Powered by Deep Web Technologies
Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Evaluation of roller-type itch-relief device employing hot and cold alternating stimuli  

Science Conference Proceedings (OSTI)

An itch is a significant problem for many diseases and relief of itch without side effect is required. We focused on the fact that painful thermal stimulation inhibits the itch sensation. Based on two well-known phenomena, thermal grill illusion and ... Keywords: itch, thermal stimulation

Ryo Watanabe; Naoki Saito; Yuichiro Mori; Taku Hachisu; Michi Sato; Shogo Fukushima; Hiroyuki Kajimoto

2013-04-01T23:59:59.000Z

2

Development of roller-type itch-relief device employing alternating hot and cold stimuli  

Science Conference Proceedings (OSTI)

Painful thermal stimulation is known to inhibit itch, which is a significant problem in many diseases. We focused on thermal grill illusion and synthetic heat, which are well-known phenomena that can generate pain or burning sensation without physical ... Keywords: heat stimulation, itch, thermal, vibration

Ryo Watanabe; Taku Hachisu; Michi Sato; Shogo Fukushima; Hiroyuki Kajimoto; Naoki Saito; Yuichiro Mori

2013-03-01T23:59:59.000Z

3

STEM-ing the Tide | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

STEM-ing the Tide STEM-ing the Tide STEM-ing the Tide September 29, 2010 - 4:29pm Addthis Ali Zaidi Special Assistant to the Secretary of Energy Yesterday, the MacArthur Foundation rolled out its latest class of "geniuses" - 23 Americans who stand out because of their creativity and enterprise. Each recipient of the honor (and the $500,000 prize) has made an extraordinary contribution. One of those recipients is Amir Abo-Shaeer, an engineer in the aerospace and telecommunications industries who decided 10 years ago to go back to high school - this time as a teacher. At his alma mater, Dos Pueblos High School (in Santa Barbara, California), Amir created "a school within a school" built around a hands-on curriculum that helps students learn by connecting the ideas of physics, engineering and mathematics through

4

Personnel Change Notification ImagIng: GRSF/T  

E-Print Network (OSTI)

Personnel Change Notification OGS Form 3 ImagIng: GRSF/T Admit Year/Term: GS Web Front Desk: Office., reviewers, coordinators and chairs) Update: View all AIM Graduate Studies pages and enter decisions on GS02: Search for and view applicants; edit emails Connect: Add, search for and communicate with prospects

Hart, Gus

5

"Dark Web: Exploring and Min-ing the Dark Side of the Web"  

E-Print Network (OSTI)

Title: "Dark Web: Exploring and Min- ing the Dark Side of the Web" Speaker: Director, Prof will review the emerging research in Terrorism Informatics based on a web mining perspective. Recent progress in the internationally re- nowned Dark Web project will be reviewed, including: deep/dark web spider- ing (web sites

Michelsen, Claus

6

13:00 Begrung und Symposiumserffnung Prof. Dr.-Ing. Gerd Holbach  

E-Print Network (OSTI)

Windenergie-Gewinnung Dipl.-Ing. Jörgen Thiele Stiftung Offshore-Windenergie, Varel 14:45 Evolution der Meyer Werft GmbH, Papenburg 14:00 Energiewende als Chance und Heraus- forderung am Beispiel der Offshore challenges for ships and offshore structures (Englisch) Dr.-Ing. Bas Buchner, Maritime Research Institute

Berlin,Technische Universität

7

"Cook"ing at Y-12 for 70 years | Y-12 National Security Complex  

NLE Websites -- All DOE Office Websites (Extended Search)

"Cook"ing at Y-12 ... "Cook"ing at Y-12 ... "Cook"ing at Y-12 for 70 years Posted: December 5, 2013 - 4:48pm At a Nov. 14 visit to Y-12, National Nuclear Security Administration's Deputy Administrator for Defense Don Cook shared his outlook on the future and his thanks to employees for continuing their 70-year tradition of making America safer. "There are three things to remember," Cook told a meeting of NNSA Production Office and Y-12 employees. "We have an enduring mission. Y-12 plays a key role in it. And a nuclear deterrent remains the ultimate insurance policy for America." Cook also shared his thanks for preparing for the potential furlough in October because of the government shutdown and lack of appropriations. During what was the longest government shutdown to date, Cook said Y-12

8

TRANSPORTATION SYSTEMS are the build-ing blocks of modern society. Efficient and  

E-Print Network (OSTI)

TRANSPORTATION SYSTEMS are the build- ing blocks of modern society. Efficient and safe movement. How- ever, transportation systems by their very nature also affect the environment through operations, construction, and maintenance of transportation facilities, and through the travel behaviors they encourage

Wang, Yuhang

9

Water is used for many purposes, includ-ing growing crops, producing copper,  

E-Print Network (OSTI)

WATER USES Water is used for many purposes, includ- ing growing crops, producing copper, generating electricity, watering lawns, keeping clean, drinking and recreation. Bal- ancing the water budget comes down of the water budget. Reducing demand involves re- ducing how much water each person uses, lim- iting the number

10

ing system  

E-Print Network (OSTI)

Oct 29, 2002 ... GAs are search algorithms based on the mechanics of natural selection and natural genetics. They combine the concept of survival of the.

11

Scratching middle schoolers' creative itch  

Science Conference Proceedings (OSTI)

Each July since 2003, the author has directed summer camps that introduce middle school boys and girls to the basic ideas of computer programming. Prior to 2009, the author used Alice 2.0 to introduce object-based computing. In 2009, the author decided ... Keywords: 2-d animation, alice, computer science, games, gender, middle school, music, programming, scratch, summer camps, videos

Joel C. Adams

2010-03-01T23:59:59.000Z

12

Material development in the SI sub 3 N sub 4 system using glass encapsulated Hip'ing  

DOE Green Energy (OSTI)

This report covers a two-year program to develop fully dense Si{sub 3}N{sub 4} matrix SiC whisker composites with enhanced properties over monolithic Si{sub 3}N{sub 4} materials. The primary goal was to develop a composite with a fracture toughness > 10 MPa{radical}m, capable of using high pressure glass encapsulated HIP'ing. Coating methods were developed to apply thin (<150nm) stoichiometric BN layers to SiC whiskers and also to apply a dual coating of SiC over carbon to the whiskers. Fracture toughness of the composites was determined to increase as the quantity of whiskers (or elongated grains) with their axis perpendicular to the crack plane increased. Of the interface compositions evaluated in this effort, carbon was determined to be the most effective for increasing toughness. The highest toughnesses (6.8--7.0 MPa{radical}m) were obtained with uniaxially aligned carbon coated whiskers. There was no evidence of the carbon coating compromising the oxidation resistance of the composites at 1370{degree}C.

Corbin, N.D.; Sundberg, G.J.; Siebein, K.N.; Willkens, C.A.; Pujari, V.K.; Rossi, G.A.; Hansen, J.S.; Chang, C.L.; Hammarstrom, J.L.

1992-04-01T23:59:59.000Z

13

Publications Dipl.-Ing. Ing. Hana Krsn (ne Spickov)  

E-Print Network (OSTI)

analýzu VLBI dat. Konferenz des CEDR ­ Center for Earth's Dynamic Research. Trest, Czech Republic, 14 ­ 16

Schuh, Harald

14

Material development in the SI{sub 3}N{sub 4} system using glass encapsulated Hip`ing. Final report, Phase 2: DOE/ORNL Ceramic Technology Project  

DOE Green Energy (OSTI)

This report covers a two-year program to develop fully dense Si{sub 3}N{sub 4} matrix SiC whisker composites with enhanced properties over monolithic Si{sub 3}N{sub 4} materials. The primary goal was to develop a composite with a fracture toughness > 10 MPa{radical}m, capable of using high pressure glass encapsulated HIP`ing. Coating methods were developed to apply thin (<150nm) stoichiometric BN layers to SiC whiskers and also to apply a dual coating of SiC over carbon to the whiskers. Fracture toughness of the composites was determined to increase as the quantity of whiskers (or elongated grains) with their axis perpendicular to the crack plane increased. Of the interface compositions evaluated in this effort, carbon was determined to be the most effective for increasing toughness. The highest toughnesses (6.8--7.0 MPa{radical}m) were obtained with uniaxially aligned carbon coated whiskers. There was no evidence of the carbon coating compromising the oxidation resistance of the composites at 1370{degree}C.

Corbin, N.D.; Sundberg, G.J.; Siebein, K.N.; Willkens, C.A.; Pujari, V.K.; Rossi, G.A.; Hansen, J.S.; Chang, C.L.; Hammarstrom, J.L.

1992-04-01T23:59:59.000Z

15

Hydraulic fractur ing--also called hy  

E-Print Network (OSTI)

reported four species of pollinators (Riley, 1892; Davis, 1967; Frack, 1982; Powell, 1984), including three

Goodman, Robert M.

16

E(Race)ing gender: Stratified identities  

E-Print Network (OSTI)

In the discussion that follows, I will examine, on the broadest level, Hurston's complex negotiation of identity, as manifested in Their Eyes Were Watching God. Central to this investigation is an understanding of the strategies that women, specifically African American women, have adopted, under the auspices of marriage and the patronage system, to seek an equal place within a hegemonic culture. Most importantly, I want to address the cultural and social price exacted for accepting (as seen in the appropriation of white standards, and rejecting (as seen in Janie's trial for her husband's death) those institutions as the basis of one's identity. The cultural and social price that Janie pays, furthermore, challenges her adaptive capacity to stratify her racial and gender identity. Finally, it exacts a toll on the community as a whole, a fact Hurston repeatedly suggests by illustrating the extent to which the community has absorbed hegemonic standards of value and beauty with little or no inspection of or reflection on the effects to itself or to its individual members.

Nguyen, Le Thuy Thi

2000-01-01T23:59:59.000Z

17

IMPROVED GROOVING TOOL FOR TU ING  

te hnology readiness level: 6 a market deliverable has been demonstrated in relevant environments and is in final development . author: alexandra ...

18

Go-ing for the prediction of protein folding mechanisms  

E-Print Network (OSTI)

of Chemistry, Faculty of Science, Kobe University, Kobe, 657-8501, Japan Protein folding has been a long-lived could be relatively simple. These three ingredients are linked together with an almost one-line free work (8, 9). The surprise of the three papers is that apparently one can have both simplicity and fair

Takada, Shoji

19

The physical function-ing of a city sometimes  

E-Print Network (OSTI)

insurance. It is recommended that parents carefully review their homeowners, auto and health insurance. Parents should check their homeowners policy to see whether it will cover a student's possessions while

20

DOE/EIA  

U.S. Energy Information Administration (EIA) Indexed Site

EIA EIA -0515(88 ) Septemb er 1991 Ma nuf act urin g Fue l-Sw itch ing Ca pab ility 198 8 1 6 6 1 : 6 u i i u t i d s n / i u i p s / d w B s s i u s i d B u f j n i o e t n u e w e t / j ; o e o o S I U B S B J ^ B J A / e u f / a / « / j : o ; o y d J M O O i u d g ' w e e 6 1 0 0 - S / 2 - Z 0 2 - 1 X V d 8 G Z C - C 8 Z ( 2 0 3 ) 0 0 ' u o i S u m s e M I U 9 U J U J 9 A O O s n 1 0 l u e p u a t u u s d n s ' 9 u > n ' u i d s - u u e g 1 9 U - 9 8 S 0 0 9 8 - 9 6 9 0 0 ' i u o o u ' f t u i u o i ; s J i s | U ( i u p v U O I I B U J J O J U I : s « o i ( O j s e e j e s j n o g p u e ' s j e o i u n u a u o g d o i a i ' s e s s e j p p v ' | i ? i u A q j e i u a o a g j 0 1 p a i o e i i p a o p i n o g s s o n s u e i s A B j ^ u a u o 6 u | ] u u d l u e i i i u j S A O O a g i U K > J | p d u i e i q o e q A e u i s u o i - u i O u i s e i j o j n d a o « ( t O B m i u i i d j u e u j u j e A o o g n s i u a u m a o a t o 6 u | j e e g J D J a o * A d p s u o ! i e o i u n u j u j o 3 « | 9 t j o U O I I ^ N s , v i 3 j o 1 8 ^ 1 0 j o s u j i » ) u i o j | p a s m p j n d e q A e t u u t x i s a i t q n d s n u DOE/EIA-0515(88) Distribution Category UC-98 Manufacturing Fuel-Switching

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

CANTON LAKESHORE CANTON E BEST CON NEAUT GIDD INGS EAST N ELLSWORT  

U.S. Energy Information Administration (EIA) Indexed Site

MCKEESPORT MCKEESPORT COR AOPOLIS-MOON REDHAW ST. CLAIR SC ROGGSFIELD FRANKLIN -OAK FOREST RIMERSBURG RENNERD AL E GREENVILL E PAT MOS CRABTR EE BLAC K ASH ROYALT ON N BAKERSTOWN QUEEN ROU GH RUN LUCAS BLAC K H ILL CRESTON WAT TSVILLE WADSWORTH -NORT H OAKLAN D HOM EWORT H UNIT Y ESSELBRUN ALAMED A PAR K-CROOKED RU CHERRY GROVE FRENC HTOWN ST EWART RUN MILL C REEK GLENF IELD-MOU NT NEBO HICKORY E HARRISVILLE E LEST ER GRIGGS CORNERS EN GLAN D WEST VIL LE LAKE BAILEY LAKE OAKFORD BR UNSWICK N HOR ACE WALBORN RESERVOIR YOUN GSVILLE RPD-LORAIN -1 INGOMAR-GRUBBS BIG MEADOWS GARD EN ISLE TURT LE CREEK LEWIST ON E BR USH CR EEK FOOT VILLE BU LL CREEK BESSEMER EAGLEVILLE LIVER POOL E RIDGEVILLE E EVANS CIT Y GUIT ONVILLE WOLF S COR NERS WIN DFALL ABBEYVILLE ROC K CAMP LEATH ER WOOD AR COLA CR EEK MEC HANICST OWN NINE MILE RU N WALKCHALK RENFR EW-MCCALMONT BU FFALO N VALENCIA WELLIN GT ON

22

ing the distribution of those galaxies, the way they clump and spread out, scientists  

E-Print Network (OSTI)

illuminated realms as small as a single molecule and as large as a gamma ray burst. of the Year Agony ex- plosions in the universe: titanic blasts of en- ergy called gamma ray bursts (GRBs). Most notably of black holes and other phenomena in the gamma ray region of the spectrum. And the Wilkinson Microwave

Yildiz, Ahmet

23

SUSTAINABILITY EXCELLENTIA CoLumbIA ENgINEErINg130  

E-Print Network (OSTI)

. Journal of "Solar Energy Materials and Solar Cells". Proceedings of IEEE Photovoltaic Specialist Conferences. Proceedings of European Photovoltaic Solar Energy Conferences. #12;Module 2/Photovoltaics, Wiley, 1995. R.H.Bube, Photovoltaic Materials, Imperial College Press, 1998. Journal of "Solar Energy

24

SUSTAINABILITY EXCELLENTIA CoLumbIA ENgINEErINg102  

E-Print Network (OSTI)

when carbon dioxide is introduced into thermal conversion processes such as the gasification of coal to syngas, leaving behind only a carbonless char. Castaldi estimates that if the biomass were used

25

Spring'ing' Forward Into the Finals . . . Of A Competition Like...  

Office of Science (SC) Website

& Testimony Recovery Act Contact Information Office of Science U.S. Department of Energy 1000 Independence Ave., SW Washington, DC 20585 P: (202) 586-5430 03.11.13...

26

'March'ing Into The Finals . . . Of A Competition Like No Other  

Office of Science (SC) Website

& Testimony Recovery Act Contact Information Office of Science U.S. Department of Energy 1000 Independence Ave., SW Washington, DC 20585 P: (202) 586-5430 03.04.13...

27

Power Electronics and Electrical Drives Prof. Dr.-Ing. Joachim Bcker  

E-Print Network (OSTI)

, e.g. Interior permanent magnet synchronous motors (IPMSM)Interior permanent magnet synchronous rings Permanent Magnet Synchronous Motor integrated into the rotor outlines Active magnetic bearing motors (IPMSM) Switched reluctance drives FPGA based control Self optimizing systems (Collaborative

Noé, Reinhold

28

Programme Coordination Professor Dr.-Ing. habil. Dr. h. c. Karl J. Thom-Kozmiensky  

E-Print Network (OSTI)

Waste Management · Recycling · Waste-to-Energy Recovery of Biowastes · Mechanical-Biological Treatment of the European Suppliers of Waste to Energy Technology (ESWET), Brussels, Belgium 10.30 Hrs. Waste Framework.V., Gent, Belgium 12.30 Hrs. Waste incineration in the 21st century ­ Energy-efficient and climate

Hone, James

29

Wolfram Hoefer, Dr.-Ing. Assistant Professor Department of Landscape Architecture  

E-Print Network (OSTI)

Landentwicklung. Gärtner im Garten- und Landschaftsbau. (State exam for professional degree as gardener, landscape Ltd. London 1984-86 Apprenticeship as landscape gardener with Hermann Kretz, Garten und Landschaftsbau

Goodman, Robert M.

30

Pico-ing into the future of mobile projection and contexts  

Science Conference Proceedings (OSTI)

Ten years ago, we were on the verge of having cameras built into our mobile phones, but knew very little about what to expect or how they would be used. Now we are faced with the same unknowns with mobile projector phones. This research seeks to explore ... Keywords: Diary study, Experience sampling, Mobile, Pico-projectors

Max L. Wilson; Dan Craggs; Simon Robinson; Matt Jones; Kristian Brimble

2012-01-01T23:59:59.000Z

31

Koordination: Prof. Dr.-Ing. J. Seume Institut fr Turbomaschinen und Fluid-Dynamik  

E-Print Network (OSTI)

of installation of offshore wind farms (from Wiese 2008: Auswirkungen der Offshore-Windenergie auf den Betrieb von and offshore applications require appropriate planning and design. For most of them, statistics of extreme wind coastDat have been used in a large variety of coastal, offshore and terrestrial applications

32

Sandra Koch Dipl.-Ing. (FH) Telefon: 04921-807-1489  

E-Print Network (OSTI)

die Voraussetzung geschaffen, um die Stromerzeugung aus Windenergie Offshore langfristig erfolgreich geschaffen, um die Stromerzeugung aus Offshore Windenergie langfristig erfolgreich und effizient entwickeln-02 Bestimmung von Wärme- und Impulsfluss in der marinen atmosphärischen Grenzschicht für die Offshore

Damm, Werner

33

CANTON LAKESHORE CANTON E BEST CON NEAUT GIDD INGS EAST N ELLSWORT  

Annual Energy Outlook 2012 (EIA)

RURAL RID GE ROWSBUR G SH ERRETT MON AC A QUEEN JUN CTION YELLOW CR EEK SMELTZ ER CAT FISH R UN POLK E JEROMESVILLE N FLORENCE-FIVE POINTS ATEN CLARINGTON MILLERSBURG...

34

Following weeks of purging and organiz-ing, phase one of the School's reloca-  

E-Print Network (OSTI)

in August. The depart- ments of Consumer Science and Human Development and Family Studies, as well as UW from top: Gloria McCord, Human Ecology financial specialist, casts a spell at the punch-bowl cauldron

Sheridan, Jennifer

35

INFORMATION EXCELLENTIA CoLumbIA ENgINEErINg238  

E-Print Network (OSTI)

that bends and twists. "Computers, geometry, and physics are my ingredients. I mix them up in a bowl and what science as well. B.A.Sc., University of Toronto (Canada), 1997; M.S., California Institute of TechnologySPUn Associate Professor of Computer Science #12;

Hone, James

36

SUSTAINABILITY EXCELLENTIA CoLumbIA ENgINEErINg 141  

E-Print Network (OSTI)

- onry is also crucial to their safe storage. Plutonium, an active ingredient in nuclear weap- ons, has to determine how the electrons within these materials will behave. "The plutonium in the weapons ages, and we have to be able to predict the proper- ties of plutonium under a variety of conditions," Chris

37

Protective interior wall and attach8ing means for a fusion reactor vacuum vessel  

DOE Patents (OSTI)

An array of connected plates mounted on the inside wall of the vacuum vessel of a magnetic confinement reactor in order to provide a protective surface for energy deposition inside the vessel. All fasteners are concealed and protected beneath the plates, while the plates themselves share common mounting points. The entire array is installed with torqued nuts on threaded studs; provision also exists for thermal expansion by mounting each plate with two of its four mounts captured in an oversize grooved spool. A spool-washer mounting hardware allows one edge of a protective plate to be torqued while the other side remains loose, by simply inverting the spool-washer hardware.

Phelps, Richard D. (Greeley, CO); Upham, Gerald A. (Valley Center, CA); Anderson, Paul M. (San Diego, CA)

1988-01-01T23:59:59.000Z

38

METHOD FOR REDU ING A KGROUND LUTTER IN A AMERA IMAGE  

... bulky and heavy, expensive, fragile, short-range, sensitive to vibration, and unreliable for outdoor use in bright sunlight conditions. The ...

39

SOLAR TRA ING SENSORS FOR MAXIMUM SOLAR ON ENTRATOR EFFI IEN Y  

POTENTIAL APPLI ATIONS Parabolic dish & trough solar concentrating collectors Solar energy and renewable energy Electric utility

40

Kurzlebenslauf (CV) Stand September 2011 Dr.-Ing. Diplom-Physiker  

E-Print Network (OSTI)

:30 Panel: Erneuerbare Energien: Rentable Investitionen oder teure Experimente? Christof Stein (KfW Bank) Dr für Klima, Umwelt und Energie) Matthias Willenbacher (JuWi Holding) Moderation: Monika Seynsche

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

whITe PaPer The ChaNgINg DYNaMICS OF  

E-Print Network (OSTI)

of the smart grid, which integrates AMI with distribution automation and other tech- nologies to connect consumers Network Automation And Analytics Smart Meters Distributed Generation Today: Centralized and One smart grid and advanced metering deployments. Bob Brnilovich, IBM www.UtilitiesProject.com/10803

42

Institutsleitung: Univ.-Prof. Dr.-Ing. Prof. E.h. Dr.-Ing. E.h. Dr. h.c. mult. Engelbert Westkmper Kontakt: Birgit Spaeth Presse-und ffentlichkeitsarbeit  

E-Print Network (OSTI)

Universitätsprofessor ernannt wird. Thomas Bauernhansl, 1969 im fränkischen Miltenberg geboren, hat Maschinenbau an der

Möbius, Bernd

43

Technical Report Documentation Page 1. Report No.  

E-Print Network (OSTI)

.-Ing. Biljana Milivojevic Dipl.-Ing. Vitali Mirvoda Stip. Dipl.-Ing. Timo Pfau Dr.-Ing. David Sandel Dr

44

The Burning Man festival is a unique happen-ing. For one week in September every year,  

E-Print Network (OSTI)

spaces, the city as it alters over the seven days and from year to year, exhibiting emergent properties- ance of oversized gas-guzzling camper vans, fossil-fuel-powered generators and gratuitous combustion, it is no Utopia. But the City's Alternative Energy Zone, with its huge bank of solar panels, multiple experiments

Bourne, Philip E.

45

58 UTS ANNUAL REPORT 2008 sUppoRtING oUR objEctIvEs  

E-Print Network (OSTI)

improvingenvironmentalsustainabilityin ourcampusoperations.Itisoverseenby asteeringcommitteeandsevenworking groups:waste,transport,energy into the atmosphere. The proposal from students Antony Henry and Kavit Pandya was to put this wasted energy through Energy-efficientlightinginmorethan> 60percentoftheUniversity Savingtheequivalentof45Olympic

University of Technology, Sydney

46

Tactical urbanism, public policy reform, and 'innovation spotting' by government : from Park(ing) Day to San Francisco's parklet program  

E-Print Network (OSTI)

This thesis examines the prospects and impacts of tactical urbanism (TU). While tactical urbanism remains primarily a subcultural movement, it is beginning to gain traction in popular culture in traditionally politically ...

Davidson, Mariko Mura

2013-01-01T23:59:59.000Z

47

Cultivat(ing) modernities : the Society for National Heritage, political propaganda and public architecture in twentieth-century Iran  

E-Print Network (OSTI)

Beginning in 1922, under the auspices of the Pahlavi dynasty of Iran, the tombs of selected historical figures were systematically destroyed to make way for modern mausoleums erected as metaphors for an "Aryan" nation in ...

Grigor, Talinn, 1972-

2005-01-01T23:59:59.000Z

48

HOW ENVIRONMENTAL RISK FROM LEACH ING OF HEAVY METALS IN ASH RESIDUES FROM COMBUSTION OF MUNIC IPAL SOLID WASTE  

E-Print Network (OSTI)

Laboratories which led to the use of acid tests such as the EP and TCLP tests. [25] 13 #12;CONCLUSIONS and soluble metals in the ash from Waste-to Energy (WTE) facilities has led to a public concern about why has led to the requirement for continuous monitoring of oxygen , carbon monoxide (CO) , and acid gases

Columbia University

49

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings...

50

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings*...

51

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings*...

52

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Intensity (thousand Btusquare foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

53

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Revised: December, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings...

54

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Electricity Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

55

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Major Fuel Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

56

Clemson University Preservation master Plan Part III: ExIstIng CondItIons ChaPtEr Four FEbruary 2009 JMa, InC. 70  

E-Print Network (OSTI)

,337 CFDA # 15.922 - Native American Graves Protection and Repatriation Act Direct Federal Awards 16,227 525,830 - 4,830 Lawrence Berkeley Natl Lab RF HANFORD SEDM THOMP-6875736 48,614 2,965 45,649 Savannah River Nuclear Solutns RF RIVERBASIN GRUND-AC716760 132,105 9,248 122,857 Savannah River Nuclear Solutns RF SUP

Stuart, Steven J.

57

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

Tar Balls from Smoldering Biomass Combustion. Atmos. Chem.gases and particles from biomass burning in Brazil, J. Ge-for smoke from African biomass burning, J. Geophys. Res. ,

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

58

MICRO-MACHINED THIN FILM HYDROGEN GAS SENSORS Frank DiMeo, Jr., Ing-Shin Chen, Philip Chen, Jeffrey Neuner  

E-Print Network (OSTI)

;Introduction The reputation of hydrogen as the next generation energy delivery agent, supplementing electricity of Electric Power Research Institute, in a recent The Industrial Physicist column, observed the multifaceted as a national security priority. While fuel cell cars often feature prominently in news media and are touted

59

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

2001. Kerminen, V. -M. , Makela, T. E. , Ojanen, C. H. ,Saarikoski, S. , Frey, A. , Mkel, T. , and Hillamo, R. :Acker, K. , Hillamo, R. , Mkel, T. : Intercomparison of

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

60

Early and sustained interventions which strongly feature mentoring are essential in help-ing Native American and Latino students navigate an unfamiliar academic system that is  

E-Print Network (OSTI)

(Navajo) is the largest, with 170,000 members. Others include the Oglala Sioux, Cherokee Nation, Blackfeet

Benitez-Nelson, Claudia

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61
62

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

DOE Green Energy (OSTI)

Aerosol samples were collected at a pasture site in the Amazon Basin as part of the project LBA-SMOCC-2002 (Large-Scale Biosphere-Atmosphere Experiment in Amazonia - Smoke Aerosols, Clouds, Rainfall and Climate: Aerosols from Biomass Burning Perturb Global and Regional Climate). Sampling was conducted during the late dry season, when the aerosol composition was dominated by biomass burning emissions, especially in the submicron fraction. A 13-stage Dekati low-pressure impactor (DLPI) was used to collect particles with nominal aerodynamic diameters (D{sub p}) ranging from 0.03 to 0.10 m. Gravimetric analyses of the DLPI substrates and filters were performed to obtain aerosol mass concentrations. The concentrations of total, apparent elemental, and organic carbon (TC, EC{sub a}, and OC) were determined using thermal and thermal-optical analysis (TOA) methods. A light transmission method (LTM) was used to determine the concentration of equivalent black carbon (BC{sub e}) or the absorbing fraction at 880 nm for the size-resolved samples. During the dry period, due to the pervasive presence of fires in the region upwind of the sampling site, concentrations of fine aerosols (D{sub p} < 2.5 {mu}m: average 59.8 {mu}g m{sup -3}) were higher than coarse aerosols (D{sub p} > 2.5 {mu}m: 4.1 {mu}g m{sup -3}). Carbonaceous matter, estimated as the sum of the particulate organic matter (i.e., OC x 1.8) plus BC{sub e}, comprised more than 90% to the total aerosol mass. Concentrations of EC{sub a} (estimated by thermal analysis with a correction for charring) and BCe (estimated by LTM) averaged 5.2 {+-} 1.3 and 3.1 {+-} 0.8 {mu}g m{sup -3}, respectively. The determination of EC was improved by extracting water-soluble organic material from the samples, which reduced the average light absorption {angstrom} exponent of particles in the size range of 0.1 to 1.0 {mu}m from > 2.0 to approximately 1.2. The size-resolved BC{sub e} measured by the LTM showed a clear maximum between 0.4 and 0.6 m in diameter. The concentrations of OC and BC{sub e} varied diurnally during the dry period, and this variation is related to diurnal changes in boundary layer thickness and in fire frequency.

Soto-Garcia, Lydia L.; Andreae, Meinrat O.; Andreae, Tracey W.; taxo, Paulo Ar-; Maenhaut, Willy; Kirchstetter, Thomas; Novakov, T.; Chow, Judith C.; Mayol-Bracero, Olga L.

2011-06-03T23:59:59.000Z

63

CS-03-02 A PIvotIng PRocEDuRE FoR A ClAss oF SEconD-oRDER ...  

E-Print Network (OSTI)

linear function over an intersection of an affine set and second-order cones. SOCP is a .... Note that the e q uality constraints of does not contain!7# .

64

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

Crutzen, P. : Atmospheric Aerosols: Biogeochemical sourcesof optically active aerosol particles over the Amazonproperties of Amazonian aerosol particles: Rev. Geophys. ,

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

65

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

Science Conference Proceedings (OSTI)

Aerosol samples were collected at a pasture site in the Amazon Basin as part of the project LBA-SMOCC-2002 (Large-Scale Biosphere-Atmosphere Experiment in Amazonia - Smoke Aerosols, Clouds, Rainfall and Climate: Aerosols from Biomass Burning Perturb Global and Regional Climate). Sampling was conducted during the late dry season, when the aerosol composition was dominated by biomass burning emissions, especially in the submicron fraction. A 13-stage Dekati low-pressure impactor (DLPI) was used to collect particles with nominal aerodynamic diameters (D{sub p}) ranging from 0.03 to 0.10 m. Gravimetric analyses of the DLPI substrates and filters were performed to obtain aerosol mass concentrations. The concentrations of total, apparent elemental, and organic carbon (TC, EC{sub a}, and OC) were determined using thermal and thermal-optical analysis (TOA) methods. A light transmission method (LTM) was used to determine the concentration of equivalent black carbon (BC{sub e}) or the absorbing fraction at 880 nm for the size-resolved samples. During the dry period, due to the pervasive presence of fires in the region upwind of the sampling site, concentrations of fine aerosols (D{sub p} aerosols (D{sub p} > 2.5 {mu}m: 4.1 {mu}g m{sup -3}). Carbonaceous matter, estimated as the sum of the particulate organic matter (i.e., OC x 1.8) plus BC{sub e}, comprised more than 90% to the total aerosol mass. Concentrations of EC{sub a} (estimated by thermal analysis with a correction for charring) and BCe (estimated by LTM) averaged 5.2 {+-} 1.3 and 3.1 {+-} 0.8 {mu}g m{sup -3}, respectively. The determination of EC was improved by extracting water-soluble organic material from the samples, which reduced the average light absorption {angstrom} exponent of particles in the size range of 0.1 to 1.0 {mu}m from > 2.0 to approximately 1.2. The size-resolved BC{sub e} measured by the LTM showed a clear maximum between 0.4 and 0.6 m in diameter. The concentrations of OC and BC{sub e} varied diurnally during the dry period, and this variation is related to diurnal changes in boundary layer thickness and in fire frequency.

Soto-Garcia, Lydia L.; Andreae, Meinrat O.; Andreae, Tracey W.; taxo, Paulo Ar-; Maenhaut, Willy; Kirchstetter, Thomas; Novakov, T.; Chow, Judith C.; Mayol-Bracero, Olga L.

2011-06-03T23:59:59.000Z

66

Evaluation of the carbon content of aerosols from the burn- ing of biomass in the Brazilian Amazon using thermal, op- tical and thermal-optical analysis methods  

E-Print Network (OSTI)

from Smoldering Biomass Combustion. Atmos. Chem. Phys. , 10,aerosols emitted during biomass combustion [Robinson et al.burning samples. Combustion of biomass produces EC a and

Soto-Garcia, Lydia L.

2012-01-01T23:59:59.000Z

67

Understanding the Effect of Baseline Modeling Implementation Choices on Analysis of Demand Response Performance  

E-Print Network (OSTI)

IEEE Transactions on Smart Grid, ings. Journal of Solaroperations. With continu- ing Smart Grid development, there

Addy, Nathan

2013-01-01T23:59:59.000Z

68

Table E6. Electricity Consumption (kWh) Intensities by End Use ...  

U.S. Energy Information Administration (EIA)

Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other All Buildings* ..... ...

69

Table E4. Electricity Consumption (Btu) Intensities by End Use ...  

U.S. Energy Information Administration (EIA)

Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other All Buildings* ..... ...

70

Table E3A. Electricity Consumption (Btu) by End Use for All ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters ...

71

Table E4A. Electricity Consumption (Btu) Intensities by End ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters ...

72

Table E1. Major Fuel Consumption (Btu) by End Use for Non-Mall ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other

73

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Electricity Consumption (billion kWh) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

74

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Energy Intensity (kWhsquare foot) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

75

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Survey: Energy End-Use Consumption Tables Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other...

76

Table E5A. Electricity Consumption (kWh) by End Use for All ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other

77

Table E6A. Electricity Consumption (kWh) Intensities by End Use ...  

U.S. Energy Information Administration (EIA)

Released: September, 2008 Total Space Heat-ing Cool-ing Venti-lation Water Heat-ing Light-ing Cook-ing Refrig-eration Office Equip-ment Com-puters Other

78

Tel. +49-541-969 2872/2890 -Fax. +49-541-969 1221/2262 -Email. Junge@uni-osnabrueck.de 1 Prof. Dr.-Ing. Wolfgang Junge Gutenbergstrae 36, 49076 Osnabrck  

E-Print Network (OSTI)

for Biophysics, Osnabrück 1992 95th Conference of the Deutsche Bunsengesellschaft für Physikalische Chemie, Jena Chemie Deutsche Gesellschaft für Biophysik Deutsche Gesellschaft für Naturforscher und ?rzte Gesellschaft for Biophysics Chair 1984-1985 Section "Membranes" of Gesellschaft für Biologische Chemie, Board Member 1987

Junge, Wolfgang

79

Automatic annotation of organellar genomes with DOGMA  

E-Print Network (OSTI)

for 98 chloroplast protein cod- ing genes (with two entriessimilarly to the protein cod- ing genes, except that

Wyman, Stacia; Jansen, Robert K.; Boore, Jeffrey L.

2004-01-01T23:59:59.000Z

80

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

Mitarbeiter und Stipendiaten Dr. Olaf Adamczyk Dr.-Ing. Suhas Bhandare Stip. M. Sc. Mohamed Ebrahim Fahmy Taha El-Darawy Stip. M. Sc. Vijitha Herath M. Sc. Ariya Hidayat Dipl.-Ing. Sebastian Hoffmann Dr Stip. Dipl.-Ing. Timo Pfau Dr.-Ing. David Sandel Dr.-Ing. Sunil Survaiya Dr.-Ing. Hongbin Zhang

Noé, Reinhold

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Short Desc Long Desc Short Desc Long Desc Short Desc Long Desc Short Desc Long Desc 401k 401k D PP PT2 Dental Pre-Paid PT 2 Misc Miscellaneous Deductions ROTH ROTH 401(k)  

E-Print Network (OSTI)

FICA Additional Medicare Tax ORP ING1 ORP Retirement ING 10% TCRS NF TCRS Retirement Non-Faculty AFLACSIC Aflac - Sickness Indemnity Foundat Foundation ORP ING2 ORP Retirement ING Two Split TCRS TCB Closed Teacher Class B Contrib AFLCIEET Aflac - Critical ILL-EE-Tobacco Foundat ETSU Foundation ORP ING3

Karsai, Istvan

82

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

Bhandare M. Sc. Abas Ahmad Fauzi Stip. M. Sc. Vijitha Herath M. Sc. Ariya Hidayat Dipl.-Ing. Sebastian Hoffmann M. Sc. Selwan K. Ibrahim Dr.-Ing. Biljana Milivojevic Dipl.-Ing. Vitali Mirvoda Stip. Dipl

Noé, Reinhold

83

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 222 194 17...

84

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings ... 2,100...

85

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 1,928 1,316...

86

Proceedings of the TOUGH Symposium 2009  

E-Print Network (OSTI)

and oil recovery by waterflood- ing, SPE ReservoirY. and N.R. Morrow, Waterflood performance by injection ofof low-salinity waterflood- ing, the exact mechanisms

Moridis, George J.

2010-01-01T23:59:59.000Z

87

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Energy Consumption Survey: Energy End-Use Consumption Tables Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

88

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

cubic feet) Natural Gas Energy Intensity (cubic feetsquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

89

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 1,870 1,276...

90

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

(trillion Btu) Fuel Oil Energy Intensity (thousand Btusquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

91

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

(million gallons) Fuel Oil Energy Intensity (gallonssquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

92

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Btu) District Heat Energy Intensity (thousand Btusquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

93

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

Btu) Natural Gas Energy Intensity (thousand Btusquare foot) Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All...

94

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings* ... 1,602 1,397...

95

Total Space Heating Water Heating Cook-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Total Space Heating Water Heating Cook- ing Other Total Space Heating Water Heating Cook- ing Other All Buildings ... 2,037...

96

DON'T LET THE BED BUGS BITE We've all heard the saying, "sleep tight, don't let the bed bugs bite." Most of us have never  

E-Print Network (OSTI)

and appear bright red after feeding. The wings of bed bugs are vestigial, so they cannot fly. Bed bugs can. Small, flat, or raised bumps on the skin are the most common sign; redness, swelling, and itching

Bertini, Robert L.

97

Aberdeen can teach you a thing or two. This bustling city by the sea  

E-Print Network (OSTI)

describe Aberdeen? It's a really cosmopolitan, welcoming city. The night scene is splendid. You go from pub with potential, this cosmopolitan city by the sea is just itching to spring some surprises. Here, broad

Levi, Ran

98

Medical Sites  

NLE Websites -- All DOE Office Websites (Extended Search)

Medical Sites Name: Jenielle Location: NA Country: NA Date: NA Question: I started itching Aug. 1999. Diagnosed with ITP Oct.1999. I am in remission With a platelet count in...

99

The Decline and Death of Nuclear Power  

E-Print Network (OSTI)

9. The Economist (2012). Nuclear power: The 30-year itch.Germany and France, the anti-nuclear movement has taken suchtime since the Cold War, nuclear power plants are being

Melville, Jonathan

2013-01-01T23:59:59.000Z

100

Economic Contributions of the California Nursery Industry  

E-Print Network (OSTI)

energy and input costs, government regulation, chang- ing market structure, competition, information,

Carman, Hoy; Rodriguez, Ana Maria

2004-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Short-Term Energy Outlook - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

102

Arizona - State Energy Profile Overview - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

103

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

Wissenschaftliche Mitarbeiter und Stipen- diaten Dr. Olaf Adamczyk Stip. M. Sc. Ali Al-Bermani Stip. M. Sc. Mohamed Ebrahim Fahmy Taha El-Darawy Stip. M. Sc. Vijitha Herath M. Sc. Ariya Hidayat Dr.-Ing. Sebastian Hoffmann Dipl.-Ing. Benjamin Koch Dr. rer. nat. Manfred Lichtinger Dr.-Ing. Vitali Mirvoda Stip. Dipl.-Ing. Timo

Noé, Reinhold

104

fr Elektrotechnik und Informationstechnik  

E-Print Network (OSTI)

/2009 ­ 02/2010) Prof. Dr.-Ing. Reinhold Noé Personal Wissenschaftliche Mitarbeiter und Stipendiaten Stip. M. Sc. Ali Al-Bermani Stip. M. Sc. Mohamed Ebrahim Fahmy Taha El-Darawy Stip. M. Sc. Vijitha Herath Dr.-Ing. Timo Pfau Stip. M. EE. Kidsanapong Puntsri Dr.-Ing. David Sandel Dr.-Ing. Stephan Schulz Technische

Noé, Reinhold

105

Chemical Education Today JChemEd.chem.wisc.edu Vol. 75 No. 5 May 1998 Journal of Chemical Education 537  

E-Print Network (OSTI)

esoteric than necessary. Chemistry is certainly a complicated subject, but shroud- ing it in esoteric

Rioux, Frank

106

Techniques for Maximizing Efficiency of Solar Energy Harvesting Systems (Invited Paper)  

E-Print Network (OSTI)

power point tracking, energy harvest- ing, solar panel, photovoltaic cell, supercapacitor, ultracapac

Shinozuka, Masanobu

107

News Briefs  

Science Conference Proceedings (OSTI)

... ing and cleanup, decontamination and decommissioning efforts, testing for ... the commercial radioactivity laboratories, nuclear power radiochemistry ...

1997-11-25T23:59:59.000Z

108

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

109

RADIATION RESEARCH 153, 220238 (2000) 0033-7587/00 $5.00  

E-Print Network (OSTI)

): the light water reactor [(LWR) in both pressurized and boil- ing versions]; heavy water (CANDU) reactor

110

DOI: 10.1126/science.1184167 , 76 (2010);328Science  

E-Print Network (OSTI)

, includ- ing nanolubricants and components in micro- and nanoeletromechanical systems devices. References

Kim, Philip

111

Glossary - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

112

Event-Places in North America: City Meaning and Making [Research and Debate  

E-Print Network (OSTI)

events in the cityscape triggers both memories and anticipation, bridg- ing the gap between performances.

Frenchman, Dennis

2004-01-01T23:59:59.000Z

113

United States - Search - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

114

- Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

115

About EIA - U.S. Energy Information Administration (EIA) - U.S ...  

U.S. Energy Information Administration (EIA)

Uranium fuel, nuclear reactors, ... Environment. Greenhouse gas data, voluntary report- ing, ... Office of Personnel Management;

116

he Romberg Tiburon Center in Marin County is not an easy place to find. While running late and driving too  

E-Print Network (OSTI)

is complete as yellow sun rays blend with the rust-colored towers of the iconic Golden Gate Bridge. Dur- ing originally built for offload- ing coal. Later, it was used to support the assembly of submarine nets

117

Network computing : limits and achievability  

E-Print Network (OSTI)

insufficiency of linear network cod- ing. 2009. [88] R.and K. Zeger. Network cod- ing for computing. In Allertonto target function f is C cod (N , f ) = sup k : ? (k, n)

Karamchandani, Nikhil

2011-01-01T23:59:59.000Z

118

EXPERIMENTAL AND THEORETICAL STUDIES OF THERMAL ENERGY STORAGE IN AQUIFERS  

E-Print Network (OSTI)

In Proceed- ings of Thermal Energy Storage in Aquifers Work-Mathematical Modeling of Thermal Energy storage in Aquifers.In Proceed- ings of Thermal Energy Storage in Aquifers Work-

Tsang, Chin Fu

2011-01-01T23:59:59.000Z

119

Mansaa thai June is, 1989  

E-Print Network (OSTI)

.ing cell.ing cell.iving cell.ging cell.nnn ccccggggng cell.ggggg cng cell.eelg cell.eee l.lke up every

Kemner, Ken

120

74 Scientific American, April 2011 Illustration by Tom Whalen Earthquake early-warning networks  

E-Print Network (OSTI)

, but it is enough to send shutdown warn- ings to power plants and rail networks, automatically open ele- vator doors comes in two parts: a fast- moving, sudden jolt and a slower-mov- ing wave that causes the great

Allen, Richard M.

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Natural Gas Productive Capacity for the Lower 48 States 1986 ...  

U.S. Energy Information Administration (EIA)

con strued as ad vo cat ing or re flect ing any pol icy po si tion of the De part ment of En ergy o r any other or - gani za tion. Preface

122

BUILDING CORRELATORS WITH MANY-CORE HARDWARE Rob V. van Nieuwpoort and John W. Romein  

E-Print Network (OSTI)

- ing techniques, but more on signal-processing techniques. For example, LOFAR [1], MeerKAT (Karoo Array International Conference on Supercomput- ing, New York, NY, June 2009, pp. 440­449. [11] "Karoo array telescope

Romein, John W.

123

Copyright 2008 No part of this presentation may be reproduced in any form without prior authorization.  

E-Print Network (OSTI)

demon- stration project for Xcel Energy, convert- ing a Ford Escape Hybrid PHEV vehicle to put power. Utilizing fully automated fast processing, the new technology will be capable of produc- ing one solar cell

Amin, S. Massoud

124

OFFICE OF AUDITOR OF STATE STATE OF IOWA  

E-Print Network (OSTI)

users 16-ID-D · HP-CAT · Materials science, geoscience · Nuclear resonant scatter- ing, inelastic x

Daniels, Thomas E.

125

Public servants A key part of the  

E-Print Network (OSTI)

users 16-ID-D · HP-CAT · Materials science, geoscience · Nuclear resonant scatter- ing, inelastic x

Manapat, Michael

126

B U S I N E S SB U S I N E S S ROBERT H. SMITH SCHOOL OF BUSINESS UNIVERSITY OF MARYLAND SPRING 2011 VOL. 12 NO. 1  

E-Print Network (OSTI)

and cellphone products. Employees were asked daily over a period of 10 work- ing days to list any incidents

Milchberg, Howard

127

e3_Coyote Case Study2000/L&J  

Science Conference Proceedings (OSTI)

... graphic design technology; biotechnology; heat- ing, ventilating ... the local school districts and work ... HVAC Heating, Ventilating, and Air Conditioning ...

2013-06-04T23:59:59.000Z

128

Cross-market relationships strengthened in the third quarter of ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... The correlation between prompt-month West Texas Intermediate ...

129

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... What is shale gas and why is it important? ...

130

U.S. Energy Information Administration - EIA - Independent ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

131

More recycling raises average energy content of waste used to ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

132

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

133

EIA - Emissions of Greenhouse Gases in the United States 2009  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

134

Annual Energy Outlook 2013 - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

135

State-Level Energy-Related Carbon Dioxide Emissions, 2000-2009  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

136

Cross State Air Pollution Rule requires emissions reductions from ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

137

Countries - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

138

U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

139

Does EIA have maps or information on the location of natural gas ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

140

The geology of natural gas resources - Today in Energy - U.S ...  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights Short-Term Energy Outlook ...

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

Kazakhstan - Analysis - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power ... by the Kazakhstan's Electricity Grid Operating ... regional electricity distribution .. ...

142

Second-Generation Nickel-Base Single Crystal Superalloy  

Science Conference Proceedings (OSTI)

creased, the demands placed on turbine airfoils have escalated dramatically. ... The demand- ing goals established ..... (maximum tensile strain at minimum...

143

Mid-Atlantic electricity market reacts to Tuesday's earthquake ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, ... after the event. ...

144

Selected publications, with commentary William Bialek February 11, 2004  

E-Print Network (OSTI)

synergistic cod- ing, and this synergy is a significant component of the high coding efficiency seen in [66

145

EIA - State Electricity Profiles - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Generation and thermal output; Electric power plants generating capacity;

146

EIA - State Electricity Profiles  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Generation and thermal output; Electric power plants generating capacity;

147

Electric Power Monthly - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Generation and thermal output; Electric power plants generating capacity;

148

U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Nuclear & Uranium. Uranium fuel, nuclear reactors, generation, spent fuel. ... Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

149

Electricity use by machine drives varies significantly by ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Fossil fuels may be used to drive turbines, reciprocating engines, ...

150

Fermi and the ergodic problem Giovanni Gallavotti  

E-Print Network (OSTI)

the esoteric (quasi) ergodic problem. Consider- ing a `{degrees of freedom system, ` > 2, with Hamilto- nian H

Roma "La Sapienza", Università di

151

Reference List 1751-2000  

Science Conference Proceedings (OSTI)

... 1934. Wurmb-Schwark, N. v, Michaela Harbeck, Urs Wiesbrock, Inge Schroeder, Stefanie Ritz-Timme, and Manfred Oehmichen. ...

2003-12-18T23:59:59.000Z

152

ENERGY & ENVIRONMENT DIVISION. ANNUAL REPORT FY 1980  

E-Print Network (OSTI)

storm and double-pane windows, insulat- ing shutters, caulking and weatherstripping, fur- nace retrofits, and active and passive solar

Authors, Various

2010-01-01T23:59:59.000Z

153

Underwater 3D Mapping: Experiences and Lessons learned  

E-Print Network (OSTI)

in Okinawa in 1998[5]. Monitoring the health of coral reefs is a difficult and time consum- ing task

Jenkin, Michael R. M.

154

Integrating Rhetorical-Semantic Relation Models for Query ...  

Science Conference Proceedings (OSTI)

... In Galia Angelova, Kalina Bontcheva, Ruslan Mitkov, Nicolas Nicolov, and Nikolai Nikolov, editors, Proceed- ings of the International Conference ...

2006-10-03T23:59:59.000Z

155

Countries - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Includes hydropower, solar, wind, geothermal, biomass and ethanol. ... Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights

156

ICAL: A Tool for Analyzing Imperfect Comparison Algorithms Wee-Chong Oon and Martin Henz  

E-Print Network (OSTI)

[7] that was based on temporal difference learn- ing, and the checkers program Anaconda [1, 2] based

Henz, Martin

157

SOLAR ENERGY PROGRAM. CHAPTER FROM THE ENERGY AND ENVIRONMENT ANNUAL REPORT 1978  

E-Print Network (OSTI)

of develop- ing a photovoltaic cell, based on a catalyst (has been shown that a photovoltaic cell can be constructed

authors, Various

2011-01-01T23:59:59.000Z

158

Assessing regional evapotranspiration and water balance across a Mediterranean montane climate gradient  

E-Print Network (OSTI)

topography and calculated solar radiation. Hydrol. Process.al. (2011). Incom- ing solar radiation was derived from the

Anderson, Ray G.; Jin, Yufang; Goulden, Michael L.

2012-01-01T23:59:59.000Z

159

Puerto Rico - U.S. Energy Information Administration (EIA) - U.S ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Puerto Rico Energy Affairs Administration, Administracin de Asuntos Energticos;

160

Countries - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Puerto Rico* Saint Kitts and Nevis Saint Lucia Saint Vincent ...

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

Markov Random field edge-centric image/video processing  

E-Print Network (OSTI)

using adaptive fast B-spline ?lter- ing, IEEE Internationalimage resizing using modi?ed B-splines, IEEE International

Li, Min

2007-01-01T23:59:59.000Z

162

UNIVERSITE DE NICE-SOPHIA ANTIPOLIS -UFR SCIENCES Ecole Doctorale Sciences et Technologies de l'Information et de la Communication  

E-Print Network (OSTI)

- ing the properties of such a ladder in this poorly explored regime. Acknowledgements The work at ORNL

Paris-Sud XI, Université de

163

Energy Information Administration (EIA)- Commercial Buildings ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... CBECS enters the final phase of questionnaire design.

164

Paycheck Deduction Codes 01/10 Deduct Code Description  

E-Print Network (OSTI)

Garnishment GFNOPROV GF Mand Ret-No Providor Chosen GFTSAING GF - TSA ING GFTSALINC GF - TSA Lincoln GFTSASEC

Peterson, Blake R.

165

Common coastal foraging areas for loggerheads in the Gulf of Mexico: Opportunities for marine conservation  

E-Print Network (OSTI)

and its find- ings validated. On the other hand, to confirm the validity of the new tag tracking method

Florida, University of

166

Illinois coal production pushes Illinois Basin production above ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... based on the Mine Safety and Health Administration (MSHA).

167

Alkylation is an important source for octane in gasoline - Today ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... (like temperature and pressure) along with different safety considerations.

168

Eastern Mediterranean natural gas exploration focused on the ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Gaza Marine: 1: unknown: Sources: EIA estimates, IHS, ...

169

Error-reducing corrections for the method of regularized Stokeslet for fluid-membrane interactions  

E-Print Network (OSTI)

for SDS [1], and sec- ond, we investigate the summarisation of XML documents by tak- ing into account

Ullmer, Brygg

170

How is electricity used in U.S. homes? - FAQ - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... heating elements, and motors not listed above. Learn more:

171

U.S. total motor gasoline exports down slightly from last year but ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Total motor gasoline = finished motor gasoline + motor gasoline blending components.

172

COMBINING MAGNETIC SHIELDING AND CRYOPUMPING FOR A NEUTRAL BEAM SOURCE  

E-Print Network (OSTI)

generated by the fusion reactor while the cold surface willfor the Toka. -nak Fusion Test Reactor", in Proceed ings of

Tanabe, J.

2010-01-01T23:59:59.000Z

173

Applied and Computational Mathematics Division Applied and ...  

Science Conference Proceedings (OSTI)

... ing, materials science, chemistry, bioscience, engineering, fire ... mathematics are fundamental tools enabling ... The NIST Handbook of Mathematical ...

2013-05-08T23:59:59.000Z

174

Arizona - Rankings - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Markets & Finance. Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, ...

175

EXPERIMENTAL ANALYSIS OF HEURISTICS FOR THE ...  

E-Print Network (OSTI)

order from inaccurate adjacency information [19], medical image process- ing [2] ...... salesman problem, Research Report, Department of Computer Science,...

176

- Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Energy use in homes, commercial buildings, manufacturing, and transportation. ... Greenhouse gas data, voluntary report- ing, electric power plant ...

177

Markov decision process (MDP) framework for software power optimization using call profiles on mobile phones  

E-Print Network (OSTI)

Duke researchers [21] extend this approach to the system level by formulat- ing a general framework to manage energy

Jung, Eric; Maker, Frank; Cheung, Tang Lung; Liu, Xin; Akella, Venkatesh

2010-01-01T23:59:59.000Z

178

View / Download  

Science Conference Proceedings (OSTI)

developing fields of technology, mak- ing major advancements in traditional fields of engineering, or developing/ implementing innovative approaches.

179

THE CORROSION OF SILICATE MATERIALS BY HYDROGEN GAS AND HYDROFLUORIC ACID SOLUTION  

E-Print Network (OSTI)

occurring in the coal gasifier and then find- ing a methodmaterial for the coal gasifier applica- tion. The corrosion

Tso, Stephen T.

2011-01-01T23:59:59.000Z

180

Fuel economy standards have affected vehicle efficiency - Today in ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Notes: Combined means both foreign and domestic vehicles.

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

COMPARISON OF PROPORTIONAL AND ON/OFF COLLECTOR LOOP CONTROL STRATEGIES USING A DYNAMIC COLLECTOR MODEL  

E-Print Network (OSTI)

Department of Energy. "Solar heating and Cooling ProjectProgram." ings of the Solar Heating and Operational Resultsin the Control of Solar Heating and Cooling Systems."

Schiller, Steven R.

2013-01-01T23:59:59.000Z

182

Porous Core-Shell Nanostructures for Catalytic Applications  

E-Print Network (OSTI)

kinetic and sum frequency gen- eration vibrational spectroscopy study. Journal of the American Chemicalkinetic studies of their activity and stability against leach- ing. Journal of the American Chemical

Ewers, Trevor David

2012-01-01T23:59:59.000Z

183

China Energy Databook - Rev. 4  

E-Print Network (OSTI)

com- mercial energy source, petroleum began contribut- ing aFrom British Petroleum. Source: China Energy StatisticalSource: United Nations, 1994; World Energy Council, 1992; British Petroleum,

Sinton Editor, J.E.

2010-01-01T23:59:59.000Z

184

An Attractor-Repeller Approach to Floorplanning  

E-Print Network (OSTI)

ing the optimal positions for a given set of modules of fixed area (but perhaps ...... 51. This problem has 10 mobile modules. (departments) and, in contrast with...

185

Markets expect Marcellus growth to drive Appalachian natural gas ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

186

Why Sandia?  

NLE Websites -- All DOE Office Websites (Extended Search)

Sandia? Sandia was doing cyber before the term cyberspace existed. Today, with cybersecurity a daunting - and rapidly grow- ing - national security problem, Sandia is applying...

187

FEMP Outdoor Solid State Lighting Intiative: Resources for Outdoor...  

NLE Websites -- All DOE Office Websites (Extended Search)

Fact Sheet - The Consortium shares technical information and experi- ences related to LED street and area light- ing demonstrations. The Consortium also serves as an objective...

188

Three Public Neighborhoods [EDRA / Places Awards -- Research  

E-Print Network (OSTI)

Enhanced maintenance and management performance. Improvedbetter maintenance, stricter management and increasedand management of the importance of their collective contribution to redevelopment and ongo- ing maintenance.

Nesmith, Barbara Stabin

2001-01-01T23:59:59.000Z

189

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... CAFE standards August 3, 2012 Fuel economy standards have affected vehicle efficiency.

190

Recently, S&P 500 Index and WTI crude oil futures price movements ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... One notable exception to this recent price correlation came on August 9.

191

Technology Transfer Division - Los Alamos National Lab: National ...  

administer commercial, noncommercial, ... As one of the U.S. Department of Energys multiprogram, ... ing 47 technical areas with 8 million square feet under roof.

192

Monitoring Power Quality  

Science Conference Proceedings (OSTI)

... or without filter), isola- tion transformer, voltage regulator ... reality before expensive line condition- ing equipment is ... if any line conditioning is required. ...

2013-05-17T23:59:59.000Z

193

Energy Star Building Upgrade Manual Introduction Chapter 1  

NLE Websites -- All DOE Office Websites (Extended Search)

offer- ings. The label now covers new homes, commercial and institutional buildings, residential heating and cooling equipment, major appliances, office equipment, lighting,...

194

Ctontents  

Science Conference Proceedings (OSTI)

... "Time that material started flaming where ... a 4D shift from left to right, and start- ing with ... by repeating the length change calcula- tions starting at the ...

2003-10-14T23:59:59.000Z

195

A new lower bound for one-machine earliness-tardiness scheduling  

E-Print Network (OSTI)

the 50-job instances remain unsolved within a large time limit. ..... Our heuristic is based on the analysis of the pseudo-schedule correspond- ing to the optimum...

196

The NIST Length Scale Interferometer  

Science Conference Proceedings (OSTI)

... This approach to measurements was pioneered by Churchill ... as part of this study of systematic effects but ... the stand- ing wave train between the ...

2013-10-22T23:59:59.000Z

197

International Carbon Dioxide Emissions and Carbon Intensity  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

198

Angola - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... but in the short-term access to power will remain a challenge.

199

Few transportation fuels surpass the energy densities of gasoline ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

200

Fast dimensional inspection of deformable parts from partial views Andres Jaramillo a  

E-Print Network (OSTI)

Nacional de Colombia, Cra 27 No. 64-60 Manizales, Caldas, Colombia b Depto. Ing. Meca´nica y Mecatro

Alberta, University of

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Qatar - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Includes hydropower, solar, wind, geothermal, ... voluntary report- ing, ... Qatar's Oryx GTL project is in operation and the Pearl GTL project is expected to begin ...

202

Invariant semidefinite programs - Optimization Online  

E-Print Network (OSTI)

V.I. Levenshtein, Universal bounds for codes and designs, in Handbook of Cod- ing Theory, eds V. Pless and W. C. Huffmann, Amsterdam: Elsevier, 1998,.

203

Structural Changes During Thermal Fatigue of Two Nickel-Based ...  

Science Conference Proceedings (OSTI)

greatly affect the thermal endurance of these heat-resisting alloys. I?. ... factors govern- ing the thermal fatigue behavior of a number of commercial nickel-.

204

Netherlands - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... (BkWh) of electricity in 2011, mostly from conventional thermal power plants.

205

--No Title--  

Annual Energy Outlook 2012 (EIA)

3. Cooking Energy Sources, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 Number of Buildings (thousand) Total Floorspace (million square feet) All Build- ings*...

206

at Clemson University Department of Forest Resources  

E-Print Network (OSTI)

prediction. For. Sci. 54(5):553­566. ZHANG, L., J.A. MOORE, AND J.D. NEWBERRY. 1993. Disaggregat- ing stand

Bolding, M. Chad

207

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, ... Short, timely articles with graphics on energy, facts, issues, and trends. FAQs Glossary For Teachers.

208

AQUIFER THERMAL ENERGY STORAGE  

E-Print Network (OSTI)

using aquifers for thermal energy storage. Problems outlinedmatical Modeling of Thermal Energy Storage in Aquifers,"Proceed- ings of Aquifer Thermal Energy Storage Workshop,

Tsang, C.-F.

2011-01-01T23:59:59.000Z

209

U.S. energy intensity projected to continue its steady decline ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Light-duty vehicles are by far the largest energy consuming part of ...

210

Homeward Bound: Food-Related Transportation Strategies in Low Income and Transit Dependent Communities  

E-Print Network (OSTI)

s Ad Hoc Food Security ing Home the Broccoli: Innovativeor administrative home for food security planning, includingtheir goods home. broadly, food security approaches. The

Gottlieb, Robert; Fisher, Andrew; Dohan, Marc; O'Connor, Linda; Parks, Virginia

1996-01-01T23:59:59.000Z

211

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... A report of historical annual energy statistics. For many series, ...

212

View / Download - TMS  

Science Conference Proceedings (OSTI)

neering at the University of Leeds,. United Kingdom. She received the award for research on bioengineer- ing, in particular on the tribology of hip replacements.

213

COMMUNICATIONS OF THE ACM January 2002/Vol. 45, No. 1 43 ameBots [1] is a virtual reality  

E-Print Network (OSTI)

is available in Tcl/Tk, Java, C/C++, and more. Tools for visualiz- ing the terrain in which agents interact

Kaminka, Gal A.

214

SHA-3 Conference, August 2010, CubeHash  

Science Conference Proceedings (OSTI)

... he analysis! ... were the easy issues. issues, most interesting arty analyses of CubeHash: ingly sophisticated ntial attacks. ... No Limited RAM size? ...

2012-05-30T23:59:59.000Z

215

Health and Rights at the Margins  

E-Print Network (OSTI)

City, on the China-Myanmar line, the flow of drugs, people,in China when a study found that 146 inject- ing drug users

Shih, Elena

2012-01-01T23:59:59.000Z

216

A NONSTANDARD SIMPLEX ALGORITHM FOR LINEAR ...  

E-Print Network (OSTI)

standard simplex algorithm. 2. Pivoting operations. In the next section, we describe column and row pivot- ing operations. This topic is closely related to the ...

217

eTuner: tuning schema matching software using synthetic scenarios  

Science Conference Proceedings (OSTI)

ranked list of answers to the human user. In such sce- narios ... manually, largely by trial and error a time consum- ing, frustrating, and error prone process.

218

OP - SFNET - Volume 15, Number 2 March 15, 2008  

Science Conference Proceedings (OSTI)

... ing WAVE - WAVElets S - Signal processing People interested in attending the workshop and/or the banquet can register using the website http ...

2008-06-30T23:59:59.000Z

219

Gender and Modernity in Colonial Korea  

E-Print Network (OSTI)

by Jennifer J. Jung-Kim Gender & Modernity in Colonial Koreathe ongo- ing reformulation of gender identities. First, Iupdate he reconstruction of gender identities My findings

Jung-Kim, Jennifer J.

2006-01-01T23:59:59.000Z

220

Table 5.13d Petroleum Consumption Estimates: Electric ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, ... For 1949-1979, data are for gas turbine and internal combustion plant use of petroleum. For 1980-2000, ...

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

MEASUREMENT SCIENCE AND TECHNOLOGY FOR THE ...  

Science Conference Proceedings (OSTI)

... To boost fuel efficiency, the US auto industry is striv- ing to manufacture cars from lightweight ... for evaluating how parts of a hydro- gen pipeline ...

2012-11-14T23:59:59.000Z

222

EXPERIMENTAL AND THEORETICAL STUDIES OF THERMAL ENERGY STORAGE IN AQUIFERS  

E-Print Network (OSTI)

Department of Energy, Energy Storage Division through thegeneration and energy storage, Presented at Frontiers ofIn Proceed- ings of Thermal Energy Storage in Aquifers Work-

Tsang, Chin Fu

2011-01-01T23:59:59.000Z

223

AQUIFER THERMAL ENERGY STORAGE  

E-Print Network (OSTI)

aquifers for thermal energy storage. Problems outlined aboveModeling of Thermal Energy Storage in Aquifers," Proceed-ings of Aquifer Thermal Energy Storage Workshop, Lawrence

Tsang, C.-F.

2011-01-01T23:59:59.000Z

224

Exhibition Directory  

Science Conference Proceedings (OSTI)

Feb 7, 2008 ... Fundamentals ..... ing ASM Handbooks Online, ASM Alloy Center and the Al- ..... sales engineers to answer any questions you may have.

225

Automated extraction and classification of thunderstorm and ...  

Science Conference Proceedings (OSTI)

... found that thunder- storms dominated the wind climate in West Texas. ... may be unrealistically long, suggest- ing that intermediate beginning and ...

2013-01-17T23:59:59.000Z

226

Total Energy - Data - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

227

Press Room - Press Releases - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

228

The Ethics of Industry Experimentation Using Employees: The Case of Taste-Testing Pesticide-Treated Tobacco  

E-Print Network (OSTI)

RJ, Barbeau EM. Tobacco industry documents: com- paring theRE, Balbach ED. Tobacco industry documents: treasure trovecombined meet- ing of the Industry Technical Committee and

McDaniel, Patricia A; Solomon, Gina; Malone, Ruth E

2006-01-01T23:59:59.000Z

229

U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

230

Legal Metrology Devices Program  

Science Conference Proceedings (OSTI)

... such as retail motor-fuel dispensers or gas pumps, vehicle mounted meters for delivering home heating oil, and liquefied petroleum gas liquid-ing ...

2013-07-31T23:59:59.000Z

231

Planning Water Use in California  

E-Print Network (OSTI)

the University of Maryland Water Policy Collaborative, 2006.FURTH ER READ ING California Department of Water Resources.California Water Plan Update 2005: A Framework for Action.

Eisenstein, William; Kondolf, G. Mathias

2008-01-01T23:59:59.000Z

232

Using seafloor geodesy to monitor volcanic collapse on the south flank of Kilauea Volcano, Hawaii  

E-Print Network (OSTI)

accommodat- ing subsidence in the summit caldera (Lipman etshow the amount of subsidence (in meters) measured theremagnitude seaward slip and subsidence on the south ?ank as

Phillips, Kathleen A.

2006-01-01T23:59:59.000Z

233

Domestic Violence and Risk Factors among Korean Immigrant ...  

Science Conference Proceedings (OSTI)

Mar 23, 2007 ... ing laundry (Wife), driving the car (Husband), shopping for groceries (Wife), paying bills (Both), taking care of the chil- dren (Wife), disciplining...

234

Review of Literature Related to Residential Ventilation Requirements  

E-Print Network (OSTI)

Refrigerating, and Air -Conditioning Engineers, Atlanta, GRefrigerat ing, and Air-Conditioning Engineers, Atlanta, Gof Ventilation and Air Conditioning: Is C E R N up to Date

McWilliams, Jennifer; Sherman, Max

2005-01-01T23:59:59.000Z

235

China consumes nearly as much coal as the rest of the world ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

236

Ohio - U.S. Energy Information Administration (EIA) - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, ... Ohio Energy Resources Division;

237

X:\\L6046\\Data_Publication\\Pma\\current\\ventura\\pma.vp  

Gasoline and Diesel Fuel Update (EIA)

evacuations. Following the storm-related interruptions to production, refin- xii Energy Information AdministrationPetroleum Marketing Annual 2002 ing, and delivery...

238

Blanchard Cr JohnsonGulch  

E-Print Network (OSTI)

Whale Cr Tepee Cr Thoma Cr KintlaCr Logg ing Cr Anaconda Cr Bo wmanCr Kintla Cr Cam a s Cr A naco nda

239

Next generation solutions for the energy services industry  

E-Print Network (OSTI)

to target cost-effective energy efficiency upgrades. and analyze energy efficiency cost and performance data canEnergy Efficiency Services to Large Commercial Firms: Operat- ing Cost

Kumar, Satish; Kromer, Steve

2006-01-01T23:59:59.000Z

240

South Carolina - State Energy Profile Analysis - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

U.S. Energy Information Administration - EIA - Independent ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

242

U.S. States - Maps - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

243

Georgia - State Energy Profile Overview - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

244

Rhode Island - State Energy Profile Overview - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

245

United States - Rankings - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; State Profiles; Economy; Prices;

246

Delaware - Compare - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

247

U.S. Energy Information Administration - EIA - Independent ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Puerto Rico US Virgin Islands: Overview; Data; Economy; Prices; Reserves ...

248

Statistical Analysis of Dross Data for Hydro Aluminium Casthouses  

Science Conference Proceedings (OSTI)

Presentation Title, Statistical Analysis of Dross Data for Hydro Aluminium Casthouses. Author(s), Christian Rosenkilde, Inge Johansen, Amanda Bowles. On-Site...

249

Land Use Planning to Promote Marine Conservation of Coral reef Ecosystems in Moorea, French Polynesia  

E-Print Network (OSTI)

material, creat- ing rich compost that can be used forcrops. Manage Solids Compost: Pig waste and carcasses can bematerials such as mats. Compost Solid waste from the solid

Timothy Duane

2006-01-01T23:59:59.000Z

250

The Cultivar newsletter, Spring/Summer 2005  

E-Print Network (OSTI)

to disease; and incorporating compost to enhance biologicalways to adjust fertilizer and compost levels and applicationSUMMER 2005 ing pre-plant compost applications, especially

Brown, Martha

2005-01-01T23:59:59.000Z

251

The Riemann Hypothesis Peter Borwein - CECM  

E-Print Network (OSTI)

The distribution of such prime numbers among all natural numbers does ... ing the distribution of prime numbers. ... inent mathematician of his generation, raised .

252

The Influence of VIM Crucible Composition, Vacuum Arc Remelting ...  

Science Conference Proceedings (OSTI)

ing a weight of 23 kilograms. (50 pounds). The as-cast ingot surface was maintained on all ingots. VIM Ingot Cleanliness. Evaluation. The cleanliness evaluation.

253

Research Article A Comprehensive Evaluation of Indoor ...  

Science Conference Proceedings (OSTI)

... fixed-length sliding window originat- ing at the beginning of the impulse response ... ments with range below 10 m to protect it from over- load and also ...

2007-12-10T23:59:59.000Z

254

GGCATCATCAATTTCGAAGGGCAAAGGCACCGGTGAAGT-GGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGAAGTGACCGGCACCGTCTATTTCAAAAGGCACCGGTGAAGTGAAAGGCACCGGTGA  

E-Print Network (OSTI)

CaliforniaCouncilonEnergyandResourcesin1975andprofessorofengin eer ing at the Uni ver- sity of Cal i for nia, Da vis, in 1977. He re ceived

California at Santa Cruz, University of

255

Highlights Year in Review - 2004 - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Highlights Year in Review - 2004 International crude oil prices rose considerably dur-ing 2004. While many issues contributed to higher prices, perhaps the most ...

256

STATE OF GREEN bUSINESS 2012  

Science Conference Proceedings (OSTI)

... Cool technologies are start- ing to make home energy efficiency more com ... years, hundreds of millions of households and businesses worldwide will ...

2013-07-29T23:59:59.000Z

257

Member News_Dec 2011_7M.indd - TMS  

Science Conference Proceedings (OSTI)

The nomination form and support- ing documentsincluding ... bridge University's science program, and then just to see ... a pipe organ construction business in.

258

METAHEURISTIC HYBRIDIZATION WITH GRASP 1. Introduction ...  

E-Print Network (OSTI)

Apr 14, 2008 ... ing, scheduling, inventory and production planning, and facility location. ..... that the size of the neighborhood be such that its exploration can.

259

Secretaries Chu and Salazar to Convene Meeting on Strengthening...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Commandant for Operations, United States Coast Guard Andrew Inglis, Chief Executive of Exploration & Production, BP Rex W. Tillerson, Chairman& CEO, ExxonMobil Hon. Don Winter,...

260

Shot boundary detection using the moving query window  

Science Conference Proceedings (OSTI)

... and after it will usually be near- symmetrical. ... while using only the luminance component of the ... Proceed- ings of the SPIE; Visualization and Optimi ...

2002-11-08T23:59:59.000Z

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Georgia - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Georgia's power grid was previously part of an integrated South Caucasus network.

262

EIA - Emissions of Greenhouse Gases in the United States 2009  

U.S. Energy Information Administration (EIA)

Environment. Greenhouse gas data, voluntary report- ing, ... Short, timely articles with graphics on energy, facts, issues, and trends. FAQs Glossary For Teachers.

263

FLAMMABILITY OF HFC/HCFC -AIR MIXTURES AT ...  

Science Conference Proceedings (OSTI)

... a hatch for inspection and cleaning, sockets for installation of pressure transducers, thermocouples and an igniter and a jacket for thermostat- ing. ...

2011-10-13T23:59:59.000Z

264

View / Download - TMS  

Science Conference Proceedings (OSTI)

neer at EWI, Columbus, Ohio. Work- ing in the materials group, he provides expertise on ceramics and fundamen- tal materials science to clients in such.

265

Assessment of Hybrid Geothermal Heat Pump Systems - Technology...  

NLE Websites -- All DOE Office Websites (Extended Search)

cool- ing needs of the building and offers general guidelines Assessment of Hybrid Geothermal Heat Pump Systems Geothermal heat pumps offer attractive choice for space...

266

February 2010 TOC.indd  

Science Conference Proceedings (OSTI)

Feb 2, 2010 ... and geothermal power is available. Ad- ditional sources of hydro power are be- ing developed in China and Brazil and this trend is expected to...

267

Estimation of Hurricane Wind Speed Probabilities: Application ...  

Science Conference Proceedings (OSTI)

... of experienc- ing nonlinear behavior under exceptionally strong windstorm events, or for the design of Liquid Natural Gas (LNG) facilities, required ...

2013-07-26T23:59:59.000Z

268

Sandia Labs Accomplishments 2010  

NLE Websites -- All DOE Office Websites (Extended Search)

THz transceiver. Engineering sciences The first large-scale liquefied natural gas (LNG) fire test in the Phoenix series was successfully conducted. The result- ing fire was...

269

DISTRIBUTED SENSOR PROCESSING OVER AN AD HOC ...  

Science Conference Proceedings (OSTI)

... ing mechanisms that consider the remaining battery life of a node? ... The Linked Cluster algorithm (LCA) [1] was used to self-organize the network ...

2009-02-03T23:59:59.000Z

270

Impact of Ground-level Aviation Emissions on Air Quality in the Western United States.  

E-Print Network (OSTI)

??The aviation industry has experienced sustained growth since its inception result- ing in an increase in air pollutant emissions. Exposure to particulate matter less than (more)

Clark, Eric Edward

2010-01-01T23:59:59.000Z

271

View / Download  

Science Conference Proceedings (OSTI)

Anderson Leads Research on Magnets for Electric Motors. TMS Member Iver Anderson is lead- ing a research team at the U.S. Depart- ment of Energy's Ames

272

Quinine, an old anti-malarial drug in a modern world: role in the treatment of malaria  

E-Print Network (OSTI)

versus quinine-doxycycline in the Western Amazon region ofof quinine plus doxycycline, tetracycline or clindamycin astreated with quinine+doxycycline [46]. Consider- ing the

2011-01-01T23:59:59.000Z

273

Application of a simple and sensitive GCMS method for ...  

Science Conference Proceedings (OSTI)

ing with isopropanol, deionized water, and isopropanol, dried at room ... several months after the last intake, because they enter the hair roots from the...

274

Meshless Deformable Models for LV Motion Analysis Xiaoxu Wang Dimitis Metaxas  

E-Print Network (OSTI)

-Assisted Intervention, pages 469­476, 2007. 6 [3] T. Chen, S. Chung, and L. Axel. Automated tag tracking us- ing gabor

275

Physical Similitude in Hierarchical Engineered Systems  

E-Print Network (OSTI)

scal- ing methodology for severe accident technical issuein the case of severe accidents, bismuth alloys have beenexperiments investigating severe accident phenomenology are

Blandford, Edward David

2010-01-01T23:59:59.000Z

276

1471-2164-10-34.fm  

NLE Websites -- All DOE Office Websites (Extended Search)

of Z. mobilis for bio-ethanol fermentation from the lignocellulosic res- idues such as corn stover 9. Z. mobilis ferments glucose, fructose, and sucrose produc- ing ethanol...

277

Can feedstock production for biofuels be sustainable in California?  

E-Print Network (OSTI)

gallons annually of corn ethanol, 1 bil- lion gallons oflocations) and corn for ethanol, and oil palm, soybean andinvestment in corn-grain-based ethanol manufactur- ing in

Kaffka, Stephen R.

2009-01-01T23:59:59.000Z

278

High-rate chemical vapor deposition of nanocrystalline silicon carbide films by radio frequency thermal plasma  

E-Print Network (OSTI)

by liquid spray injection of disilanes into an argon­hydrogen RF plasma operat- ing at 20­40 kPa [4]. Here

Zachariah, Michael R.

279

RADIOLOGICAL HEALTH AND RELATED STANDARDS FOR NUCLEAR POWER PLANTS. VOLUME 2 OF HEALTH AND SAFETY IMPACTS OF NUCLEAR, GEOTHERMAL, AND FOSSIL-FUEL ELECTRIC GENERATION IN CALIFORNIA  

E-Print Network (OSTI)

On the ather hand, ather radionuclides, such as I and Sr,The remain- ing radionuclides cantributed much less to thedoses Important radionuclides for background exposures and

Nero, A.V.

2010-01-01T23:59:59.000Z

280

Section 9.7 Employee Incentive Programs: Greening Federal Facilities...  

NLE Websites -- All DOE Office Websites (Extended Search)

Water Management Awards are presented by DOE in conjunction with the Federal Interagency Energy Policy Committee (the "656" Committee). The program recognizes outstand- ing...

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Coal - U.S. Energy Information Administration (EIA) - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Electric power sector consumption of coal by census region, 2010

282

Meso-machining  

NLE Websites -- All DOE Office Websites (Extended Search)

following meso-machin- ing technologies: * Focused ion beam (FIB) machining, * Micro-milling and -turning, * Femto-second laser machining * Micro-Electro Discharge Machining...

283

View / Download  

Science Conference Proceedings (OSTI)

director of the Quad Cities Manufac- turing Laboratory, a nonprofit research and development company in the Rock. Island ArsenalJoint Manufactur- ing and...

284

View / Download - TMS  

Science Conference Proceedings (OSTI)

Anderson Leads Research on Magnets for Electric Motors. TMS Member Iver Anderson is lead- ing a research team at the U.S. Depart- ment of Energy's Ames ...

285

CONTROL OF POPULATION DENSITIES SURROUNDING NUCLEAR POWER PLANTS. VOLUME 5 OF THE FINAL REPORT ON HEALTH AND SAFETY IMPACTS OF NUCLEAR, GEOTHERMAL, AND FOSSIL-FUEL ELECTRIC GENERATION IN CALIFORNIA  

E-Print Network (OSTI)

Commission. Office of Nuclear Reactor Licens- ing. StandardCommission. Office of Nuclear Reactor Regula- tion.Nuclear Regulatory Commission Standard Review Plan for Light Water Reactor

Nero, jA.V.

2010-01-01T23:59:59.000Z

286

Advanced Modeling and Evaluation of the Response of Base-Isolated Nuclear Facility Structures to Vertical Earthquake Excitation  

E-Print Network (OSTI)

II Offshore Platforms. environmentalprotection.com.retrofit of Chirag 1 offshore platform, Proceed- ings, Int.have been used for offshore oil platforms including the

Keldrauk, Eric Scott

2012-01-01T23:59:59.000Z

287

Evince Technology | Open Energy Information  

Open Energy Info (EERE)

Evince Technology Jump to: navigation, search Name Evince Technology Place United Kingdom Sector Efficiency, Wind energy Product String representation "Evince has pion ... ing...

288

--No Title--  

Gasoline and Diesel Fuel Update (EIA)

2. Water Heating Equipment, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 Number of Buildings (thousand) Total Floorspace (million square feet) All Build- ings*...

289

EIA - State Electricity Profiles - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

290

Berkeley Lab Computing Sciences: Accelerating Scientific Discovery  

E-Print Network (OSTI)

facilities NERSC and ESnet and by conduct- ing appliedCOMPUTATIONAL SCIENCE ESnet is a reliable, high- bandwidthdevelopment. NERSC and ESnet staff participate in advanced

Hules, John A

2009-01-01T23:59:59.000Z

291

Trophic status of Chlamydomonas reinhardtii influences the impact of iron deficiency on photosynthesis  

E-Print Network (OSTI)

of iron de?ciency on photosynthesis Aimee M. Terauchi rates by suppress- ing photosynthesis but increasing insteadal. 2007). In oxygenic photosynthesis, iron is a cofactor in

Terauchi, Aimee M.; Peers, Graham; Kobayashi, Marilyn C.; Niyogi, Krishna K.; Merchant, Sabeeha S.

2010-01-01T23:59:59.000Z

292

DOE Joint Genome Institute 2008 Progress Report  

E-Print Network (OSTI)

are potential raw materials for production of biofuels. TheRaw plant material, or dedicated bioenergy crops, can provide the starting point for mak- ing biofuels.

Gilbert, David

2009-01-01T23:59:59.000Z

293

STATEMENT OF CONSIDERATIONS CLASS WAIVER OF U.S. AND FOREIGN...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

model ing and simulation. This approach will harness the power of systems biology to overcome bioma ss recalcitrance. The BESC currently has eighteen members...

294

Synthesis of D-Glucose-1-C14 and D-Mannose-1-C14  

Science Conference Proceedings (OSTI)

... The product weighed 470 mg, rep- resenting a ... ing formation of esters, condensation products, and the ... The alco- holic liquors were neutralized with ...

2006-03-29T23:59:59.000Z

295

Distributed Energy Harvesting for Energy Neutral Sensor Networks  

E-Print Network (OSTI)

to exploit to develop piezoelectric energy harvesters. Manyenergy. Current piezoelectric energy harvest- ing researchwill improve piezoelectric energy harvesting technologys

Kansal, Aman; Srivastava, Mani B.

2005-01-01T23:59:59.000Z

296

Quantifying Changes in Building Electricity Use, with Application to Demand Response  

E-Print Network (OSTI)

build- ings, Journal of Solar Energy Engineering, vol. 120,buildings, Journal of Solar Energy Engineering, vol. 120,modeling, Journal of Solar Energy Engineering, vol. 120, p.

Mathieu, Johanna L.

2012-01-01T23:59:59.000Z

297

The TREC-2001 Video Track Report  

Science Conference Proceedings (OSTI)

... Marchionini, 2001), the NIST Digital Video Library (Over, 2001 ... SPIE 2670 (pp. ... Evaluat- ing and Combining Digital Video Shot Bound- ary Detection ...

2004-11-04T23:59:59.000Z

298

The TREC-2002 Video Track Report  

Science Conference Proceedings (OSTI)

... on Project RDD/G/235 to the British Library Research and ... SPIE 2670 (pp. ... Evaluat- ing and Combining Digital Video Shot Bound- ary Detection ...

2004-11-04T23:59:59.000Z

299

Blueberry research launches exciting new California specialty crop  

E-Print Network (OSTI)

2. Estimated highbush blueberry crop, 2004 State Growers whoin spearhead- ing specialty crops research and efforts tonew California specialty crop Manuel Jimenez Francis

Jimenez, Manuel; Carpenter, Francis; Molinar, Richard H.; Wright, Kathryn; Day, Kevin R.

2005-01-01T23:59:59.000Z

300

A Statistical Profile of Horticultural Crop Farm Industries in California  

E-Print Network (OSTI)

Profile of Horticultural Crop Farm Industries in Californiaproject funded by the Federal Crop Insurance Corporation,Williams. Model- ing Farm-Level Crop Insurance Demand with

Lee, Hyunok; Blank, Steven C.

2004-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

License Application Guidelines  

6. A review of the competition currently existing or expected to develop follow-ing introduction of the product. 7. A comparison of this product to ...

302

Instructions for use Phenomenology of supersymmetry SU5 GUT with neutrinophilic Higgs boson  

E-Print Network (OSTI)

of the primary goals of LHC is the search for the Higgs boson, the last miss- ing ingredient of the Standard

Tsunogai, Urumu

303

timeline_PNNL_PRINT.indd  

NLE Websites -- All DOE Office Websites (Extended Search)

1997 PNNL developed a highly sensitive sampleranalyzer that can be used to prevent proliferation of nuclear weapons by remotely detect- ing trace quantities of materials...

304

BFRL98Annual Cvrs 1-4  

Science Conference Proceedings (OSTI)

... In addition to the programs of the individual ... of roof solar reflectance on the annual heat- ing ... BFRL's Thermal Analysis Research Program (TARP) for ...

2000-03-16T23:59:59.000Z

305

Energy Information Administration (EIA)- Commercial Buildings ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

306

NIST CENTER FOR NEUTRON RESEARCH LAYOUT  

Science Conference Proceedings (OSTI)

... 17 18 19 13 13 Spin Echo Spectrometer offer- ing neV energy resolution, based upon Jlich design, sponsored by NIST, Jlich, and ExxonMobil. ...

2001-02-27T23:59:59.000Z

307

Die emanzipierte Emanzipationsgegnerin: Caroline Pichlers theoretische Schriften  

E-Print Network (OSTI)

Lit- eraturwissenschaft. Hrsg. Inge Stephan und SigridVon Brgern und ihren Frauen. Hrsg. Mar- gret Friedrich undEin Bonner Symposium. Hrsg. Karl Konrad Polheim. Bonn:

Laukov, Lucia

2011-01-01T23:59:59.000Z

308

NANOSTRUCTURED CATALYTIC MEMBRANES - Argonne National Laboratory  

different sources, including coal, natural gas, or biomass such as corn. NCMs also can be used for selective ... ing production costs, and improving ...

309

A Provably Secure Operating System  

Science Conference Proceedings (OSTI)

... ing availability of desired facilities, correctness of ... hierarchical structure and the doctrine of invisibility of ... An on-line facility for interactive editing of ...

2013-04-15T23:59:59.000Z

310

Passive Cooling of a Micromechanical Oscillator with a ...  

Science Conference Proceedings (OSTI)

... Closely related passive cooling has been reported in [9,20 ... Although rather modest cooling is obtained here ... eventually provide ground state cool- ing ...

2007-09-26T23:59:59.000Z

311

Section 4.1.3 Natural Ventilation: Greening Federal Facilities...  

NLE Websites -- All DOE Office Websites (Extended Search)

in and through build- ings. These airflows may be used both for ventilation air and for passive cooling strategies. Natural ventila- tion is often strongly preferred by building...

312

Cooperative motions in supercooled liquids and glasses  

E-Print Network (OSTI)

method[167, 168, 169] (WHAM). The resulting free energy pro?in ?gure 5.4a. Us- ing WHAM and the library construction

Stevenson, Jacob D.

2009-01-01T23:59:59.000Z

313

How much tax do we pay on a gallon of gasoline and diesel fuel ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Does EIA have city or county-level energy consumption and price data?

314

Does EIA publish off-road diesel fuel prices? - FAQ - U.S. Energy ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Does EIA have city or county-level energy consumption and price data?

315

Laser Plasma Particle Accelerators: Large Fields for Smaller Facility Sources  

E-Print Network (OSTI)

Scientific Comput- ing (NERSC) Center Analytics Team, usingsimulations on Seaborg at NERSC, made possible by an INCITEand ongoing work on Franklin at NERSC and Atlas at Lawrence

Geddes, Cameron G.R.

2010-01-01T23:59:59.000Z

316

What do you prefer? Using Preferences to Enhance Learning Technology  

E-Print Network (OSTI)

-based courses to self-organized home-based learning mak- ing use of on-line material. These courses might target

Olmedilla, Daniel

317

Basing Transport Planning on Principles of Social Justice  

E-Print Network (OSTI)

M. Frost, et al. (2000). Transport and Social Exclusion inG. Willumsen. (1994). Modelling Transport. Chichester: JohnG. Willumsen. (2001). Modelling Transport. Chichester: John

Martens, Karel

2006-01-01T23:59:59.000Z

318

A GENETIC ALGORITHM FOR THE WEIGHT SETTING PROBLEM ...  

E-Print Network (OSTI)

Oct 9, 2001 ... versity of Michigan, 1971. [16] Internet Engineering Task Force. Ospf version 2. Technical Report RFC 1583, Network Work- ing Group, 1994.

319

GROWTH OF PACIFIC SAUR~ COWLABlS SAlRA, IN THE NORTHEASTERN AND NORTHWESTERN PACIFIC OCEANI  

E-Print Network (OSTI)

on the embryonic development of killifish rpnnl"t.p.1i hv Arm"trona "nli r.h;]n il QAI'\\ {)h".,.r,,_ ing

320

Performance Profiles of Major Energy Producers - Energy ...  

U.S. Energy Information Administration (EIA)

Financial market analysis and financial data for major energy companies. Environment. Greenhouse gas data, voluntary report- ing, electric power plant emissions.

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

MOST Multiple Objective Spanning Trees Repository Project  

E-Print Network (OSTI)

VLSI layout, electricity, water, telecommunication or traffic networks. (Sack and ... a set of trade-off compromises between all concurring weights, result- ing in a...

322

Vehicle use varies across U.S. regions - Today in Energy - U.S ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... Reliance on vehicles can vary significantly across the United States.

323

Annual Energy Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. Highlights ... 2.8 Motor Vehicle Mileage, Fuel Consumption, and Fuel Economy, ...

324

Table 2.8 Motor Vehicle Mileage, Fuel Consumption, and Fuel ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Table 2.8 Motor Vehicle Mileage, Fuel Consumption, and Fuel Economy, 1949-2010:

325

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... flexible fuel vehicles October 10, 2013 New-vehicle fuel economy continues to increase.

326

Essays on Foreign Direct Investment, Growth and the Environment  

E-Print Network (OSTI)

high levels of capital intensity. The principal limitationof labor at current capital intensity using the base-periodlabor at base-period capital intensity us- ing the current

Gu, Waner

2011-01-01T23:59:59.000Z

327

southeastern geographer, 44(1) 2004: pp. 814 Rethinking the Region  

E-Print Network (OSTI)

-runners, allow- ing for the sale of cotton to European mar- kets and the purchase of all-important guns and steel

Gamble, Douglas W.

328

48 CRO MAR/APR 2008 Climate Change  

E-Print Network (OSTI)

regulations that limit tobacco sales and public smoking. Similarly,therewillbenoscientificsmok- ing gun Companies looking for smoking gun should skip the science,looktotheeco

Hoffman, Andrew J.

329

Petroleum & Other Liquids - Data - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Greenhouse gas data, voluntary report- ing, electric power plant emissions. ... Projects published on Beta are not final and may not include up-to-date data.

330

Modeling and Reasoning about Everyday Events Dustin Arthur Smith  

E-Print Network (OSTI)

that is inexpensive (and what price is "expensive"?).For example, the way one travels to an event (e.g., taxi, foot already filled in, or searching for alternative restaurants in the expected neigh- borhood and price range- ing context aware assistance, us- ing information from the calen- dar program and the cellphone (e

331

Annual Report of ADVANCE Program for University of Wisconsin-Madison  

E-Print Network (OSTI)

in Natural Language Process- ing, pages 620­627, Vancouver, British Columbia, Canada, October. Gabriele of the Ninth International Workshop on Pars- ing Technology, pages 83­92, Vancouver, British Columbia, October of syntactic and semantic representations is a viable alter- native to approaches based on a pipeline of local

Sheridan, Jennifer

332

Port Lions, Alaska 26 January 2006  

E-Print Network (OSTI)

to the benefits it produces, when you consider that high school and college baseball is played during the time- ing the season. Maintain Pitcher's Mound and Home Plate A few minutes each day repairing the pitcher's mound and home plate area keeps them in good play- ing condition. Sweep the mound with a stiff broom

US Army Corps of Engineers

333

REcuRsiVE TRust-REGion MEthoDs FoR MuLtiLEVEL NonLinEAR ...  

E-Print Network (OSTI)

Aug 11, 2004 ... the minimie ing se& uence at level6s 1.`r f%n&s 1b&t belongs to this minimie ing se uence,Hg e use the notation n55 Pt...

334

Biannual Report Department of Mathematics  

E-Print Network (OSTI)

Windenergie-Gewinnung Dipl.-Ing. Jörgen Thiele Stiftung Offshore-Windenergie, Varel 14:45 Evolution der Meyer Werft GmbH, Papenburg 14:00 Energiewende als Chance und Heraus- forderung am Beispiel der Offshore challenges for ships and offshore structures (Englisch) Dr.-Ing. Bas Buchner, Maritime Research Institute

Kohlenbach, Ulrich

335

Abrahamse, W., L. Steg, et al. (2005). "A review of intervention studies aimed at household energy conservation." Journal of Environmental Psychology 25(3): 273-291.  

E-Print Network (OSTI)

Windenergie-Gewinnung Dipl.-Ing. Jörgen Thiele Stiftung Offshore-Windenergie, Varel 14:45 Evolution der Meyer Werft GmbH, Papenburg 14:00 Energiewende als Chance und Heraus- forderung am Beispiel der Offshore challenges for ships and offshore structures (Englisch) Dr.-Ing. Bas Buchner, Maritime Research Institute

336

Pour diffusion immdiate En pleine refonte du rgime forestier,  

E-Print Network (OSTI)

en 2010 pour répondre aux nouveaux défis Robert Beauregard, doyen de la Faculté de foresterie, de donner des entrevues. Porte-parole Fonctions Sujets Robert Beauregard, ing., ing.f, Ph.D. Doyen de la

Laval, Université

337

(S11lSC) sruals,(5lueure8euey4les?qete6l's:olndruoc leuosred Jo uoqcnportur eqt reu? perylldurs  

E-Print Network (OSTI)

of Tsunami Deposits . . . . . . . . . . . . . . . 17 3.5 Search Methods Research (NCTR) was established to conduct re- search and development in support of the NOAA mission was a result of search- ing the tsunami runup database by state with no other conditions and divid- ing

Hack, Robert

338

Kansas Board of Regents Mandatory Retirement Plan Enrollment Information  

E-Print Network (OSTI)

Plan Providers: ING and TIAA-CREF. For additional information about the Plan, see the KU HR website://www.ingretirementplans.com/custom/KansasBOREnrollmentServices/. For additional ING information, visit http://www6.ingretirementplans.com/SponsorExtranet/KansasBOR/. TIAA-CREF: To enroll and to find fund lineup information, see the TIAA-CREF microsite http://www.tiaa

Peterson, Blake R.

339

A Novel Process for Demulsification of Water-in-Crude Oil Emulsions by Dense Carbon Dioxide  

E-Print Network (OSTI)

using a wide variety of equipments such as centrifuges, rotary vacuum filters, belt presses, and filter concentrations behave as a liquid, with Newtonian flow characteristics. Centrifugal dewater- ing is possible obtained, which was considered acceptable since a dry- ing system followed centrifugation. Pressure filters

Kilpatrick, Peter K.

340

 

Gasoline and Diesel Fuel Update (EIA)

. Electricity Consumption (Btu) by End Use for Non-Mall Buildings, 2003 . Electricity Consumption (Btu) by End Use for Non-Mall Buildings, 2003 Total Electricity Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 3,037 115 397 384 52 1,143 22 354 64 148 357 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 386 19 43 18 11 93 7 137 8 12 38 5,001 to 10,000 ....................... 262 12 35 17 5 83 4 56 6 9 35 10,001 to 25,000 ..................... 407 20 46 44 8 151 3 53 9 19 54 25,001 to 50,000 ..................... 350 15 55 50 9 121 2 34 7 16 42 50,001 to 100,000 ................... 405 16 57 65 7 158 2 29 6 18 45

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Note: Does The Graphemic Buffer Play A Role In Reading?  

E-Print Network (OSTI)

this paper, we investigate the read ing performance of a patient previously reported as hav ing an impairment at the level of the graphem ic buffer (Kay & Hanley , 1994). Desp ite his spelling problems, this patient is good at read ing fam iliar words, at reading nonwords, and at written lexical decision. This pattern of performance is d iscussed w ith respect to Caramazza, Capasso, and Miceli's (1996) recent claim that damage to the graphem ic buffer leads to a problem in reading that w ill be obvious especially when the patient is asked to read nonwords

J. Richard Hanley; Janice Kay

1998-01-01T23:59:59.000Z

342

BWXTymes, A newsletter for the employees and friends of the Y...  

NLE Websites -- All DOE Office Websites (Extended Search)

cameras and sniper detection, Y-12 is forc- ing adversaries to abandon use of armored vehicles or face engagement before they are ready. Thus, offi cers are able to...

343

Role of Surface Proteins in the Deposition Kinetics of Cryptosporidium parvum Oocysts  

E-Print Network (OSTI)

strengths where DLVO theory predicts the absence of an electrostatic energy barrier. An "electrosteric.Additionally,treatmentofsurface watersbynaturalfiltrationthroughalluvialvalleyaquifer sedimentssa process known as bank filtrationsis emerg- ing as a feasible method for the removal

Elimelech, Menachem

344

arch layout 11.21.98  

NLE Websites -- All DOE Office Websites (Extended Search)

jpg Electric light ing comprises 515,000,000 MWh or 20% of the nation's electricity consumption. Of this total, approximately 10-15% is used to light a building's perimeter zone...

345

Section 7.1.3 Wood Products: Greening Federal Facilities; Second...  

NLE Websites -- All DOE Office Websites (Extended Search)

wood is being used in a building, there is an opportunity to advance good forest management by specifying certified wood products. When wood is be- ing used for framing-more...

346

Member News August 2012_8S.indd  

Science Conference Proceedings (OSTI)

dering GPS system that has directed them into more than a few tight spots. But for Belt, this ... ing gas money. The Belts plan to eventually settle on a permanent...

347

Lab Tests Demonstrate Effectiveness of Advanced Power Strips...  

NLE Websites -- All DOE Office Websites (Extended Search)

choose the right one for their plug loads. Many consumer electronics devices waste energy even after they are turned off via "vampire" loads, mean- ing they continue to draw...

348

How to Start Your Own Business  

enough money to get going. In this ar-ticle, the sixth in our Business Engineer-ing series, Ill try to answer some of your questions about raising money for

349

FACT: A Framework for the Application of Throughput and Power Optimizing Transformations to Control-flow Intensive Behavioral Descriptions  

E-Print Network (OSTI)

Inthispaper,wepresentanalgorithmfortheapplicationofa generalclassoftransformationstocontrol-flowintensivebehavioraldescriptions. Ouralgorithmisbasedontheobservationthat incorporationofschedulinginformationcanhelpguidetheselectionandapplicationofcandidatetransformations, andsignificantly enhancethequalityofthesynthesizedsolution.Theefficacyofthe selectedthroughputandpoweroptimizingtransformationsisenhancedbytheabilityofouralgorithmtotranscendbasicblocksin thebehavioraldescription.Thisabilityisimpartedtoouralgorithm byageneraltechniquewehavedevised.Oursystemcurrentlysupportsassociativity, commutativity,distributivity,constantpropagation, codemotion,andloopunrolling.Itisintegratedwithaschedulerwhichperformsimplicitloopunrollingandfunctionalpipelin - ing,andhastheabilitytoparallelizetheexecutionofindependent iterativeconstructswhosebodiescanshareresources.Othertransformationscaneasilybeincorporatedwithintheframework. We demonstratetheefficacyofouralgorithmbyapplyingittoseveral commonlyavai...

Ganesh Lakshminarayana; Niraj K. Jha; Ganeshlakshminarayana Andnirajk Jha

1998-01-01T23:59:59.000Z

350

A 6.4 TESLA DIPOLE MAGNET FOR THE SSC  

E-Print Network (OSTI)

Engineering, Volume 31 A 6.4 TESLA DIPOLE MAGNET FOR THE SSCR. SCANLAN SSC-MAG A 6.4 TESLA DIPOLE MAGiET FOR THE SSC* C.increa.ing up to . 28 tesla . - The resultins systematic

Taylor, C.E.

2010-01-01T23:59:59.000Z

351

System level design of power distribution network for mobile computing platforms  

E-Print Network (OSTI)

to meet the system voltage noise requirements. Introductiondifferent voltage level specs due to V cc min requirement ofvoltage and frequency scaling (DVFS), Dynamic Power Gat- ing (DPM), and area/performance requirements

Shayan Arani, Amirali

2011-01-01T23:59:59.000Z

352

scripps institution of oceanography, university of california, san diego Cecil H. & Ida M. Green Institute of Geophysics & Planetary Physics  

E-Print Network (OSTI)

- ing Philippine Sea Experiment Over the past year I have been partipating in an ocean acoustic in the Philippine Sea starting in 2009 and ending in 2011. This location is in a chal- lenging and dynamic part

Constable, Steve

353

1. executive committee bylaws  

Science Conference Proceedings (OSTI)

teer requests uthorized. and execute nonvoting, all ng). Technical Div ng and organ recommenda ficant action in ors. m time-to-tim ing non-inclu nd the procedu.

354

Parimutuel Betting on Permutations  

E-Print Network (OSTI)

||?g(Y )||2 ? ng(Y ) ?. ? n||?g(Y )||2. Proof. See the appendix. Now, we can obtain an approximate separat- ing oracle for the ellipsoid method. Lemma 5.6.

355

231.ps  

E-Print Network (OSTI)

Vn := f1;:::;ng, En := fij j 1 ing, and dn := jEnj = n. 2 . Let Sn denote the. set of n n symmetric matrices. For X 2Sn, X 0 means that X is positive semide nite.

356

Loss mechanisms in turbine tip clearance flows  

E-Print Network (OSTI)

Numerical simulations of tip clearance ow have been carried out to dene the loss generation mechanisms associated with tip leakage in unshrouded axial turbines. Mix- ing loss between the leakage, which takes the form of a ...

Huang, Arthur (Arthur C.)

2011-01-01T23:59:59.000Z

357

1 Introduction ``It is a well-known phenomenon that we do not notice anything happening in our surround-  

E-Print Network (OSTI)

surround- ings while being absorbed in the inspection of something; focusing our attention on a certain demonstrations of the importance of attention in perception (see Neisser 1979 for an overview). In these studies

Chabris, Christopher F.

358

http://magnets.rhic.bnl.gov/Sta.PDF  

NLE Websites -- All DOE Office Websites (Extended Search)

(BNL) is build- ing a number of magnets for the insertion regions of the Large Hadron Collider (LHC). This paper presents the magnetic de- sign and the expected field...

359

fall2009_web.indd  

NLE Websites -- All DOE Office Websites (Extended Search)

structures. Dur- ing this portion of the project, ESRI's 3-D Technical Services Group web conferenced into a few classes to provide training and support in the art of 3-D...

360

5.2 e-Facilitating networking in distance co-operation ... - Springer  

Science Conference Proceedings (OSTI)

sophisticated systems based on the theory of the six degrees of separation, whose main concept is .... ing process the initial design and appropriate set-up of the virtual learning .... how instructional activities (if there are any) are sequenced

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

TIME SERIES MODELING  

Science Conference Proceedings (OSTI)

does involve some knowledge of hydrodynamics (especially when decid- ing the formula for ... 109120. Munk, W.H., and Cartwright, D.E., 1966. Tidal spectroscopy and pre- diction. ..... Principles of Forecasting: A Handbook for. Researchers...

362

Faculty of Fine, Applied and Performing Arts Annual Report 2012  

E-Print Network (OSTI)

(Jeppson 1976). A method of finding an approximat- 7 #12;ing function by converting to logarithmic compared to the Colebrook and White equation (Jeppson 1976), the maximum error of this approximation is 6

Harding, Karin

363

The landscape of RNA polymerase II transcription initiation in C. elegans reveals a novel enhancer architecture  

E-Print Network (OSTI)

- gated. We characterized the global landscape of RNA Pol II transcription initiation, identifying 73,500 distinct clus- ters of initiation, many of which are bidirectional. We assign transcription initiation sites to 7691 protein-cod- ing genes and find...

Chen, Ron; Down, Thomas; Ahringer, Julie

2013-03-18T23:59:59.000Z

364

Network coding for function computation  

E-Print Network (OSTI)

K. Zeger. Unachievability of Network Cod- ing Capacity. IEEEto target function f is C cod (N , f ) = sup k : ? (k, n)target function f , then C cod (N , f ) ? min-cut(N , f ).

Appuswamy, Rathinakumar

2011-01-01T23:59:59.000Z

365

EPRI Journal: Summer 2007  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

operation because of its inability to withdraw a suffi- cient amount of water to meet its thermal discharge permit. According to John Maulbetsch, a cool- ing systems expert and...

366

2012 Immediate Science Ecology 1 7 Immediate Science Ecology 1: 711, 2012  

E-Print Network (OSTI)

regime where the frog occurs can result in breeding site desiccation during the long dry summer, solar radiation pro- duced mid-day shallow-water temperatures approach- ing 30°C. These preliminary data

367

Proceedings of ACL-08: HLT, pages 335343, Columbus, Ohio, USA, June 2008. c 2008 Association for Computational Linguistics  

E-Print Network (OSTI)

: · (crude oil) prices ­ left-branching · world (oil prices) ­ right-branching Lauer (1995) presents two. We then run a number of parsing experiments us- ing our new version of the CCGbank corpus

368

Tools for transparent synchronous collaborative environments  

Science Conference Proceedings (OSTI)

Nov 30, 2006 ... server checks if the client is a latecomer for this application. ...... However, other participants think that they need technical support for not only training but .... He received the Ing. Dipl. degree in Electrical Engineering from.

369

Northwest National Laboratory's Chemical Imaging Initiative is...  

NLE Websites -- All DOE Office Websites (Extended Search)

generated. CHEMICAL IMAgINg Main particle Pt (110) Pt (111) Pt (pores) g-Al 2 O 3 pores gamma-alumina particles contain pores and have a corrugated surface according to a chemical...

370

On the Mean Iteration - CECM  

E-Print Network (OSTI)

These logarithmic asymptotes also lead to two very clean quadratically converg- ing product expansions: (N = 3) let. 1~~~~~~~~~~~~~~~ zo := 9 and x. L [1 + V/(...

371

INFORMATIKK Nr. 08 15 mai 2009  

E-Print Network (OSTI)

(datasikkerhet, II-råd, MN-styre, UiB-styre) Vacation, technical support, office hours Utlysning av u.stip/ medarbeidere i nye roller Anne-Kristin Stavrum, stip. bioinformatikk Svein Harald Soleim, avd. ing

Fomin, Fedor V.

372

Quaero at TRECVID 2011: Semantic Indexing and Multimedi Event Detection (draft)  

E-Print Network (OSTI)

of interest points descriptors (SIFT, color SIFT, SURF, STIP), local edge patterns, saliency moments, percepts information. We will also integrate to the actual system other interest- ing descriptors like STIP

373

Companies plugged in: A study of the motivations of companies to introduce electric vehicles in their organisation:.  

E-Print Network (OSTI)

??Electric driving is currently a hot item in the Netherlands. Yet, it is surrounded by uncertainty result-ing in companies adopting a wait-and-see attitude regarding the (more)

Verouden, C.T.A.F.

2013-01-01T23:59:59.000Z

374

330.ps.Z - Optimization Online  

E-Print Network (OSTI)

May 24, 2001 ... tion of ow through a pipe is modeled by a disjunction. ...... ing, S.T., Klepeis, J.L., Meyer, C.A. and Schweiger, C.A. Handbook of Test Problems.

375

M I C R O D E S I G N R E S O U R C E S J A N U A R Y 2 6 , 1 9 9 8 M I C R O P R O C E S S O R R E P O R T by Peter Song  

E-Print Network (OSTI)

units and registers, greatly simplify- ing hardware without unduly degrading the processor's throughput the effective address as a result, reducing the overhead of hoisting speculative loads above earlier stores

Skadron, Kevin

376

Enhancing the Teaching of Statistics: Portfolio Theory, an Application of Statistics in Finance  

E-Print Network (OSTI)

obtained for the stocks IBM, EXXON-MOBIL, and BOE- ING (theyClosing prices of IBM, Exxon-Mobil, Boeing, January 2000 -December 2005. IBM EXXON-MOBIIL BOEING Mean Q 1 Median Q 3

Nicolas Christou

2011-01-01T23:59:59.000Z

377

Enhancing the Teaching of Statistics: Portfolio Theory, an Application of Statistics in Finance  

E-Print Network (OSTI)

obtained for the stocks IBM, EXXON-MOBIL, and BOE- ING (theyClosing prices of IBM, Exxon-Mobil, Boeing, January 2000 -December 2005. IBM EXXON-MOBIIL BOEING Mean Q 1 Median Q 3

Christou, Nicolas

2007-01-01T23:59:59.000Z

378

AN EXPERTISE BASED ENERGY INFORMATION SYSTEM  

E-Print Network (OSTI)

overseas supplier of crude oil decreases supplies to the U,supplies of gas and heating oil are sufficient. Ignoring forsimple no tic~ ing. A model of oil flow in the United States

Rosenberg, S.

2013-01-01T23:59:59.000Z

379

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ing-grid-getting-more-out-america-s-energy-0 Article EM Occupational Injury and Illness Rates Continued to Decline in Fiscal Year 2011 WASHINGTON, D.C. - The EM Office of Safety...

380

THERMAL ENERGY STORAGE IN AQUIFERS WORKSHOP  

E-Print Network (OSTI)

government in their regulation of natural gas prices. ThatRegulation of energy sup- ply activites, chiefly electric and natural gasregulation requ1red householders to give up burn- ing coal in favor of natural gas

Authors, Various

2011-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Non-invasive MR imaging of inflammation in a patient with both asymptomatic carotid atheroma and an abdominal aortic aneurysm: a case report  

E-Print Network (OSTI)

- ticipated in the design of the study and edited the manuscript. ZYL helped in editing the manuscript and cre- ating the Figure. SRW was involved with manuscript edit- ing, patient care and helped perform the operation. MEG edited the manuscript...

Howarth, Simon P S; Tang, Tjun Y; Graves, Martin J; U-King-Im, Jean-Marie; Li, Zhi-Yong; Walsh, Stewart R; Gaunt, Michael E; Gillard, Jonathan H

2007-02-21T23:59:59.000Z

382

Gone with the Wind - The Potential Tragedy of the Common Wind  

E-Print Network (OSTI)

42 In fact, the price of wind energy is decreas- ing at aprice of wind en- ergy is competitive with other forms of energyother energy production technologies: 43 the price for wind

Lifshitz-Goldberg, Yaei

2010-01-01T23:59:59.000Z

383

WS WEBIN Structu AR: F ural Da FEMA amage A E-74 R s ...  

Science Conference Proceedings (OSTI)

... es are limited o view the web es so many ot f the presenta nts. A record a FEMA.gov. N: ... binar/ re, please test ing here: p/en/support/m 36 ...

2013-01-29T23:59:59.000Z

384

Linearly Scaling 3D Fragment Method for Large-Scale Electronic Structure Calculations  

E-Print Network (OSTI)

Comput- ing Facility (ALCF). R EFERENCES [1] A. Luque and A.BlueGene/P system (Intrepid) at the ALCF at Argonne NationalBlueGene/P system in the ALCF facility at Argonne National

Wang, Lin-Wang

2008-01-01T23:59:59.000Z

385

A class of DantzigWolfe type decomposition methods for variational ...  

E-Print Network (OSTI)

CEPEL, Electric Energy Research Center. On leave from INRIA ..... ing variational equilibria of game-theoretical models of electricity markets are presented in. Section 4. ...... approximations, which incorporate more information. The situation is...

386

The Role of U.S. Insurance Regulators in Responding to Climate Change  

E-Print Network (OSTI)

note 23. 25. John Brownstein, Lyme Disease: Implications ofNile Virus to ticks carry- ing Lyme Disease 25 to rodentsWNV in North America. Lyme disease is the most widespread

Mills, Evan

2008-01-01T23:59:59.000Z

387

From the Dean Leadership Changes  

E-Print Network (OSTI)

`maiz'ing potential page 4 Biomass Gas Cleanup CH2M HILL Foundation Gift Classified staff recognized Clemson is designed to create a regional knowledge-based cluster attracting high-tech, high- paying jobs. Clemson

Duchowski, Andrew T.

388

Recovery Act Funding Leads to Record Year for Transuranic Waste...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

With the help of Ameri- can Recovery and Reinvestment Act fund- ing, the Waste Isolation Pilot Plant (WIPP) received the most transuranic waste ship- ments in a single year since...

389

POWER PLANT RELIABILITY-AVAILABILITY AND STATE REGULATION. VOLUME 7 OF THE FINAL REPORT ON HEALTH AND SAFETY IMPACTS OF NUCLEAR, GEOTHERMAL, AND FOSSIL-FUEL ELECTRIC GENERATION IN CALIFORNIA  

E-Print Network (OSTI)

generate steam to drive a steam turbine, giving rise to theValves and Pi~ing STEAM TURBINE COMPONENT OUTAGE CAUSESbasically of a steam-driven turbine, an electric generator

Nero, A.V.

2010-01-01T23:59:59.000Z

390

Monitoring soil carbon will prepare growers for a carbon trading system  

E-Print Network (OSTI)

waste orchard bio- mass and compost applications: (1) 1 tonorchard waste prun- ings added with compost, (2) 3 tons ofwalnut shells added with compost and (3) cover crop and

Suddick, Emma C; Ngugi, Moffatt K; Paustian, Keith; Six, Johan

2013-01-01T23:59:59.000Z

391

A Strategy for the Abandonment of Modified In-Situ Oil Shale Retorts  

E-Print Network (OSTI)

Effects of steam on oil shale ing: a preliminary laboratoryInstitute to Rio Blanco Oil Shale Project, May 1977. 1~Cement, pozzolan and oil shale chemistry The chemistry of

Fox, J.P.; Persoff, P.; Moody, M.M.; Sisemore, C.J.

1978-01-01T23:59:59.000Z

392

PARTITIONING OF MAJOR, MINOR, AND TRACE ELEMENTS DURING SIMULATED IN SITU OIL SHALE RETORTING IN A CONTROLLED-STATE RETORT  

E-Print Network (OSTI)

or by refin- ing and using shale Oil Mass balances and oil.shale retorting produces shale oil, mobility factors wereand retort operating shale, shale oil, retorting (LETC) con-

Fox, J. P.

2011-01-01T23:59:59.000Z

393

Natural vs. mechanical ventilation and cooling.  

E-Print Network (OSTI)

cant and well-docu- mented. ASHRAE Standard 55 prescribes aless comfortable. ASHRAE Standard 55-2004 includes an adap-and standards, includ- ing ASHRAE Standard 90.1. Mechanical

Brager, Gail; Alspach, Peter; Nall, Daniel H.

2011-01-01T23:59:59.000Z

394

Experimental Mathematics - CECM  

E-Print Network (OSTI)

ing or even re-correcting them. he. "fallibilism" of mathematics is brilliantly. argued in Lakatos'x roofs an efr ta. tions. uYu. x eere are i ? erent versions of proof.

395

A Strategy for the Abandonment of Modified In-Situ Oil Shale Retorts  

E-Print Network (OSTI)

Effects of steam on oil shale ing: a preliminary laboratoryInstitute to Rio Blanco Oil Shale Project, May 1977. 1~OF MODIFIED IN-SITU OIL SHALE RETORTS J. P. Fox and P.

Fox, J.P.; Persoff, P.; Moody, M.M.; Sisemore, C.J.

1978-01-01T23:59:59.000Z

396

Doing Well by Doing Good? Green Office Buildings  

E-Print Network (OSTI)

we obtained the data on energy usage reported to theWe also discuss the energy usage data made available to usengineer- ing studies of energy usage. There seems to be a

Eichholtz, Piet; Kok, Nils; Quigley, John M.

2009-01-01T23:59:59.000Z

397

ENERGY AND ENVIRONMENT DIVISION ANNUAL REPORT 1978  

E-Print Network (OSTI)

Characteristics of Medieval Brasses H. V. Michel, F. Asaro,and the tarnish- ing of brass fixtures and silver. In vapor-Characteristics of Medieval Brasses* H. V. Michel, F. Asaro

Cairns, E.L.

2011-01-01T23:59:59.000Z

398

Computational Aesthetics in Graphics, Visualization and Imaging (2005) L. Neumann, M. Sbert, B. Gooch, W. Purgathofer (Editors)  

E-Print Network (OSTI)

finishes. The software makes use of a reflection model for car paint that is based on industry standards- ture, the glaze of a ceramic vase, or the color of an oil paint- ing are all important aesthetic

Meyer, Gary

399

285.ps  

E-Print Network (OSTI)

Feb 23, 2001 ... ing strategy makes extensive use of dual information associated ...... The total potential energy, expressed in terms of the coe cients of the approximating ...... population and have di erential costs of production and marketing.

400

Sample Size Calculation for Method Validation Using Linear Regression  

E-Print Network (OSTI)

, J. L. O. Miranda Departament of Statistics, Federal University of Minas Gerais, 31270-901 - Belo. Compared to a traditional method and us- ing Monte Carlo simulations, encouraging results attest

Cruz, Frederico

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

References - Energy Information Administration  

U.S. Energy Information Administration (EIA)

References 1.En ergy In for ma tion Ad min istra tion. Natu ral Gas Pro - duc tive Ca pac ity for the Lower 48 States 1980 through 1991 . DOE/EIA- 0542 (Wash ing ton ...

402

Baseline information development for energy smart schools -- applied research, field testing and technology integration  

E-Print Network (OSTI)

swimm ing pools and climate zones. Th e major findings aresound statements. The way the climate zones are divided waswhich aggregated CEC 16 climate zones into four regions by

Xu, Tengfang; Piette, Mary Ann

2004-01-01T23:59:59.000Z

403

Surface Water Temperatures At Shore Stations, United States West Coast 1984  

E-Print Network (OSTI)

off the rocks near the water intake for the laboratory. MonoStation Off rocks near water intake for laboratory Trinidadthat monitors the cool- ing intake water for the generators.

Scripps Institution of Oceanography

1985-01-01T23:59:59.000Z

404

Surface Water Temperatures At Shore Stations, United States West Coast 1986  

E-Print Network (OSTI)

off the rocks near the water intake for the laboratory. MonoStation Off rocks near water intake for laboratory Farallnthat monitors the cool ing intake water for the generators.

Scripps Institution of Oceanography

1987-01-01T23:59:59.000Z

405

Surface Water Temperatures At Shore Stations, United States West Coast 1983  

E-Print Network (OSTI)

off the rocks near the water intake for the laboratory. MonoStation Off rocks near water intake for laboratory Granitethat monitors the cool ing intake water for the generators.

Scripps Institution of Oceanography

1984-01-01T23:59:59.000Z

406

Surface Water Temperatures At Shore Stations, United States West Coast 1985  

E-Print Network (OSTI)

off the rocks near the water intake for the laboratory.Station Off rocks near water intake for laboratory Farallnthat monitors the cool ing intake water for the generators.

Scripps Institution of Oceanography

1986-01-01T23:59:59.000Z

407

Operating Experience Summary, 2011-07  

NLE Websites -- All DOE Office Websites (Extended Search)

individuals. These concerns resulted in the DOE Office of Health, Safety and Security (HSS) conduct- ing an inspection of the site-wide CBDPP. The inspection was download this...

408

Large Neighborhood Search for LNG Inventory Routing  

E-Print Network (OSTI)

Natural gas is expected to be the world's fastest growing fossil fuel with consumption increas- ing at an average rate of 1.6% per year from 2008 to 2035 [

409

LINX Test Facility at SLAC  

NLE Websites -- All DOE Office Websites (Extended Search)

LINX LINear collider X-ing Linear Collider Interaction Region Engineering Test Facility at SLAC The NLC collaboration is proposing to create the LINX test facility at SLAC to...

410

DIABETES CARE, VOLUME 24, NUMBER 1, JANUARY 2001 117 n November 1999, the National Insti-  

E-Print Network (OSTI)

differences in the macroenviron- ment. Evidence indicating the importance of the environment is seen to change the macroenvironment and thereby change eat- ing behavior and physical activity. Prior research

Meagher, Mary

411

A-1 2012 SITE ENVIRONMENTAL REPORT APPENDIX A: GLOSSARY  

E-Print Network (OSTI)

that cross contamination has not occurred. blowdown ­ Water discharged from either a boiler or cool- ing procedure SPCC Spill Prevention Control and Countermeasures SPDES* State Pollutant Discharge Elimination Compliance Assurance Process TCE* trichloroethylene TCLP toxicity characteristic leaching procedure TEAM

412

A Strategy for the Abandonment of Modified In-Situ Oil Shale Retorts  

E-Print Network (OSTI)

Effects of steam on oil shale ing: a preliminary laboratoryJr. , "Disposal J. spent shale ash in "in situ" retortedInstitute to Rio Blanco Oil Shale Project, May 1977. 1~

Fox, J.P.; Persoff, P.; Moody, M.M.; Sisemore, C.J.

1978-01-01T23:59:59.000Z

413

Black and Korean: Racialized Development and the Korean American Subject in Korean/American Fiction  

E-Print Network (OSTI)

say that bars and clubs for black GIs are often smaller andshows the hierarchy of white over black. See Saundra Pollockare racialized as white or black depend[ing] on with whom

Lim, Jeehyun

2013-01-01T23:59:59.000Z

414

MSU Extension Publication Archive Archive copy of publication, do not use for current recommendations. Up-to-date  

E-Print Network (OSTI)

of flooding is essential in planning recre- ational facilities. #12;The degree of the limitation of the soils roads and intensively used areas, and install- ing sanitary facilities and utility lines. Camp areas

415

FREE TRIAL WEEK! We will offer many of our classes free of charge from Monday, September 19 Sunday, Sep-  

E-Print Network (OSTI)

FREE TRIAL WEEK! We will offer many of our classes free of charge from Monday, September 19 ­Sunday intensity style program us- ing free weights, resistance and body weight. RISE AND SHINE INTERVAL

416

Flame suppression by aerosols derived from aqueous ...  

Science Conference Proceedings (OSTI)

... Plug flow boundary conditions at the nozzle exit are ... DMMP and H2O, as a function of dopant loading. ... Load- ings are given as the mole fraction of ...

2012-06-10T23:59:59.000Z

417

The IceCube Collaboration:contributions to the 30 th International Cosmic Ray Conference (ICRC 2007),  

E-Print Network (OSTI)

total of 5 neutrino event triggers were initiated by AMANDA-in deep IceCube. Events that trigger both the surface arraya common run control, trigger- ing, event building and

Ackermann, M.; IceCube Collaboration

2008-01-01T23:59:59.000Z

418

untitled  

Gasoline and Diesel Fuel Update (EIA)

moved within a 47-per-barrel range. Spot market prices for regular gasoline and No. 2 heating oil at New York Harbor were also less volatile, mov- ing at less than half the...

419

Quasi-experimental trial of diabetes Self-Management Automated and Real-Time Telephonic Support (SMARTSteps) in a Medicaid managed care plan: study protocol  

E-Print Network (OSTI)

recommended health services, including laboratory test- ing,Health Services Research 2012, 12:22 http://www.biomedcentral.com/1472-6963/12/22 delivery processes: proportion receiving blood pressure checks, laboratory

2012-01-01T23:59:59.000Z

420

Atmos. Chem. Phys., 7, 37713781, 2007 www.atmos-chem-phys.net/7/3771/2007/  

E-Print Network (OSTI)

of homogeneous and heterogeneous freez- ing processes, ice particle growth and fallout, and mesoscale vertical, and the initial increased (see Eq. 1). 2) As Reff decreased, fallout timescales (fallout [s]) and cloud lifetimes

Paris-Sud XI, Université de

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

Industry  

E-Print Network (OSTI)

milling industry: An ENERGY STAR Guide for Energy and Plantcement mak- ing - An ENERGY STAR Guide for Energy and Plantre- fineries - An ENERGY STAR Guide for Energy and Plant

Bernstein, Lenny

2008-01-01T23:59:59.000Z

422

Universitt Stuttgart Auslandsorientierter Studiengang  

E-Print Network (OSTI)

. Benner for guiding and explaining the applied projects in the Ruhr basin, Prof. Dr.-Ing. Rainer Helmig Problem and Control . . . . . . . . . . . . . . . . . 3 1.4 Co-generation Power Plants

Cirpka, Olaf Arie

423

CARNEGIE MELLON UNIVERSITY Automatic Graceful Degradation  

E-Print Network (OSTI)

identifies a heretofore-unknown problem in the system syn- thesis research space and explores solution love of learning into a roar- ing fire -- or at least gave me enough fuel to make it blaze

Koopman, Philip

424

SOLAR NEUTRINOS REVIEW Revised December  

NLE Websites -- All DOE Office Websites (Extended Search)

+ + 2 e . (1) Positrons annihilate with electrons. Therefore, when consider- ing the solar thermal energy generation, a relevant expression is 4p + 2e - 4 He + 2 e + 26.73...

425

Molecular surface-free continuum model for electrodiffusion processes  

E-Print Network (OSTI)

Molecular surface-free continuum model for electrod-of introduc- ing a molecular surface and the painful task ofreaction kinet- ics, and molecular surface de?ned as an

Lu, Benzhuo; McCammon, J. Andrew

2008-01-01T23:59:59.000Z

426

Production of Ultrashort FEL XUV Pulses via a Reverse Undulator Taper  

E-Print Network (OSTI)

1 (2004); also SLAC Rpt. LCLS-TN-04-3 [13] M. Xie, Nucl.Linac Coherent Light Source (LCLS) Conceptual Design Report,ing down to 12 nm and the LCLS facility [2] pro- jected to

Fawley, William M.

2007-01-01T23:59:59.000Z

427

Calls to Action -- Seattle 2220: Our Ancestors' Planning Legacy  

E-Print Network (OSTI)

worlds remain- ing coal-fired power plants pumped out morechange. The use of coal-fired power plants worldwide willfive-hundred-megawatt coal-fired power plants. 2 The ice on

Matthews, David J.

2008-01-01T23:59:59.000Z

428

VarPetrRef 1 VARIETY AND THE EVOLUTION OF REFINERY PROCESSING  

E-Print Network (OSTI)

. Catalytic reforming followed as a means of upgrading the octane of gasoline range materials principally): Catalytic reforming, Isomerization, Alkylation, Catalytic polymerization, MTBE and Hydrotreating. The last Distillation Visbreaking Hydrotreating Hydrocracking Thermal Reforming Alkylation MTBE Catalytic Reform ing

Paris-Sud XI, Université de

429

Large-magnitude geomagnetic disturbances in the North Sea region: Statistics, causes, and forecasting  

E-Print Network (OSTI)

Large-magnitude geomagnetic disturbances in the North Sea region: Statistics, causes require an undisturbed geomagnetic field. The Danish Meteorological Institute cur- rently offers real- ing project aiming at the development of geomagnetic forecast services, we have investigated

Gleisner, Hans

430

The Electron-Pair Origin of Antiaromaticity  

E-Print Network (OSTI)

the result- ing forbiddingness of an electric dipole electronic w xtransition between the two twins 5. In spite of their widespread usage, the concepts of aromaticity and antiaromaticity have escaped a precise

Haas, Yehuda

431

Weather-based yield forecasts developed for 12 California crops  

E-Print Network (OSTI)

precipitation on California crop yields. Climatic Change. InG. 1999. Understanding crop statis- tics. www.usda.gov/nass/developed for 12 California crops by David B. Lobell,

Lobell, David; Cahill, Kimberly Nicholas; Field, Christopher

2006-01-01T23:59:59.000Z

432

Flow Reconstruction for Data-Driven Traffic Animation David Wilkie  

E-Print Network (OSTI)

on a GIS-derived domain and overlaid on a public domain aerial image from the U.S. Geological Survey improved sensing technologies, real-time render- ing, and procedural modeling. For example, aerial imagery

North Carolina at Chapel Hill, University of

433

Search for antideuterons and strangelets in cosmic rays with AMS-01  

E-Print Network (OSTI)

AMS (the Alpha Magnetic Spectrometer) is a high-energy particle detector in space. An engineer- ing version of AMS, AMS-01, flew on the space shuttle Discovery for ten days in June 1998 and collected 108 cosmic ray events. ...

Henning, Reyco, 1975-

2004-01-01T23:59:59.000Z

434

Online Energy Generation Scheduling for Microgrids with  

E-Print Network (OSTI)

Online Energy Generation Scheduling for Microgrids with Intermittent Energy Sources and Co entitled: Online Energy Generation Scheduling for Microgrids with Intermittent Energy Sources and Co schedul- ing. However, accurate prediction cannot be guaranteed due to the small scale of microgrids

Zhang, Junshan

435

A CD19/Fc fusion protein for detection of anti-CD19 chimeric antigen receptors  

E-Print Network (OSTI)

Oliveira et al. : A CD19/Fc fusion protein for detection ofof the CD19-IgG 1 Fc fusion was performed under denatur- ingOpen Access A CD19/Fc fusion protein for detection of anti-

De Oliveira, Satiro N; Wang, Jiexin; Ryan, Christine; Morrison, Sherie L; Kohn, Donald B; Hollis, Roger P

2013-01-01T23:59:59.000Z

436

Endowed Chairs and Professorships Academic Village Undergraduate Scholarships Graduate Fellowships  

E-Print Network (OSTI)

Saturdays dur- ing the fall semester. Funding from Xcel Energy Foundation enables the University to offer Controls Group Xcel Energy Xilinx, Inc. Gifts on Behalf Ayres Associates Inc. Binder & Associates

437

Moisture Control in Insulated Raised Floor Systems in Southern Louisiana  

E-Print Network (OSTI)

polyisocyanurate foam, open-cell sprayed polyurethane foams of vary- ing vapor permeance, closed-cell sprayed in guidance for insulating raised floors in the hot and humid climate of the Gulf Houses with pier foundations

438

Introduction Epidemiology - Springer  

Science Conference Proceedings (OSTI)

are trauma victims, and early care does not deviate from Advanced Trauma. Life Support ... ing safety procedures. The type of ... This is a progressive process and the ..... All patients should be transferred with appropriately trained escort staff.

439

INFRASTRUCTURE PRELIMINARIES  

E-Print Network (OSTI)

, 300 rpm), centrifuged (2,000?g, 5 min), and supernatants collected and frozen. Differences from a rotating biological contactor treat- ing ammonium-rich leachate. Arch Microbiol 175: 198­207 8

440

An Evaluation of the Market Potential for Transit-Oriented Development Using Visual Simulation Techniques  

E-Print Network (OSTI)

to support frequent rail services. Research findings byresearch methodology itself as well as the general conceptof promoting denser housingdevelopment railresearch suggeststhere is aa untapped marketpotential for moderately dense hous- ing projects near rail

Cervero, Robert; Bosselmann, Peter

1994-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

careInlorlladon Infrastructure:  

Science Conference Proceedings (OSTI)

... BrInging HeaithcG1eOnline: Th~ Rot. of infotmotIon Technologiu, OTA-rrc-624, USGovernment PrInting Office. Washington. Dc.1995.) ...

2012-11-26T23:59:59.000Z

442

Studies of the front end of a neutrino factory  

E-Print Network (OSTI)

determining the needed volt-seconds (and thus core material)decreases the accelerat- ing volt-sec needed for ? 0 ? ? Lmagnitude of the decelerating volt-sec which must be applied

Fawley, William; Penn, Gregory; Sessler, Andrew; Wurtele, Jonathan

2001-01-01T23:59:59.000Z

443

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ings-bonneville-power Page EA-0531: Proposed Natural Gas Protection Program for Naval Oil Shale Reserves Nos. 1 and 3, Garfield County, Colorado This EA evaluates the environmental...

444

Newsletter (May 2009).pub  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

tive Action Request (CAR) is provided. The contractor is responsible for respond- ing in a timely and com- plete manner through its Corrective Action Plan (CAP). The Federal Pro-...

445

Released: June 2006  

U.S. Energy Information Administration (EIA) Indexed Site

2. Water Heating Equipment, Number of Buildings and Floorspace for Non-Mall Buildings, 2003" 2. Water Heating Equipment, Number of Buildings and Floorspace for Non-Mall Buildings, 2003" ,"Number of Buildings (thousand)",,,,,"Total Floorspace (million square feet)" ,"All Build- ings*","Build- ings with Water Heating","Type of Water Heating Equipment",,,"All Build- ings*","Build- ings with Water Heating","Type of Water Heating Equipment" ,,,"Central- ized System","Distrib- uted System","Combin- ation Central- ized and Distrib- uted Systems",,,"Central- ized System","Distrib- uted System","Combin- ation Central- ized and Distrib- uted Systems" "All Buildings* ...............",4645,3472,2513,785,175,64783,56478,34671,11540,10267

446

Ir I L  

Office of Legacy Management (LM)

*- -I ..' -I I... "- II .- (1 "^ 1 6 7 8 9 10 11 LIST O F FIGURES General location of the Granite City Steel Facility , Granite City , Illinois . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 9 View of the betatron building, look ing south . . . . . . . . . . . . . . . . . . . 10 View of the betatron building, look ing west . . . . . . . . . . . . . . . . . . . . . 11 Diagram of the ground floor of the betatron building . . . . . . . . . . . . . . 12 Photo showing the larger of the two betatrons (no. 1, Fig. 4) . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 13 View of transformer s torage area ins ide the betatron building . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

447

nemsoverview_928.vp  

Gasoline and Diesel Fuel Update (EIA)

9) 9) The Na tional En ergy Mod el ing Sys tem: An Over view 2009 October 2009 En ergy In for ma tion Ad min is tra tion Of fice of In te grated Anal y sis and Fore cast ing U.S. De part ment of En ergy Wash ing ton, DC 20585 This re port was pre pared by the En ergy In for ma tion Ad min is tra tion, the in de pend ent sta tis ti cal and an a lyt i cal agency within the U.S. De part ment of En ergy. The in for ma tion con tained herein should be at trib uted to the En ergy In for ma tion Ad min is tra tion and should not be con strued as ad vo cat ing or re flect ing any pol icy po si tion of the De part ment of En ergy or any other or ga ni za tion. This pub li ca tion is on the WEB at: www.eia.doe.gov/oiaf/aeo/over view/ The Na tional En ergy Mod el ing Sys tem: An Over view 2009 pro vides a sum mary de scrip tion of the Na tional En ergy

448

 

Gasoline and Diesel Fuel Update (EIA)

. Major Fuel Consumption (Btu) by End Use for Non-Mall Buildings, 2003 . Major Fuel Consumption (Btu) by End Use for Non-Mall Buildings, 2003 Total Major Fuel Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 5,820 2,203 431 384 448 1,143 167 354 64 148 478 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 672 207 45 18 48 93 48 137 8 12 55 5,001 to 10,000 ....................... 516 198 36 17 40 83 35 56 6 9 39 10,001 to 25,000 ..................... 776 324 47 44 43 151 25 53 9 19 62 25,001 to 50,000 ..................... 673 262 57 50 55 121 13 34 7 16 58 50,001 to 100,000 ................... 759 293 59 65 55 158 11 29 6 18 64

449

Total Space Heat-  

Gasoline and Diesel Fuel Update (EIA)

Released: September, 2008 Released: September, 2008 Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................... 3,037 115 397 384 52 1,143 22 354 64 148 357 Building Floorspace (Square Feet) 1,001 to 5,000 ........................... 386 19 43 18 11 93 7 137 8 12 38 5,001 to 10,000 .......................... 262 12 35 17 5 83 4 56 6 9 35 10,001 to 25,000 ........................ 407 20 46 44 8 151 3 53 9 19 54 25,001 to 50,000 ........................ 350 15 55 50 9 121 2 34 7 16 42 50,001 to 100,000 ...................... 405 16 57 65 7 158 2 29 6 18 45 100,001 to 200,000 .................... 483 16 62 80 5 195 1 24 Q 31 56 200,001 to 500,000 .................... 361 8 51 54 5 162 1 9 8 19 43 Over 500,000 ............................. 383 8 47 56 3 181 2 12 8 23 43 Principal Building Activity

450

 

Gasoline and Diesel Fuel Update (EIA)

A. Major Fuel Consumption (Btu) by End Use for All Buildings, 2003 A. Major Fuel Consumption (Btu) by End Use for All Buildings, 2003 Total Major Fuel Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 6,523 2,365 516 436 501 1,340 190 381 69 156 569 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 685 213 46 18 49 96 49 138 8 12 56 5,001 to 10,000 ....................... 563 212 39 18 43 95 37 57 6 10 46 10,001 to 25,000 ..................... 899 357 57 52 51 184 29 57 10 20 83 25,001 to 50,000 ..................... 742 281 63 55 60 140 16 37 7 17 66 50,001 to 100,000 ................... 913 325 79 78 67 202 17 35 7 20 83

451

LANL: MST e-News April 2012  

NLE Websites -- All DOE Office Websites (Extended Search)

MST e-News-Newsletter of the Materials Science and Technology Division MST e-News-Newsletter of the Materials Science and Technology Division April 2012 I N S I D E 2 From mark's Desk 3 In sItu monItorIng oF DynamIc phenomena DurIng solIDIFIcatIon 4 comparIson oF In sItu 3D ImageD Foams In compressIon wIth moDelIng 5 John carpenter to receIve tms young leaDer proFessIonal Development awarD scIentIFIc Journal publIshes specIal Issue In honor oF carlos tomé 6 three sprIng meetIngs on raDIatIon eFFects The world-record highest non- destructive magnetic field achieved last month at the National High Magnetic Field Laboratory-Pulsed Field Facility will be just one technical achievement featured during the 2012 Materials Capability Review.

452

 

Gasoline and Diesel Fuel Update (EIA)

A. Electricity Consumption (kWh) by End Use for All Buildings, 2003 A. Electricity Consumption (kWh) by End Use for All Buildings, 2003 Total Electricity Consumption (billion kWh) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 1,043 49 141 128 26 393 7 112 20 46 122 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 115 6 13 5 3 28 2 40 2 3 11 5,001 to 10,000 ....................... 86 5 11 5 2 28 1 17 2 3 11 10,001 to 25,000 ..................... 142 8 16 15 4 54 1 17 3 6 19 25,001 to 50,000 ..................... 116 5 18 16 3 41 (*) 11 2 5 14 50,001 to 100,000 ................... 153 8 22 23 4 59 1 10 2 6 17

453

 

Gasoline and Diesel Fuel Update (EIA)

E3A. Electricity Consumption (Btu) by End Use for All Buildings, 2003 E3A. Electricity Consumption (Btu) by End Use for All Buildings, 2003 Total Electricity Consumption (trillion Btu) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings ......................... 3,559 167 481 436 88 1,340 24 381 69 156 418 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 392 19 44 18 11 96 7 138 8 12 39 5,001 to 10,000 ....................... 293 18 38 18 8 95 4 57 6 10 39 10,001 to 25,000 ..................... 485 26 55 52 14 184 3 57 10 20 63 25,001 to 50,000 ..................... 397 18 62 55 12 140 2 37 7 17 48 50,001 to 100,000 ................... 523 28 77 78 15 202 3 35 7 20 59

454

 

Gasoline and Diesel Fuel Update (EIA)

. Electricity Consumption (kWh) by End Use for Non-Mall Buildings, 2003 . Electricity Consumption (kWh) by End Use for Non-Mall Buildings, 2003 Total Electricity Consumption (billion kWh) Total Space Heat- ing Cool- ing Venti- lation Water Heat- ing Light- ing Cook- ing Refrig- eration Office Equip- ment Com- puters Other All Buildings* ........................ 890 34 116 113 15 335 6 104 19 43 105 Building Floorspace (Square Feet) 1,001 to 5,000 ......................... 113 5 13 5 3 27 2 40 2 3 11 5,001 to 10,000 ....................... 77 4 10 5 2 24 1 16 2 3 10 10,001 to 25,000 ..................... 119 6 14 13 2 44 1 15 3 6 16 25,001 to 50,000 ..................... 103 4 16 15 3 35 (*) 10 2 5 12 50,001 to 100,000 ................... 119 5 17 19 2 46 1 9 2 5 13

455

EPIC Muon Cooling Simulations using COSY INFINITY  

SciTech Connect

Next generation magnet systems needed for cooling channels in both neutrino factories and muon colliders will be innovative and complicated. Designing, simulating and optimizing these systems is a challenge. Using COSY INFINITY, a differential algebra-based code, to simulate complicated elements can allow the computation and correction of a variety of higher order effects, such as spherical and chromatic aberrations, that are difficult to address with other simulation tools. As an example, a helical dipole magnet has been implemented and simulated, and the performance of an epicyclic parametric ionization cooling system for muons is studied and compared to simulations made using G4Beamline, a GEANT4 toolkit.

J.A. Maloney, B. Erdelyi, A. Afanasev, R.P. Johnson, S.A. Bogacz, Y.S. Derbenev, V.S. Morozov

2011-03-01T23:59:59.000Z

456

Tag: Naval Reactors  

NLE Websites -- All DOE Office Websites (Extended Search)

9/all en "Cook"ing at Y-12 for 70 9/all en "Cook"ing at Y-12 for 70 years http://www.y12.doe.gov/employees-retirees/y-12-times/cooking-y-12-70-years

We have an enduring mission. Y-12 plays a key role in it. And a nuclear deterrent remains the ultimate insurance policy for America.

10993_Primer_v2i3  

NLE Websites -- All DOE Office Websites (Extended Search)

rich coast-due to the large quantities rich coast-due to the large quantities of gold "found" among the indigenous As the number of sequenced micro- bial genomes has been steadily increas- ing over the past few years, the finish- ing process has become a constriction point. A discussion of ways to increase productivity and improve work efficiency was the motivation behind a two-day meeting held on June 29th and 30th at the JGI-PGF in Walnut Creek. The meet- ing, convened by finishing coordinator Patrick Chain from LLNL, marked the first face-to-face meeting of personnel from all institutions at all levels. Until this meeting, each of the insti- tutions had been generating their own approaches and protocols needed to handle the load. However, many of the steps involved in microbial finishing can

458

Microsoft Word - LANL outprocessing 022205.doc  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ING OF TERMINATED EMPLOYEES AT LOS ALAMOS ING OF TERMINATED EMPLOYEES AT LOS ALAMOS NATIONAL LABORATORY U.S. Department of Energy Office of Inspector General Office of Inspections and Special Inquiries Inspection Report Security and Other Issues Related to Out-Processing of Employees at Los Alamos National Laboratory DOE/IG-0677 February 2005 SECURITY AND OTHER ISSUES RELATED TO OUT- PROCESSING OF EMPLOYEES AT LOS ALAMOS NATIONAL LABORATORY TABLE OF CONTENTS OVERVIEW Introduction and Objectives 1 Observations and Conclusions 1 DETAILS OF FINDINGS Out-Processing Procedures 3 Performance Measures 8 RECOMMENDATIONS 8 MANAGEMENT COMMENTS 9 INSPECTOR COMMENTS 9 APPENDICES A. Scope and Methodology 10

459

arch layout 11.21.98  

NLE Websites -- All DOE Office Websites (Extended Search)

Production Readiness Production Readiness Weprogressed towardmarketadoptionby developing, build- ing and testing prototype systems using numerical simula- tion tools andfield tests,by working with industry andmanu- facturing partners, and by demonstrating the technologies in full-scalecommercialbuildings. Thisprovidedabroad,highly defensible record of documented performance. Prototypeswere developed in cooperationwith industrypart- ners to speed commercializationand to work out market bar- riers to full-scaleadoption.Industrypartners in glazing, win- dow systems, shading systems, controls hardware and light- ing were solicited to participate. Feedback through trade as- sociations, conferences and industry associations helped to identify potential obstaclessuch asdifficulties with cross-dis-

460

methane hydrate science plan-final.indd  

NLE Websites -- All DOE Office Websites (Extended Search)

Period Start Date: October 1, 2012 Period Start Date: October 1, 2012 Project Period End Date: December 31, 2013 Principal Authors: / h [ a I t { { / h [ DUNS #:046862582 1201 New York Avenue, NW Fourth Floor, Washington, D.C. 20005 Prepared for: { 5 9 b 9 [ DO E Aw ard No .: DE -FE 00 10 19 5 Proje ct Title: Met hane Hyd rate Field Prog ram : Deve lopm ent of { t Met hane Hyd rate -Foc used Mar ine Drill ing, Logg ing and Cori ng Prog

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Probing the druggability of the Notch1 ankyrin domain using a fragment-based approach  

E-Print Network (OSTI)

ctively. r region he structur lar region c nd LNR do terminal P ing DSL do SL EGF- 7 s of CSL-d ). PDB cod is known a al and funct onsists of E main, the EST region main and E LNR like repeats NRR ependant N es... ctively. r region he structur lar region c nd LNR do terminal P ing DSL do SL EGF- 7 s of CSL-d ). PDB cod is known a al and funct onsists of E main, the EST region main and E LNR like repeats NRR ependant N es...

Abdel-Rahman, Noha

2011-02-08T23:59:59.000Z

462

Towards the Prediction of Weld Metal Properties  

E-Print Network (OSTI)

assumed to be negligible compared to other contri- 2 Transfer of melted coating to weld pool Metal droplet covered with molten slag Parent metal Figure 1.1: Schematic diagram of the MMA welding process. (After B. Lundqvist (1977), "Sandvik Welding Handbook... ., SVENSSON, L.-E., and GRETOFT, B. (1986), "'Weld- ing and Performance of Pipe Welds", [Proc. Conj.], Welding Institute, Abington, U.K., paper 17. BHADESHIA, H. K. D. H., SVENSSON, L.-E., and GRETOFT, B. (1987), "Weld- ing Metallurgy of Structural Steels...

Sugden, Alastair Allen Brockbank

1989-01-31T23:59:59.000Z

463

Question of the Week: How Will You Landscape for Energy Efficiency? |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Question of the Week: How Will You Landscape for Energy Efficiency? Question of the Week: How Will You Landscape for Energy Efficiency? Question of the Week: How Will You Landscape for Energy Efficiency? April 9, 2009 - 11:31am Addthis On Tuesday, Elizabeth wrote about some resources that will help you landscape with an eye to energy efficiency. Now that spring is here, I know many of your are just itching to get outside and work on your landscaping. How will you landscape for energy efficiency? Each Thursday, you have the chance to share your thoughts on a topic related to energy efficiency or renewable energy for consumers. Please e-mail your responses to the Energy Saver team at consumer.webmaster@nrel.gov. Addthis Related Articles Question of the Week: How Does Your Community Encourage Energy and Fuel Savings? What Have You Done to Ensure Your Water Pipes are Efficient and Safe?

464

 

U.S. Energy Information Administration (EIA) Indexed Site

3. Cooking Energy Sources, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 3. Cooking Energy Sources, Number of Buildings and Floorspace for Non-Mall Buildings, 2003 Number of Buildings (thousand) Total Floorspace (million square feet) All Build- ings* Build- ings with Cooking Cooking Energy Sources (more than one may apply) All Build- ings* Build- ings with Cooking Cooking Energy Sources (more than one may apply) Elec- tricity Natural Gas Propane Elec- tricity Natural Gas Propane All Buildings* ............................... 4,645 801 410 457 108 64,783 22,237 13,161 15,438 1,460 Building Floorspace (Square Feet) 1,001 to 5,000 ................................ 2,552 354 170 183 63 6,789 997 493 549 165 5,001 to 10,000 .............................. 889 155 82 88 Q 6,585 1,136 621 641 Q 10,001 to 25,000 ............................ 738 127 59 75 Q 11,535 1,954 961 1,115 Q

465

 

U.S. Energy Information Administration (EIA) Indexed Site

ENERGY ENERGY ENERGY IN FORMATION ADMINISTRATION Washington, D. C. 20585 OMB No. 1905-0165 Expiration Date: 01/31/2013 (Version No. 2010.02) EIA-804 WEEKLY IMPORTS REPORT INSTRUCTIONS .............................................................................................................................. ................................................................. QUESTIONS If you have any questions abou t Fo rm EIA-80 4 after read ing the

466

International Energy Outlook 1998  

Gasoline and Diesel Fuel Update (EIA)

8) 8) Dis tri bu tion Cate gory UC-950 In ter na tional En ergy Out look 1998 April 1998 En ergy In for ma tion Ad min istra tion Of fice of In te grated Analy sis and Fore cast ing U.S. De part ment of En ergy Wash ing ton, DC 20585 This re port was pre pared by the En ergy In for ma tion Ad min istra tion, the in de pend ent sta tis ti cal and ana lyti cal agency within the De part ment of En ergy. The in for ma tion con tained herein should be at trib uted to the En ergy In for ma tion Ad min istra tion and should not be con strued as ad vo cat ing or re flect ing any pol icy po si tion of the De part ment of En ergy or of any other or gani za tion. Con tacts The Inter na tional Energy Out look is pre pared by the Energy Infor ma tion Admin istra tion (EIA). Gen eral

467

September 2005 Standards Forum and Standards Actions  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Page September 2005 Page September 2005 TSP Manager's Notes 1 The Halo Effect: American National Standards and the rest 2 Standards Development for Report- ing of Declarable Substances 5 Technical Standards Manager Spotlight 8 DOE Revises "Integration of Environment, Safety, and Health

468

1992 CBECS BC  

U.S. Energy Information Administration (EIA) Indexed Site

7. Energy Conservation Features, Number of Buildings 7. Energy Conservation Features, Number of Buildings and Floorspace, 1992 Building Characteristics RSE Column Factor: Number of Buildings (thousand) Total Floorspace (million square feet) RSE Row Factor All Buildings Any Conser- vation Features Build- ing Shell HVAC Light- ing Other All Buildings Any Conser- vation Features Build- ing Shell HVAC Light- ing Other 0.8 0.8 0.8 0.9 1.0 1.9 0.8 0.9 0.9 0.9 1.2 1.7 All Buildings ................................... 4,806 4,357 4,223 2,604 1,178 264 67,876 64,403 62,056 50,281 29,453 5,952 4.7 Building Floorspace (square feet) 1,001 to 5,000 ................................ 2,681 2,376 2,305 1,194 452 102 7,327 6,575 6,375 3,370 1,302 291 7.4 5,001 to 10,000 .............................. 975 887 864 569 275 62 7,199 6,566 6,405 4,221 2,066 467 5.6 10,001 to 25,000

469

Harold Black and the Negative-Feedback Amplifier  

E-Print Network (OSTI)

Harold Black and the Negative-Feedback Amplifier n August 2, 1927,Harold 0Black, a young Bell Labs- cated on West Street in Man- hattan.) Black recalled, "I felt an urge to write but had noth- ing of the newspaper pages used by Black tojot down his early ideas on feedbad (Photo:AT&T Archives) The author

Oriolo, Giuseppe

470

Measuring Energy Sustainability  

E-Print Network (OSTI)

and natural gas, unconventional oil (e.g., tar sands, oil shale, and extra heavy oil), unconventional natural unconventional resources, such as oil shale or tight gas formations. Over the first thirty years there is a clear. However, the chemical processes for mak- ing distillate fuel from coal, oil shale, natural gas, and even

471

Solar Radiative Heating in First Year Sea Ice M.J. McGuinness 1 , K.A. Landman 2 , H.J. Trodahl 3 , A.E. Pantoja 3  

E-Print Network (OSTI)

Solar Radiative Heating in First Year Sea Ice M.J. McGuinness 1 , K.A. Landman 2 , H.J. Trodahl 3 ice show daily oscillations consistent with heating by solar radiation. We present and solve a heat for solar power absorption based on Monte Carlo scatter­ ing simulations of penetrating photons. We observe

472

Modeling and Control Interactive Networks  

E-Print Network (OSTI)

and disturbance-free electricity; bank- ing and finance systems depend on the robustness of elec- tric power aircraft and land and sea vessels, depend on communica- tion and energy networks. Links between the power to be a lynchpin of energy 22 IEEE Control Systems Magazine February 2002 0272-1708/02/$17.00©2002IEEE Theauthor

Amin, S. Massoud

473

Regenerative Braking for an Electric Vehicle Using Ultracapacitors and a Buck-Boost Converter  

E-Print Network (OSTI)

-mail: jdixon@ing.puc.cl *University of Concepción Abstract An ultracapacitor bank control system and decelerations of the vehicle with minimal loss of energy, and minimal degradation of the main battery pack. The system uses an IGBT Buck-Boost converter, which is connected to the ultracapacitor bank at the Boost side

Rudnick, Hugh

474

Landesschulamt Stand: 14.02.2013 Prfungsstelle Darmstadt  

E-Print Network (OSTI)

. Barbara Albert Chemie (Anorg. u. Physik. Chemie) 28.02.2015 Dr. Ing. Hans-Jürgen Bär Chemie ( Physik. Chemie ) 28.02.2015 Prof. Dr. Robert Berger Organische Chemie / Biochemie. 30.09.2014 Prof. Dr. Markus Biesalski Chemie ( für Drucktechnik ) 28.02.2015 Prof. Dr. Gerd Buntkowsky Chemie ( Phys. Chemie ) 28

Hoffmann, Rolf

475

IEEE TRANSACTIONS ON MICROWAVE THEORY AND TECHNIQUES, VOL. 47, NO. 8, AUGUST 1999 1433 Application of GaInP/GaAs DHBT's to Power  

E-Print Network (OSTI)

elements in mobile wireless- communication systems since they account for a large fraction of the overall, these devices are presently in widespread use in commercial systems, with annual manufacturing volume above 20 was involved in developing fiber-optic switches us- ing micromachining techniques. Her research inter- ests

Asbeck, Peter M.

476

amagazineforalumniandfriendsoftheinstituteoftechnology|SPring/Summer2007 AltErnAtivEs  

E-Print Network (OSTI)

ways to produce lower-cost solar heating systems manufactured of plastic rather than of cop- per. They are developing improved storage systems and methods to reduce scaling on the polymer surfaces of solar unitsIng tomorrow on the Cover Professor Eray Aydil tests a nanowire-based solar cell in his lab. Aydil is just one

Minnesota, University of

477

THE POLYTECHNIC REPORTER Bloomberg Chosen to Head  

E-Print Network (OSTI)

. Eventually, the state gave the city an $86,000 grant to add more traffic lights and better signage to improve of the benefits of joining NSBE? · A support system for academic success · An opportunity for community NSBE Club systems, shorten- ing street blocks, adding side- walks, improving sidewalk networks, planting more street

Gupta, Nikhil

478

David Kaiser The Physics of Spin  

E-Print Network (OSTI)

tests on science advisers, censor- ing scientific reports to better reflect political imperatives. On first blush, several areas of over- lap stand out: elite atomic diplomacy, low-brow domestic anticom" from the "science" in the circulation of cryogenics experts and factory- sized machinery from hydrogen-bomb

Kaiser, David

479

EditorialnReviewsandCommentaRy 330 radiology.rsna.org n Radiology: Volume 265: Number 2--November 2012  

E-Print Network (OSTI)

in Medicine (5) states the follow- ing: "Risks of medical imaging at effective doses below 50 mSv for single of exposed Japanese atomic bomb survivors (8). Clearly, there are many differences between a CT scan and an atomic bomb exposure; however, about 30000 atomic bomb survivors who were located several miles from

Brenner, David Jonathan

480

ealth physics is concerned with protecting people from the harmful effects of ionizing radiation while allowing its beneficial use in medicine, science,  

E-Print Network (OSTI)

, particularly from medical exposures and from the atomic-bomb ex- posures in Hiroshima and Nagasaki. DuringH ealth physics is concerned with protecting people from the harmful effects of ionizing radiation effects such as cancer that had been observed in populations of people receiv- ing high doses

Massey, Thomas N.

Note: This page contains sample records for the topic "l-sw itch ing" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

NANOSECOND PULSE NONEQUILIBRIUM DISCHARGES FOR HIGH SPEED FLOW CONTROL AND PLASMA ASSISTED COMBUSTION  

E-Print Network (OSTI)

their poten tial for engineering applications such as plasma assisted combustion, highspeed flow con trol by RNSPD and compared with kinetic model ing. The results show that ignition in a uniform plasma occurs Engi neering from Moscow Institute of Physics and Technology and a Ph.D. in Chemical Physics from OSU

Shyy, Wei

482

Combining CSP and ObjectZ: Finite or Infinite Trace Semantics?  

E-Print Network (OSTI)

Combining CSP and Object­Z: Finite or Infinite Trace Semantics? Clemens Fischer Universit semantics as a means of combin­ ing CSP with Object­Z. The purpose of this combination is to more effectively specify complex, concurrent systems: while CSP is ideal for modelling systems of concurrent

Smith, Graeme

483

Australasian Language Workshop 2005  

E-Print Network (OSTI)

;FOREWORD There are twice as many people in the United States now as there were 50 years ago. The gross- ing the year, 4.2 percent less than during the pre- vious year. The decreases are attributed to severe during the 4-year period, increasing the first 2 years, but declining 63 percent below the peak

484

Wildlife Research Pi^lems Pr^f^ms Pro^,|s w  

E-Print Network (OSTI)

;FOREWORD There are twice as many people in the United States now as there were 50 years ago. The gross- ing the year, 4.2 percent less than during the pre- vious year. The decreases are attributed to severe during the 4-year period, increasing the first 2 years, but declining 63 percent below the peak

485

Energy Codes and the Landlord-Tenant Problem  

E-Print Network (OSTI)

market premiums from energy efficiency investments may be miti- gated due to asymmetric informationenergy efficiency in real estate markets (EPA (2003)). 8 Sources of asymmetric informationenergy efficient build- ings remains a first order concern, for several reasons that extend beyond the potential for information market

Papineau, Maya

2013-01-01T23:59:59.000Z

486

A Primer on the Fifth Power Plan: A Guide for Our Energy Future  

E-Print Network (OSTI)

gas (LNG), loaded onto specially designed LNG tankers, and shipped to LNG receiv- ing terminals where, their efforts are in response to FERC's proposed solution for the nation, which happens to be a bad fit for the Northwest's system. The regional group's current proposal out- lines a staged process in which the inde

487

Quantized states in homogenous polarized GaInN GaN quantum wells  

E-Print Network (OSTI)

Quantized states in homogenous polarized GaInN GaN quantum wells C. Wetzel1, S. Kamiyama1, H. Amano wells is calculated in a single particle model. The act- ing electric eld in the wells and the band gap-dimensional well layers our approach is based on induction from results obtained at the binary GaN barri- ers

Wetzel, Christian M.

488

Experimental observation of enhanced interaction of magnetic solitons with potential barriers and wells  

E-Print Network (OSTI)

and wells Vladislav E. Demidov,* Ulf-Hendrik Hansen, and Sergej O. Demokritov Institute for Applied Physics magnetic potential barriers and wells. We have found that the nonlinearity in the system causes of potential barriers the solitons demonstrate an enhanced tunnel- ing, whereas for potential wells they show

Demokritov, S.O.

489

Inhibition recruitment in prefrontal cortex during sleep spindles and gating of hippocampal inputs  

E-Print Network (OSTI)

scientific payloads to study celestial gamma ray bursts and X-ray sources. For conduct- ing atmospheric have been high-energy cosmic ray variability using neutron/ meson/Cerenkov monitors, equatorial is likely to carry soft and hard X-ray detectors and imaging payloads, all sky X-ray monitors and a UV

Destexhe, Alain

490

Airport sustainability encompasses a wide variety of airport management and  

E-Print Network (OSTI)

of these measures are replac- ing an old or inefficient water heater or replacing incandescent light bulbs of existing buildings and ground vehicles to collecting water and managing waste. Assessing the sustainability is to consider renewable energies. Solar photovoltaic (PV), which uses panels to absorb solar energy, is prob

Blanchette, Robert A.

491

ANN. MISSOURI BOT. GARD. 90: 3555. 2003. YUCCAS, YUCCA MOTHS,  

E-Print Network (OSTI)

of Mexico have been excluded. cies (Frack, 1982; Nielsen, 1982; Pellmyr & Bal- ca´zar-Lara, in prep larvae that feed inside host tissue until feed- ing is complete (Davis, 1967; Frack, 1982). Mese- piola, the peduncles of at least six Agave species are used (Frack, 1982) by some Prodoxus species. I will not deal

Pellmyr, Olle

492

annual report 2011-2012 park Scholarships Staff  

E-Print Network (OSTI)

- turned to the surface is the fracking fluid (also called drilling return wa- ter, drilling wastewater with this drilling and hydrofractur- ing (fracking), the portion of water withdrawals related to mining is likely for re- fracking, these types of water with- drawals might continue further into the future, past

493

Journal of Power Sources 135 (2004) 327331 Short communication  

E-Print Network (OSTI)

Photovoltaic (PV) energy is gaining greater visibility dur- ing the last several years as a convenient for photovoltaic arrays, in: Proceedings of the Second World Conference on Photovoltaic Solar Energy Conversion for photovoltaic applications S. Yuvarajana,, Dachuan Yua, Shanguang Xub a Electrical and Computer Engineering

Yuvarajan, Subbaraya

494

V O L U M E 8 2 N U M B E R 4 F A L L 2 0 0 1 M A G A Z I N E  

E-Print Network (OSTI)

's authors. s Vanderbilt and the School of Engineering each advanced one spot in the latest rank- ings by U.S articles published in Vanderbilt Magazine. Readers may correspond via U.S. mail to: Vanderbilt Magazine, VU. Readers may correspond via U.S. mail to: Vanderbilt Magazine, VU Station B 357703, 2301 Vanderbilt Place

Bordenstein, Seth

495

What could a million cores do to solve Integer Programs?  

E-Print Network (OSTI)

After all, such systems are not yet available and may even seem fanciful by ... supercomputers is the amount of energy they will consume. The current number. 2 ..... ing from increased integration, e.g. more bits per DIMM, more cores per CPU,.

496

Crossover effects in the temperature dependence of the critical current in YBa2Cu3O7 H. Darhmaoui and J. Jung*  

E-Print Network (OSTI)

the magnitude of the persistent current's self-field in the center of the ring. This technique eliminated depinning critical current is determined by magnetic flux movement and pinning forces. If the flux lines in the superconductor, accord- ing to the Maxwell equations. The superconductor can sup- port the current if the flux

Darhmaoui, Hassane

497

0018-9162/01/$10.00 2001 IEEE52 Computer Power: A First-Class  

E-Print Network (OSTI)

important. A recent analysis by Deo Singh and Vivek Tawair of Intel showed that a 25,000-square-foot server or indi- rectly accounts for 25 percent of the cost for manag- ing such a facility (see the proceedings, which increases linearly. Alpha model 21364's power density has reached approximately 30 watts per

Mudge, Trevor

498

PERFORMANCE STATUS OF THE RF-GUN BASED INJECTOR OF THE TESLA TEST FACILITY LINAC  

E-Print Network (OSTI)

PERFORMANCE STATUS OF THE RF-GUN BASED INJECTOR OF THE TESLA TEST FACILITY LINAC S. Schreiber£ for the TESLA Collaboration, DESY, 22603 Hamburg, Germany Abstract The TESLA Test Facility Linac (TTFL) at DESY uses two modules with 8 TESLA superconducting accelerat- ing structures each to accelerate an electron

499

A Functional Regression Approach for Prediction in a District-Heating System  

E-Print Network (OSTI)

A Functional Regression Approach for Prediction in a District-Heating System Aldo Goia Dipartimento in a district heating sys- tem. Our dataset consists of four separated periods, with 198 days each period and 24 load forecasting, district heat- ing system Introduction Among the activities of support

Paris-Sud XI, Université de

500

Online prediction and control nonlinear stochastic systems  

E-Print Network (OSTI)

temperature in district heat- ing systems. · Prediction of power production from the wind turbines located and their application to prediction and control within district heating systems and for prediction of wind power. Here temperature in district heating systems', Techni- cal Report IMM-REP-2002-23, Informatics and Mathematical