medicine, Aurora, Colorado (United States)] [Department of Radiation Oncology, University of Colorado School of Medicine, Aurora, Colorado (United States); Ney, Douglas [Department of Neurology, University of Colorado School of Medicine, Aurora, Colorado (United States)] [Department of Neurology, University of Colorado School of Medicine, Aurora, Colorado (United States); Waziri, Allen; Lillehei, Kevin [Department of Neurosurgery, University of Colorado School of Medicine, Aurora, Colorado (United States)] [Department of Neurosurgery, University of Colorado School of Medicine, Aurora, Colorado (United States); Stuhr, Kelly; Kavanagh, Brian D. [Department of Radiation Oncology, University of Colorado School of Medicine, Aurora, Colorado (United States)] [Department of Radiation Oncology, University of Colorado School of Medicine, Aurora, Colorado (United States); Chen Changhu, E-mail: changhu.chen@ucdenver.edu [Department of Radiation Oncology, University of Colorado School of Medicine, Aurora, Colorado (United States)

2012-11-01T23:59:59.000Z

426

Dose-Volume Relationships for Acute Bowel Toxicity in Patients Treated With Pelvic Nodal Irradiation for Prostate Cancer  

SciTech Connect (OSTI)

Purpose: To find correlation between dose-volume histograms (DVHs) of the intestinal cavity (IC) and moderate-severe acute bowel toxicity in men with prostate cancer treated with pelvic nodal irradiation. Methods and Materials: The study group consisted of 191 patients with localized prostate cancer who underwent whole-pelvis radiotherapy with radical or adjuvant/salvage intent during January 2004 to November 2007. Complete planning/clinical data were available in 175 of these men, 91 of whom were treated with a conventional four-field technique (50.4 Gy, 1.8 Gy/fraction) and 84 of whom were treated with IMRT using conventional Linac (n = 26, 50.4 Gy, 1.8 Gy/fraction) or Helical TomoTherapy (n = 58, 50-54 Gy, 1.8-2 Gy/fraction). The IC outside the planning target volume (PTV) was contoured and the DVH for the first 6 weeks of treatment was recovered in all patients. The correlation between a number of clinical and DVH (V10-V55) variables and toxicity was investigated in univariate and multivariate analyses. The correlation between DVHs for the IC outside the PTV and DVHs for the whole IC was also assessed. Results: Twenty-two patients experienced toxicity (3/22 in the IMRT/tomotherapy group). Univariate analyses showed a significant correlation between V20-V50 and toxicity (p = 0.0002-0.001), with a higher predictive value observed for V40-V50. Previous prostatectomy (p = 0.066) and abdominal/pelvic surgery (p = 0.12) also correlated with toxicity. Multivariate analysis that included V45, abdominal/pelvic surgery, and prostatectomy showed that the most predictive parameters were V45 (p = 0.002) and abdominal/pelvic surgery (p = 0.05, HR = 2.4) Conclusions: Our avoidance IMRT approach drastically reduces the incidence of acute bowel toxicity. V40-V50 of IC and, secondarily, previous abdominal/pelvic surgery were the main predictors of acute bowel toxicity.

Fiorino, Claudio [Department of Medical Physics, San Raffaele Scientific Institute, Milan (Italy)], E-mail: fiorino.claudio@hsr.it; Alongi, Filippo [Department of Radiotherapy, San Raffaele Scientific Institute, Milan (Italy); Istituto di Bioimaging e Fisiologia Molecolare-Consiglio Nazionale delle Ricerche, Unita Operativa Supporto, Cefalu (Italy); Perna, Lucia; Broggi, Sara; Cattaneo, Giovanni Mauro [Department of Medical Physics, San Raffaele Scientific Institute, Milan (Italy); Cozzarini, Cesare; Di Muzio, Nadia; Fazio, Ferruccio [Department of Radiotherapy, San Raffaele Scientific Institute, Milan (Italy); Calandrino, Riccardo [Department of Medical Physics, San Raffaele Scientific Institute, Milan (Italy)

2009-09-01T23:59:59.000Z

427

A Dose-Volume Analysis of Radiation Pneumonitis in Non-Small Cell Lung Cancer Patients Treated With Stereotactic Body Radiation Therapy  

SciTech Connect (OSTI)

Purpose: To examine the rates and risk factors of radiation pneumonitis (RP) in non-small cell lung cancer (NSCLC) patients treated with stereotactic body radiotherapy (SBRT). Methods and Materials: Dosimetry records for 251 patients with lymph node-negative Stage I-IIB NSCLC and no prior chest radiation therapy (RT) treated with SBRT were reviewed. Patients were coded on the basis of the presence of at least Grade (G) 2 RP using the Common Toxicity Criteria version 2 criteria. Radiation doses, V5, V10, V20, and mean lung dose (MLD) data points were extracted from the dose-volume histogram (DVH). Results: Median PTV volume was 48 cc. Median prescribed radiation dose was 60 Gy delivered in three fractions to the 80% isodose line. Median age at treatment was 74 years. Median follow-up was 17 months. RP was reported after treatment of 42 lesions: G1 in 19 (8%), G2 in 17 (7%), G3 in 5 (2%), and G4 in 1 (0.4%). Total lung DVHs were available for 143 patients. For evaluable patients, median MLD, V5, V10, and V20 were 4.1 Gy, 20%, 12%, and 4%, respectively. Median MLDs were 4 Gy and 5 Gy for G0-1 and G2-4 groups, respectively (p = 0.14); median V5 was 20% for G0-1 and 24% for G2-4 (p = 0.70); median V10 was 12% in G0-1 and 16% in G2-4 (p = 0.08), and median V20 was 4% in G0-1 and 6.6% in G2-4 (p = 0.05). G2-4 RP was noted in 4.3% of patients with MLD {<=}4 Gy compared with 17.6% of patients with MLD >4 Gy (p = 0.02), and in 4.3% of patients with V20 {<=}4% compared with 16.4% of patients with V20 >4% (p = 0.03). Conclusion: Overall rate of G2-4 RP in our population treated with SBRT was 9.4%. Development of symptomatic RP in this series correlated with MLD and V20.

Barriger, R. Bryan [Department of Radiation Oncology, Indiana University School of Medicine, Indianapolis, IN (United States); Forquer, Jeffrey A. [Toledo Radiation Oncology Inc., Toledo, OH (United States); Department of Radiation Oncology, University of Toledo, Toledo, OH (United States); Brabham, Jeffrey G. [Florida Hospital Cancer Institute Waterman, Tavares, Florida (United States); Andolino, David L.; Shapiro, Ronald H.; Henderson, Mark A.; Johnstone, Peter A.S. [Department of Radiation Oncology, Indiana University School of Medicine, Indianapolis, IN (United States); Fakiris, Achilles J., E-mail: afakiris@iupui.edu [Department of Radiation Oncology, Indiana University School of Medicine, Indianapolis, IN (United States)

2012-01-01T23:59:59.000Z

428

Five Year Outcome of 145 Patients With Ductal Carcinoma In Situ (DCIS) After Accelerated Breast Radiotherapy  

SciTech Connect (OSTI)

Background: Accelerated whole-breast radiotherapy (RT) with tumor bed boost in the treatment of early invasive breast cancer has demonstrated equivalent local control and cosmesis when compared with standard RT. Its efficacy in the treatment of ductal carcinoma in situ (DCIS) remains unknown. Methods and Materials: Patients treated for DCIS with lumpectomy and negative margins were eligible for 2 consecutive hypofractionated whole-breast RT clinical trials. The first trial (New York University [NYU] 01-51) prescribed to the whole breast 42 Gy (2.8 Gy in 15 fractions) and the second trial (NYU 05-181) 40.5 Gy (2.7 Gy in 15 fractions) with an additional daily boost of 0.5 Gy to the surgical cavity. Results: Between 2002 and 2009, 145 DCIS patients accrued, 59 to the first protocol and 86 to the second trial. Median age was 56 years and 65% were postmenopausal at the time of treatment. Based on optimal sparing of normal tissue, 79% of the patients were planned and treated prone and 21% supine. At 5 years' median follow-up (60 months; range 2.6-105.5 months), 6 patients (4.1%) experienced an ipsilateral breast recurrence in all cases of DCIS histology. In 3/6 patients, recurrence occurred at the original site of DCIS and in the remaining 3 cases outside the original tumor bed. New contralateral breast cancers arose in 3 cases (1 DCIS and 2 invasive carcinomas). Cosmetic self-assessment at least 2 years after treatment is available in 125 patients: 91% reported good-to-excellent and 9% reported fair-to-poor outcomes. Conclusions: With a median follow-up of 5 years, the ipsilateral local recurrence rate is 4.1%, comparable to that reported from the NSABP (National Surgical Adjuvant Breast and Bowel Project) trials that employed 50 Gy in 25 fractions of radiotherapy for DCIS. There were no invasive recurrences. These results provide preliminary evidence that accelerated hypofractionated external beam radiotherapy is a viable option for DCIS.

Ciervide, Raquel [Department of Radiation Oncology, New York University School of Medicine, NYU Langone Medical Center, New York, New York (United States); Dhage, Shubhada; Guth, Amber; Shapiro, Richard L.; Axelrod, Deborah M.; Roses, Daniel F. [Department of Surgery, New York University School of Medicine, NYU Langone Medical Center, New York, New York (United States); Formenti, Silvia C., E-mail: silvia.formenti@nyumc.org [Department of Radiation Oncology, New York University School of Medicine, NYU Langone Medical Center, New York, New York (United States)

2012-06-01T23:59:59.000Z

429

Early-Stage Breast Cancer Treated With 3-Week Accelerated Whole-Breast Radiation Therapy and Concomitant Boost  

SciTech Connect (OSTI)

Purpose: To report early outcomes of accelerated whole-breast radiation therapy with concomitant boost. Methods and Materials: This is a prospective, institutional review board-approved study. Eligibility included stage TisN0, T1N0, and T2N0 breast cancer. Patients receiving adjuvant chemotherapy were ineligible. The whole breast received 40.5 Gy in 2.7-Gy fractions with a concomitant lumpectomy boost of 4.5 Gy in 0.3-Gy fractions. Total dose to the lumpectomy site was 45 Gy in 15 fractions over 19 days. Results: Between October 2004 and December 2010, 160 patients were treated; stage distribution was as follows: TisN0, n=63; T1N0, n=88; and T2N0, n=9. With a median follow-up of 3.5 years (range, 1.5-7.8 years) the 5-year overall survival and disease-free survival rates were 90% (95% confidence interval [CI] 0.84-0.94) and 97% (95% CI 0.93-0.99), respectively. Five-year local relapse-free survival was 99% (95% CI 0.96-0.99). Acute National Cancer Institute/Common Toxicity Criteria grade 1 and 2 skin toxicity was observed in 70% and 5%, respectively. Among the patients with ?2-year follow-up no toxicity higher than grade 2 on the Late Effects in Normal TissuesSubjective, Objective, Management, and Analytic scale was observed. Review of the radiation therapy dosevolume histogram noted that ?95% of the prescribed dose encompassed the lumpectomy target volume in >95% of plans. The median dose received by the heart D{sub 05} was 215 cGy, and median lung V{sub 20} was 7.6%. Conclusions: The prescribed accelerated schedule of whole-breast radiation therapy with concomitant boost can be administered, achieving acceptable dose distribution. With follow-up to date, the results are encouraging and suggest minimal side effects and excellent local control.

Chadha, Manjeet, E-mail: MChadha@chpnet.org [Department of Radiation Oncology, Beth Israel Medical Center, New York, New York (United States)] [Department of Radiation Oncology, Beth Israel Medical Center, New York, New York (United States); Woode, Rudolph; Sillanpaa, Jussi [Department of Radiation Oncology, Beth Israel Medical Center, New York, New York (United States)] [Department of Radiation Oncology, Beth Israel Medical Center, New York, New York (United States); Lucido, David [Department of Biostatistics, Beth Israel Medical Center, New York, New York (United States)] [Department of Biostatistics, Beth Israel Medical Center, New York, New York (United States); Boolbol, Susan K.; Kirstein, Laurie; Osborne, Michael P.; Feldman, Sheldon [Division of Breast Surgery, Beth Israel Medical Center, New York, New York (United States)] [Division of Breast Surgery, Beth Israel Medical Center, New York, New York (United States); Harrison, Louis B. [Department of Radiation Oncology, Beth Israel Medical Center, New York, New York (United States)] [Department of Radiation Oncology, Beth Israel Medical Center, New York, New York (United States)

2013-05-01T23:59:59.000Z

430

Prospective study evaluating the use of IV contrast on IMRT treatment planning for lung cancer  

SciTech Connect (OSTI)

Purpose: To investigate the impact of exclusively using intravenous (IV) contrast x-ray computed tomography (CT) scans on lung cancer intensity-modulated radiation therapy (IMRT) treatment planning. Methods: Eight patients with lung cancer (one small cell, seven nonsmall cell) scheduled to receive IMRT consented to acquisition of simulation CT scans with and without IV contrast. Clinical treatment plans optimized on the noncontrast scans were recomputed on contrast scans and dose coverage was compared, along with the ? passing rates. Results: IV contrast enhanced scans provided better target and critical structure conspicuity than the noncontrast scans. Using noncontrast scan as a reference, the median absolute/relative differences in mean, maximum, and minimum doses to the planning target volume (PTV) were ?4.5 cGy/?0.09%, 41.1 cGy/0.62%, and ?19.7 cGy/?0.50%, respectively. Regarding organs-at-risk (OARs), the median absolute/relative differences of maximum dose to heart was ?13.3 cGy/?0.32%, to esophagus was ?63.4 cGy/?0.89%, and to spinal cord was ?16.3 cGy/?0.46%. The median heart region of interest CT Hounsfield Unit (HU) number difference between noncontrast and contrast scans was 136.4 HU (range, 94.2161.8 HU). Subjectively, the regions with absolute dose differences greater than 3% of the prescription dose were small and typically located at the patient periphery and/or at the beam edges. The median ? passing rate was 0.9981 (range, 0.96540.9999) using 3% absolute dose difference/3 mm distance-to-agreement criteria. Overall, all evaluated cases were found to be clinically equivalent. Conclusions: PTV and OARs dose differences between noncontrast and contrast scans appear to be minimal for lung cancer patients undergoing IMRT. Using IV contrast scans as the primary simulation dataset could increase treatment planning efficiency and accuracy by avoiding unnecessary scans, manually region overriding, and planning errors caused by nonperfect image registrations.

Li, Hua, E-mail: huli@radonc.wustl.edu; Bottani, Beth; DeWees, Todd; Michalski, Jeff M.; Mutic, Sasa; Bradley, Jeffrey D.; Robinson, Clifford G. [Department of Radiation Oncology, Washington University School of Medicine, Saint Louis, Missouri 63110 (United States)] [Department of Radiation Oncology, Washington University School of Medicine, Saint Louis, Missouri 63110 (United States); Low, Daniel A. [Department of Radiation Oncology, University of California Los Angeles, Los Angeles, California 90095 (United States)] [Department of Radiation Oncology, University of California Los Angeles, Los Angeles, California 90095 (United States)

2014-03-15T23:59:59.000Z

431

NTCP Modeling of Subacute/Late Laryngeal Edema Scored by Fiberoptic Examination  

SciTech Connect (OSTI)

Purpose: Finding best-fit parameters of normal tissue complication probability (NTCP) models for laryngeal edema after radiotherapy for head and neck cancer. Methods and Materials: Forty-eight patients were considered for this study who met the following criteria: (1) grossly uninvolved larynx, (2) no prior major surgery except for neck dissection and tonsillectomy, (3) at least one fiberoptic examination of the larynx within 2 years from radiotherapy, (4) minimum follow-up of 15 months. Larynx dose-volume histograms (DVHs) were corrected into a linear quadratic equivalent one at 2 Gy/fr with alpha/beta = 3 Gy. Subacute/late edema was prospectively scored at each follow-up examination according to the Radiation Therapy Oncology Group scale. G2-G3 edema within 15 months from RT was considered as our endpoint. Two NTCP models were considered: (1) the Lyman model with DVH reduced to the equivalent uniform dose (EUD; LEUD) and (2) the Logit model with DVH reduced to the EUD (LOGEUD). The parameters for the models were fit to patient data using a maximum likelihood analysis. Results: All patients had a minimum of 15 months follow-up (only 8/48 received concurrent chemotherapy): 25/48 (52.1%) experienced G2-G3 edema. Both NTCP models fit well the clinical data: with LOGEUD the relationship between EUD and NTCP can be described with TD50 = 46.7 +- 2.1 Gy, n = 1.41 +- 0.8 and a steepness parameter k = 7.2 +- 2.5 Gy. Best fit parameters for LEUD are n = 1.17 +- 0.6, m = 0.23 +- 0.07 and TD50 = 47.3 +- 2.1 Gy. Conclusions: A clear volume effect was found for edema, consistent with a parallel architecture of the larynx for this endpoint. On the basis of our findings, an EUD <30-35 Gy should drastically reduce the risk of G2-G3 edema.

Rancati, Tiziana [Prostate Program, Istituto Nazionale dei Tumori, Milano (Italy); Fiorino, Claudio, E-mail: fiorino.claudio@hsr.i [Medical Physics, San Raffaele Scientific Institute, Milano (Italy); Sanguineti, Giuseppe [Radiation Oncology, University of Texas Medical Branch, Galveston, TX (United States)

2009-11-01T23:59:59.000Z

432

Helical Tomotherapy Planning for Lung Cancer Based on Ventilation Magnetic Resonance Imaging  

SciTech Connect (OSTI)

To investigate the feasibility of lung ventilation-based treatment planning, computed tomography and hyperpolarized (HP) helium-3 (He-3) magnetic resonance imaging (MRI) ventilation images of 6 subjects were coregistered for intensity-modulated radiation therapy planning in Tomotherapy. Highly-functional lungs (HFL) and less-functional lungs (LFL) were contoured based on their ventilation image intensities, and a cylindrical planning-target-volume was simulated at locations adjacent to both HFL and LFL. Annals of an anatomy-based plan (Plan 1) and a ventilation-based plan (Plan 2) were generated. The following dosimetric parameters were determined and compared between the 2 plans: percentage of total/HFL volume receiving {>=}20 Gy, 15 Gy, 10 Gy, and 5 Gy (TLV{sub 20}, HFLV{sub 20}, TLV{sub 15}, HFLV{sub 15}, TLV{sub 10}, HFLV{sub 10}, TLV{sub 5}, HFLV{sub 5}), mean total/HFL dose (MTLD/HFLD), maximum doses to all organs at risk (OARs), and target dose conformality. Compared with Plan 1, Plan 2 reduced mean HFLD (mean reduction, 0.8 Gy), MTLD (mean reduction, 0.6 Gy), HFLV{sub 20} (mean reduction, 1.9%), TLV{sub 20} (mean reduction, 1.5%), TLV{sub 15} (mean reduction, 1.7%), and TLV{sub 10} (mean reduction, 2.1%). P-values of the above comparisons are less than 0.05 using the Wilcoxon signed rank test. For HFLV{sub 15}, HFLV{sub 10}, TLV{sub 5}, and HTLV{sub 5}, Plan 2 resulted in lower values than plan 1 but the differences are not significant (P-value range, 0.063-0.219). Plan 2 did not significantly change maximum doses to OARs (P-value range, 0.063-0.563) and target conformality (P = 1.000). HP He-3 MRI of patients with lung disease shows a highly heterogeneous ventilation capacity that can be utilized for functional treatment planning. Moderate but statistically significant improvements in sparing functional lungs were achieved using helical tomotherapy plans.

Cai Jing; McLawhorn, Robert [Department of Radiation Oncology, University of Virginia, Charlottesville, VA (United States); Altes, Tallisa A.; Lange, Eduard de [Department of Radiology, University of Virginia, Charlottesville, VA (United States); Read, Paul W.; Larner, James M.; Benedict, Stanley H. [Department of Radiation Oncology, University of Virginia, Charlottesville, VA (United States); Sheng Ke, E-mail: ks2mc@virginia.edu [Department of Radiation Oncology, University of Virginia, Charlottesville, VA (United States)

2011-01-01T23:59:59.000Z

433

Potential for Improved Intelligence Quotient Using Volumetric Modulated Arc Therapy Compared With Conventional 3-Dimensional Conformal Radiation for Whole-Ventricular Radiation in Children  

SciTech Connect (OSTI)

Purpose: To compare volumetric modulated arc therapy (VMAT) with 3-dimensional conformal radiation therapy (3D-CRT) in the treatment of localized intracranial germinoma. We modeled the effect of the dosimetric differences on intelligence quotient (IQ). Method and Materials: Ten children with intracranial germinomas were used for planning. The prescription doses were 23.4 Gy to the ventricles followed by 21.6 Gy to the tumor located in the pineal region. For each child, a 3D-CRT and full arc VMAT was generated. Coverage of the target was assessed by computing a conformity index and heterogeneity index. We also generated VMAT plans with explicit temporal lobe sparing and with smaller ventricular margin expansions. Mean dose to the temporal lobe was used to estimate IQ 5 years after completion of radiation, using a patient age of 10 years. Results: Compared with the 3D-CRT plan, VMAT improved conformality (conformity index 1.10 vs 1.85), with slightly higher heterogeneity (heterogeneity index 1.09 vs 1.06). The averaged mean doses for left and right temporal lobes were 31.3 and 31.7 Gy, respectively, for VMAT plans and 37.7 and 37.6 Gy for 3D-CRT plans. This difference in mean temporal lobe dose resulted in an estimated IQ difference of 3.1 points at 5 years after radiation therapy. When the temporal lobes were explicitly included in the VMAT optimization, the mean temporal lobe dose was reduced 5.6-5.7 Gy, resulting in an estimated IQ difference of an additional 3 points. Reducing the ventricular margin from 1.5 cm to 0.5 cm decreased mean temporal lobe dose 11.4-13.1 Gy, corresponding to an estimated increase in IQ of 7 points. Conclusion: For treatment of children with intracranial pure germinomas, VMAT compared with 3D-CRT provides increased conformality and reduces doses to normal tissue. This may result in improvements in IQ in these children.

Qi, X. Sharon, E-mail: xqi@mednet.ucla.edu [Department of Radiation Oncology, David Geffen School of Medicine at UCLA, Los Angeles, California (United States); Department of Radiation Oncology, University of Colorado Denver, Aurora, Colorado (United States); Stinauer, Michelle; Rogers, Brion [Department of Radiation Oncology, University of Colorado Denver, Aurora, Colorado (United States)] [Department of Radiation Oncology, University of Colorado Denver, Aurora, Colorado (United States); Madden, Jennifer R. [Department of Neuro-Oncology, The Children's Hospital, Aurora, Colorado (United States)] [Department of Neuro-Oncology, The Children's Hospital, Aurora, Colorado (United States); Wilkening, Greta N. [Department of Pediatrics, The Children's Hospital, Aurora, Colorado (United States)] [Department of Pediatrics, The Children's Hospital, Aurora, Colorado (United States); Liu, Arthur K. [Department of Radiation Oncology, University of Colorado Denver, Aurora, Colorado (United States)] [Department of Radiation Oncology, University of Colorado Denver, Aurora, Colorado (United States)

2012-12-01T23:59:59.000Z

434

In vivo dosimetry with radiochromic films in low-voltage intraoperative radiotherapy of the breast  

SciTech Connect (OSTI)

Purpose: EBT2 radiochromic films were studied and used for in vivo dosimetry in targeted intraoperative radiotherapy (TARGIT), a technique in which the Intrabeam system (Carl Zeiss, Oberkochen, Germany) is used to perform intraoperative partial breast irradiation with x-rays of 50 kV{sub p}. Methods: The energy of the radiation emitted by the Intrabeam with the different spherical applicators, under 1 and 2 cm of solid water, and under the tungsten impregnated rubber used for shielding of the heart in TARGIT of the breast, was characterized with measurements of half-value layer (HVL). The stability of response of EBT2 was verified inside this range of energies. EBT2 films were calibrated using the red and green channels of the absorption spectrum in the 0-20 Gy dose range delivered by the Intrabeam x-rays. The dependence of film response on temperature during irradiation was measured. For in vivo dosimetry, pieces of radiochromic films wrapped in sterile envelopes were inserted after breast conserving surgery and before TARGIT into the excision cavity, on the skin and on the shielded pectoralis fascia for treatments of the left breast. Results: HVLs of the Intrabeam in TARGIT of the breast correspond to effective energies of 20.7-36.3 keV. The response of EBT2 was constant inside this range of energies. We measured the dose to the target tissue and to organs at risk in 23 patients and obtained an average dose of 13.52 {+-} 1.21 Gy to the target tissue. Dose to the skin in close proximity to the applicator was 2.22 {+-} 0.97 Gy, 0.29 {+-} 0.17 Gy at 5-10 cm from the applicator, and 0.08 {+-} 0.07 Gy at more than 10 cm from the applicator. Dose to the pectoral muscle for left breast treatment was 0.57 {+-} 0.23 Gy. Conclusions: Our results show that EBT2 films are accurate at the beam energies, dose range, and irradiation temperature found in TARGIT and that in vivo dosimetry in TARGIT with EBT2 films wrapped in sterile envelopes is a feasible procedure. Measured dose to the organs at risk indicates that the technique is safe from side effects to the skin and the heart.

Avanzo, M.; Rink, A.; Dassie, A.; Massarut, S.; Roncadin, M.; Borsatti, E.; Capra, E. [Department of Medical Physics, Centro di Riferimento Oncologico, 33081 Aviano (Italy); Department of Radiation Physics, Princess Margaret Hospital, Ontario M5G 2M9 (Canada); Department of Medical Physics, Centro di Riferimento Oncologico, 33081 Aviano (Italy); Department of Surgery, Centro di Riferimento Oncologico, 33081 Aviano (Italy); Department of Radiation Oncology, Centro di Riferimento Oncologico, 33081 Aviano (Italy); Department of Nuclear Medicine, Centro di Riferimento Oncologico, 33081 Aviano (Italy); Department of Medical Physics, Centro di Riferimento Oncologico, 33081 Aviano (Italy)

2012-05-15T23:59:59.000Z

435

Microsoft PowerPoint - 06 Crawley Drive for Net Zero Energy Commercial Buildings  

Broader source: Energy.gov (indexed) [DOE]

PROGRAM PROGRAM The Drive for Net-Zero Energy Commercial Buildings Drury B. Crawley, Ph.D. U.S. Department of Energy Energy Efficiency and Renewable Energy Net-Zero Energy Commercial Building Initiative commercialbuildings.energy.gov 1 gy y gy Buildings' Energy Use Net-Zero Energy Commercial Building Initiative commercialbuildings.energy.gov 2 Commercial Square Footage Projections g j 104 Plus ~38B ft. 2 new additions 72 82 66 Minus ~16B ft. 2 demolitions 66 Net-Zero Energy Commercial Building Initiative commercialbuildings.energy.gov 3 Source: EIA's Annual Energy Outlook 2009, Table 5. 2010 2003 2030 Projected Electricity Growth 2010 to 2025, by End-Use Sector (site quad) Net-Zero Energy Commercial Building Initiative commercialbuildings.energy.gov 4 Projected Increase in

436

Low Dose Radiation Research Program: DNA Damage in Acutely Irradiated F2  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

DNA Damage in Acutely Irradiated F2 Mice with a History of Paternal DNA Damage in Acutely Irradiated F2 Mice with a History of Paternal F0 Germline Irradiation Authors: J.E. Baulch and O.G. Raabe Institutions: Center for Health and the Environment, University of California, Davis, CA. The main goal of this grant is to evaluate heritable, transgenerational effects of low dose, low-linear-energy-transfer (LET) radiation (0.1 Gy attenuated 137Cs gamma rays) on Type B spermatogonia in 129SVE mice; wild-type and heterozygous for Ataxia-telangiectasia (AT). The ATM heterozygotes are carriers for a genetic mutation (AT mutated, ATM) that is thought to predispose both humans and mice to radiation sensitivity. Experiments conducted in our laboratory have demonstrated heritable effects of paternal germline exposure to ionizing radiation in mice using 1.0 Gy of

437

NFkB in the Thiol-Induced Adaptive Response (A)  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

A) A) David Grdina The University of Chicago Abstract Exposure of cells to low non-lethal doses of ionizing radiation (≤ 10 cGy) or WR1065, the active free thiol form of amifostine, can induce pro-survival pathways that result in protection against the damaging effects of a 2 Gy dose of ionizing radiation. One such signaling pathway involves the activation of NFκB and the subsequent elevation of active manganese superoxide dismutase (SOD2). SOD2 is a mitochondrial matrix protein that serves as the primary mitochondrial defense against superoxide formation. Its primary function is to facilitate the dismutation of two molecules of superoxide anion (O2-) produced by normal respiratory processes or following exposure to ionizing radiation into water and hydrogen peroxide. To characterize the role of SOD2 in the radiation- and

438

Lighting Technology Panel  

Broader source: Energy.gov (indexed) [DOE]

Technology Panel Technology Panel Federal Utility Partnership Working Group N b 2009 November 1 1 8, 2009 Doug Avery Southern California Edison Southern California Edison National Energy Conservation M d t Mandates * There are Federal and State Mandates to reduce energy consumption - California Investor Owned Electric Utilities are ordered to save around 3 Billion kWh's each y year from 2007-2113 - Federal buildings ordered to reduce electrical Federal buildings ordered to reduce electrical energy consumption 35% by 2012 Energy Consump ption gy Lighting accounts for 42 7% of energy consumption Lighting accounts for 42.7% of energy consumption Data Courtesy of SDG&E Data Courtesy of SDG&E Energy Consump ption gy More than ¾ of the lighting load is non-residential. Data Courtesy of SDG&E

439

September 18, 2013, FTCP Face to Face Meeting Presentation - NTC Briefing  

Broader source: Energy.gov (indexed) [DOE]

September 18th, 2012 September 18th, 2012 Discussion Topics Discussion Topics NTC T h l * NTC Technology * Nuclear Safety Training Program y g g * Safeguards & Security Training Program Program NTC Technology gy * eLearning - SAF-200DE: Safety Conscious Work Environment Prerequisite - PHY-210DE: Facility Security Officer Orientation SAF 330DE: Accident Investigation Refresher - SAF-330DE: Accident Investigation Refresher * Distance Learning - SAF-720: Hazard Identification - SAF-725: Hazard Categorization ISC 202: Legal Aspects of Inquiries - ISC-202: Legal Aspects of Inquiries NTC Technology gy * Continuing Education - SAF-340DV NELT: Differing Professional Opinions and Employee Concerns - SAF-340DV NELT: Environmental Sustainability and Compliance - SAF-340DV NELT: Managing the Safety Basis - SAF-785DV: Technical Safety Requirements

440

Genetic profiling of lymphoblastoid cell lines sensitive to low dose  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

profiling of lymphoblastoid cell lines sensitive to low dose profiling of lymphoblastoid cell lines sensitive to low dose radiation David Rocke University of California Davis Abstract Previous study from our laboratory has identified pathways associated with low dose ionizing radiation (LDIR) in vivo that is consistent across individuals. Furthermore, gene expression patterns have revealed genetic variation between individuals, which may play a role in individual sensitivity to LDIR. The aim is to evaluate microRNA and mRNA expression patterns in lymphoblast cell lines that exhibit sensitivity to radiation. Human lymphoblastoid cell lines were screened for low dose radiation sensitivity by apoptosis, cellular proliferation, and colony forming assay. Cells were irradiated with 5cGy and 10cGy and analyzed at multiple time

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Microsoft PowerPoint - 2010_07_27_SECA_SD Vora F.pptx  

Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

gy gy g July 27, 2010 Dr. Shailesh D. Vora Technology Manager, Fuel Cells National Energy Technology Laboratory United States Department of Energy SECA Mission * Enable the generation of efficient, cost-effective l t i it f d ti l ith t h i electricity from domestic coal with near-zero atmospheric emissions of CO 2 and air pollutants (99% CO 2 capture) and minimal use of water in central power generation applications. * Provide the technology base to permit grid-independent distributed generation applications. g pp 60% Environmental: Low Cost, Fuel-Flexible: S NG ≥ 99% CO Modular Efficiency (Coal HHV) <0.5ppm NOx, low H 2 O use similar footprint to IGCC Syngas, NG, H 2 , Diesel, etc. ≥ 99% CO 2 Capture Modular Technology 2 SECA Program Structure Program Management Industry Input Project M t Research Topics Needs Management Core Industry

442

Microsoft PowerPoint - NEUP FY2011 R&D Review Processes For Web.pptx  

Broader source: Energy.gov (indexed) [DOE]

gy gy y g FY2011 Review Process FY2011 NEUP Review Process FY2011 NEUP Review Process RPA Proposals RPA 3 Pagers: Submission of three page RPA Proposals 3 page P R i RPA 3 Pagers: Submission of three page proposals by university respondents Relevancy Panels: Composed of two Federally selected reviewers representing technical areas Peer Review Panels: Composed of Federally Relevancy Panels Peer Review Panels Peer Review Panels: Composed of Federally selected University or Laboratory technical peers Recommendation Panels: Composed of Federal Directors and their selected advisors SSO Selection: Presentation of Recommendation Panels SSO Selection: Presentation of recommendations by NEUP to the SSO Invited: Proposals selected by the SSO to submit a full proposal N t I it d P l t l t d b th SSO SSO Selection

443

REPLY TO AmN OF: EM-421  

Office of Legacy Management (LM)

gy5.t3 CIy ( 1 IG-. 14-l gy5.t3 CIy ( 1 IG-. 14-l \ United States Government L/d &J~f,j-o p-1 memoratwJum h:3. I q Department of Energy DATE: fi\jfS 0 2 1990 REPLY TO AmN OF: EM-421 SUwECT: Addition of Sites to FUSRAP To' Lester K. Price, Director Technical Services Division Oak Ridge Operations Office Attached is a memorandum approving transfer of responsibility for the Niagara Falls Storage Site (NFSS) in New York and the New Brunswick Laboratory (NBL) Site in New Jersey to FUSRAP. Please incorporate these sites in the FUSRAP rebaselining effort now underway. As we previously discussed, fundinq for NBL will provide for continued surveillance and maintenance activities at the site and will be borne FUSRAP beginning in FY 1991. Funding for NFSS will be provided under

444

The Honorable Bill Johnson j.  

Office of Legacy Management (LM)

- Department of En&gy, - Department of En&gy, Washington, DC 20585 \APR 0 3 7995 The Honorable Bill Johnson j. 30 Church Street, Rochester, New-York 14614 / Dear MayorJohnson: 'I Secretary of Energy Hazel O'Leary has announced a'nei approach to openness in the Department of'Energy (DDE) and its communications with the public. In, support of this initiative, we are pleased to forward the enclosed info&tion related to the former University of. Rochester site in, your jurisdiction performed work for DOE or its predecessor agencies. Thins information is provided for your information, use, and retqntion. DDE's Formerly Utilized SitesRemedial Action Program.isI responsible for identification of sites used by DOE's predecessor agencies, determining current 'radiological condition.'and, where, it has authority, performing

445

Poly [1,1'-bis(ethynyl)-4,4'-biphenyl(bis-tributylphosphine)Pt(II)] solutions used as low dose ionizing radiation dosimeter  

SciTech Connect (OSTI)

In this work, the effect of gamma radiation on the optical properties of polymetallayne poly[1,1'-bis(ethynyl)-4,4'-biphenyl(bis-tributylphosphine)Pt(II)] (Pt-DEBP) in chloroform solution is studied. The samples were irradiated at room temperature with doses from 0.01 Gy to 1 Gy using a {sup 60}Co gamma ray source. A new band at 420 nm is observed in the emission spectra, in superposition to the emission maximum at 398 nm, linearly dependent on dose. We propose to use the ratio of the emission amplitude bands as the dosimetric parameter. This method proved to be robust, accurate, and can be used as a dosimeter in medical applications.

Bronze-Uhle, E. S.; Graeff, C. F. O. [Department of Physics, FC-UNESP, Av. Eng. Luiz Edmundo Carrijo Coube 14-01, 17033-360 Bauru (Brazil)] [Department of Physics, FC-UNESP, Av. Eng. Luiz Edmundo Carrijo Coube 14-01, 17033-360 Bauru (Brazil); Batagin-Neto, A.; Fernandes, D. M. [UNESP-Univ Estadual Paulista, POSMAT-Programa de Pos-Graduacao em Ciencia e Tecnologia de Materiais, Bauru, Sao Paulo (Brazil)] [UNESP-Univ Estadual Paulista, POSMAT-Programa de Pos-Graduacao em Ciencia e Tecnologia de Materiais, Bauru, Sao Paulo (Brazil); Fratoddi, I.; Russo, M. V. [Department of Chemistry, University of Rome 'Sapienza,' P.le A. Moro 5, 00185 Rome (Italy)] [Department of Chemistry, University of Rome 'Sapienza,' P.le A. Moro 5, 00185 Rome (Italy)

2013-06-17T23:59:59.000Z

446

Repair of gamma-ray-induced DNA base damage in xeroderma pigmentosum cells  

SciTech Connect (OSTI)

The repair of DNA damage produced by /sup 137/Cs gamma irradiation was measured with a preparation from Micrococcus luteus containing DNA damage-specific endonucleases in combination with alkaline elution. The frequency of these endonuclease sensitive sites (ESS) was determined after 54 or 110 Gy of oxic irradiation in normal and xeroderma pigmentosum (XP) fibroblasts from complementation groups A, C, D, and G. Repair was rapid in all cell strains with greater than 50% repair after 1.5 h of repair incubation. At later repair times, 12-17 h, more ESS remained in XP than in normal cells. The frequency of excess ESS in XP cells was approximately 0.04 per 10(9) Da of DNA per Gy which was equivalent to 10% of the initial ESS produced. The removal of ESS was comparable in XP cells with normal radiosensitivity and XP3BR cells which have been reported to be moderately radiosensitive.

Fornace, A.J. Jr.; Dobson, P.P.; Kinsella, T.J.

1986-04-01T23:59:59.000Z

447

Distribution of stresses in a tapered cantilever beam due to a concentrated load at the end  

E-Print Network [OSTI]

- To dctc5$1BS Oy 8$ 2~ 4858idsx' gigugo 14 {c, ) Oy 4P' = Oy Gy Care~n)4. y Fgy (Rc g?) P Zxy (Xg~~)ton OC (g) Other apprcndsmLte methods may be used for the datexminatim of the stresses at any points but they do not lend themselves as wQ1...- To dctc5$1BS Oy 8$ 2~ 4858idsx' gigugo 14 {c, ) Oy 4P' = Oy Gy Care~n)4. y Fgy (Rc g?) P Zxy (Xg~~)ton OC (g) Other apprcndsmLte methods may be used for the datexminatim of the stresses at any points but they do not lend themselves as wQ1...

Wilhoit, James Cammack

2012-06-07T23:59:59.000Z

448

Estimation of radiation doses from 137Cs to frogs in a wetland ecosystem  

Science Journals Connector (OSTI)

Currently, there is no established methodology to estimate radiation doses to non-human biota. Therefore, in this study, various dose models were used to estimate radiation doses to moor frogs (Rana arvalis) in a wetland ecosystem contaminated with 137Cs. External dose estimations were based on activity concentrations of 137Cs in soil and water, considering changes in habitat over a life-cycle. Internal doses were calculated from the activity concentrations of 137Cs measured in moor frogs. Depending on the dose model used, the results varied substantially. External dose rates ranged from 21 to 160 mGy/y, and internal dose rates varied between 1 and 14 mGy/y. Maximum total dose rates to frogs were below the expected safe level for terrestrial populations, but close to the suggested critical dose rate for amphibians. The results show that realistic assumptions in dose models are particularly important at high levels of contamination.

K. Stark; R. Avila; P. Wallberg

2004-01-01T23:59:59.000Z

449

Neutron insensitive depolymerization of polyacrylamide for californium-252 photon dosimetry  

SciTech Connect (OSTI)

A photon dosimeter based on degradation of polyacrylamide (PAA) in dilute aqueous solution has been found to be insensitive to neutrons from Cf-252, independent of photon energy from 34 keV/sub eff/ to 1.33 MeV, and useful over a dose range of 1 to 100 Gy. Because this dilute polymer solution is virtually 100% water, it is nearly tissue equivalent for photon absorption as well as neutron scatter and attenuation. Radiation response was determined by measuring decreases in viscosity three days after irradiation. The measured response is dose rate independent from 10 to over 300 Gy/h but increases rapidly at lower dose rates. Long-term, radiation-induced viscosity changes were also observed. The many advantages of this tissue equivalent system for photon/neutron dosimetry suggest the need for further studies of the observed over-response at low dose rates.

Moyers, M.F.; Beach, J.L.

1982-09-01T23:59:59.000Z

450

German contribution to the assessment of doses and health risks from nuclear catastrophes in the former Soviet Union  

SciTech Connect (OSTI)

Apart from the large scale contaminations from the reactor accident of Tschernobyl-4, the successor states of the Soviet Union are also exposed to considerable environmental contaminations from the nuclear weapon program. Particularly in the region between Cheliabinsk, and Ekatarinenburg in the South Ural, the beginning of the bomb production caused heavy occupational exposures of up to 1 Gy per year in the reprocessing of plutonium and discharges of significant activities of fissile material (10{sup 17} Bq (3 MCi)) into the Techa River and the lakes in the catchment basin. Communities situated downriver, which were supplied with drinking water from the Techa in the beginning of the 50s, received doses to the bone marrow of up to 3 Gy, due to {sup 90}S ingestion. Significantly increased risks are found for leukemia and solid tumors in the South Ural region whereas childhood thyroid carcinomas are reported around Chernobyl. The body burden for {sup 90}Sr and {sup 137}Cs was determined.

Burkart, W. [Federal Office of Radiation Protection, Munich (Germany). Inst. for Radiation Hygiene

1993-12-31T23:59:59.000Z

451

Gamma irradiation effects in W films  

SciTech Connect (OSTI)

Using the van Der Pauw methodology, the surface resistivity of irradiated tungsten films deposited on Silicon substrate was measured. The films were exposed to {gamma} radiation using a isotopic {sup 60}Co source in three irradiation stages attaining 40.35 kGy in total dose. The obtained results for superficial resistivity display a time annealing features and their values are proportional to the total dose.

Claro, Luiz H. [Instituto de Estudos Avancados - IEAv, Rod. dos Tamoios, km 5,5, CEP: 12228-840, Sao Jose dos Campos, SP (Brazil) and Faculdade de Tecnologia Sao Francisco - FATESF, Av. Siqueira Campos, 1174, CEP: 12207-000, Jacarei (Brazil); Santos, Ingrid A. [Instituto de Estudos Avancados - IEAv, Rod. dos Tamoios, km 5,5, CEP: 12228-840, Sao Jose dos Campos, SP (Brazil); Silva, Cassia F. [Faculdade de Tecnologia Sao Francisco - FATESF, Av. Siqueira Campos, 1174, CEP: 12207-000, Jacarei, SP (Brazil)

2013-05-06T23:59:59.000Z

452

Accuracy on eigenvalues for a Schrodinger operator with a degenerate potential in the semi-classical limit  

E-Print Network [OSTI]

We consider a semi-classical Schrodinger operator with a degenerate potential V(x,y) =f(x) g(y) . g is assumed to be a homogeneous positive function of m variables and f is a strictly positive function of n variables, with a strict minimum. We give sharp asymptotic behaviour of low eigenvalues bounded by some power of the parameter h, by improving Born-Oppenheimer approximation.

Abderemane Morame; Francoise Truc

2006-06-09T23:59:59.000Z

453

INTERNATIONAL PROSPECTUS 2012  

E-Print Network [OSTI]

and career. At CDU I am confident that we can help you achieve your ambitions. I look forward to welcomingDUCAtIon 25 tHe CentRe FoR ReneWABLe eneRGY AnD LoW eMIssIon teCHnoLoGY 26 tHe noRtHeRn InstItUte 26 tHe Rese

454

Feasibility of boron neutron capture therapy (BNCT) for malignant pleural mesothelioma from a viewpoint of dose distribution analysis  

SciTech Connect (OSTI)

Purpose: To investigate the feasibility of boron neutron capture therapy (BNCT) for malignant pleural mesothelioma (MPM) from a viewpoint of dose distribution analysis using Simulation Environment for Radiotherapy Applications (SERA), a currently available BNCT treatment planning system. Methods and Materials: The BNCT treatment plans were constructed for 3 patients with MPM using the SERA system, with 2 opposed anterior-posterior beams. The {sup 1}B concentrations in the tumor and normal lung in this study were assumed to be 84 and 24 ppm, respectively, and were derived from data observed in clinical trials. The maximum, mean, and minimum doses to the tumors and the normal lung were assessed for each plan. The doses delivered to 5% and 95% of the tumor volume, D{sub 05} and D{sub 95}, were adopted as the representative dose for the maximum and minimum dose, respectively. Results: When the D{sub 05} to the normal ipsilateral lung was 5 Gy-Eq, the D{sub 95} and mean doses delivered to the normal lung were 2.2-3.6 and 3.5-4.2 Gy-Eq, respectively. The mean doses delivered to the tumors were 22.4-27.2 Gy-Eq. The D{sub 05} and D{sub 95} doses to the tumors were 9.6-15.0 and 31.5-39.5 Gy-Eq, respectively. Conclusions: From a viewpoint of the dose-distribution analysis, BNCT has the possibility to be a promising treatment for MPM patients who are inoperable because of age and other medical illnesses.

Suzuki, Minoru [Particle Oncology Research Center, Osaka (Japan)]. E-mail: msuzuki@rri.kyoto-u.ac.jp; Sakurai, Yoshinori [Division of Medical Physics, Department of Radiation Life Science, Research Reactor Institute, Kyoto University, Osaka (Japan); Masunaga, Shinichiro [Particle Oncology Research Center, Osaka (Japan); Kinashi, Yuko [Particle Oncology Research Center, Osaka (Japan); Nagata, Kenji [Particle Oncology Research Center, Osaka (Japan); Maruhashi, Akira [Division of Medical Physics, Department of Radiation Life Science, Research Reactor Institute, Kyoto University, Osaka (Japan); Ono, Koji [Particle Oncology Research Center, Osaka (Japan)

2006-12-01T23:59:59.000Z

455

Treatment Planning Constraints to Avoid Xerostomia in Head-and-Neck Radiotherapy: An Independent Test of QUANTEC Criteria Using a Prospectively Collected Dataset  

SciTech Connect (OSTI)

Purpose: The severe reduction of salivary function (xerostomia) is a common complication after radiation therapy for head-and-neck cancer. Consequently, guidelines to ensure adequate function based on parotid gland tolerance dose-volume parameters have been suggested by the QUANTEC group and by Ortholan et al. We perform a validation test of these guidelines against a prospectively collected dataset and compared with a previously published dataset. Methods and Materials: Whole-mouth stimulated salivary flow data from 66 head-and-neck cancer patients treated with radiotherapy at the British Columbia Cancer Agency (BCCA) were measured, and treatment planning data were abstracted. Flow measurements were collected from 50 patients at 3 months, and 60 patients at 12-month follow-up. Previously published data from a second institution, Washington University in St. Louis (WUSTL), were used for comparison. A logistic model was used to describe the incidence of Grade 4 xerostomia as a function of the mean dose of the spared parotid gland. The rate of correctly predicting the lack of xerostomia (negative predictive value [NPV]) was computed for both the QUANTEC constraints and Ortholan et al. recommendation to constrain the total volume of both glands receiving more than 40 Gy to less than 33%. Results: Both datasets showed a rate of xerostomia of less than 20% when the mean dose to the least-irradiated parotid gland is kept to less than 20 Gy. Logistic model parameters for the incidence of xerostomia at 12 months after therapy, based on the least-irradiated gland, were D{sub 50} = 32.4 Gy and and {gamma} = 0.97. NPVs for QUANTEC guideline were 94% (BCCA data), and 90% (WUSTL data). For Ortholan et al. guideline NPVs were 85% (BCCA) and 86% (WUSTL). Conclusion: These data confirm that the QUANTEC guideline effectively avoids xerostomia, and this is somewhat more effective than constraints on the volume receiving more than 40 Gy.

Moiseenko, Vitali, E-mail: vmoiseenko@bccancer.bc.ca [Department of Medical Physics, Vancouver Cancer Centre, British Columbia Cancer Agency, Vancouver, BC (Canada); Wu, Jonn [Department of Radiation Oncology, Vancouver Cancer Centre, British Columbia Cancer Agency, Vancouver, BC (Canada); Hovan, Allan [Department of Oral Oncology, Vancouver Cancer Centre, British Columbia Cancer Agency, Vancouver, BC (Canada); Saleh, Ziad; Apte, Aditya; Deasy, Joseph O. [Department of Medical Physics, Memorial Sloan-Kettering Cancer Center, New York, NY (United States); Harrow, Stephen [Department of Radiation Oncology, Vancouver Cancer Centre, British Columbia Cancer Agency, Vancouver, BC (Canada); Rabuka, Carman; Muggli, Adam [Department of Oral Oncology, Vancouver Cancer Centre, British Columbia Cancer Agency, Vancouver, BC (Canada); Thompson, Anna [Department of Radiation Oncology, Vancouver Cancer Centre, British Columbia Cancer Agency, Vancouver, BC (Canada)

2012-03-01T23:59:59.000Z

456

Stereotactic Body Radiotherapy for Primary Hepatocellular Carcinoma  

SciTech Connect (OSTI)

Purpose: To evaluate the safety and efficacy of stereotactic body radiotherapy (SBRT) for the treatment of primary hepatocellular carcinoma (HCC). Methods and Materials: From 2005 to 2009, 60 patients with liver-confined HCC were treated with SBRT at the Indiana University Simon Cancer Center: 36 Child-Turcotte-Pugh (CTP) Class A and 24 CTP Class B. The median number of fractions, dose per fraction, and total dose, was 3, 14 Gy, and 44 Gy, respectively, for those with CTP Class A cirrhosis and 5, 8 Gy, and 40 Gy, respectively, for those with CTP Class B. Treatment was delivered via 6 to 12 beams and in nearly all cases was prescribed to the 80% isodose line. The records of all patients were reviewed, and treatment response was scored according to Response Evaluation Criteria in Solid Tumors v1.1. Toxicity was graded according to the Common Terminology Criteria for Adverse Events v4.0. Local control (LC), time to progression (TTP), progression-free survival (PFS), and overall survival (OS) were calculated according to the method of Kaplan and Meier. Results: The median follow-up time was 27 months, and the median tumor diameter was 3.2 cm. The 2-year LC, PFS, and OS were 90%, 48%, and 67%, respectively, with median TTP of 47.8 months. Subsequently, 23 patients underwent transplant, with a median time to transplant of 7 months. There were no {>=}Grade 3 nonhematologic toxicities. Thirteen percent of patients experienced an increase in hematologic/hepatic dysfunction greater than 1 grade, and 20% experienced progression in CTP class within 3 months of treatment. Conclusions: SBRT is a safe, effective, noninvasive option for patients with HCC {<=}6 cm. As such, SBRT should be considered when bridging to transplant or as definitive therapy for those ineligible for transplant.

Andolino, David L., E-mail: dandolin@iupui.edu [Department of Radiation Oncology, Indiana University School of Medicine, Indianapolis, IN (United States); Johnson, Cynthia S. [Department of Biostatistics, Indiana University School of Medicine, Indianapolis, IN (United States); Maluccio, Mary [Department of Surgery, Indiana University School of Medicine, Indianapolis, IN (United States); Kwo, Paul [Department of Medicine, Indiana University School of Medicine, Indianapolis, IN (United States); Tector, A. Joseph [Department of Surgery, Indiana University School of Medicine, Indianapolis, IN (United States); Zook, Jennifer; Johnstone, Peter A.S.; Cardenes, Higinia R. [Department of Radiation Oncology, Indiana University School of Medicine, Indianapolis, IN (United States)

2011-11-15T23:59:59.000Z

457

Patterns of Radiotherapy Practice for Pancreatic Cancer in Japan: Results of the Japanese Radiation Oncology Study Group (JROSG) Survey  

Science Journals Connector (OSTI)

Purpose To determine the patterns of radiotherapy practice for pancreatic cancer in Japan. Methods and Materials A questionnaire-based national survey of radiotherapy for pancreatic cancer treated between 2000 and 2006 was conducted by the Japanese Radiation Oncology Study Group (JROSG). Detailed information on 870 patients from 34 radiation oncology institutions was accumulated. Results The median age of all patients was 64 years (range, 3688), and 80.2% of the patients had good performance status. More than 85% of patients had clinical Stage T3-T4 disease, and 68.9% of patients had unresectable disease at diagnosis. Concerning radiotherapy (RT), 49.8% of patients were treated with radical external beam RT (EBRT) (median dose, 50.4 Gy), 44.4% of patients were treated with intraoperative RT (median dose, 25 Gy) with or without EBRT (median dose, 45 Gy), and 5.9% of patients were treated with postoperative radiotherapy (median dose, 50 Gy). The treatment field consisted of the primary tumor (bed) only in 55.6% of the patients. Computed tomography-based treatment planning and conformal RT was used in 93.1% and 83.1% of the patients treated with EBRT, respectively. Chemotherapy was used for 691 patients (79.4%; before RT for 66 patients; during RT for 531; and after RT for 364). Gemcitabine was the most frequently used drug, followed by 5-fluorouracil. Conclusion This study describes the general patterns of RT practice for pancreatic cancer in Japan. Most patients had advanced unresectable disease, and radical EBRT, as well as intraoperative RT with or without EBRT, was frequently used. Chemotherapy with gemcitabine was commonly used in conjunction with RT during the survey period.

Kazuhiko Ogawa; Yoshinori Ito; Katsuyuki Karasawa; Yoshihiro Ogawa; Hiroshi Onishi; Tomoko Kazumoto; Keiko Shibuya; Hitoshi Shibuya; Yoshishige Okuno; Shigeo Nishino; Etsuyo Ogo; Nobue Uchida; Kumiko Karasawa; Kenji Nemoto; Yasumasa Nishimura

2010-01-01T23:59:59.000Z

458

Patterns of Radiotherapy Practice for Pancreatic Cancer in Japan: Results of the Japanese Radiation Oncology Study Group (JROSG) Survey  

SciTech Connect (OSTI)

Purpose: To determine the patterns of radiotherapy practice for pancreatic cancer in Japan. Methods and Materials: A questionnaire-based national survey of radiotherapy for pancreatic cancer treated between 2000 and 2006 was conducted by the Japanese Radiation Oncology Study Group (JROSG). Detailed information on 870 patients from 34 radiation oncology institutions was accumulated. Results: The median age of all patients was 64 years (range, 36-88), and 80.2% of the patients had good performance status. More than 85% of patients had clinical Stage T3-T4 disease, and 68.9% of patients had unresectable disease at diagnosis. Concerning radiotherapy (RT), 49.8% of patients were treated with radical external beam RT (EBRT) (median dose, 50.4 Gy), 44.4% of patients were treated with intraoperative RT (median dose, 25 Gy) with or without EBRT (median dose, 45 Gy), and 5.9% of patients were treated with postoperative radiotherapy (median dose, 50 Gy). The treatment field consisted of the primary tumor (bed) only in 55.6% of the patients. Computed tomography-based treatment planning and conformal RT was used in 93.1% and 83.1% of the patients treated with EBRT, respectively. Chemotherapy was used for 691 patients (79.4%; before RT for 66 patients; during RT for 531; and after RT for 364). Gemcitabine was the most frequently used drug, followed by 5-fluorouracil. Conclusion: This study describes the general patterns of RT practice for pancreatic cancer in Japan. Most patients had advanced unresectable disease, and radical EBRT, as well as intraoperative RT with or without EBRT, was frequently used. Chemotherapy with gemcitabine was commonly used in conjunction with RT during the survey period.

Ogawa, Kazuhiko, E-mail: kogawa@med.u-ryukyu.ac.j [Department of Radiology, University of the Ryukyus, Okinawa (Japan); Ito, Yoshinori [Department of Radiation Oncology, National Cancer Center, Tokyo (Japan); Karasawa, Katsuyuki [Department of Radiation Oncology, Tokyo Metropolitan Komagome Hospital, Tokyo (Japan); Ogawa, Yoshihiro [Department of Radiation Oncology, Tohoku University, Sendai (Japan); Onishi, Hiroshi [Department of Radiology, Yamanashi University, Yamanashi (Japan); Kazumoto, Tomoko [Department of Radiation Oncology, Saitama Cancer Center, Saitama (Japan); Shibuya, Keiko [Department of Radiation Oncology and Image-Applied Therapy, Kyoto University, Kyoto (Japan); Shibuya, Hitoshi [Department of Radiology, Tokyo Medical and Dental University, Tokyo (Japan); Okuno, Yoshishige [Department of Radiation Oncology, Kobe City Medical Center General Hospital, Kobe (Japan); Nishino, Shigeo [Department of Radiation Oncology, Sapporo Kosei General Hospital, Sapporo (Japan); Ogo, Etsuyo [Department of Radiology, Kurume University, Kurume (Japan); Uchida, Nobue [Department of Radiation Oncology, Shimane Medical University, Shimane (Japan); Karasawa, Kumiko [Department of Radiation Oncology, Juntendo University, Tokyo (Japan); Nemoto, Kenji [Department of Radiation Oncology, Yamagata University, Yamagata (Japan); Nishimura, Yasumasa [Department of Radiation Oncology, Kinki University School of Medicine, Osaka (Japan)

2010-07-01T23:59:59.000Z

459

Treatment Outcomes, Growth Height, and Neuroendocrine Functions in Patients With Intracranial Germ Cell Tumors Treated With Chemoradiation Therapy  

SciTech Connect (OSTI)

Purpose: We carried out a retrospective review of patients receiving chemoradiation therapy (CRT) for intracranial germ cell tumor (GCT) using a lower dose than those previously reported. To identify an optimal GCT treatment strategy, we evaluated treatment outcomes, growth height, and neuroendocrine functions. Methods and Materials: Twenty-two patients with GCT, including 4 patients with nongerminomatous GCT (NGGCT) were treated with CRT. The median age at initial diagnosis was 11.5 years (range, 6-19 years). Seventeen patients initially received whole brain irradiation (median dose, 19.8 Gy), and 5 patients, including 4 with NGGCT, received craniospinal irradiation (median dose, 30.6 Gy). The median radiation doses delivered to the primary site were 36 Gy for pure germinoma and 45 Gy for NGGCT. Seventeen patients had tumors adjacent to the hypothalamic-pituitary axis (HPA), and 5 had tumors away from the HPA. Results: The median follow-up time was 72 months (range, 18-203 months). The rates of both disease-free survival and overall survival were 100%. The standard deviation scores (SDSs) of final heights recorded at the last assessment tended to be lower than those at initial diagnosis. Even in all 5 patients with tumors located away from the HPA, final height SDSs decreased (p = 0.018). In 16 patients with tumors adjacent to the HPA, 8 showed metabolic changes suggestive of hypothalamic obesity and/or growth hormone deficiency, and 13 had other pituitary hormone deficiencies. In contrast, 4 of 5 patients with tumors away from the HPA did not show any neuroendocrine dysfunctions except for a tendency to short stature. Conclusions: CRT for GCT using limited radiation doses resulted in excellent treatment outcomes. Even after limited radiation doses, insufficient growth height was often observed that was independent of tumor location. Our study suggests that close follow-up of neuroendocrine functions, including growth hormone, is essential for all patients with GCT.

Odagiri, Kazumasa, E-mail: t086016a@yokohama-cu.ac.jp [Department of Radiology, Yokohama City University Graduate School of Medicine, Yokohama (Japan) [Department of Radiology, Yokohama City University Graduate School of Medicine, Yokohama (Japan); Department of Radiology, Kanagawa Children's Medical Center, Yokohama (Japan); Omura, Motoko [Department of Radiology, Yokohama City University Graduate School of Medicine, Yokohama (Japan) [Department of Radiology, Yokohama City University Graduate School of Medicine, Yokohama (Japan); Department of Radiology, Kanagawa Children's Medical Center, Yokohama (Japan); Hata, Masaharu [Department of Radiology, Yokohama City University Graduate School of Medicine, Yokohama (Japan)] [Department of Radiology, Yokohama City University Graduate School of Medicine, Yokohama (Japan); Aida, Noriko; Niwa, Tetsu [Department of Radiology, Kanagawa Children's Medical Center, Yokohama (Japan)] [Department of Radiology, Kanagawa Children's Medical Center, Yokohama (Japan); Ogino, Ichiro [Department of Radiology, Yokohama City University Medical Center, Yokohama (Japan)] [Department of Radiology, Yokohama City University Medical Center, Yokohama (Japan); Kigasawa, Hisato [Division of Hemato-oncology/Regeneration Medicine, Kanagawa Children's Medical Center, Yokohama (Japan)] [Division of Hemato-oncology/Regeneration Medicine, Kanagawa Children's Medical Center, Yokohama (Japan); Ito, Susumu [Department of Neurosurgery, Kanagawa Children's Medical Center, Yokohama (Japan)] [Department of Neurosurgery, Kanagawa Children's Medical Center, Yokohama (Japan); Adachi, Masataka [Department of Endocrinology, Kanagawa Children's Medical Center, Yokohama (Japan)] [Department of Endocrinology, Kanagawa Children's Medical Center, Yokohama (Japan); Inoue, Tomio [Department of Radiology, Yokohama City University Graduate School of Medicine, Yokohama (Japan)] [Department of Radiology, Yokohama City University Graduate School of Medicine, Yokohama (Japan)

2012-11-01T23:59:59.000Z

460

Fully Automated Simultaneous Integrated Boosted-Intensity Modulated Radiation Therapy Treatment Planning Is Feasible for Head-and-Neck Cancer: A Prospective Clinical Study  

SciTech Connect (OSTI)

Purpose: To prospectively determine whether overlap volume histogram (OVH)-driven, automated simultaneous integrated boosted (SIB)-intensity-modulated radiation therapy (IMRT) treatment planning for head-and-neck cancer can be implemented in clinics. Methods and Materials: A prospective study was designed to compare fully automated plans (APs) created by an OVH-driven, automated planning application with clinical plans (CPs) created by dosimetrists in a 3-dose-level (70 Gy, 63 Gy, and 58.1 Gy), head-and-neck SIB-IMRT planning. Because primary organ sparing (cord, brain, brainstem, mandible, and optic nerve/chiasm) always received the highest priority in clinical planning, the study aimed to show the noninferiority of APs with respect to PTV coverage and secondary organ sparing (parotid, brachial plexus, esophagus, larynx, inner ear, and oral mucosa). The sample size was determined a priori by a superiority hypothesis test that had 85% power to detect a 4% dose decrease in secondary organ sparing with a 2-sided alpha level of 0.05. A generalized estimating equation (GEE) regression model was used for statistical comparison. Results: Forty consecutive patients were accrued from July to December 2010. GEE analysis indicated that in APs, overall average dose to the secondary organs was reduced by 1.16 (95% CI = 0.09-2.33) with P=.04, overall average PTV coverage was increased by 0.26% (95% CI = 0.06-0.47) with P=.02 and overall average dose to the primary organs was reduced by 1.14 Gy (95% CI = 0.45-1.8) with P=.004. A physician determined that all APs could be delivered to patients, and APs were clinically superior in 27 of 40 cases. Conclusions: The application can be implemented in clinics as a fast, reliable, and consistent way of generating plans that need only minor adjustments to meet specific clinical needs.

Wu Binbin, E-mail: binbin.wu@gunet.georgetown.edu [Department of Radiation Oncology and Molecular Radiation Science, Johns Hopkins University, Baltimore, Maryland (United States); Department of Radiation Medicine, Georgetown University Hospital, Washington, DC (United States); McNutt, Todd [Department of Radiation Oncology and Molecular Radiation Science, Johns Hopkins University, Baltimore, Maryland (United States)] [Department of Radiation Oncology and Molecular Radiation Science, Johns Hopkins University, Baltimore, Maryland (United States); Zahurak, Marianna [Department of Oncology Biostatistics, Johns Hopkins University, Baltimore, Maryland (United States)] [Department of Oncology Biostatistics, Johns Hopkins University, Baltimore, Maryland (United States); Simari, Patricio [Autodesk Research, Toronto, ON (Canada)] [Autodesk Research, Toronto, ON (Canada); Pang, Dalong [Department of Radiation Medicine, Georgetown University Hospital, Washington, DC (United States)] [Department of Radiation Medicine, Georgetown University Hospital, Washington, DC (United States); Taylor, Russell [Department of Computer Science, Johns Hopkins University, Baltimore, Maryland (United States)] [Department of Computer Science, Johns Hopkins University, Baltimore, Maryland (United States); Sanguineti, Giuseppe [Department of Radiation Oncology and Molecular Radiation Science, Johns Hopkins University, Baltimore, Maryland (United States)] [Department of Radiation Oncology and Molecular Radiation Science, Johns Hopkins University, Baltimore, Maryland (United States)

2012-12-01T23:59:59.000Z

Note: This page contains sample records for the topic "lesotho gy guyana" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Serum Amyloid A as a Predictive Marker for Radiation Pneumonitis in Lung Cancer Patients  

SciTech Connect (OSTI)

Purpose: To investigate serum markers associated with radiation pneumonitis (RP) grade ?3 in patients with lung cancer who were treated with radiation therapy. Methods and Materials: Pretreatment serum samples from patients with stage Ib-IV lung cancer who developed RP within 1 year after radiation therapy were analyzed to identify a proteome marker able to stratify patients prone to develop severe RP by surface-enhanced laser desorption/ionization time-of-flight mass spectrometry (SELDI-TOF-MS). Dosimetric parameters and 3 biological factors were compared. Results: Serum samples from 16 patients (28%) with severe RP (grade 3-4) and 42 patients (72%) with no or mild RP (grade 0-2) were collected for analysis. All patients received a median of 54 Gy (range, 42-70 Gy) of three-dimensional conformal radiation therapy with a mean lung dose (MLD) of 1502 cGy (range, 700-2794 cGy). An m/z peak of 11,480 Da was identified by SELDI-TOF-MS, and serum amyloid A (SAA) was the primary splitter serum marker. The receiver operating characteristic area under the curve of SAA (0.94; 95% confidence interval [CI], 0.87-1.00) was higher than those of C-reactive protein (0.83; 95% CI, 0.72-0.94), interleukin-6 (0.79; 95% CI, 0.65-0.94), and MLD (0.57; 95% CI, 0.37-0.77). The best sensitivity and specificity of combined SAA and MLD for predicting RP were 88.9% and 96.0%, respectively. Conclusions: Baseline SAA could be used as an auxiliary marker for predicting severe RP. Extreme care should be taken to limit the lung irradiation dose in patients with high SAA.

Wang, Yu-Shan [Department of Radiation Therapy and Oncology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China) [Department of Radiation Therapy and Oncology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Department of Animal Science, National Ilan University, Ilan, Taiwan (China); Chang, Heng-Jui [Department of Radiation Therapy and Oncology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China)] [Department of Radiation Therapy and Oncology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Chang, Yue-Cune [Department of Mathematics, Tamkang University, Taipei, Taiwan (China)] [Department of Mathematics, Tamkang University, Taipei, Taiwan (China); Huang, Su-Chen; Ko, Hui-Ling; Chang, Chih-Chia [Department of Radiation Therapy and Oncology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China)] [Department of Radiation Therapy and Oncology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Yeh, Yu-Wung; Jiang, Jiunn-Song [Department of Chest Medicine, Shin-Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China)] [Department of Chest Medicine, Shin-Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Lee, Cheng-Yen; Chi, Mau-Shin [Department of Radiation Therapy and Oncology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China)] [Department of Radiation Therapy and Oncology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Chi, Kwan-Hwa, E-mail: M006565@ms.skh.org.tw [Department of Radiation Therapy and Oncology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China) [Department of Radiation Therapy and Oncology, Shin Kong Wu Ho-Su Memorial Hospital, Taipei, Taiwan (China); Institute of Radiation Science and School of Medicine, National Yang-Ming University, Taipei, Taiwan (China)

2013-03-01T23:59:59.000Z

462

Vertebral Compression Fracture (VCF) After Spine Stereotactic Body Radiation Therapy (SBRT): Analysis of Predictive Factors  

SciTech Connect (OSTI)

Purpose: Vertebral compression fractures (VCFs) are increasingly observed after spine stereotactic body radiation therapy (SBRT). The aim of this study was to determine the risk of VCF after spine SBRT and identify clinical and dosimetric factors predictive for VCF. The analysis incorporated the recently described Spinal Instability Neoplastic Score (SINS) criteria. Methods and Materials: The primary endpoint of this study was the development of a de novo VCF (ie, new endplate fracture or collapse deformity) or fracture progression based on an existing fracture at the site of treatment after SBRT. We retrospectively scored 167 spinal segments in 90 patients treated with spine SBRT according to each of the 6 SINS criteria. We also evaluated the presence of paraspinal extension, prior radiation, various dosimetric parameters including dose per fraction ({>=}20 Gy vs <20 Gy), age, and histology. Results: The median follow-up was 7.4 months. We identified 19 fractures (11%): 12 de novo fractures (63%) and 7 cases of fracture progression (37%). The mean time to fracture after SBRT was 3.3 months (range, 0.5-21.6 months). The 1-year fracture-free probability was 87.3%. Multivariate analysis confirmed that alignment (P=.0003), lytic lesions (P=.007), lung (P=.03) and hepatocellular (P<.0001) primary histologies, and dose per fraction of 20 Gy or greater (P=.004) were significant predictors of VCF. Conclusions: The presence of kyphotic/scoliotic deformity and the presence of lytic tumor were the only predictive factors of VCF based on the original 6 SINS criteria. We also report that patients with lung and hepatocellular tumors and treatment with SBRT of 20 Gy or greater in a single fraction are at a higher risk of VCF.

Cunha, Marcelo V.R. [Division of Neurosurgery, Sunnybrook Health Sciences Centre, University of Toronto, Toronto, Ontario (Canada)] [Division of Neurosurgery, Sunnybrook Health Sciences Centre, University of Toronto, Toronto, Ontario (Canada); Al-Omair, Ameen [Department of Radiation Oncology, Princess Margaret Hospital, University of Toronto, Toronto, Ontario (Canada)] [Department of Radiation Oncology, Princess Margaret Hospital, University of Toronto, Toronto, Ontario (Canada); Atenafu, Eshetu G. [Department of Biostatistics, University Health Network, University of Toronto, Toronto, Ontario (Canada)] [Department of Biostatistics, University Health Network, University of Toronto, Toronto, Ontario (Canada); Masucci, Giuseppina Laura; Letourneau, Daniel [Department of Radiation Oncology, Princess Margaret Hospital, University of Toronto, Toronto, Ontario (Canada)] [Department of Radiation Oncology, Princess Margaret Hospital, University of Toronto, Toronto, Ontario (Canada); Korol, Renee [Department of Medical Physics, Sunnybrook Health Sciences Centre, University of Toronto, Toronto, Ontario (Canada)] [Department of Medical Physics, Sunnybrook Health Sciences Centre, University of Toronto, Toronto, Ontario (Canada); Yu, Eugene [Department of Radiology and Otolaryngology-Head and Neck Surgery, University Health Network, Mount Sinai Hospital and Women's College Hospital, University of Toronto, Toronto, Ontario (Canada)] [Department of Radiology and Otolaryngology-Head and Neck Surgery, University Health Network, Mount Sinai Hospital and Women's College Hospital, University of Toronto, Toronto, Ontario (Canada); Howard, Peter [Department of Radiology, Sunnybrook Health Sciences Centre, University of Toronto, Toronto, Ontario (Canada)] [Department of Radiology, Sunnybrook Health Sciences Centre, University of Toronto, Toronto, Ontario (Canada); Lochray, Fiona [Department of Radiation Oncology, Sunnybrook Health Sciences Centre, University of Toronto, Toronto, Ontario (Canada)] [Department of Radiation Oncology, Sunnybrook Health Sciences Centre, University of Toronto, Toronto, Ontario (Canada); Costa, Leodante B. da [Department of Radiology, Sunnybrook Health Sciences Centre, University of Toronto, Toronto, Ontario (Canada)] [Department of Radiology, Sunnybrook Health Sciences Centre, University of Toronto, Toronto, Ontario (Canada); Fehlings, Michael G. [Division of Neurosurgery and Spinal Program, Toronto Western Hospital, University of Toronto, Toronto, Ontario (Canada)] [Division of Neurosurgery and Spinal Program, Toronto Western Hospital, University of Toronto, Toronto, Ontario (Canada); Sahgal, Arjun, E-mail: arjun.sahgal@sunnybrook.ca [Department of Radiation Oncology, Princess Margaret Hospital, University of Toronto, Toronto, Ontario (Canada) [Department of Radiation Oncology, Princess Margaret Hospital, University of Toronto, Toronto, Ontario (Canada); Department of Radiation Oncology, Sunnybrook Health Sciences Centre, University of Toronto, Toronto, Ontario (Canada)

2012-11-01T23:59:59.000Z

463

Importance of a Patient Dosimetry and Clinical Follow-up Program in the Detection of Radiodermatitis After Long Percutaneous Coronary Interventions  

SciTech Connect (OSTI)

Complex percutaneous interventions often require high radiation doses likely to produce skin radiation injuries. We assessed the methodology used to select patients with potential skin injuries in cardiac procedures and in need of clinical follow-up. We evaluated peak skin dose and clinical follow-up in a case of radiodermatitis produced during a total occlusion recanalization. This prospective study followed CIRSE and ACC/AHA/SCAI recommendations for patient radiation dose management in interventional procedures carried out in a university hospital with a workload of 4200 interventional cardiac procedures per year. Patient dose reports were automatically transferred to a central database. Patients exceeding trigger levels for air kerma area product (500 Gy cm{sup 2}) and cumulative skin dose (5 Gy) were counseled and underwent follow-up for early detection of skin injuries, with dermatologic support. The Ethical Committee and the Quality Assurance and Radiation Safety Committee approved the program. During 2010, a total of 13 patients (3.0/1,000 that year) received dose values exceeding trigger levels in the cardiovascular institute. Only one patient, who had undergone two consecutive procedures resulting in 970 Gy cm{sup 2} and 13.0 Gy as cumulative skin dose, showed signs of serious radiodermatitis that resolved in 3.7 months. The remaining patients did not manifest skin lesions during follow-up, and whenever patient examination was not feasible as part of the follow-up, neither patients nor families reported any skin injuries. Peak skin dose calculation and close clinical follow-up were feasible and appropriate, with a moderate additional workload for the staff and satisfaction for the patient.

Vano, Eliseo, E-mail: eliseov@med.ucm.es [Instituto de Investigacion Sanitaria Hospital Clinico San Carlos and Complutense University, Medical Physics Service and Radiology Department (Spain)] [Instituto de Investigacion Sanitaria Hospital Clinico San Carlos and Complutense University, Medical Physics Service and Radiology Department (Spain); Escaned, Javier [Hospital Clinico San Carlos, Cardiovascular Institute (Spain)] [Hospital Clinico San Carlos, Cardiovascular Institute (Spain); Vano-Galvan, Sergio [Hospital Ramon y Cajal, Dermatology Service (Spain)] [Hospital Ramon y Cajal, Dermatology Service (Spain); Fernandez, Jose M. [Instituto de Investigacion Sanitaria Hospital Clinico San Carlos and Complutense University, Medical Physics Service and Radiology Department (Spain)] [Instituto de Investigacion Sanitaria Hospital Clinico San Carlos and Complutense University, Medical Physics Service and Radiology Department (Spain); Galvan, Carmen, E-mail: cgalvan@med.ucm.es [Instituto de Investigacion Sanitaria Hospital Clinico San Carlos and Complutense University, Radiotherapy Service and Radiology Department (Spain)] [Instituto de Investigacion Sanitaria Hospital Clinico San Carlos and Complutense University, Radiotherapy Service and Radiology Department (Spain)

2013-04-15T23:59:59.000Z

464

Radiosurgery for Para-IAC Meningiomas: The Effect of Radiation Dose to the Cochlea on Hearing Outcome  

SciTech Connect (OSTI)

Purpose: This study was performed to assess the radiosurgical results of meningiomas extending into the internal acoustic canal (para-IAC meningiomas), with a particular focus on the effect of radiation dose to the cochlea on hearing outcome. Methods and Materials: A total of 50 patients who underwent radiosurgery for para-IAC meningiomas between 1998 and 2009, which were followed for 2 years, were enrolled. The mean age was 55.8 years (range, 15-75). The mean tumor volume was 6.1 cm{sup 3} (range, 1.0-19.0), the mean tumor length in the IAC was 6.9 mm (range, 1.3-13.3), and the mean prescribed marginal dose was 13.1 Gy (range, 10-15) at an isodose line of 50%. The mean follow-up duration was 46 months (range, 24-122). Results: Eight (16.0%) patients had nonserviceable hearing at the time of surgery. At the last follow-up, the tumor control rate was 94%; unchanged in 17 patients, decreased in 30 patients, and increased in 3 patients. Among 42 patients with serviceable hearing at the time of radiosurgery, it was preserved in 41 (97.6%) patients at the last follow-up. The maximal and mean radiation doses to the cochleae of these 41 patients were 5.8 Gy {+-} 0.3 (range, 3.1-11.5) and 4.3 Gy {+-} 0.2 (range, 2.2-7.5), respectively. The maximal dose to the cochlea of the patient who lost hearing after radiosurgery was 4.7 Gy. Conclusions: The radiation dose to the cochlea may have the minimal toxic effect on the hearing outcome in patients who undergo radiosurgery for para-IAC meningiomas.

Kim, Young-Hoon [Department of Neurosurgery, Seoul National University Bundang Hospital, Seongnam-si (Korea, Republic of) [Department of Neurosurgery, Seoul National University Bundang Hospital, Seongnam-si (Korea, Republic of); Department of Neurosurgery, Seoul National University College of Medicine, Seoul (Korea, Republic of); Kim, Dong Gyu, E-mail: gknife@plaza.snu.ac.kr [Department of Neurosurgery, Seoul National University Hospital, Seoul (Korea, Republic of); Department of Neurosurgery, Seoul National University College of Medicine, Seoul (Korea, Republic of); Han, Jung Ho [Department of Neurosurgery, Seoul National University Bundang Hospital, Seongnam-si (Korea, Republic of) [Department of Neurosurgery, Seoul National University Bundang Hospital, Seongnam-si (Korea, Republic of); Department of Neurosurgery, Seoul National University College of Medicine, Seoul (Korea, Republic of); Chung, Hyun-Tai; Kim, In Kyung; Song, Sang Woo [Department of Neurosurgery, Seoul National University Hospital, Seoul (Korea, Republic of) [Department of Neurosurgery, Seoul National University Hospital, Seoul (Korea, Republic of); Department of Neurosurgery, Seoul National University College of Medicine, Seoul (Korea, Republic of); Park, Jeong-Hoon [Department of Neurosurgery, Seoul National University Bundang Hospital, Seongnam-si (Korea, Republic of) [Department of Neurosurgery, Seoul National University Bundang Hospital, Seongnam-si (Korea, Republic of); Department of Neurosurgery, Seoul National University College of Medicine, Seoul (Korea, Republic of); Kim, Jin Wook; Kim, Yong Hwy; Park, Chul-Kee [Department of Neurosurgery, Seoul National University Hospital, Seoul (Korea, Republic of) [Department of Neurosurgery, Seoul National University Hospital, Seoul (Korea, Republic of); Department of Neurosurgery, Seoul National University College of Medicine, Seoul (Korea, Republic of); Kim, Chae-Yong [Department of Neurosurgery, Seoul National University Bundang Hospital, Seongnam-si (Korea, Republic of) [Department of Neurosurgery, Seoul National University Bundang Hospital, Seongnam-si (Korea, Republic of); Department of Neurosurgery, Seoul National University College of Medicine, Seoul (Korea, Republic of); Paek, Sun Ha; Jung, Hee-Won [Department of Neurosurgery, Seoul National University Hospital, Seoul (Korea, Republic of) [Department of Neurosurgery, Seoul National University Hospital, Seoul (Korea, Republic of); Department of Neurosurgery, Seoul National University College of Medicine, Seoul (Korea, Republic of)

2012-11-01T23:59:59.000Z

465

A Prospective Cohort Study to Compare Treatment Results Between 2 Fractionation Schedules of High-Dose-Rate Intracavitary Brachytherapy (HDR-ICBT) in Patients With Cervical Cancer  

SciTech Connect (OSTI)

Purpose: To compare the treatment results of 2 fractionation schedules for high-dose-rate intracavitary brachytherapy (HDR-ICBT) in patients with cervical cancer. Methods and Materials: From June 2001 through January 2008, 267 patients with stage IB-IVA cervical cancer were enrolled in the study. All patients underwent 4-field pelvic irradiation and HDR-ICBT. The median central and parametrial doses were 39.6 Gy and 45 Gy, respectively. Patient underwent either 6 Gy Multiplication-Sign 4 (HDR-4) (n=144) or 4.5 Gy Multiplication-Sign 6 (HDR-6) (n=123) to point A of ICBT using {sup 192}Ir isotope twice weekly. The rates of overall survival, locoregional failure, distant metastasis, proctitis, cystitis, and enterocolitis were compared between HDR-4 and HDR-6. Results: There were no significant differences in the demographic data between HDR-4 and HDR-6 except for total treatment time. The 5-year proctitis rates were 23.0% and 21.5% in HDR-4 and HDR-6 (P=.399), respectively. The corresponding rates of grade 2-4 proctitis were 18.7% and 9.6% (P=.060). The corresponding rates of grades 3-4 proctitis were 5.2% and 1.3% (P=.231). Subgroup analysis revealed that HDR-4 significantly increased grade 2-4 proctitis in patients aged {>=}62 years old (P=.012) but not in patients aged <62 years (P=.976). The rates of overall survival, locoregional failure, distant metastasis, cystitis, and enterocolitis were not significantly different between HDR-4 and HDR-6 schedules. Conclusion: The small fraction size of HDR-ICBT is associated with grade 2 proctitis without compromise of prognosis in elderly patients. This schedule is suggested for patients who tolerate an additional 2 applications of HDR-ICBT.

Huang, Eng-Yen [Department of Radiation Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China) [Department of Radiation Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); School of Traditional Chinese Medicine, Chang Gung University College of Medicine, Taiwan (China); Sun, Li-Min [Department of Radiation Oncology, Zuoying Armed Forces General Hospital, Kaohsiung, Taiwan (China)] [Department of Radiation Oncology, Zuoying Armed Forces General Hospital, Kaohsiung, Taiwan (China); Lin, Hao [Department of Gynecologic Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China)] [Department of Gynecologic Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); Lan, Jen-Hong [Department of Radiation Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China)] [Department of Radiation Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); Chanchien, Chan-Chao [Department of Gynecologic Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China)] [Department of Gynecologic Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); Huang, Yu-Jie; Wang, Chang-Yu [Department of Radiation Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China)] [Department of Radiation Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China); Wang, Chong-Jong, E-mail: cjw1010@adm.cgmh.org.tw [Department of Radiation Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China)] [Department of Radiation Oncology, Kaohsiung Chang Gung Memorial Hospital, Chang Gung University College of Medicine, Kaohsiung, Taiwan (China)

2013-01-01T23:59:59.000Z

466

Correlation of Clinical and Dosimetric Factors With Adverse Pulmonary Outcomes in Children After Lung Irradiation  

SciTech Connect (OSTI)

Purpose: To identify the incidence and the risk factors for pulmonary toxicity in children treated for cancer with contemporary lung irradiation. Methods and Materials: We analyzed clinical features, radiographic findings, pulmonary function tests, and dosimetric parameters of children receiving irradiation to the lung fields over a 10-year period. Results: We identified 109 patients (75 male patients). The median age at irradiation was 13.8 years (range, 0.04-20.9 years). The median follow-up period was 3.4 years. The median prescribed radiation dose was 21 Gy (range, 0.4-64.8 Gy). Pulmonary toxic chemotherapy included bleomycin in 58.7% of patients and cyclophosphamide in 83.5%. The following pulmonary outcomes were identified and the 5-year cumulative incidence after irradiation was determined: pneumonitis, 6%; chronic cough, 10%; pneumonia, 35%; dyspnea, 11%; supplemental oxygen requirement, 2%; radiographic interstitial lung disease, 40%; and chest wall deformity, 12%. One patient died of progressive respiratory failure. Post-irradiation pulmonary function tests available from 44 patients showed evidence of obstructive lung disease (25%), restrictive disease (11%), hyperinflation (32%), and abnormal diffusion capacity (12%). Thoracic surgery, bleomycin, age, mean lung irradiation dose (MLD), maximum lung dose, prescribed dose, and dosimetric parameters between V{sub 22} (volume of lung exposed to a radiation dose ?22 Gy) and V{sub 30} (volume of lung exposed to a radiation dose ?30 Gy) were significant for the development of adverse pulmonary outcomes on univariate analysis. MLD, maximum lung dose, and V{sub dose} (percentage of volume of lung receiving the threshold dose or greater) were highly correlated. On multivariate analysis, MLD was the sole significant predictor of adverse pulmonary outcome (P=.01). Conclusions: Significant pulmonary dysfunction occurs in children receiving lung irradiation by contemporary techniques. MLD rather than prescribed dose should be used to perform risk stratification of patients receiving lung irradiation.

Venkatramani, Rajkumar, E-mail: rvenkatramani@chla.usc.edu [Division of Hematology/Oncology, Children's Hospital Los Angeles, Los Angeles, California (United States); Department of Pediatrics, Keck School of Medicine, University of Southern California, Los Angeles, California (United States); Kamath, Sunil [Department of Pulmonology, Children's Hospital Los Angeles, Los Angeles, California (United States); Wong, Kenneth [Division of Hematology/Oncology, Children's Hospital Los Angeles, Los Angeles, California (United States); Olch, Arthur J. [Division of Hematology/Oncology, Children's Hospital Los Angeles, Los Angeles, California (United States); Department of Radiation Oncology, University of Southern California, Los Angeles, California (United States); Malvar, Jemily [Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles, California (United States); Sposto, Richard [Division of Hematology/Oncology, Children's Hospital Los Angeles, Los Angeles, California (United States); Department of Preventive Medicine, Keck School of Medicine, University of Southern California, Los Angeles, California (United States); Goodarzian, Fariba [Department of Radiology, Children's Hospital Los Angeles, Los Angeles, California (United States); Freyer, David R. [Division of Hematology/Oncology, Children's Hospital Los Angeles, Los Angeles, California (United States); Department of Pediatrics, Keck School of Medicine, University of Southern California, Los Angeles, California (United States); Keens, Thomas G. [Department of Pediatrics, Keck School of Medicine, University of Southern California, Los Angeles, California (United States); Department of Pulmonology, Children's Hospital Los Angeles, Los Angeles, California (United States); and others

2013-08-01T23:59:59.000Z

467

Early Clinical Outcomes Demonstrate Preserved Cognitive Function in Children With Average-Risk Medulloblastoma When Treated With Hyperfractionated Radiation Therapy  

SciTech Connect (OSTI)

Purpose: To report on acute toxicity, longitudinal cognitive function, and early clinical outcomes in children with average-risk medulloblastoma. Methods and Materials: Twenty children {>=}5 years of age classified as having average-risk medulloblastoma were accrued on a prospective protocol of hyperfractionated radiation therapy (HFRT) alone. Radiotherapy was delivered with two daily fractions (1 Gy/fraction, 6 to 8 hours apart, 5 days/week), initially to the neuraxis (36 Gy/36 fractions), followed by conformal tumor bed boost (32 Gy/32 fractions) for a total tumor bed dose of 68 Gy/68 fractions over 6 to 7 weeks. Cognitive function was prospectively assessed longitudinally (pretreatment and at specified posttreatment follow-up visits) with the Wechsler Intelligence Scale for Children to give verbal quotient, performance quotient, and full-scale intelligence quotient (FSIQ). Results: The median age of the study cohort was 8 years (range, 5-14 years), representing a slightly older cohort. Acute hematologic toxicity was mild and self-limiting. Eight (40%) children had subnormal intelligence (FSIQ <85), including 3 (15%) with mild mental retardation (FSIQ 56-70) even before radiotherapy. Cognitive functioning for all tested domains was preserved in children evaluable at 3 months, 1 year, and 2 years after completion of HFRT, with no significant decline over time. Age at diagnosis or baseline FSIQ did not have a significant impact on longitudinal cognitive function. At a median follow-up time of 33 months (range, 16-58 months), 3 patients had died (2 of relapse and 1 of accidental burns), resulting in 3-year relapse-free survival and overall survival of 83.5% and 83.2%, respectively. Conclusion: HFRT without upfront chemotherapy has an acceptable acute toxicity profile, without an unduly increased risk of relapse, with preserved cognitive functioning in children with average-risk medulloblastoma.

Gupta, Tejpal, E-mail: tejpalgupta@rediffmail.com [Department of Radiation Oncology, Advanced Centre for Treatment Research and Education in Cancer and Tata Memorial Hospital, Mumbai (India)] [Department of Radiation Oncology, Advanced Centre for Treatment Research and Education in Cancer and Tata Memorial Hospital, Mumbai (India); Jalali, Rakesh [Department of Radiation Oncology, Advanced Centre for Treatment Research and Education in Cancer and Tata Memorial Hospital, Mumbai (India)] [Department of Radiation Oncology, Advanced Centre for Treatment Research and Education in Cancer and Tata Memorial Hospital, Mumbai (India); Goswami, Savita [Department of Clinical Psychology and Psychiatry Unit, Advanced Centre for Treatment Research and Education in Cancer and Tata Memorial Hospital, Mumbai (India)] [Department of Clinical Psychology and Psychiatry Unit, Advanced Centre for Treatment Research and Education in Cancer and Tata Memorial Hospital, Mumbai (India); Nair, Vimoj [Department of Radiation Oncology, Advanced Centre for Treatment Research and Education in Cancer and Tata Memorial Hospital, Mumbai (India)] [Department of Radiation Oncology, Advanced Centre for Treatment Research and Education in Cancer and Tata Memorial Hospital, Mumbai (India); Moiyadi, Aliasgar [Division of Neuro-Surgery, Department of Surgical Oncology, Advanced Centre for Treatment Research and Education in Cancer and Tata Memorial Hospital, Mumbai (India)] [Division of Neuro-Surgery, Department of Surgical Oncology, Advanced Centre for Treatment Research and Education in Cancer and Tata Memorial Hospital, Mumbai (India); Epari, Sridhar [Department of Pathology, Advanced Centre for Treatment Research and Education in Cancer and Tata Memorial Hospital, Mumbai (India)] [Department of Pathology, Advanced Centre for Treatment Research and Education in Cancer and Tata Memorial Hospital, Mumbai (India); Sarin, Rajiv [Department of Radiation Oncology, Advanced Centre for Treatment Research and Education in Cancer and Tata Memorial Hospital, Mumbai (India)] [Department of Radiation Oncology, Advanced Centre for Treatment Research and Education in Cancer and Tata Memorial Hospital, Mumbai (India)

2012-08-01T23:59:59.000Z

468

Radiotherapy With or Without Surgery for Patients With Idiopathic Sclerosing Orbital Inflammation Refractory or Intolerant to Steroid Therapy  

SciTech Connect (OSTI)

Purpose: To evaluate the outcomes of patients with idiopathic sclerosing orbital inflammation (ISOI) treated with radiotherapy with or without surgery. Methods and Materials: We retrospectively reviewed 22 patients with histopathologically confirmed ISOI who had been refractory or intolerant to steroid therapy and treated with radiation with or without surgery. The radiation dose ranged from 20 to 40 Gy (median, 20 Gy) at 2 Gy per fraction. Presenting signs and treatment outcomes were assessed. Results: Proptosis was the most common sign at presentation, seen in 19 (86.3%) patients, followed by restriction of extraocular movements in 10 (45.4%) patients. Response to radiotherapy was complete in 15 (68.1%) patients, partial in 3 (13.6%) patients, and none in 4 (18.2%) patients. At the median follow-up of 34 months, 14 (63.6%) patients had progression-free state of symptoms and signs, with the progression-free duration ranging from 3 to 75 months (median, 41.5 months), whereas 8 (36.4%) patients had recurrent or persistent disease although they had received radiotherapy. Of the 14 progression-free patients, 6 underwent a bimodality treatment of debulking surgery of ocular disease and radiotherapy. They had had no recurrent disease. Cataract was the most common late complications, and 2 patients experienced a Grade 3 cataract. Conclusion: Our study suggests that for patients with ISOI who are refractory or intolerant to steroid therapy, 20 Gy of radiotherapy appears to be effective for the control of disease with acceptable complications, especially when it is combined with surgery.

Lee, Jong Hoon [Department of Radiation Oncology, Seoul St. Mary's Hospital, College of Medicine, Catholic University of Korea, Seoul (Korea, Republic of)] [Department of Radiation Oncology, Seoul St. Mary's Hospital, College of Medicine, Catholic University of Korea, Seoul (Korea, Republic of); Kim, Yeon-Sil, E-mail: yeonkim7@catholic.ac.kr [Department of Radiation Oncology, Seoul St. Mary's Hospital, College of Medicine, Catholic University of Korea, Seoul (Korea, Republic of)] [Department of Radiation Oncology, Seoul St. Mary's Hospital, College of Medicine, Catholic University of Korea, Seoul (Korea, Republic of); Yang, Suk Woo; Cho, Won-Kyung [Department of Ophthalmology, Seoul St. Mary's Hospital, College of Medicine, Catholic University of Korea, Seoul (Korea, Republic of)] [Department of Ophthalmology, Seoul St. Mary's Hospital, College of Medicine, Catholic University of Korea, Seoul (Korea, Republic of); Lee, Sang Nam [Department of Radiation Oncology, Seoul St. Mary's Hospital, College of Medicine, Catholic University of Korea, Seoul (Korea, Republic of)] [Department of Radiation Oncology, Seoul St. Mary's Hospital, College of Medicine, Catholic University of Korea, Seoul (Korea, Republic of); Lee, Kyung Ji [Department of Hospital Pathology, Seoul St. Mary's Hospital, College of Medicine, Catholic University of Korea, Seoul (Korea, Republic of)] [Department of Hospital Pathology, Seoul St. Mary's Hospital, College of Medicine, Catholic University of Korea, Seoul (Korea, Republic of); Ryu, Mi-Ryeong; Jang, Hong Seok [Department of Radiation Oncology, Seoul St. Mary's Hospital, College of Medicine, Catholic University of Korea, Seoul (Korea, Republic of)] [Department of Radiation Oncology, Seoul St. Mary's Hospital, College of Medicine, Catholic University of Korea, Seoul (Korea, Republic of)

2012-09-01T23:59:59.000Z

469

Caustic Recycle from Hanford Tank Waste Using Large Area NaSICON Structures (LANS)  

SciTech Connect (OSTI)

This report presents the results of a 5-day test of an electrochemical bench-scale apparatus using a proprietary (NAS-GY) material formulation of a (Na) Super Ion Conductor (NaSICON) membrane in a Large Area NaSICON Structures (LANS) configuration. The primary objectives of this work were to assess system performance, membrane seal integrity, and material degradation while removing Na from Group 5 and 6 tank waste from the Hanford Site.

Fountain, Matthew S.; Sevigny, Gary J.; Balagopal, S.; Bhavaraju, S.

2009-03-31T23:59:59.000Z

470

Ion-beam and electron-beam irradiation of synthetic britholite S. Utsunomiya a  

E-Print Network [OSTI]

on previously amorphized britholite (N56) with an electron flux of 1.07 · 1025 e? /m2 /s. The ionizing radiation resulted in recrystallization at the absorbed dose of 6.2 · 1013 Gy. This result suggests that the ionizingV Kr2þ and 1.5 MeV Xeþ over the temperature range of 50­973 K. The process of ion irradiation

Utsunomiya, Satoshi

471

Adjuvant stereotactic permanent seed breast implant: A boost series in view of partial breast irradiation  

SciTech Connect (OSTI)

Purpose: The aim of this study was to use permanent seed implants in the breast and describe our experience with 15 cases, using iodine seed implants as a tumor bed boost. Methods and Materials: Breasts were fixed with a thermoplastic sheet, a template bridge applied, the thorax scanned and the images rotated to be perpendicular to the implant axis. Skin, heart, and lung were delineated. A preplan was made, prescribing 50 Gy to the clinical target volume (CTV), consisting in this boost series of nearly a quadrant. Iodine (125) seeds were stereotactically implanted through the template, and results were checked with a postplan computed tomographic (CT) scan. Results: The breast was immobilized reproducibly. Simulation, scanning, and implant were performed without difficulties. Preplan CTV D90% (the dose delivered to 90% of the CTV) was 66 Gy, and postoperative fluoroscopic or CT scan checks were satisfactory. Pre- and postplan dose-volume histogram showed good organ sparing: mean postplan skin, heart, and lung V30 Gy (the organ volume receiving a dose of 30 Gy) of 2 {+-} 2.2 mL, 0.24 {+-} 0.34 mL, and 3.5 {+-} 5 mL, respectively. No short-term toxicity above Grade 1 was noted, except for transient Grade 3 neuropathy in 1 patient. Conclusions: Seeds remained in the right place, as assessed by fluoroscopy, absence of significant pre- to postplan dose-volume histogram change for critical organs, and total irradiated breast volume. The method could be proposed as a boost when high dosimetric selectivity is required (young patients after cardiotoxic chemotherapy for left-sided cancer). This boost series was a preliminary step before testing partial breast irradiation by permanent seed implant in a prospective trial.

Jansen, Nicolas [Department of Radiation Oncology, Liege University Hospital, Liege (Belgium)]. E-mail: nicolas.jansen@chu.ulg.ac.be; Deneufbourg, Jean-Marie [Department of Radiation Oncology, Liege University Hospital, Liege (Belgium); Nickers, Philippe [Department of Radiation Oncology, Liege University Hospital, Liege (Belgium)

2007-03-15T23:59:59.000Z

472

Rapid assessment of high-dose radiation exposures through scoring of cell-fusion-induced premature chromosome condensation and ring chromosomes  

Science Journals Connector (OSTI)

Abstract Analysis of premature chromosome condensation (PCC) mediated by fusion of G0-lymphocytes with mitotic CHO cells in combination with rapid visualization and quantification of rings (PCC-Rf) is proposed as an alternative technique for dose assessment of radiation-exposed individuals. Isolated lymphocytes or whole blood from six individuals were ?-irradiated with 5, 10, 15 and 20Gy at a dose rate of 0.5Gy/min. Following either 8- or 24-h post-exposure incubation of irradiated samples at 37C, chromosome spreads were prepared by standard PCC cytogenetic procedures. The protocol for PCC fusion proved to be effective at doses as high as 20Gy, enabling the analysis of ring chromosomes and excess PCC fragments. The ring frequencies remained constant during the 824-h repair time; the pooled dose relationship between ring frequency (Y) and dose (D) was linear: Y=(0.0880.005)נD. During the repair time, excess fragments decreased from 0.91 to 0.59 chromatid pieces per Gy, revealing the importance of information about the exact time of exposure for dose assessment on the basis of fragments. Compared with other cytogenetic assays to estimate radiation dose, the PCC-Rf method has the following benefits: a 48-h culture time is not required, allowing a much faster assessment of dose in comparison with conventional scoring of dicentrics and rings in assays for chemically-induced premature chromosome condensation (PCC-Rch), and it allows the analysis of heavily irradiated lymphocytes that are delayed or never reach mitosis, thus avoiding the problem of saturation at high doses. In conclusion, the use of the PCC fusion assay in conjunction with scoring of rings in G0-lymphocytes offers a suitable alternative for fast dose estimation following accidental exposure to high radiation doses.

A.I. Lamadrid Boada; I. Romero Aguilera; G.I. Terzoudi; J.E. Gonzlez Mesa; G. Pantelias; O. Garca

2013-01-01T23:59:59.000Z

473

Boron neutron capture therapy (BNCT) for liver metastasis in an experimental model: doseresponse at five-week follow-up based on retrospective dose assessment in individual rats  

SciTech Connect (OSTI)

Boron neutron capture therapy (BNCT) was proposed for untreatable colorectal liver metastases. Employing an experimental model of liver metastases in rats, we recently demonstrated that BNCT mediated by boronophenylalanine (BPA-BNCT) at 13 Gy prescribed to tumor is therapeutically useful at 3-week follow-up. The aim of the present study was to evaluate doseresponse at 5-week follow-up, based on retrospective dose assessment in individual rats. BDIX rats were inoculated with syngeneic colon cancer cells DHD/K12/TRb. Tumor-bearing animals were divided into three groups: BPA-BNCT (n = 19), Beam only (n = 8) and Sham (n = 7) (matched manipulation, no treatment). For each rat, neutron flux was measured in situ and boron content was measured in a pre-irradiat