National Library of Energy BETA

Sample records for latest exogenous information

  1. Information Security Policy Manual Latest Revision: May 16, 2012

    E-Print Network [OSTI]

    Alpay, S. Pamir

    1 Information Security Policy Manual Latest Revision: May 16, 2012 #12;2 Table of Contents Information Security Policy Manual...............................................................................................................................................17 Information Security Glossary

  2. The Earth Institute I Corporate Circle The latest information, tools and networks to achieve sustainability

    E-Print Network [OSTI]

    The Earth Institute I Corporate Circle Fall 2009 The latest information, tools and networks to achieve sustainability #12;The Earth Institute I Corporate Circle STRATEGIC OPPORTUNITIES GOAL Engage and allow for flexibility in the nature and extent of engagement. The Earth Institute I Corporate Circle #12

  3. Preliminary Safety Information Document for the Standard MHTGR. Volume 1, (includes latest Amendments)

    SciTech Connect (OSTI)

    1986-12-01

    With NRC concurrence, the Licensing Plan for the Standard HTGR describes an application program consistent with 10CFR50, Appendix O to support a US Nuclear Regulatory Commission (NRC) review and design certification of an advanced Standard modular High Temperature Gas-Cooled Reactor (MHTGR) design. Consistent with the NRC's Advanced Reactor Policy, the Plan also outlines a series of preapplication activities which have as an objective the early issuance of an NRC Licensability Statement on the Standard MHTGR conceptual design. This Preliminary Safety Information Document (PSID) has been prepared as one of the submittals to the NRC by the US Department of Energy in support of preapplication activities on the Standard MHTGR. Other submittals to be provided include a Probabilistic Risk Assessment, a Regulatory Technology Development Plan, and an Emergency Planning Bases Report.

  4. Latest News Release

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDid you notHeat PumpsTechnologies | Blandine JeromeLatest Feature

  5. Optimal combined wind power forecasts using exogeneous variables

    E-Print Network [OSTI]

    Optimal combined wind power forecasts using exogeneous variables Fannar ¨Orn Thordarson Kongens to the Klim wind farm using three WPPT forecasts based on different weather forecasting systems. It is shown of the thesis is combined wind power forecasts using informations from meteorological forecasts. Lyngby, January

  6. Double Chooz: Latest results

    E-Print Network [OSTI]

    J. I. Crespo-Anadón; for the Double Chooz collaboration

    2014-12-11

    The latest results from the Double Chooz experiment on the neutrino mixing angle $\\theta_{13}$ are presented. A detector located at an average distance of 1050 m from the two reactor cores of the Chooz nuclear power plant has accumulated a live time of 467.90 days, corresponding to an exposure of 66.5 GW-ton-year (reactor power $\\times$ detector mass $\\times$ live time). A revised analysis has boosted the signal efficiency and reduced the backgrounds and systematic uncertainties compared to previous publications, paving the way for the two detector phase. The measured $\\sin^2 2\\theta_{13} = 0.090^{+0.032}_{-0.029}$ is extracted from a fit to the energy spectrum. A deviation from the prediction above a visible energy of 4 MeV is found, being consistent with an unaccounted reactor flux effect, which does not affect the $\\theta_{13}$ result. A consistent value of $\\theta_{13}$ is measured in a rate-only fit to the number of observed candidates as a function of the reactor power, confirming the robustness of the result.

  7. Latest News | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACTThousand CubicResourcelogo and- EnergyNews » Latest News Latest News

  8. Latest Electroweak Results from CDF

    SciTech Connect (OSTI)

    Lancaster, Mark

    2010-05-01

    The latest results in electroweak physics from proton anti-proton collisions at the Fermilab Tevatron recorded by the CDF detector are presented. The results provide constraints on parton distribution functions, the mass of the Higgs boson and beyond the Standard Model physics.

  9. Drosophila lifespan enhancement by exogenous bacteria

    E-Print Network [OSTI]

    Seroude, Laurent

    Drosophila lifespan enhancement by exogenous bacteria Ted Brummel*, Alisa Ching*, Laurent Seroude with customary procedure. The experiments revealed that the presence of bacteria during the first week of adult life can enhance lifespan, despite unchanged food intake. Later in life, the presence of bacteria can

  10. Sandia National Laboratories: Latest News

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power AdministrationRobust, High-ThroughputUpcoming Release of thePrograms: Center forFacebookFactIon Beam LabLatest

  11. Latest News | Critical Materials Institute

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDid you notHeat PumpsTechnologies | Blandine JeromeLatest

  12. Exogenous Versus Endogenous for Chaotic Business Cycles

    E-Print Network [OSTI]

    Marat Akhmet; Zhanar Akhmetova; Mehmet Onur Fen

    2015-09-03

    We propose a novel approach to generate chaotic business cycles in a deterministic setting. Rather than producing chaos endogenously, we consider aggregate economic models with limit cycles and equilibriums, subject them to chaotic exogenous shocks and obtain chaotic cyclical motions. Thus, we emphasize that chaotic cycles, which are inevitable in economics, are not only interior properties of economic models, but also can be considered as a result of interaction of several economical systems. This provides a comprehension of chaos (unpredictability, lack of forecasting) and control of chaos as a global economic phenomenon from the deterministic point of view. We suppose that the results of our paper are contribution to the mixed exogenous-endogenous theories of business cycles in classification by P.A. Samuelson [76]. Moreover, they demonstrate that the irregularity of the extended chaos can be structured, and this distinguishes them from the generalized synchronization. The advantage of the knowledge of the structure is that by applying instruments, which already have been developed for deterministic chaos one can control the chaos, emphasizing a parameter or a type of motion. For the globalization of cyclic chaos phenomenon we utilize new mechanisms such that entrainment by chaos, attraction of chaotic cycles by equilibriums and bifurcation of chaotic cycles developed in our earlier papers.

  13. Latest News Releases | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDid you notHeat PumpsTechnologies | Blandine JeromeLatest FeatureLatest

  14. AER & FAME Review... May'14 The latest...

    E-Print Network [OSTI]

    Chittka, Lars

    AER & FAME Review... May'14 The latest... Places are rapidly filling for our Aquatic Ecology and diverse set of students studying with us from October. Project updates: Melina Jack (AER part tolerance experiment -- in Kiel, Germany Also AER, Marco Magazzu' is using his extended project time

  15. AER & FAME Review... Feb'15 The latest...

    E-Print Network [OSTI]

    Chittka, Lars

    AER & FAME Review... Feb'15 The latest... The new year brings new plans and the paths of the two programmes diverge. FAME students still have a few taught modules to complete but AER students should have Eizaguirre. Meanwhile, Patricia Peinado Fuentes (AER) is playing the `who can fieldwork furthest flung' game

  16. Latest Jets Results from the Tevatron

    E-Print Network [OSTI]

    Christina Mesropian

    2011-06-15

    A comprehensive overview of the latest aspects of jet physics in proton-antiproton collisions at $\\sqrt{s}=$1.96 TeV is presented. In particular, measurements of the inclusive jet production, dijet and multi-jet production, and jet substructure studies are discussed.

  17. Better Buildings Neighborhood Program Reporting and Information System

    Broader source: Energy.gov [DOE]

    This page includes the latest guidance, resources, and links to assist partners with reporting. Information includes:

  18. Latest Report Shows Cost of Going Solar has Dropped Significantly...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Latest Report Shows Cost of Going Solar has Dropped Significantly for 5 Years Latest Report Shows Cost of Going Solar has Dropped Significantly for 5 Years August 12, 2015 - 2:28pm...

  19. DOE Releases Latest Report on Energy Savings Forecast of Solid...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    Latest Report on Energy Savings Forecast of Solid-State Lighting DOE Releases Latest Report on Energy Savings Forecast of Solid-State Lighting September 12, 2014 - 2:06pm Addthis...

  20. ORIGINAL PAPER Autism and urinary exogenous neuropeptides: development

    E-Print Network [OSTI]

    Hammock, Bruce D.

    ORIGINAL PAPER Autism and urinary exogenous neuropeptides: development of an on-line SPE / Published online: 23 May 2007 # Springer-Verlag 2007 Abstract Autism is a complex neurodevelopmental disor- der with unknown etiology. One hypothesis regarding etiology in autism is the "opioid peptide excess

  1. International Environmental Agreements with Endogenous or Exogenous Risk

    E-Print Network [OSTI]

    Karp, Larry S.

    Agreement (IEA). Exogenous and endogenous risk have different implications for the (expected) level of equilibrium participation in an IEA. Our paper is the first to examine the effect of risk aversion on equilibrium IEA participation under endogenous risk. We also extend and clarify Boucher and Bra- moulle (2010

  2. Latest notices | OpenEI Community

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LIST OFAMERICA'SHeavyAgency (IRENA) Jump to:LEDSGP.org noticeLangcheng RuifengLatest

  3. Latest Feature Video | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDid you notHeat PumpsTechnologies | Blandine JeromeLatest Feature Video

  4. Abstract --Most logistics network design models assume exogenous customer demand that is independent of the service

    E-Print Network [OSTI]

    Graves, Stephen C.

    Abstract -- Most logistics network design models assume exogenous customer demand for the network design decision making process. Index Terms -- Logistics Network Design, Demand Classes, Benefits. In most logistics network design models, the customer demand is exogenous and defined as a uniform

  5. Latest News Releases | The Ames Laboratory

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformationJesse Bergkamp GraduateResidential Energy Consumption Survey Form EIA-457ALatest

  6. Latest Developments in Image Processing Methods and Technologies for Magnetic Confinement Nuclear Fusion

    E-Print Network [OSTI]

    Latest Developments in Image Processing Methods and Technologies for Magnetic Confinement Nuclear Fusion

  7. Web page presents latest info on influenza situation

    E-Print Network [OSTI]

    Victoria, University of

    SPEED READING SWINE FLU Web page presents latest info on influenza situation The university reform is available on the web.View the panel discussion and the question-and-answer session sessions will be held for each building once project schedules are established. Story, page 2 STUDENT

  8. Effects of Exogenously Applied Indole-3-Acetic Acid (IAA) to Cotton 

    E-Print Network [OSTI]

    Clement, Jenny D.

    2011-08-08

    elongation in cotton fiber development. An increase in IAA at specific fiber developmental stages may promote increased lint percent and longer fibers. Objectives of this research project were to determine how exogenous applications in a field environment...

  9. Barium Titanate Nanoparticles as Exogenous Contrast Agents in Second Harmonic Optical Coherence Tomography 

    E-Print Network [OSTI]

    Pearson, Jeremy T

    2013-05-06

    I propose and demonstrate a method by which barium titanate nanoparticle clusters can be used as exogenous contrast agents in Second Harmonic Optical Coherence Tomography imaging systems to localize and highlight desired ...

  10. Endogenous and exogenous dynamics of pressure fluctuations in an impinging entrained-flow gasifier

    E-Print Network [OSTI]

    Niu, Miao-Ren; Zhou, Wei-Xing; Wang, Fu-Chen; Yu, Zun-Hong

    2007-01-01

    On a laboratory-scale testing platform of impinging entrained-flow gasifier with two opposed burners, the pressure fluctuation signals were measured with a stainless steel water-cooled probe. Phenomenological investigations of the endogenous and exogenous dynamics in the fluctuations of pressure were carried out by performing the mean-variance analysis and separating the endogenous and exogenous components of the signals. Non-universal dynamics with power-law behaviors have been found not only in the original signals but also in their components. A new inequality was obtained showing that the exogenous exponent is smallest while the overall dynamic exponent is the largest. The results highlight that the dynamics of pressure fluctuations in the first fifteen minutes of the gasification process is driven dominantly by the ignition process. The method can be readily applied to the other multiphase systems like bubble column, fluidized bed, etc.

  11. Latest Results in SLAC 75-MW PPM Klystrons

    SciTech Connect (OSTI)

    Sprehn, D.; Caryotakis, G.; Haase, A.; Jongewaard, E.; Laurent, L.; Pearson, C.; Phillips, R.; /SLAC

    2006-03-06

    75 MW X-band klystrons utilizing Periodic Permanent Magnet (PPM) focusing have been undergoing design, fabrication and testing at the Stanford Linear Accelerator Center (SLAC) for almost nine years. The klystron development has been geared toward realizing the necessary components for the construction of the Next Linear Collider (NLC). The PPM devices built to date which fit this class of operation consist of a variety of 50 MW and 75 MW devices constructed by SLAC, KEK (Tsukuba, Japan) and industry. All these tubes follow from the successful SLAC design of a 50 MW PPM klystron in 1996. In 2004 the latest two klystrons were constructed and tested with preliminary results reported at EPAC2004. The first of these two devices was tested to the full NLC specifications of 75 MW, 1.6 microseconds pulse length, and 120 Hz. This 14.4 kW average power operation came with a tube efficiency >50%. The most recent testing of these last two devices will be presented here. Design and manufacturing issues of the latest klystron, due to be tested by the Fall of 2005, are also discussed.

  12. Motivation sharpens exogenous spatial attention Jan B. Engelmann(1) and Luiz Pessoa(2)

    E-Print Network [OSTI]

    Pessoa, Luiz

    1 Motivation sharpens exogenous spatial attention Jan B. Engelmann(1) and Luiz Pessoa(2) (1) Jan B (lpessoa@indiana.edu). #12;2 ABSTRACT Although both attention and motivation affect behavior, how these two participants performed a spatially-cued forced-choice localization task under varying levels of motivation

  13. Poster Session 08: Bystander and other Low Dose Effect Exogenous carbon monoxide suppresses adaptive response induced

    E-Print Network [OSTI]

    Yu, Peter K.N.

    Poster Session 08: Bystander and other Low Dose Effect Exogenous carbon monoxide suppresses; adaptive response; zebrafish embryos Journal of Radiation Research, 2014, 55, i115 Supplement doi: 10 prepared medium with the chemical at different time points after the application of the priming dose. Our

  14. Effects of exogenous carbon monoxide on radiation-induced bystander effect in zebrafish embryos in vivo

    E-Print Network [OSTI]

    Yu, Peter K.N.

    that the dose-response of radiation in the low-dose regime deviated from the LNT model. A notable example radiation are linearly proportional to the absorbed dose, evidence accumulated in the past decades showed as a pharmaceutical agent to release a low dose of exogenous carbon monoxide (CO) to attenuate the effect on bystander

  15. Planning in The Face of Frequent Exogenous Events Christian Fritz and Sheila A. McIlraith

    E-Print Network [OSTI]

    McIlraith, Sheila

    Planning in The Face of Frequent Exogenous Events Christian Fritz and Sheila A. Mc,sheila}@cs.toronto.edu Abstract Generating optimal plans in highly dynamic environments is challenging. Plans are predicated on an assumed initial state, but this state can change unexpectedly during plan genera- tion, potentially

  16. Mutations in yhiT enable utilization of exogenous pyrimidine intermediates in Salmonella enterica

    E-Print Network [OSTI]

    Coller, Jeff

    Mutations in yhiT enable utilization of exogenous pyrimidine intermediates in Salmonella enterica auxotrophs of Salmonella enterica serovar Typhimurium LT2. The gain-of-function phenotypes both resulted from a continual supply of deoxyribo- and ribonucleoside triphosphates. In Escherichia coli and Salmonella enterica

  17. Latest results of MEG and status of MEG-II

    E-Print Network [OSTI]

    Francesco Renga

    2014-10-17

    Within the Standard Model, in spite of neutrino oscillations, the flavor of charged leptons is conserved in very good approximation, and therefore charged Lepton Flavor Violation is expected to be unobservable. On the other hand, most new physics models predict charged Lepton Flavor Violation within the experimental reach, and processes like the $\\mu \\to e \\gamma$ decay became standard probes for physics beyond the Standard model. The MEG experiment, at the Paul Scherrer Institute (Switzerland), searches for the $\\mu \\to e \\gamma$ decay, down to a Branching Ratio of about $5 \\times 10^{-13}$, exploiting the most intense continuous muon beam in the world and innovative detectors. In this talk I will present the latest results from MEG, and the status of its upgrade (MEG-II), aiming at an improvement of the sensitivity by one order of magnitude within this decade.

  18. Latest Jurassic-early Cretaceous regressive facies, northeast Africa craton

    SciTech Connect (OSTI)

    van Houten, F.B.

    1980-06-01

    Nonmarine to paralic detrital deposits accumulated in six large basins between Algeria and the Arabo-Nubian shield during major regression in latest Jurassic and Early Cretaceous time. The Ghadames Sirte (north-central Libya), and Northern (Egypt) basins lay along the cratonic margin of northeastern Africa. The Murzuk, Kufra, and Southern (Egypt) basins lay in the south within the craton. Data for reconstructing distribution, facies, and thickness of relevant sequences are adequate for the three northern basins only. High detrital influx near the end of Jurassic time and in mid-Cretaceous time produced regressive nubian facies composed largely of low-sinuosity stream and fahdelta deposits. In the west and southwest the Ghadames, Murzuk, and Kufra basins were filled with a few hundred meters of detritus after long-continued earlier Mesozoic aggradation. In northern Egypt the regressive sequence succeeded earlier Mesozoic marine sedimentation; in the Sirte and Southern basins correlative deposits accumulated on Precambrian and Variscan terranes after earlier Mesozoic uplift and erosion. Waning of detrital influx into southern Tunisia and adjacent Libya in the west and into Israel in the east initiated an Albian to early Cenomanian transgression of Tethys. By late Cenomanian time it had flooded the entire cratonic margin, and spread southward into the Murzuk and Southern basins, as well as onto the Arabo-Nubian shield. Latest Jurassic-earliest Cretaceous, mid-Cretaceous, and Late Cretaceous transgressions across northeastern Africa recorded in these sequences may reflect worldwide eustatic sea-level rises. In contrast, renewed large supply of detritus during each regression and a comparable subsidence history of intracratonic and marginal basins imply regional tectonic control. 6 figures.

  19. Text-Alternative Version: LED Replacement Lamps: Current Performance and the Latest on ENERGY STAR®

    Office of Energy Efficiency and Renewable Energy (EERE)

    Below is the text-alternative version of the LED Replacement Lamps: Current Performance and the Latest on ENERGY STAR® webcast.

  20. Secretary Chu Announces Latest Efforts to Address Cybersecurity...

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    in creating a framework to identify and prepare for challenges to grid reliability; share information, best practices, resources, and solutions to and from domestic and...

  1. Rehabilitation engineers help people with disabilities with wireless technology LATEST NEWS

    E-Print Network [OSTI]

    Rehabilitation engineers help people with disabilities with wireless technology SEARCH LATEST NEWS Research Horizons Magazine November 27, 2002 Rehabilitation Engineers' Emphasis on Helping People research projects now under way at the new Rehabilitation Engineering Research Center on Mobile Wireless

  2. Latest News Browse Topics Encyclopedia Science Shop Green-winged macaws. (Photo courtesy of Arizona

    E-Print Network [OSTI]

    McGraw, Kevin J.

    Latest News Browse Topics Encyclopedia Science Shop Green-winged macaws. (Photo courtesy of Arizona & Energy > Computers & Math > Fossils & Ruins Science Topics > Agriculture > Astronomy > Biology > more topics Encyclopedia > Agriculture > Anthropology Source: Arizona State University Date: 2005

  3. Ecosystems: Issues and problems. (Latest citations from the ABI/Inform database). Published Search

    SciTech Connect (OSTI)

    NONE

    1996-02-01

    The bibliography contains citations concerning issues and problems relating to ecosystems in different parts of the world. Preservation of resources, environmental protection, industrial impacts on ecosystems, ecological economics, biodiversity of specific ecosystems, and effects of deforestation and erosion are examined. Citations review impacts of human inhabitants, eco-tourism, and alien species on an ecosystem. The relationship to an ecosystem of pests and microbial infections is covered, and long-range planning for ecosystems is cited. (Contains 50-250 citations and includes a subject term index and title list.) (Copyright NERAC, Inc. 1995)

  4. Mark Rasch, SecurityFocus, 2004.10.25: "The latest tool in competition: hacking

    E-Print Network [OSTI]

    Bernstein, Daniel

    Mark Rasch, SecurityFocus, 2004.10.25: "The latest tool in competition: hacking "Your competitor; or (C) hack into the competitor's website, steal the code, and for good measure hire their critical and welcome to the new world of competitive hacking. #12;"On October 15, the United States Court of Appeals

  5. USING NERC SCIENCE Welcome to the latest edition of the Natural Environment Research Council (NERC)

    E-Print Network [OSTI]

    Williams, Paul

    USING NERC SCIENCE March 2009 Welcome to the latest edition of the Natural Environment Research. The results will show how the UK can meet its goal to cut greenhouse gas emissions by 80% by 2050 while dealing with anxieties about energy security. The two year project has involved a unique whole systems

  6. Instructions for Web Browsers Make sure you have the latest version of your preferred web browser.

    E-Print Network [OSTI]

    Millar, Andrew J.

    Instructions for Web Browsers Make sure you have the latest version of your preferred web browser Alternatively you can right click the web links and choose save target as to save the PDF form. Once downloaded for reference Alternatively you can right click the web link and choose save Link as to save the PDF file. Once

  7. MDS degree requirements Latest revision: 10/18/2013 Required MATH 231

    E-Print Network [OSTI]

    Simons, Gordon

    MDS degree requirements Latest revision: 10/18/2013 Required MATH 231 1st and STOR 155 STOR 215 MATH 232 COMP 116 (or 110) ECON 101 2nd year Intro to Intro to Calculus Intro to Intro to Econ courses Statistics Decision Sci Programming (optional) (All offered MATH 233 F and S) Multi-Var Calc STOR 455 (FSm

  8. The latest Paleocene crisis in the deep sea: Ostracode succession at Maud Rise, Southern Ocean

    E-Print Network [OSTI]

    Thomas, Ellen

    The latest Paleocene crisis in the deep sea: Ostracode succession at Maud Rise, Southern Ocean P of intermediate water mass from high altitudes to the subtropics. These data also suggest that warm saline waters values of benthic and planktonic fo- raminifera at high latitudes and benthic fo- raminifera worldwide

  9. Asbestos fibers mediate transformation of monkey cells by exogenous plasmid DNA

    SciTech Connect (OSTI)

    Appel, J.D.; Fasy, T.M.; Kohtz, D.S.; Kohtz, J.D.; Johnson, E.M. (Mount Sinai School of Medicine of the City Univ. of New York, NY (USA))

    1988-10-01

    The authors have tested the ability of chrysotile asbestos fibers to introduce plasmid DNA into monkey COS-7 cells and the ability of this DNA to function in both replication and gene expression. Chrysotile fibers are at least as effective as calcium phosphate in standard transfection assays at optimal ratios of asbestos to DNA. After transfection with chrysotile, a minor percentage of introduced plasmid DNA bearing a simian virus 40 origin of replication replicates after 24 hr. Fragmentation of entering DNA is more prominent with asbestos than with calcium phosphate, and after 72 hr most DNA introduced by asbestos is associated with chromosomal DNA. Cells transfected with plasmid p11-4, bearing the p53 protooncogene, express this gene. Cells transfected with pSV2-neo express a gene conferring resistance of antibiotic G418, allowing isolation of colonies of transformed cells after 18 days. The introduction of exogenous DNA into eukaryotic cells could cause mutations in several ways and thus contribute to asbestos-induced oncogenesis.

  10. Interrelationship of endogenous and exogenous prostaglandins with uterine involution and postpartum interval in beef cows and heifers 

    E-Print Network [OSTI]

    Tolleson, Douglas Ray

    1986-01-01

    Interrelationship of Endogenous and Exogenous Prostaglandins with Uterine Involution and Postpartum Interval in Beef Cows and Heifers (August 1986) Douglas Ray Tolleson, B. S. , Texas ALM University Chairman of Advisory Committee: Dr. Ronald D. Randel A review... ALPHA PRODUCTION BY THE INVOLUTING BOVINE UTERUS AT 14 AND 35 DAYS POSTPARTUM: PATTERN OF RELEASE AND RESPONSE TO PHYSICAL MANIPULATION. 26 28 33 44 47 Introduction. . . . . . . . . Materia1s and Methods. Resu1ts. Discussion. CHAPTER V...

  11. Exogenous contrast agents for thermoacoustic imaging: An investigation into the underlying sources of contrast

    SciTech Connect (OSTI)

    Ogunlade, Olumide Beard, Paul

    2015-01-15

    Purpose: Thermoacoustic imaging at microwave excitation frequencies is limited by the low differential contrast exhibited by high water content tissues. To overcome this, exogenous thermoacoustic contrast agents based on gadolinium compounds, iron oxide, and single wall carbon nanotubes have previously been suggested and investigated. However, these previous studies did not fully characterize the electric, magnetic, and thermodynamic properties of these agents thus precluding identification of the underlying sources of contrast. To address this, measurements of the complex permittivity, complex permeability, DC conductivity, and Grüneisen parameter have been made. These measurements allowed the origins of the contrast provided by each substance to be identified. Methods: The electric and magnetic properties of the contrast agents were characterized at 3 GHz using two rectangular waveguide cavities. The DC conductivity was measured separately using a conductivity meter. Thermoacoustic signals were then acquired and compared to those generated in water. Finally, 3D electromagnetic simulations were used to decouple the different contributions to the absorbed power density. Results: It was found that the gadolinium compounds provided appreciable electric contrast but not originating from the gadolinium itself. The contrast was either due to dissociation of the gadolinium salt which increased ionic conductivity or its nondissociated polar fraction which increased dielectric polarization loss or a combination of both. In addition, very high concentrations were required to achieve appreciable contrast, to the extent that the Grüneisen parameter increased significantly and became a source of contrast. Iron oxide particles were found to produce low but measurable dielectric contrast due to dielectric polarization loss, but this is attributed to the coating of the particles not the iron oxide. Single wall carbon nanotubes did not provide measurable contrast of any type. Conclusions: It is concluded that gadolinium based contrast agents, iron oxide particles, and single walled carbon nanotubes have little intrinsic merit as thermoacoustic contrast agents. Simple electrolytes such as saline which yield high contrast based on ionic conductivity provide much higher dielectric contrast per unit solute concentration and are likely to be significantly more effective as contrast agents.

  12. ESTSC - Find the latest in U.S. Department of Energy Software

    Office of Scientific and Technical Information (OSTI)

    Package Record Not Found SOFTWARE ABSTRACT Request Information Back PACKAGE ID LIMITATIONAUDIENCE CODE Request Information Back...

  13. Set home page Bookmark site Add search Latest News Browse Topics Encyclopedia Health Center Videos Amazon Store

    E-Print Network [OSTI]

    Suslick, Kenneth S.

    Encyclopedia > Agriculture > Anthropology > Archaeology > Astronomy > Biology > Chemistry > CommunicationSet home page · Bookmark site · Add search Latest News Browse Topics Encyclopedia Health Center > Fossils & Ruins Science Topics > Agriculture > Astronomy > Biology > Chemistry > Earth Sciences

  14. Latest Results from the Alpha Magnetic Spectrometer on the International Space Station

    E-Print Network [OSTI]

    Martin Pohl

    2014-12-08

    I review latest results from AMS on electrons and positrons in primary cosmic rays in the GeV to TeV energy range. Separate fluxes for electrons and positrons as well as their sum are presented. Neither of the fluxes is compatible with a simple power law. New data on the fraction of positrons in the joint electron and positron flux are also presented, which extend the energy range of our previous observation and increase its precision. The new results show, for the first time, that above about 200 GeV the positron fraction no longer exhibits an increase with energy. The results confirm that a common new source of electrons and positrons exists.

  15. Latest Results from the Alpha Magnetic Spectrometer on the International Space Station

    E-Print Network [OSTI]

    Pohl, Martin

    2014-01-01

    I review latest results from AMS on electrons and positrons in primary cosmic rays in the GeV to TeV energy range. Separate fluxes for electrons and positrons as well as their sum are presented. Neither of the fluxes is compatible with a simple power law. New data on the fraction of positrons in the joint electron and positron flux are also presented, which extend the energy range of our previous observation and increase its precision. The new results show, for the first time, that above about 200 GeV the positron fraction no longer exhibits an increase with energy. The results confirm that a common new source of electrons and positrons exists.

  16. The HiSeq 2000 is the latest high-throughtput DNA sequencing platform from Illumina that in-

    E-Print Network [OSTI]

    Noble, James S.

    The HiSeq 2000 is the latest high-throughtput DNA sequencing platform from Illumina that in sequencing. The DNA Core has recently pur- chased a HiSeq 2000 with the trade-in of a single GAIIx instrument. The core now operates a GAIIx and HiSeq 2000. The TruSeq v5 sequencing chemistry is the recently released

  17. LATEST RESULTS FROM A SEARCH FOR NEUTRINOLESS DOUBLE BETA DECAY WITH NEMO3 AND PLANS FOR SUPERNEMO

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    LATEST RESULTS FROM A SEARCH FOR NEUTRINOLESS DOUBLE BETA DECAY WITH NEMO3 AND PLANS FOR SUPERNEMO The NEMO3 experiment is devoted to the search for neutrinoless double beta decay, as well as for accurate Experimental search for the neutrinoless double beta decay (0) is of major importance in particle physics

  18. ESTSC - Find the latest in U.S. Department of Energy Software

    Office of Scientific and Technical Information (OSTI)

    Record Not Found Fill out the fields below to request more information (including pricing) about this package. Package ID: Acronym: Title: Full Name: CompanyOrganization:...

  19. On the Use of Automatically Generated Discourse-Level Information in a Concept-to-Speech Synthesis System 

    E-Print Network [OSTI]

    Hitzeman, Janet; Black, Alan W; Taylor, Paul; Mellish, Chris; Oberlander, Jon

    This paper describes the latest version of the SOLE concept-to-speech system, which uses linguistic information provided by a natural language generation system to improve the prosody of synthetic speech. We discuss the ...

  20. Representing energy technologies in top-down economic models using bottom-up information

    E-Print Network [OSTI]

    take energy and other prices as exogenous and, therefore, may overestimate the potential penetrationRepresenting energy technologies in top-down economic models using bottom-up information J.R. Mc 02139, USA c Laboratory for Energy and the Environment, M.I.T., Cambridge, MA 02139, USA Available

  1. The Center for International Education welcomes its fourth cohort of Global Studies Fellows for the 2013/14 academic year. The Fellows will present their latest research at

    E-Print Network [OSTI]

    Saldin, Dilano

    The Center for International Education welcomes its fourth cohort of Global Studies Fellows for the 2013/14 academic year. The Fellows will present their latest research at colloquia on Friday, November

  2. A generic information extraction architecture for financial applications L.K.A. Weea

    E-Print Network [OSTI]

    Tan, Chew Lim

    and to the latest Internet web pages. Having the right useful information (or knowl- edge) at the right timeA generic information extraction architecture for financial applications L.K.A. Weea , L.C. Tonga The advent of computing has exacerbated the problem of overwhelming information. To manage the deluge

  3. Information Technologies Activity Report M A Y AU G U S T 20 1 3

    E-Print Network [OSTI]

    Firestone, Jeremy

    1 Information Technologies Activity Report M A Y ­ AU G U S T 20 1 3 Voice over Internet Protocol Technology Services (IT-ATS) to incorporate information learned from the technology "testing" room in 218 Gore Hall and combined that information with the latest A/V technology to outfit the classrooms

  4. Does the Utility Rates service on OpenEI return/display the latest data or

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePower VenturesInformation9)ask queriesWindSiteProjectonly approved data? |

  5. Neutrinos in the holographic dark energy model: constraints from latest measurements of expansion history and growth of structure

    E-Print Network [OSTI]

    Jing-Fei Zhang; Ming-Ming Zhao; Yun-He Li; Xin Zhang

    2015-03-27

    The model of holographic dark energy (HDE) with massive neutrinos and/or dark radiation is investigated in detail. The background and perturbation evolutions in the HDE model are calculated. We employ the PPF approach to overcome the gravity instability difficulty (perturbation divergence of dark energy) led by the equation-of-state parameter $w$ evolving across the phantom divide $w=-1$ in the HDE model with $cpower spectrum and the matter power spectrum in the HDE scenario are discussed. Furthermore, we constrain the models of HDE with massive neutrinos and/or dark radiation by using the latest measurements of expansion history and growth of structure, including the Planck CMB temperature data, the baryon acoustic oscillation data, the JLA supernova data, the Hubble constant direct measurement, the cosmic shear data of weak lensing, the Planck CMB lensing data, and the redshift space distortions data. We find that $\\sum m_\

  6. Neutrinos in the holographic dark energy model: constraints from latest measurements of expansion history and growth of structure

    E-Print Network [OSTI]

    Zhang, Jing-Fei; Li, Yun-He; Zhang, Xin

    2015-01-01

    The model of holographic dark energy (HDE) with massive neutrinos and/or dark radiation is investigated in detail. The background and perturbation evolutions in the HDE model are calculated. We employ the PPF approach to overcome the gravity instability difficulty (perturbation divergence of dark energy) led by the equation-of-state parameter $w$ evolving across the phantom divide $w=-1$ in the HDE model with $cpower spectrum and the matter power spectrum in the HDE scenario are discussed. Furthermore, we constrain the models of HDE with massive neutrinos and/or dark radiation by using the latest measurements of expansion history and growth of structure, including the Planck CMB temperature data, the baryon acoustic oscillation data, the JLA supernova data, the Hubble constant direct measurement, the cosmic shear...

  7. The Histoty of Ventilation and Air Conditioning is CERN Up to Date with the latest Technological Developments?

    E-Print Network [OSTI]

    Kühnl-Kinel, J

    2000-01-01

    The invention of ventilation cannot be ascribed to a certain date. It started with simple aeration when man brought fire into his abode and continued through different stages including air cooling using ice to finally arrive at the time when ventilation and air conditioning has become an essential part of our life and plays an important role in human evolution. This paper presents the history of ventilation and air conditioning, explains the key constraints over the centuries, and shows its influence on everyday life. Some examples of previous air-conditioning plants are described and different approaches to the way of calculation of ventilation systems discussed. It gives an overview of the Heating, Ventilation and Air Conditioning (HVAC) installations at CERN and points out their particularities. It also compares them with the latest technological developments in the field as well as showing the new trends that are being applied at CERN.

  8. Responses of East Asian Summer Monsoon to Natural and Anthropogenic Forcings in the 17 Latest CMIP5 Models

    SciTech Connect (OSTI)

    Song, Fengfei; Zhou, Tianjun; Qian, Yun

    2014-01-31

    In this study, we examined the responses of East Asian Summer Monsoon (EASM) to natural (solar variability and volcanic aerosols) and anthropogenic (greenhouse gasses and aerosols) forcings simulated in the 17 latest Coupled Model Intercomparison Program phase 5 (CMIP5) models with 105 realizations. The observed weakening trend of low-level EASM circulation during 1958-2001 is partly reproduced under all-forcing runs. A comparison of separate forcing experiments reveals that the aerosol-forcing plays a primary role in driving the weakened low-level monsoon circulation. The preferential cooling over continental East Asia caused by aerosol affects the monsoon circulation through reducing the land-sea thermal contrast and results in higher sea level pressure over northern China. In the upper-level, both natural-forcing and aerosol-forcing contribute to the observed southward shift of East Asian subtropical jet through changing the meridional temperature gradient.

  9. Single-Database Private Information Retrieval Protocols : Overview, Usability and Trends.

    E-Print Network [OSTI]

    Paris-Sud XI, Université de

    1 Single-Database Private Information Retrieval Protocols : Overview, Usability and Trends. Carlos and Ostrovsky in 1997 and up to the latest trends in single-database PIR research such as trusted hardware usage be : · an electronic library, and which books we are interested in may provide information about our politic

  10. User'sManual All information contained in these materials, including products and product specifications,

    E-Print Network [OSTI]

    Bezrukov, Sergei

    is issued. Such information, however, is subject to change without any prior notice. Before purchasing or using any Renesas Electronics products listed herein, please confirm the latest product information. Renesas Electronics does not assume any liability for infringement of patents, copyrights, or other

  11. CIE/USA-DFW Blog Welcome to CIE/USA-DFW Chapter Blog. We consistently update this blog with latest CIE news.

    E-Print Network [OSTI]

    Chiao, Jung-Chih

    CIE/USA-DFW Blog Welcome to CIE/USA-DFW Chapter Blog. We consistently update this blog with latest/USA-DFW Blog Blog at WordPress.com. Theme: INove by NeoEase. Page 3 of 4Dr. J.-C. Chiao received Lockheed

  12. Latest Data Show Strong Fertility Center Offers Region's Best IVF Success Rates! The Society for Assisted Reproductive Technology (SART), the primary organization of

    E-Print Network [OSTI]

    Goldman, Steven A.

    Latest Data Show Strong Fertility Center Offers Region's Best IVF Success Rates! The Society Fertility Center surpasses the national average for IVF in women under 35 years of age. Over 51% of embryo transfers in women under age 35 resulted in live births. In fact, Strong Fertility Center's IVF success

  13. HIV-AIDS Information Resources from the NLM - ACIO

    SciTech Connect (OSTI)

    Templin-Branner, W.

    2010-10-01

    As the treatment and management of HIV/AIDS continues to evolve with new scientific breakthroughs, treatment discoveries, and management challenges, it is difficult for people living with HIV/AIDS and those who care for them to keep up with the latest information on HIV/AIDS screening and testing, prevention, treatment, and research. The National Library of Medicine (NLM), of the National Institutes of Health, has a wealth of health information resources freely available on the Internet to address these needs.

  14. EETimes.com -New York bridge to get wireless monitor http://www.eetimes.com/news/latest/showArticle.jhtml?articleID=2015... 1 of 1 8/13/2007 3:03 PM

    E-Print Network [OSTI]

    Lu, Chenyang

    EETimes.com - New York bridge to get wireless monitor http://www.eetimes.com/news/latest/showArticle.jhtml?articleID=2015... 1 of 1 8/13/2007 3:03 PM EE Times: Latest News New York bridge to get wireless monitor R. Colin PORTLAND, Ore. -- Monitoring the structural integrity of New York state bridges could become a model

  15. Latest Documents and Notices

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRDEnergyTurbine blades beingLMlatest-documents-notices Office

  16. "Leveraging University Expertise to Inform Better Policy" Figure: 2050 Scenario from California Air Resources Board

    E-Print Network [OSTI]

    California at Davis, University of

    , and diversify our transportation energy supply. This policy forum draws from the latest research to explore some"Leveraging University Expertise to Inform Better Policy" Figure: 2050 Scenario from California Air dependency, California has adopted numerous vehicle and fuel policies that accelerate the introduction

  17. Cogeneration: Economic and technical analysis. (Latest citations from the INSPEC: Information Services for the Physics and Engineering Communities data base). Published Search

    SciTech Connect (OSTI)

    Not Available

    1992-08-01

    The bibliography contains citations concerning economic and technical analyses of cogeneration systems. Topics include electric power generation, industrial cogeneration, use by utilities, and fuel cell cogeneration. The citations explore steam power station, gas turbine and steam turbine technology, district heating, refuse derived fuels, environmental effects and regulations, bioenergy and solar energy conversion, waste heat and waste product recycling, and performance analysis. (Contains a minimum of 89 citations and includes a subject term index and title list.)

  18. Cogeneration: Economic and technical analysis. (Latest citations from the INSPEC: Information Services for the Physics and Engineering Communities database). Published Search

    SciTech Connect (OSTI)

    Not Available

    1993-07-01

    The bibliography contains citations concerning economic and technical analyses of cogeneration systems. Topics include electric power generation, industrial cogeneration, use by utilities, and fuel cell cogeneration. The citations explore steam power station, gas turbine and steam turbine technology, district heating, refuse derived fuels, environmental effects and regulations, bioenergy and solar energy conversion, waste heat and waste product recycling, and performance analysis. (Contains a minimum of 102 citations and includes a subject term index and title list.)

  19. Official war maps: latest indexed map of the world, Cuba, Santo Domingo, Puerto Rico, West Indies, China and Philippine Islands, also other information of national interest 

    E-Print Network [OSTI]

    1898-01-01

    . The experimental results indicate that injection rates play a very important role in affecting the recovery process, more so in the presence of fractures. At high injection rates, faster breakthrough of CO2 and higher oil bypass were observed than at low injection...

  20. Alarmist misrepresentations of the findings of the latest scientific assessment report of the intergovernmental Panel on climate change

    SciTech Connect (OSTI)

    Linden, Henry R.

    2007-08-15

    The alarmist propaganda following release of the Policymakers Summary of the Fourth Assessment Report of Working Group 1 of the IPCC this year is unjustified. We had this information since 2001, when the Third Assessment Report was released. However, this does not mean that we should ignore the potential consequences of increasing the impact of the current interglacial period. (author)

  1. Information friction : information technology and military performance

    E-Print Network [OSTI]

    Lindsay, Jon Randall

    2011-01-01

    Militaries have long been eager to adopt the latest technology (IT) in a quest to improve knowledge of and control over the battlefield. At the same time, uncertainty and confusion have remained prominent in actual experience ...

  2. Caribbean Equal Access Program: HIV/AIDS Information Resources from the National Library of Medicine

    SciTech Connect (OSTI)

    Nancy Dancy, NLM, and Wilma Templin-Branner, ORISE

    2009-01-01

    As the treatment and management of HIV/AIDS continues to evolve with new scientific breakthroughs, treatment discoveries, and management challenges, it is difficult for people living with HIV/AIDS and those who care for them to keep up with the latest information on HIV/AIDS prevention, treatment, and research. The National Library of Medicine, of the National Institutes of Health, has a wealth of health information resources freely available on the Internet to address these needs.

  3. Markets, herding and response to external information

    E-Print Network [OSTI]

    Carro, Adrián; Miguel, Maxi San

    2015-01-01

    We focus on the influence of external sources of information upon financial markets. In particular, we develop a stochastic agent-based market model characterized by a certain herding behavior as well as allowing traders to be influenced by an external dynamic signal of information. This signal can be interpreted as a time-varying advertising, public perception or rumor, in favor or against one of two possible trading behaviors, thus breaking the symmetry of the system and acting as a continuously varying exogenous shock. As an illustration, we use a well-known German Indicator of Economic Sentiment as information input and compare our results with Germany's leading stock market index, the DAX, in order to calibrate some of the model parameters. We study the conditions for the ensemble of agents to more accurately follow the information input signal. The response of the system to the external information is maximal for an intermediate range of values of a market parameter, suggesting the existence of three di...

  4. Information Cartography 1 Information Cartography

    E-Print Network [OSTI]

    Old, L. John

    Information Cartography 1 Information Cartography · The use of Geographic Information Systems (GIS) to visualize non- geographic data · Utilizes Geographic Information Science to develop models and organize information--not an art form · Used to build information maps. Information maps consist of a landscape (base

  5. EIA Energy Information Administration

    U.S. Energy Information Administration (EIA) Indexed Site

    MMBtu. Generally higher supply prices during this heating season are expected to affect residential customers before the winter has ended. According to EIA&20;s latest Short-Term...

  6. Information flow in the DAMA Project beyond database managers: Information flow managers

    SciTech Connect (OSTI)

    Russell, L.; Wolfson, O.; Yu, C.

    1996-03-01

    To meet the demands of commercial data traffic on the information highway, a new look at managing data is necessary. One projected activity, sharing of point-of-sale information, is being considered in the Demand Activated Manufacturing Project of the American Textile Partnership project. A scenario is examined in which 100,000 retail outlets communicate over a period of days. They provide the latest estimate of demand for sewn products across a chain of 26,000 suppliers through the use of bill-of-materials explosions at four levels of detail. A new paradign the information flow manager, is developed to handle this situation, including the case where members of the supply chain fail to communicate and go out of business. Techniques for approximation are introduced to keep estimates of demand as current as possible.

  7. Approved Module Information for LT2319, 2014/5 Module Title/Name: International Logistics and Purchasing Module Code: LT2319

    E-Print Network [OSTI]

    Neirotti, Juan Pablo

    Approved Module Information for LT2319, 2014/5 Module Title/Name: International Logistics-of-the-art strategic understanding of international logistics and purchasing with an emphasis on global competition. The topics include latest trends in globalization and international trade, major international logistics

  8. 3/5/2014 Micro-Windmill Technology: Future Uses Include Recharging Your Smartphone | Philippine Latest News http://philsense.com/2014/01/11/micro-windmill-technology-future-uses-include-recharging-your-smartphone/ 1/6

    E-Print Network [OSTI]

    Chiao, Jung-Chih

    3/5/2014 Micro-Windmill Technology: Future Uses Include Recharging Your Smartphone | Philippine Latest News http://philsense.com/2014/01/11/micro-windmill Micro-Windmill Technology: Future Uses Include Recharging Your Smartphone Your ads w ill be inserted

  9. NDTV.com -Latest News from India http://www.ndtv.com/addons/printpage.asp?id=69893&callid=1&capt... 1 of 1 3/13/05 5:26 AM

    E-Print Network [OSTI]

    ... 1 of 1 3/13/05 5:26 AM India seeks to join EU energy project Sunday, March 13, 2005 (Brussels energy equivalent to that of Sun. Negotiations have already begun for India's inclusion in the projectNDTV.com - Latest News from India http://www.ndtv.com/addons/printpage.asp?id=69893&callid=1&capt

  10. 1/27/2014 Microscopic Wind Turbines Offer Renewable Energyon the Go http://oilprice.com/Latest-Energy-News/World-News/Microscopic-Wind-Turbines-Offer-Renewable-Energy-on-the-Go.html 1/3

    E-Print Network [OSTI]

    Chiao, Jung-Chih

    -Energy-News/World-News/Microscopic-Wind-Turbines-Offer-Renewable-Energy-on-the-Go.html 1/3 Log In Sign Up Energy on the Go Microscopic Wind Turbines Offer Renewable Energy on the Go By Brian Westenhaus | Thu, 23;1/27/2014 Microscopic Wind Turbines Offer Renewable Energyon the Go http://oilprice.com/Latest-Energy-News/World-News

  11. Environment News Service for the latest environmental news, current issues, climate, water, food, forests, species, energy, education. RSS feed. | | | | |Home About News Index Services My Account Events | Search February 2, 2006

    E-Print Network [OSTI]

    Environment News Service for the latest environmental news, current issues, climate, water, food, forests, species, energy, education. RSS feed. | | | | |Home About News Index Services My Account Events Kingdom and the United States at the beginning of the year. The core topics for the G8 meeting are energy

  12. FINANCIAL INFORMATION 45 Information

    E-Print Network [OSTI]

    Xie,Jiang (Linda)

    for Tuition Purposes. Copies of the Manual are available for inspection in the Library and the Residency twelve (12) months immediately prior to classification as a resident for tuition purposes. In order meets their needs. Payment plan options and additional information can be found at http

  13. Computer Simulation of Atoms Nuclei Structure Using Information Coefficients of Proportionality

    E-Print Network [OSTI]

    Mikhail M. Labushev

    2012-06-20

    The latest research of the proportionality of atomic weights of chemical elements made it possible to obtain 3 x 3 matrices for the calculation of information coefficients of proportionality Ip that can be used for 3D modeling of the structure of atom nucleus. The results of computer simulation show high potential of nucleus structure research for the characterization of their chemical and physical properties.

  14. Computer Simulation of Atoms Nuclei Structure Using Information Coefficients of Proportionality

    E-Print Network [OSTI]

    Labushev, Mikhail M

    2012-01-01

    The latest research of the proportionality of atomic weights of chemical elements made it possible to obtain 3 x 3 matrices for the calculation of information coefficients of proportionality Ip that can be used for 3D modeling of the structure of atom nucleus. The results of computer simulation show high potential of nucleus structure research for the characterization of their chemical and physical properties.

  15. 4/5/2014 Using Windmills Smaller than a Grain of Rice to Charge Portable Devices http://oilprice.com/Latest-Energy-News/World-News/Using-Windmills-Smaller-than-a-Grain-of-Rice-to-Charge-Portable-Devices.html 1/2

    E-Print Network [OSTI]

    Chiao, Jung-Chih

    Energy Trends and Investment Opportunities before the mainstream media and investing public are aware of industry insiders who will let you in on the latest trends and investment opportunities in the energy space.com/Latest-Energy-News/World-News/Using-Windmills-Smaller-than

  16. information security

    E-Print Network [OSTI]

    Faculty listing for "information security" ... 1167; Phone: +1 765 49-46022; Email: wagstaff@purdue.edu; Research Interests: number theory, information security.

  17. Latest News | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    News Josh Allen of Richland Operations Office Named 2014 Facility Representative of the Year Congratulations to Josh Allen, Richland Operations Office, the winner of the 2014 DOE...

  18. Latest News Osteoporosis Clinical Trials

    E-Print Network [OSTI]

    Espinosa, Horacio D.

    in Project to Produce Solar Modules using Thin-Film Technology Home Directory Content Products Publications and as a nanomanufacturing tool to build the implantable drug delivery devices that will apply these treatments Competitive Technologies' Bone Nanoparticle Biomaterial Technology Issued Patent Abraxis BioScience to Present

  19. Latest News | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRDEnergyTurbine bladesJune 22, 2015 EA-1948:

  20. Latest ARPA-E News

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDid you notHeat PumpsTechnologies | Blandine Jerome

  1. LATEST_m_93.DOC

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACTThousand CubicResource and Job EventpopLA TexturePresentations atLASSO:3

  2. ISO 14000 information platform. Quarterly report, January 1--March 31, 1998

    SciTech Connect (OSTI)

    NONE

    1998-09-01

    GETE, through its ISO 14000 Information Platform, globeNet{trademark} (www.iso14000.net), seeks to provide FETC and the US Department of Energy (DOE) with a timely, accurate, and reliable information resource on the issue of environmental management standards. This resource allows FETC to keep track of the latest developments in the ISO 14000 arena, in DOE as well as throughout the federal complex and industry. Utilizing this information, FETC and DOE can make critical decisions on their own use and implementation of the ISO 14000 standards. The information platform also provides FETC with a forum to present information on its activities, such as the DOE ISO 14000 Pilot Projects, and as an information gathering and dissemination resource for its publications. GETE works with an array of national and international contacts and content sources to gather information and provide daily updates on ISO 14000 and related environmental management issues.

  3. 2/22/2014 Now `micro-windmills' to power your cellphone | Latest Tech News, Video & Photo Reviews at BGR India http://www.bgr.in/news/now-micro-windmills-to-power-your-cellphone/ 1/4

    E-Print Network [OSTI]

    Chiao, Jung-Chih

    2/22/2014 Now `micro-windmills' to power your cellphone | Latest Tech News, Video & Photo Reviews at BGR India http://www.bgr.in/news/now-micro-windmills-to-power-your-cellphone/ 1/4 Free MailZeeNews DNA-windmills' to power your cellphone By ANI on Jan 13, 2014 at 3:21 PM NEWS WE RECOMMEND by TaboolaSponsored Content

  4. General Information

    National Nuclear Security Administration (NNSA)

    Site Waste Profile Sheet - Revision 0 - February 27, 2012 (Log No. 2012-048) A. Generator Information 1. Company name: ...

  5. BPD Webinar: Analyze Building Energy Data, Understand Market Trends, Inform Decisions

    Broader source: Energy.gov [DOE]

    The Building Performance Database (BPD) includes over 850,000 building records—making it the largest database for energy-related information on existing residential and commercial buildings. Users can access anonymized data on hundreds and thousands of buildings and homes to explore and analyze energy use characteristics to inform important decisions on energy efficiency. On Tuesday, October 13, DOE hosted a webinar to highlight the latest updates to the BPD, including a demo of the new features that have been added to help users gain deeper insight on the data, and ways you can get involved.

  6. Information Technology: American National Standard for Information

    E-Print Network [OSTI]

    Information Technology: American National Standard for Information Systems-- Data Format 500-275 Information Technology: American National Standard for Information Systems-- Data Format Coleman, and Patrice Yuh, Editors Sponsored by Information Access Division Information Technology

  7. Information Technology: American National Standard for Information

    E-Print Network [OSTI]

    Information Technology: American National Standard for Information Systems-- Data Format-271 Information Technology: American National Standard for Information Systems-- Data Format for the Interchange Sponsored by Information Access Division Information Technology Laboratory National Institute of Standards

  8. Information Security Advisory Information Security, Computing and Information Services

    E-Print Network [OSTI]

    Qiu, Weigang

    Information Security Advisory Information Security, Computing and Information Services security's IT Security Procedures require that non-public University information, including social security numbers and professional information in a secure and appropriate manner. #12;

  9. Information Science

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Information Science and Technology (ASIS&T) American Society for Indexing (ASI) Digital Library Federation (DLF) National Archives and Records Administration (NARA) Special...

  10. A Model for Tuberculosis with Exogeneous Reinfection

    E-Print Network [OSTI]

    Feng, Z., et al.

    2000-05-16

    immunodeficiency virus, in ``Tuberculosis: A Comprehensive Inter- national Approach'' (L. B. Reichman and E. S. Hershfield, Eds.),. Lung Biology in Health and ...

  11. ELECTRICAL & INFORMATION

    E-Print Network [OSTI]

    Wagner, Stephan

    of energy and smarter management of the system. These are called Smart Grids. A number of research projects in the creation of three overarching research thrusts: Energy, Information and Systems. All the activities Engineering Research Group has a number of current research interests. INFORMATION ENERGY SYSTEMS #12

  12. Promote the use of electric and hybrid vehicles through information dissemination & data collection through the NESEA American Tour de Sol. Final project report

    SciTech Connect (OSTI)

    2000-09-12

    A report on information dissemination on alternative fueled vehicles and on efficiency data collected at the NESEA American Tour de Sol is presented. Some of the latest advanced transportation technology vehicles were showcased. Numerous attachments are included, such as the post-event newsletter, press kit, publicity report, results table, technical workshop proceedings, NESEA tour rules and resources, and a paper titled ''Quantifying the fuel use and greenhouse gas reduction potential of electric and hybrid vehicles.''

  13. Technical Information 

    E-Print Network [OSTI]

    Unknown

    2011-08-17

    Research shows that people have difficulty forgetting inferences they make after reading a passage, even when the information that the inferences are based on is later known to be untrue. This dissertation examined the effects of these inferences...

  14. Applicant Information

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Assistant Josefina Salazar Email Request more information Email The Los Alamos Space Weather Summer School program is open to U.S. and foreign graduate students enrolled in a PhD...

  15. Information Security

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2011-06-20

    The protection and control of classified information is critical to our nation’s security. This Order establishes requirements and responsibilities for Department of Energy (DOE) Departmental Elements, including the National Nuclear Security Administration (NNSA), to protect and control classified information as required by statutes, regulation, Executive Orders, government-wide policy directives and guidelines, and DOE policy and directives. Cancels DOE M 470.4-4A Chg except for Section D.

  16. Faculty Information Security Guide

    E-Print Network [OSTI]

    Faculty Information Security Guide Dartmouth Your information is vitally important to your teaching protect your information. THE DARTMOUTH INFORMATION SECURITY COMMITTEE The Dartmouth Information Security Committee (DISC) meets monthly to assess vulnerabilities of information security, and to develop and revise

  17. PROTECTING SENSITIVE INFORMATION TRANSMITTED

    E-Print Network [OSTI]

    INFORMATION TRANSMITTED IN PUBLIC NETWORKS Shirley Radack, EditorShirley Radack, Editor Computer Security DivisionComputer Security Division Information Technology LaboratoryInformation Technology Laboratory to the overall security of an organization's information and information systems. The Information Technology

  18. Information Security

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2011-06-20

    The protection and control of classified information is critical to our nation’s security. This Order establishes requirements and responsibilities for Department of Energy (DOE) Departmental Elements, including the National Nuclear Security Administration (NNSA), to protect and control classified information as required by statutes, regulation, Executive Orders, government-wide policy directives and guidelines, and DOE policy and directives. Cancels DOE M 470.4-4A Chg except for Section D. Admin Chg 1, dated 11-23-2012, cancels DOE O 471.6. Canceled by Admin Chg 2 dated 5-15-15.

  19. Information Sciences

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACT EVALUATION PLAN FOR THEVorticesInformation Resources3 Information

  20. Information Repository

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenry Bellamy,ImpactScientificInfluence of Topological Spin0 Information

  1. Information Security Advisory Information Security, Computing and Information Services

    E-Print Network [OSTI]

    Qiu, Weigang

    Information Security Advisory Information Security, Computing and Information Services security.cuny.edu Published: November 2014 Holiday Season Phishing Scams and Malware Campaigns CUNY/CIS Information Security.cuny.edu under "CUNY Issued Security Advisories" Visit the Federal Trade Commission's Consumer Information page

  2. Networks, Information andNetworks, Information and Information Worker ProductivityInformation Worker Productivity

    E-Print Network [OSTI]

    Reif, Rafael

    Yahoo! - July 28, 2006 © 2006 All Rights Reserved Information and Non-Information Work1 Networks, Information andNetworks, Information and Information Worker ProductivityInformationEmployment Source: Wolff (2005) Information Work Non - Information Work 70% of labor force; 60% of GDP of US (Apte

  3. Approximate Information Theory

    E-Print Network [OSTI]

    Penny, Will

    Approximate Inference Will Penny Information Theory Information Entropy Kullback-Liebler Divergence Approximate Inference Will Penny 31st March 2011 #12;Approximate Inference Will Penny Information Theory Will Penny Information Theory Information Entropy Kullback-Liebler Divergence Gaussians Asymmetry

  4. Mathematics Information

    E-Print Network [OSTI]

    Lyuu, Yuh-Dauh

    Discrete Mathematics Lecture Notes Yuh-Dauh Lyuu Dept. Computer Science & Information Engineering and Combination #15; n! = n #1; (n 1) #1; #1; #1; 1. #15; (Stirling's formula) n! #25; p 2#25;n (n=e) n and n of Approximation to n! 200 400 600 800 1.0002 1.0004 1.0006 1.0008 n! over approximation 7 #12; Proof of Stirling

  5. Information Security

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2011-06-29

    This Order establishes requirements and responsibilities for Department of Energy (DOE) Departmental Elements, including the National Nuclear Security Administration (NNSA), to protect and control classified information as required by statutes, regulation, Executive Orders, government-wide policy directives and guidelines, and DOE policy and directives. (The original DOE O 471.6 canceled DOE M 470.4-4A, except for Section D). Admin Chg 2, dated 5-15-15, supersedes Admin Chg 1. Certified 5-21-2015.

  6. General Information

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverse (Journal Article)ForthcomingGENERALProblemsGeneral Information General

  7. Personal Information Request Request for Personal Information

    E-Print Network [OSTI]

    deYoung, Brad

    Personal Information Request Request for Personal Information Request for Correction of Personal Information Personal information on this form is collected under Newfoundland and Labrador's Access to Information and Protection of Privacy (ATIPP) Act and will be used to respond to a request for, or correction

  8. Information Security

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2007-06-29

    Establishes security requirements for the protection and control of information and matter required to be classified or controlled by statutes, regulations, or Department of Energy directives. Section E, Technical Surveillance Countermeasures Program, is Official Use Only. Please contact the DOE Office of Health, Safety and Security at 301-903-0292 if your official duties require you to have access to this part of the directive. Cancels: DOE M 471.2-1B, DOE M 471.2-1C, DOE M 471.2-4, and DOE O 471.2A

  9. Information Security

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2005-08-26

    This Manual establishes security requirements for the protection and control of information and matter required to be classified or controlled by statutes, regulations, or Department of Energy directives. Attachment E, Technical Surveillance Countermeasures Program, is for Official Use Only. Contact the Office of Security and Safety Performance Assurance at 301-903-3653 if your official duties require you to have access to this part of the directive. Cancels: DOE M 471.2-1B, DOE M 471.2-1C, DOE M 471.2-4, and DOE O 471.2A.

  10. Computing Information

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room News PublicationsAuditsCluster Compatibilitydefault Changes TheComputeComputingInformation From

  11. Information Repository

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.Theory ofDid you notHeat Pumps Heat Pumpsfacility doe logoInIndustry @Information

  12. Hotel Information

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenry Bellamy, Ph.D.Food Drive HolidayHours UsedFire DepartmentLogistics

  13. Hotel Information

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenry Bellamy, Ph.D.Food Drive HolidayHours UsedFire

  14. Information Repository

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenry Bellamy,ImpactScientificInfluence of Topological Spin0

  15. Information Repository

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenry Bellamy,ImpactScientificInfluence of Topological Spin02

  16. Information Repository

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenry Bellamy,ImpactScientificInfluence of Topological Spin023

  17. Information Repository

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation CurrentHenry Bellamy,ImpactScientificInfluence of Topological Spin0234

  18. Local Information

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACTThousand CubicResourcelogo and-E CChinaC L S C OLocal Information Local

  19. Update Information

    U.S. Energy Information Administration (EIA) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home PageMonthly","10/2015"4,"Ames5 Tables July 1996 Energy Information Administration Office of Coal,Demand Module of theCubicEstimation Results for PAD Districts

  20. Information science is neither

    E-Print Network [OSTI]

    Furner, J

    2015-01-01

    of library and information sciences, 3rd ed. , edited byAmerican Society for Information Science and Technology 63,Annual Review of Information Science and Technology 41, no.

  1. Information Technology and Libraries

    E-Print Network [OSTI]

    Hubble, Ann; Murphy, Deborah A.; Perry, Susan Chesley

    2011-01-01

    Sue Chesley Perry 196 INFORMATION TECHNOLOGY AND LIBRARIES |LITA - Library & Information Technology Association). ”Two of the 190 INFORMATION TECHNOLOGY AND LIBRARIES |

  2. 16/05/12 3:57 PMWATER: Floating robots use GPS-enabled smartphones to track water flow, help water management Page 1 of 4http://www.lakeconews.com/index.php?option=com_content&view=article...o-track-water-flow-help-water-management&catid=1:latest&Itemid=1

    E-Print Network [OSTI]

    management Page 1 of 4http://www.lakeconews.com/index.php?option=com_content&view=article...o-track-water-flow-help-water=com_content&view=article...o-track-water-flow-help-water-management&catid=1:latest&Itemid=19716/05/12 3:57 PMWATER: Floating robots use GPS-enabled smartphones to track water flow, help water

  3. Zihan Xu xuz@seas.wustl.edu (A survey paper written under guidance of Prof. Raj Jain) Since the existing power grid is designed neither by latest technologies nor to comply with rapidly climate changes, a new intelligent power grid is

    E-Print Network [OSTI]

    Jain, Raj

    Abstract: Since the existing power grid is designed neither by latest technologies nor to comply with rapidly climate changes, a new intelligent power grid is urgently needed and will soon be applied to power and obstacles of its developments. Keywords: Smart Grid; Power Systems; Self-healing; Customers Participation

  4. National Environmental Information Infrastructure

    E-Print Network [OSTI]

    Greenslade, Diana

    National Environmental Information Infrastructure: Reference Architecture Contributing to the Australian Government National Plan for Environmental Information initiative #12;National Environmental Information Infrastructure: Reference Architecture v1.1 Environmental Information Programme Publication Series

  5. Variational Information Theory

    E-Print Network [OSTI]

    Penny, Will

    Variational Inference Will Penny Information Theory Information Entropy Kullback-Liebler Divergence Summary References Variational Inference Will Penny Bayesian Inference Course, WTCN, UCL, March 2013 #12;Variational Inference Will Penny Information Theory Information Entropy Kullback-Liebler Divergence Gaussians

  6. Press Room - Press Releases - U.S. Energy Information Administration...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    this feedback into the final release, the new tool represents EIA's latest step in making energy data more accessible, understandable, relevant, and responsive to users' needs. The...

  7. Press Room - Press Releases - U.S. Energy Information Administration...

    Annual Energy Outlook [U.S. Energy Information Administration (EIA)]

    that feedback into the final release, the new tool represents EIA's latest step in making energy data more accessible, understandable, relevant, and responsive to users' needs. The...

  8. An Information Calculus for Information Retrieval

    E-Print Network [OSTI]

    Jose, Joemon M.

    An Information Calculus for Information Retrieval C.J. van Rijsbergen Computing Science Department not whistle it in mathematics either' Introduction In the beginning there was information, later there was probability, and very much later there was logic. Information is and always has been an elusive concept

  9. Information Governance Freedom of Information Request Form

    E-Print Network [OSTI]

    Romano, Daniela

    Information Governance Freedom of Information Request Form foi@salford.ac.uk http://www.infogov.salford.ac.uk Details of the applicant Name: Address: Post code: Tel. No.: Email: Description of information requested Please provide a description of the information you would like to receive, please be as specific

  10. PUBLIC INFORMATION ANNEX I -PUBLIC INFORMATION

    E-Print Network [OSTI]

    ANNEX I PUBLIC INFORMATION #12;ANNEX I - PUBLIC INFORMATION 11/12/2013 v. 2.0 Page I-1 PROMULGATION STATEMENT Annex I: Public Information, and contents within, is a guide to how the University maintains public information during an incident. The Annex is written in support of the Texas A&M University (TAMU

  11. March 23, 2008 Databases: Information Systems 1 Information Systems

    E-Print Network [OSTI]

    Adam, Salah

    March 23, 2008 Databases: Information Systems 1 Information Systems #12;March 23, 2008 Databases: Information Systems 2 Objectives What is an Information System (IS) + Classification of Information Systems + Evolution of Information Systems + Information System Management + Performance Requirements of ISs + #12

  12. Latest research findings from petite sismique trials

    SciTech Connect (OSTI)

    Belesky, R.M.; Bieniawski, Z.T.; Greenfield, R.J.

    1984-01-01

    Research on a novel in-situ technique known as petite sismique is discussed. This geophysical method is capable of estimating the static deformation modules of a rock mass. The petite-sismique technique utilizes a seismic-refraction survey stressing a correlation between shear-wave frequency and the static deformation modulus. Although the technique was introduced in 1967, petite sismique has not been used extensively due to difficulties in shear-wave generation and detection. Recent developments in geophysical instrumentation provided an opportunity to evaluate better the technique in this study. With the objective of assessing the deformation modulus, field trials were conducted in coal and limestone mines. Despite attempts to develop a reliable shear-wave source, difficulties in frequency determinations persisted due to source characteristics and receiver resonance. A limited number of shear-wave-frequency observations did not confirm the originally documented relationship between shear-wave frequency and the static deformation modulus. The indicated discrepancy is attributed to differences in characteristics of the sources used in the two studies. Arising out of this research are equipment modifications and procedural recommendations which should improve the chances for success in future studies.

  13. Light at Night - The Latest Science

    SciTech Connect (OSTI)

    Tuenge, Jason R.

    2010-10-04

    Discussions about possible health implications of exposure to light at night run the gamut, but given the available research, should any changes be made to currently recommended lighting practices? A panel of leading experts was assembled to explore what today's science can tell us about light at night. While it remains unproven that typical exposures to outdoor lighting have negative health impacts, this cannot be ruled out without more data and a standard metric for quantifying the relevant light exposures. LED technology holds tremendous potential for energy savings, but it is not yet clear whether its spectral characteristics will offer advantages over other light sources in terms of vision and circadian entrainment.

  14. Latest Results from BNL and RHIC--2013

    E-Print Network [OSTI]

    Tannenbaum, M J

    2014-01-01

    A selection of results from the Relativistic Heavy Ion Collider (RHIC) at Brookhaven National Laboratory (BNL) from 2012 to 2013 is presented together with a few newsworthy developments in this period. The move of the g-2 magnet from BNL to Fermilab for the "fifth muon g-2 experiment" inspired a brief discussion of the original g-2 experiments at CERN. Highlights of the past year include a change in the measurement of the suppression of large transverse momentum ($p_T$) particles in the Quark Gluon Plasma to a measure of the fractional shift in the observed $p_T$ spectrum from the expected A+A spectrum for independent collisions as an estimate of the energy loss in the medium. The p+Pb run at LHC in early 2013 spurred new or improved measurements in d+Au at RHIC which included the observation of elliptical flow in d+Au collisions and measurements of transverse energy ($E_T$) spectra in p-p, d+Au and Au+Au collisions at 200 GeV nucleon-nucleon c.m. energy which demonstrated that constituent quarks are the fund...

  15. Latest Results from BNL and RHIC--2013

    E-Print Network [OSTI]

    M. J. Tannenbaum

    2014-04-22

    A selection of results from the Relativistic Heavy Ion Collider (RHIC) at Brookhaven National Laboratory (BNL) from 2012 to 2013 is presented together with a few newsworthy developments in this period. The move of the g-2 magnet from BNL to Fermilab for the "fifth muon g-2 experiment" inspired a brief discussion of the original g-2 experiments at CERN. Highlights of the past year include a change in the measurement of the suppression of large transverse momentum ($p_T$) particles in the Quark Gluon Plasma to a measure of the fractional shift in the observed $p_T$ spectrum from the expected A+A spectrum for independent collisions as an estimate of the energy loss in the medium. The p+Pb run at LHC in early 2013 spurred new or improved measurements in d+Au at RHIC which included the observation of elliptical flow in d+Au collisions and measurements of transverse energy ($E_T$) spectra in p-p, d+Au and Au+Au collisions at 200 GeV nucleon-nucleon c.m. energy which demonstrated that constituent quarks are the fundamental element of particle production in all 3 systems. Measurements of identified hadrons in d+Au show a huge Cronin effect for protons but no effect for mesons. An important step for the future was the acquisition by BNL of the superconducting solenoid used in the BABAR experiment at SLAC for use in future experiments at RHIC and possibly eRHIC, starting with an upgrade of the PHENIX experiment called sPHENIX.

  16. ARQ07-1.latest.indd

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    such as mass spectroscopy are also used on elemental plutonium and uranium and trace elements. At Los Alamos, some 100 men and women work with plutonium routinely in the only...

  17. AER & FAME Review... Jan'14 The latest...

    E-Print Network [OSTI]

    Chittka, Lars

    systems, such as the chalk stream River Cray for an assessed practical (above) and helping out a former QM will be on offer from October 2014. Students designing their sampling strategy for the delightful River Cray above

  18. ARQ07-1.latest.indd

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 OutreachProductswsicloudwsicloudden Documentation DataStreamsTotal OzoneStudy ofPlutonium Manufacturing andNRC

  19. Latest Documents and Notices | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRDEnergyTurbine blades beingLMlatest-documents-notices

  20. Latest Documents and Notices | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRDEnergyTurbine blades beingLMlatest-documents-noticesSeptember

  1. Latest Documents and Notices | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRDEnergyTurbine blades

  2. Latest Documents and Notices | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRDEnergyTurbine bladesJune 22, 2015 EA-1948: Revised Finding of

  3. Latest Documents and Notices | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRDEnergyTurbine bladesJune 22, 2015 EA-1948: Revised Finding

  4. Latest Documents and Notices | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRDEnergyTurbine bladesJune 22, 2015 EA-1948: Revised

  5. Latest Documents and Notices | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRDEnergyTurbine bladesJune 22, 2015 EA-1948: RevisedOctober 28,

  6. Latest Documents and Notices | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergy A plug-inPPLforLDRDEnergyTurbine bladesJune 22, 2015 EA-1948: RevisedOctober

  7. Latest Documents and Notices | Department of Energy

    Broader source: Energy.gov (indexed) [DOE]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of Natural GasAdjustmentsShirleyEnergyTher i nAand DOE Safety StandardsLabor Relations<i>A Porsche 911

  8. Latest Documents and Notices | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICE INDUSTRIALU.S.Leadership on Clean Energy |Department ofLast-OutRecoveryMay

  9. Latest Documents and Notices | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICE INDUSTRIALU.S.Leadership on Clean Energy |Department

  10. Latest Documents and Notices | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICE INDUSTRIALU.S.Leadership on Clean Energy |DepartmentFebruary 12, 2015

  11. Latest Documents and Notices | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious RankADVANCED MANUFACTURING OFFICE INDUSTRIALU.S.Leadership on Clean Energy |DepartmentFebruary 12, 2015June

  12. Latest Documents and Notices | Department of Energy

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantityBonneville Power Administration would likeUniverseIMPACTThousand CubicResourcelogo and- Energy

  13. Alternative Fuels Data Center: Latest Additions

    Alternative Fuels and Advanced Vehicles Data Center [Office of Energy Efficiency and Renewable Energy (EERE)]

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on Delicious Rank EERE: Alternative Fuels Data Center Home Page on Digg FindPortsasIdle Reduction

  14. Introduction to Information Theory

    E-Print Network [OSTI]

    Belohlavek, Radim

    Introduction to Information Theory and Its Applications Radim Belohl´avek Dept. Computer Science providing introduction to Information Theory. Radim Belohl´avek, Introduction to Information Theory and Its Applications 1 #12;Information Theory: What and Why · information: one of key terms in our society

  15. From Signal Information Processing

    E-Print Network [OSTI]

    From Signal to Information Processing Don H. Johnson Computer and Information Technology Institute of signals o Here, all signals are assumed to be stochastic information source information encoder Information extraction systems--determining a from X(a)--fall into two categories h Classification: Which

  16. Information Security for Libraries (1) INFORMATION SECURITY FOR LIBRARIES

    E-Print Network [OSTI]

    Newby, Gregory B.

    Information Security for Libraries (1) INFORMATION SECURITY FOR LIBRARIES Gregory B. Newby School an active role in information security. INTRODUCTION By most accounts, the proliferation of the Internet of information security, making concrete recommendations for safeguarding information and information access

  17. SELECTING INFORMATION TECHNOLOGY SECURITY

    E-Print Network [OSTI]

    April 2004 SELECTING INFORMATION TECHNOLOGY SECURITY PRODUCTS Shirley Radack, Editor Computer Security Division Information Technology Laboratory National Institute of Standards and Technology Information technology security prod ucts are essential to better secure infor mation technology (IT) systems

  18. Emergency Information Desk Reference

    E-Print Network [OSTI]

    Gopalakrishnan, K.

    Emergency Information Desk Reference ECU Police Department ECU Environmental Health & Safety Revised Feb 2012 #12;Emergency Information Desk Reference 2 INTRODUCTION Emergencies, accidents, and injuries can occur at any time and without warning. ECU has designed this emergency information desk

  19. Energy information sheets

    SciTech Connect (OSTI)

    1995-07-01

    The National Energy Information Center (NEIC), as part of its mission, provides energy information and referral assistance to Federal, State, and local governments, the academic community, business and industrial organizations, and the public. The Energy Information Sheets was developed to provide general information on various aspects of fuel production, prices, consumption, and capability. Additional information on related subject matter can be found in other Energy Information Administration (EIA) publications as referenced at the end of each sheet.

  20. Information Center (Brochure)

    SciTech Connect (OSTI)

    Not Available

    2010-10-01

    This letter-fold brochure provides an overview of the tools, information, and partnership opportunities that the Office of Energy Efficiency and Renewable Energy Information Center offers.

  1. Tools for Public Information

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Tools for Public Information Tools for Public Information A list of resources for the public, including Intellus, an online tool that provides transparency and accessibility to the...

  2. Chief Information Officer

    Broader source: Energy.gov [DOE]

    The Federal Energy Regulatory Commission is looking for an experienced senior level executive to serve as the Chief Information Officer (CIO). The Chief Information Officer (CIO) reports directly...

  3. Information science is neither

    E-Print Network [OSTI]

    Furner, J

    2015-01-01

    Information science is neither Jonathan Furner University ofIt would appear that we neither use nor need the conceptabout information, neither is data science primarily about

  4. Information Foraging Peter Pirolli

    E-Print Network [OSTI]

    Information Foraging Peter Pirolli and Stuart K. Card UIR Technical Report Funded in part of Naval Research, under contract N00014-96-C-0097. #12;Information Foraging 2 ABSTRACT Information Foraging Theory is an approach to understanding how strategies and technologies for information seeking

  5. INFORMATIONQUALITYEVALUATIONFORGRID INFORMATION SERVICES

    E-Print Network [OSTI]

    Pallis, George

    INFORMATIONQUALITYEVALUATIONFORGRID INFORMATION SERVICES Wei Xing, Oscar Corcho, Carole Goble@cs.ucy.ac.cy Abstract The quality of the information provided by information services deployed in the EGEE production query by different information services can be different. Developers of these services and of other

  6. Information Protection of

    E-Print Network [OSTI]

    Thompson, Michael

    information #12;3 Key FIPPA Principles · ACCESS · Right of access to university records · For the most part and disposal of personal information by institution in its activities · Right to access and request correction of own personal information · Right to complain to Information and Privacy Commissioner when privacy

  7. Information Science Tefko Saracevic

    E-Print Network [OSTI]

    Saracevic, Tefko

    Information Science Tefko Saracevic School of Communication, Information and Library Studies@scils.rutgers.edu This essay is a personal analysis of information science as a field of scientific inquiry and professional science in re- spect to the problems of information explosion; the so- cial role of the field; the nature

  8. Aquaculture information package

    SciTech Connect (OSTI)

    Boyd, T.; Rafferty, K.

    1998-08-01

    This package of information is intended to provide background information to developers of geothermal aquaculture projects. The material is divided into eight sections and includes information on market and price information for typical species, aquaculture water quality issues, typical species culture information, pond heat loss calculations, an aquaculture glossary, regional and university aquaculture offices and state aquaculture permit requirements. A bibliography containing 68 references is also included.

  9. The Flow of Information in Information Retrieval: its modelling

    E-Print Network [OSTI]

    Lalmas, Mounia

    The Flow of Information in Information Retrieval: its modelling Mounia Lalmas Department of Computing Science University of Glasgow Situation Theory for Information Retrieval Information is and intuitively acceptable definition of information; until now, none of these have succeeded. Authors

  10. Section 4 -Financial Information A. General Information

    E-Print Network [OSTI]

    Pantaleone, Jim

    Section 4 - Financial Information A. General Information 1. All University Housing and Dining fees of Alaska campuses until the debt is paid in full. B. Security deposit 1. A security deposit is required performance of the agreement, and (2) for damages beyond normal wear and tear. The security deposit does

  11. A. General Information A1 Address Information

    E-Print Network [OSTI]

    Maxwell, Bruce D.

    .montana.edu/wwwcat/appopts.html A2 Source of institutional control (Check only one): A2 Public X A3 Classify your undergraduate of students for each of the following categories as of the institution's official fall reporting dateA. General Information A1 Address Information A1 Name of College/University: Montana State

  12. A. GENERAL INFORMATION A1. Address Information

    E-Print Network [OSTI]

    Kunkle, Tom

    @cofc.edu Is there a separate URL application site on the Internet? If so, pleasespecify: A2. Source of institutional control categories as of the institution's official fall reporting date or as of October 15, 2002. FULL-TIME PARTA. GENERAL INFORMATION A1. Address Information Name of College or University College of Charleston

  13. Energy information sheets

    SciTech Connect (OSTI)

    Not Available

    1993-12-02

    The National Energy Information Center (NEIC), as part of its mission, provides energy information and referral assistance to Federal, State, and local governments, the academic community, business and industrial organizations, and the general public. Written for the general public, the EIA publication Energy Information Sheets was developed to provide information on various aspects of fuel production, prices, consumption and capability. The information contained herein pertains to energy data as of December 1991. Additional information on related subject matter can be found in other EIA publications as referenced at the end of each sheet.

  14. Swansea University, Information Services & Systems

    E-Print Network [OSTI]

    Martin, Ralph R.

    Swansea University, Information Services & Systems Information and Digital Literacy Strategy and interpreting information in their subject areas. Our students need the skills to manage an information University need information and digital literacy skills so that they can maximise their opportunities

  15. Office of Information Management

    Broader source: Energy.gov [DOE]

    The Office of Information Management provides a broad range of information technology services in support of the Associate Under Secretary for the Office of Environment, Health, Safety and Security (AU).

  16. Computerized Energy Information Sources 

    E-Print Network [OSTI]

    Gordon, D.

    1979-01-01

    , the Freelance Research Service in Houston, and the Industrial Information Service at SMU in Dallas. Regardless of who is obtaining your materials for you, they will need the mos~ complete bibliographic information that you can give them. This will assure...

  17. Location linked information

    E-Print Network [OSTI]

    Mankins, Matthew William David, 1975-

    2003-01-01

    This work builds an infrastructure called Location Linked Information that offers a means to associate digital information with public, physical places. This connection creates a hybrid virtual/physical space, called glean ...

  18. Confidential Business Information

    Energy Savers [EERE]

    Confidential Business Information Pursuant to 10 CFR 1004.11, any person submitting information that he or she believes to be confidential and exempt by law from public disclosure...

  19. Information Technology Management

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2008-12-23

    The Order identifies the objectives, components, and responsibilities for implementing processes to ensure the effective management of information and information systems within the Department. Supersedes DOE O 200.1.

  20. Gaussian quantum information

    E-Print Network [OSTI]

    Weedbrook, Christian

    The science of quantum information has arisen over the last two decades centered on the manipulation of individual quanta of information, known as quantum bits or qubits. Quantum computers, quantum cryptography, and quantum ...

  1. Coding with side information 

    E-Print Network [OSTI]

    Cheng, Szeming

    2005-11-01

    Source coding and channel coding are two important problems in communications. Although side information exists in everyday scenario, the e?ect of side information is not taken into account in the conventional setups. ...

  2. casualty actuarial information

    E-Print Network [OSTI]

    D. Hoppe

    weather; political. Regulated and Legislated. new laws; Department of Insurance requirements. Casualty Actuarial Information. Opportunities at Allstate. 15.

  3. Definiteness as Maximal Informativeness

    E-Print Network [OSTI]

    von Fintel, Kai

    2014-01-01

    We argue that definites are interpreted as denoting the maximally informative object that falls under the relevant predicate.

  4. Secure Core Contact Information

    E-Print Network [OSTI]

    Secure Core Contact Information C. E. Irvine irvine@nps.edu 831-656-2461 Department of Computer for the secure management of local and/or remote information in multiple contexts. The SecureCore project Science Graduate School of Operations and Information Sciences www.cisr.nps.edu Project Description

  5. Information Security Guide

    E-Print Network [OSTI]

    Information Security Guide For Government Executives Pauline Bowen Elizabeth Chew Joan Hash #12; Table of Contents Introduction 1 Why do I need to invest in information security? 2 Where do I need to focus my attention in accomplishing critical information security goals? 4 What are the key activities

  6. Information Security Program

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1997-03-27

    Establishes an Information Security Program for the protection and control of classified and sensitive information. Extended until 5-11-06 by DOE N 251.63, dated 5-11-05. DOE O 471.2A, Information Security Program, dated 3/27/1997, extended by DOE N 251.57, dated 4/28/2004. Cancels: DOE O 471.2

  7. Curriculum Vitae Contact Information

    E-Print Network [OSTI]

    Dennison, Philip

    Information Systems and Remote Sensing B.S. Zhengzhou University, China, 2006 Geographic Information Systems Academic Study, Peking University Research and Teaching Interests Geographical information science; spatial Bounding Based Solution Approach for the Continuous Arc Covering Problem", Journal of Geographical Systems

  8. Identifying Classified Information

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2014-10-03

    To establish the program to identify information classified under the Atomic Energy Act [Restricted Data (RD), Formerly Restricted Data (FRD), and Transclassified Foreign Nuclear Information (TFNI)] or Executive Order (E.O.) 13526 [National Security Information (NSI)], so that it can be protected against unauthorized dissemination. Supersedes DOE O 475.2A.

  9. Identifying Classified Information

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2014-06-03

    The Order establishes the program to identify information classified under the Atomic Energy Act [Restricted Data (RD), Formerly Restricted Data (FRD), and Transclassified Foreign Nuclear Information (TFNI)]or Executive Order (E.O.) 13526 [National Security Information (NSI)], so that it can be protected against unauthorized dissemination.

  10. Identifying Classified Information

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2011-02-01

    The Order establishes the program to identify information classified under the Atomic Energy Act [Restricted Data (RD), Formerly Restricted Data (FRD), and Transclassified Foreign Nuclear Information (TFNI)] or Executive Order (E.O.) 13526 [National Security Information (NSI)], so that it can be protected against unauthorized dissemination. Cancels DOE O 475.2 and DOE M 475.1-1B.

  11. Security classification of information

    SciTech Connect (OSTI)

    Quist, A.S.

    1993-04-01

    This document is the second of a planned four-volume work that comprehensively discusses the security classification of information. The main focus of Volume 2 is on the principles for classification of information. Included herein are descriptions of the two major types of information that governments classify for national security reasons (subjective and objective information), guidance to use when determining whether information under consideration for classification is controlled by the government (a necessary requirement for classification to be effective), information disclosure risks and benefits (the benefits and costs of classification), standards to use when balancing information disclosure risks and benefits, guidance for assigning classification levels (Top Secret, Secret, or Confidential) to classified information, guidance for determining how long information should be classified (classification duration), classification of associations of information, classification of compilations of information, and principles for declassifying and downgrading information. Rules or principles of certain areas of our legal system (e.g., trade secret law) are sometimes mentioned to .provide added support to some of those classification principles.

  12. TRAINING FOR INFORMATION

    E-Print Network [OSTI]

    June 1998 TRAINING FOR INFORMATION TECHNOLOGY SECURITY: EVALUATING THE EFFECTIVENESS OF RESULTS-BASED LEARNING The basic principles of results-based training for information technology (IT) security were discussed in our April 1998 bulletin, Training Require- ments for Information Technology Security

  13. Presented by Information Fusion

    E-Print Network [OSTI]

    Presented by Information Fusion: Science and Engineering of Combining Information from Multiple's Office of Science #12;2 Managed by UT-Battelle for the U.S. Department of Energy Rao_InfoFusion_SC10 Information Fusion at ORNL · ORNL Instrumental in formulating and fostering this multi-disciplinary area

  14. INFORMATION IIT SCHOOL OF

    E-Print Network [OSTI]

    Heller, Barbara

    INFORMATION TECHNOLOGY AND MANAGEMENT IIT SCHOOL OF APPLIED TECHNOLOGY CYBER SECURITY an undergraduate degree in Information Technology and Management (ITM) from Illinois Tech's School of Applied. · You'll learn relevant skills so you can integrate information technology and management into your

  15. INFORMATION FOR RENEWABLE ENERGY

    E-Print Network [OSTI]

    ENHANCING INFORMATION FOR RENEWABLE ENERGY TECHNOLOGY DEPLOYMENT IN BRAZIL, CHINA, AND SOUTH AFRICA UNITEDNATIONSENERGYPROGRAMME #12;#12;Enhancing Information for Renewable Energy Technology Deployment in Brazil, China Piratini, All other photos: ERI, INPE, CRSES #12;Enhancing Information for Renewable Energy Technology

  16. Information Security Program

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1992-10-19

    To establish the Department of Energy (DOE) Information Security Program and set forth policies, procedures and responsibilities for the protection and control of classified and sensitive information. The Information Security Program is a system of elements which serve to deter collection activities, This directive does not cancel another directive. Canceled by DOE O 471.2 of 9-28-1995.

  17. Energy information directory 1995

    SciTech Connect (OSTI)

    1995-10-01

    The National Energy Information Center provides energy information and referral assistance to Federal, State, and local governments, the academic community, business and industrial organizations, and the general public. This Energy Information Directory is used to assist the Center staff as well as other DOE staff in directing inquires to the proper offices.

  18. Information About Me Information About My Position

    E-Print Network [OSTI]

    Hamburger, Peter

    home telephone and address will be printed in the Student/Staff Telephone Directory unless you direct: ____________________________________________ Date: ______/_____/_____ HRS ­form 13FW (Revised September 2008) Employee Information Form (please

  19. When you think of the film industry, what comes to mind? Entertainment. In this issue you will discover how films not only bring us the latest adventures but also are being sculptured at

    E-Print Network [OSTI]

    Demirel, Melik C.

    rooftop market. Solyndra uses a copper-indium-gallium-diselenide (CIGS) absorber layer in its solar cell to create revolutionary optics, semiconductors, medical devices, and solar cells. Spring 2009 In This Issue information, visit: www.jbg3.net Alumni Spotlight Phil Kraus (B.S. '93) is the director of technology at solar-cell

  20. MyUNLV Student Information System Update Your Biographic Information

    E-Print Network [OSTI]

    Walker, Lawrence R.

    MyUNLV Student Information System Update Your Biographic Information My of biographical information in your MyUNLV Student Center including certain addresses, phone. Step 1. Locate the Personal Information section of your Student Center

  1. UMass Office of Information Technologies Office of Information Technologies

    E-Print Network [OSTI]

    Mountziaris, T. J.

    UMass Office of Information Technologies Office of Information Technologies A218 Lederle GRC University of Massachusetts Amherst http://www.oit.umass.edu/ The Instructor's Guide to Information Security 1. Student Information at UMass Amherst What is FERPA anyway

  2. School of Information Studies Information Science & Technology (IST) Major

    E-Print Network [OSTI]

    Saldin, Dilano

    School of Information Studies Information Science & Technology (IST, and dissemination of information. With a wide breadth of technological knowledge about) Major We are all living in an information-oriented digital society in which

  3. Math Information Session -Introduction Mathematical Sciences Information Session

    E-Print Network [OSTI]

    Fukshansky, Lenny

    Math Information Session - Introduction Mathematical Sciences Information Session Department of Mathematical Sciences Claremont McKenna College August 30, 2013 #12;Math Information Session - Introduction Welcome to CMC Mathematical Sciences! #12;Math Information Session - Introduction Welcome to CMC

  4. Required Information Release Stephen Chong

    E-Print Network [OSTI]

    Chong, Stephen

    Required Information Release Stephen Chong School of Engineering and Applied Sciences Harvard re- quirement to release information. Such requirements are an important part of a system's information security requirements. Current information-flow control techniques are able to reason about

  5. Office of Information Technology Accomplishments

    E-Print Network [OSTI]

    Yorke, James

    Office of Information Technology Accomplishments Fiscal Year 2007 #12;Office of Information'scentralinformationtechnologyserviceorganization,itismypleasuretosharewithyou theOfficeofInformationTechnology'spublication,"OITAccomplishmentsFiscalYear2007,"whichfeatures's goal is to take a quantum leap forward in the information technology environmentavailabletostudents

  6. Brazilian Dairy Model: Impacts of Agricultural Policies and Exogenous Shocks 

    E-Print Network [OSTI]

    Rodrigues Carvalho, Glauco

    2015-04-28

    structural econometric model of the Brazilian dairy sector is used to analyze the consequences of changes in policies and other variables of interest on the production, consumption, and milk prices. A stochastic approach is also developed that incorporates...

  7. IP3 signalling regulates exogenous RNAi in Caenorhabditis elegans

    E-Print Network [OSTI]

    Nagy, Anikó I.; Vázquez-Manrique, Rafael P.; Lopez, Marie; Christov, Christo; Sequedo, María Dolores; Herzog, Mareike; Herlihy, Anna E; Bodak, Maxime; Gatsi, Roxani; Baylis, Howard A.

    2015-01-21

    -proteins acting downstream of GPCRs [34]. Thus signalling through a GPCR may be important to the alterations in RNAi sensitivity. Increased IP3 signalling causes RNAi resistance. To ascertain whether IP3 signalling is capable of modulating the RNAi... : cgcgttcaccactcgaccaccgaac and tttttatgggttttggtaggttttag) [7], a 1.19 kb promoter region of unc-47 (terminal sequences: gatcccggaacagtcg and ctgtaatgaaataaatgt) were amplified from genomic DNA and cloned upstream of the itr-1 cDNA using restriction enzyme splicing...

  8. Information Science, Computing, Applied Math

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Information Science, Computing, Applied Math science-innovationassetsimagesicon-science.jpg Information Science, Computing, Applied Math National security depends on science...

  9. Thermochronometry | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) |InformationThe2009) |Information Raft River

  10. Thermosolar | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) |InformationThe2009) |Information Raft

  11. Identifying Classified Information

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2001-02-26

    This Manual provides requirements for managing the Department of Energy (DOE) classification and declassification program, including details for classifying and declassifying information, documents, and material. This Manual also supplements DOE O 200.1, INFORMATION MANAGEMENT PROGRAM, which combines broad information management topics under a single Order. Specific requirements for each topic are issued in separate Manuals. Cancels DOE M 475.1-1. Canceled by DOE M 475.1-1B

  12. Temperature | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) | Open Energy InformationEnergy Information

  13. Information Nominee's Name

    E-Print Network [OSTI]

    Information Nominee's Name G# _____________________ Department Supervisor's Signature Department Head's Signature Has this employee received any monetary or non-monetary awards this fiscal year? Yes

  14. EIA Energy Information Administration

    U.S. Energy Information Administration (EIA) Indexed Site

    a new brochure with information on and the outlook for residential natural gas prices. An electronic version is located at: http:www.eia.doe.govoilgasnaturalgas...

  15. Information Meeting- Education

    ScienceCinema (OSTI)

    None

    2011-04-25

    Suite ŕ un circulaire, Messieurs Goldschmidt et Ullmann donnent plus d'information et attendent des questions/réponses concernant les problčmes d'éducation d'enfants

  16. Biofuels Information Center

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    biofuels production facilities and infrastructure by providing essential biofuels data, tools, and information to all stakeholders * The Bioenergy Atlas tools provide interactive...

  17. Supervisory Information Technology Specialist

    Broader source: Energy.gov [DOE]

    A successful candidate in this position will be responsible for providing Information Technology (IT) infrastructure, capabilities and technical support to the Department of Energy (DOE),...

  18. Personally Identifiable Information

    Broader source: Energy.gov [DOE]

    Websites and applications that collect data on individuals are gathering personally identifiable information (PII). PII is also often collected for customer surveys or user experience (UX) research.

  19. CAES Contact Information

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    View all events >> x CAES Home Home About Us Contact Information Our CAES Building FAQs Affiliated Centers Research Core Capabilities Laboratories and Equipment Technology Transfer...

  20. WVCP | Open Energy Information

    Open Energy Info (EERE)

    Information About Partnership with NREL Partnership with NREL Yes Partnership Type Test & Evaluation Partner Partnering Center within NREL Electricity Resources & Building...

  1. Unclassified Controlled Nuclear Information

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1995-09-25

    To prevent unauthorized dissemination of Unclassified Controlled Nuclear Information (UCNI). Cancels DOE 5635.4 and DOE 5650.3A

  2. Emergency Public Information

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1997-08-21

    This volume defines elements of providing information to the public during and following emergencies. Canceled by DOE G 151.1-4.

  3. Value of Information spreadsheet

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Trainor-Guitton, Whitney

    This spreadsheet represents the information posteriors derived from synthetic data of magnetotellurics (MT). These were used to calculate value of information of MT for geothermal exploration. Information posteriors describe how well MT was able to locate the "throat" of clay caps, which are indicative of hidden geothermal resources. This data is full explained in the peer-reviewed publication: Trainor-Guitton, W., Hoversten, G. M., Ramirez, A., Roberts, J., Júlíusson, E., Key, K., Mellors, R. (Sept-Oct. 2014) The value of spatial information for determining well placement: a geothermal example, Geophysics.

  4. Value of Information spreadsheet

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Trainor-Guitton, Whitney

    2014-05-12

    This spreadsheet represents the information posteriors derived from synthetic data of magnetotellurics (MT). These were used to calculate value of information of MT for geothermal exploration. Information posteriors describe how well MT was able to locate the "throat" of clay caps, which are indicative of hidden geothermal resources. This data is full explained in the peer-reviewed publication: Trainor-Guitton, W., Hoversten, G. M., Ramirez, A., Roberts, J., Júlíusson, E., Key, K., Mellors, R. (Sept-Oct. 2014) The value of spatial information for determining well placement: a geothermal example, Geophysics.

  5. Final Exam Information

    E-Print Network [OSTI]

    OwenDavis

    2014-11-28

    MA 22400 FINAL EXAM INFORMATION. The Final Exam is scheduled for Tuesday, December 16, at 7:00 PM in. Lambert Fieldhouse(Indoor Track Area).

  6. Information Structure in Discourse 

    E-Print Network [OSTI]

    Traat, Maarika

    The present dissertation proposes integrating Discourse Representation Theory (DRT), information structure (IS) and Combinatory Categorial Grammar (CCG) into a single framework. It achieves this by making two new ...

  7. Personalized Peripheral Information Awareness through Information Art

    E-Print Network [OSTI]

    Stasko, John T.

    suggestions for system improvements. 1 Introduction Our lives are filled with information that influences what project at work nearing completion? What will the weather be like tomorrow? How much traffic will there be on the ride home? What's my child having for lunch at school? As human beings, we naturally care about

  8. Information Brokers: Gathering Information from Heterogeneous Information Sources Richard Fikes, Adam Farquhar, Wanda Pratt

    E-Print Network [OSTI]

    Pratt, Vaughan

    Information Brokers: Gathering Information from Heterogeneous Information Sources Richard Fikes,adam_farquhar,pratt}@ksl.stanford.edu Abstract The Internet provides dramatic new opportunities for gather­ ing information from multiple technical problems for the information­seeking client, including finding the information sources relevant

  9. Carson Hall Information

    E-Print Network [OSTI]

    Ravikumar, B.

    RedwoodDrive ResidentialCommunity Lot B Lot C Lot D Reserved / Special Event Lot J Lot F Lot G Lot A Reserved Parking Lot M Entrance Rohnert Park Expressway Juniper Lane Reserved Parking Parking & Information Center Parking & Information Center General Parking General Parking General Parking General Parking General Parking General

  10. Global Information Technologies

    E-Print Network [OSTI]

    Keromytis, Angelos D.

    Global Information Technologies: Concepts, Methodologies, Tools, and Applications Felix B. Tan in the United States of America by Information Science Reference (an imprint of IGI Global) 701 E. Chocolate (an imprint of IGI Global) 3 Henrietta Street Covent Garden London WC2E 8LU Tel: 44 20 7240 0856 Fax

  11. Information Security Program

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1995-09-28

    Establishes an Information Security Program for the protection and control of classified and sensitive information. Cancels DOE 5630.8A, DOE 5639.1, DOE 5639.5, DOE 5639.6A, DOE 5639.7, DOE M 5632.1C-1, Chapter III, Para. 1, 2, and 4-9

  12. DRILLING MACHINES GENERAL INFORMATION

    E-Print Network [OSTI]

    Gellman, Andrew J.

    TC 9-524 Chapter 4 DRILLING MACHINES GENERAL INFORMATION PURPOSE This chapter contains basic information pertaining to drilling machines. A drilling machine comes in many shapes and sizes, from small hand-held power drills to bench mounted and finally floor-mounted models. They can perform operations

  13. Information extraction system

    DOE Patents [OSTI]

    Lemmond, Tracy D; Hanley, William G; Guensche, Joseph Wendell; Perry, Nathan C; Nitao, John J; Kidwell, Paul Brandon; Boakye, Kofi Agyeman; Glaser, Ron E; Prenger, Ryan James

    2014-05-13

    An information extraction system and methods of operating the system are provided. In particular, an information extraction system for performing meta-extraction of named entities of people, organizations, and locations as well as relationships and events from text documents are described herein.

  14. Identifying Classified Information

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2007-08-28

    The Order establishes the program to identify information classified under the Atomic Energy Act [Restricted Data (RD) and Formerly Restricted Data (FRD)] or Executive Order 12958, as amended [National Security Information (NSI)], so that it can be protected against unauthorized dissemination. Canceled by DOE O 475.2

  15. Physics from information

    E-Print Network [OSTI]

    Jae-Weon Lee

    2012-01-28

    This is an ongoing review on the idea that the phase space information loss at causal horizons is the key ingredient of major physical laws. Assuming that information is fundamental and the information propagates with finite velocity, one can find that basic physical laws such as Newton's second law and Einstein's equation simply describe the energy-information relation (dE=TdS) for matter or space time crossing causal horizons. Quantum mechanics is related to the phase space information loss of matter crossing the Rindler horizon, which explains why superluminal communication is impossible even with quantum entanglement. This approach also explains the origin of Jacobson's thermodynamic formalism of Einstein gravity and Verlinde's entropic gravity. When applied to a cosmic causal horizon, the conjecture can reproduce the observed dark energy and the zero cosmological constant. Quantum entanglement, path integral, and holography are also natural consequences of this theory.

  16. Energy information directory 1994

    SciTech Connect (OSTI)

    Not Available

    1994-03-28

    The National Energy Information Center (NEIC), as part of its mission, provides energy information and referral assistance to Federal, State, and local governments, the academic community, business and industrial organizations, and the general public. The two principal functions related to this task are (1) operating a general access telephone line, and (2) responding to energy-related correspondence addressed to the Energy Information Administration (EIA). The Energy Information Directory was developed to assist the NEIC staff, as well as other Department of Energy (DOE) staff, in directing inquiries to the proper offices within DOE, other Federal agencies, or energy-related trade associations. The Directory is a list of most Government offices and trade associations that are involved in energy matters. It does not include those DOE offices which do not deal with the public or public information.

  17. INFORMATION SECURITY POLICY.doc INFORMATION SECURITY POLICY

    E-Print Network [OSTI]

    Subramanian, Sriram

    - 1 ­ INFORMATION SECURITY POLICY.doc INFORMATION SECURITY POLICY Ratified by RCA Senate, February 2007 Contents Introduction 2 Policy Statement 3 Information Security at RCA 5 Annexes A. Applicable ­ INFORMATION SECURITY POLICY.doc Introduction Why Information Security? The access, availability

  18. Information interaction A Cognitive Analysis of Information Retrieval

    E-Print Network [OSTI]

    Mizzaro, Stefano

    Information interaction 233 A Cognitive Analysis of Information Retrieval Stefano Mizzaro The lackness of a formal account is probably one of the most evident of the shortcomings of information retrieval: concepts like information, information need, and relevance are neither well understood nor

  19. The Information Mural: Increasing Information Bandwidth in Visualizations

    E-Print Network [OSTI]

    Stasko, John T.

    The Information Mural: Increasing Information Bandwidth in Visualizations Dean F. Jerding and John Abstract Information visualizations must allow users to browse information spaces and focus quickly on items of interest. Being able to see some representation of the entire information space provides

  20. Montana Geographic Information Library | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: Energy ResourcesDec(Pritchett, 2004)Michigan:MontanaInformation|

  1. Accident information needs

    SciTech Connect (OSTI)

    Hanson, D.J.; Arcieri, W.C.; Ward, L.W.

    1992-12-31

    A Five-step methodology has been developed to evaluate information needs for nuclear power plants under accident conditions and the availability of plant instrumentation during severe accidents. Step 1 examines the credible accidents and their relationships to plant safety functions. Step 2 determines the information personnel involved in accident management will need to understand plant behavior. Step 3 determines the capability of the instrumentation to function properly under severe accident conditions. Step 4 determines the conditions expected during the identified severe accidents. Step 5 compares the instrument capabilities and the severe accident conditions to evaluate the availability of the instrumentation to supply needed plant information.

  2. Accident information needs

    SciTech Connect (OSTI)

    Hanson, D.J.; Arcieri, W.C.; Ward, L.W.

    1992-01-01

    A Five-step methodology has been developed to evaluate information needs for nuclear power plants under accident conditions and the availability of plant instrumentation during severe accidents. Step 1 examines the credible accidents and their relationships to plant safety functions. Step 2 determines the information personnel involved in accident management will need to understand plant behavior. Step 3 determines the capability of the instrumentation to function properly under severe accident conditions. Step 4 determines the conditions expected during the identified severe accidents. Step 5 compares the instrument capabilities and the severe accident conditions to evaluate the availability of the instrumentation to supply needed plant information.

  3. Information Management Program

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1996-09-30

    Provides a framework for managing information, information resources, and information technology investment, which supports the operating elements of the Department in the accomplishment of its missions and functions in both an efficient and effective manner and in accordance with Departmental policy. Cancels: DOE 1324.5B, DOE 5900.1A, DOE 1130.8A, DOE 1330.1D, DOE 1410.2, DOE 1450.3A, DOE 1700.1, DOE 1800.1A, DOE 5300.1C

  4. ENERGY INFORMATION CLEARINGHOUSE

    SciTech Connect (OSTI)

    Ron Johnson

    2003-10-01

    Alaska has spent billions of dollars on various energy-related activities over the past several decades, with projects ranging from smaller utilities used to produce heat and power in rural Alaska to huge endeavors relating to exported resources. To help provide information for end users, utilities, decision makers, and the general public, the Institute of Northern Engineering at UAF established an Energy Information Clearinghouse accessible through the worldwide web in 2002. This clearinghouse contains information on energy resources, end use technologies, policies, related environmental issues, emerging technologies, efficiency, storage, demand side management, and developments in Alaska.

  5. Information and integrity in the

    E-Print Network [OSTI]

    De Montfort University

    Information and integrity in the information age Converging technologies have changed the way we should look at information. Traditional paradigms of information suppliers and consumers no longer seem of information and its associated integrity using illustrations from the virtual world Converging technologies

  6. Essays on information, technology and information worker productivity

    E-Print Network [OSTI]

    Aral, Sinan

    2007-01-01

    I examine how information technology (IT) skills and use, communication network structures, and the distribution and flow of information in organizations impact individual information worker productivity. The work is divided ...

  7. Office of Information Security

    Broader source: Energy.gov [DOE]

    The Office of Information Security is responsible for implementation of the Classified Matter Protection and Control Program (CMPC), the Operations Security Program (OPSEC) and the Facility Clearance Program and the Survey Program for Headquarters

  8. Mapping healthcare information technology

    E-Print Network [OSTI]

    Crawford, William Charles Richards

    2010-01-01

    In this thesis I have developed a map of Healthcare Information Technology applications used in the United States for care delivery, healthcare enterprise management, clinical support, research and patient engagement. No ...

  9. Value of Information References

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Morency, Christina

    2014-12-12

    This file contains a list of relevant references on value of information (VOI) in RIS format. VOI provides a quantitative analysis to evaluate the outcome of the combined technologies (seismology, hydrology, geodesy) used to monitor Brady's Geothermal Field.

  10. Value of Information References

    DOE Data Explorer [Office of Scientific and Technical Information (OSTI)]

    Morency, Christina

    This file contains a list of relevant references on value of information (VOI) in RIS format. VOI provides a quantitative analysis to evaluate the outcome of the combined technologies (seismology, hydrology, geodesy) used to monitor Brady's Geothermal Field.

  11. Information and Communications Infrastructure

    E-Print Network [OSTI]

    Communications Utilization and Performance________________________ 20 5.3 Systems Support Utilization and Performance ____________________________ 21 5.4 Radio Communications Systems Utilization and Performance of the communications infrastructure and information systems used during this time period. It addresses resources

  12. Department of Systems & Information

    E-Print Network [OSTI]

    Zhigilei, Leonid V.

    , communication systems, control systems, economic systems, energy and environmental systems, human factors systems, safety-critical systems, wireless communications, game theory and artificial intelligenceDeveloping Leaders of Innovation Department of Systems & Information Engineering #12;In the U

  13. Identifying Classified Information

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1998-05-08

    This Manual provides requirements for managing the Department’s classification and declassification program, including details for classifying and declassifying information, documents, and material. Cancels DOE O 5650.2B.

  14. Computational information design

    E-Print Network [OSTI]

    Fry, Benjamin Jotham, 1975-

    2004-01-01

    The ability to collect, store, and manage data is increasing quickly, but our ability to understand it remains constant. In an attempt to gain better understanding of data, fields such as information visualization, data ...

  15. Information Resources - Publications

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    is necessary to inform the publisher of the U.S. Government policy on the publication license. This should be included on the front of the submitted manuscript, perhaps on the...

  16. Medical Information | Jefferson Lab

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    Medical Information Occupational Medicine provides a range of health services and can work with your personal physician on your health needs. A D D I T I O N A L L I N K S:...

  17. Identification of Classified Information

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1991-12-31

    To specify responsibilities, authorities, policy, and procedures for the management of the Department of Energy (DOE) program to identify classified information, documents, or material. Cancels DOE O 5650.2A, dated 5-8-85.

  18. Energy Information Directory 1996

    SciTech Connect (OSTI)

    1997-01-01

    This directory lists most government offices and trade associations that are involved in energy matters. It does not include DOE offices which do not deal with the public or public information.

  19. Energy information directory 1998

    SciTech Connect (OSTI)

    1998-11-01

    The National Energy Information Center (NEIC), as part of its mission, provides energy information and referral assistance to Federal, State, and local governments, the academic community, business and industrial organizations, and the general public. The two principal functions related to this task are: (1) operating a general access telephone line, and (2) responding to energy-related correspondence addressed to the Energy Information Administration (EIA). The Energy Information Directory was developed to assist the NEIC staff, as well as other Department of Energy (DOE) staff, in directing inquiries to the proper offices within DOE, other Federal agencies, or energy-related trade associations. The Directory lists most Government offices and trade associations that are involved in energy matters.

  20. Information applications: Rapporteur summary

    SciTech Connect (OSTI)

    Siegel, S.

    1990-12-31

    An increased level of mathematical sophistication will be needed in the future to be able to handle the spectrum of information as it comes from a broad array of biological systems and other sources. Classification will be an increasingly complex and difficult issue. Several projects that are discussed are being developed by the US Department of Health and Human Services (DHHS), including a directory of risk assessment projects and a directory of exposure information resources.

  1. Information systems definition architecture

    SciTech Connect (OSTI)

    Calapristi, A.J.

    1996-06-20

    The Tank Waste Remediation System (TWRS) Information Systems Definition architecture evaluated information Management (IM) processes in several key organizations. The intent of the study is to identify improvements in TWRS IM processes that will enable better support to the TWRS mission, and accommodate changes in TWRS business environment. The ultimate goals of the study are to reduce IM costs, Manage the configuration of TWRS IM elements, and improve IM-related process performance.

  2. Target | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)ModelTalbotts Ltd JumpJumpInformationTaosTarget

  3. Technosun | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)ModelTalbottsInformation ResearchPartnersTechnosun Jump

  4. Tecnalia | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)ModelTalbottsInformation ResearchPartnersTechnosun

  5. Tecsol | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)ModelTalbottsInformationOpen EnergyTecsol Jump to:

  6. Shinepower | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity for LowInformation NanoTexas:Shiloh, Ohio:

  7. Silatronix | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity for LowInformationShoshoneEnergyMountain, Tennessee:Silatronix

  8. Solactiva | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity forSilicium deEnergy Information North|

  9. Security of Foreign Intelligence Information and Sensitive Compartmented Information Facilities

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    1993-07-23

    The order establishes responsibilities and authorities for protecting Foreign Intelligence Information (FII) and Sensitive Compartmented Information Facilities (SCIFs) within DOE. Supersedes DOE 5639.8.

  10. Photovoltaics information user study

    SciTech Connect (OSTI)

    Belew, W.W.; Wood, B.L.; Marie, T.L.; Reinhardt, C.L.

    1980-10-01

    The results of a series of telephone interviews with groups of users of information on photovoltaics (PV) are described. These results, part of a larger study on many different solar technologies, identify types of information each group needed and the best ways to get information to each group. The report is 1 of 10 discussing study results. The overall study provides baseline data about information needs in the solar community. It covers these technological areas: photovoltaics, passive solar heating and cooling, active solar heating and cooling, biomass energy, solar thermal electric power, solar industrial and agricultural process heat, wind energy, ocean energy, and advanced energy storage. An earlier study identified the information user groups in the solar community and the priority (to accelerate solar energy commercialization) of getting information to each group. In the current study only high-priority groups were examined. Results from seven PV groups respondents are analyzed in this report: DOE-Funded Researchers, Non-DOE-Funded Researchers, Researchers Working for Manufacturers, Representatives of Other Manufacturers, Representatives of Utilities, Electric Power Engineers, and Educators.

  11. Nevada Transmission Siting Information | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPI Ventures Ltd JumpNesjavellirInformationCertified TankNevada

  12. Geographic Information System | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePowerEdistoWhiskeyFootprintGEXAGeminiEnergy InformationGeographic

  13. Photovoltaic Geographical Information System | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII JumpQuarterly Smart GridNorthInformationPersuPlanPhotoSolar JumpExperts

  14. Fish Camp 2015 Freshmen Information

    E-Print Network [OSTI]

    Bermúdez, José Luis

    1 Fish Camp 2015 Freshmen Information Packet #12;2 Contents Fish Camp General Information ..................................................................................................... 3 Session Dates for Fish Camp 2015.......................................................................................................................... 10 #12;3 Fish Camp General Information Fish Camp Office Mailing Address Student Activities, 131

  15. National Center for Geographic Information

    E-Print Network [OSTI]

    California at Santa Barbara, University of

    of the possibilities of using Geographic Information Systems (GIS) for statistical analysis, research.. managementNCGIA National Center for Geographic Information and Analysis Locational Models, Geographic Information, and Planning Support Systems by Britton Harris Department of City and Regional Planning

  16. Information -Communication Communication des entreprises

    E-Print Network [OSTI]

    Sart, Remi

    Information - Communication 2 PARCOURS Communication des entreprises Communication et solidarité;2 Information - Communication UFR Langues Appliquées, Commerce et Communication PRÉSENTATION Objectifs La Licence Information et communication est destinée aux étudiants qui souhaitent suivre un parcours

  17. SECTION A: STUDENT INFORMATION ______________________________________________________________________ 93#____________________________________

    E-Print Network [OSTI]

    Lewis, Robert Michael

    , as Amended, you have the right to withhold the disclosure of "Directory Information." a. Student's name bSECTION A: STUDENT INFORMATION # __________________@_________________________ (______)______________ ________/________/_________ Email Address Phone # Effective Date of this Request SECTION B: ADDITIONAL INFORMATION The items listed

  18. MOCI : Museum of contemporary information

    E-Print Network [OSTI]

    Petersen, Michelle (Michelle Nicole)

    2009-01-01

    As the internet is becoming the primary point of access to information, we are confronted with new issues related to information retrieval. These include who has access to information, credibility of sources, and most ...

  19. Energy information sheets, July 1998

    SciTech Connect (OSTI)

    1998-07-01

    The National Energy Information Center (NEIC), as part of its mission, provides energy information and referral assistance to Federal, State, and local governments, the academic community, business and industrial organizations, and the public. The Energy Information Sheets was developed to provide general information on various aspects of fuel production, prices, consumption, and capability. Additional information on related subject matter can be found in other Energy Information Administration (EIA) publications as referenced at the end of each sheet.

  20. Energy information sheets, September 1996

    SciTech Connect (OSTI)

    1996-09-01

    The National Energy Information Center (NEIC), as part of its mission, provides energy information and referral assistance to Federal, State, and local governments, the academic community, business and industrial organizations, and the public. The Energy Information Sheets was developed to provide general information on various aspects of fuel production, prices, consumption, and capability. Additional information on related subject matter can be found in other Energy Information Administration (EIA) publications as referenced at the end of each sheet.

  1. Staying Informed | Department of Energy

    Office of Energy Efficiency and Renewable Energy (EERE) Indexed Site

    like the Automobile Association of America and GasBuddy.com for information about gasoline and diesel fuel prices. Stay tuned to local media reports. Seek out information...

  2. GENERAL INFORMATION City State Zip

    E-Print Network [OSTI]

    Ullrich, Paul

    GENERAL INFORMATION City State Zip Phone Number Mobile Number BACKGROUND INFORMATION Venture of operation of your company? TM VENTURE CATALYST Smart Toolkit for Accelerated Research Translation START Last

  3. Vehicle Technologies Office: Information Resources

    Broader source: Energy.gov [DOE]

    From here you can access additional information on advanced transportation technologies; view programmatic publications and technical information; learn the basics of hybrid vehicle technology;...

  4. INFORMATION SECURITY University Policy No: IM7800

    E-Print Network [OSTI]

    Victoria, University of

    Page 1 INFORMATION SECURITY POLICY University Policy No: IM7800 Classification: Information to an Information Security Incident Procedures for Addressing Security Vulnerabilities of University Information Resources and Information Systems University Information Security Classification Procedures Procedures

  5. Information Technology: American National Standard for

    E-Print Network [OSTI]

    Information Technology: American National Standard for Information Systems-- Data Format Publication 500-245 Information Technology: American National Standard for Information Systems-- Data Format for the Interchange of Fingerprint, Facial, & Scar Mark & Tattoo (SMT) Information Sponsored by Information Technology

  6. Energy information directory 1997

    SciTech Connect (OSTI)

    1997-09-01

    The National Energy Information Center (NEIC), as part of its mission, provides energy information and referral assistance to Federal, state, and local governments, the academic community, business and industrial organizations, and the general public. The two principal functions related to this task are: (1) operating a general access telephone line, and (2) responding to energy-related correspondence addressed to the Energy Information Administration (EIA). The Energy Information Directory was developed to assist the NEIC staff, as well as other Department of Energy (DOE) staff, in directing inquiries to the proper offices within DOE, other Federal agencies, or energy-related trade associations. The Directory lists some of the Government offices and trade associations that are involved in energy matters. It includes those DOE offices which deal with the public or public information. For the purposes of this publication, each entry has been given a numeric identification symbol. The index found in the back of this publication uses these identification numbers to refer the reader to relevant entries.

  7. Transaction Costs, Information Technology and Development

    E-Print Network [OSTI]

    Singh, Nirvikar

    2004-01-01

    Transaction Costs, Information Technology and Development 1.Transaction Costs, Information Technology and DevelopmentTransaction Costs, Information Technology and Development *

  8. Transaction Costs, Information Technology and Development

    E-Print Network [OSTI]

    Singh, Nirvikar

    2004-01-01

    Transaction Costs, Information Technology and Development 1.Transaction Costs, Information Technology and DevelopmentTransaction Costs, Information Technology and Development

  9. Protecting FWP Participant Personally Identifiable Information...

    Energy Savers [EERE]

    Protecting FWP Participant Personally Identifiable InformationProtected Health Information Protecting FWP Participant Personally Identifiable InformationProtected Health...

  10. AT&TSecurity Consulting Information Assurance Federal Information Security

    E-Print Network [OSTI]

    Fisher, Kathleen

    AT&TSecurity Consulting Information Assurance ­ Federal Information Security Management Act (FISMA requirements under the Federal Information Security Management Act of 2002, of general support systems the security controls for the information system. The AT&T Consulting methodology is based on National

  11. Assessing Information Literacy among Undergraduates 71 Assessing Information Literacy

    E-Print Network [OSTI]

    California at Berkeley, University of

    of information tools as well as primary sources in molding informa- tion-solutionstotheirproblems."1 In a sub- sequent iteration of the concept, IIA dropped its reference to information re- sources being usedAssessing Information Literacy among Undergraduates 71 71 Assessing Information Literacy among

  12. Information Granulation for Web based Information Retrieval Support Systems

    E-Print Network [OSTI]

    Yao, JingTao

    Department of Computer Science University of Regina Regina, Saskatchewan, Canada S4S 0A2 E-mail: {jtyao, yyao. These URLs provide location information. Like titles of books in traditional libraries, no one can remember and out dated information. Information retrieval systems provide useful information in libraries

  13. GEOGRAPHIC INFORMATION Prepare for a Career in Information

    E-Print Network [OSTI]

    Frank, Thomas D.

    demand for students with knowledge about the earth's systems and how geographic information systems GEOG 371 Spatial Analysis GEOG 379 Introduction to Geographic Information Systems GEOG 473 CartographyGEOGRAPHIC INFORMATION SCIENCE Prepare for a Career in Information Technology The Department

  14. The Seventeen Theoretical Constructs of Information Searching and Information Retrieval

    E-Print Network [OSTI]

    Jansen, James

    The Seventeen Theoretical Constructs of Information Searching and Information Retrieval Bernard J. Jansen College of Information Sciences and Technology, The Pennsylvania State University, University Park, PA 16801. E-mail: jjansen@acm.org Soo Young Rieh School of Information, University of Michigan, Ann

  15. Information Access Router for Integrated Information Access System Koji Murakami

    E-Print Network [OSTI]

    Information Access Router for Integrated Information Access System Koji Murakami Department System (IIAS) that accepts diverse kinds of questions and provides the requested information in the most will report on the implementation of one important com- ponent of the system, the Information Ac- cess Router

  16. Information Systems 23(3-4), June 1998. Information Modeling

    E-Print Network [OSTI]

    Mylopoulos, John

    - 1 - Information Systems 23(3-4), June 1998. Information Modeling in the Time of the Revolution1 resource, its modeling is serving as a core technology for information systems engineering. We present), and Requirements Analysis (Software Engineering and Information Systems). We then offer a characterization

  17. The Western Pacific Fishery Information Network: A Fisheries Information System

    E-Print Network [OSTI]

    The Western Pacific Fishery Information Network: A Fisheries Information System Introduction. This pa per describes the development and status of this fishery information system. DAVID C. HAMM fishery chang ing with them to obtain and utilize the proper data and information needed to monitor and manage

  18. ITS Identity & Information Security Information Security Program Date 10-02-2013 Page 1

    E-Print Network [OSTI]

    Su, Xiao

    ITS Identity & Information Security Information Security Program Date 10-02-2013 Page 1 Information................................................................................................................................................................................3 Information Security Policy...............................................................................................................................................4 Information Security Policy Management

  19. WIPP Recovery Information | Department of Energy

    Office of Environmental Management (EM)

    WIPP Recovery Information WIPP Recovery Information Topic: J. R. Stroble CBFO, Provided Information on Locations to Access WIPP Recovery Information. WIPP Recovery - March 26, 2014...

  20. Waspa | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin,VillageWarren Park,|Information 6thMaine:Washtucna,Waspa

  1. Telvent | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) | Open Energy Information DixieGeothermalTelioTelvent Jump

  2. Text | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) |Information 5th congressional district:View New Pages

  3. Siding | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity for LowInformationShoshone County,Si BrilliantSibleySiding Jump

  4. Siemens | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity for LowInformationShoshone County,SiCorporateSiemens Jump to:

  5. Flume | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButtePowerEdistoWhiskey flatsInformationFlintInformation

  6. Camelot | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoopButte County, California:InformationInformationCalvertCamEnergyCamelot Jump

  7. Norden | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to:Information 3rd| Open Energy Information Lawyers'Norden Jump to:

  8. Onsemble | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsourceII Jump to:InformationInformation 6thOhmsettOklahoma:the Grid

  9. School of Information & Library Studies

    E-Print Network [OSTI]

    , are problems a 'systems failure'? #12;but, with the information explosion, comes new problems... · how to find - Web pages - ePortfolios #12;Employment? · Information professions: ­ information management, web ­ using existing technologies, adapting to new ones · information intensive society ­ any job will require

  10. FIPS PUB 188 Federal Information

    E-Print Network [OSTI]

    OF COMMERCE / National Institute of Standards and Technology Standard Security Label for Information Transfer Computer Systems Laboratory Abstract Information Transfer security labels convey information used with semantics provided by the authority establishing the security policy for the protection of the information

  11. EMERGENCY INFORMATION State Privacy Notification

    E-Print Network [OSTI]

    Hernes, Peter J.

    April 2005 EMERGENCY INFORMATION State Privacy Notification The State of California Information Practices Act of 1977 (effective July 1, 1978) requires the University to provide the following information to individuals who are asked to supply information about themselves. The principal purpose for requesting

  12. LBNL Frequently Needed Proposal Information

    E-Print Network [OSTI]

    06/05/2014 LBNL Frequently Needed Proposal Information Frequently Needed Proposal information is LBNL Institutional Information that may be required to complete proposals and grant applications. If you do not find the institutional information you need, please contact your OSPIP Contracts Officer

  13. PERSONAL INFORMATION CONSENT [insert name

    E-Print Network [OSTI]

    Wapstra, Erik

    consent. 4. I have the right to access my personal information held by the University in accordance with the Right to Information Act 2009. I may contact the University in relation to my personal information usingPERSONAL INFORMATION CONSENT I [insert name] of [insert address] Have read, understood and agree

  14. MASTER OF SCIENCE Information Systems

    E-Print Network [OSTI]

    Yang, Eui-Hyeok

    MASTER OF SCIENCE Information Systems LEADING INFORMATION INNOVATION www.stevens.edu/howe/IS #12. Organizations are upgrading their information systems (IS) and switching to newer, faster and more mobile and management insight. The Master of Science in Information Systems at Stevens prepares students and current

  15. Physics of Binary Information

    E-Print Network [OSTI]

    Walter Smilga

    2013-03-24

    Basic concepts of theoretical particle physics, including quantum mechanics and Poincar\\'e invariance, the leptonic mass spectrum and the proton mass, can be derived, without reference to first principles, from intrinsic properties of the simplest elements of information represented by binary data. What we comprehend as physical reality is, therefore, a reflection of mathematically determined logical structures, built from elements of binary data.

  16. Technology Advertising Contact Information

    E-Print Network [OSTI]

    Peters, Richard

    Overview #12;Technology Advertising Contact Information Alex Sheath 8596 4063 asheath Overview Our online Technology section is geared towards an IT professional environment, reaching a range of technology enthusiasts from every day gadget consumers to business decision makers where enterprise solutions

  17. CURRICULUM VITAE PERSONAL INFORMATION

    E-Print Network [OSTI]

    Ryabov, Boris I.

    CURRICULUM VITAE PERSONAL INFORMATION Name RYABOV, Boris Address Ropazu 5 - 13, Riga, LV-1039 telescope RATAN-600. Page 1 ­ Curriculum vitae of RYABOV, Boris #12;· Dates 1984 ­ 1987, 1977 ­ 1979, 1974 good · Writing skills basic · Verbal skills excellent Page 2 ­ Curriculum vitae of RYABOV, Boris #12

  18. Managing environmental information

    SciTech Connect (OSTI)

    Solyst, J. [Chemical Manufacturers Association, Arlington, VA (United States)

    1998-12-31

    The public`s right to know about environmental policy has moved to the forefront with the technological advances in recent years. Congress has not kept pace with these developments having twice considered and twice rejected legislation that is necessary in this field. Congress should provide leadership to the Environmental Protection Agency (EPA) for a broad strategy to improve information resources and management.

  19. Accident management information needs

    SciTech Connect (OSTI)

    Hanson, D.J.; Ward, L.W.; Nelson, W.R.; Meyer, O.R. (EG and G Idaho, Inc., Idaho Falls, ID (USA))

    1990-04-01

    In support of the US Nuclear Regulatory Commission (NRC) Accident Management Research Program, a methodology has been developed for identifying the plant information needs necessary for personnel involved in the management of an accident to diagnose that an accident is in progress, select and implement strategies to prevent or mitigate the accident, and monitor the effectiveness of these strategies. This report describes the methodology and presents an application of this methodology to a Pressurized Water Reactor (PWR) with a large dry containment. A risk-important severe accident sequence for a PWR is used to examine the capability of the existing measurements to supply the necessary information. The method includes an assessment of the effects of the sequence on the measurement availability including the effects of environmental conditions. The information needs and capabilities identified using this approach are also intended to form the basis for more comprehensive information needs assessment performed during the analyses and development of specific strategies for use in accident management prevention and mitigation. 3 refs., 16 figs., 7 tabs.

  20. Smart Information Systems Presents...

    E-Print Network [OSTI]

    Michalek, Jeremy J.

    Smart Information Systems Presents... AWARE TM Developed for Interea Inc by Team Five: · Jeremy the UK. Central to all regions is a collection of databases and query management systems called the Smart log in at the store to access a user profile which they set on the website using their home PC

  1. Small Wind Information (Postcard)

    SciTech Connect (OSTI)

    Not Available

    2011-08-01

    The U.S. Department of Energy's Wind Powering America initiative maintains a website section devoted to information about small wind turbines for homeowners, ranchers, and small businesses. This postcard is a marketing piece that stakeholders can provide to interested parties; it will guide them to this online resource.

  2. CURRICULUM VITAE CONTACT INFORMATION

    E-Print Network [OSTI]

    Services, Human Well-Being, and Policies in Coupled Human and Natural Systems" (Major Advisor: Jianguo, remote sensing, and system modeling) to study ecosystem services, human well-being, their linkagesCURRICULUM VITAE Wu Yang CONTACT INFORMATION Center for Systems Integration & Sustainability

  3. Training Management Information System

    SciTech Connect (OSTI)

    Rackley, M.P.

    1989-01-01

    The Training Management Information System (TMIS) is an integrated information system for all training related activities. TMIS is at the leading edge of training information systems used in the nuclear industry. The database contains all the necessary records to confirm the department's adherence to accreditation criteria and houses all test questions, student records and information needed to evaluate the training process. The key to the TMIS system is that the impact of any change (i.e., procedure change, new equipment, safety incident in the commercial nuclear industry, etc.) can be tracked throughout the training process. This ensures the best training can be performed that meets the needs of the employees. TMIS is comprised of six functional areas: Job and Task Analysis, Training Materials Design and Development, Exam Management, Student Records/Scheduling, Evaluation, and Commitment Tracking. The system consists of a VAX 6320 Cluster with IBM and MacIntosh computers tied into an ethernet with the VAX. Other peripherals are also tied into the system: Exam Generation Stations to include mark sense readers for test grading, Production PC's for Desk-Top Publishing of Training Material, and PC Image Workstations. 5 figs.

  4. Contact Information Mustafa KRLI

    E-Print Network [OSTI]

    Erdem, Erkut

    Forces Information System project. I am a SAP BASIS consultant as well. Education Ms.D. : Turkish Air in various military projects. My business interest is on IBM Power hardware, AIX operating system, ORACLE database and RAC systems, SAN networks, SAP applications. I am one of the senior architects of Turkish Air

  5. Information Technology Project Guide

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2008-09-12

    This Guide provides Department of Energy recommended guidelines to ensure that the acquisition of information technology capital assets is performed in compliance with DOE O 413.3A, Program and Project Management for the Acquisition of Capital Assets, dated 7-28-06. Canceled by DOE N 251.105.

  6. Information Collection Management Program

    Broader source: Directives, Delegations, and Requirements [Office of Management (MA)]

    2006-10-11

    This Order sets forth DOE requirements and responsibilities for implementing the information collection management provisions of the Paperwork Reduction Act of 1995 and the Office of Management and Budgets implementing regulation Controlling Paperwork Burdens on the Public, as contained in 5 CFR 1320. No cancellation.

  7. Rylands Library Visitor Information

    E-Print Network [OSTI]

    Abrahams, I. David

    . Members of the general public are welcome to join the Deansgate Library as readers. If you wish to useThe John Rylands Library Visitor Information #12;The floor plan overleaf will help you find your staircase to Level 1 Exhibitions. Introductory Gallery Find out how and when the Library was built

  8. LEAD POISONING PREVENTION INFORMATION

    E-Print Network [OSTI]

    Families AreForever LEAD POISONING PREVENTION INFORMATION FOR PARENTS & PROSPECTIVE-lead levels There is no safe level of lead in the body. Often, symptoms are not obvious, so lead poisoning's medical examination in the U.S. or contact your state or local Childhood Lead Poisoning Prevention Program

  9. Professional Training Information Pack

    E-Print Network [OSTI]

    Davies, Christopher

    Intending Professional Training Students Year 2 Information Pack #12;- 1 - Applying for a Professional Training Placement To be allowed to do the Professional Training you must have enrolled on one must talk to Dr J. M. Thompson immediately. General introduction to professional training Students

  10. Sifting through Hierarchical Information

    E-Print Network [OSTI]

    Greenberg, Saul

    hierarchical information 2 Schaffer & Greenberg INTRODUCTION As storage mediums decrease in cost fairly fuzzy query specifications, and see the results as a range of candidates. Four innovations help TREES [4] and VARIABLE ZOOM [6]. By combining these four innovations, users should be able to specify

  11. Burak Yuksel Information

    E-Print Network [OSTI]

    Burak Y¨uksel Contact Information Spemannstr.38 +49-7071 601 213 MPI, 72076 T¨ubingen, Germany Institute, Personal Webpage · Personal Webpage Education University of Stuttgart, Stuttgart, Germany Ph University, Istanbul, Turkey M.Sc., Control and Automation Engineering, June 2012, GPA: 3.94/4.00 · Topic

  12. Mercury Information Clearinghouse

    SciTech Connect (OSTI)

    Chad A. Wocken; Michael J. Holmes; Dennis L. Laudal; Debra F. Pflughoeft-Hassett; Greg F. Weber; Nicholas V. C. Ralston; Stanley J. Miller; Grant E. Dunham; Edwin S. Olson; Laura J. Raymond; John H. Pavlish; Everett A. Sondreal; Steven A. Benson

    2006-03-31

    The Canadian Electricity Association (CEA) identified a need and contracted the Energy & Environmental Research Center (EERC) to create and maintain an information clearinghouse on global research and development activities related to mercury emissions from coal-fired electric utilities. With the support of CEA, the Center for Air Toxic Metals{reg_sign} (CATM{reg_sign}) Affiliates, and the U.S. Department of Energy (DOE), the EERC developed comprehensive quarterly information updates that provide a detailed assessment of developments in the various areas of mercury monitoring, control, policy, and research. A total of eight topical reports were completed and are summarized and updated in this final CEA quarterly report. The original quarterly reports can be viewed at the CEA Web site (www.ceamercuryprogram.ca). In addition to a comprehensive update of previous mercury-related topics, a review of results from the CEA Mercury Program is provided. Members of Canada's coal-fired electricity generation sector (ATCO Power, EPCOR, Manitoba Hydro, New Brunswick Power, Nova Scotia Power Inc., Ontario Power Generation, SaskPower, and TransAlta) and CEA, have compiled an extensive database of information from stack-, coal-, and ash-sampling activities. Data from this effort are also available at the CEA Web site and have provided critical information for establishing and reviewing a mercury standard for Canada that is protective of environment and public health and is cost-effective. Specific goals outlined for the CEA mercury program included the following: (1) Improve emission inventories and develop management options through an intensive 2-year coal-, ash-, and stack-sampling program; (2) Promote effective stack testing through the development of guidance material and the support of on-site training on the Ontario Hydro method for employees, government representatives, and contractors on an as-needed basis; (3) Strengthen laboratory analytical capabilities through analysis and quality assurance programs; and (4) Create and maintain an information clearinghouse to ensure that all parties can keep informed on global mercury research and development activities.

  13. Information Seeking and Sharing in Design Teams

    E-Print Network [OSTI]

    Narasayya, Vivek

    Information Seeking and Sharing in Design Teams Abstract. Information retrieval is generally considered an individual activity, and information retrieval research and tools reflect this view. As digitally mediated communication and information sharing increase, collaborative information retrieval

  14. Responsible University Officer Chief Information Officer

    E-Print Network [OSTI]

    Whitton, Mary C.

    Responsible University Officer Chief Information Officer Responsible Office Information Technology Services Information Security Liaison Policy Policy Statement Given the risks associated with information and Department Heads be aware of information security issues and of their responsibilities for mitigating

  15. University of Massachusetts Fair Information Practices Regulations

    E-Print Network [OSTI]

    Massachusetts at Lowell, University of

    Information Under the University's Fair Information Practices Regulations, I have the right to requestUniversity of Massachusetts Fair Information Practices Regulations Directive Regarding Directory that certain personal information which is regarded by the University as "Directory Information

  16. Transcending the Information Given: Designing Learning Environments for Informed

    E-Print Network [OSTI]

    Fischer, Gerhard

    and design environments [Arias et al., 2000]; (2) collaborative knowledge construction [Fischer & OstwaldTranscending the Information Given: Designing Learning Environments for Informed Participation is designed to see humans only as consumers, television being the most obvious medium that promotes

  17. Unisun | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, New York: EnergyU.S.UnifinPark,

  18. Urbasolar | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, New York:PowerNew York: Energy Resources Jump

  19. Vacant | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, New York:PowerNewPumatyUvalde County,

  20. Viralcool | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin,Village of Wellington, Ohio (UtilityVinyl Kraft

  1. Transmission | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013)OpenEnergyTrail Canyon Geothermal

  2. Transmission | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013)OpenEnergyTrail Canyon GeothermalTransmission (Redirected from

  3. Navigating the information landscape

    E-Print Network [OSTI]

    Coonan, Emma

    2011-10-26

    , a student using the library’s website with its dozens of user interfaces, search protocols, and limitations ... might with some justification conclude that is the library, not her, that needs help understanding the nature of electronic information... COONAN (M.St., M.Sc., Ph.D.), Research Skills & Development Librarian, Cambridge University Library Mailing address: Reader Services, Cambridge University Library, West Road, Cambridge CB3 9DR, UK Email address: emma.coonan@lib.cam.ac.uk Keywords...

  4. Stratosolar | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren) JumpandStereoNewCreek Formation

  5. Stratovolcano | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren) JumpandStereoNewCreek FormationStratovolcano Jump to:

  6. Sunvalley | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)Model for theSunLan SolarKoreaSuntechnics

  7. TSNergy | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)Model forTechnologies95Symerton,E CTEP

  8. Takigami | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)Model forTechnologies95Symerton,EEconomies

  9. Terrafore | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) | Opensource HistoryTerraWatt Power Jump to:

  10. Test | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013) | Opensource HistoryTerraWatt PowerTerryDETERMINACION

  11. EPB | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstrumentsAreaforInformationBrownfields

  12. ERSA | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstrumentsAreaforInformationBrownfieldsEPIRERCOT Wind Scraper

  13. Semafo | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk,SageScheucoSedcoInformation Twenty-Nine PalmsSelva 1Semafo

  14. Sensox | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk,SageScheucoSedcoInformationManor,Open EnergySenegal:Sensox

  15. Sensus | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk,SageScheucoSedcoInformationManor,Open

  16. Sermatec | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity for Low Emission Development Strategies (EC-LEDS)

  17. Service | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity for Low Emission Development Strategies (EC-LEDS)Serveron Corp

  18. Servidyne | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity for Low Emission Development Strategies (EC-LEDS)Serveron

  19. Silicification | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity for

  20. Simisa | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity forSilicium de Provence SAS Silpro

  1. Skyonic | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity forSilicium de ProvenceSolar Jump to: navigation, search

  2. Solarese | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity forSilicium deEnergyCompanySolarLabSolarcomplex AG

  3. Solarfun | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity forSilicium deEnergyCompanySolarLabSolarcomplex AGSolarezo Jump

  4. Solaria | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity forSilicium deEnergyCompanySolarLabSolarcomplex

  5. Solarity | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity forSilicium deEnergyCompanySolarLabSolarcomplexSolarig

  6. Solartwin | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity forSiliciumEnergy Inc Jump to: navigation, searchPowerSolartwin

  7. Solinova | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity forSiliciumEnergy Inc Jump to:Solergy Power

  8. Mountainous | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver, Pennsylvania: EnergyPark,Mountainous Jump to:

  9. Macrophotography | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,Information MHKMHK5 < MHKKemblaSolarMacoupin County,

  10. Klimaschutzberatung | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrderInformationKizildere I GeothermalKlimaschutzberatung Jump

  11. Pfhotonika | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPIProtectio1975) | Open Energy Information RooseveltPettisPfeiffer

  12. NARI | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformationOliver,Minnesota:EnergyNARI Jump to: navigation, search

  13. Newbie | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPI Ventures LtdNeville,Information 7thJersey:

  14. Biomasa | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental JumpInformationBio-Gas Technologies, LLC JumpBiofame

  15. Larankelo | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource History ViewInformationWinds Jump to:

  16. Lispolis | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource History ViewInformationWinds JumpOxiranchemRemodelers

  17. Manchester | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIXsource HistoryScenarios TowardsInformation Reducing the GHG

  18. College of Communication and Information LIS Library and Information Science

    E-Print Network [OSTI]

    MacAdam, Keith

    ) Developmentoflibrariesandbooksfromearliesttimetothepresentwithspecialreferencetotheirrelationshiptocontemporarysocial, economic, cultural and political trends. Emphasis is given to American library and book historyCollege of Communication and Information LIS Library and Information Science KEY: # = new course of information (both utilitarian and aesthetic) in contemporary society, and to the role played by libraries

  19. Scandinavian Journal of Information Systems, 2000, 12 211 INFORMATION ABOUT

    E-Print Network [OSTI]

    Bertelsen, Olav W.

    ©Scandinavian Journal of Information Systems, 2000, 12 211 INFORMATION ABOUT THE JOURNAL HOW TO SUBSCRIBE The Scandinavian Journal of Information Systems is published once a year from Volume 10. As from 1998 the journal is administrated by the IRIS Association. All subscribing as individuals will receive

  20. Information Engineering -Department of Computer and Information Science at the University of Constance

    E-Print Network [OSTI]

    Kuhlen, Rainer

    Information Engineering - Department of Computer and Information Science at the University Wissens #12;Information Engineering - Department of Computer and Information Science at the University Science u Formen des Umgangs mit Wissen und Information u Wissen und Information u Napsterisierung u

  1. Information Engineering -Department of Computer and Information Science at the University of Constance Rainer Kuhlen

    E-Print Network [OSTI]

    Kuhlen, Rainer

    Information Engineering - Department of Computer and Information Science at the University;Information Engineering - Department of Computer and Information Science University of Constance? Initiativen #12;Information Engineering - Department of Computer and Information Science University

  2. The Crockett Planning Information Document 

    E-Print Network [OSTI]

    Anderson, Kirt; Bass, Ogden; Echols, Alex; Fleck, John; Guy, Marc; Hurd, Nancy; James, Kathy; Kerby, Scott; Lee, Chun; Stewart, Lucy; Truex, Dan; Webb, John

    1980-01-01

    Examines and catalogs information concerning the existing state of the natural and built environments, as well as the social economic structure of the city. It also utilizes information to calculate the city's projected needs for a twenty...

  3. Structure and Information Stephen Binns

    E-Print Network [OSTI]

    Binns, Stephen

    of a Turing Machine. Stephen Binns Structure and Information #12;Alan Turing's Machines A Turing machine (TM and Information #12;Alan Turing's Machines A Turing machine (TM) consists of an infinite (in one direction) tape

  4. Coherent control of quantum information

    E-Print Network [OSTI]

    Henry, Michael Kevin

    2006-01-01

    Quantum computation requires the ability to efficiently control quantum information in the presence of noise. In this thesis, NMR quantum information processors (QIPs) are used to study noise processes that compromise ...

  5. Information scraps : understanding and design

    E-Print Network [OSTI]

    Bernstein, Michael (Michael Scott)

    2008-01-01

    In this thesis I investigate information scraps - personal information whose content has been scribbled on Post-it notes, scrawled on the corners of sheets of paper, stuck in our pockets, sent in e-mail messages to ourselves, ...

  6. Information Technology Security Assessment Framework

    E-Print Network [OSTI]

    Federal Information Technology Security Assessment Framework November 28, 2000 Prepared (NIST) Computer Security Division #12;Overview Information and the systems that process it are among and maintain a program to adequately secure its information and system assets. Agency programs must: 1) assure

  7. Georgia Southern University Information Technology

    E-Print Network [OSTI]

    Hutcheon, James M.

    Georgia Southern University Information Technology Organization Chart 2014-2015 FINAL: August 29, 2014 R:\\Common\\OrgCharts\\Rev 2015 Information Technology \\CIO Produced: Strategic Research & Analysis of the groups of units reporting there. President Vice President for Information Technology and Chief

  8. James Madison University Information Technology

    E-Print Network [OSTI]

    Arnold, Elizabeth A.

    0 James Madison University Information Technology Strategic Plan 2014-2020 #12;1 James Madison University Information Technology Strategic Plan Introduction In 2012, prior to his official inauguration a new strategic roadmap for the 2014-2020 timeframe. Several Information Technology (IT) leaders

  9. Transporting Information and Energy Simultaneously

    E-Print Network [OSTI]

    Goyal, Vivek K

    Transporting Information and Energy Simultaneously Lav R. Varshney Laboratory for Information--The fundamental tradeoff between the rates at which energy and reliable information can be transmitted over received energy. A capacity-energy function is defined and a coding theorem is given. The capacity-energy

  10. Blended Interaction for Information Visualization

    E-Print Network [OSTI]

    Deussen, Oliver

    about digital information in ways that fit more closely with their existing everyday thinking practises; qualitative studies ACM Classification Keywords H.5.m. Information interfaces and presentation (e.g., HCI and digital actions, offer many new opportunities to think beyond current information visualization (Info

  11. National Center for Geographic Information

    E-Print Network [OSTI]

    California at Santa Barbara, University of

    /regional government; 3. local government; 4. geographic information system (GIS) consultants familiar with the needsNCGIA National Center for Geographic Information and Analysis NCGIA Research Initiative 9 Institutions Sharing Geographic Information Scientific Report for the Specialist Meeting 26-29 February 1992

  12. Title: Information theory Reference: 13791

    E-Print Network [OSTI]

    Overill, Richard E.

    environment or communicates with others. One of the fundamental tenets of information theory a spate of publications appeared applying information theory to many aspects of music analysisTitle: Information theory Reference: 13791 Sort key: informationtheory Version: 3.0 Revision

  13. OGC Compatible Geographical Information Systems

    E-Print Network [OSTI]

    OGC Compatible Geographical Information Systems Web Services Indiana University Computer Science and for online services, that has been widely adopted in the Geographical Information System (GIS) community interoperability problems between different WMS systems. #12;2 1 Introduction Geographical Information Systems (GIS

  14. National Center for Geographic Information

    E-Print Network [OSTI]

    California at Santa Barbara, University of

    was titled "Case Study Research Methods for Geographic Information Systems" (Onsrud, Pinto, and Azad 1992 and processes involved in implementing and using geographic information systems. References Onsrud, H., J. Pinto, and B. Azad (1992) Case study research methods for geographic information systems. URISA Journal, 4(l

  15. Wind Energy Information Guide 2004

    SciTech Connect (OSTI)

    anon.

    2004-01-01

    The guide provides a list of contact information and Web site addresses for resources that provide a range of general and technical information about wind energy, including general information, wind and renewable energy, university programs and research institutes, international wind energy associations and others.

  16. SYSTEMS BIOLOGY Accurate information transmission

    E-Print Network [OSTI]

    Tsimring, Lev S.

    SYSTEMS BIOLOGY Accurate information transmission through dynamic biochemical signaling networks) and variability in cellular states (extrinsic noise) degrade information transmitted through signaling networks-induced information loss. In the extracellular signal­regulated kinase (ERK), calcium (Ca2+ ), and nuclear factor

  17. National Center for Geographic Information

    E-Print Network [OSTI]

    California at Santa Barbara, University of

    . The impetus for the initiative is based on rapid changes in spatial information system technology and a desireNCGIA National Center for Geographic Information and Analysis NCGIA Research Initiative 7 and utility of visualization for understanding and analyzing information about the quality of GIS data

  18. National Center for Geographic Information

    E-Print Network [OSTI]

    California at Santa Barbara, University of

    of these two powerful technologies. Geographic information systems: · facilitate access to a variety of dataNCGIA National Center for Geographic Information and Analysis Remote Sensing and GIS Integration Research Agenda John E. Estes and Jeffrey L. Star National Center for Geographic Information and Analysis

  19. INTERNATIONAL WORKSHOP BIOMEDICAL INFORMATION EXTRACTION

    E-Print Network [OSTI]

    INTERNATIONAL WORKSHOP BIOMEDICAL INFORMATION EXTRACTION held in conjunction with the International BIOMEDICAL INFORMATION EXTRACTION PROCEEDINGS Borovets, Bulgaria 18 September 2009 ISBN 978-954-452-013-7 Designed and Printed by INCOMA Ltd. Shoumen, Bulgaria ii #12;Welcome to the Biomedical Information

  20. Information Technology and Web Science

    E-Print Network [OSTI]

    Rensselaer Graduate Studies Information Technology and Web Science Rensselaer nurtures a "low walls advanced study in the highly creative, interdisci- plinary field of Information Technology and Web Science to gain a breadth of IT knowledge: itws.rpi.edu #12;itws.rpi.edu Information Technology and Web Science

  1. Wavebob | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin,VillageWarrensourceCentre Jump to: navigation, searchWindJump

  2. Welt | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEtGeorgia: Energy Resources Jump to:Search YourIndiana: EnergyWells,WelshWelt

  3. Ziphany | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEtGeorgia:Illinois:WizardYates County,Zena, NewZhuluZipZone Technologies

  4. Unifin | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, New York: EnergyU.S.Unifin Jump to: navigation, search

  5. Uninova | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, New York: EnergyU.S.Unifin Jump to: navigation,

  6. Usivale | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, New York:PowerNewPumaty Jump to: navigation,Usivale Jump to:

  7. VELOcar | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, New York:PowerNewPumatyUvalde County, Texas:EnergyVELOcar Jump

  8. Vecarius | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, NewArkansas: Energy ResourcesVecarius Jump to: navigation,

  9. Velocys | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, NewArkansas: Energy ResourcesVecariusEnergy India Ltd Jump

  10. Ventures | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, NewArkansas: EnergyVentnor City, New Jersey: EnergyVentures

  11. Verdiem | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, NewArkansas: EnergyVentnor City, NewVerdi Energy Group Jump

  12. Vestas | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, NewArkansas:Standards JumpUSA Jump to: navigation, search

  13. Viewshed | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, NewArkansas:Standards JumpUSA(EC-LEDS) |Vietnam:Viewshed Jump

  14. Warmroof | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin,Village ofWaialua,Wallington,Solar CoFacility | Open

  15. Tinox | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013)Open EnergyTinox Jump to: navigation, search Name: Tinox Place:

  16. Trenergi | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013)OpenEnergyTrail CanyonsourceRiver Solar | Open EnergyTrenergi

  17. Tunnel | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al., 2013)OpenEnergyTrailTrosky,EnergyTullahassee,TunicaTunnel Jump to:

  18. Tussol | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, New York: Energy Resources JumpTuscaloosaI GeothermalTussol

  19. USFS | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, New York: EnergyU.S. EPA RegionforUStoNRCS Jump

  20. USGS | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-EnhancingEt Al.,Turin, New York: EnergyU.S. EPA RegionforUStoNRCS JumpJump to:

  1. Wind energy information guide

    SciTech Connect (OSTI)

    1996-04-01

    This book is divided into nine chapters. Chapters 1--8 provide background and annotated references on wind energy research, development, and commercialization. Chapter 9 lists additional sources of printed information and relevant organizations. Four indices provide alphabetical access to authors, organizations, computer models and design tools, and subjects. A list of abbreviations and acronyms is also included. Chapter topics include: introduction; economics of using wind energy; wind energy resources; wind turbine design, development, and testing; applications; environmental issues of wind power; institutional issues; and wind energy systems development.

  2. String | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren) JumpandStereoNewCreek FormationStratovolcanoOpenStressView

  3. Sungevity | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)Model for theSunLan Solar CoSungevity Jump to: navigation,

  4. Suniverse | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)Model for theSunLan Solar CoSungevity Jump to:Suniverse Jump

  5. Sunluz | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)Model for theSunLan Solar CoSungevity JumpSunluz Jump to:

  6. Sunreps | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)Model for theSunLan SolarKorea Jump to:Sunreps Jump to:

  7. Sunselex | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)Model for theSunLan SolarKorea JumpSunselex Jump to:

  8. Sunuser | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)Model for theSunLan SolarKoreaSuntechnics BelgiumSunuser

  9. TAHAFET | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)Model forTechnologies95Symerton,E C Center Inc aka TECT

  10. TECSTAR | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)Model forTechnologies95Symerton,E C CenterRegional

  11. TEEMP | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)Model forTechnologies95Symerton,E C CenterRegionalWebsite

  12. TESS | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)Model forTechnologies95Symerton,E CTEP Asia Ltd Jump

  13. TRUenergy | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing CapacityVectren)Model forTechnologies95Symerton,E CTEP AsiaTIAXTR1TRUenergy

  14. Growind | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County,Solar JumpInformationGrowind Jump to: navigation, search

  15. Grupovi | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainableGlynn County,Solar JumpInformationGrowind JumpIsidro JumpVolta

  16. General | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable UrbanKentucky: EnergyGateway EditOpen Energy InformationGeneral Jump

  17. Geotermia | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable UrbanKentucky: EnergyGateway1997)Information(EC-LEDS)studies

  18. Geothermometry | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View New PagesSustainable UrbanKentucky:BoreOpen Energy InformationOpen EnergyRocher,

  19. EGallon | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstrumentsAreaforInformation ECr TechnologiesEERE - JumpEGS

  20. EIS | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, Alabama (UtilityInstrumentsAreaforInformation ECr TechnologiesEERE - JumpEGSEIG

  1. Electrolysis | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTIONRobertsdale, AlabamaETEC GmbH Jump to:Providence,NewInformation atProject) |

  2. Resolar | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page onRAPID/Geothermal/Exploration/ColoradoRemsenburg-Speonk, New York: EnergyOpen EnergyInformation FishResolar Jump to:

  3. Solarezo | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity forSilicium deEnergyCompanySolarLabSolarcomplex AGSolarezo Jump to:

  4. Solavanti | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity forSiliciumEnergy Inc Jump to: navigation,Solasta aka TheSolavanti

  5. Solexel | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page| Open Energy Information Serbia-Enhancing Capacity forSiliciumEnergy Inc Jump to:Solergy Power Jump to:Solexant

  6. Moshanir | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland: EnergyInformation MontanaOhio:Hill,Morrisville, NewMoshanir Jump to:

  7. MTPV | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,Information MHKMHK5 < MHKKemblaSolar Jump to:Industries IncMTPV Jump

  8. Macy's | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,Information MHKMHK5 < MHKKemblaSolarMacoupin County,Macy's Jump to:

  9. Magpie | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,Information MHKMHK5 <Kentucky:York:Texas: EnergyMagpie Jump to:

  10. Maxwell | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas:Montezuma,InformationIllinois:Martin,OpenMatthews,Maverick County,MaxPowerMaxwell

  11. Korowatt | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrderInformationKizildereTexas:Solar Inc Jump to:Kornic Glory

  12. JEA | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History View NewTexas: Energy ResourcesOrder at 8,Open EnergyIssaquah,Energy Information Bar LJDSJEA

  13. Oceanlinx | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPI VenturesNewSt. Louis,Energy Information AreaCountyEnergyOceanaOceanlinx

  14. Ocenergy | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QAsource History ViewMayo, Maryland:NPI VenturesNewSt. Louis,Energy InformationOceanshore Ventures JumpOcenergy

  15. WIPP Stakeholder Information Page

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired SolarAbout /Two0 -UsingHeatInformationDevelopmentProgram*56 WIPP

  16. WIPP Stakeholder Information Page

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired SolarAbout /Two0 -UsingHeatInformationDevelopmentProgram*56 WIPP2007

  17. WIPP Stakeholder Information Page

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired SolarAbout /Two0 -UsingHeatInformationDevelopmentProgram*56 WIPP20078

  18. WIPP Stakeholder Information Page

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired SolarAbout /Two0 -UsingHeatInformationDevelopmentProgram*56 WIPP2007809

  19. WIPP Stakeholder Information Page

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired SolarAbout /Two0 -UsingHeatInformationDevelopmentProgram*56

  20. WIPP Stakeholder Information Page

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired SolarAbout /Two0 -UsingHeatInformationDevelopmentProgram*561 WIPP

  1. WIPP Stakeholder Information Page

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired SolarAbout /Two0 -UsingHeatInformationDevelopmentProgram*561 WIPP2 WIPP

  2. WIPP Stakeholder Information Page

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired SolarAbout /Two0 -UsingHeatInformationDevelopmentProgram*561 WIPP2

  3. WIPP Stakeholder Information Page

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home RoomPreservationBio-Inspired SolarAbout /Two0 -UsingHeatInformationDevelopmentProgram*561 WIPP25

  4. 2015 Information Repository Documents

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity of NaturalDukeWakefieldSulfateSciTechtail.TheoryTuesday, August 10, 2010 james-r.giusti@srs.govTuesday,25 Information

  5. Disposal Information - Hanford Site

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HAB PacketDiesel pricesCenter atDirectoryandDispelling a

  6. Freedom of Information Act

    Broader source: All U.S. Department of Energy (DOE) Office Webpages (Extended Search)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Homesum_a_epg0_fpd_mmcf_m.xls" ,"Available from WebQuantity ofkandz-cm11 Outreach Home Room NewsInformation Current HABFES OctoberEvanServicesAmesFour Los AlamosFranklinFred LoeblFOIA

  7. DASH | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler,CoalConcordiaConsumerLEDSEnergy Information aka

  8. DATAGRO | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler,CoalConcordiaConsumerLEDSEnergy Information akaDATAGRO Jump

  9. DEGERenergie | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar EnergyLawler,CoalConcordiaConsumerLEDSEnergy InformationDEFRA

  10. Pegasus | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LIST OFAMERICA'SHeavyAgency (IRENA)Options JumpOpenEIEnergy InformationPegasus

  11. AHERC | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LIST OFAMERICA'SHeavyAgencyTendo NewYanbu,Information onAD HydroCompanyAG

  12. Lynntech | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar2-0057-EAInvervarLeeds,Asia-PacificInformationLuxcaraNew

  13. Marcegaglia | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to: navigation, search Name:PowerInformationMantechMapMarcegaglia

  14. Invall | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar2-0057-EA JumpDuimenMakingBiofuelsInformationSociety ISESHydrogenInvall

  15. Invensil | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar2-0057-EA JumpDuimenMakingBiofuelsInformationSociety

  16. Libelula | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX E LISTStar2-0057-EAInvervarLeeds, United Kingdom:InformationLibelula Jump to:

  17. Rotartica | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION J APPENDIX ECoop Inc Jump to:Newberg,EnergyEast JumpInformation Sanjunyan SmallSManagement

  18. Sunhydro | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS ReportEuropeEnergy Information RecentSundrop Fuels IncSunhydro

  19. Sunmetrix | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS ReportEuropeEnergy Information RecentSundropEnergy Jump

  20. Sunrain | Open Energy Information

    Open Energy Info (EERE)

    AFDC Printable Version Share this resource Send a link to EERE: Alternative Fuels Data Center Home Page to someone by E-mail Share EERE: Alternative Fuels Data Center Home Page on Facebook Tweet about EERE: Alternative Fuels Data Center Home Page on Twitter Bookmark EERE: Alternative Fuels Data Center Home Page on Google Bookmark EERE: Alternative Fuels Data Center Home Page on QA:QA J-E-1 SECTION JEnvironmental Jump to:EA EIS ReportEuropeEnergy InformationSunrain Jump to: navigation, search