National Library of Energy BETA

Sample records for le sh ip

  1. SH Coatings LP

    Office of Energy Efficiency and Renewable Energy (EERE)

    SH Coatings, based in Dallas, Texas, employs Super Hydrophobic Coating (SHC) technology that protects power systems by preventing ice accumulation on power lines in ice storm threatened areas and contamination of power lines from salt on the coasts. In order to successfully utilize and commercialize the SHC technology for this application, tools to apply the coating onto new and existing lines must be developed. SH Coatings is developing these tools with the help of technology from Oak Ridge National Laboratory.

  2. Workforce Statistics - NA SH | National Nuclear Security Administratio...

    National Nuclear Security Administration (NNSA)

    Us Our Operations Management and Budget Office of Civil Rights Workforce Statistics Workforce Statistics - NA SH Workforce Statistics - NA SH NA SH FY14 Year End...

  3. Income Protection (IP) Insurance 

    E-Print Network [OSTI]

    Stokes, Kenneth; Barnaby, G. A. Art; Waller, Mark L.; Outlaw, Joe

    1999-06-09

    Kenneth Stokes, G.A. ?Art? Barnaby, Mark Waller and Joe Outlaw* The Income Protection (IP) program insures the producer against lost income from reductions in yield or price. This policy pays when the harvested and appraised production to count, multiplied...

  4. IP SwitchingIP Switching and Label Switchingand Label Switching

    E-Print Network [OSTI]

    Jain, Raj

    Raj Jain 1 IP SwitchingIP Switching and Label Switchingand Label Switching Raj Jain Professor Switching vs routing q IP Switching (Ipsilon) q Tag Switching (CISCO) q Multi-protocol label switching a tag. Exit router strips it off. H R R R H H HUntagged Packet Tagged packet #12;Raj Jain 9 Tag

  5. Project no. 004089 Instrument : IP

    E-Print Network [OSTI]

    Guichard, Francoise

    Project no. 004089 AMMA Instrument : IP D.2.1.A.e The impacts of contrasting atmospheric convective available potential energy (CAPE). This finding is consistent with observations that daytime

  6. Material Stock Requests -SH Version Date: June 2013

    E-Print Network [OSTI]

    Material Stock Requests - SH Version Date: June 2013 #12;Training Guide Material Stock Requests injury. If you use this software in dangerous applications, then you shall be responsible to take all Stock Requests - SH Page iii Table of Contents Material Stock Requests - SH

  7. ~'SH' G INDUSTRY IN BRAZIL (TERES INA.

    E-Print Network [OSTI]

    ~'SH' G INDUSTRY IN BRAZIL FORTALEZA (TERES INA. ~ SALVADOR BELO HOR I ZONTE · ~ VIT6RIA R I O DE··········· ··········· ····················· Y Vice Consul, American Embassyt R10 de Janeiro, Brazil. Report No. 202, June 3, 1948. Page 2 3 4 4 4 5 5 5 6 7 9 12 16 25 26 30 30 30 40 41 41 41 42 P-7 2;2 #12;BACKGrouND Fishing in Brazil is little

  8. IDS120j WITHOUT RESISTIVE MAGNETS MODIFYING Hg MODULE ( NEW SH#1 REGION )

    E-Print Network [OSTI]

    McDonald, Kirk

    CRYO#1 WAS DECIDED DURING 11 / 15 / 2012 TARGET MEETING AND AN EXTENSION OF THE Hg POOL UPSTREAM UP cm. # RESULTS FROM SIMULATIONS WITH MODIFIED Hg POOL AND SH#1 REGION ( SC#1+2, SC#4 SEGMENTATION;IDS120j: GENERAL OVERVIEW (LEFT), POOL REGION DETAILS (RIGHT). [20 cm GAPS] SH#1 SH#1 SH#1A SH#2 SH#1A

  9. Intellectual Property (IP) Service Providers for Acquisition...

    Energy Savers [EERE]

    Property (IP) Service Providers for Acquisition and Assistance Transactions WA05056IBMWATSONRESEARCHCENTERWaiverofDomesticand.pdf Need to Consider Intentional...

  10. A -calculus model of a Spanish sh market { Preliminary Report {

    E-Print Network [OSTI]

    Bradford, Russell

    : an informal description This analysis has arisen from joint work with the the Spanish government AI researchA #25;-calculus model of a Spanish #12;sh market { Preliminary Report { Julian Padget and Russell of an electronic marketplace. Speci#12;cally, we are looking at the Spanish #12;sh market, since we have

  11. Structure of mouse IP-10, a chemokine

    SciTech Connect (OSTI)

    Jabeen, Talat; Leonard, Philip; Jamaluddin, Haryati; Acharya, K. Ravi, E-mail: bsskra@bath.ac.uk [Department of Biology and Biochemistry, University of Bath, Claverton Down, Bath BA2 7AY (United Kingdom)

    2008-06-01

    The structure of mouse IP-10 shows a novel tetrameric association. Interferon-?-inducible protein (IP-10) belongs to the CXC class of chemokines and plays a significant role in the pathophysiology of various immune and inflammatory responses. It is also a potent angiostatic factor with antifibrotic properties. The biological activities of IP-10 are exerted by interactions with the G-protein-coupled receptor CXCR3 expressed on Th1 lymphocytes. IP-10 thus forms an attractive target for structure-based rational drug design of anti-inflammatory molecules. The crystal structure of mouse IP-10 has been determined and reveals a novel tetrameric association. In the tetramer, two conventional CXC chemokine dimers are associated through their N-terminal regions to form a 12-stranded elongated ?-sheet of ?90 Å in length. This association differs significantly from the previously studied tetramers of human IP-10, platelet factor 4 and neutrophil-activating peptide-2. In addition, heparin- and receptor-binding residues were mapped on the surface of IP-10 tetramer. Two heparin-binding sites were observed on the surface and were present at the interface of each of the two ?-sheet dimers. The structure supports the formation of higher order oligomers of IP-10, as observed in recent in vivo studies with mouse IP-10, which will have functional relevance.

  12. Empirical Tests of Anonymous Voice Over IP Marc Liberatoreb,

    E-Print Network [OSTI]

    Wright , Matthew

    Proxy Proxy Contact Anonymous Voice over IP (aVoIP) Initiator Proxy Proxy Proxy The Onion Router (Tor for extending onion-routing style anonymity protocols for supporting anonymous VoIP (aVoIP) traffic show that aVoIP could be developed in an onion routing system with reasonable performance guarantees

  13. BASICS IP PC104 Security Policy

    E-Print Network [OSTI]

    BASICS IP PC104 Security Policy Version: 1.2 Vocality International Ltd. Revision Date: 1 June 2012 revision. #12;Vocality International Ltd. Document Version 1.1 BASICS IP PC104 Security Policy Page 2 of 21 ........................................................................................................................................ 9 5 Identification and Authentication Policy

  14. The Wireless IP Project Mikael Sternad

    E-Print Network [OSTI]

    The Wireless IP Project Mikael Sternad ¡ Signals and Systems, Uppsala University, PO Box 528,SE-751 20 Uppsala, Sweden. Abstract The optimization of resources in wireless packet data sys- tems year 2000 formed the Wireless IP project, which studies such issues. We perform research towards

  15. Le stage international et interculturel

    E-Print Network [OSTI]

    Laval, Université

    femme · Le rôle de l'infirmier /la perception · Les normes et les routines de soins · Le soulagement de

  16. On the development of Voice over IP 

    E-Print Network [OSTI]

    Yang, Xu

    2009-05-15

    problems in the Session Initiation Protocol (SIP) call setup process. To support product line development and enable product evolution in the quickly growing VoIP market, I have proposed a generic development framework for SIP application servers...

  17. IP routing lookup: hardware and software approach 

    E-Print Network [OSTI]

    Chakaravarthy, Ravikumar V.

    2005-08-29

    The work presented in this thesis is motivated by the dual goal of developing a scalable and efficient approach for IP lookup using both hardware and software approach. The work involved designing algorithms and techniques to increase the capacity...

  18. ITDS tech contacts ip-requests@sfu.ca

    E-Print Network [OSTI]

    Kavanagh, Karen L.

    Desktop printer? ITDS tech contacts ip-requests@sfu.ca for static IP address from NS ITDS tech functionality Y N HCS Printer? N MFD?Y Obtain second static IP from ip-requests@sfu.ca for scanning Y ITDS tech questions such as the following of their clients when they request to purchase a new printer: · Why do you

  19. LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM LINE *

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    LINEAR COLLIDER TEST FACILITY: TWISS PARAMETER ANALYSIS AT THE IP/POST-IP LOCATION OF THE ATF2 BEAM through to the IP, the Twiss parameters need to be measured at the IP or PIP. Up to now, these parameters to extract the Twiss parameters and the emittance thanks to the three coefficients of the fit

  20. SALT-flSH INPUSTRIES FISHERY LEAFLET 240

    E-Print Network [OSTI]

    SALT-flSH INPUSTRIES FISHERY LEAFLET 240 FISH AND WILDLIFE SERVICE UNITED STATES DEPARTMENT, Albert M. Day, Director #12;THE VENEZUKLAN SALT-FISH INDUSTRIES CONTE^fTS Part II Potential Productive and Craft 29 Development of Unused or Underutilized Species 29 Development of New Areas 35 Salt 35 Studies

  1. PubMed advanced exercise: MeSH Searching

    E-Print Network [OSTI]

    Scheichl, Robert

    achilles tendon and click Search. With MeSH searches, you enter only one search term at a time and you don can remove the need to enter multiple alternative terms to describe the same concept. For the following exercise, please search PubMed using: a) search terms that feature within the following

  2. Intraperitoneal administration of AAV9-shRNA inhibits target gene expression in the dorsal root ganglia of neonatal mice

    E-Print Network [OSTI]

    2013-01-01

    al. : Intraperitoneal administration of AAV9-shRNA inhibitsAccess Intraperitoneal administration of AAV9-shRNA inhibitsespecially by systemic administration. We have developed a

  3. BRSIC RECIPES COOKinG fiSH

    E-Print Network [OSTI]

    BRSIC RECIPES fOR COOKinG fiSH Fishery Leaflet 106 Fish anel Wi Iellife Se r v;ce po-)ited States Department of the Interior Wa s.hi ngton, D.C. #12;United States Department of the Interior, J. A. Fish~9~4~9 Introduction .· ... BASTC R~CIP~~ FOR GOOK IN~ FISH By Rose G. Kerr, Home Economist Branch of Commercial

  4. TIMBERMIST-YUKON-JACK sh-KANIKSU-REIGN

    E-Print Network [OSTI]

    Lacy, Bob

    TIMBERMIST-YUKON-JACK wr-DUNCAN sh-KANIKSU-REIGN GLENDON'S-SWEETIE nd-X-CHEENA gm-X-NORTH-TRAV'LER gm-X-CEDAR-ADAHI hr-NOKOMIS-DREAM gm-X-TANACROSS gm-X-SCHOODIC-MIST gm-X-YUKON-CHARLEY gm-X-COHO gm-X-SINAMOKST-RED gm-LYRIC-TIKAANI gm-TANAINA gm-KINGUYAKKIIcn-NORTHERN-KODIAK BASHABA-MURPHY BASHABA-SAKARI-DAWN PIPPA

  5. RESEARCH & INNOVATION OFFICE EASY ACCESS IP

    E-Print Network [OSTI]

    University of Technology, Sydney

    RESEARCH & INNOVATION OFFICE EASY ACCESS IP AN INTRODUCTION FOR INDUSTRY PARTNERS FEBRUARY 2014 #12 to provide industry with greater opportunity and incentive to develop products and services that will lead regardless of how successful the end product is You gain easy access to cutting edge science, technology

  6. Towards All-IP Wireless Networks: Architectures and Resource Management

    E-Print Network [OSTI]

    Boutaba, Raouf

    Towards All-IP Wireless Networks: Architectures and Resource Management Mechanism Majid Ghaderi-IP network integrating different wireless technologies using IP and its associated service models. The first to facilitate the integration of wireless LAN and 3G cellular networks towards a uniform architecture for all

  7. Multimedia Communications over IP Networks 4 -6 September 2000

    E-Print Network [OSTI]

    Abu-Rgheff, Mosa Ali

    Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution of the Internet David@plymouth.ac.uk School of Computing #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution' applying at each level: #12;Multimedia Communications over IP Networks 4 - 6 September 2000 Evolution

  8. Detecting VoIP Floods Using the Hellinger Distance

    E-Print Network [OSTI]

    Wang, Haining

    Detecting VoIP Floods Using the Hellinger Distance Hemant Sengar, Student Member, IEEE, Haining running over the TCP/IP suite, it is susceptible to flooding attacks. If flooded, as a time. Because multiple protocols are involved in a VoIP service and most of them are susceptible to flooding

  9. July 5 -August 2 (SICCEP and IP-CHINA) July 19 -August 16 (IP-CHINA and SICCEP)

    E-Print Network [OSTI]

    Herrmann, Samuel

    July 5 - August 2 (SICCEP and IP-CHINA) July 19 - August 16 (IP-CHINA and SICCEP) Summer School ................................................................................................. 11 #12;#12;SUMMER SCHOOL 2014 Page 4 SICCEP IP-CHINA-CHINA Introduction to Chinese LawIntroduction to Chinese Law, Institutions, and Politics, Institutions, and Politics Environment, Science, and Society

  10. IP address management : augmenting Sandia's capabilities through open source tools.

    SciTech Connect (OSTI)

    Nayar, R. Daniel

    2005-08-01

    Internet Protocol (IP) address management is an increasingly growing concern at Sandia National Laboratories (SNL) and the networking community as a whole. The current state of the available IP addresses indicates that they are nearly exhausted. Currently SNL doesn't have the justification to obtain more IP address space from Internet Assigned Numbers Authority (IANA). There must exist a local entity to manage and allocate IP assignments efficiently. Ongoing efforts at Sandia have been in the form of a multifunctional database application notably known as Network Information System (NWIS). NWIS is a database responsible for a multitude of network administrative services including IP address management. This study will explore the feasibility of augmenting NWIS's IP management capabilities utilizing open source tools. Modifications of existing capabilities to better allocate available IP address space are studied.

  11. polyurethane foam Goods, S.H.; Neuschwanger, C.L.; Henderson...

    Office of Scientific and Technical Information (OSTI)

    Mechanical properties and energy absorption characteristics of a polyurethane foam Goods, S.H.; Neuschwanger, C.L.; Henderson, C.; Skala, D.M. 36 MATERIALS SCIENCE; FOAMS;...

  12. IDS120j WITHOUT RESISTIVE MAGNETS MODIFYING Hg MODULE ( NEW SH#1 REGION + Hg POOL LENGTH)

    E-Print Network [OSTI]

    McDonald, Kirk

    IDS120j WITHOUT RESISTIVE MAGNETS MODIFYING Hg MODULE ( NEW SH#1 REGION + Hg POOL LENGTH) Nicholas CRYO#1 WAS DECIDED DURING THE LAST MEETING AND AN EXTENSION OF THE Hg POOL UPSTREAM UP TO ~ - 100 cm FROM SIMULATIONS WITH MODIFIED Hg POOL AND SH#1 REGION

  13. Parallel Folding Pathways in the SH3 Domain Protein , J. M. Borreguero2

    E-Print Network [OSTI]

    Buldyrev, Sergey

    Parallel Folding Pathways in the SH3 Domain Protein A. R. Lam1 , J. M. Borreguero2 , F. Ding3 , N of protein conformations with an equal probability to fold or unfold. Its characterization is crucial for an understanding of the folding process. We determined the TSE of the src-SH3 domain protein by using extensive

  14. Composition and temporal dynamics of a temperate rocky cryptobenthic sh assemblage

    E-Print Network [OSTI]

    explained by the arrival of new recruits of some of the most abundant species in the assemblage. Assemblage). The ecological importance of cryptobenthic ¢sh, as energy mediators (Depczynski & Bellwood, 2003), justi¢es an increased e¡ort aimed at a deeper understanding of this overlooked component of the rocky coast ¢sh

  15. Lessons Learned in the Design and Use of IP1 / IP2 Flexible Packaging - 13621

    SciTech Connect (OSTI)

    Sanchez, Mike; Reeves, Wendall; Smart, Bill

    2013-07-01

    For many years in the USA, Low Level Radioactive Waste (LLW), contaminated soils and construction debris, have been transported, interim stored, and disposed of, using IP1 / IP2 metal containers. The performance of these containers has been more than adequate, with few safety occurrences. The containers are used under the regulatory oversight of the US Department of Transportation (DOT), 49 Code of Federal Regulations (CFR). In the late 90's the introduction of flexible packaging for the transport, storage, and disposal of low level contaminated soils and construction debris was introduced. The development of flexible packaging came out of a need for a more cost effective package, for the large volumes of waste generated by the decommissioning of many of the US Department of Energy (DOE) legacy sites across the US. Flexible packaging had to be designed to handle a wide array of waste streams, including soil, gravel, construction debris, and fine particulate dust migration. The design also had to meet all of the IP1 requirements under 49CFR 173.410, and be robust enough to pass the IP2 testing 49 CFR 173.465 required for many LLW shipments. Tens of thousands of flexible packages have been safely deployed and used across the US nuclear industry as well as for hazardous non-radioactive applications, with no recorded release of radioactive materials. To ensure that flexible packages are designed properly, the manufacturer must use lessons learned over the years, and the tests performed to provide evidence that these packages are suitable for transporting low level radioactive wastes. The design and testing of flexible packaging for LLW, VLLW and other hazardous waste streams must be as strict and stringent as the design and testing of metal containers. The design should take into consideration the materials being loaded into the package, and should incorporate the right materials, and manufacturing methods, to provide a quality, safe product. Flexible packaging can be shown to meet the criteria for safe and fit for purpose packaging, by meeting the US DOT regulations, and the IAEA Standards for IP-1 and IP-2 including leak tightness. (authors)

  16. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins ¡ Adrian Perrig Ion hosts is denial- of-service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop ­ not the net- work ­ should be given control to respond to packet floods and overload. Ideally, hosts should

  17. Experimental Comparison of Handoff Performance of SIGMA and Mobile IP

    E-Print Network [OSTI]

    Atiquzzaman, Mohammed

    to be eight seconds which is significantly higher than the six milliseconds handoff latency of SIGMA. The restExperimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan;1 Experimental Comparison of Handoff Performance of SIGMA and Mobile IP Surendra Kumar Sivagurunathan, Justin

  18. The IPS Compiler: Optimizations, Variants and Concrete Efficiency

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    The IPS Compiler: Optimizations, Variants and Concrete Efficiency Yehuda Lindell Eli Oxman Benny, it is black-box in the underlying semi-honest protocol, and it has excellent asymptotic efficiency. In this paper, we study the IPS compiler from a number different angles. We present an efficiency improvement

  19. Hardware IP Protection during Evaluation Using Embedded Sequential Trojan

    E-Print Network [OSTI]

    Bhunia, Swarup

    encryption and vendor-specific toolsets, which may be unacceptable due to lack of flexibility to use in-house IPs from piracy and reverse- engineering include passive defenses like watermarking [1] as well. It creates the possibility of a design house illegally using an IP in an IC design or selling it to external

  20. Security Challenges in the IP-based Internet of Things

    E-Print Network [OSTI]

    Security Challenges in the IP-based Internet of Things Tobias Heer , Oscar Garcia-Morchon , Ren.garcia,sye.loong.keoh,sandeep.kumar}@philips.com Abstract. A direct interpretation of the term Internet of Things refers to the use of standard Internet of standard IP security protocols. Keywords: Security, Internet of Things, IETF 1 Introduction The Internet

  1. plTW ScholArShIpS for INcomINg The OSU admission application serves as the primary scholarship

    E-Print Network [OSTI]

    within the College of Engineering, Architecture and Technology, you will be considered for nearly all OF Engineering, Architecture & Technology pRoject lead the Way scholaRships The College of Engineering, Architecture and Technology is proud to offer nearly $2.3 million in scholarships annually. Thanks

  2. Population SAMC, ChIP-chip Data Analysis and Beyond 

    E-Print Network [OSTI]

    Wu, Mingqi

    2011-02-22

    This dissertation research consists of two topics, population stochastics approximation Monte Carlo (Pop-SAMC) for Baysian model selection problems and ChIP-chip data analysis. The following two paragraphs give a brief introduction to each...

  3. Universal IP multicast delivery Beichuan Zhang a,*, Wenjie Wang b

    E-Print Network [OSTI]

    Massey, Dan

    it is available, and automatically build unicast tunnels to connect IP Multicast ``islands'' to form an overall mechanisms we adopted to support end hosts behind Network Address Translation (NAT) gateways and firewalls. Ó

  4. Performance comparison of native ATM vs IP over ATM 

    E-Print Network [OSTI]

    Mohammed, Shajiuddin Asif

    1998-01-01

    engineers through its high bandwidth and multi traffic support. The robustness of the Internet Protocol (115 contributed to massive increase in Internet hosts globally. IP is a connectionless protocol as opposed to ATM, which is connection oriented...

  5. IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans

    E-Print Network [OSTI]

    Nagy, Anikó I.; Vázquez-Manrique, Rafael P.; Lopez, Marie; Christov, Christo; Sequedo, María Dolores; Herzog, Mareike; Herlihy, Anna E; Bodak, Maxime; Gatsi, Roxani; Baylis, Howard A.

    2015-01-21

    -proteins acting downstream of GPCRs [34]. Thus signalling through a GPCR may be important to the alterations in RNAi sensitivity. Increased IP3 signalling causes RNAi resistance. To ascertain whether IP3 signalling is capable of modulating the RNAi... : cgcgttcaccactcgaccaccgaac and tttttatgggttttggtaggttttag) [7], a 1.19 kb promoter region of unc-47 (terminal sequences: gatcccggaacagtcg and ctgtaatgaaataaatgt) were amplified from genomic DNA and cloned upstream of the itr-1 cDNA using restriction enzyme splicing...

  6. Analysis of the mouse embryonic stem cell regulatory networks obtained by ChIP-chip and ChIP-PET

    E-Print Network [OSTI]

    Mathur, Divya

    Background: Genome-wide approaches have begun to reveal the transcriptional networks responsible for pluripotency in embryonic stem (ES) cells. Chromatin Immunoprecipitation (ChIP) followed either by hybridization to a ...

  7. Le LHC, un tunnel cosmique

    ScienceCinema (OSTI)

    None

    2011-10-06

    Et si la lumière au bout du tunnel du LHC était cosmique ? En d?autres termes, qu?est-ce que le LHC peut nous apporter dans la connaissance de l?Univers ? Car la montée en énergie des accélérateurs de particules nous permet de mieux appréhender l?univers primordial, chaud et dense. Mais dans quel sens dit-on que le LHC reproduit des conditions proches du Big bang ? Quelles informations nous apporte-t-il sur le contenu de l?Univers ? La matière noire est-elle détectable au LHC ? L?énergie noire ? Pourquoi l?antimatière accumulée au CERN est-elle si rare dans l?Univers ? Et si le CERN a bâti sa réputation sur l?exploration des forces faibles et fortes qui opèrent au sein des atomes et de leurs noyaux, est-ce que le LHC peut nous apporter des informations sur la force gravitationnelle qui gouverne l?évolution cosmique ? Depuis une trentaine d?années, notre compréhension de l?univers dans ses plus grandes dimensions et l?appréhension de son comportement aux plus petites distances sont intimement liées : en quoi le LHC va-t-il tester expérimentalement cette vision unifiée ? Tout public, entrée libre / Réservations au +41 (0)22 767 76 76

  8. Probing the Magnetized Interstellar Medium Surrounding the Planetary Nebula Sh 2-216

    E-Print Network [OSTI]

    Ryan Ransom; Bulent Uyaniker; Roland Kothes; Tom Landecker

    2008-06-09

    We present 1420 MHz polarization images of a 2.5 X 2.5 degree region around the planetary nebula (PN) Sh 2-216. The images are taken from the Canadian Galactic Plane Survey (CGPS). An arc of low polarized intensity appears prominently in the north-east portion of the visible disk of Sh 2-216, coincident with the optically identified interaction region between the PN and the interstellar medium (ISM). The arc contains structural variations down to the ~1 arcminute resolution limit in both polarized intensity and polarization angle. Several polarization-angle "knots" appear along the arc. By comparison of the polarization angles at the centers of the knots and the mean polarization angle outside Sh 2-216, we estimate the rotation measure (RM) through the knots to be -43 +/- 10 rad/m^2. Using this estimate for the RM and an estimate of the electron density in the shell of Sh 2-216, we derive a line-of-sight magnetic field in the interaction region of 5.0 +/- 2.0 microG. We believe it more likely the observed magnetic field is interstellar than stellar, though we cannot completely dismiss the latter possibility. We interpret our observations via a simple model which describes the ISM magnetic field around Sh 2-216, and comment on the potential use of old PNe as probes of the magnetized ISM.

  9. Structure of the SH3 domain of human osteoclast-stimulating factor at atomic resolution

    SciTech Connect (OSTI)

    Chen, Liqing Wang, Yujun; Wells, David; Toh, Diana; Harold, Hunt; Zhou, Jing; DiGiammarino, Enrico; Meehan, Edward J.

    2006-09-01

    The crystal structure of the SH3 domain of human osteoclast-stimulating factor has been determined and refined to the ultrahigh resolution of 1.07 Å. The structure at atomic resolution provides an accurate framework for structure-based design of its inhibitors. Osteoclast-stimulating factor (OSF) is an intracellular signaling protein, produced by osteoclasts themselves, that enhances osteoclast formation and bone resorption. It is thought to act via an Src-related signaling pathway and contains SH3 and ankyrin-repeat domains which are involved in protein–protein interactions. As part of a structure-based anti-bone-loss drug-design program, the atomic resolution X-ray structure of the recombinant human OSF SH3 domain (hOSF-SH3) has been determined. The domain, residues 12–72, yielded crystals that diffracted to the ultrahigh resolution of 1.07 Å. The overall structure shows a characteristic SH3 fold consisting of two perpendicular ?-sheets that form a ?-barrel. Structure-based sequence alignment reveals that the putative proline-rich peptide-binding site of hOSF-SH3 consists of (i) residues that are highly conserved in the SH3-domain family, including residues Tyr21, Phe23, Trp49, Pro62, Asn64 and Tyr65, and (ii) residues that are less conserved and/or even specific to hOSF, including Thr22, Arg26, Thr27, Glu30, Asp46, Thr47, Asn48 and Leu60, which might be key to designing specific inhibitors for hOSF to fight osteoporosis and related bone-loss diseases. There are a total of 13 well defined water molecules forming hydrogen bonds with the above residues in and around the peptide-binding pocket. Some of those water molecules might be important for drug-design approaches. The hOSF-SH3 structure at atomic resolution provides an accurate framework for structure-based design of its inhibitors.

  10. Anchorages For FRPby M.A. Erki and S.H. Rizkalla ommercially available fiber-

    E-Print Network [OSTI]

    , and describes the products available commercially. Fiber reinforced plastic (FRP) rein- forcement has already-tensioning and post-tensioning. Wedge-type an- chorages were recently introduced for carbon and aramid fiber tendonsAnchorages For FRPby M.A. Erki and S.H. Rizkalla C ommercially available fiber- based reinforcement

  11. UNITED STATES DEPARTMEl\\1T OF THE I NTERI OR FI SH AND WILDLIFE SERVICE

    E-Print Network [OSTI]

    UNITED STATES DEPARTMEl\\1T OF THE I NTERI OR FI SH AND WILDLIFE SERVICE Washington} D. C. } 20240. A simple penetrometer for the measurement of texture ch::mges in canned salmon. Gulf States shrimp cinnin on spoil age characteri stics. Equi pment Kote #8 - New hydraulically driven block speeds hauling crab -pot

  12. SH3BP2 is an activator of NFAT activity and osteoclastogenesis

    SciTech Connect (OSTI)

    Lietman, Steven A. [Department of Orthopaedic Surgery, Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195 (United States); Department of Biomedical Engineering, Cleveland Clinic Foundation, Cleveland, OH 44195 (United States)], E-mail: lietmas@ccf.org; Yin Lihong [Department of Orthopaedic Surgery, Cleveland Clinic Foundation, 9500 Euclid Avenue, Cleveland, OH 44195 (United States); Department of Biomedical Engineering, Cleveland Clinic Foundation, Cleveland, OH 44195 (United States); Levine, Michael A. [The Division of Endocrinology, The Children's Hospital of Philadelphia, 34th and Civic Center Boulevard, Philadelphia, PA 19104 (United States)

    2008-07-11

    Heterozygous activating mutations in exon 9 of SH3BP2 have been found in most patients with cherubism, an unusual genetic syndrome characterized by excessive remodeling of the mandible and maxilla due to spontaneous and excessive osteoclastic bone resorption. Osteoclasts differentiate after binding of sRANKL to RANK induces a number of downstream signaling effects, including activation of the calcineurin/NFAT (nuclear factor of activated T cells) pathway. Here, we have investigated the functional significance of SH3BP2 protein on osteoclastogenesis in the presence of sRANKL. Our results indicate that SH3BP2 both increases nuclear NFATc1 in sRANKL treated RAW 264.7 preosteoclast cells and enhances expression of tartrate resistant acid phosphatase (TRAP), a specific marker of osteoclast differentiation. Moreover, overexpression of SH3BP2 in RAW 264.7 cells potentiates sRANKL-stimulated phosphorylation of PLC{gamma}1 and 2, thus providing a mechanistic pathway for the rapid translocation of NFATc1 into the nucleus and increased osteoclastogenesis in cherubism.

  13. BUCKLING BEHAVIOUR OF WOODEN POLES J. Savic" S.H. Rizkalla2

    E-Print Network [OSTI]

    BUCKLING BEHAVIOUR OF WOODEN POLES by J. Savic" S.H. Rizkalla2 , D. Polyzois3 , and C. K. Wong' ABSTRACT Woodc:n poles are popular structural elements currently used by Manitoba Hydro for distribution lines and transmission towers. In recent years, a considerable number of such poles have failed duc

  14. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Chan, Chee Yong

    of the up-to-date band- width utilizations and path latencies is critical for numerous im- portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  15. Efficiently Monitoring Bandwidth and Latency in IP Networks

    E-Print Network [OSTI]

    Garofalakis, Minos

    of the up­to­date band­ width utilizations and path latencies is critical for numerous im­ portant network the challenging problem of efficiently monitoring bandwidth utilization and path latencies in an IP data network of links or packet flows, and (b) path latencies for a given set of paths, while minimizing the overhead

  16. IP ROUTING ISSUES IN SATELLITE CONSTELLATION NETWORKS A. CLERGET,2

    E-Print Network [OSTI]

    Wood, Lloyd

    constellation networks; Internet Protocol (IP); routing; tunnelling; Multi-Protocol Label Switching (MPLS); Border Gateway Protocol (BGP); Quality of Service (QoS); multicast. 1 INTRODUCTION Satellite; in conjunction with its terrestrial gateway stations it forms an autonomous system (AS). Over the same period

  17. CIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic

    E-Print Network [OSTI]

    Gorinsky, Sergey

    transit links. In- tuitively, the less traffic of an ISP flows through those links, the lower the costCIPT: Using Tuangou to Reduce IP Transit Costs Rade Stanojevic Ignacio Castro Sergey Gorinsky prices per Mbps de- cline steadily, the overall transit costs of these ISPs remain high or even increase

  18. Quantitative Visualization of ChIP-chip Data by Using Linked...

    Office of Scientific and Technical Information (OSTI)

    Quantitative Visualization of ChIP-chip Data by Using Linked Views Citation Details In-Document Search Title: Quantitative Visualization of ChIP-chip Data by Using Linked Views...

  19. Mobility Modeling and Handoff Analysis for IP/MPLS-Based Cellular Networks

    E-Print Network [OSTI]

    Boutaba, Raouf

    that every Foreign Agent (FA) has the functionality of a FA and Gateway Foreign Agent (GFA). However by removing the need for IP-in- IP tunneling from the HA to the FA using Label Switched Paths (LSPs). However

  20. An approach for improving performance of aggregate voice-over-IP traffic 

    E-Print Network [OSTI]

    Al-Najjar, Camelia

    2006-10-30

    The emerging popularity and interest in Voice-over-IP (VoIP) has been accompanied by customer concerns about voice quality over these networks. The lack of an appropriate real-time capable infrastructure in packet networks ...

  1. OUTLOOK 2007 -Configuration POP 1. Slectionnez le menu Outils

    E-Print Network [OSTI]

    Charette, André

    OUTLOOK 2007 - Configuration POP 1. Sélectionnez le menu Outils 2. Sélectionnez le menu Paramètres. Cliquez sur le bouton Suivant 20. Cliquez sur le bouton Terminer. #12;OUTLOOK 2007 - Configuration IMAP 1

  2. Automate avec sortie Automates et le temps

    E-Print Network [OSTI]

    Grigoras, .Romulus

    Automate avec sortie Automates et le temps Automates et l'inni Automates avec contrôle auxiliaire Généralisations Philippe Quéinnec 3 janvier 2011 1 / 26 #12;Automate avec sortie Automates et le temps Automates et l'inni Automates avec contrôle auxiliaire Plan 1 Automate avec sortie 2 Automates et le temps 3

  3. LE CONTRLE DE GESTION LOGISTIQUE HOSPITALIER

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    , approvisionnement, transport, courrier, etc. Des réformes du management hospitalier français ont introduit une hospitalière dans le management des établissements hospitaliers, la forme qu'exerce le contrôle de gestion1 LE CONTRÔLE DE GESTION LOGISTIQUE HOSPITALIER Nicolas PETIT, doctorant à l'IGR-IAE de l

  4. Security Through Obscurity: An Approach for Protecting Register Transfer Level Hardware IP

    E-Print Network [OSTI]

    Bhunia, Swarup

    Property (IP) cores. Recent trends of IP piracy and reverse-engineering are causing major revenue loss piracy, RTL obfuscation. I. INTRODUCTION Recent trends in IP-piracy and reverse-engineering efforts that is functionally equivalent to the original but is significantly more difficult to reverse engineer [11]. Software

  5. Assessment of VoIP Service Availability in the Current Internet

    E-Print Network [OSTI]

    Kaiser, Gail E.

    Assessment of VoIP Service Availability in the Current Internet Wenyu Jiang Department of Computer Science Columbia University Email: hgs@cs.columbia.edu Abstract-- We evaluate the availability of voice over IP (VoIP) service typically achieved in the current Internet. Service avail- ability is examined

  6. Le Modle des Espaces de Travail I. Introduction.............................................................. 14

    E-Print Network [OSTI]

    Donsez, Didier

    Chapitre 3 Le Modèle des Espaces de Travail I. Introduction.............................................................. 14 II. Le Modèle Client-Serveur ........................................14 III. Le Modèle des Espaces de Travail.............................20 IV. Espaces de Travail et Services

  7. MeSH key terms for validation and annotation of gene expression clusters

    SciTech Connect (OSTI)

    Rechtsteiner, A. (Andreas); Rocha, L. M. (Luis Mateus)

    2004-01-01

    Integration of different sources of information is a great challenge for the analysis of gene expression data, and for the field of Functional Genomics in general. As the availability of numerical data from high-throughput methods increases, so does the need for technologies that assist in the validation and evaluation of the biological significance of results extracted from these data. In mRNA assaying with microarrays, for example, numerical analysis often attempts to identify clusters of co-expressed genes. The important task to find the biological significance of the results and validate them has so far mostly fallen to the biological expert who had to perform this task manually. One of the most promising avenues to develop automated and integrative technology for such tasks lies in the application of modern Information Retrieval (IR) and Knowledge Management (KM) algorithms to databases with biomedical publications and data. Examples of databases available for the field are bibliographic databases c ntaining scientific publications (e.g. MEDLINE/PUBMED), databases containing sequence data (e.g. GenBank) and databases of semantic annotations (e.g. the Gene Ontology Consortium and Medical Subject Headings (MeSH)). We present here an approach that uses the MeSH terms and their concept hierarchies to validate and obtain functional information for gene expression clusters. The controlled and hierarchical MeSH vocabulary is used by the National Library of Medicine (NLM) to index all the articles cited in MEDLINE. Such indexing with a controlled vocabulary eliminates some of the ambiguity due to polysemy (terms that have multiple meanings) and synonymy (multiple terms have similar meaning) that would be encountered if terms would be extracted directly from the articles due to differing article contexts or author preferences and background. Further, the hierarchical organization of the MeSH terms can illustrate the conceptuallfunctional relationships of genes associated with MeSH terms. MeSH terms can be associated with genes through co-occurrence of these in MEDLINE citations, i.e. the genes occur in titles or abstracts and the MeSH terms are assigned by experts. To identify MeSH terms associated with a group of genes we used the tool MESHGENE developed at the Information Dynamics Lab at HP Labs (http://www-idl.hpl.hp.com/meshgene/). When presented with a list of human genes, MESHGENE uses some sophisticated techniques to search for these gene symbols in the titles and abstracts of all MEDLINE citations. MeSH terms and the number of co-occurrences can be retrieved. Gene symbols that are aliases of each other are pooled from several databases. This addresses the problem of synonymy, the fact that several symbols can refer to the same gene. MESHGENE employs some sophisticated algorithms that disregards symbols that are likely to be acronyms for other concepts than a gene. This addresses the problem of polysemy, i.e. possible multiple meanings of a gene symbol. We applied our approach to gene expression data from herpes virus infected human fibroblast cells. The data contains 12 time-points, between 1/2 hrs and 48 hrs after infection. Singular Value Decomposition was used to identify the dominant modes of expression. 75% of the variance in the expression data was captured by the first two modes, the first exhibiting a monotonly increasing expression pattern and the second a more transient pattern. Projection of the gene expression vectors onto this first two modes identified 3 statistically significant clusters of co-expressed genes. 500 genes from cluster 1 and 300 genes from clusters 2 and 3 each were uploaded to MESHGENE and the MeSH terms and co-occurrence values were retrieved. MeSH terms were also obtained for 5 groups of randomly selected genes with similar numbers of genes. The log was taken of the co-occurrence values and for each MeSH term these log co-occurrence values were summed for each group over the genes in that group. A matrix with 8 columns for the 8 groups of genes and with 14,000 rows with the MeSH terms

  8. http://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006_05_06.doc created 2006_04_30 printed: 5/7/2006

    E-Print Network [OSTI]

    Adler, Joan

    ) IPS signed an Agreement with the American Physical Society (APS) www.aps.org All IPS members advantage of our reciprocal arrangements with EPS, APS and IOP · Strengthen our ability to promote physicshttp://physics.technion.ac.il/~ips/webIsrael Physical Society Prof. Cezar Bruma IPS_Join_to_2006

  9. In vivo pool-based shRNA screens to identify modulators of disease progression in hematopoietic malignancies

    E-Print Network [OSTI]

    Meacham, Corbin Elizabeth

    2012-01-01

    shRNA screens have been very effective in identifying novel cancer genes in mammalian cells, but they have primarily been limited to in vitro applications in tumor cell lines. Whereas in vivo retroviral mutagenesis screens ...

  10. La quête du bonheur en France au 18e siècle : le bonheur individuel et le bonheur collectif dans le roman utopique, libertin et sentimental

    E-Print Network [OSTI]

    Fernandez-Nurdin, Delphine Isabelle

    2009-06-15

    Cette thèse se propose d'examiner le concept du bonheur qui semble être devenu une préoccupation majeure au XVIIIe siècle en France. Or, si le bonheur individuel et le bonheur collectif sont tous deux recherchés, ils ne ...

  11. Nonlinear dust acoustic waves and shocks R. L. Merlino, J. R. Heinrich, S.-H. Hyun, and J. K. Meyer

    E-Print Network [OSTI]

    Merlino, Robert L.

    Nonlinear dust acoustic waves and shocks R. L. Merlino, J. R. Heinrich, S.-H. Hyun, and J. K. Meyer, 032110 (2012) Planar and non-planar dust ion-acoustic solitary waves in a quantum dusty electronegative://pop.aip.org/about/rights_and_permissions #12;Nonlinear dust acoustic waves and shocksa) R. L. Merlino,b) J. R. Heinrich, S.-H. Hyun, and J. K

  12. JOURNEE MONDIALE DE LUTTE CONTRE LE SIDA 2014 LE PROGRAMME BREST

    E-Print Network [OSTI]

    Brest, Université de

    ludique « sexe et chocolat ». - Sur le temps de midi, les infirmiers du SUMPPS de l'UBO et les étudiants

  13. Tecnologie ICT per le Smart City Prof. R. Laurini Tecnologie ICT per le Smart City

    E-Print Network [OSTI]

    Laurini, Robert

    Tecnologie ICT per le Smart City Prof. R. Laurini 1 Tecnologie ICT per le Smart City 1 ­ Le smart-fertilization tra ICT e Smart City 4 ­ Problemi emergenti 5 ­ Conclusioni Definizione di Carlo Ratti (MIT) · Una, efficiente, ­ aperta, collaborativa, ­ creativa, digitale ­ e green European Smart Cities · Volendo essere

  14. Characterization of a novel weak interaction between MUC1 and Src-SH3 using nuclear magnetic resonance spectroscopy

    SciTech Connect (OSTI)

    Gunasekara, Nirosha [Department of Laboratory Medicine and Pathology, University of Alberta, 5B4.21 WCM Health Science Centre, 8440-112th Street, Edmonton, Alberta, Canada T6G 2R7 (Canada)] [Department of Laboratory Medicine and Pathology, University of Alberta, 5B4.21 WCM Health Science Centre, 8440-112th Street, Edmonton, Alberta, Canada T6G 2R7 (Canada); Sykes, Brian, E-mail: brian.sykes@ualberta.ca [Department of Biochemistry, 4-19B Medical Sciences Bldg., University of Alberta Edmonton, Alberta, Canada T6G 2H7 (Canada)] [Department of Biochemistry, 4-19B Medical Sciences Bldg., University of Alberta Edmonton, Alberta, Canada T6G 2H7 (Canada); Hugh, Judith, E-mail: judithh@ualberta.ca [Department of Laboratory Medicine and Pathology, University of Alberta, 5B4.21 WCM Health Science Centre, 8440-112th Street, Edmonton, Alberta, Canada T6G 2R7 (Canada)] [Department of Laboratory Medicine and Pathology, University of Alberta, 5B4.21 WCM Health Science Centre, 8440-112th Street, Edmonton, Alberta, Canada T6G 2R7 (Canada)

    2012-05-18

    Highlights: Black-Right-Pointing-Pointer MUC1 binds the Src-SH3 domain potentially triggering Src dependent cell migration. Black-Right-Pointing-Pointer NMR Spectroscopy was used to monitor MUC1-CD and Src SH3 domain titrations. Black-Right-Pointing-Pointer MUC1-CD peptides bind with a low affinity (K{sub d} of 2-3 mM) to a non-canonical site. Black-Right-Pointing-Pointer Weak interactions may mediate dynamic processes like migration. Black-Right-Pointing-Pointer The MUC1-CD and Src-SH3 interaction may be a prime target to inhibit cell migration. -- Abstract: Breast cancer causes death through cancer cell migration and subsequent metastasis to distant organs. In vitro, the MUC1 mucin can mediate breast cancer cell migration by binding to intercellular adhesion molecule-1 (ICAM-1). This migration is dependent on MUC1 cytoplasmic domain (MUC1-CD) activation of the non-receptor tyrosine kinase, Src, possibly through competitive displacement of an inhibitory Src intramolecular SH3 binding. Therefore, we characterized the binding site and affinity of the MUC1-CD for Src-SH3 using multidimensional nuclear magnetic resonance (NMR) spectroscopy to monitor the titration of the {sup 15}N labeled Src-SH3 domain with synthetic native and mutant peptides of MUC1-CD. The results revealed that the dissociation constant (K{sub d}) for the interaction of the native MUC1-CD peptides and Src-SH3 domain was weak with a K{sub d} of 2-3 mM. Notably, the SH3 residues most perturbed upon peptide binding were located outside the usual hydrophobic binding cleft in a previously described alternate binding site on the Src-SH3, suggesting that MUC1-CD binds to a non-canonical site. The binding characteristics outlined here suggest that the interaction between Src-SH3 and MUC1-CD represents a novel weak electrostatic interaction of the type which is increasingly recognized as important in transient and dynamic protein complexes required for cell migration and signal transduction. As such, this study forms the foundation for the design of specific inhibitors of this interaction which may target breast cancer metastases with exquisite specificity.

  15. Case history: 3-D shear-wave processing and interpretation in radial-transverse (SV-SH) coordi-James L. Simmons, Jr.*, Milo M. Backus, Bob A. Hardage, and Robert J. Graebner

    E-Print Network [OSTI]

    Texas at Austin, University of

    of the strong low-frequency SH reflection package at the Morrow level. These statics clearly improve the alignment of the SH head waves, the SH reflections, the SV head waves, and the SV-P-SV head waves. The complexity of the head waves on SV contrasts with the simple SH first arrivals. It is easy to see how

  16. Minute of proceedings from the IP, Competition and Human Rights conference 

    E-Print Network [OSTI]

    Waelde, Charlotte

    Minute of proceedings from the IP, Competition and Human Rights conference, chaired by Waelde and Brown. The meeting was held in Edinburgh during 2004....

  17. Le Nigeria sous Obasanjo. Violences et dmocratie

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    #12;5 LE DOSSIER Le Nigeria sous Obasanjo. Violences et démocratie Coordonné par Laurent Fourchard Nigeria Au Nigeria, de nombreux journalistes et chercheurs ont associé la réémer- gence de conflits'au Nigeria il soit à peine plus aisé de compter les morts que de recenser les vivants2. La comparaison 1. Je

  18. Service des finances Le saviez-vous ?

    E-Print Network [OSTI]

    respectant les normes ISO 14 024. De plus, ces certifications attestent que les produits certifiés ont étéService des finances Le saviez-vous ? Les certifications de produits Approvisionnement responsable Penser autrement, acheter mieux ! Les certifications officielles sont le meilleur moyen de repérer

  19. Linear Collider Test Facility: Twiss Parameter Analysis at the IP/Post-IP Location of the ATF2 Beam Line

    SciTech Connect (OSTI)

    Bolzon, Benoit; /Annecy, LAPP; Jeremie, Andrea; /Annecy, LAPP; Bai, Sha; /Beijing, Inst. High Energy Phys.; Bambade, Philip; /KEK, Tsukuba; White, Glen; /SLAC

    2012-07-02

    At the first stage of the ATF2 beam tuning, vertical beam size is usually bigger than 3 {micro}m at the IP. Beam waist measurements using wire scanners and a laser wire are usually performed to check the initial matching of the beam through to the IP. These measurements are described in this paper for the optics currently used ({beta}{sub x} = 4cm and {beta}{sub y} = 1mm). Software implemented in the control room to automate these measurements with integrated analysis is also described. Measurements showed that {beta} functions and emittances were within errors of measurements when no rematching and coupling corrections were done. However, it was observed that the waist in the horizontal (X) and vertical (Y) plane was abnormally shifted and simulations were performed to try to understand these shifts. They also showed that multiknobs are needed in the current optics to correct simultaneously {alpha}{sub x}, {alpha}{sub y} and the horizontal dispersion (D{sub x}). Such multiknobs were found and their linearity and orthogonality were successfully checked using MAD optics code. The software for these multiknobs was implemented in the control room and waist scan measurements using the {alpha}{sub y} knob were successfully performed.

  20. Sh2-138: Physical environment around a small cluster of massive stars

    E-Print Network [OSTI]

    Baug, T; Dewangan, L K; Ninan, J P; Bhatt, B C; Ghosh, S K; Mallick, K K

    2015-01-01

    We present a multi-wavelength study of the Sh2-138, a Galactic compact H II region. The data comprise of optical and near-infrared (NIR) photometric and spectroscopic observations from the 2-m Himalayan Chandra Telescope, radio observations from the Giant Metrewave Radio Telescope (GMRT), and archival data covering radio through NIR wavelengths. A total of 10 Class I and 54 Class II young stellar objects (YSOs) are identified in a 4'.6$\\times$4'.6 area of the Sh2-138 region. Five compact ionized clumps, with four lacking of any optical or NIR counterparts, are identified using the 1280 MHz radio map, and correspond to sources with spectral type earlier than B0.5. Free-free emission spectral energy distribution fitting of the central compact H II region yields an electron density of ~2250$\\pm$400 cm$^{-3}$. With the aid of a wide range of spectra, from 0.5-15 $\\mu m$, the central brightest source - previously hypothesised to be the main ionizing source - is characterized as a Herbig Be type star. At large scal...

  1. Stochastic TCO minimization for Video Transmission over IP Networks

    E-Print Network [OSTI]

    Goudarzi, Pejman

    2012-01-01

    From the viewpoint of service operators the Total Cost of Ownership (TCO) for developing a communication service comprises from two parts; CAPital EXpenditure (CAPEX) and OPerational EXpenditure (OPEX). These two types of costs are interrelated and affect any service provider's deployment strategy. In many traditional methods, selection of critical elements of a new service is performed in a heuristic manner aimed at reducing only the OPEX part of the TCO which is not necessarily optimal. Furthermore, exact cost modeling for such services is not always possible and contains some uncertainties. In the current work, after cost modeling of each video streaming element by capturing the effect of the model uncertainties, the TCO optimization problem for video streaming over IP networks is formulated as a stochastic optimization problem. The solution of the proposed optimization problem can cope with the cost modeling uncertainties and track the dynamism in the TCO and lead to a time-varying optimal solution. Numer...

  2. Taming IP Packet Flooding Attacks Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion Stoica

    E-Print Network [OSTI]

    Perrig, Adrian

    Taming IP Packet Flooding Attacks #3; Karthik Lakshminarayanan Daniel Adkins y Adrian Perrig Ion hosts is denial­ of­service (DoS) caused by IP packet floods. Hosts in the Internet are unable to stop -- not the net­ work -- should be given control to respond to packet floods and overload. Ideally, hosts should

  3. 9.IP.002.5.en.do Item 5: Obs

    E-Print Network [OSTI]

    Wauben, Wiel

    latter Vaisala stitute ng the sensor port. 9-IP/2 #12;AMOFSG/9-IP/2 - 2 - 2. SOLUTION AND EVALUATION 2 KNMI decide OR at civil ai International forward scatte used for visib ficant reductio r sensors hav forecasting a EOROLOG FORWARD (Present SU s in the meteo er sensors hav ts in the meas nsor firmwar es

  4. Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support

    E-Print Network [OSTI]

    Schwefel, Hans-Peter

    Page 1 Hans Peter Schwefel Wireless Networks III, Fall 2005: MM1, IP Mobility Support Wireless@kom.auc.dk http://www.kom.auc.dk/~hps http://www.kom.auc.dk/~tatiana · Mm1 IP Mobility Support (HPS) · Mm2 Wireless TCP (HPS) · Mm3 Wireless applications, SIP & IMS (HPS) · Mm4 Ad-hoc Networks I (TKM) · Mm5 Ad

  5. Econometric Feedback for Runtime Risk Management in VoIP Architectures

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Econometric Feedback for Runtime Risk Management in VoIP Architectures Oussema Dabbebi, R. Risk management provides new perspectives for addressing this issue. Risk models permit to reduce-configuration strategy for support- ing runtime risk management in VoIP architectures. This strategy aims

  6. BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203

    E-Print Network [OSTI]

    BH-2 Mainframe Chassis 65-0200 IP-2 Iontophoresis Pump Module 65-0203 PPM-2 Pneumatic Pump Module Module ..............6 MS-2 Power Supply ..........................................6 IP-2 Pump Module ..............................................7-8 PPM-2 Pneumatic Pump Module ..........................9 Recommended Setup Procedure

  7. Low-Latency Mobile IP Hando for Infrastructure-Mode Wireless LANs

    E-Print Network [OSTI]

    Chiueh, Tzi-cker

    Low-Latency Mobile IP Hando#11; for Infrastructure-Mode Wireless LANs Srikant Sharma Ningning Zhu roaming through multiple wireless LAN segments. However, the peculiarities of commer- cially available 802.11b wireless LAN hardware prevent existing mobile IP implementations from achieving sub- second Mobile

  8. NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso.

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa, Davide Buscaldi, Paolo Rosso. NLE Lab, ELiRF Research Group, DSIC, Universidad Politécnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the IP@CLEF-2009 competition. We adapted

  9. Recovery from Shared Risk Link Group Failures using IP Fast Reroute

    E-Print Network [OSTI]

    Chao, Jonathan

    and randomly generated topologies. Index Terms--routing, failure recovery, shared risk link group (SRLG), fastRecovery from Shared Risk Link Group Failures using IP Fast Reroute Kang Xi, H. Jonathan Chao}@poly.edu, cguo01@students.poly.edu Abstract--Failure recovery in IP networks is critical to high- quality service

  10. Energy star compliant voice over internet protocol (VoIP) telecommunications network including energy star compliant VoIP devices

    DOE Patents [OSTI]

    Kouchri, Farrokh Mohammadzadeh

    2012-11-06

    A Voice over Internet Protocol (VoIP) communications system, a method of managing a communications network in such a system and a program product therefore. The system/network includes an ENERGY STAR (E-star) aware softswitch and E-star compliant communications devices at system endpoints. The E-star aware softswitch allows E-star compliant communications devices to enter and remain in power saving mode. The E-star aware softswitch spools messages and forwards only selected messages (e.g., calls) to the devices in power saving mode. When the E-star compliant communications devices exit power saving mode, the E-star aware softswitch forwards spooled messages.

  11. A PANCHROMATIC VIEW OF THE RESTLESS SN 2009ip REVEALS THE EXPLOSIVE EJECTION OF A MASSIVE STAR ENVELOPE

    E-Print Network [OSTI]

    Friedman, Andrew Samuel

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. ...

  12. LHC, le Big Bang en éprouvette

    ScienceCinema (OSTI)

    None

    2011-10-06

    Notre compréhension de l?Univers est en train de changer? Bar des Sciences - Tout public Débat modéré par Marie-Odile Montchicourt, journaliste de France Info. Evenement en vidéoconférence entre le Globe de la science et de l?innovation, le bar le Baloard de Montpellier et la Maison des Métallos à Paris. Intervenants au CERN : Philippe Charpentier et Daniel Froideveaux, physiciens au CERN. Intervenants à Paris : Vincent Bontemps, philosophe et chercheur au CEA ; Jacques Arnould, philosophe, historien des sciences et théologien, Jean-Jacques Beineix, réalisateur, producteur, scénariste de cinéma. Intervenants à Montpellier (LPTA) : André Neveu, physicien théoricien et directeur de recherche au CNRS ; Gilbert Moultaka, physicien théoricien et chargé de recherche au CNRS. Partenariat : CERN, CEA, IN2P3, Université MPL2 (LPTA) Dans le cadre de la Fête de la science 2008

  13. agir au Sud avec le Sud et

    E-Print Network [OSTI]

    « moins avancés », tels que le Mozambique, l'Éthiopie et l'Angola. Cer- tains d'entre eux ont connu une Africa (Afrique du Sud, Cap Town); · LBMV, Laboratoire de biotechnologie microbienne et végétale (Maroc

  14. Le Guerrou DISS. ETH NO. 16533

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Erwan Le Guerroué 2006 DISS. ETH NO. 16533 Sedimentology & Chemostratigraphy of the Ediacaran Shuram Formation, Nafun Group, Oman tel-00331341,version1-16Oct2008 #12;DISS. ETH NO. 16533 Sedimentology

  15. Le rane delle risaie Osservazioni sugli Iperolidi del

    E-Print Network [OSTI]

    maschio. I sessi possono tuttavia di- stinguersi notevolmente per la colo- razione: le femmine hanno

  16. Diffraction of dust acoustic waves by a circular cylinder S.-H. Kim, J. R. Heinrich, and R. L. Merlinoa

    E-Print Network [OSTI]

    Merlino, Robert L.

    Diffraction of dust acoustic waves by a circular cylinder S.-H. Kim, J. R. Heinrich, and R. L, 1896 . © 2008 American Institute of Physics. DOI: 10.1063/1.2977986 Dust acoustic DA waves are pressure July 2008; accepted 14 August 2008; published online 23 September 2008 The diffraction of dust acoustic

  17. ABSTRACT FINAL ID: SH51A-1991 TITLE: Three-Dimensional Numerical Simulations of Interaction Between Flux Ropes in the

    E-Print Network [OSTI]

    Ng, Chung-Sang

    Flux Ropes in the Solar Corona SESSION TYPE: Poster SESSION TITLE: SH51A. An Integrated View of Flux is a fundamental process in the solar corona that leads to current-sheet formation, 3D magnetic reconnectionBA71G, and a NSF grant AGS-0962477. KEYWORDS: [7524] SOLAR PHYSICS, ASTROPHYSICS, AND ASTRONOMY

  18. Honours Programmes involving Physics and Astronomy, March 2015 Page 1 Entering SH within Physics and Astronomy and Joint Degrees -2015

    E-Print Network [OSTI]

    Greenaway, Alan

    Honours Programmes involving Physics and Astronomy, March 2015 Page 1 Entering SH within Physics subject to University approvals, we plan to offer BSc Mathematics and Physics students a choice of Maths or Physics project. Some details of the modules open to you are in the University's Course Catalogue

  19. Paris, le 24 janvier 2013 MNAGERIE, LE ZOO DU JARDIN DES PLANTES

    E-Print Network [OSTI]

    ://dsifilex.mnhn.fr/get?k=mac3yq7XA69OYRN5VUp Théodora, 24 ans, est née le 5 mai 1988. Elle est arrivée le 28 novembre 2007 du Cécile Brissaud : 01 40 79 80 75 / brissaud@mnhn.fr Jérôme Munier : 01 40 79 54 42 / munier@mnhn.fr #12;

  20. T-648: Avaya IP Office Manager TFTP Server Lets Remote Users Traverse the Directory

    Broader source: Energy.gov [DOE]

    The software does not properly validate user-supplied input. A remote user can supply a specially crafted request to view files on target system running the IP Office Manager software.

  1. Architecture and Performance Models for Scalable IP Lookup Engines on FPGA*

    E-Print Network [OSTI]

    Hwang, Kai

    requirement of the IP lookup engine. In particular, a simple but realistic model of DDR3 memory is used designs achieve 5.6x ­ 70x the energy efficiency of TCAM, and have performance independent of the prefix

  2. U-107: Cisco NX-OS IP Packet Processing Flaw Lets Remote Users...

    Broader source: Energy.gov (indexed) [DOE]

    can cause denial of service conditions. PLATFORM: Nexus 1000v, 5000, and 7000 Series Switches ABSTRACT: A remote user can send a specially crafted IP packet to cause the target...

  3. 28 BIts&ChIps 17 november 2005 Energetiq Technology heeft een licht-

    E-Print Network [OSTI]

    Cambridge, University of

    28 · BIts&ChIps · 17 november 2005 Energetiq Technology heeft een licht- bron gelanceerd voor extreem ultravi- olet (EUV) metrologie. Deze Electrode- less Z-Pinch EUV-source, of EQ-10M, genereert EUV

  4. NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso

    E-Print Network [OSTI]

    Rosso, Paolo

    NLEL-MAAT at CLEF-IP Santiago Correa and Davide Buscaldi and Paolo Rosso NLE Lab, ELiRF Research Group, DSIC, Universidad Polit´ecnica de Valencia, Spain. {scorrea, dbuscaldi, prosso}@dsic.upv.es http://users.dsic.upv.es/grupos/nle Abstract. This report presents the work carried out at NLE Lab for the CLEF-IP 2009 competition. We adapted

  5. Insights into substrate specificity of NlpC/P60 cell wall hydrolases containing bacterial SH3 domains

    DOE Public Access Gateway for Energy & Science Beta (PAGES Beta)

    Xu, Qingping; Mengin-Lecreulx, Dominique; Liu, Xueqian W.; Patin, Delphine; Farr, Carol L.; Grant, Joanna C.; Chiu, Hsiu -Ju; Jaroszewski, Lukasz; Knuth, Mark W.; Godzik, Adam; et al

    2015-09-15

    Bacterial SH3 (SH3b) domains are commonly fused with papain-like Nlp/P60 cell wall hydrolase domains. To understand how the modular architecture of SH3b and NlpC/P60 affects the activity of the catalytic domain, three putative NlpC/P60 cell wall hydrolases were biochemically and structurally characterized. In addition, these enzymes all have ?-d-Glu-A2pm (A2pm is diaminopimelic acid) cysteine amidase (ordl-endopeptidase) activities but with different substrate specificities. One enzyme is a cell wall lysin that cleaves peptidoglycan (PG), while the other two are cell wall recycling enzymes that only cleave stem peptides with an N-terminall-Ala. Their crystal structures revealed a highly conserved structure consisting ofmore »two SH3b domains and a C-terminal NlpC/P60 catalytic domain, despite very low sequence identity. Interestingly, loops from the first SH3b domain dock into the ends of the active site groove of the catalytic domain, remodel the substrate binding site, and modulate substrate specificity. Two amino acid differences at the domain interface alter the substrate binding specificity in favor of stem peptides in recycling enzymes, whereas the SH3b domain may extend the peptidoglycan binding surface in the cell wall lysins. Remarkably, the cell wall lysin can be converted into a recycling enzyme with a single mutation.Peptidoglycan is a meshlike polymer that envelops the bacterial plasma membrane and bestows structural integrity. Cell wall lysins and recycling enzymes are part of a set of lytic enzymes that target covalent bonds connecting the amino acid and amino sugar building blocks of the PG network. These hydrolases are involved in processes such as cell growth and division, autolysis, invasion, and PG turnover and recycling. To avoid cleavage of unintended substrates, these enzymes have very selective substrate specificities. Our biochemical and structural analysis of three modular NlpC/P60 hydrolases, one lysin, and two recycling enzymes, show that they may have evolved from a common molecular architecture, where the substrate preference is modulated by local changes. These results also suggest that new pathways for recycling PG turnover products, such as tracheal cytotoxin, may have evolved in bacteria in the human gut microbiome that involve NlpC/P60 cell wall hydrolases.« less

  6. Deep optical survey of the stellar content of Sh2-311 region

    E-Print Network [OSTI]

    Yadav, Ram Kesh; Sharma, Saurabh; Jose, J; Ogura, K; Kobayashi, N; Samal, M R; Eswaraiah, C; Chandola, H C

    2014-01-01

    The stellar content in and around Sh2-311 region have been studied using the deep optical observations as well as near-infrared (NIR) data from 2MASS. The region contains three clusters, viz. NGC 2467, Haffner 18 and Haffner 19. We have made an attempt to distinguish the stellar content of these individual regions as well as to re-determine their fundamental parameters such as distance, reddening, age, onto the basis of a new and more extended optical and infrared photometric data set. NGC 2467 and Haffner 19 are found to be located in the Perseus arm at the distances of 5.0 $\\pm$ 0.4 kpc and 5.7 $\\pm$ 0.4 kpc, respectively, whereas Haffner 18 is located at the distance of 11.2 $\\pm$ 1.0 kpc. The clusters NGC 2467 and Haffner 19 might have formed from the same molecular cloud, whereas the cluster Haffner 18 is located in the outer galactic arm, i.e. the Norma-Cygnus arm. We identify 8 class II young stellar objects (YSOs) using the NIR $(J - H)/(H - K)$ two colour diagram. We have estimated the age and mass o...

  7. Le projet H2M : Hbergement Mutualis Montpellier

    E-Print Network [OSTI]

    van Tiggelen, Bart

    Le projet H2M : Hébergement Mutualisé à Montpellier Formation Datacentres écoinfo à Cargèse Le 30): certains de nos datacentres sont saturés, et ne peuvent plus accueillir de nouvelles baies (une solution

  8. PRESSIONS ET BUDGET: UNE ETUDE QUALITATIVE DANS LE SECTEUR

    E-Print Network [OSTI]

    Boyer, Edmond

    PRESSIONS ET BUDGET: UNE ETUDE QUALITATIVE DANS LE SECTEUR HOSPITALIER Résumé Le courant Reliance secteur hospitalier public. Mots clés : pression budgétaire, manipulation de données, conflit de rôle 31 praticiens hospitaliers dans deux Centres Hospitaliers Universitaires. Ce choix est justifié par

  9. SH 3.2.39 1 Study of the Shadow of the Moon and Sun with VHE Cosmic

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    SH 3.2.39 1 Study of the Shadow of the Moon and Sun with VHE Cosmic Rays M.O. Wascko 1 1 Department by primaries with energy below 1 TeV. The shadows of the sun and moon observed with cosmic rays can be used. This is expected to distort and displace the shadows of the sun and the moon. The moon shadow, offset from

  10. Curriculum Vit Frederic LE MOU EL

    E-Print Network [OSTI]

    Le Mouël, Frédéric

    / INRIA CITI Laboratory INSA Lyon B^atiment Claude Chappe 6 avenue des Arts F-69621 Villeurbanne Cedex Tel. : +33 472 436 422 Fax : +33 472 436 227 E-mail : frederic.le-mouel@insa-lyon.fr Web : http://citi, France. ­ Researcher in the INRIA CITI Laboratory (Innovation Center in Telecommunications and Services

  11. Michel Grossetti Universit de Toulouse-le-

    E-Print Network [OSTI]

    Boyer, Edmond

    1 Michel Grossetti CERS Université de Toulouse-le- Mirail, 5, Allées A. Machado, 31058 Toulouse : 05 57 57 19 72 mail : Philippe.Losego@lapsac.u- bordeaux2.fr Béatrice Milard CERS Université de and towns and the study of scientific publications. This allow us to evaluate the effects

  12. Les fonctions holomorphes et méromorphes dans le cercle-unité

    E-Print Network [OSTI]

    A. Bloch

    2011-06-28

    MÉMORIAL DES SCIENCES MATHÉMATIQUES. A. BLOCH. Les fonctions holomorphes et méromorphes dans le cercle-unité. Mémorial des sciences ...

  13. LE JOURNAL DE PHYSIQUE CENT ANS DE JOURNAL DE PHYSIQUE

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1 LE JOURNAL DE PHYSIQUE CENT ANS DE JOURNAL DE PHYSIQUE J. LANGEVIN Pour marquer le centenaire du Journal de Physique nous publions ci-dessous un article de M. Jean Langevin, qui retrace l'histoire du Journal depuis sa fondation. Monsieur J. Langevin a occupé pendant de longues années le poste de Rédacteur

  14. Proceedings of the 2013 Winter Simulation Conference R. Pasupathy, S.-H. Kim, A. Tolk, R. Hill, and M. E. Kuhl, eds.

    E-Print Network [OSTI]

    Whitt, Ward

    Proceedings of the 2013 Winter Simulation Conference R. Pasupathy, S.-H. Kim, A. Tolk, R. Hill University New York, NY 10027, USA Ward Whitt Industrial Engineering and Operations Research Columbia

  15. Rapid Recycling of Ca2+ Between IP3-Sensitive Stores and Lysosomes

    E-Print Network [OSTI]

    López Sanjurjo, Cristina I.; Tovey, Stephen C.; Taylor, Colin W.

    2014-10-22

    to the many receptors that stimulate phospholipase C (PLC), and then to mediate regener- ative propagation of the cytosolic Ca2+ signals [7]. The ER is unique among intracellular organelles in the extent to which it forms intimate associations with other... of lysosomal Ca2+ uptake exaggerates the Ca2+ signals evoked by Ca2+ release from distinct IP3-sensitive stores Stimulation of the endogenous muscarinic M3 receptors of HEK cells with carbachol (CCh) activates PLC. The IP3 produced then evokes Ca2+ release from...

  16. Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam

    E-Print Network [OSTI]

    Markopoulou, Athina

    Is the Internet ready for VoIP? Fouad A. Tobagi, Athina P. Markopoulou, Mansour J.Karam Email communication over the Internet (VoIP). If the Internet were to become the universal network for all the packet loss and delay characteristics of today's Internet, in order to understand the effectiveness

  17. Le processus de commissionnement vu par le maitre d'ouvrage 

    E-Print Network [OSTI]

    Moro, M.

    2004-01-01

    stream_source_info ESL-IC-04-10-15.pdf.txt stream_content_type text/plain stream_size 6097 Content-Encoding ISO-8859-1 stream_name ESL-IC-04-10-15.pdf.txt Content-Type text/plain; charset=ISO-8859-1 Le processus de... commissionnement vu par le maître d?ouvrage Marc MORO UCANSS ?¾?¾ Activités abritées Immeuble administratif, centre informatique, centre de formationprofessionnelle, maison de la petite enfance, centre de vacances, établissement médicalisé, maison de retraite, etc...

  18. IP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance

    E-Print Network [OSTI]

    Dunkels, Adam

    , smart cities, structural health management systems, smart grid and energy management, and transportationIP for Smart Objects Internet Protocol for Smart Objects (IPSO) Alliance White paper #1 Adam, Cisco Systems September 2008 Executive Summary The emerging application space for smart objects requires

  19. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated to find information on the invisible web. We describe our overall architecture and process: from obtaining

  20. The peculiar balmer decrement of SN 2009ip: Constraints on circumstellar geometry

    SciTech Connect (OSTI)

    Levesque, Emily M.; Stringfellow, Guy S.; Bally, John; Keeney, Brian A. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado 389-UCB, Boulder, CO 80309 (United States); Ginsburg, Adam G., E-mail: Emily.Levesque@colorado.edu [European Southern Observatory, ESO Headquarters, Karl-Schwarzschild-Strasse 2, D-95748 Garching bei München (Germany)

    2014-01-01

    We present optical and near-IR spectroscopic observations of the luminous blue variable SN 2009ip during its remarkable photometric evolution of 2012. The spectra sample three key points in the SN 2009ip light curve, corresponding to its initial brightening in August (2012-A) and its dramatic rebrightening in early October (2012-B). Based on line fluxes and velocities measured in our spectra, we find a surprisingly low I(H?)/I(H?) ratio (?1.3-1.4) in the 2012-B spectra. Such a ratio implies either a rare Case B recombination scenario where H?, but not H?, is optically thick, or an extremely high density for the circumstellar material of n{sub e} > 10{sup 13} cm{sup –3}. The H? line intensity yields a minimum radiating surface area of ?20,000 AU{sup 2} in H? at the peak of SN 2009ip's photometric evolution. Combined with the nature of this object's spectral evolution in 2012, a high circumstellar density and large radiating surface area imply the presence of a thin disk geometry around the central star (and, consequently, a possible binary companion), suggesting that the observed 2012-B rebrightening of SN 2009ip can be attributed to the illumination of the disk's inner rim by fast-moving ejecta produced by the underlying events of 2012-A.

  1. CPS-IP: Cyber Physical Systems Interconnection Protocol Department of Computer

    E-Print Network [OSTI]

    He, Tian

    heterogeneity of CPS systems at three different levels: function interoperability, policy regulation of the devices used in cyber physical system have very limited memory, computing capability and energy, whichCPS-IP: Cyber Physical Systems Interconnection Protocol Shan Lin Department of Computer Science

  2. SIP-based VoIP Traffic Behavior Profiling and Its Applications

    E-Print Network [OSTI]

    Zhang, Zhi-Li

    calls over the Internet, or any other IP network, using the packet switched network as a transmission maximize network efficiency, stream- line the network architecture, reduce capital and operational Hun such powerful infrastructures also make them a liability. Risks include Denial of Service (DoS), Ser- vice Theft

  3. Automatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen

    E-Print Network [OSTI]

    Lin, King-Ip "David"

    that is untouched by the traditional search engines. Known as the "invisible web" or "deep web", it representsAutomatic Information Discovery from the "Invisible Web" King-Ip Lin, Hui Chen Division of Computer@memphis.edu Abstract A large amount of on-line information resides on the invisible web ­ web pages generated

  4. Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov

    E-Print Network [OSTI]

    Hammerton, James

    Host-IP Clustering Technique for Deep Web Characterization Denis Shestakov Department of Media databases. This part of the Web, known as the deep Web, is to date relatively unexplored and even major are aimed at more accurate estimation of main parameters of the deep Web by sampling one national web domain

  5. Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E

    E-Print Network [OSTI]

    Peleg, Shmuel

    #12;Translation of a Patent Certificate Translated by AFD China IP Our Ref. No.:080801507-E Certificate No. 1156871 Certificate of Invention Patent Title: Method and System for Producing a Video Synopsis Inventors: Shmuel Peleg; Alexander Rav-Acha Patent No.: ZL 2006 8 0048754.8 Date of Filing

  6. IP Traffic Grooming over WDM Optical Networks Jing Fang and Arun K. Somani

    E-Print Network [OSTI]

    originating from hosts that are IP endpoints. This growth is being fueled by various applications capacity at the end systems. The advent of new services with increasing intelligence and the corresponding WDM to send ATM cells over SONET devices that are connect

  7. SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide

    E-Print Network [OSTI]

    Blake, Edwin

    SoftBridge: An Architecture for Building IP-based Bridges over the Digital Divide John Lewis, Bill outline the architecture and the requirements that the SoftBridge has to fulfill. An ap- proach and some), about 4 million land lines exist in South Africa and only 20% of South Africans have cellphones. Even

  8. Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks

    E-Print Network [OSTI]

    Greenberg, Albert

    Cost and Reliability Considerations in Designing the Next-Generation IP over WDM Backbone Networks of the cost and reliability considerations involved in designing the next-generation backbone network. Our cost of the network. Hence, a fundamental redesign of the backbone network which avoids such redundant

  9. Large-Scale Quality Analysis of Published ChIP-seq Data

    E-Print Network [OSTI]

    Kundaje, Anshul

    ChIP-seq has become the primary method for identifying in vivo protein–DNA interactions on a genome-wide scale, with nearly 800 publications involving the technique appearing in PubMed as of December 2012. Individually and ...

  10. Reflectivity retrieval in a networked radar environment: Demonstration from the CASA IP1

    E-Print Network [OSTI]

    Jayasumana, Anura P.

    using data from the first Integration Project (IP1) radar network in Oklahoma. Electromagnetic waves, the lowest coverage altitude gets higher with range due to earth curvature [1]. A networked radar environment is capable of high spatial coverage and temporal resolution. The Engineering Research Center for CASA

  11. Performance optimization of mobile WiMAX netwoks for VoIP streams

    E-Print Network [OSTI]

    Gomez-Castellanos, Javier

    -I, 09340 - Mexico City milo@xanum.uam.mx Abstract-- Supporting as many VoIP (Voice over Internet Protocol. Department of Telecommunications UNAM, Mexico City {lortiz, victor, javierg}@fi-b.unam.mx R. Santos School of Telematics UCOL, Colima, Mexico aquinor@ucol.mx M. Lopez-Guerrero Department of Electrical Engineering UAM

  12. University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1

    E-Print Network [OSTI]

    Oklahoma, University of

    University of Oklahoma [INTELLECTUAL PROPERTY POLICY] The University of Oklahoma |IP Policy 1 INTELLECTUAL PROPERTY POLICY 3.27.1 PREAMBLE (A) The people of the State of Oklahoma may reasonably expect from their creative works, trademarks, discoveries, and inventions. #12;University of Oklahoma

  13. A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner

    E-Print Network [OSTI]

    International Association for Cryptologic Research (IACR)

    A Key Establishment IP-Core for Ubiquitous Computing Markus Volkmer and Sebastian Wallner Hamburg in the ubiquitous and pervasive comput- ing setting is secure key exchange. The restrictions moti- vate-core in ¢¡¤£¦¥¨§ -CMOS technology are evaluated. 1. Introduction In ubiquitous and pervasive computing scenarios, key

  14. Developpement WebPHP pour le Web Developpement Web

    E-Print Network [OSTI]

    Richer, Jean-Michel

    D´eveloppement WebPHP pour le Web D´eveloppement Web PHP pour le Web Jean-Michel Richer jean-michel.richer@univ-angers.fr http://www.info.univ-angers.fr/pub/richer 2008 1 / 130 #12;D´eveloppement WebPHP pour le Web Objectif´eveloppement Web fonctionnalit´es de base du langage acc`es aux bases de donn´ees (PDO) la couche objet (classe, h

  15. Admission par internet et sur dossier. Le Rectorat de l'Acadmie de Nantes coordonne le

    E-Print Network [OSTI]

    Di Girolami, Cristina

    'entreprise (achats, logistique, marketing, ventes...) : option GMO (Gestion et Management des Organisations Comptabilité et de Gestion (DCG) - Gestion et Management des Organisations (GMO) - Gestion des Ressources financier Option GMO : chargé de clientèle, responsable d'agence, chef de projet... Option GRH

  16. Louvain-la-Neuve, le 6 septembre 2012 Recherche UCL

    E-Print Network [OSTI]

    Nesterov, Yurii

    fournir une avancée dans le domaine des batteries lithium-ion flexibles. Les résultats montrent comment le mettre au point un procédé de recyclage du silicium pour produire des batteries lithium-ion de haute la durée de vie des batteries au lithium Une équipe internationale, dont trois chercheurs de l

  17. Le 29 mai 2005 Aprs une campagne longue et

    E-Print Network [OSTI]

    Meyer-Vernet, Nicole

    Le 29 mai 2005 Après une campagne longue et passionnante, une large majorité de Français (54 Parlement · Le Parlement ne représente pas correctement l'opinion des Français. En 2005, quand 54,7% des avis sur l'Europe, dire si les politiques qu'elle mène depuis 20 ans ont rempli leurs promesses · Nous

  18. LE 6 AVRIL 2004 RGIME DE RETRAITE DE

    E-Print Network [OSTI]

    Skorobogatiy, Maksim

    , par le biais d'un appel d'offres, de la société Mercer, Consultation en gestion de placement pour'École. Vers la fin des années 90, les fonds de la firme de placement américaine Lancer Management Group Mercer. Recherche d'un nouveau gestionnaire d'actions américaines. Du point de vue financier, le Comité

  19. www.le.ac.uk/physics UNDERGRADUATE COURSES IN

    E-Print Network [OSTI]

    Banaji,. Murad

    www.le.ac.uk/physics UNDERGRADUATE COURSES IN Physics and Astronomy Department of Physics and Astronomy #12;www.le.ac.uk/physics-ug "The Leicester Department of Physics and Astronomy offers superb courses. Students get a broader exposure to different areas of physics and astronomy than is possible

  20. Lissieu, le 12 juin 2015 Communiqu de presse

    E-Print Network [OSTI]

    Chamroukhi, Faicel

    Lissieu, le 12 juin 2015 Communiqué de presse Détection et neutralisation de drones civils développement de l'usage des drones pour des applications civiles et suite aux survols d'opérateurs d zones sensibles vis-à-vis du survol des drones aériens. Le projet SPID a ainsi été retenu, avec pour

  1. PONDER - A Real time software backend for pulsar and IPS observations at the Ooty Radio Telescope

    E-Print Network [OSTI]

    Naidu, Arun; Manoharan, P K; Krishnakumar, M A

    2015-01-01

    This paper describes a new real-time versatile backend, the Pulsar Ooty Radio Telescope New Digital Efficient Receiver (PONDER), which has been designed to operate along with the legacy analog system of the Ooty Radio Telescope (ORT). PONDER makes use of the current state of the art computing hardware, a Graphical Processing Unit (GPU) and sufficiently large disk storage to support high time resolution real-time data of pulsar observations, obtained by coherent dedispersion over a bandpass of 16 MHz. Four different modes for pulsar observations are implemented in PONDER to provide standard reduced data products, such as time-stamped integrated profiles and dedispersed time series, allowing faster avenues to scientific results for a variety of pulsar studies. Additionally, PONDER also supports general modes of interplanetary scintillation (IPS) measurements and very long baseline interferometry data recording. The IPS mode yields a single polarisation correlated time series of solar wind scintillation over a b...

  2. Approved Module Information for LE1083, 2014/5 Module Title/Name: Words & Meaning Module Code: LE1083

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    and use data and information from primary sources (e.g. corpora) and secondary sources (e.g. dictionariesApproved Module Information for LE1083, 2014/5 Module Title/Name: Words & Meaning Module Code: LE Module Credits: 20 Module Management Information Module Leader Name Garry Plappert Email Address g

  3. A Mathematical Model for Hurricanes Alain-Yves LeRoux, Marie-Noelle LeRoux

    E-Print Network [OSTI]

    A Mathematical Model for Hurricanes Alain-Yves LeRoux, Marie-Noelle LeRoux Abstract The source outside a circular crown. The internal circle represents the eye wall of the hurricane and corresponds the hurricane. 1 Introduction A source wave is a wave whose velocity is completely determined by a root

  4. Approved Module Information for LE1008, 2014/5 Module Title/Name: Grammar & Meaning Module Code: LE1008

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LE1008, 2014/5 Module Title/Name: Grammar & Meaning Module Code: LE1008 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Jack Grieve Email Address grievej1

  5. Approved Module Information for LE2057, 2014/5 Module Title/Name: Computer Mediated Communication Module Code: LE2057

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LE2057, 2014/5 Module Title/Name: Computer Mediated Communication Module Code: LE2057 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 20 Module Management Information Module Leader Name Nur Hooton Email Address n

  6. Approved Module Information for LE2053, 2014/5 Module Title/Name: Variations of English Module Code: LE2053

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LE2053, 2014/5 Module Title/Name: Variations of English Module Code: LE2053 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 20 Module Management Information Module Leader Name Jack Grieve Email Address grievej1

  7. Une nouvelle grille d'analyse pour le contrle de gestion hospitalier : le contrle intgr de Simons

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1 Une nouvelle grille d'analyse pour le contrôle de gestion hospitalier : le contrôle intégré de'Entreprise et du Management, Université de Montpellier 1, jeldds@hotmail.fr Thierry NOBRE, Professeur des Universités, Ecole de Management Strasbourg thierry.nobre@unistra.fr Résumé : Cette communication a pour but d

  8. Three-Dimensional (3-D) Reconstructions of EISCAT IPS Velocity Data in the Declining Phase of Solar Cycle 23

    E-Print Network [OSTI]

    2010-01-01

    scintillation observations of the solar wind. Geophys. Res.IPS observations of the solar wind. Proc. SPIE 6689, 668911-scale structure of the fast solar wind. J. Geophys. Res.

  9. CSP 541: Internet Technologies W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison-Wesley, ISBN 0201633469

    E-Print Network [OSTI]

    Heller, Barbara

    CSP 541: Internet Technologies Texts W.R. Stevens, TCP/IP Illustrated, Volume 1, Addison March 2006 (html, css checks) CSP 541: Internet Technologies - CS Dept, Illinois Institut... 1 of 1 #12;

  10. Cooling Neutron Stars and Super uidity in Their Interiors D.G. Yakovlev, K.P. Leven sh, Yu.A. Shibanov

    E-Print Network [OSTI]

    Cooling Neutron Stars and Super uidity in Their Interiors D.G. Yakovlev, K.P. Leven#12;sh, Yu). The results are used for cooling simulations of isolated neutron stars. Both, the standard cooling and the cooling enhanced by the direct Urca process, are strongly a#11;ected by nucleon super uidity. Comparison

  11. Simulating Dead Wood in the Coast Range of Oregon Rebecca S.H. Kennedy1,2 and Keith A. Olsen3

    E-Print Network [OSTI]

    Simulating Dead Wood in the Coast Range of Oregon Rebecca S.H. Kennedy1,2 and Keith A. Olsen3 1-Growth; for descriptions see Ohmann and Gregory 2002) for the range of current dead wood amounts and potential management-group selection during model runs by matching total dead wood volume and snag volume criteria for each level we

  12. Advanced optimization methods for power systems P. Panciatici, M.C. Campi, S. Garatti, S.H. Low, D.K. Molzahn, A.X.

    E-Print Network [OSTI]

    Ernst, Damien

    Advanced optimization methods for power systems P. Panciatici, M.C. Campi, S. Garatti, S.H. Low, D from a grid operator perspective 2 Taxonomy of optimization problems 3 Recent developments in the eld of optimization 4 Possible synergies with sister elds 5 Summary 6 References 2 / 53 #12;Context: An increasing

  13. QUANTIFICATION OF LOSSES IN THIN-FILM CdS/CdTe SOLAR CELLS S.H. Demtsu and J.R. Sites

    E-Print Network [OSTI]

    Sites, James R.

    QUANTIFICATION OF LOSSES IN THIN-FILM CdS/CdTe SOLAR CELLS S.H. Demtsu and J.R. Sites Department of Physics, Colorado State University, Fort Collins, CO 80523, USA ABSTRACT Quantification of solar cell Thin-film CdS/CdTe devices have been studied extensively, but some basic underlying properties

  14. Mod. 021/2012/SSS Spett. le Politecnico di Milano

    E-Print Network [OSTI]

    Mod. 021/2012/SSS Spett. le Politecnico di Milano Area Servizi agli Studenti e ai Dottorandi P.za .________________________________________________________________________________________________________________________________ Riservato alla Segreteria: For administrative use only: Visto documento Document submitted: patente / drive

  15. Ben LePage, Ph.D. PECO Energy Company

    E-Print Network [OSTI]

    Charles, Donald

    -specific biochemical preservation revealed by comparative pyrolysis analysis of Tertiary Metasequoia fossil.A. LePage & S.P. Werts. 2004. Methanogenesis in Eocene Arctic soils inferred from 13 C of tree fossil

  16. Pisa Dependable Computing Ente Per le Nuove Tecnologie,

    E-Print Network [OSTI]

    Firenze, Università degli Studi di

    Pisa Dependable Computing Center Ente Per le Nuove Tecnologie, l'Energia e l'Ambiente del tool e di come esse cambino, a seconda del tipo di problema e di ambiente. La sperimentazione si e

  17. LE SYSTEME D'INFORMATION DE GESTION HOSPITALIER

    E-Print Network [OSTI]

    Boyer, Edmond

    LE SYSTEME D'INFORMATION DE GESTION HOSPITALIER : QUELLES CARACTERISTIQUES PRIVILEGIER POUR'hôpital public de court séjour. Abstract: Accounting Management Tools Implementation requires a Management's capabilities to make easier the Accounting Management Tools Implementation in a particular organisation

  18. Gomatique --13/2003. Les SIG sur le web, pages 323 338 Information gospatiale dans internet

    E-Print Network [OSTI]

    Géomatique -- 13/2003. Les SIG sur le web, pages 323 à 338 Information géospatiale dans internet documents tels les cartes, pages web, images et jeux de données géographiques décrivent, représentent ou utiliser le nom d'un pays avec le nom d'une ville pour rechercher des pages web portant sur le tourisme de

  19. Clues to the nature of SN 2009ip from photometric and spectroscopic evolution to late times

    SciTech Connect (OSTI)

    Graham, M. L. [Astronomy Department, University of California, Berkeley, CA 94720 (United States); Sand, D. J. [Physics Department, Texas Tech University, Lubbock, TX 79409 (United States); Valenti, S.; Howell, D. A.; Parrent, J. [Las Cumbres Observatory Global Telescope Network, Goleta, CA 93117 (United States); Halford, M.; Zaritsky, D. [Astronomy Department, University of Arizona, Tucson, AZ 85721 (United States); Bianco, F. [Department of Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Rest, A. [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Dilday, B., E-mail: melissagraham@berkeley.edu [North Idaho College, 1000 W. Garden Avenue, Coeur d'Alene, ID 83814 (United States)

    2014-06-01

    We present time series photometric and spectroscopic data for the transient SN 2009ip from the start of its outburst in 2012 September until 2013 November. These data were collected primarily with the new robotic capabilities of the Las Cumbres Observatory Global Telescope Network, a specialized facility for time domain astrophysics, and includes supporting high-resolution spectroscopy from the Southern Astrophysical Research Telescope, Kitt Peak National Observatory, and Gemini Observatory. Based on our nightly photometric monitoring, we interpret the strength and timing of fluctuations in the light curve as interactions between fast-moving ejecta and an inhomogeneous circumstellar material (CSM) produced by past eruptions of this massive luminous blue variable (LBV) star. Our time series of spectroscopy in 2012 reveals that, as the continuum and narrow H? flux from CSM interactions declines, the broad component of H? persists with supernova (SN)-like velocities that are not typically seen in LBVs or SN impostor events. At late times, we find that SN 2009ip continues to decline slowly, at ? 0.01 mag day{sup –1}, with small fluctuations in slope similar to Type IIn supernovae (SNe IIn) or SN impostors but no further LBV-like activity. The late-time spectrum features broad calcium lines similar to both late-time SNe and SN impostors. In general, we find that the photometric and spectroscopic evolution of SN 2009ip is more similar to SNe IIn than either continued eruptions of an LBV star or SN impostors but we cannot rule out a nonterminal explosion. In this context, we discuss the implications for episodic mass loss during the late stages of massive star evolution.

  20. Implementation of load sharing in TCP/IP distributed systems by election technique 

    E-Print Network [OSTI]

    Muppidi, Sridhar Reddy

    1991-01-01

    asynchronous Mesh Complete Arbitary 8(n log n) 8(n log n) 8(a log n) 8(n log n + m) 8(n log n) 8(n) 8(n) 8(a log n+ m) 13 Only recently have algorithms been designed for networks with faulty channels. Goldreich and Shrira [14] study election...IMPLEMENTATION OF LOAD SHARING IN TCP/IP DISTRIBUTED SYSTEMS BY ELECTION TECHNIQUE A Thesis by SRIDHAR REDDY MUPPIDI Submitted to the Oflice of Graduate Studies of Texas A&M University in partial fulfillment of the requirements for the degree...

  1. Fusion rules and vortices in $p_x+ip_y$ superconductors

    E-Print Network [OSTI]

    Michael Stone; Suk Bum Chung

    2005-11-30

    The "half-quantum" vortices ($\\sigma$) and quasiparticles ($\\psi$) in a two-dimensional $p_x+ip_y$ superconductor obey the Ising-like fusion rules $\\psi\\times \\psi=1$, $\\sigma\\times \\psi=\\sigma$, and $\\sigma\\times \\sigma= 1+\\psi$. We explain how the physical fusion of vortex-antivortex pairs allows us to use these rules to read out the information encoded in the topologically protected space of degenerate ground states. We comment on the potential applicability of this fact to quantum computation. Modified 11/30/05 to reflect manuscript as accepted for publication. Includes corrected last section.

  2. Assistance Transactions Headquarters IP Counsel, GC-62, John Lucas, 202-586-2939

    Office of Environmental Management (EM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirley Ann Jackson About UsEnergy Marketing Corp. |Storage, Oversight Assessment ofAssessment of(IP)

  3. Revue Prvenir N 40 Travail et sant , 2001 La fatigue, le stress et le travail motionnel de l'infirmire

    E-Print Network [OSTI]

    Boyer, Edmond

    évident lorsque l'on aborde lestressetlafatigue mentale. Dans l'imaginaire infirmier, l médical et non le soin infirmier; ainsi cette infirmière de pneumologie pédiatrique : «La prescription est

  4. Le pilotage des centres de recherche des ples de comptitivit Le cas du centre intgr MIRCen1

    E-Print Network [OSTI]

    Boyer, Edmond

    (Service hospitalier Frédéric Joliot), présent depuis avril 1959 à Orsay, NeuroSpin, inauguré en novembre. hal-00320879,version1-11Sep2008 Manuscrit auteur, publié dans "Vers le KM 2.0 : quel management des

  5. 10/2/2014 LE Advertising Information http://uwpress.wisc.edu/journals/journals/le_ads.html 1/2

    E-Print Network [OSTI]

    Sprott, Julien Clinton

    10/2/2014 LE Advertising Information http://uwpress.wisc.edu/journals/journals/le_ads.html 1 of this page) Print Ad Rates Cost Width Height Full page (B&W) $530 51/2" 8" Half page (B&W) $440 51/2" 37/8" Cover 3 or 4 (Full page, B&W) $560 51/2" 8" Online Ad Rates Cost Width Height Leaderboard $450 728px

  6. PublicationsmailagreementNo.40014024 the VeSSeL WILL

    E-Print Network [OSTI]

    Victoria, University of

    YBRID `GReeN ShIP' POWeReD BY eLeCtRICItY, hYDROGeN FUeL CeLLS & LOW- eMISSION DIeSeL FUeL RING SEPTEMBER 2011's first plug-in hybrid "green ship" powered by electricity, hydrogen fuel cells and low- emission diesel beyond fair trade, where growers get a fair price for their product, to serve coffee whose growers also

  7. Impact of wireless losses on the predictability of end-to-end flow characteristics in Mobile IP Networks 

    E-Print Network [OSTI]

    Bhoite, Sameer Prabhakarrao

    2005-02-17

    -1 IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to the Office of Graduate Studies of Texas A&M University in partial fulfillment of the requirements... for the degree of MASTER OF SCIENCE December 2004 Major Subject: Mechanical Engineering IMPACT OF WIRELESS LOSSES ON THE PREDICTABILITY OF END-TO-END FLOW CHARACTERISTICS IN MOBILE IP NETWORKS A Thesis by SAMEER BHOITE Submitted to Texas A&M University in partial...

  8. p{sub x}+ip{sub y} Superfluid from s-Wave Interactions of Fermionic Cold Atoms

    SciTech Connect (OSTI)

    Zhang Chuanwei; Tewari, Sumanta; Lutchyn, Roman M.; Das Sarma, S.

    2008-10-17

    Two-dimensional (p{sub x}+ip{sub y}) superfluids or superconductors offer a playground for studying intriguing physics such as quantum teleportation, non-Abelian statistics, and topological quantum computation. Creating such a superfluid in cold fermionic atom optical traps using p-wave Feshbach resonance is turning out to be challenging. Here we propose a method to create a p{sub x}+ip{sub y} superfluid directly from an s-wave interaction making use of a topological Berry phase, which can be artificially generated. We discuss ways to detect the spontaneous Hall mass current, which acts as a diagnostic for the chiral p-wave superfluid.

  9. CtIP tetramer assembly is required for DNA-end resection and repair

    E-Print Network [OSTI]

    Davies, Owen R.; Forment, Josep V.; Sun, Meidai; Belotserkovskaya, Rimma; Coates, Julia; Galanty, Yaron; Demir, Mukerrem; Morton, Christopher; Rzechorzek, Neil; Jackson, Stephen P.; Pellegrini, Luca

    2015-01-05

    of reservoir solution (200 mM lithium sulphate, 100 mM sodium acetate pH 3.6, 32% (v/v) PEG 400) and equilibrated for 7-10 days. Suitable crystals were incubated in cryoprotectant (20 mM Tris pH 8.0, 150 mM sodium chloride, 200 mM lithium sulphate, 100 m... protocol22. CtIP recombinant protein samples at 0.5-0.1 mg/ml were digested with 0.6 µg/µl proteinase K (NEB) at 60°C for 1 hour. For each digested protein sample, in addition to standard solutions containing 0-100 µM zinc acetate, 10 µl of supernatant...

  10. Characterization, Monitoring, and Sensor Technology Integrated Program (CMST-IP). Technology summary

    SciTech Connect (OSTI)

    Not Available

    1994-04-01

    The Characterization, Monitoring, and Sensor Technology Integrated Program seeks to deliver needed technologies, timely and cost-effectively, to the Office of Waste Management (EM-30), the Office of Environmental Restoration (EM-40), and the Office of Facility Transition and Management (EM-60). The scope of characterizations monitoring, and sensor technology needs that are required by those organizations encompass: (1) initial location and characterization of wastes and waste environments - prior to treatment; (2) monitoring of waste retrieval, remediation and treatment processes; (3) characterization of the co-position of final waste treatment forms to evaluate the performance of waste treatments processes; and (4) site closure and compliance monitoring. Wherever possible, the CMST-IP fosters technology transfer and commercialization of technologies that it sponsors.

  11. Abstract--Broadcast TV distribution over an IP network requires stringent QoS constraints, such as low latency and loss.

    E-Print Network [OSTI]

    Greenberg, Albert

    technique at the IP layer. Link-based FRR creates a pseudo-wire or tunnel in parallel to the IP adjacencies (links); and thus, single link failures are transparent to the Interior Gateway Protocol (IGP). Although to rebuild the multi-cast tree after a network failure. This process, when combined with the Internal Gateway

  12. Some Implications of Low Power Wireless to IP Networking Kannan Srinivasan, Prabal Dutta, Arsalan Tavakoli, and Philip Levis

    E-Print Network [OSTI]

    Levis, Philip

    and cellphones. This trend towards smaller, lower power, and more numerous devices has led to new wirelessSome Implications of Low Power Wireless to IP Networking Kannan Srinivasan, Prabal Dutta, Arsalan Division, UC Berkeley, Berkeley, CA Abstract We examine and outline challenges in IPv6 routing over low-power

  13. Comparison of Energy Efficiency in PSTN and VoIP Florin Bota, Faheem Khuhawar, Marco Mellia, Michela Meo

    E-Print Network [OSTI]

    Comparison of Energy Efficiency in PSTN and VoIP Systems Florin Bota, Faheem Khuhawar, Marco Mellia.lastname@polito.it ABSTRACT The importance of deploying energy efficient networks has vastly increased due to the rapidly to existing networks that could prove to be energy efficient. In this paper, two telephone net- works namely

  14. On the Selection of Optimal Diverse AS-Paths for Inter-Domain IP/(G)MPLS Tunnel Provisioning

    E-Print Network [OSTI]

    Rougier, Jean-Louis

    On the Selection of Optimal Diverse AS-Paths for Inter-Domain IP/(G)MPLS Tunnel Provisioning of diverse AS paths can be computed, in order to proactively increase the success rate of tunnel set these services beyond domain boundaries, particularly for critical inter-AS VPNs, TV transport or voice gateways

  15. Semi-Markov modeling of dependability of VoIP network in the presence of resource degradation and security attacks

    E-Print Network [OSTI]

    Dharmaraja, S.

    of Technology, Delhi, India a r t i c l e i n f o Article history: Received 19 August 2010 Received in revised models. & 2011 Elsevier Ltd. All rights reserved. 1. Introduction Voice over Internet Protocol (VoIP), also known as Internet telephony, is the technology that enables people to use the Internet

  16. Les rseaux optiques et le refroidissement par bande latrale 1 Effets collectifs et diffusion multiple . . . . . . . . . . 2

    E-Print Network [OSTI]

    Dalibard, Jean

    expériences avec des atomes froids est l'at- teinte du régime quantique pour le gaz, régime dans lequel les'atomes de densité uniforme. Les obstacles principaux sont la dif- fusion multiple de photons dans le gaz

  17. Service Provision in Disconnected Mobile Ad hoc Networks Nicolas Le Sommer

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Service Provision in Disconnected Mobile Ad hoc Networks Nicolas Le Sommer Valoria Laboratory, University of South Brittany Nicolas.Le-Sommer@univ-ubs.fr Abstract With the proliferation of mobiles devices

  18. Communiqu de presse Lyon, le 20 mars 2014

    E-Print Network [OSTI]

    Dellandréa, Emmanuel

    Communiqué de presse Lyon, le 20 mars 2014 3 000 étudiants pour la 32ème édition du Challenge Centrale Lyon Ce weekend du 22 et 23 mars 2014, l'école Centrale Lyon (Ecully) accueille sur son campus

  19. Pisa Dependable Computing Ente Per le Nuove Tecnologie,

    E-Print Network [OSTI]

    Firenze, Università degli Studi di

    Pisa Dependable Computing Center Ente Per le Nuove Tecnologie, l'Energia e l'Ambiente Modelli Ingegneria Informatica, Univerista' di Pisa, via Diotisalvi 2 56127 PISA, Italy mura@iet.unipi.it * * PDCC - Consorzio Pisa Ricerche, Piazza A. D'Ancona, 1 - 56127 PISA, Italy S

  20. se de doctorat en informatique Comprendre le Web cach

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    niveau à l'aide de telles descriptions. Abstract e hidden Web (also known as deep or invisible Web'informations, complexité Keywords: hidden Web, deep Web, databases, information extraction, complexity tel-00198150,versionèse de doctorat en informatique Comprendre le Web caché Understanding the Hidden Web Pierre

  1. Molten salts and nuclear energy production Christian Le Bruna*

    E-Print Network [OSTI]

    Boyer, Edmond

    with solid fuels, liquid fuel in molten salt reactor, solvents for spent nuclear solid fuel in the caseMolten salts and nuclear energy production Christian Le Bruna* a Laboratoire de Physique or chlorides) have been taken in consideration very soon in nuclear energy production researches

  2. Data Mining et Statistique Philippe Besse # , Caroline Le Gall + ,

    E-Print Network [OSTI]

    Besse, Philippe

    Data Mining et Statistique Philippe Besse # , Caroline Le Gall + , Nathalie Raimbault # & Sophie Sarpy § Râ??esumâ??e Cet article propose une introduction au Data Mining. Celle­ci prend la forme d'une r permettent de tirer quelques ensei­ gnements sur les pratiques du data mining : choix d'une mâ??ethode, comp

  3. Paris, janvier 2013 SOPHIE FERREIRA LE MORVAN NOMME

    E-Print Network [OSTI]

    Ferreira Le Morvan, 39 ans, a été nommée directrice du Parc zoologique de Paris, dit zoo de Vincennes, à collection publique mondiale de l'artiste, fonction qu'elle a exercée pendant 6 ans en accompagnement de la://parczoologiquedeparis.fr/ Contacts presse Cécile Brissaud / 01 40 79 80 75 / brissaud@mnhn.fr Jérôme Munier / 01 40 79 54 42 / munier

  4. Pisa Dependable Computing Ente Per le Nuove Tecnologie,

    E-Print Network [OSTI]

    Firenze, Università degli Studi di

    in questa famiglia le FMEA (Failure Mode Effect Analysis). La seconda contiene i metodi che proce- dendo sistema al livello dei componenti. I fault-tree rappresentano un tipico esempio di tali metodi. 2.1 FMEA La FMEA é una tecnica induttiva il cui principio fondamentale é l'analisi, per ogni componente, degli

  5. Algorithms for Determining Network Robustness Heath J. LeBlanc

    E-Print Network [OSTI]

    Koutsoukos, Xenofon D.

    Algorithms for Determining Network Robustness Heath J. LeBlanc Department of Electrical & Computer.koutsoukos@vanderbilt.edu ABSTRACT In this paper, we study algorithms for determining the robustness of a network. Network robustness algorithms that use purely local strategies are able to succeed in the presence of adversary nodes. Therefore

  6. LE CONTROLE DE GESTION EN MILIEU HOSPITALIER : UNE

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    LE CONTROLE DE GESTION EN MILIEU HOSPITALIER : UNE REPONSE A L'EMERGENCE DE RISQUES)product-based risk ; 2) procedure-based risk ; 3) individual-based risk. Management controls appears, risques organisationnels, relations interpersonnelles. Keywords : management control, organisational risks

  7. Prsente pour obtenir le grade de L'UNIVERSIT PARISEST

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    modeling of transport and freezing phenomena within unsaturated porous media Soutenue le 23 septembre 2013. This thesis deals with the transport properties and then the freezing behaviors of unsaturated porous media Présentée par : Rongwei YANG Sujet de la thèse : Contributions à la modélisation micromécanique du transport

  8. Graphene Enhanced Wireless Sensors Taoran Le, Trang Thai, Vasileios Lakafosis,

    E-Print Network [OSTI]

    Tentzeris, Manos

    Graphene Enhanced Wireless Sensors Taoran Le, Trang Thai, Vasileios Lakafosis, Manos Tentzeris utilizing both analog and digital principles. The sensors will utilize Graphene-based thin films integrated. Our thin films are produced from water-based, inkjet printed graphene oxide (GO) on paper

  9. Resource Management for Parallel Adaptive Components Luc Courtrai, Frdric Guidec, Nicolas Le Sommer, Yves Maho

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Sommer, Yves Mahéo VALORIA, Université de Bretagne-Sud, France {Luc.Courtrai Frederic.Guidec Nicolas.Le-Sommer

  10. Etude cologique en immunofluorescence de Rhizobium japonicum dans le sol et la rhizosphre

    E-Print Network [OSTI]

    Boyer, Edmond

    'une association efficiente entre la plante hôte et la bactérie du genre Rhizobium. Lorsque le Rhizobium est absent

  11. Louvain-la-Neuve, le 27 janvier 2011 Hunza ! : images du Pakistan, par Benoit Sneessens

    E-Print Network [OSTI]

    Nesterov, Yurii

    Louvain-la-Neuve, le 27 janvier 2011 « Hunza ! » : images du Pakistan, par Benoit Sneessens Du 1er trois ans, l'artiste a parcouru à pieds les sentiers escarpés de la vallée de Hunza, au Nord du Pakistan reportages à l'étranger, s'envole pour le Pakistan. Le but de son expédition : confronter l'image du pays

  12. La Qualit l'ENSEEIHT Le Systme de Management de la qualit (ISO 9001)

    E-Print Network [OSTI]

    Grigoras, .Romulus

    La Qualité à l'ENSEEIHT Le Système de Management de la qualité (ISO 9001) En 3 mots : le Système de Management de la qualité (ISO 9001) - Le SMQ c'est : * Réaliser = Procédures, réaliser les activités (selon constatés. Les rapports d'audit de certification et internes sont présentés dans la page audits. #12;

  13. LE CADRE DE SANTE ENTRE LOGIQUES D'UTILITE ET LOGIQUES DE SOINS HOSPITALIERS

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    valorisation des cadres hospitaliers avec pour objectif: « Le renforcement du management hospitalier » La1 LE CADRE DE SANTE ENTRE LOGIQUES D'UTILITE ET LOGIQUES DE SOINS HOSPITALIERS Résumé : Le cadre de santé hospitalier réalise, au niveau d'un service, l'ensemble des missions d'organisation de l

  14. Europe, comment a va avec les artistes? Avignon, le 24 juillet 2011

    E-Print Network [OSTI]

    Naud Frédéric

    1. Europe, comment ça va avec les artistes? Avignon, le 24 juillet 2011 #12;Arnaud Laporte. Bonjour artistes. Le titre générique de ces Rencontres, « Europe, le regard des artistes », énonce cette idée que « Europe, comment ça va avec les artistes ? » (en écho au beau film de Raymond Depardon, Afrique, comment

  15. Approved Module Information for LE3028, 2014/5 Module Title/Name: Corpus Linguistics Module Code: LE3028

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    from primary sources (i.e. corpora) and secondary sources (e.g. dictionaries) Carrying outApproved Module Information for LE3028, 2014/5 Module Title/Name: Corpus Linguistics Module Code Module Credits: 20 Module Management Information Module Leader Name Garry Plappert Email Address g

  16. Ahb Compatible DDR Sdram Controller Ip Core for Arm Based Soc

    E-Print Network [OSTI]

    Shashikumar, Dr R; Nagendrakumar, M; Hemanthkumar, C S

    2010-01-01

    DDR SDRAM is similar in function to the regular SDRAM but doubles the bandwidth of the memory by transferring data on both edges of the clock cycles. DDR SDRAM most commonly used in various embedded application like networking, image or video processing, Laptops ete. Now a days many applications needs more and more cheap and fast memory. Especially in the field of signal processing, requires significant amount of memory. The most used type of dynamic memory for that purpose is DDR SDRAM. For FPGA design the IC manufacturers are providing commercial memory controller IP cores working only on their products. Main disadvantage is the lack of memory access optimization for random memory access patterns. The data path part of those controllers can be used free of charge. This work propose an architecture of a DDR SDRAM controller, which takes advantage of those available and well tested data paths and can be used for any FPGA device or ASIC design.(5). In most of the SOC design, DDR SDRAM is commonly used. ARM pro...

  17. A panchromatic view of the restless SN 2009ip reveals the explosive ejection of a massive star envelope

    SciTech Connect (OSTI)

    Margutti, R.; Milisavljevic, D.; Soderberg, A. M.; Chornock, R.; Zauderer, B. A.; Sanders, N. E.; Berger, E. [Harvard-Smithsonian Center for Astrophysics, 60 Garden St., Cambridge, MA 02138 (United States); Murase, K. [Institute for Advanced Study, Princeton, NJ 08540 (United States); Guidorzi, C. [Department of Physics, University of Ferrara, via Saragat 1, I-44122 Ferrara (Italy); Kuin, P. [University College London, MSSL, Holmbury St. Mary, Dorking, Surrey RH5 6NT (United Kingdom); Fransson, C. [Department of Astronomy and the Oskar Klein Centre, Stockholm University, AlbaNova, SE-106 91 Stockholm (Sweden); Levesque, E. M. [CASA, Department of Astrophysical and Planetary Sciences, University of Colorado, 389-UCB, Boulder, CO 80309 (United States); Chandra, P.; Challis, P. [National Centre for Radio Astrophysics, Tata Institute of Fundamental Research, Pune University Campus, Ganeshkhind, Pune 411007 (India); Bianco, F. B. [Center for Cosmology and Particle Physics, New York University, 4 Washington Place, New York, NY 10003 (United States); Brown, P. J. [George P. and Cynthia Woods Mitchell Institute for Fundamental Physics and Astronomy, Texas A. and M. University, Department of Physics and Astronomy, 4242 TAMU, College Station, TX 77843 (United States); Chatzopoulos, E. [Department of Astronomy, University of Texas at Austin, Austin, TX 78712-1205 (United States); Cheung, C. C. [Space Science Division, Naval Research Laboratory, Washington, DC 20375-5352 (United States); Choi, C. [CEOU/Department of Physics and Astronomy, Seoul National University, Seoul 151-742 (Korea, Republic of); Chomiuk, L. [National Radio Astronomy Observatory, P.O. Box O, Socorro, NM 87801 (United States); and others

    2014-01-01

    The double explosion of SN 2009ip in 2012 raises questions about our understanding of the late stages of massive star evolution. Here we present a comprehensive study of SN 2009ip during its remarkable rebrightenings. High-cadence photometric and spectroscopic observations from the GeV to the radio band obtained from a variety of ground-based and space facilities (including the Very Large Array, Swift, Fermi, Hubble Space Telescope, and XMM) constrain SN 2009ip to be a low energy (E ? 10{sup 50} erg for an ejecta mass ?0.5 M {sub ?}) and asymmetric explosion in a complex medium shaped by multiple eruptions of the restless progenitor star. Most of the energy is radiated as a result of the shock breaking out through a dense shell of material located at ?5 × 10{sup 14} cm with M ? 0.1 M {sub ?}, ejected by the precursor outburst ?40 days before the major explosion. We interpret the NIR excess of emission as signature of material located further out, the origin of which has to be connected with documented mass-loss episodes in the previous years. Our modeling predicts bright neutrino emission associated with the shock break-out if the cosmic-ray energy is comparable to the radiated energy. We connect this phenomenology with the explosive ejection of the outer layers of the massive progenitor star, which later interacted with material deposited in the surroundings by previous eruptions. Future observations will reveal if the massive luminous progenitor star survived. Irrespective of whether the explosion was terminal, SN 2009ip brought to light the existence of new channels for sustained episodic mass loss, the physical origin of which has yet to be identified.

  18. SiFi: Exploiting VoIP Silence for WiFi Energy Savings in Smart Phones

    E-Print Network [OSTI]

    Zhou, Gang

    ), to its sleep or Power Save Mode (PSM), which consumes little power (36mW). Applications like VoIP do not perform well under PSM mode however, due to their real-time nature, so the energy footprint is quite high WiFi to the Power Save Mode (PSM) which consumes 20 fold less energy (36mW in Sprint HTC Hero

  19. IP ADDRESS HOSTNAME MACHINE TYPE 129.252.130.106 canopus.cse.sc.edu # SUN Ultra10

    E-Print Network [OSTI]

    Bakos, Jason D.

    IP ADDRESS HOSTNAME MACHINE TYPE 129.252.130.106 canopus.cse.sc.edu # SUN Ultra10 129.252.130.107 deneb.cse.sc.edu # SUN Ultra10 129.252.130.108 glensh.cse.sc.edu # SUN Ultra10 129.252.130.111 menkar.cse.sc.edu # SUN Ultra10 129.252.130.112 nunki.cse.sc.edu # SUN Ultra10 129.252.130.113 pollux.cse.sc.edu # SUN

  20. Exact solution of the p+ip Hamiltonian revisited: duality relations in the hole-pair picture

    E-Print Network [OSTI]

    Jon Links; Ian Marquette; Amir Moghaddam

    2015-04-02

    We study the exact Bethe Ansatz solution of the p+ip Hamiltonian in a form whereby quantum numbers of states refer to hole-pairs, rather than particle-pairs used in previous studies. We find an asymmetry between these approaches. For the attractive system states in the strong pairing regime take the form of a quasi-condensate involving two distinct hole-pair creation operators. An analogous feature is not observed in the particle-pair picture.

  1. Effects of verbenone and brevicomin on within-tree populations of Dendroctonus frontalis and Ips avulsus (Coleoptera: Scolytidae) 

    E-Print Network [OSTI]

    Watterson, Gary Phillip

    1979-01-01

    EFFECTS OF VERBENONE AND BREVICOMIN ON WITHIN-TREE POPULATIONS OF DENDROCTONUS FRONTALIS AND IPS AVULSUS (COLEOPTERA: SCOLYTIDAE) A Thesis by GARY PHILLIP WATTERSON Submitted to the Graduate College of Texas A8M University in partial... by GARY PHILLIP WATTERSON Approved as to style and content by: Chairman of o ee Head of Department ember Member I , Mem er December, 1979 ABSTRACT Effects of Verbenone and Brevi comi n on Within-Tree Populations of Dendroctonus frontalis and ~I...

  2. La programmation orientee objets et le langage Java

    E-Print Network [OSTI]

    Tichit, Laurent

    La programmation orient´ee objets et le langage Java Master Pro BBSG 2 Henri Garreta, Laurent Tichit D´epartement d'Informatique, Facult´e des Sciences de Luminy Cours 1: Java "sans les objets" c H. Garreta et L. Tichit, 2011-2012 POO et Java 1 / 32 #12;Java "sans les objets" Ressources Documentation www.dil.univ-mrs.fr/~tichit/java

  3. La dynamique de communication entre Hydro-Qubec et les Innus dans le cadre du projet de la Romaine

    E-Print Network [OSTI]

    La dynamique de communication entre Hydro-Québec et les Innus dans le cadre du projet de la Romaine Fortin, 2014 #12;#12;iii Résumé Le mémoire porte sur la dynamique de communication entre Hydro-Québec et, composées dInnus et de représentants dHydro-Québec, et dont le rôle est de gérer les fonds. De plus, le

  4. Les NEP ont-elles rduit le risque d'audit ? 1 Les NEP ont-elles rduit le risque d'audit ?

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Les NEP ont-elles réduit le risque d'audit ? 1 Les NEP ont-elles réduit le risque d'audit ? Alain changements importants, à commencer par l'apparition de normes d'exercice professionnel (NEP) homologuées par sociétés à responsabilité limitée 2 NEP 9605 du 20 avril 2010 3 Article L. 225-235 du code de commerce 4

  5. Approved Module Information for LE1088, 2014/5 Module Title/Name: Theories of Language and Identities Module Code: LE1088

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LE1088, 2014/5 Module Title/Name: Theories of Language and Identities Module Code: LE1088 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Urszula Clark Email Address u

  6. Rserve Internationale de Ciel Etoile au Pic de Midi de Le pic du Midi de Bigorre est situ est situ dans les Pyrnes franaises, dans le

    E-Print Network [OSTI]

    Dintrans, Boris

    Titre Réserve Internationale de Ciel Etoilée au Pic de Midi de Bigorre Résumé Le pic du Midi de en avant de la chaîne, le pic est connu pour son panorama magnifique sur la chaîne de montagnes étoilé au pic du Midi de Bigorre. Pourquoi une Réserve de Ciel Etoilé au Pic du Midi ? Ce site

  7. Gomatique --13/2003. Les SIG sur le web, pages 339 359 Cartographie sur demande sur le web et bases de donnes

    E-Print Network [OSTI]

    Géomatique -- 13/2003. Les SIG sur le web, pages 339 à 359 Cartographie sur demande sur le web et.bernier;yvan.bedard;melanie.lambert}@.scg.ulaval.ca RÉSUMÉ. Depuis quelques années, plusieurs applications web permettent aux internautes d'accéder à de l witnessed the emerging of web mapping applications. These applications allow a user to have access

  8. Continuity of the phase transition for planar random-cluster and Potts models with $1\\le q\\le4$

    E-Print Network [OSTI]

    Hugo Duminil-Copin; Vladas Sidoravicius; Vincent Tassion

    2015-05-15

    This article studies the planar Potts model and its random-cluster representation. We show that the phase transition of the nearest-neighbor ferromagnetic $q$-state Potts model on $\\mathbb Z^2$ is continuous for $q\\in\\{2,3,4\\}$, in the sense that there exists a unique Gibbs state, or equivalently that there is no ordering for the critical Gibbs states with monochromatic boundary conditions. The proof uses the random-cluster model with cluster-weight $q\\ge1$ (note that $q$ is not necessarily an integer) and is based on two ingredients: 1. The fact that the two-point function for the free state decays sub-exponentially fast for cluster-weights $1\\le q\\le 4$, which is derived studying parafermionic observables on a discrete Riemann surface. 2. A new result proving the equivalence of several properties of critical random-cluster models: - the absence of infinite-cluster for wired boundary conditions, - the uniqueness of infinite-volume measures, - the sub-exponential decay of the two-point function for free boundary conditions, - a Russo-Seymour-Welsh type result on crossing probabilities in rectangles with arbitrary boundary conditions. The result leads to a number of consequences concerning the scaling limit of the random-cluster model with $1\\le q \\le 4$. It shows that the family of interfaces (for instance for Dobrushin boundary conditions) are tight when taking the scaling limit and that any sub-sequential limit can be parametrized by a Loewner chain. We also study the effect of boundary conditions on these sub-sequential limits. Let us mention that the result should be instrumental in the study of critical exponents as well.

  9. SN 2009ip: CONSTRAINTS ON THE PROGENITOR MASS-LOSS RATE

    SciTech Connect (OSTI)

    Ofek, E. O.; Lin, L.; Goegues, E.; Kouveliotou, C.; Kasliwal, M. M.; Cao, Y.

    2013-05-01

    Some supernovae (SNe) show evidence for mass-loss events taking place prior to their explosions. Measuring their pre-outburst mass-loss rates provides essential information regarding the mechanisms that are responsible for these events. Here we present XMM-Newton and Swift X-ray observations taken after the latest, and presumably the final, outburst of SN 2009ip. We use these observations as well as new near-infrared and visible-light spectra and published radio and visible-light observations to put six independent order-of-magnitude constraints on the mass-loss rate of the SN progenitor prior to the explosion. Our methods utilize the X-ray luminosity, the bound-free absorption, the H{alpha} luminosity, the SN rise time, free-free absorption, and the bolometric luminosity of the outburst detected prior to the explosion. Assuming spherical mass loss with a wind-density profile, we estimate that the effective mass-loss rate from the progenitor was between 10{sup -3} and 10{sup -2} M{sub Sun} yr{sup -1}, over a few years prior to the explosion, with a velocity of {approx}10{sup 3} km s{sup -1}. This mass-loss rate corresponds to a total circumstellar matter (CSM) mass of {approx}0.04 M{sub Sun }, within 6 Multiplication-Sign 10{sup 15} cm of the SN. We note that the mass-loss rate estimate based on the H{alpha} luminosity is higher by an order of magnitude. This can be explained if the narrow-line H{alpha} component is generated at radii larger than the shock radius, or if the CSM has an aspherical geometry. We discuss simple geometries which are consistent with our results.

  10. Le Flore County, Oklahoma: Energy Resources | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma, Arizona: Energy ResourcesProjectMississippi: EnergyLawrie v. Silsby,LazyLe

  11. Archea ME LE Anlagenbau GmbH | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar Energy LLC Jump to: navigation,Summaries | OpenLibraryAquafuelAralcoME LE

  12. Experimental Investigation of HighEnergy Photon Splitting in Atomic Fields Sh. Zh. Akhmadaliev, G. Ya. Kezerashvili, S. G. Klimenko, R. N. Lee, V. M. Malyshev, A. L. Maslennikov, A. M. Milov,

    E-Print Network [OSTI]

    at the VEPP­4M collider. In the energy region of 120--450 MeV, statistics of 1:6 # 10 9 photons incidentExperimental Investigation of High­Energy Photon Splitting in Atomic Fields Sh. Zh. Akhmadaliev, G the initial photon energy ! 1 (see Fig. 1). This is an example of a self­ action of an electromagnetic field

  13. de l'UNIGEle journalDu 25 octobre au 8 novembre 2012 | Parat le jeudi | www.unige.ch/lejournal vu d'ici | 4

    E-Print Network [OSTI]

    Halazonetis, Thanos

    Festival Global+5, le 9octobre dernier, le projet «Planet Solar Deepwater» pré- voit quant à lui de mener une série d'expériences inédites le long du Gulf Stream avec le bateau Planet Solar. point fort | 2 de la Faculté de droit. Planet Solar dans le Pacifique Photo: P. Lesage #12;| 2 | 25 octobre-8

  14. A closer look at the fluctuations in the brightness of SN 2009IP during its late 2012 eruption

    SciTech Connect (OSTI)

    Martin, J. C. [Barber Observatory, University of Illinois Springfield, Springfield, IL 62704 (United States); Hambsch, F.-J. [Remote Observatory, Atacama Desert, Chile Vereniging Voor Sterrenkunde (VVS), Oude Bleken 12, B-2400 Mol (Belgium); Margutti, R.; Soderberg, A. [Harvard-Smithsonian Center for Astrophysics, 60 Garden Street, Cambridge, MA 02318 (United States); Tan, T. G. [Perth Exoplanet Survey Telescope, Perth (Australia); Curtis, I., E-mail: jmart5@uis.edu [Adelaide (Australia)

    2015-01-01

    The supernova (SN) impostor SN 2009ip has re-brightened several times since its initial discovery in 2009 August. During its last outburst in late 2012 September, it reached a peak brightness of m{sub v} ?13.5 (M{sub v} brighter than ?18), causing some to speculate that it had undergone a terminal core-collapse SN. Relatively high-cadence multi-wavelength photometry of the post-peak decline revealed bumps in brightness infrequently observed in other SNe IIn. These bumps occurred synchronously in all ultraviolet (UV) and optical bands with amplitudes of 0.1–0.4 mag at intervals of 10–30 days. Episodic continuum brightening and dimming in the UV and optical with these characteristics is not easily explained within the context of models that have been proposed for the late September 2012 outburst of SN 2009ip. We also present evidence that the post-peak fluctuations in brightness occur at regular intervals and raise more questions about their origin.

  15. Animation de mod`eles UML -Application dans le contexte des Smartgrids

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Animation de mod`eles UML - Application dans le contexte des Smartgrids Rachida Seghiri T'arriv´ee des Smartgrids dans le domaine ´electrique apporte de profonds changements au sein des Syst`emes d, nous ´etayons cet ´etat de l'art par la simulation d'un cas m´etier illustratif des Smartgrids en

  16. Le luri : quelques notes sur une langue tchadique du Nigeria Bernard CARON

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1 Le luri : quelques notes sur une langue tchadique du Nigeria Bernard CARON LLACAN (CNRS, INALCO arbres magnifiques de la savane du nord du Nigeria où ruissellent les cours d'eau dans la tendre d'une langue tchadique non citée dans (Shimizu, 1978), le luri : « LURI : a language of Nigeria SIL

  17. Algorithme exact pour le probl`eme de l'independant faiblement connexe de

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Fatiha BENDALI, Jean MAILFERT, Djelloul MAMERI LIMOS UMR CNRS 6158, Campus Scientifique des C´electionner le plus petit nombre Travail partiellement financ´e par le projet TODO ANR 09-EMER-010. bendali,mailfert,mameri BENDALI, Jean MAILFERT, Djelloul MAMERI de tels sommets. Cependant d´eterminer un dominant connexe ou

  18. DEMANDE DE CONGE Cette demande doit tre effectue un mois avant le dbut du semestre.

    E-Print Network [OSTI]

    Halazonetis, Thanos

    DEMANDE DE CONGE Cette demande doit être effectuée un mois avant le début du semestre. Date de la demande .......................................................... NOM-mail .......................................................................................................................................................................... @etu.unige.ch Demande à être mis au bénéfice d'un congé pour le(s) semestre(s) suivant(s) (2 semestres

  19. A S T R O F I S I C A Le Stelle n. 5360

    E-Print Network [OSTI]

    Savin, Daniel Wolf

    ghiaccio emettono raggi X di alta energia? Le risposte a queste domande sono racchiuse negli spettri della'Universo al di là del Sistema Solare. Le leggi della fisica ci dicono che ogni atomo, o molecola, emette o come un prisma disperde la luce solare in un arcobaleno di Fare astrofisica in laboratorioNon tutti gli

  20. Communiqu de presse Paris, le 14 novembre 2013 Parrainez un animal du

    E-Print Network [OSTI]

    79 54 42 / munier@mnhn.fr Pierre Laporte Communication : Marie Roy : 01 45 23 14 14 / marie'Ouest, Girafa camelopardalis antiquorum Née le 13 juin 1996 (17 ans) au zoo. Elle sera présentée dans la biozone Sahel-Soudan. Nom : Aramis Jaguar, panthera onca Né le 11 décembre 2009 (4 ans) à Varsovie en Pologne

  1. Universit du Maine, Le Mans, France cole Doctorale Sciences Pour l'Ingnieur, Gosciences, Architecture

    E-Print Network [OSTI]

    Boyer, Edmond

    to monitoring the sodium! cooled fast reactors (SFR) and consists in positioning in the reactor core rapides refroidis par du sodium liquide (RNR!Na). De manière générale, la télémétrie consiste à travers un milieu inhomogène et aléatoire car le sodium liquide est le siège de fluctuations de

  2. The PortevinLe Chatelier (PLC) effect and shear band formation in an AA5754 alloy

    E-Print Network [OSTI]

    Niewczas, Marek

    The Portevin­Le Chatelier (PLC) effect and shear band formation in an AA5754 alloy Herdawandi Halim in order to observe Portevin­Le Chatelier (PLC) band behaviour during tensile deformation of AA5754 sheet and subsequently to measure the level of incre- mental plastic strain carried within the bands. In addition, PLC

  3. Facult des sciences infirmires Le Baccalaurat en sciences infirmires est offert selon divers par-

    E-Print Network [OSTI]

    Montréal, Université de

    titulaires d'un DEC en soins infirmiers, première composante du DEC- Baccalauréat intégré et à l'intention des infirmières et infirmiers en exercice. Le programme est offert selon deux modalités : temps plein destiné aux infirmières et infirmiers en exercice. Le parcours est constitué de trois étapes, les Mineures

  4. La coordination dans le champ sanitaire et mdico-social Enjeux organisationnels et dynamiques professionnelles

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    , management d'équipe, et animation de réseau, p.117 C. Coordonner le parcours des personnes : gestionnaire de : Centre hospitalier universitaire CLIC : Centres locaux d'information et de coordination à caractère, qui sont confrontés à une fragmentation de l'offre (entre le secteur hospitalier, la médecine de ville

  5. Quelles collaborations pour contribuer dvelopper des thrapies innovantes contre le cancer ?

    E-Print Network [OSTI]

    Bordenave, Charles

    cancer ? » 11 mai 2015 - 14h-17h - Amphi II Maison de la Recherche et de la Valorisation 14h00, chimie, physique, ingénierie pour contribuer à améliorer le traitement du cancer. Pierre Brousset, ingénierie pour contribuer à améliorer le traitement du cancer. Jean-Jacques Fournier ­ Centre de Recherche

  6. Propagation de Contraintes et Listes Tabou pour le CSP Mohammad DIB, Alexandre CAMINADA, Hakim MABED

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Propagation de Contraintes et Listes Tabou pour le CSP Mohammad DIB, Alexandre CAMINADA, Hakim pour le CSP. Nous proposons une méthode déterministe qui permet de gérer dynamiquement des coupes dans percentages. 1 INTRODUCTION Un problème de satisfaction de contraintes (CSP) [1] est défini par un ensemble de

  7. nationaL d'Histoire natureLLe Chercheurs, enseignants, musologues... tous partagent le mme but : mieux connatre la

    E-Print Network [OSTI]

    , muséologues... tous partagent le même but : mieux connaître la nature afin de mieux la préserver. Un credo que

  8. ATF2 ULTRA-LOW IP BETAS PROPOSAL R. Tomas, H. Braun, J.P. Delahaye, E. Marn, D. Schulte, F. Zimmermann, CERN

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    ATF2 ULTRA-LOW IP BETAS PROPOSAL R. Tom´as, H. Braun, J.P. Delahaye, E. Mar´n, D. Schulte, F at these ultra-low IP betas. INTRODUCTION ATF2 is a test facility with the aim of testing the FFS design that has Design 0.1 1.0 19000 ATF2 ultra-low Proposed 0.025 1.0 76000 CLIC 3TeV Design 0.09 3.5 63000 ILC Design 0

  9. PDGF-mediated protection of SH-SY5Y cells against Tat toxin involves regulation of extracellular glutamate and intracellular calcium

    SciTech Connect (OSTI)

    Zhu Xuhui [Department of Molecular and Integrative Physiology, 5000 Wahl Hall East, University of Kansas Medical Center, 3901 Rainbow Blvd, Kansas City, KS 66160 (United States); Department of Laboratory Medicine, Tongji Hospital and Tongji Medical College of Huazhong University of Science and Technology, Wuhan (China); Yao Honghong; Peng Fuwang; Callen, Shannon [Department of Molecular and Integrative Physiology, 5000 Wahl Hall East, University of Kansas Medical Center, 3901 Rainbow Blvd, Kansas City, KS 66160 (United States); Buch, Shilpa [Department of Molecular and Integrative Physiology, 5000 Wahl Hall East, University of Kansas Medical Center, 3901 Rainbow Blvd, Kansas City, KS 66160 (United States)], E-mail: sbuch@kumc.edu

    2009-10-15

    The human immunodeficiency virus (HIV-1) protein Tat has been implicated in mediating neuronal apoptosis, one of the hallmark features of HIV-associated dementia (HAD). Mitigation of the toxic effects of Tat could thus be a potential mechanism for reducing HIV toxicity in the brain. In this study we demonstrated that Tat-induced neurotoxicity was abolished by NMDA antagonist-MK801, suggesting the role of glutamate in this process. Furthermore, we also found that pretreatment of SH-SY5Y cells with PDGF exerted protection against Tat toxicity by decreasing extracellular glutamate levels. We also demonstrated that extracellular calcium chelator EGTA was able to abolish PDGF-mediated neuroprotection, thereby underscoring the role of calcium signaling in PDGF-mediated neuroprotection. We also showed that Erk signaling pathway was critical for PDGF-mediated protection of cells. Additionally, blocking calcium entry with EGTA resulted in suppression of PDGF-induced Erk activation. These findings thus underscore the role of PDGF-mediated calcium signaling and Erk phosphorylation in the protection of cells against HIV Tat toxicity.

  10. Le polyimide-alumine : un isolant performant utilis dans un aimant supraconducteur refroidi l'hlium superfluide

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1761 Le polyimide-alumine : un isolant performant utilisé dans un aimant supraconducteur refroidi à'est avéré nécessaire de développer un matériau nouveau : le polyimide-alumine. Le programme de développement to develop a new material : polyimide-alumina. The development program resulted in the achievement

  11. YAHOO!, INC., a Delaware corporation, Plaintiff, LA LIGUE CONTRE LE RACISME ET L'ANTISEMITISME, a French association, et al.,

    E-Print Network [OSTI]

    Shamos, Michael I.

    YAHOO!, INC., a Delaware corporation, Plaintiff, v. LA LIGUE CONTRE LE RACISME ET L Defendants La Ligue Contre Le Racisme Et l'Antisemitisme ("LICRA") and L'Union Des Etudiants Juifs De France each. Join now. Tell me when this page is updated Page 1 of 10Yahoo v. La Ligue Contre Le Racisme et L

  12. ACCUEIL > NUMRIQUE & INFORMATIQUE Le professeur Andrew Ellis pense que les tuyaux d'Internet seront bientt victimes

    E-Print Network [OSTI]

    Lefèvre, Laurent

    'Internet seront bientôt victimes d'embouteillages XXL provocant un blackout total. © DR SUR LE MÊME SUJET Internet Nouvelle France industrielle : le numérique est partout ! Un blackout d'Internet en 2023 ? 5 raisons de ne'Internet seront bientôt victimes d'embouteillages XXL provocant un blackout total. Le professeur Andrew Ellis

  13. ACCELERATING VERY FAST GAS IN THE SUPERNOVA IMPOSTOR SN 2009ip WITH JETS FROM A STELLAR COMPANION

    SciTech Connect (OSTI)

    Tsebrenko, Danny; Soker, Noam E-mail: soker@physics.technion.ac.il

    2013-11-10

    Using hydrodynamic numerical simulations we show that high-velocity ejecta with v ? 10{sup 4} km s{sup –1} in the outbursts of the supernova impostor SN 2009ip and similar luminous blue variable (LBV) stars can be explained by the interaction of fast jets, having v {sub jet} ? 2000-3000 km s{sup –1}, with a circumbinary shell (extended envelope). The density profile in the shell is very steep such that the shock wave, that is excited by the jets' interaction with the shell, accelerates to high velocities as it propagates outward. The amount of very fast ejecta is small, but sufficient to account for some absorption lines. Such an extended envelope can be formed from the binary interaction and/or the unstable phase of the LBV primary star. The jets themselves are launched by the more compact secondary star near periastron passages.

  14. A two-step route to planar perovskite cells exhibiting reduced hysteresis Alexander H. Ip, Li Na Quan, Michael M. Adachi, Jeffrey J. McDowell, Jixian Xu, Dong Ha Kim, and Edward H.

    E-Print Network [OSTI]

    Sargent, Edward H. "Ted"

    A two-step route to planar perovskite cells exhibiting reduced hysteresis Alexander H. Ip, Li Na-efficiency planar perovskite solar cells Appl. Phys. Lett. 104, 253508 (2014); 10.1063/1.4885367 Dominating to IP: 142.150.235.171 On: Mon, 08 Jun 2015 18:21:31 #12;A two-step route to planar perovskite cells

  15. Abstract--Broadcast TV distribution over an IP network requires stringent QoS constraints, such as low latency and loss.

    E-Print Network [OSTI]

    Yuksel, Murat

    -wire or tunnel in parallel to the IP adjacencies (links) along the forwarding path used by the PIM tree. For each such tunnel both a primary and backup path are defined. The backup path is Layer-1-disjoint from the physical are transparent to the Interior Gateway Protocol (IGP). Although one may choose the back-up path's IGP link

  16. 978-1-4244-5489-1/10/ $26.00 2010 IEEE Abstract--Broadcast TV distribution over an IP network

    E-Print Network [OSTI]

    Yuksel, Murat

    ) is a proven failure restoration technique. Link-based FRR creates a pseudo-wire or tunnel in parallel to the IP adjacencies (links); and thus, single link failures are transparent to the Interior Gateway combined with the Internal Gateway Protocol (IGP) reconfiguration process (which may take several seconds

  17. Msc. Project in Ecology and Evolution or Climate Sciences Paleoecology Group, IPS and OCCR, Dr. Paul Henne and Prof. Willy Tinner

    E-Print Network [OSTI]

    Bern, Universität

    Msc. Project in Ecology and Evolution or Climate Sciences Paleoecology Group, IPS and OCCR, Dr. Paul Henne and Prof. Willy Tinner Applying paleoecological data to improve simulations of tree regeneration in Swiss forests Paleoecology and ecological modeling are powerful tools for studying climate

  18. Un robot voiles pour des missions scientifiques Brest, le projet s'appelle Vaimos, pour Voilier Brest, le projet s'appelle Vaimos, pour Voilier Brest, le projet s'appelle Vaimos, pour Voilier Brest, le projet s'appelle Vaimos, pour Voilier

    E-Print Network [OSTI]

    Lherminier, Pascale

    Un robot à voiles pour des missions scientifiques À Brest, le projet s'appelle Vaimos, pour Voilier.océanographiques de surface.océanographiques de surface.océanographiques de surface. Ce robot voilier va réaliser

  19. BAND AID, le film Les inondations les plus catastrophiques au Bangladesh sont lies une conjonction de

    E-Print Network [OSTI]

    BAND AID, le film Les inondations les plus catastrophiques au Bangladesh sont liées à une- Bramapoutre-Meghna au Bangladesh et à l'adaptation des populations au changement climatique. Ce projet

  20. LIEU COMMUN ET CREATION POETIQUE NEOCLASSIQUE : LE CAS DE TOMAS DE IRIARTE (1750-1791)

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1 LIEU COMMUN ET CREATION POETIQUE NEOCLASSIQUE : LE CAS DE TOMAS DE IRIARTE (1750-1791) Marc MARTI. 222 : « ¿ Qué se entendía por imitación a principios del siglo XVIII ? siguiendo la corriente clásica

  1. Introduction au HTML Comment le HTML est-il n ? En fait, tout commence quand TIM BERNERS-LEE cre une

    E-Print Network [OSTI]

    Vellend, Mark

    ). Le langage HTML ne se rencontre pas exclusivement sur le web, celui ci est également utilisé pourIntroduction au HTML Naissance Comment le HTML est-il né ? En fait, tout commence quand TIM BERNERS'époque "la mère de tous les réseaux" : Internet. Le World Wide Web (W.W.W.) est constitué de pages Web. Ces

  2. 1. Exit at Washington Ave. (Exit 17C) 2. Le at Washington Ave. S.

    E-Print Network [OSTI]

    Thomas, David D.

    From I-35W Southbound 1. Exit at Washington Ave. (Exit 17C) 2. Le at Washington Ave. S. 3. Con nue Straight as Washington Ave S becomes Cedar Ave 5. Le on 3rd St S. 6. For 19th Ave Ramp, turn right 17C) 2. Stay in the middle lane and follow the signs for Washington Ave./U of M/West Bank. 3

  3. 1. Exit at Washington Ave. (Exit 17C) 2. Le at Washington Ave. S.

    E-Print Network [OSTI]

    Thomas, David D.

    From I-35W Southbound 1. Exit at Washington Ave. (Exit 17C) 2. Le at Washington Ave. S. 3. Con nue Straight as Washington Ave S becomes Cedar Ave 5. Le on 3rd St S. 6. Con nue to 19th Ave S. Turn right. Con the signs for Washington Ave./U of M/West Bank. 3. Then move to the right lane and take the exit for U of M

  4. 1. Exit at Washington Ave. (Exit 17C) 2. Le at Washington Ave. S.

    E-Print Network [OSTI]

    Thomas, David D.

    From I-35W Southbound 1. Exit at Washington Ave. (Exit 17C) 2. Le at Washington Ave. S. 3. Le at the 2nd signal to con nue on Washington Ave S. 4. Con nue through the signal at 19th Ave. On to 2nd St./U of M (Exit 17C) 2. Stay in the middle lane and follow the signs for Washington Ave./U of M/West Bank. 3

  5. La rflexion sur le projet quinquennal, la rdaction du document AERES et la visite du comit sont maintenant loin derrire nous... A tel point que nous pouvons avoir le sentiment d'tre

    E-Print Network [OSTI]

    Cattin, Rodolphe

    édito La réflexion sur le projet quinquennal, la rédaction du document AERES et la visite du comité

  6. Mme sans dossier AERES, le mois de septembre est toujours aussi anim. Celui-ci n'aura pas drog la rgle, avec en plus le poids des restrictions budgtaires qui pse sur les emplois

    E-Print Network [OSTI]

    Cattin, Rodolphe

    édito Même sans dossier AERES, le mois de septembre est toujours aussi animé. Celui-ci n'aura pas

  7. CAHIER DE RECHERCHE : 2008-05 E1 En France, le concours d'accs aux tudes en soins

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1 CAHIER DE RECHERCHE : 2008-05 E1 En France, le concours d'accès aux études en soins infirmiers de-11Feb2010 #12;2 En France, le concours d'accès aux études en soins infirmiers de 1992 répond-il aux concours d'accès aux études en soins infirmiers défini en 1992, représente le "sas d'entrée en formation

  8. L'Universit Yale L'Universit Yale se trouve dans le centre historique de New Haven, ville portu-

    E-Print Network [OSTI]

    'Environnement en 1900, l'Ecole d'Infirmiers en 1923, le Conservatoire de Théâtre en 1955, l'Ecole d'Architecture en

  9. Low-Resolution STELab IPS 3D Reconstructions of the Whole Heliosphere Interval and Comparison with in-Ecliptic Solar Wind Measurements from STEREO and Wind Instrumentation

    E-Print Network [OSTI]

    Bisi, M. M.; Jackson, B. V.; Buffington, A.; Clover, J. M.; Hick, P. P.; Tokumaru, M.

    2009-01-01

    structure of the fast solar wind. J. Geophys. Res. 112,observations of the solar wind. Proc. SPIE 6689, 668911-1.W.A. , Maagoe, S. : 1972, Solar wind velocity from ips

  10. Reprogramming peripheral blood mononuclear cells using an efficient feeder-free, non-integration method to generate iPS cells and the effect of immunophenotype and epigenetic state on HSPC fate 

    E-Print Network [OSTI]

    Liu, Jing

    2014-11-28

    Background and objectives In 2006 Shinya Yamanaka successfully reprogrammed mouse fibroblasts back to an embryonic stem cell-like state (called induced pluripotent cells, iPS cells) using retrovirus to introduce four ...

  11. http://dx.doi.org/10.1090/conm/426/08187 Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download from IP 128.118.88.48.

    E-Print Network [OSTI]

    Bressan, Alberto

    on Sun Dec 29 17:35:46 EST 2013 for download from IP 128.118.88.48. License or copyright restrictions may(t,O+),z(t))dt. ~ Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download from IP://www.ams.org/publications/ebooks/terms #12;~ Licensed to Penn St Univ, University Park. Prepared on Sun Dec 29 17:35:46 EST 2013 for download

  12. SULFUR CHEMISTRY IN THE INTERSTELLAR MEDIUM: THE EFFECT OF VIBRATIONAL EXCITATION OF H{sub 2} IN THE REACTION S{sup +}+H{sub 2} ?SH{sup +}+H

    SciTech Connect (OSTI)

    Zanchet, Alexandre; Herrero, Victor J.; Agúndez, Marcelino; Aguado, Alfredo; Roncero, Octavio

    2013-11-01

    Specific rate constants for the S{sup +}+H{sub 2} reaction are calculated using the ground quartet state potential energy surface and quasi-classical trajectories method. The calculations are performed for H{sub 2} in different vibrational states v = 0-4 and thermal conditions for rotational and translational energies. The calculations lead to slow rate constants for the H{sub 2} vibrational levels v = 0, 1, but a significant enhancement of reactivity is observed when v > 1. The inverse reaction is also studied and rate constants for v = 0 are presented. For comparison, we also recompile previous results of state-to-state rate constants of the C{sup +}+H{sub 2} for H{sub 2} in rovibrational state v, j = (0,0), (1,0), (1,1), and (2,0). The calculated rate coefficients are fitted using an improved form of the standard three-parameter Arrhenius-like equation, which is found to be very accurate in fitting rate constants over a wide range of temperatures (10-4000 K). We investigate the impact of the calculated rate coefficients on the formation of SH{sup +} in the photon-dominated region Orion Bar and find an abundance enhancement of nearly three orders of magnitude when the reaction of S{sup +} with vibrationally excited H{sub 2} is taken into account. The title reaction is thus one of the principal mechanisms in forming SH{sup +} in interstellar clouds.

  13. Approved Module Information for LE2012, 2014/5 Module Title/Name: Teaching English to Speakers of Other

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LE2012, 2014/5 Module Title/Name: Teaching English to Speakers of Other Languages Module Code: LE2012 School: Languages and Social Sciences Module Type: Standard Module New Module? Not Specified Module Credits: 10 Module Management Information Module Leader Name Sue

  14. M. ,PELLET. -CON'l'RIBUTION 13 et elle sera ralise en Allemagne cette anne. Le flacon normal, dans

    E-Print Network [OSTI]

    Boyer, Edmond

    M. ,PELLET. - CON'l'RIBUTION 13 et elle sera réalisée en Allemagne cette année. Le flacon normal. CONTRIBUTION A L'ÉTUDE DU LAIT STÉRILISÉ par M. PELLET, Ingénieur agronome. La stérilisation du lait a été j- vations à la Laiterie municipale de Nantes . .Simultanément, M. Pellet donna-t dans le « Lait» (Septembre

  15. ip_11.indd

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorkingLosThe 26th AnnualHistoryM aterials S cience a nd

  16. II. Disparition du plancher ocanique au fur et mesure que les plaques s'enfoncent le long des fosses ocaniques profondes

    E-Print Network [OSTI]

    Miller, Scott

    formation des volcans débute lorsque la dalle froide s'enfonce dans le manteau brûlant, se réchauffe et se résistant. Comme ce matériau en fusion (ou magma) est moins dense que le manteau dur adjacent, il s

  17. Systme de rapports d'incidents conforme aux normes ITIL pour le

    E-Print Network [OSTI]

    Libre de Bruxelles, Université

    Système de rapports d'incidents conforme aux normes ITIL pour le réseau A.S.T.R.I.D Mémoire . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 1 1.2 Aper¸cu d'ITIL . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 2 1.3 Objectifs de ce m´emoire . . . . . . . . . . . . . . . . . . . . . . . . . . . 3 2 ITIL 4 2.1 Introduction

  18. Is Computational Materials Science Richard LeSar, Materials Science and Technology Division, Los Alamos National

    E-Print Network [OSTI]

    Zhigilei, Leonid V.

    Is Computational Materials Science Overrated? Richard LeSar, Materials Science and Technology of Materials Science and Mineral Engineering, Universityof California, Berkeley, CA 94720, USA, and Materials Computational materials science is one of the fastest growing disciplines in materials science. With an ever

  19. Journe thmatique MOMAS sur l'lectrocintique, le 29 juin 2011 Lyon (campus de la Doua),

    E-Print Network [OSTI]

    Maume-Deschamps, Véronique

    Journée thématique MOMAS sur l'électrocinétique, le 29 juin 2011 à Lyon (campus de la Doua), Amphi Grignard http://oscar.univ-lyon1.fr/appli-externe/plan/plans/plan_campus_ouest.html 09h30-09h40 Accueil et UMR CNRS 5208 Faculté des Sciences et Technologies, Université Lyon 1 43, Bd du onze novembre 1918

  20. Approved Module Information for LE3025, 2014/5 Module Title/Name: Leadership & Management

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    . Students will continue to learn how to: select and use data and information from primary sources (eApproved Module Information for LE3025, 2014/5 Module Title/Name: Leadership & Management Module? Not Specified Module Credits: 20 Module Management Information Module Leader Name Judith Baxter

  1. Approved Module Information for LE3024, 2014/5 Module Title/Name: Leadership & Management

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    will learn how to: select and use data and information from primary sources (e.g. authentic dataApproved Module Information for LE3024, 2014/5 Module Title/Name: Leadership & Management Module? Not Specified Module Credits: 20 Module Management Information Module Leader Name Judith Baxter

  2. Mis `a jour le 5 decembre 2009 Rapport sur ma mission

    E-Print Network [OSTI]

    Waldschmidt, Michel

    Mis `a jour le 5 d´ecembre 2009 Rapport sur ma mission French Science Tour in Pakistan du 25 au Pakistan, `a effectuer une mission French Science Tour in Pakistan du 25 novembre au 2 d'agissait de ma deuxi`eme mission au Pakistan, la premi`ere ayant eu lieu en f´evrier 2009, quand j'avais pass

  3. pour obtenir le grade de Docteur de l'Universit des Antilles et de la Guyane

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    . Néanmoins, des mercis spéciaux à Raphaël Achard le sauveur dégazeur, Philippe Tixier et Pierre Direction du CIRAD m'a également toujours soutenue ; merci en particulier à Jean-Pierre Gaillard, Jacky monde que nous espérons meilleurs : Pierre Beaujard, François Leclant, Daniel Barreteau... Heureusement

  4. ED n431 : ICMS Information, communication, modlisation et simulation pour obtenir le grade de

    E-Print Network [OSTI]

    Boyer, Edmond

    . Corinne ROUMES Rapporteur M. Patrick LE CALLET Rapporteur M. Jacques DROULEZ Examinateur M. Jean-Pierre JESSEL Examinateur M. Philippe FUCHS Examinateur M. Guillaume MOREAU Examinateur M. Frédéric ACHARD ses remarques m'a encouragée à être plus précise dans mes futures recherches. · Jean-Pierre Jessel et

  5. A Tutorial on Energy-Based Learning Yann LeCun, Sumit Chopra, Raia Hadsell,

    E-Print Network [OSTI]

    LeCun, Yann

    /learning framework, the wide choice of energy func- tions and loss functionals allows for the design of many types as special types of energy-based models in which the energy function satisfies certain normalizabilityA Tutorial on Energy-Based Learning Yann LeCun, Sumit Chopra, Raia Hadsell, Marc'Aurelio Ranzato

  6. A Tutorial on EnergyBased Learning Yann LeCun, Sumit Chopra, Raia Hadsell,

    E-Print Network [OSTI]

    LeCun, Yann

    /learning framework, the wide choice of energy func­ tions and loss functionals allows for the design of many types as special types of energy­based models in which the energy function satisfies certain normalizabilityA Tutorial on Energy­Based Learning Yann LeCun, Sumit Chopra, Raia Hadsell, Marc'Aurelio Ranzato

  7. LE JOURNAL DE PHYSIQUE Generalization of the Fermi-Segr formula

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1491 LE JOURNAL DE PHYSIQUE Generalization of the Fermi-Segrè formula N. Frôman and P. O. Fröman. 2014 A generalization of the non-relativistic Fermi-Segrè formula into a formula which is valid also. The formula thus obtained, which gives an expression for the limit of u(r)/rl+ 1 as r ~ 0, where u

  8. REGULATION POLITIQUE ET REGULATION D'USAGE DANS LE TEMPS DE TRAVAIL1

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1 REGULATION POLITIQUE ET REGULATION D'USAGE DANS LE TEMPS DE TRAVAIL1 : par G. de Terssac, J REGULATION AND REGULATION OF USE OVER WORKING TIME In this paper we discuss « social regulations » as defined by Reynaud (1999). These regulations, in our case (working)-time regulations, are multiple. Their combination

  9. Contribution # l'implantation d'algorithmes g#om#triques sur machine parall#le

    E-Print Network [OSTI]

    Bermond, Jean-Claude

    , les donn#es d'un probl#me sont souvent acquises progressivement, particuli#rement dans le domaine de maintenir une carte des trap#zes sur une bande verticale, l'ensemble de ces cartes formant une partition du#cessaire de maintenir une r#partition #quilibr#e des donn#es entre les processeurs. Pour #viter la saturation

  10. Devoir en temps libre d'algorithmique # rendre le lundi 26 novembre 2001

    E-Print Network [OSTI]

    Portier, Natacha

    autant que possible le m#me poids de fromage chacun. Une donn#e du probl#me de partition est un Portier # r#diger soigneusement. Partition La cr#mi#re donne # Jean-Claude et Pascal un probl#me de partitio* *n ? Montrez qu'il existe une constante K telle que m(S) Km* pour toute

  11. Test de conformit : une approche algbrique Agns Arnould* --Pascale Le Gall**

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    RECHERCHE Test de conformité : une approche algébrique Agnès Arnould* -- Pascale Le Gall** * IRCOM@lami.univ-evry.fr RÉSUMÉ. Nous proposons dans cet article une formalisation du test de conformité contre des spécifications concrétisons les tests abstraits issus des spécifications en tests concrets dans les langages de programmation

  12. Good Practices as a Quality-Oriented Modeling Vincent Le Gloahec

    E-Print Network [OSTI]

    Boyer, Edmond

    Good Practices as a Quality-Oriented Modeling Assistant Vincent Le Gloahec Alkante SAS, France. These good practices are often described in software quality manuals that, in this form, do not guarantee framework enables on the one hand to describe the good practices and on the other hand to check

  13. prsente pour obtenir le grade de Docteur de l' cole Nationale Suprieure des Tlcommunications

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Nouveaux Codes Spatio-Temporels pour les Systèmes Ultra Large Bande par Impulsions Jury composé de enthousi- asme et persévérance le développement de ma thèse. Je remercie également Norbert Daniele qui transmissions, most of the existing space-time (ST) coding schemes (the best known ones in any case) can

  14. Active and Passive Learning in Agent-based Financial Markets Blake LeBaron

    E-Print Network [OSTI]

    Tesfatsion, Leigh

    Active and Passive Learning in Agent-based Financial Markets Blake LeBaron International Business of learning which are present in most agent-based financial markets. First, passive learning refers to a form active and passive learning dynamics. I will define and argue that both these forms of learning

  15. 2-Loop Functional Renormalization Group Theory of the Depinning Transition Pierre Le Doussal1

    E-Print Network [OSTI]

    Wiese, Kay Jörg

    simulations. The high value of 0.5 found in experiments both on the contact line depinning of liquid Helium2-Loop Functional Renormalization Group Theory of the Depinning Transition Pierre Le Doussal1 , Kay and elastic periodic systems at zero temperature, taking properly into account the non- analytic form

  16. Two-loop functional renormalization group theory of the depinning transition Pierre Le Doussal,1

    E-Print Network [OSTI]

    Wiese, Kay Jörg

    with simulations. The high value of 0.5 in experiments both on Helium contact line depinning and on slow crackTwo-loop functional renormalization group theory of the depinning transition Pierre Le Doussal,1 at zero temperature, taking properly into account the nonanalytic form of the dynamical action. This cures

  17. Europe et Japon au coude--coude pour accueillir le racteur ITER

    E-Print Network [OSTI]

    LE 18.12.03 | 13h1713h17 · La compétition pour l'implantation de la machine à fusion thermonucléaire expérimental à fusion thermonucléaire ITER. S'il fait penser à la hampe d'un drapeau fichée sur un sommet spécialistes - dont une cinquantaine d'experts étrangers - de la fusion thermonucléaire, qui viennent d

  18. Come si sceglie l'algoritmo di allineamento? le due proteine

    E-Print Network [OSTI]

    Morante, Silvia

    Come si sceglie l'algoritmo di allineamento? Domande: le due proteine hanno domini simili locale quale algoritmo di allineamento è opportuno utilizzare quale matrice di somiglianza è opportuno;Descrizione di un generico algoritmo di allineamento Siano date due sequenze, S1 e S2 , formate

  19. Big Data Retour vers le Futur -3 -De Statisticien Data Scientist

    E-Print Network [OSTI]

    Besse, Philippe

    Big Data ­ Retour vers le Futur - 3 - De Statisticien à Data Scientist Philippe Besse Aurélien ; statistical learning ; big data. Université de Toulouse ­ INSA, Institut de Mathématiques, UMR CNRS 5219 omiques la décennie suivante ; ­ avènement récent et très médiatisé du big data. Nous terminons en

  20. Complete Genome Sequence of Le Blanc Virus, a Third Caenorhabditis Nematode-Infecting Virus

    E-Print Network [OSTI]

    Wang, David

    Complete Genome Sequence of Le Blanc Virus, a Third Caenorhabditis Nematode-Infecting Virus Carl J,a and Institute of Biology of the Ecole Normale Supérieure (IBENS), Paris, Franceb Orsay virus and Santeuil virus, the first known viruses capable of naturally infecting the nematodes Caenorhabditis elegans

  1. Building the Santa Fe Artificial Stock Market Blake LeBaron

    E-Print Network [OSTI]

    Tesfatsion, Leigh

    Building the Santa Fe Artificial Stock Market Blake LeBaron Brandeis University June 2002 Abstract This short summary presents an insider's look at the construction of the Santa Fe artificial stock of the directions that researchers have been taking is the use of agent-based financial markets. These "bottom- up

  2. Article pour le n10 de la revue Sociologies Pratiques SOCIOLOGIE et MANAGEMENT Allers et retours

    E-Print Network [OSTI]

    Boyer, Edmond

    certifications en France, 96196 en Europe et 203098 dans le monde2 . La norme ISO 14001 propose aux acteurs rapport d'audit est concluant. La certification selon la norme ISO 14001 n'est pas la seule possibilité'évaluation, la certification selon ISO 14001 et l'EMAS sont très proches dans leur fonctionnement et dans leurs

  3. Editorial p 3 Le Forum EPFL en bref... p 4-5

    E-Print Network [OSTI]

    Picasso, Marco

    » évolue également en 2013 et devient le « Forum Respon- sable » ! En effet, après la certification ISO 14 certification ISO 9001, standard international en matiere de gestion de la qualité. Nous nous réjouissons de esprit corporate ! Comité Forum EPFL 2013 ISO 14001 r esponsabl e a LDE_infos_partie1.indd 3 28.08.13 11

  4. Shannon meets Blackwell and Le Cam: channels, codes, and statistical experiments

    E-Print Network [OSTI]

    Raginsky, Maxim

    Abstract--The Blackwell­Le Cam decision theory provides an approximation framework for statistical). This theory has led to deep results in mathematical statistics, such as the proof of asymptotic equivalence, a statistical experiment is just a noisy communication channel with an uncoded input [9]; all the processing

  5. JAMUS: Java Accommodation of Mobile Untrusted Software Nicolas Le Sommer and Frdric Guidec

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    JAMUS: Java Accommodation of Mobile Untrusted Software Nicolas Le Sommer and Frédéric Guidec (Java Accommodation of Mobile Un- trusted Software) platform we tackle these problems based on a contractual approach of resource manage- ment and access control. JAMUS can accommodate mo- bile Java

  6. The first ML scale for North of Vietnam Le Minh Nguyen a,d

    E-Print Network [OSTI]

    Wu, Yih-Min

    The first ML scale for North of Vietnam Le Minh Nguyen a,d , Ting-Li Lin a,*, Yih-Min Wu a , Bor Attenuation Vietnam Northern Vietnam a b s t r a c t The first local magnitude scale (ML) for Northern Vietnam has been derived using a portable broadband seismic network in Northern Vietnam as part

  7. Universit Paul Czanne -Aix-Marseille III pour obtenir le grade de Docteur en Sciences

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Université Paul Cézanne - Aix-Marseille III THÈSE pour obtenir le grade de Docteur en Sciences de l'Université Paul Cézanne - Aix-Marseille III n 2007AIX30060 Discipline : Optique électromagnétique et image Chat Perdu. À Robert Mi(t)chou(m). Aux Special Ca's (Frères)...et à leur Moitié (Relax). Aux Morbai

  8. LE CONSEIL D'ADMINISTRATION -ANNEXES Conseil d'administration au 1er

    E-Print Network [OSTI]

    DSFDME DRV DSS DEV SAJ SAS #12;58 LES UNITÉS DE RECHERCHE ET LES UNITÉS DE SERVICE au 1er juillet 200556 LE CONSEIL D'ADMINISTRATION - ANNEXES Conseil d'administration au 1er juillet 2005 Président;ORGANIGRAMME DES SERVICES CENTRAUXAU 1ER JUILLET 2005 CENTRES RÉGIONAUX EN FRANCE REPRÉSENTATIONS À L

  9. Reprsentations professionnelles, satisfaction au travail et choix de carrire des personnels infirmiers : le rle des

    E-Print Network [OSTI]

    Jeanjean, Louis

    infirmiers : le rôle des valeurs d'autonomie Professional representations, job satisfaction, and career inciter les infirmiers à quitter leur profession. Dans ce cadre, la satisfaction au travail apparaît comme un facteur explicatif majeur, dépendant de la place accordée au "rôle propre" infirmier. Par ailleurs

  10. Facult des sciences infirmires Le Baccalaurat en sciences infirmires est offert selon divers par-

    E-Print Network [OSTI]

    Parrott, Lael

    -Baccalauréat intégré et à l'intention des infirmières et infirmiers en exercice. ­ Les programmes 1-630-4-0, 1 professionnelles L'article 36 de la Loi sur les infirmières et les infirmiers (Lii, art. 36, 2002) présente ainsi le champ de pratique des infirmières : « L'exercice infirmier consiste à évaluer l'état de santé d

  11. Commission nationale franaise pour l'UNESCO Colloque sur le mtier d'enseignant du suprieur

    E-Print Network [OSTI]

    Boyer, Edmond

    'organiser la réponse à un appel d'offre, d'améliorer les relations internationales de son institution, de autour de cinq catégories : - l'enseignement - la recherche - l'administration et le « management » - la métier d'universitaire aux activités d'enseignement et de recherche. De multiples définitions et

  12. Cursus avant le Master Professionnel : 15 hommes et 10 femmes ont rpondu au questionnaire,

    E-Print Network [OSTI]

    Heurteaux, Yanick

    3 Génie électrique (réponse autre) Diplôme supérieur d'Assistant en Management (réponse autre) DUT - sécurité - environnement dans des entreprises de toutes tailles, dans le milieu hospitalier, mais aussi Management d'une équipe de 7 agents spécialisés en QSE + documentation auditeur. F Laboratoire de mesure de

  13. Elsevier Editorial System(tm) for Le Pharmacien hospitalier et clinicien Manuscript Draft

    E-Print Network [OSTI]

    Boyer, Edmond

    Elsevier Editorial System(tm) for Le Pharmacien hospitalier et clinicien Manuscript Draft hospitalier : enquête sur les outils documentaires employés et expression du ressenti. Drug-drug interactions management by hospital pharmacists: survey of used documentation tools and ease self-assessment. Article Type

  14. ENTROPY: A COUNTERPART IN STATISTICAL ENERGY A. Le Bot, A. Carbonelli, J. Perret-Liaudet

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    to the energy level. ICSV18, 10­14 July 2011, Rio de Janeiro, Brazil 1 #12;18th International Congress on SoundENTROPY: A COUNTERPART IN STATISTICAL ENERGY ANALYSIS A. Le Bot, A. Carbonelli, J. Perret. Statistical energy analysis (SEA) is the most famous method intended to prediction of sound and vibration

  15. Dure des phases vgtative et reproductrice chez le mas. Influence du gnotype et du milieu

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    with or without plastic mulch).' Soil ' temperature was more representative than 'air temperature ' to explain, dates of sowing, plastic mulch. I. INTRODUCTION Le cycle du maïs est constitué d'une succession de années, semis décalés, sol couvert ou non de mulch plastique. La vitesse de développement jusqu'à l

  16. Mining Association Rules of Simple Conjunctive Queries Bart Goethals Wim Le Page

    E-Print Network [OSTI]

    Antwerpen, Universiteit

    Mining Association Rules of Simple Conjunctive Queries Bart Goethals Wim Le Page University of Antwerp, Belgium Heikki Mannila HIIT, Helsinki University of Technology University of Helsinki Abstract We present an algorithm for mining association rules in ar- bitrary relational databases. We define

  17. Heat capacity of silver paint A. LeR. Dawson and D. H. Ryan

    E-Print Network [OSTI]

    Ryan, Dominic

    Heat capacity of silver paint A. LeR. Dawson and D. H. Ryan Department of Physics, Center; accepted for publication 15 March 1996 The heat capacity [CP(T)] of a silver loaded paint has been measured,3 however, we have found a silver paint Flexible Silver No. 16 Ref. 4 to be better than Apiezon N for many

  18. Heat Capacity of Silver Paint A.LeR. Dawson and D.H. Ryan

    E-Print Network [OSTI]

    Ryan, Dominic

    Heat Capacity of Silver Paint A.LeR. Dawson and D.H. Ryan Department of Physics The heat capacity (C P (T )) of a silver loaded paint has been measured between 3 K and 30 K. It is shown is Apiezon N grease [2,3], however, we have found a silver paint (Flexible Silver #16 [4]) to be better than

  19. Composition du Comit de slection pour le recrutement d'un professeur 1re

    E-Print Network [OSTI]

    Gutkin, Boris

    Basin (professeur ETH Zurich) sécurité · John Canny (professeur UC Berkeley) robotique, HCI · Laurence comité de sélection se réunira au DI - salle S16 - 45 rue d'Ulm - 75005 Paris : - le vendredi 30 janvier

  20. CNRS Dlgation Cte d'Azur Micro Manager et Arduino pour le pilotage de stations de microscopie 1er au 3 juin 2015

    E-Print Network [OSTI]

    Boulicaut, Jean-François

    CNRS ­ Délégation Côte d'Azur ­ Micro Manager et Arduino pour le pilotage de stations de microscopie ­ 1er au 3 juin 2015 Micro Manager et Arduino pour le pilotage de stations de microscopie Public-midi Arduino : théorie Atelier Arduino Pratique : leds, tensions, températures Commande via le serial

  1. Une plate-forme en Midi-Pyrnes Par La rdaction -Publi le 30 janvier 2014 | L'Usine Nouvelle n 3362

    E-Print Network [OSTI]

    Bordenave, Charles

    ) cherchent à structurer une nouvelle plate-forme mutualisée dans le domaine des drones, à Toulouse. Le projet pourrait bénéficier d'un soutien du conseil régional, dans le cadre du nouveau plan Robotique et drones'un centre d'expérimentation dédié aux drones de moins de 150 kilos. "L'objectif est de se positionner comme

  2. S-H bond activation in H{sub 2}S and thiols by [RhMn(CO){sub 4}(Ph{sub 2}PCH{sub 2}PPh{sub 2}){sub 2}]. Compounds containing terminal or bridging sulfhydryl and thiolato groups

    SciTech Connect (OSTI)

    Li-Sheng Wang; McDonald, R.; Cowie, M. [Univ. of Alberta, Edmonton (Canada)

    1994-08-17

    A rhodium-magnesium carbonyl-phosphines reacted with thiols to yield the products of S-H addition. Further reactions result in bridging sulfide can be alkylated or protonated at the sulfur. The compound, [RhMn(CO){sub 4}({mu}-S)(dppm){sub 2}], was structurally characterized by X-ray crystallography.

  3. ISFA Lyon et IRA Le Mans INSTITUT DE SCIENCE FINANCIERE ET D'ASSURANCES

    E-Print Network [OSTI]

    Di Girolami, Cristina

    ISFA Lyon et IRA Le Mans INSTITUT DE SCIENCE FINANCIERE ET D'ASSURANCES Domaine Scientifique de Gerland 50 Avenue Tony Garnier 69366 LYON CEDEX 07 Tél. (33) 04.37.28.74.40 Fax (33) 04.37.28.76.32 E-mail : isfa@univ-lyon1.fr 2e Journée de séminaires actuariels Vendredi 1er février 2013 àà ll '' II .. SS

  4. Le service d'hbergement web Journes Mathrice Lyon, octobre 2011

    E-Print Network [OSTI]

    Menichi, Luc

    Le service d'hébergement web de la PLM Journées Mathrice Lyon, octobre 2011 #12;L'offre de service les utilisateurs : http://plm.math.cnrs.fr #12;Architecture (logique) rprox db cms web05 web04 web03 web02 web01 htdocs NFS http ssh mysql #12;htdocs Architecture (physique) rprox db cms NFS web05 web04

  5. School of Psychology www.le.ac.uk/psychology/ POSTGRADUATE STUDIES

    E-Print Network [OSTI]

    Banaji,. Murad

    School of Psychology www.le.ac.uk/psychology/ POSTGRADUATE STUDIES MSc Psychological Research in Psychological Research Methods 3 Research in the School 4 Research Degrees: PhD / MPhil 4 How to Apply 6 The School of Psychology 7 The University of Leicester 7 The City 7 U n i v e r s i t y o f L e i c e s t e r

  6. Quand le port d'Ostie dvoile ses mystres Depuis la redcouverte du site antique d'Ostie, la

    E-Print Network [OSTI]

    van Tiggelen, Bart

    lalettrede i'inshs A PROPOS Quand le port d'Ostie dévoile ses mystères Depuis la redécouverte du site antique d'Ostie, la localisation du port romain fait l'objet de débats et sa recherche est

  7. C(re)ek-storation Community Collaboration Site: North Fork of Strawberry Creek by La Loma and Le Conte Avenues

    E-Print Network [OSTI]

    Tannenbaum, Sara Rose

    2011-01-01

    1987. Excerpts from: The Strawberry Creek Management Plan.and Vince Resh. 1992. Strawberry Creek on the University ofSite: North Fork of Strawberry Creek by La Loma and Le Conte

  8. CAHIER DE RECHERCHE : 2008-04 E1 Grer la mobilit professionnelle et l'adaptabilit : le cas des

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    infirmiers. RAPIAU Marie-Thérèse Unité Mixte de Recherche CNRS / Université Pierre Mendès France Grenoble 2 : Gérer la mobilité professionnelle et l'adaptabilité : le cas des infirmiers. Título : Gerenciar, mobilité professionnelle, compétences générales, infirmiers, mondialisation Palavras chave : gestão

  9. Saclay, le 24 avril 2015 EMBARGO JUSQU'AU 24 AVRIL 2015 11H00 (HEURE DE PARIS)

    E-Print Network [OSTI]

    van Tiggelen, Bart

    1/3 Saclay, le 24 avril 2015 EMBARGO JUSQU'AU 24 AVRIL 2015 à 11H00 (HEURE DE PARIS) Batteries Li'utilisation. Au fil de l'utilisation d'une batterie d'accumulateurs, l'électrolyte, qui permet le transport des'utilisation de l'appareil. L'électrolyte est donc un composant clé pour des batteries sûres, fiables et

  10. [1] E. P. Freire, A. Ziviani, and R. M. Salles. Detecting VoIP calls hidden in web traffic. IEEE Transactions on Network and Service Management, 5(4):204-214, Dec. 2008. [ bib | DOI

    E-Print Network [OSTI]

    Briesemeister, Linda

    generated traffic by using real-world experimental data gathered at a commercial Internet Service Provider. Aracil, J. E. L. de Vergara, and S. Lopez-Buedo. Characterization of the busy-hour traffic of ip networks ] Internet traffic measurements collected during the busy hour constitute a key tool to evaluate

  11. Please cite this article in press as: Ramsey, R., & Hamilton, A.F.d.C. Triangles have goals too: Understanding action representation in left aIPS. Neuropsychologia (2010), doi:10.1016/j.neuropsychologia.2010.04.028

    E-Print Network [OSTI]

    Hamilton, Antonia

    2010-01-01

    Please cite this article in press as: Ramsey, R., & Hamilton, A.F.d.C. Triangles have goals too communication Triangles have goals too: Understanding action representation in left aIPS Richard Ramsey of animacy Corresponding author. E-mail address: richard.ramsey@nottingham.ac.uk (R. Ramsey). and brain

  12. Voyage dans le noir. Trous noirs, matière noire, énergie noire et antimatière

    ScienceCinema (OSTI)

    None

    2011-10-06

    Et si nous faisions avec les physiciens un voyage dans le noir ? De l'astrophysique à la physique des particules les trois noirs, la matière noire, l'énergie noire ou l?antimatière intriguent et fascinent. Que sont ces objets qui bousculent nos idées et qui véhiculent parfois des craintes irraisonnées? Luis Alvarez-Gaume, Michael Doser et Christophe Grojean, physiciens du CERN vous invitent à mettre en lumière (!) les constituants de base de la matière et à explorer les mystères de la physique contemporaine. Une soirée lumineuse pour éclairer des concepts et ne plus avoir peur du noir.

  13. Critical Dynamics of Burst Instabilities in the Portevin-Le Chatelier Effect

    SciTech Connect (OSTI)

    D'Anna, Gianfranco; Nori, Franco

    2000-11-06

    We investigate the Portevin-Le Chatelier effect (PLC), by compressing Al-Mg alloys in a very large deformation range, and interpret the results from the viewpoint of phase transitions and critical phenomena. The system undergoes two dynamical phase transitions between intermittent (or ''jerky'') and ''laminar'' plastic dynamic phases. Near these two dynamic critical points, the order parameter 1/{tau} of the PLC effect exhibits large fluctuations, and ''critical slowing down'' (i.e., the number {tau} of bursts, or plastic instabilities, per unit time slows down considerably).

  14. DOE - Office of Legacy Management -- R K Le Blond Machine Tool Co - OH 38

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth Dakota Edgemont,Manufacturing0-19Rulison - COQueen CityK Le

  15. On the Sensitivity of L/E Analysis of Super-Kamiokande Atmospheric Neutrino Data to Neutrino Oscillation Part~2 --- Four Possible L/E Analyses for the Maximum Oscillation by the Numerical Computer Experiment ---

    E-Print Network [OSTI]

    E. Konishi; Y. Minorikawa; V. I. Galkin; M. Ishiwata; I. Nakamura; N. Takahashi; M. Kato; A. Misaki

    2010-07-28

    In the previous paper (Part~1), we have verified that the SK assumption on the direction does not hold in the analysis of neutrino events occurred inside the SK detector. We have made four possible L/E analyses, L_nu/E_nu, L_nu/E_mu, L_mu/E_nu and L_mu/E_mu. Among four kinds of L/E analyses, we have shown that only L_nu/E_nu analysis can give the signature of maximum oscillations clearly, while the L_mu/E_mu analysis which are really done by Super-Kamiokande Collaboration cannot give the maximum oscillation at all. It is thus concluded that Super-Kamiokande type experiment cannot find the maximum oscillation from L/E analysis. Therefore, we would suggest Super-Kamiokande Collaboration to re-analyze the zenith angle distribution of the neutrino events which occur inside the detector carefully.

  16. Toward a midisuperspace quantization of LeMaitre-Tolman-Bondi collapse models

    SciTech Connect (OSTI)

    Vaz, Cenalo; Witten, Louis; Singh, T. P.

    2001-05-15

    LeMaitre-Tolman-Bondi models of spherical dust collapse have been used and continue to be used extensively to study various stellar collapse scenarios. It is by now well known that these models lead to the formation of black holes and naked singularities from regular initial data. The final outcome of the collapse, particularly in the event of naked singularity formation, depends very heavily on quantum effects during the final stages. These quantum effects cannot generally be treated semiclassically as quantum fluctuations of the gravitational field are expected to dominate before the final state is reached. We present a canonical reduction of LeMaitre-Tolman-Bondi space-times describing the marginally bound collapse of inhomogeneous dust, in which the physical radius R, the proper time of the collapsing dust {tau}, and the mass function F are the canonical coordinates R(r), {tau}(r) and F(r) on the phase space. Dirac's constraint quantization leads to a simple functional (Wheeler-DeWitt) equation. The equation is solved and the solution can be employed to study some of the effects of quantum gravity during gravitational collapse with different initial conditions.

  17. SN 2005ip: A luminous type IIn supernova emerging from a dense circumstellar medium as revealed by X-ray observations

    SciTech Connect (OSTI)

    Katsuda, Satoru [RIKEN (The Institute of Physical and Chemical Research) Nishina Center, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Maeda, Keiichi [Department of Astronomy, Kyoto University, Kitashirakawa-Oiwake-cho, Sakyo-ku, Kyoto 606-8502 (Japan); Nozawa, Takaya [Kavli Institute for the Physics and Mathematics of the Universe (WPI), University of Tokyo, 5-1-5 Kashiwanoha, Kashiwa, Chiba 277-8583 (Japan); Pooley, David [Department of Physics, Sam Houston State University, Huntsville, TX 77341-2267 (United States); Immler, Stefan [Astrophysics Science Division, NASA Goddard Space Flight Center, Greenbelt, MD 2077 (United States)

    2014-01-10

    We report on the X-ray spectral evolution of the nearby Type IIn supernova (SN) 2005ip based on Chandra and Swift observations covering ?1-6 yr after explosion. X-ray spectra in all epochs are well fitted by a thermal emission model with kT ? 7 keV. The somewhat high temperature suggests that the X-ray emission mainly arises from the circumstellar medium (CSM) heated by the forward shock. We find that the spectra taken two to three years after the explosion are heavily absorbed (N {sub H} ? 5 × 10{sup 22} cm{sup –2}), but the absorption gradually decreases to the level of the Galactic absorption (N {sub H} ? 4 × 10{sup 20} cm{sup –2}) at the final epoch. This indicates that the SN went off in a dense CSM and that the forward shock has overtaken it. The intrinsic X-ray luminosity stays constant until the final epoch, when it drops by a factor of ?2. The intrinsic 0.2-10 keV luminosity during the plateau phase is measured to be ?1.5 × 10{sup 41} erg s{sup –1}, ranking SN 2005ip as one of the brightest X-ray SNe. Based on the column density, we derive a lower limit of a mass-loss rate to be M-dot ?1.5×10{sup ?2} (V{sub w} /100 km s{sup –1}) M {sub ?} yr{sup –1}, which roughly agrees with that inferred from the X-ray luminosity, M-dot ?2×10{sup ?2} (V{sub w} /100 km s{sup –1}) M {sub ?} yr{sup –1}, where V{sub w} is the circumstellar wind speed. Such a high mass-loss rate suggests that the progenitor star had eruptive mass ejections similar to a luminous blue variable star. The total mass ejected in the eruptive period is estimated to be ?15 M {sub ?}, indicating that the progenitor mass is ? 25 M {sub ?}.

  18. SpoonEMF, une brique logicielle pour l'utilisation de l'IDM dans le cadre de la ringnierie de programmes Java5

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    programmes Java5 Olivier Barais Projet Triskell/IRISA campus de Beaulieu. F - 35 042 Rennes Cedex barais'IDM dans le cadre de la réingénierie d'applications écrites en Java. L'accent dans cette courte réutilisation d'outils comme l'analyseur syntaxique de code Java5 (parser) ou le générateur de code (pretty

  19. Compte rendu du sixime caf thique Le dernier caf thique de l'anne a runi environ 55 personnes, une bonne

    E-Print Network [OSTI]

    Dellandréa, Emmanuel

    notion de guerre juste aujourd'hui. Les nouvelles technologies comme les drones, et le fait d'éloigner l'ONU joue un grand rôle. L'Amiral conclut en affirmant que l'usage de drones contredit le principe

  20. PROGRAMMES DE PREMIER CYCLE EN SCIENCES DES RELIGIONS Le prsent guide nonce les exigences de base du baccalaurat en sciences des religions. Il

    E-Print Network [OSTI]

    Petriu, Emil M.

    l'année prochaine, et vice versa. Planifiez donc en conséquence. Le cours SRS4702 est un cours l'année prochaine, et vice versa. Planifiez donc en conséquence'Antiquité tardive SRS3163/CLA3163 Women in Early Christianity SRS3563/CLA3563 La femme dans le christianisme des

  1. Service Europe et Recherche Le Service Europe et Recherche de L'UNAM est un dispositif d'appui la recherche

    E-Print Network [OSTI]

    Di Girolami, Cristina

    Service Europe et Recherche Le Service Europe et Recherche de L'UNAM est un dispositif d'appui à la'Angers et de Nantes. Pour plus d'informations, retrouvez-nous sur le site du Service Europe et Recherche de Ministère de l'Enseignement Supérieur et de la Recherche PRES L'UNAM Contact : europe.lemans@lunam.fr #12;

  2. Le Camp Massawippi du Centre de radaptation MAB-Mackay est un camp de vacances bilingue qui reoit des campeurs gs entre 6 et 30 ans, qui vivent avec une dficience motrice, auditive, ou visuelle. Le Camp est situ

    E-Print Network [OSTI]

    'équipe de soins infirmiers; Établir les normes et procédures pour le déroulement des activités d'urgence et Langue de travail : Bilingue : Français et Anglais Exigences : Diplôme d'études en soins infirmiers complété; Membre de l'Ordre des infirmiers et infirmières du Québec (OIIQ); Excellent en communication et

  3. Intelligent Placement of Datacenters for Internet Services I~nigo Goiri, Kien Le, Jordi Guitart, Jordi Torres, and Ricardo Bianchini

    E-Print Network [OSTI]

    Bianchini, Ricardo

    Intelligent Placement of Datacenters for Internet Services ´I~nigo Goiri, Kien Le, Jordi Guitart distributed datacenters. The location of the datacenters has a direct impact on the services' response times for datacenters, and delve deeper into seven in- teresting locations. Using the framework and our solution

  4. LeS D.4 Monitored Natural Attenuation -3 ENA OF HETEROCYCLIC HYDROCARBONS BY ADDING HYDROGEN PEROXIDE IN GROUND-

    E-Print Network [OSTI]

    Cirpka, Olaf Arie

    LeS D.4 Monitored Natural Attenuation - 3 ENA OF HETEROCYCLIC HYDROCARBONS BY ADDING HYDROGEN.troetschler@iws.uni-stuttgart.de Keywords: Enhanced Natural Attenuation, Aerobic Biological Degradation, Heterocyclic Hydro- carbons, PAH, Field Trial, Groundwater Circulation Wells (GCW) 1 Introduction Heterocyclic Hydrocarbons (NSO

  5. A Flexible Class Hierarchy Locking Technique in Object-Oriented Database Systems Woochun Jun and Le Gruenwald

    E-Print Network [OSTI]

    Gruenwald, Le

    A Flexible Class Hierarchy Locking Technique in Object-Oriented Database Systems Woochun Jun and Le with class hierarchy which is an important property in OODBs. Our scheme is based on so called special classes and can be used for any applications, with less overhead, by adjusting the number of special

  6. Building Design for Moderate Seismic Regions Peter J. Cheever, LeMessurier Consultants, Cambridge, MA, pcheever@lemessurier.com

    E-Print Network [OSTI]

    Hines, Eric

    Building Design for Moderate Seismic Regions Authors: Peter J. Cheever, LeMessurier Consultants which result in most buildings being designed for Seismic Design Category C, including special seismic detailing consistent with the 1992 AISC Seismic Provisions. Spectral design acceleration values

  7. Multiuser Detection Techniques: An Overview 1 Guoqiang Xue, Jianfeng Weng, Tho LeNgoc, and Sofi`ene Tahar

    E-Print Network [OSTI]

    Tahar, Sofiène

    communication because of the overwhelming MAI. This phenomenon is called near­far problem. Power control is employed in the current 2nd generation CDMA system to mitigate the near­far effect. Ideal power controlMultiuser Detection Techniques: An Overview 1 Guoqiang Xue, Jianfeng Weng, Tho Le­Ngoc, and Sofi

  8. Intraoperative Tracking of Aortic Valve Plane* DLH Nguyen, M Garreau, V Auffret, H Le Breton, JP Verhoye, P Haigron

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1 Intraoperative Tracking of Aortic Valve Plane* DLH Nguyen, M Garreau, V Auffret, H Le Breton, JP Verhoye, P Haigron Abstract--The main objective of this work is to track the aortic valve plane in intra-operative fluoroscopic images in order to optimize and secure Transcatheter Aortic Valve Implantation (TAVI) procedure

  9. L. Le, G. Donohue, C. H. Chen 1 Using Auction-Based Slot Allocation for Traffic Demand

    E-Print Network [OSTI]

    L. Le, G. Donohue, C. H. Chen 1 Using Auction-Based Slot Allocation for Traffic Demand Management, airlines' prior investment and monetary bid into a ranking function with respective weights, we put forward of Hartsfield Atlanta International Airport (ATL) to compare different allocation schemas and the resulting

  10. MicroCast: Network Coding on Android Phones Anh Le, Blerim CiCi, Athina Markopoulou (UC Irvine)

    E-Print Network [OSTI]

    Markopoulou, Athina

    MicroCast: Network Coding on Android Phones Anh Le, Blerim CiCi, Athina Markopoulou (UC Irvine connections: 3G, 802.11, Bluetooth 2.1+EDR Software platform - Android 2.3 - Application written in Java runs on both Android and Java 2 SE Performance Evaluation Uncongested Local Network Congested Local Network

  11. PARTICIPATION SOIGNANTE ET AUTONOMIE INFIRMIERE DANS LE CADRE D'UN DISPOSITIF DE DEPISTAGE DU VIH/SIDA

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    auteur, publié dans "Recherche en soins infirmiers 2012;(108):43-52" #12;2 RESUME Lors d'une étude sur le activité. Des études internationales ont montré l'intérêt d'un dépistage infirmier. Dans cinq des services, 25 entretiens ont été conduits auprès d'infirmier-e-s, cadres infirmier-e-s et médecins. La

  12. Le Laboratoire d'Ocanographie et du Climat, Exprimentations et Approches Numriques (LOCEAN) recrute son Administrateur (F/H)

    E-Print Network [OSTI]

    Arleo, Angelo

    d'offre Préparer les contrats et les conventions et contribuer au développement des partenariats (7 agents) Vos activités associées : Mettre en oeuvre la politique d'achat et les procédures d'appel recherche et d'enseignement supérieur Le fonctionnement et les circuits de décision des tutelles Les

  13. 80 IEEE SIGNAL PROCESSING LE'ITERS, VOL. 1, NO. 5, MAY 1994 Using Least Squares to Improve

    E-Print Network [OSTI]

    Swindlehurst, A. Lee

    80 IEEE SIGNAL PROCESSING LE'ITERS, VOL. 1, NO. 5, MAY 1994 Using Least Squares to Improve Blind Signal Copy Performance A. Swindlehurst, Member, IEEE, and J. Yang Abstract-Conventional methods for signal copy require one to estimate the directions of arrival (DOA's) of the signals prior to computing

  14. Automatic Learning of Subclasses of Pattern Languages John Case 1 , Sanjay Jain #,2 , Trong Dao Le 2 ,

    E-Print Network [OSTI]

    Stephan, Frank

    Automatic Learning of Subclasses of Pattern Languages John Case 1 , Sanjay Jain #,2 , Trong Dao Le, Republic of Singapore. fstephan@comp.nus.edu.sg Abstract. Automatic classes are classes of languages way, given an index for the language. For alphabet size of at least 4, every automatic class

  15. RNA Extraction and Labeling 1. To IP pellet (~ 25 l vol), add 175 l of: 10 mM HEPES-NaOH, pH 7.5

    E-Print Network [OSTI]

    Aris, John P.

    85 RNA Extraction and Labeling 1. To IP pellet (~ 25 µl vol), add 175 µl of: 10 mM HEPES-NaOH, pH 7 Speed-Vac. 7. Labeling 3' ends. To each pellet, add 10 µl containing: 1 X NEB RNA Ligase buffer 10% DMSO precipitate. Use DEPC-treated 3M NaOAc, pH 5. Wash with 75% EtOH and dry. 12. Resuspend pellet completely in 5

  16. The severe scaling challenges of mainstream memories mo vated recent ac ve research on emerging nonvola le memory (eNVM) technologies. Some promising candidates, i.e., phase change memory, spintronic memory, and resis ve memory

    E-Print Network [OSTI]

    DeMara, Ronald F.

    nonvola le memory (eNVM) technologies. Some promising candidates, i.e., phase change memory, spintronic

  17. Plutonium stabilization and handling (PuSH)

    SciTech Connect (OSTI)

    Weiss, E.V.

    1997-01-23

    This Functional Design Criteria (FDC) addresses construction of a Stabilization and Packaging System (SPS) to oxidize and package for long term storage remaining plutonium-bearing special nuclear materials currently in inventory at the Plutonium Finishing Plant (PFP), and modification of vault equipment to allow storage of resulting packages of stabilized SNM for up to fifty years. The major sections of the project are: site preparation; SPS Procurement, Installation, and Testing; storage vault modification; and characterization equipment additions. The SPS will be procured as part of a Department of Energy nationwide common procurement. Specific design crit1460eria for the SPS have been extracted from that contract and are contained in an appendix to this document.

  18. 4. Wrzburger Workshop ,,IP Netzmanagement, IP Netzplanung und Optimierung"

    E-Print Network [OSTI]

    Tran-Gia, Phuoc

    Protocol (ICMP, ,,ping" and ,,traceroute" Funktionen) - Simple Network Management Protocol (SNMP) - DNSRessourcenmanagement Architektur R R R R R R S R R R S S QoS Architektur Harte und weiche QoS Garantien DiffServ Netz mit

  19. Voil plus d'un an que nous nous prparions cette visite : le comit AERES sera dans nos murs la semaine prochaine pour valuer le bilan scientifique de notre unit au cours des dernires

    E-Print Network [OSTI]

    Cattin, Rodolphe

    édito Voilà plus d'un an que nous nous préparions à cette visite : le comité AERES sera dans nos laboratoire, doctorants compris, et les membres du comité AERES. Si des réunions sont organisées en amont par... les personnels - arrivée - distinction - naissance à savoir - visite du comité AERES - LIAArménie - 14

  20. Dynaically Responsive IP Window Coatings

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Pacific Northwest National Laboratory Dynamically Responsive IR Window Coatings 2014 Building Technologies Office Peer Review 2 Project Summary Timeline: Start date:...

  1. IP_Climate_Poster 121312

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    of a publication or guarantee its technical correctness. Title: Northern New Mexico Climate, Water Year 2012 at Los Alamos National Laboratory, Poster, Individual Permit for...

  2. IP Awareness Seminar Presented by

    E-Print Network [OSTI]

    Yang, Eui-Hyeok

    /Patent Process at Stevens Inventor Idea Issued Patent 2 ­ 4 Years US PTO Inventor Incentives Inventor OIE: Details, Details, 1. "First-Inventor-to-File" system ­ Effective Date: March 16, 2013. 3. Post requirement that an individual inventor be listed as the applicant. Effective Date: Applies to applications

  3. IP_Climate_Poster 121312

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (JournalvivoHighHussein KhalilResearch88 Sign In About | Careers |

  4. A review of "Apology for the Woman Writing and Other Works." by Marie le Jars de Gournay 

    E-Print Network [OSTI]

    Alisa Plant

    2003-01-01

    they are understood, albeit in terms of the dominant discourse, and contribute to the production and negotiation of meaning. Luckyj?s provocative work invites scholars to investigate the complex implications of silences? both theoretical and cultural?and should... prompt questions about whether multivalent silences also inform other early modern cul- tural discourses such as treason, Protestant spirituality, witchcraft, race, and class. Marie le Jars de Gournay. Apology for the Woman Writing and Other Works...

  5. Les dterminants du prix du carbone sur le march europen des quotas Carbon price drivers in the EU Emissions Trading Scheme

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    in the EU Emissions Trading Scheme Emilie Alberola1 et Julien Chevallier2 Résumé: L'article examine le prix des quotas durant la première période (2005-2007) de l'European Union Emissions Trading Scheme (EU

  6. Le 16 mars 2007 3me Colloque du PESOR V.2 Aude Schindler 1/40 Quels outils de pilotage stratgique

    E-Print Network [OSTI]

    Recanati, Catherine

    stratégique pour les entreprises innovantes ? Le cas du centre de recherche intégré MIRCen (CEA) « Management*-NeuroSpin-MIRCen** Domaine de la santé et de l'expérimentation animale * SHFJ : Service Hospitalier Frédéric Joliot

  7. Italo Calvino: mythical writing in an enlightened world. Desire, utopia and earthly transcendence in the cosmicomic stories, Le città invisibili, and Palomar 

    E-Print Network [OSTI]

    Petsota, Myrto

    2012-11-27

    This thesis offers an interpretative framework of Italo Calvino’s later work (the cosmicomic stories, Le città invisibili, and Palomar), based on the notions of myth, desire, utopia and science. Its aim is to suggest a ...

  8. 03/12/10 21:54 -LE_SOIR du 04/12/10 -p. 36 L'alternance jour-nuit, les battements du coeur, la respiration : la vie est une

    E-Print Network [OSTI]

    Goldbeter, Albert

    03/12/10 21:54 - LE_SOIR du 04/12/10 - p. 36 L'alternance jour-nuit, les battements du coeur, la longs. Un exem- ple : le bambou. Sa floraison n'intervient pas chaque an- née. « La plupart des espèces ont une périodicité de florai- son de l'ordre de 15 à 60 ans », écrit le chercheur qui précise aussi

  9. ISSN 0362 1197, Human Physiology, 2012, Vol. 38, No. 2, pp. 121128. Pleiades Publishing, Inc., 2012. Original Russian Text I.P. Ganin, S.L. Shishkin, A. G. Kochetova, A.Ya. Kaplan, 2012, published in Fiziologiya Cheloveka, 2012, Vol. 38, No. 2, pp. 513.

    E-Print Network [OSTI]

    Kaplan, Alexander

    ., 2012. Original Russian Text © I.P. Ganin, S.L. Shishkin, A. G. Kochetova, A.Ya. Kaplan, 2012, published of the Stimulus Position in a Stimulus Train I. P. Ganin, S. L. Shishkin, A. G. Kochetova, and A. Ya. Kaplan

  10. Depinning in a two-layer model of plastic flow Pierre Le Doussal,1 M. Cristina Marchetti,2 and Kay Jrg Wiese1

    E-Print Network [OSTI]

    Wiese, Kay Jörg

    Depinning in a two-layer model of plastic flow Pierre Le Doussal,1 M. Cristina Marchetti,2 and Kay to hysteretic plastic depinning as disorder or viscous coupling is increased. A functional renormalization group state and a pinned state below the elastic depinning threshold, with hysteretic plastic depinning

  11. Dans l'espace Le problme en volume est moins simple qu'il n'en a l'air.

    E-Print Network [OSTI]

    Pansu, Pierre

    Dans l'espace Le problème en volume est moins simple qu'il n'en a l'air. Cela ressemble à une de savon maximise l'aire enserrée par la ficelle (en minimisant l'aire du complémentaire). A New

  12. Lecture Session (LeS): E.1 In-situ chemical oxidation-1 ENA OF HETEROCYCLIC HYDROCARBONS USING HYDROGEN PEROXIDE AND

    E-Print Network [OSTI]

    Cirpka, Olaf Arie

    , In situ Biological Degradation, Heterocyclic Hydrocarbons, PAH, Field Trial, Groundwater Circulation WellsLecture Session (LeS): E.1 In-situ chemical oxidation-1 ENA OF HETEROCYCLIC HYDROCARBONS USING (GCW), Hydrogen Peroxide Introduction Heterocyclic hydrocarbons (NSO-HET) containing nitrogen (N

  13. LE BULLETIN DE L'EPI N 41 MICRO-PROLOG DANS L'ACADMIE D'AIX MARSEILLE MICRO-PROLOG

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    -Luc Berthon, Yves Sthorez, Jean-Pierre Ferrand et Jean- Jacques Achard. Impression et diffusion par le CRDP de'ACADÉMIE D'AIX MARSEILLE Jean-Jacques ACHARD Rappels sur les années antérieures 1983-84 : au CREF1 à Luminy. ­ réécriture de Simple pour les élèves de 4ème de la Ciotat par J.- J. Achard. ­ réécriture d'une brochure d

  14. Note de lecture de Ren Guitart sur le livre de Monique Sassier, Ordres et dsordres du sens, entre langue et discours, L'harmattan, 2004, 236 p.

    E-Print Network [OSTI]

    Guitart, René - Institut de Mathématiques de Jussieu, Université Paris 7

    la modélisation proprement dite, est d'une part le « modèle VOIR » de Pierre Achard dont la en place en effet d'abord pour donner à lire des idées de Pierre Achard, et qui permet d'élargir l et d'Achard, et en relation avec une détermination du linguistique qui réfère à Saussure, à

  15. Istituzioni di Matematica C. d. L. in Biotecnologie 1. Un brodo di coltura `e infetto da N0 batteri. Le cellule dei batteri si dividono

    E-Print Network [OSTI]

    Achilles, Rüdiger

    da N0 batteri. Le cellule dei batteri si dividono ogni tre ore. (a) Quanti batteri ci saranno nel brodo dopo 24 h? (b) Determinare il parametro (in h-1 ) in modo tale che il numero N dei batteri parametro µ (in h-1 ) in modo tale che il numero N dei batteri presenti dopo t ore possa essere approssimata

  16. Istituzioni di Matematica C. d. L. in Biotecnologie 1. Un brodo di coltura `e infetto da N0 batteri. Le cellule dei batteri si dividono

    E-Print Network [OSTI]

    Achilles, Rüdiger

    da N0 batteri. Le cellule dei batteri si dividono ogni quattro ore. (a) Quanti batteri ci saranno nel brodo dopo 24 h? (b) Determinare il parametro (in h-1 ) in modo tale che il numero N dei batteri parametro µ (in h-1 ) in modo tale che il numero N dei batteri presenti dopo t ore possa essere approssimata

  17. Written by Paul LeBlond for Oceanography news letter George Pickard died recently after a short illness; he was 93. He directed the Institute of

    E-Print Network [OSTI]

    Talley, Lynne D.

    Written by Paul LeBlond for Oceanography news letter George Pickard died recently after a short illness; he was 93. He directed the Institute of Oceanography at UBC for many years and was a major player", said Gordon Shrum, then head of UBC Physics, as he steered George towards oceanography. Following

  18. Biohybrid Solid State Solar Cells David R. Needell1,2, Gabriel LeBlanc2, Evan A. Gizzie2, Kane Jennings3, David E. Cliffel2

    E-Print Network [OSTI]

    Biohybrid Solid State Solar Cells David R. Needell1,2, Gabriel LeBlanc2, Evan A. Gizzie2, Kane Introduction Materials and Methods Background! ! Current Photovoltaic Solar Cells' primary limitation state of the art PSI biohybrid solar cells have been "wet" or liquid cells, i.e. cells with a mediator

  19. Photoreduction of Graphene Oxide with Photosystem I Will Crosbya, Gabriel LeBlancb, Evan Gizzieb, G. Kane Jenningsc, and David E. Cliffelb

    E-Print Network [OSTI]

    Photoreduction of Graphene Oxide with Photosystem I Methods Will Crosbya, Gabriel LeBlancb, Evan). "Improved Synthesis of Graphene Oxide." ACS Nano 4(8): 4806-4814. [3] H. He, J. Klinowski, M. Forster and A of graphene." Nat Mater 6(3): 183-191. PSI can be used to photoreduce GO in solution making a PSI

  20. Alonso de León's 1690 expedition diary into Texas: an edition and study of the Spanish texts with semi-paleographic transcriptions 

    E-Print Network [OSTI]

    McLain, Jana Dale

    2006-04-12

    The 1690 expedition led by Alonso de León into present day Texas proved to be a pivotal journey that had lasting effects on the development of Spain's land north of the Rio Grande. This expedition established the first Catholic mission in the area...

  1. A Database of Lotic Invertebrate Traits for North By Nicole K. M. Vieira, N. LeRoy Poff, Daren M. Carlisle, Stephen R. Moulton II, Marci L. Koski,

    E-Print Network [OSTI]

    Poff, N. LeRoy

    A Database of Lotic Invertebrate Traits for North America By Nicole K. M. Vieira, N. LeRoy Poff, Boris C., 2006, A database of lotic invertebrate traits for North America: U.S. Geological Survey Data ........................................................................................................................................3 Selecting traits for the database

  2. MNHN/DICAP--Janvier2015Imprimsurpapierissudefortsgresdurablement--CouvertureJ.Munier/F.-G.Grandin/B.Faye Le jardin est ouvert de 8h 17h15

    E-Print Network [OSTI]

    rue Cuvier, 75005 Paris mnhn.fr et jardindesplantes.net Accueil des publics : 01 40 79 54 79 · 01 40 zoologique de la Haute-Touche (36) Informations : 02 54 02 20 40 -- Le Marinarium et la Station de Biologie 40 écus âgés de plus de 220 ans, un Sophora du Japon né d'une graine plantée en 1747 et qui fleurit

  3. Lunar Rover Solar Panel MountTeam Members: Tian Le, Tudor Boiangiu, Jeremy Chan, James Haensel To develop a mechanized mount for a solar panel to

    E-Print Network [OSTI]

    Sun, Yu

    Lunar Rover Solar Panel MountTeam Members: Tian Le, Tudor Boiangiu, Jeremy Chan, James Haensel To develop a mechanized mount for a solar panel to be mounted on a lunar rover. Must be: · capable of orienting panel towards sun · reside on mast extending vertically from rover · capable of unfurling solar

  4. TUDE DES LECTRONS ET DES RAIES X D'AUTOIONISATION MIS SIMULTANMENT AVEC LE RAYONNEMENT 03B2 DU PROMETHEUM 147

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    counters incoincidence, astudy has been made of the low energy photon and electron spectrum in 147Pm2 DU PROMETHEUM 147 Par F. SUZOR et G. CHARPAK, Laboratoire de Synthèse Atomique, C. N. R. S. Résumé'autoionisation du prometheum 147 l'intensité (3,2 ± 0,2) 10-4. Lespectre des électrons émis simultanément avec le

  5. u c l a Col le g e R e p or t 27 In the push to develop practical hydrogen fuel cells

    E-Print Network [OSTI]

    Corporation, MOFs are used as storage devices in which hydrogen is physically absorbed. How would hydrogenu c l a Col le g e R e p or t 27 In the push to develop practical hydrogen fuel cells to power cars and other devices, one of the biggest challenges has been finding ways to store hydrogen at the right

  6. DREAMNIGHT AT THE ZOO ! le 5 juin 2015 de 18h30 21h30 soire de rve pour les enfants

    E-Print Network [OSTI]

    partenariat avec l'Association Petits Princes qui réalise les rêves d'enfants gravement malades. Ce sont plus Paris, le 26 mai 2015 #12;# L'ASSOCIATION PETITS PRINCES Créée en 1987, l'Association Petits Princes bougies ! Originaire du Pas-de-Calais, Lauryne, 17 ans, est suivie par l'Association Petits Princes depuis

  7. L'avenir de l'Europe en dbat Sciences Po Le Council for European Studies (CES) est une institution fonde en 1970 qui runit des

    E-Print Network [OSTI]

    Wolf, Christian

    L'avenir de l'Europe en débat à Sciences Po Le Council for European Studies York, elle a pour mission de promouvoir la recherche sur l'Europe au sein des sciences humaines et qui a pour thème l'avenir de l'Europe : « Contradictions: Envisioning European Futures ». Plus de 300

  8. On a Deterministic Property of the Category of $k$-almost Primes: A Deterministic Structure Based on a Linear Function for Redefining the $k$-almost Primes ($\\exists n\\in {\\rm N} $, $1{\\le} k {\\le}n$) in Certain Intervals

    E-Print Network [OSTI]

    Ramin Zahedi

    2014-12-28

    In this paper based on a sort of linear function, a deterministic and simple algorithm with an algebraic structure is presented for calculating all (and only) $k$-almost primes ($where$ $\\exists n\\in {\\rm N} $, $1{\\le} k {\\le}n$) in certain interval. A theorem has been proven showing a new deterministic property of the category of $k$-almost primes. Through a linear function that we obtain, an equivalent redefinition of the $k$-almost primes with an algebraic characteristic is identified. Moreover, as an outcome of our function's property some relations which contain new information about the $k$-almost primes (including primes) are presented.

  9. Rappel mathematique 2004/2005 : Exercices 1. Dessinez les fonction sin(x), cos(x) et tan(x) en laissant varier le x de -`a .

    E-Print Network [OSTI]

    Jost, Christian

    Rappel math´ematique 2004/2005 : Exercices 1. Dessinez les fonction sin(x), cos(x) et tan(x) en d´eriv´ees des fonctions suivantes : a) f(x) = x cos(x), b) f(x) = cot(x2 ) c) f(x) = xx . Pour a le IR2 et elle est d´efinit par x(t) = ect cos t ect sin t Dessinez cette courbe pour c = 1 2 et -2

  10. Direction des ressources humaines Mission Insertion Handicap -procdure officielle -08/06/2015 Fiche de poste pour le recrutement par la voie contractuelle

    E-Print Network [OSTI]

    van Tiggelen, Bart

    au sein du Comité d'Action et d'Entraide Sociales (CAES) MISSION Il/Elle assure la Gestion'Action et d'Entraide Sociales CAES, GANAEL, gérant toutes les activités et prestations CAES dont peuvent capable de s'adapter au logiciel spécifique, GANAEL, pour le traitement des activités CAES (formation

  11. Voici donc le dernier numro de Gosciences-Infos avant l't. Un t sans rapport AERES rdiger... Mais avec quelques devoirs de vacances tout de mme, de faon tre tout--fait

    E-Print Network [OSTI]

    Cattin, Rodolphe

    édito Voici donc le dernier numéro de Géosciences-Infos avant l'été. Un été sans rapport AERES à

  12. Évaluation de la dose de surexposition auprès des accélérateurs de haute énergie par la reaction c${^1}$${^2}$ (x, nx) c${^1}$${^1}$ dans le système pileux

    E-Print Network [OSTI]

    Charalambus, S

    1965-01-01

    Évaluation de la dose de surexposition auprès des accélérateurs de haute énergie par la reaction c${^1}$${^2}$ (x, nx) c${^1}$${^1}$ dans le système pileux

  13. Engaging a Multi-Disciplinary Literature Review in the Development of a Framework to Assess Construction Collaboration 

    E-Print Network [OSTI]

    Iyer, Shruthi Ravi

    2015-07-29

    an iz at io n C u lt u re Jo in t P la n n in g S h ar in g R es o u rc es T ea m C o m p o si ti o n a n d D iv er si ty C le ar R o le s an d R es p o n si b il it ie s C o o p er at io n Jo in t D ec is io n M ak in g O rg an iz at io n... S tr u ct u re C o -l o ca ti o n F ee d b ac k In te rp er so n al R el at io n sh ip M u tu al R es p ec t P er fo rm an ce - In d iv id u al a n d T ea m T ea m P ro d u ct iv it y C o o rd in at io n M an ag em en t S u p p o rt T ra in in g...

  14. Members of a workshop at the tenth IAYC Conference, July 7, 2006 1. ge -hak -te le -ber, ge -fil -te -fish: sha-bes iz a far -ge -ni -gn

    E-Print Network [OSTI]

    Finkel, Raphael

    A SUDE Members of a workshop at the tenth IAYC Conference, July 7, 2006 = 90 4 4 1. ge - hak - te le - ber, ge - fil - te - fish: sha- bes iz a far - ge - ni - gn 2. kha - le gri - vn, ku - gl yoykh: ku - men on di ma - khe - to - nem. 3. shtru - dl, tsi - mes, zi - se kalte: a su - de vos men vet ge

  15. Towards more power efficient IP lookup engines 

    E-Print Network [OSTI]

    Ahmad, Seraj

    2007-04-25

    on the routing table compaction using logic minimization techniques. The second stream focuses on routing table partitioning. This work proposes to bridge the gap by employing strategies to combine these two leading state of the art schemes. The existing...

  16. Consultancy and Research IP and licensing

    E-Print Network [OSTI]

    Miall, Chris

    and public policy. Recent clients include the NHS, Proctor & Gamble, the Royal Navy and Severn Trent Water has a large portfolio of medical, biomedical, engineering and environmental patents available: Dr John Pearson Email: patents@alta.bham.ac.uk Tel: +44 (0)121 414 8632 Fax: +44 (0)121 414 9040

  17. Sports over IP : dynamics and perspectives

    E-Print Network [OSTI]

    Blain, Emmanuel

    2010-01-01

    Technological advances are allowing the use of the Internet Protocol and the Internet infrastructure mainly built by cable and telecom operators for broadcasting purposes in the U.S. This disruption raises a business issue ...

  18. Overview: IP routing o Bellman-Ford

    E-Print Network [OSTI]

    Biagioni, Edoardo S.

    if M 0new entries to all my, adding cost of reaching that router to see if route is better than what we have to each of the neighbor's metrics 2. for each entry (D, P', M') in the updated neighbor

  19. IPS- Industrial Power Systems | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LIST OFAMERICA'SHeavy ElectricalsFTLTechnology SrlWindHydrodynamic

  20. IP Kids Page | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenry Bellamy, Ph.D.FoodHydropower, WaveID-11383 Revision 2TOIOR

  1. SH 1292 Rev 10/1/14 & Affiliates

    E-Print Network [OSTI]

    Cantlon, Jessica F.

    Pharmacy Highlands at Brighton Highlands Living Center Meadowbrook Adult Day Care University of Rochester School of Nursing and Community Nursing Center Finger Lakes Visiting Nurse Service Finger Lakes Home Care Visiting Nurse Service of Rochester and Monroe County Visiting Nurse Signature Care

  2. G. Bell, D. Siewiorek, and S.H. Fuller, Editors

    E-Print Network [OSTI]

    Kleinrock, Leonard

    mes- sages is one of the most important decisions in the design of computer communication networks Machinery, Inc. General permission to republish, but not for profit, all or part of this material is granted for Computing Machinery. This research was supported by the Advanced Research Pro- jeets Agency

  3. G. Bell, D. Siewiorek, and S.H. Fuller, Editors

    E-Print Network [OSTI]

    Weimer, Westley

    - plications for the design of virtual memory systems are presented and discussed. Key Words and Phrases of our results. CopyrightO 1977,Associationfor Computing Machinery,Inc. General permission to republish granted by permissionof the Associationfor Computing Machinery. This research was partially supported

  4. 70005 MODULE AT-- U-X ASSY - Sh

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-InspiredAtmosphericdevicesPPONeApril351APPLICATION OFsafer The mp4 23 14 6 95

  5. Le mode d'emergence du Reel - L'avenement des manifestations de la base (gzhi snang) selon les conceptions de la Grande Perfection

    E-Print Network [OSTI]

    Achard, Jean-Luc

    2005-01-01

    — LE MODE D’EMERGENCE DU REEL —L’AVENEMENT DES MANIFESTATIONS DE LA BASE (GZHI SNANG)SELON LES CONCEPTIONS DE LA GRANDE PERFECTION* Par Jean-Luc Achard (CNRS) a tradition tibétaine de la Grande Perfection (rDzogs chen)représente un courant important... ’àl’époque dynastique (8e siècle) au Tibet1. L’un des élements essentiels de sapensée consiste dans la notion de Base (gzhi) qui est la pierre angulaire desenseignements de la Grande Perfection2.Définie en tant que la “Base de l’état naturel” (gzhi’i gnas lugs) del...

  6. Un modle de contour actif pour le suivi rapide d'objets en mouvement. Application au suivi de joueurs de football.

    E-Print Network [OSTI]

    Lefèvre, Sébastien

    joueurs de football. Sébastien LEF�VRE1,2, Cyril FLUCK1, Benjamin MAILLARD1, Nicole VINCENT1 1Laboratoire modélisés par des snakes ou contours actifs. Cette méthode est appliquée au suivi de joueurs de football dans le cadre de l'analyse de séquences vidéo de matchs de football acquises à l'aide d'une caméra en

  7. Madness, the supernatural and the unreliable narrator in Guy de Maupassant's Le Horla and Henry James's The Turn of the Screw 

    E-Print Network [OSTI]

    Smartt, Janna

    2013-02-22

    Maupassant, James has been continually casting doubt on the governess' believability. The reader is left in a state of perplexity reminiscent of Le Horla: does the ghost exist and has he somehow killed her pupil or is the governess insane and has she... encounter other-worldly beings and in both tales, these visitings culminate in deaths of other characters. At the same time, both Maupassant and James skillfully craft their tales so as to cast doubt on the reliability of these narrators and so as to limit...

  8. International Rainwater Catchment Systems Conference, March 28April 4, 2011, Taiwan, R.O.C. NGUYEN-DEROCHE et al., 2011. Quality of roof harvested rainwater from houses in le-de-France area,

    E-Print Network [OSTI]

    Boyer, Edmond

    .O.C. NGUYEN-DEROCHE et al., 2011. Quality of roof harvested rainwater from houses in Île-de-France area, France. 1 Quality of roof harvested rainwater from houses in Île-de-France area, France. Thi Le Nhung microorganisms in the outside tanks. The difficulty to evaluate the microbial quality of roof- harvested

  9. Aprs avoir mis en lumire l'importance du rle jou par la protine Cx36 dans le contrle de la production d'insuline, une quipe de cher-

    E-Print Network [OSTI]

    Loewith, Robbie

    Après avoir mis en lumière l'importance du rôle joué par la protéine Cx36 dans le contrôle de la ces cellules, des chercheurs de l'UNIGE ont identi é, il y a quelques mois, une protéine appelée Cx36 plus fabriquer de Cx36, la synchronisation des cellules bêta disparaît et la production d

  10. Sustained signalling by PTH modulates IP3 accumulation and IP3 receptors via cyclic AMP junctions

    E-Print Network [OSTI]

    Meena, Abha; Tovey, Stephen C.; Taylor, Colin W.

    2014-11-27

    , S., Nelson, C. D., Wang, S., Eckhardt, A. 549 E., Cowan, C. L., Spurney, R. F., Luttrell, L. M. et al. (2006). Distinct ?-arrestin- and 550 G protein-dependent pathways for parathyroid hormone receptor-stimulated ERK1/2 551 activation. J. Biol...

  11. Binding energies of the ground triplet state a{sup 3}?{sub u}{sup +} of Rb{sub 2} and Cs{sub 2} in terms of the generalized Le Roy–Bernstein near-dissociation expansion

    SciTech Connect (OSTI)

    Sovkov, V. B.; Ivanov, V. S. [V.A. Fock Institute of Physics and Department of Physics of St. Petersburg State University, Ulyanovskaya Street 1, Petrodvoretz, St. Petersburg 198504 (Russian Federation)] [V.A. Fock Institute of Physics and Department of Physics of St. Petersburg State University, Ulyanovskaya Street 1, Petrodvoretz, St. Petersburg 198504 (Russian Federation)

    2014-04-07

    Formulae of Le Roy–Bernstein near-dissociation theory are derived in a general isotope–invariant form, applicable to any term in the rotational expansion of a diatomic ro-vibrational term value. It is proposed to use the generalized Le Roy–Bernstein expansion to describe the binding energies (ro-vibrational term values) of the ground triplet state a{sup 3}?{sub u}{sup +} of alkali metal dimers. The parameters of this description are determined for Rb{sub 2} and Cs{sub 2} molecules. This approach gives a recipe to calculate the whole variety of the binding energies with characteristic accuracies from ?1 × 10{sup ?3} to 1 × 10{sup ?2} cm{sup ?1} using a relatively simple algebraic equation.

  12. for more INformATIoN College of Engineering, Architecture & Technology

    E-Print Network [OSTI]

    for more INformATIoN College of Engineering, Architecture & Technology Scholarship Coordinator 207-time in the College of Engineering, Architecture and Technology are eligable to apply for annual scholarships. Thanks requirements to demonstrated financial need. Engineering, Architecture & Technology ScholArShIpS for co

  13. for more INformATIoN College of Engineering, Architecture & Technology

    E-Print Network [OSTI]

    for more INformATIoN College of Engineering, Architecture & Technology Scholarship Coordinator 207, (405)744-5371 or (405)744-5576(fax). The College of Engineering, Architecture and Technology is proud. Engineering, Architecture & Technology ScholArShIpS for INcomINg STudeNTS: The OSU admission application

  14. LiMn{sub 2-x}Cu{sub x}O{sub 4} spinels (0.1 {le} x {le} 0.5) - a new class of 5 V cathode materials for Li batteries : I. electrochemical, structural and spectroscopic studies.

    SciTech Connect (OSTI)

    Ein-Eli, Y.

    1998-10-05

    A series of electroactive spinel compounds, LiMn{sub 2{minus}x}Cu{sub x}O{sub 4} (0.1 {le} x {le} 0.5) has been studied by crystallographic, spectroscopic and electrochemical methods and by electron-microscopy. These LiMn{sub 2{minus}x}Cu{sub x}O{sub 4} spinels are nearly identical in structure to cubic LiMn{sub 2}O{sub 4} and successfully undergo reversible Li intercalation. The electrochemical data show a remarkable reversible electrochemical process at 4.9 V which is attributed to the oxidation of Cu{sup 2+} to Cu{sub 3+}. The inclusion of Cu in the spinel structure enhances the electrochemical stability of these materials upon cycling. The initial capacity of LiMn{sub 2{minus}x}Cu{sub x}O{sub 4} spinels decreases with increasing x from 130mAh/g in LiMn{sub 2}O{sub 4} (x=0) to 70 mAh/g in ''LiMn{sub 1.5}Cu{sub 0.5}O{sub 4}'' (x=0.5). The data also show slight shifts to higher voltage for the delithiation reaction that normally occurs at 4.1 V in standard Li{sub 1{minus}x}Mn{sub 2}O{sub 4} electrodes (1 {ge} x {ge} 0) corresponding to the oxidation of Mn{sup 3+} to Mn{sup 4+}. Although the powder X-ray diffraction pattern of ''LiMn{sub 1.5}Cu{sub 0.5}O{sub 4}'' shows a single-phase spinel product, neutron diffraction data show a small, but significant quantity of an impurity phase, the composition and structure of which could not be identified. X-ray absorption spectroscopy was used to gather information about the oxidation states of the manganese and copper ions. The composition of the spinel component in the LiMn{sub 1.5}Cu{sub 0.5}O{sub 4} was determined from X-ray diffraction and XANES data to be Li{sub 1.01}Mn{sub 1.67}Cu{sub 0.32}O{sub 4} suggesting, to a best approximation, that the impurity in the sample was a lithium-copper-oxide phase. The substitution of manganese by copper enhances the reactivity of the spinel structure towards hydrogen; the compounds are more easily reduced at moderate temperature ({approximately} 200 C) than LiMn{sub 2}O{sub 4}.

  15. Time Schedu.le Preliminary

    E-Print Network [OSTI]

    Doty, Sharon Lafferty

    instead of Hutchinson Hall, which has stairway access only. 1 #12;ZlFF-DAVIS SPECIAL MARKETS GROUP EditC)r-I~lef and .General Manager Jeffrey A. Stern Group Publisher William S. David DIRECTORY OF CLASSES President Andrew C The Pattls Group 4761 W. Toohy Avenue Uncolnwood, Illinois 60646 (312)679-1100 WEST COAST Bill Curtis W

  16. Philippe LE PARC Jean VAREILLE

    E-Print Network [OSTI]

    Brest, Université de

    with the user by Taylor and al. [16], Rhino by Burgard and al.[13], Xavier by Simmons [14], Puma-Paint by Stein an applet Java (step 2). A connection is then established towards the server in charge of the management

  17. Informatica Grafica per le arti

    E-Print Network [OSTI]

    Gribaudo, Marco

    creati facendo ruotare un profilo attorno ad un asse. Solidi di rotazione Sono indicati per realizzare profilo e specificando l'asse attorno a cui esso deve essere fatto ruotare. #12;Solidi di rotazione rotazione Si passa quindi alla visuale perpendicolare all'asse di rotazione (es. TOP). Solidi di rotazione E

  18. Informatica Grafica per le arti

    E-Print Network [OSTI]

    Gribaudo, Marco

    piani ortogonali. y z x Sistemi di coordinate Una coordinata cartesiana si basa su 3 assi, chiamati asse x, asse y e asse z. Destrorsa Sinistrorsa y z x y z x Sistemi di coordinate Esistono due tipi differenti di terne di assi: quella destrorsa e sinistrorsa. Si distinguono a seconda della direzione dell'asse

  19. Le libre accs : pourquoi et

    E-Print Network [OSTI]

    was - a scientist and a taxpayer - desperate to read the results of work that I helped pay for and work that might

  20. LE & ME n Highlights

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACTThousand CubicResource and JobLCLS Operating3 DocumentReview1 LDRD

  1. LE & ME n Highlights

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACTThousand CubicResource and JobLCLS Operating3 DocumentReview1 LDRD®

  2. Minh Le | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data CenterFinancialInvesting in MinorityOverview and

  3. Duke RNAi Core: Human shRNA Clone Requests To request clones from the Human shRNA library, please identify the relevant clones, then request through the

    E-Print Network [OSTI]

    Richardson, David

    ://katahdin.cshl.org:9331/rnai/repository/scripts/newmain.pl) 1. Enter Search term (gene name, keyword, accession, using RefSeq accession number (search results using other terms or identifiers are variable). 1. Find_ prefix. 2. Enter RefSeq # into query tool. Search by GenBank Accession (Email address is not required

  4. Delivered by Ingenta to: IP : 166.111.120.71

    E-Print Network [OSTI]

    Cao, Guozhong

    , Anhui 230026, China ABSTRACT CdS/CdSe quantum dots co-sensitized TiO2 solar cell was prepared on the solar cell performance was investigated. It was found that the optimized deposition time for CdSe was 3 Science of Advanced Materials Vol. 4, pp. 1013­1017, 2012 (www.aspbs.com/sam) CdS/CdSe Co-Sensitized Solar

  5. Research Study - Global Enterprise VoIP Equipment Market Forecasts...

    Open Energy Info (EERE)

    we deeply analyzed the world's main region market conditions that including the product price, profit, capacity, production, capacity utilization, supply, demand and industry...

  6. Trademark and Copyright Enforcement in the Shadow of IP Law

    E-Print Network [OSTI]

    Gallagher, William T.

    2012-01-01

    Santa Clara Computer & High Tech. L.J. [Vol.28] made andSanta Clara Computer & High Tech. L.J. [Vol.28] A: Yes, theSanta Clara Computer & High Tech. L.J. [Vol.28] uncertainty.

  7. Delivered by Ingenta to: IP : 131.84.11.215

    E-Print Network [OSTI]

    Mukhopadhyay, Sharmila M.

    and Nanotechnology Letters Vol. 3, 110­113, 2011 Cell Growth in a Porous Microcellular Structure: Influence to have more cell growth along pore walls but do not have any significant influence on overall nuclear for specific biological environments. Such an investigation will provide effective assessment and development

  8. University of California IP : 128.200.31.113

    E-Print Network [OSTI]

    Daraio, Chiara

    boiling point and toxic solvents, thus is amenable to an environ- mentally desirable, large strongly affect their magnetic properties. Using water-in-oil microemulsions (reverse micelles) as nanoscale reactors,11 it is possible to synthesize iron oxide nanoparticles with a narrowed size

  9. Topological Design of Survivable IP Networks Using Metaheuristic Approaches

    E-Print Network [OSTI]

    di Torino, Italy 2 Departamento de Eletr^onica, Centro Federal de Educac¸~ao Tecnol´ogica do Paran

  10. DTerm IP-6 User Guide Table of Contents

    E-Print Network [OSTI]

    Bordenstein, Seth

    ............................................................................................................... 12 #12;2 Keys and Lamps LED Some of the keys listed below have a built-in Light Emitting Diode (LED

  11. Characteristics of Fragmented IP Traffic on Internet Links

    E-Print Network [OSTI]

    California at San Diego, University of

    in this paper with the work on model theoretic parchments [MTP98]. 2 Signatures For the purpose of this paper

  12. IP Concatenation: The Method for Enhancement of IPsec Performance

    E-Print Network [OSTI]

    Yeom, Heon Young

    of the public telecommunication infrastructure, maintaining privacy through the use of tunneling protocols of hosts, between a pair of IPsec gateways, or between a IPsec gateway and a host (IPsec gateway is the term to refer to a gateway that implements IPsec protocols). IPsec has some advantages

  13. MULTIMEDIA CONTENT CAPTURING HARDWARE FOR IP BROADCASTING USES Afanasyev A.

    E-Print Network [OSTI]

    California at Los Angeles, University of

    @icn.bmstu.ru . : ; ; , ; (, , .) . ( , , ), (.1). , USB PCI/PCI-X, USB (1.1, 2.0) , PCI/PCI-X . MPEG2/4 MPEG2/4 USB PCI PCI-X PCMCIA 1] TV . TV , PCI, . , . 2. PAL/SECAM/ NTSC

  14. www.abcam.com/technical TROUBLESHOOTING TIPS -IP

    E-Print Network [OSTI]

    Lebendiker, Mario

    in the pellet. If resuspension occurs, centrifuge again. Incomplete washing Wash well at relevant stages-absorbed. To much antibody used leading to non-specific binding Check the recommended amount of antibody suggested. Try using less antibody. Too many cells/too much protein in lysate leading to a lot of non

  15. Quick Start Guide Cisco Small Business Pro IP Phone

    E-Print Network [OSTI]

    Cerveny, Vlastislav

    are using an external power source, insert one end of the power cord into an outlet and insert the other end of the power cord into the power port on the phone body. STEP 7 Connect your phone to the network: · Using to the network and receives a basic configuration, your phone line keys should glow green (on models with phone

  16. Adaptive Modulation and Scheduling of IP traffic over Fading Channels

    E-Print Network [OSTI]

    the traf- fic load. An obstacle in this context is the time-variability of the channel. To achieve a high to the traffic situation. 1 INTRODUCTION Fading channels confront us with the problem of lost packets. For a predicted value of the Signal to Noise and Interfer- ence Ratio (SNIR) of each channel, the modulation level

  17. Adaptive Modulation and Scheduling of IP traffic over Fading Channels

    E-Print Network [OSTI]

    the traf­ fic load. An obstacle in this context is the time­variability of the channel. To achieve a high to the traffic situation. 1 INTRODUCTION Fading channels confront us with the problem of lost packets. For a predicted value of the Signal to Noise and Interfer­ ence Ratio (SNIR) of each channel, the modulation level

  18. High Performance TCP/IP Concepts, Issues, and Solutions

    E-Print Network [OSTI]

    Jain, Raj

    President and Editorial Director, ECS: Marcia J. Horton Publisher: Alan R. Apt Associate Editor: Toni Dianne Manufacturing Manager: Trudy Pisciotti Manufacturing Buyer: Lynda Castillo Marketing Manager: Pamela Shaffer c

  19. 'f '" . ~..,.. , _~'IpJ~ AQUATIC PLANT CONTRvL

    E-Print Network [OSTI]

    US Army Corps of Engineers

    ) Aquatic plant control Aquatic weeds Herbicides Hydrilla Water milfoil 2Q. AI9STl>ACT (C;- ------- - - - - ---- - - - - ------- - - - - Unclassified SECURITY CLASSIFICATION OF THIS PAGE (When De,e En,ered) READ INSTRUCTIONS REPORT DOCUMENTATION troll/nil Olllce) IS. SECURITY CI.ASS. (01 thl. reporl) Unclassified IS·. ~g:;M~~ll'CAT'ON700WNGRAO

  20. For IPS Office Use Only A / R: Eng Prof

    E-Print Network [OSTI]

    supporting documents have been received (for instance, transcripts and official test scores) 2. You have / Country: ______________________________ Postal Code: ____________________________________ Postal Code country code and city code in telephone) Fax number if dialed from the US

  1. Voice over IP: Risks, Threats and Vulnerabilities Angelos D. Keromytis

    E-Print Network [OSTI]

    Keromytis, Angelos D.

    , as well as the potential for lower cost through equipment consolidation and, for the con- sumer market reinforced this trend. In this envi- ronment of constant innovation, individuals, governments un- derstanding and managing their risks. In this struggle, cost reductions, convenience and new

  2. Delivered by Ingenta to: IP : 90.148.96.123

    E-Print Network [OSTI]

    Azad, Abdul-Majeed

    hydrogen (for PEMFCs) or hydrogen-rich reformate (for SOFCs) for extended periods, and deliver hydrogen Ceramic Powders, Ceria, Precious Metals, Ruthenium, Palladium, Rhodium, Sulfur-Tolerant Catalysts, Fuel Reforming, Hydrogen. CONTENTS 1. Introduction

  3. Tools for primal degenerate linear programs: IPS, DCA, and PE

    E-Print Network [OSTI]

    2014-10-01

    the selection of a compatible variable to enter the basis ensures a nondegenerate pivot, PE .... At the heart of this framework lies the search for so-

  4. Industrial Plant Services Australia Pty Ltd IPS | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrder at 8, 13 (Vt. WaterInformationPlant Services Australia Pty

  5. MHK Technologies/IPS OWEC Buoy | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenarios Towards 2050Enermar < MHKHydro Helix << MHK

  6. WP-07 IP Direct Testimony (wp07/initial)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN A 035(92/02) nerg *415, 2014OctoberFinalCase Initial

  7. WP-07 IP Rebuttal Testimony (wp07/initial)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN A 035(92/02) nerg *415, 2014OctoberFinalCase

  8. WP-07 IP Studies & Documentation (wp07/initial)

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust,Field-effectWorking WithTelecentricN A 035(92/02) nerg *415, 2014OctoberFinalCaseStudies

  9. Intellectual Property (IP) Service Providers for Acquisition and Assistance

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergy HeadquartersFuelBConservationEnergy5975-01Transactions | Department of Energy

  10. Intellectual Property (IP) Service Providers for Acquisition and Assistance

    Energy Savers [EERE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on DeliciousMathematicsEnergy HeadquartersFuelBConservationEnergy5975-01Transactions | Department of

  11. Standard Intellectual Property (IP) Provisions for Financial Assistance

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative FuelsofProgram: Report AppendicesAVideoSolarSpace-Based

  12. Fundamental breast and ovarian cancer protein isolated -health -23 August 2010 -New Scientist http://www.newscientist.com/...le/dn19350-fundamental-breast-and-ovarian-cancer-protein-isolated.html?full=true&print=true[8/23/2010 10:48:30 AM

    E-Print Network [OSTI]

    Kowalczykowski, Stephen C.

    Fundamental breast and ovarian cancer protein isolated - health - 23 August 2010 - New Scientist http://www.newscientist.com/...le/dn19350-fundamental-breast-and-ovarian-cancer in inherited cases of breast and ovarian cancer. The researchers hope that better understanding of the protein

  13. Remote Sens. 2011, 3, 83-99; doi:10.3390/rs3010083 Remote Sensing

    E-Print Network [OSTI]

    Jin, Menglin

    budget [1-3]. The land surface energy budget can be described as [4]: (1 - )Sd + LWd - Tskin 4 - SH - LE - G = 0 (1) where is surface albedo, Sd is downward surface insulation. LWd is downward longwave change LWd in Equation (1). Furthermore, the clouds microphysical properties (cloud droplet size, cloud

  14. United States Department of the Interior Fish andvi-ildlife Service

    E-Print Network [OSTI]

    ," descri bes the same phenomenon . "One is able ," he says "to freez e fishes and batrachians, to transport.--·--·-------.-_*---·----·-----,--,....,.---;:0~c"7t-o;:-b-er--::l;-;:9::T14-:::;.3--1 TH;!: TRANSPORTATIOH OF FROZEN LIVE FIST-IES -(Le transport sh culture to refrigerate the water in the r ecept acles serving for the transportation

  15. CYBER ShARE Center of Excellence Facility Use Request Form

    E-Print Network [OSTI]

    Pinheiro da Silva, Paulo

    : __________________________________________________________________________________________________________ Account Number: Account number must be provided. IDTV for payment will be generated and must be approved will be refunded only if cancellation/rescheduling is received 72 hours prior to event. Name and phone number: _______ C C C Room 401 402 404 Seats 6 40 15 ___ ___ ___ Scheduled Class Hours: ** Fall and Spring Hours

  16. SH 8/08 Ms. Blue's Measurements Page 1 of 5 Ms. Blue's Measurements

    E-Print Network [OSTI]

    California at Santa Cruz, University of

    as an adult elephant) - Tongue extended the length of the mouth (~18 feet) - Tongue palate and baleen are black - Baleen weighed 400 pounds - Water would enter the mouth at a rate of 5-20 tons per second of the aorta was 9 inches - Muscles weighed 40 tons - The mandibles of a blue whale are the largest single

  17. MATERIALS ENGINEERING (MATE) CLASS OF 2014 Name: Last, First, ID Min 126 QH + 46 SH

    E-Print Network [OSTI]

    Papautsky, Ian

    Materials I . 3 MTEN 315 Physical Metallurgy I .. 3 MTEN 342 Materials Thermo II ... 3 MTEN 431 Diffusion BoK 3 BoK 3 12U MTEN 415 Physical Metallurgy II 3 ENED 3061 Prob & Statistics 3 12FS MTEN 416 Metallurgy Lab 2 MATH 2076 Linear Algebra 3 13SS MTEN 424 X-Ray Diffraction 3 MTEN 6010LPhys Prop Solids

  18. MATERIALS ENGINEERING (MATE) CLASS OF 2013 Name: Last, First, ID Min 155 QH + 30 SH

    E-Print Network [OSTI]

    Papautsky, Ian

    Physical Metallurgy I .. 3 MTEN 342 Materials Thermo II .... 3 MTEN 431 Diffusion & Kinetics .... 3 COOP

  19. Clustering MeSH Representations of Biomedical Literature Craig A. Struble, Chitti Dharmanolla

    E-Print Network [OSTI]

    Department of Mathematics, Statistics, and Computer Science Marquette University Milwaukee, WI 53201 informa- tion for the analysis and interpretation of ex- periments in the biological sciences. Hu- man, full-text pub- lication and increasing computational power, automated techniques for knowledge discov

  20. -tin ! Imma ! sh Phase Transitions of Germanium Xiao-Jia Chen,1

    E-Print Network [OSTI]

    was determined at 90 GPa. Superconductivity was obtained up to 190 GPa using the acquired structural data mechanism is responsible for superconductivity in Ge, as evidenced by the good agreement between discovery of superconductiv- ity at ambient pressure in heavily doped elements [1­3] has renewed significant

  1. CIVIL ENGINEERING (CE) CLASS OF 2015 Name: Last, First, ID Min Hrs. 97 QH + 67 SH

    E-Print Network [OSTI]

    Papautsky, Ian

    ... 3 Total QH 11 ENGL 4092 Tech Writing............ 3 ENVE 4011 Air Polution............. 3 Take either

  2. Tungsten spectroscopy in the EUV observed in SH-HtscEBIT

    E-Print Network [OSTI]

    Li, Wenxian; Yang, Yang; Xiao, Jun; Brage, Tomas; Hutton, Roger; Zou, Yaming

    2015-01-01

    We have recorded extreme ultraviolet spectra from $\\mathrm{W^{11+}}$ to $\\mathrm{W^{15+}}$ ions using a new flat field spectrometer installed at the Shanghai high temperature superconducting electron beam ion trap. The spectra were recorded at beam energies ranging between 200 eV and 400 eV and showed spectral lines/transition arrays in the 170 - 260 \\AA{} region. The charge states and spectra transitions were identified by comparison with calculations using a detailed relativistic configuration interaction method and collisional-radiative model, both incorporated in the Flexible Atomic Code. Atomic structure calculations showed that the dominant emission arises from $5d$ $\\rightarrow$ $5p$ and $5p$ $\\rightarrow$ $5s$ transitions. The work also identified the ground-state configuration of $W^{13+}$ as $4f^{13}5s^2$, in contrast to earlier identifications.

  3. Phytoplankton blooms and sh recruitment rate: E ects of spatial distribution

    E-Print Network [OSTI]

    Biktashev, Vadim N.

    Department of Mathematical Sciences, M&O Building, Peach street, University of Liverpool, Liverpool L69 7ZL and plankton may be regarded as passive tracers of the uid motion, dispersed and mixed by the turbulent di#11 of Mathematical Sciences, M&O Building, Peach street, University of Liverpool, Liverpool L69 7ZL, UK Preprint

  4. When Sugar Turns to Sh%&: Immediate Action Decision Making and Resilience in High Reliability Teams 

    E-Print Network [OSTI]

    Wesner, Bradley Scott

    2012-02-14

    more nuanced study of high reliability processes within team contexts is warranted. This study focuses on organizational teams which are faced with the challenges of maintaining high levels of reliability. Of particular interest is how teams manage...

  5. ELECTRICAL ENGINEERING (EE) CLASS OF 2017 Name: Last, First, ID Minimum 127 SH

    E-Print Network [OSTI]

    Papautsky, Ian

    Analysis..... 5 COMM 1071 Effective Speakg(HU) 3 13FS EECE 2060C Digital Design......... 4 EECE 2070 EECE 4038C Embedded Sys Des 3 15FS EECE 3076 Signals & Systems II 3 EECE 4090 Control Systems..... 3 16 PHYS 2076 Semic Phys for Engr 3 EECE 2075 Signals & Systems I 3 14FS COOP 2011 Practice Eval # EECE

  6. ELECTRICAL ENGINEERING (EE) CLASS OF 2019 Name: Last, First, ID Minimum 127 SH

    E-Print Network [OSTI]

    Papautsky, Ian

    Analysis..... 5 COMM 1071 Effective Speakg(HU) 3 15FS EECE 2060C Digital Design......... 4 EECE 2070 & Systems II 3 EECE 4090 Control Systems..... 3 18SS EECE 3080 Engn Electromagnet 4 PD 2050 Coop Comm PHYS 2076 Semi Phys for Engn 3 EECE 2075 Signals & Systems I 3 16FS COOP 2011 Practice Eval # EECE 2077

  7. ELECTRICAL ENGINEERING (EE) CLASS OF 2016 Name: Last, First, ID Min Hrs 51 QH + 95 SH

    E-Print Network [OSTI]

    Papautsky, Ian

    1071 Intro Eff Speaking.. 3 12FS EECE 1975 Digital Design...... 1 EECE 2070 Electronics I.......... 3 Electronics Lab II 1 EECE 4038 Embeded Syst Des.. 3 14FS EECE 3076 Sig & System II.... 3 EECE 4090 Control 13SS EECE 2050C Network Analysis 5 EECE 2070L Electronics I Lab.... 1 13US MATH 2063 Multiv Calculus

  8. ELECTRICAL ENGINEERING (EE) CLASS OF 2020 Name: Last, First, ID Minimum 127 SH

    E-Print Network [OSTI]

    Papautsky, Ian

    Analysis..... 5 COMM 1071 Effective Speakg(HU) 3 16FS EECE 2060C Digital Design......... 4 EECE 2070 & Systems II 3 EECE 4090 Control Systems..... 3 19SS EECE 3080 Engn Electromagnet 4 PD 2050 Coop Comm PHYS 2076 Semi Phys for Engn 3 EECE 2075 Signals & Systems I 3 17FS COOP 2011 Practice Eval # EECE 2077

  9. ELECTRICAL ENGINEERING (EE) CLASS OF 2018 Name: Last, First, ID Minimum 127 SH

    E-Print Network [OSTI]

    Papautsky, Ian

    Analysis..... 5 COMM 1071 Effective Speakg(HU) 3 14FS EECE 2060C Digital Design......... 4 EECE 2070 EECE 4090 Control Systems..... 3 17SS EECE 3080 Engn Electromagnet 4 STAT 2037 Prob & Statistics I PHYS* 2076* US students only 3 EECE 2075 Signals & Systems I 3 15FS EECE**2076** CQU students only 3

  10. metals Fischer, S.H.; Grubelich, M.C. 37 INORGANIC, ORGANIC,...

    Office of Scientific and Technical Information (OSTI)

    IGNITION; MIXTURES; PRODUCTION; REACTION HEAT; SPECIFIC HEAT; STABILITY Thermite (metal oxide) mixtures, intermetallic reactants, and metal fuels have long been used in...

  11. Sparsely populated folding intermediates of the Fyn SH3 domain: Matching native-centric essential

    E-Print Network [OSTI]

    Chan, Hue Sun

    the important contributions that computational methods can make in providing insights into protein folding. Understanding protein folding at the atomic level is a critical but elusive goal in structural biology. A protein's folded state can often be studied by x-ray crystallography or NMR spectroscopy, and recent

  12. Coincident P and Sh reflections from basement rocks at Coso geothermal...

    Open Energy Info (EERE)

    depth varying velocities at 2-mi lateral intervals were completed in the field. Reprocessing is being done to improve the statics, velocities, signal character, and migrated...

  13. Microsoft Word - CU-ShEEP Information Exchange Webinar_Venayagamoorthy.docx

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAand DOE SafetyofDepartment of Energy OfficeAdministration's Record ofWord

  14. Coincident P and Sh reflections from basement rocks at Coso geothermal

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower Ventures Jump to: navigation, searchClover

  15. Technical Qualification Program Self-Assessment Report - NA-SH - 2013 |

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCEDInstallers/ContractorsPhotovoltaics »Tankless WaterEnergy andAdministrative FormsOffice -

  16. WAT TENBERG SPIN DLE EAT ON BONN Y GREELEY ROGGEN WAVERLY SH

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979Coal Consumers inYear JanSalesa.E. GreatCSV FileVolumeBOE

  17. WAT TENBERG SPIN DLE EAT ON BONN Y GREELEY ROGGEN WAVERLY SH

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979Coal Consumers inYear JanSalesa.E. GreatCSV

  18. WAT TENBERG SPIN DLE EAT ON BONN Y GREELEY ROGGEN WAVERLY SH

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming963 1.969 1.979Coal Consumers inYear JanSalesa.E. GreatCSVLiquids Reserve

  19. LAKESHORE AVON BR ANT-EDEN ALD EN-LANC ASTER AU BURN W SH ELDON

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1Markets See full2% of34,929.0 36,104.5 L

  20. LAKESHORE AVON BR ANT-EDEN ALD EN-LANC ASTER AU BURN W SH ELDON

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1Markets See full2% of34,929.0 36,104.5 L81 § ¨

  1. LAKESHORE AVON BR ANT-EDEN ALD EN-LANC ASTER AU BURN W SH ELDON

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1Markets See full2% of34,929.0 36,104.5 L81 §

  2. Mu ltip le V ie w p o in ts fo r In fo r m a tio n R e tr ie v a l A.C . C h a p in , Ja m e s C . F re n c h , W o rth y N . M a rtin

    E-Print Network [OSTI]

    French, James C.

    Mu ltip le V ie w p o in ts fo r In fo r m a tio n R e tr ie v a l A.C . C h a p in , Ja m e s C . F re n c h , W o rth y N . M a rtin U n iv e rsity o f V irg in ia D e p a rtm e n t o f C o m p u te r S c ie n c e h ttp ://w w w .c s.v irg in ia .e d u /~ c y b e ria A sy ste m o f m u ltip le v

  3. Page 300 Courses: Education: Single Subject (EDSS) Sonoma State University 2015-2016 Catalog edSS 446 LAnguAge LiterACy ACroSS tHe CurriCuLuM: MiddLe And SeCondAry

    E-Print Network [OSTI]

    Ravikumar, B.

    SS 446 LAnguAge LiterACy ACroSS tHe CurriCuLuM: MiddLe And SeCondAry SCHooL (4) Principles, methods to teaching practice in middle, junior high, and senior high schools. Emphasis on teaching/learning situationsLtiCuLturAL SettingS (12) A supervised teaching experience in a multicultural middle, junior high, or senior high

  4. Catalyst Composition and Impurity-Dependent Kinetics of Nanowire Heteroepitaxy

    E-Print Network [OSTI]

    Gamalski, Andrew D.; Perea, Daniel E.; Yoo, Jinkyoung; Li, Nan; Olszta, Matthew J.; Colby, Robert; Schreiber, Daniel K.; Ducati, Caterina; Picraux, S. Tom; Hofmann, Stephan

    2013-08-05

    . Keywords: Nanowire, Ge-Si Heteroepitaxy, Nucleation Barrier, Environmental Transmission Electron Microscopy, AuGa Catalyst Alloy, Dopants *Corresponding Authors: daniel.perea@pnnl.gov (D.E.P.), sh315@cam.ac.uk (S.H.) §Current Address: Intel Corporation... National Laboratory (PNNL). PNNL is operated by Battelle for the U.S. DOE under contract DE-AC05-76RL01830. We gratefully acknowledge the use of facilities within the LeRoy Eyring Center for Solid State Science at Arizona State University. This work...

  5. Reti di Calcolatori AA 2013/2014

    E-Print Network [OSTI]

    Lo Cigno, Renato Antonio

    Reti di Calcolatori AA 2013/2014 http://disi.unitn.it/locigno/index.php/teaching / esercitazione n Informazioni varie, contatti, la bacheca del corso, le date di esame, ... #12;locigno rete (IP) n Livello Data Link (Ethernet) n Livello Fisico (mezzi trasmissivi e trasmissione di segnali

  6. Reti di Calcolatori AA 2012/2013

    E-Print Network [OSTI]

    Lo Cigno, Renato Antonio

    1 Reti di Calcolatori AA 2012/2013 http://disi.unitn.it/locigno/index.php/teaching Informazioni varie, contatti, la bacheca del corso, le date di esame, ... #12;2 locigno@disi.unitn.it 4 (IP) n Livello Data Link (Ethernet) n Livello Fisico (mezzi trasmissivi e trasmissione di segnali

  7. Le JJ/MM/AAAA RELATIONS INTERNATIONALES

    E-Print Network [OSTI]

    Sart, Remi

    and industrial base of 60 000 companies with some big names : Michelin, Limagrain, Volvic IBM... sectors of Engineering University Institute of Computer Science and Modelling 1 University Institute of Technology (2;Research 25 laboratories centred on 6 main areas of research: - Mathematics and computer sciences - Science

  8. LeAnn Oliver | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    Ms. Oliver serves the Department of Energy as the Associate CIO for Information Technology (IT) Policy & Governance. She is responsible for the Department's IT Capital...

  9. LE JOURNAL DE PHYSIQUE Short communication

    E-Print Network [OSTI]

    Boyer, Edmond

    dans la phase supraconductrice et dans la phase normale. Abstract.2014 Neutron scattering and the electronic states have been obtained by neutron scattering expe- riments on single crystals [5]. It is now of magne- tic neutron scattering on a single-crystal of YBa2Cu306.55 which clearly reveal that the an

  10. LE JOURNAL DE PHYSIQUE Short Communication

    E-Print Network [OSTI]

    Boyer, Edmond

    , a notorious counter-example of non-Slater fermionic w-f is given by the B.C.S. theory of superconductiv- ity superconductors [2] and for liquid He 3 [3], leading to a new de- scription of the normal state as a non super

  11. Le origini del mondo Giuseppe Longo

    E-Print Network [OSTI]

    Santorelli, Pietro

    Bang: T= 0 (17.000.000.000 anni fa) La storia di una lenta morte termica ? L'energia totale dell'universo (meccanica, termica, nucleare, etc.) è costante Il raggio (R) dell'universo aumenta e la densità media di ogni grandezza fisica Q diminuisce con il volume V R età = t 1/R3 1/t3 La densità di energia

  12. ebuleuses et leurs etoiles dans le

    E-Print Network [OSTI]

    Delmotte, Nausicaa

    visible car enfouies dans la poussi #18; ere et photom #19; etrie non contamin #19; ee par les n #19

  13. -. ..-.. ','c^ . ... f-ey^LE OPY

    E-Print Network [OSTI]

    Oak Ridge National Laboratory

    .Modified r (V Vr Modified r = (V -V )/V It is in itself of importance in Stirling engines and v v max o o- application to Stirling and other regenerative engines. tion. The expressions of Lee [9] and of Cooke

  14. Service des finances Le saviez-vous ?

    E-Print Network [OSTI]

    peut pas être certifiée ISO 26 000. Cependant, il existe diverses certifications propres à certains des certification ISO 14 001 atteste qu'une organisation a identifié ses impacts sur l'environnement, les quantifie. La certification ISO 9001 atteste qu'une organisation a développé des pratiques de gestion qui

  15. Animal Agency in Le Quattro Volte

    E-Print Network [OSTI]

    McMahon, Laura

    2015-03-01

    Phillips notes, the film is ‘[v]irtually without human speech, yet hardly ever silent’; ‘[s]o many bleats, barks, buzzing and birdsong fills [sic] the soundtrack, the lack of human voices barely registers.’21 While the goatherd’s cough is persistent...

  16. DVELOPPEMENT Inventer pour le monde de demain

    E-Print Network [OSTI]

    Bey, Isabelle

    prix par Bouygues Immobilier + et de nombreux lots. 11e édition #12;communiqué de presse Pour sa 11e tous les sujets. À GAGNER - 1er Prix / Un an d'accompagnement de projet avec Bouygues Immobilier et

  17. William LePage 2370 Stone Rd

    E-Print Network [OSTI]

    Daly, Samantha

    .M., Henshaw, J.M., & G.H. Purser. Design and Development of a Portable Off-Grid Water Chlorina- tion System of a Portable Off-Grid Water Chlorina- tion System. ASME IMECE, Denver, Colo. 2/2 #12;

  18. FACinfoCrez le rythme novembre 2013

    E-Print Network [OSTI]

    Montréal, Université de

    de vinci (Ins- titut Supérieur d'Enseignement Infirmier associé à l'Université catholique de Louvain

  19. JOURNEE MONDIALE DE LUTTE CONTRE LE SIDA

    E-Print Network [OSTI]

    Brest, Université de

    Soins Infirmiers (IFSI) du CHRU de la Cavale Blanche, l'IFSI de la Croix Rouge Française ... Lundi 1er

  20. It, Le. requeoted thet Contmot no

    Office of Legacy Management (LM)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefield Municipal Gas &SCE-SessionsSouth DakotaRobbins and MyersHr. Anthony V. Andolina:I *r' (39 1986It,

  1. NREL: Energy Analysis - Karla LeComte

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration wouldMass map shines light on771/6/14 Contact:NewsWebmasterWorkingEllaKrueger PhotoJørnKarla

  2. Sandia Energy - Bruce LeBlanc

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust, High-Throughput Analysis ofSample SULI ProgramPhysicalNaughton Home Brian NaughtonBruce

  3. Anllals DJ ClaciololD' 21 1 995 Tnternational G laciological Society

    E-Print Network [OSTI]

    Howat, Ian M.

    concentrations are close to that of sea water, indicating l it t le or no fractionation of sea-salt aerosols. Thc and non sea-salt (nss) SO l 2 . No significant long-term trends are obsen'ed in any of the anion fluxes WeddellSea Ice Core Drill Site \\' _--- IceS. ---'CV' Filchner ---- RonneIceSh V +80'S Ice cores from

  4. EXEMPLE D'OUTILS POUR ANALYSER LE ROLE DE LA SYMBIOSE MYCORHIZIENNE DANS LE

    E-Print Network [OSTI]

    Thioulouse, Jean

    THIOULOUSE J.1 , SANGUIN H.2 , PRIN Y.2 , DUPONNOIS R.3 1 Université de Lyon, F-69000, Lyon ; université Lyon, France. Tél. : +33 472 432756. Fax : +33 472 431388 e-mail : jean.thioulouse@univ-lyon1.fr 2 Cirad

  5. Sur le vif 2008 L'le d'Anjouan figure de la balkanisation de

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    of the Comoros is experiencing chronic political instability since its independence in 1975. From coups attempts of the Comoros archipelago, Mayotte, in the French Republic and with the separatist attempts of Anjouan of the Comoros illustrates the obstacles of a national cohesion within a multi- insular state wrestling

  6. Dveloppement et mondialisation dans le Cne Sud : le territoire en dbat. Sbastien Velut

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    introducción del desarrollo sustentable justifica la redefinición de los territorios, con una mayor sustentable, políticas públicas Summary This paper presents the debates on territory and development of economic growth , which lead to rapid changes in functional spaces. The introduction of sustentable

  7. The university student's guide to S LE F CARES LE F CARE

    E-Print Network [OSTI]

    Doedel, Eusebius

    with a cold sneezes or coughs, the virus travels in airborne particles. A cold can be transmitted to another will be mild while others will produce symptoms that cause more discomfort. Some symptoms, such as a dry cough.5- 40°C), accompanied by chills, muscle and joint aches, a sore throat and a dry cough. Other symptoms

  8. Universit Toulouse 2 Le Mirail (UT2 Le Mirail) ED CLESCO : Sciences du langage

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    Dompmartin, Ancienne Directrice du DEFLE - Université Toulouse II, Chantal Cantarel, Directrice de l

  9. Rsultats du concours Le 15 septembre 2005, le jury du Concours international universitaire de drones

    E-Print Network [OSTI]

    drones miniatures a attribué des prix aux équipes suivantes : Ex-aequos (3 prix de 8000 chacun) : Prix catégorie) AéroDRONES Air'nESSTIN Amado Auryon Birotan CPX4 DAVE DroneTeam ENSAM EMA'tador LesCigognes Oiseau artificiel Polydrone Quadricoptère Satoorn XSF µDrone Innovation système contexte opérationnel

  10. SUBAQUA Mai -Juin 2014 -N 254 9 LE CRABE CHINOIS DANS LE LMAN?

    E-Print Network [OSTI]

    Jacquet, Stéphan

    ­ Neuron en inox: l'avion de chasse de Dassault aviation qui porte ce nom a des contours qui rappellent

  11. The impact of a toll reduction for truck traffic using SH 130 Muhammad Ehsanul Bari *, Mark W. Burris 1

    E-Print Network [OSTI]

    Burris, Mark W.

    travel. A time series analysis of the toll transaction data, along with the local price of diesel fuel, unemployment rate, GDP, and income levels, resulted in a toll-price elasticity of À0.43 for 5-axle vehicles paid using electronic toll collection (ETC), and the remainder paid manually (MLT). The toll-price

  12. Spectromicroscopy of boron in human glioblastomas following administration of Na2B12H11SH B. Gilbert,1,

    E-Print Network [OSTI]

    Gilbert, Pupa Gelsomina De Stasio

    1999 Boron neutron capture therapy BNCT is an experimental, binary treatment for brain cancer which by interference from physiologically present sulfur and phosphorus, which contribute structure in the same energy

  13. Toward continuous push-based P2P live streaming Dongni Ren Wangkit Wong S.-H. Gary Chan

    E-Print Network [OSTI]

    Chan, Shueng-Han Gary

    a streaming rate requirement in the presence of node churns. We address the issue through problem formulation, China Email: {tonyren, jerrywong, gchan} @cse.ust.hk Abstract--Due to unpredictable peer churns (joins. In this paper, we study a push-based P2P network formed by unreliable nodes (i.e., nodes which may churn at any

  14. The bipyridyl herbicide paraquat-induced toxicity in human neuroblastoma SH-SY5Y cells: relevance to dopaminergic pathogenesis 

    E-Print Network [OSTI]

    Yang, Wonsuk

    2006-10-30

    brain. However, it is unclear how paraquat triggers toxicity in dopaminergic neurons. Based on the previous reports, it was hypothesized that paraquat may induce oxidative stress and proteasomal dysfunction-mediated toxicity in dopaminergic neurons...

  15. An integrated approach to predict ettringite formation in sulfate soils and identifying sulfate damage along SH 130 

    E-Print Network [OSTI]

    Sachin, Kunagalli Natarajan

    2005-02-17

    Expansive soils are treated with anhydrous or hydrated lime. The use of calcium-based stabilizers such as calcium oxide (lime) in sulfate-bearing clay soils has historically led to distress due to the formation of an ...

  16. Classification of semantic relations in different syntactic structures in medical text using the MeSH hierarchy

    E-Print Network [OSTI]

    Bhooshan, Neha

    2005-01-01

    Two different classification algorithms are evaluated in recognizing semantic relationships of different syntactic compounds. The compounds, which include noun- noun, adjective-noun, noun-adjective, noun-verb, and verb-noun, ...

  17. QUARTER SH OR T-T ER M EN ER GY OU TL OO K QUAR TERL Y PROJ

    Gasoline and Diesel Fuel Update (EIA)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustments (Billion Cubic Feet) Wyoming Dry NaturalPrices1Markets160Product: TotalCoalbed7 (Released July

  18. IDS120j WITHOUT RESISTIVE MAGNETS MODIFYING Hg MODULE ( UPDATED )

    E-Print Network [OSTI]

    McDonald, Kirk

    Hg POOL. *********************************************************** >SIMULATIONS CODE: mars1512 OVERVIEW (LEFT), POOL REGION DETAILS (RIGHT). [20 cm GAPS] SH#1 SH#1 SH#1A SH#2 SH#1A Hg POOL SH#4 SH#3 Hg POOL SH#1 2 cm THICK STST OUTER TUBE CRYO#1 CRYO#4CRYO#3 CRYO#2 2 cm THICK STST BEAM PIPE BEAM PIPE

  19. Reliability of the LaCoste-Romberg Surface Ship Gravity Meter S-9 during cruise 60-H-13 of the Texas A. & M. Research Vessel "Hidalgo" 

    E-Print Network [OSTI]

    Chiburis, Edward Frank

    1962-01-01

    RELIABILITY OF THE LaCOSTE-ROMBERG SURFACE SH'IP GRAVITY METER S -9 DURING C R U I S E 60-8-13 0 F T H E T E R A S A. & M. R E S E . A R C 8 V E S S . E . L " HIDALGO " A Thesis By EDWARD F. CHIBURIS Submitted to the Graduate School... of the Agricultural and Mechanical College of Texas in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE January 1962 Major Sub)ect: Geophysics RELIABILITY OF THE LaCOSTE-ROMBERG SURFACE SHIP GRAVITY METERS-9 DURING C R U I S E 60-H...

  20. Houston, TX Trinity Uni

    E-Print Network [OSTI]

    Natelson, Douglas

    Baton Rou jnovak@PI Lin Luo The Dow C 2301 Brazo Freeport, T lluo2@dow NACS Rep Mike Reyn Shell Inter pecially if yo sh. e colleagues am to them ur Treasurer ould be mad nt registrati ip. : The best 00 t). WCS p (last #12;3 7 8 8 9 10 10 1 12 2 3 3 7:30 AM 8:25 AM 8:30 AM 9:15 AM 0:00 AM 0:30 AM 1