Powered by Deep Web Technologies
Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY...


Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



?? / Kagaku / ?? /Ky?ri: Science  

E-Print Network (OSTI)

question when considering science and technology in Japanese?? /Kagaku / ?? /Ky?ri: Science Tsukahara T?go Translationto incorporate and develop science and technology from the

Tsukahara, T?go



Category:Lexington, KY | Open Energy Information  

Open Energy Info (EERE)

Lexington, KY Lexington, KY Jump to: navigation, search Go Back to PV Economics By Location Media in category "Lexington, KY" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Lexington KY Kentucky Utilities Co.png SVFullServiceRestauran... 65 KB SVHospital Lexington KY Kentucky Utilities Co.png SVHospital Lexington K... 61 KB SVLargeHotel Lexington KY Kentucky Utilities Co.png SVLargeHotel Lexington... 61 KB SVLargeOffice Lexington KY Kentucky Utilities Co.png SVLargeOffice Lexingto... 62 KB SVMediumOffice Lexington KY Kentucky Utilities Co.png SVMediumOffice Lexingt... 64 KB SVMidriseApartment Lexington KY Kentucky Utilities Co.png SVMidriseApartment Lex... 59 KB SVOutPatient Lexington KY Kentucky Utilities Co.png SVOutPatient Lexington...


LATA KY WEA-2012-01  

Energy.gov (U.S. Department of Energy (DOE))

The Office of Enforcement and Oversight provided the results of the investigation to LATA KY in a report dated November 21, 2011. An enforcement conference was held on January 18, 2012, with LATA KY representatives to discuss the report findings and associated corrective actions. A summary of the conference is enclosed.



Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use



SciTech Connect

To begin, we examine the relationship between MiniBooNE and the neutrino beam geometry at Fermilab. In Figure 1, a schematic representation is shown of the plan view of the location of MiniBooNE relative to SciBooNE and the NuMI target, where it can be seen that SciBooNE and MiniBooNE share the same beamline and neutrino flux, and therefore share some of the same systematic effects -- A combined analysis between the two experimental groups could yield a superior result compared to segregated individual analysis. MiniBooNE makes an angle of 6.3 degrees with the NuMI beamline, an off-axis measurement if you will, that provides a relatively high yield of electron neutrinos from kaon decay. Furthermore, the proton beam incident on the MiniBooNE target possesses a 53 MHz structure that will be important in timing studies related to the low energy excess. Let's review of the results of the MiniBooNE: As is well known, MiniBooNE, a test of the LSND effect [1], adds experimental inspiration to the possible existence of new phenomena; although two neutrino-family oscillations were shown to be an unlikely candidate to explain the LSND effect, a low energy excess of 3.0 sigma in the neutrino sector at energies between 200 to 475 MeV [2] - an effect that appears to have no counterpart in the antineutrino sector [3], combined with the 3.8 sigma LSND result - at roughly 50 MeV - strains phenomenology for insight. Miniboones continues to run and collect antineutrino data; will combine disappearance analysis with SciBooNE; take data from the NuMI target, an unusual source with a potentially new look at the low energy anomaly; and use beam timing techniques to further constrain phenomenological models. In this paper we will review current topics related to MiniBooNE and other associated experiments and phenomenology.

Stefanski, Ray; /Fermilab




Office of Legacy Management (LM)

t:"'. ? - ' t:"'. ? - ' y5 NE-23, wk$& Dr. Joseph A. Warburton Chainnan, Radiological and Toxicological Safety Board University of Nevada System DRI/ASC, P.O. Box 60220 Reno, Nevada 89506 Dear Dr. Warburton: The Department of Energy (DOE), as part of its Formerly Utilized Sites Remedial Action Program (FUSRAP), has reviewed information on the Mackay School of M ines facility at the University of Nevada, Reno, Nevada, to determine whether it contains residual radioactivity traceable to activities conducted on behalf of the Atomic Energy Commission (a predecessor to DOE). A radiological survey indicated that the radiation levels at the involved portion of the facility are at or near background levtrls. Therefore, no remedial action is required, and DGE is eliminating



Office of Legacy Management (LM)

VW- VW- 50 "id AU6 3 1983 NE-24 .' . _ : ' : R&D Decontamination Projects Under the Formerly Utilized Sites Remedial Actlon Program (FUSRAP) '_ F .- ,: 'J,.LaGrone, Manager . Oak Ridge Operations Office As a result of the House-Senate Conference Report and the Energy and Water Appropriations Act for FY 1984, and based on the data in the attached reports indicating radioactive contamination in excess of acceptable guidelines, the sites listed in the attachment and their respective vicinity properties (contaminated with radioactive materials from these sites) are being designated as decontamination research and development projects under the FUSRAP. Each site and the associated vicinity properties should be treated as a separate project. The objective of each project is to decontaminate the vicinity properties



Office of Legacy Management (LM)

hi v. !&-2:. hi v. !&-2:. /qL lo 1 OCT 2 9 1984 NE-20 -. Authorization for Remedial Action of the Ashland 2 Site, Tonawanda, New York f! Joe LaGrone, Manager Oak Ridge Operations Office Based on the Aerial Radiological Survey (Attachment 1) and a "walk-on" radiologlcal survey (Attachment 2 , excerpted from the ORNL draft report "Ground-Level Investigation of Anomalous Gamma Radiation Levels in the Tonawanda, New York, Area," January 1980), the property identified as Ashland 2 is authorized for remedial action. It should be noted that the attached survey data are for designation purposes only and Bechtel National, Inc. (EM), should conduct appropriate comprehensive characterization surveys to determine the extent and magnitude of the


NE Blog Archive  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ne/blog-archive 1000 Independence Ave. SWWashington DC ne/blog-archive 1000 Independence Ave. SWWashington DC 20585202-586-5000 en Generation IV International Forum Updates Technology Roadmap and Builds Future Collaboration http://energy.gov/ne/articles/generation-iv-international-forum-updates-technology-roadmap-and-builds-future ne/articles/generation-iv-international-forum-updates-technology-roadmap-and-builds-future" class="title-link">Generation IV International Forum Updates Technology Roadmap and Builds Future Collaboration


Proceedings, World Of Coal Ash, April 11-15, 2005, Lexington, KY, USA Pultrusion of Fabric Reinforced High Flyash  

E-Print Network (OSTI)

Proceedings, World Of Coal Ash, April 11-15, 2005, Lexington, KY, USA Pultrusion of Fabric Reinforced High Flyash Blended Cement Composites Barzin Mobasher(1) , Alva Peled (2) , and Jitendra of elasticity. #12;Proceedings, World Of Coal Ash, April 11-15, 2005, Lexington, KY, USA In addition to ease

Mobasher, Barzin


Eliyahu Ne'eman  

NLE Websites -- All DOE Office Websites (Extended Search)

Eliyahu Ne'eman Eliyahu Ne'eman Consulting Engineer on Lighting and Daylighting Lawrence Berkeley National Laboratory This speaker was a visiting speaker who delivered a talk or talks on the date(s) shown at the links below. This speaker is not otherwise associated with Lawrence Berkeley National Laboratory, unless specifically identified as a Berkeley Lab staff member. Eliyahu Ne'eman is a leading international expert on lighting and daylighting. He has been involved in education, research and practice for over 40 years while working in Israel, UK, Germany and the US(LBNL). He has worked extensively in the area of occupant response in luminous spaces and he has been leading the CIE Task Group that has revised the CIE Museum Lighting Guide. This Speaker's Seminars Control of Damage to Museum Objects by Optical Radiation


File:USDA-CE-Production-GIFmaps-KY.pdf | Open Energy Information  

Open Energy Info (EERE)

KY.pdf KY.pdf Jump to: navigation, search File File history File usage Kentucky Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 387 KB, MIME type: application/pdf) Description Kentucky Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Kentucky External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:15, 27 December 2010 Thumbnail for version as of 16:15, 27 December 2010 1,650 × 1,275 (387 KB) MapBot (Talk | contribs) Automated bot upload


File:EIA-Appalach7-TN-KY-LIQ.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach7-TN-KY-LIQ.pdf Appalach7-TN-KY-LIQ.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Kentucky and Tennessee By 2001 Liquids Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 19.31 MB, MIME type: application/pdf) Description Appalachian Basin, Kentucky and Tennessee By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Kentucky, Tennessee File history Click on a date/time to view the file as it appeared at that time.


Mr. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

300, 955 L'E~~MI Phm.SW.:. Washin@on. LX. 200242174, T~kphonc(202)48ll. 5 300, 955 L'E~~MI Phm.SW.:. Washin@on. LX. 200242174, T~kphonc(202)48ll. 5 7117-03.87.cdy.43 23 September 1987 cA Mr. Andrew Wallo, III, NE-23 Division of Facility & Site Decommissioning Projects U.S. Department of Energy Germantown, Maryland 20545 Dear Mr. Wallo: ELIMINATION RECOMMENDATION -- COLLEGES AND UNIVERSITIES M/).0-05 pl 0.0% The attached elimination recommendation was prepared in accordance ML.05 with your suggestion during our meeting on 22 September. The recommendation flD.o-02 includes 26 colleges and universities identified.in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Site List, dated NO.03. 27 May 1987; three institutions (Tufts College, University of Virginia, rJc..of and the University of Washington) currently identified on the FUSRAP


Category:Omaha, NE | Open Energy Information  

Open Energy Info (EERE)

Omaha, NE Omaha, NE Jump to: navigation, search Go Back to PV Economics By Location Media in category "Omaha, NE" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Omaha NE Omaha Public Power District.png SVFullServiceRestauran... 63 KB SVHospital Omaha NE Omaha Public Power District.png SVHospital Omaha NE Om... 61 KB SVLargeHotel Omaha NE Omaha Public Power District.png SVLargeHotel Omaha NE ... 61 KB SVLargeOffice Omaha NE Omaha Public Power District.png SVLargeOffice Omaha NE... 63 KB SVMediumOffice Omaha NE Omaha Public Power District.png SVMediumOffice Omaha N... 65 KB SVMidriseApartment Omaha NE Omaha Public Power District.png SVMidriseApartment Oma... 62 KB SVOutPatient Omaha NE Omaha Public Power District.png SVOutPatient Omaha NE ...


NE-23 W  

Office of Legacy Management (LM)

>:-1. ,- '"CC3 >:-1. ,- '"CC3 . ' NE-23 .+ W h itm~ l-l& Mr. Victor 3. Canilov, Director Museum of Science and Industry East 57th Street and Lake Shore Drive Chicago, Illinois 60037 Dear kr. Danilov: The Department of Energy (DOE), as part of its Formerly Utilized Sites Remedial Action Program (FUSPSIP), has reviewed information on the Museum cf Science and Industry, Chicago, Illinois, to determine whether it contains residual radioactivity traceable to activities conducted on behalf of the Manhattan Engineer District or the Atomic Energy C o m m ission (predecessors to DOE). A radiological survey indicated that the radiation levels are equal to natural background. Therefore, no remedial action is required, ant DOE is eliminating the Museum of Science and Industry from further


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


Fractal Location and Anomalous Diffusion Dynamics for Oil Wells from the KY Geological Survey  

E-Print Network (OSTI)

Utilizing data available from the Kentucky Geonet (KYGeonet.ky.gov) the fossil fuel mining locations created by the Kentucky Geological Survey geo-locating oil and gas wells are mapped using ESRI ArcGIS in Kentucky single plain 1602 ft projection. This data was then exported into a spreadsheet showing latitude and longitude for each point to be used for modeling at different scales to determine the fractal dimension of the set. Following the porosity and diffusivity studies of Tarafdar and Roy1 we extract fractal dimensions of the fossil fuel mining locations and search for evidence of scaling laws for the set of deposits. The Levy index is used to determine a match to a statistical mechanically motivated generalized probability function for the wells. This probability distribution corresponds to a solution of a dynamical anomalous diffusion equation of fractional order that describes the Levy paths which can be solved in the diffusion limit by the Fox H function ansatz.

Andrew, Keith; Andrew, Kevin A



US NE MA Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

NE MA NE MA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 $3,000 US NE MA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US NE MA Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US NE MA Expenditures dollars ELECTRICITY ONLY average per household * Massachusetts households use 109 million Btu of energy per home, 22% more than the U.S. average. * The higher than average site consumption results in households spending 22% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S. However, spending on electricity is closer to the national average due to higher


US NE MA Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

NE MA NE MA Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 $3,000 US NE MA Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US NE MA Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US NE MA Expenditures dollars ELECTRICITY ONLY average per household * Massachusetts households use 109 million Btu of energy per home, 22% more than the U.S. average. * The higher than average site consumption results in households spending 22% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers, keeps average site electricity consumption in the state low relative to other parts of the U.S. However, spending on electricity is closer to the national average due to higher


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


Overview of NE Research Programs  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NE Research Programs NE Research Programs Sue Lesica Office of Nuclear Energy U.S. Department of Energy July 31, 2013 2 R&D Budgets FY 2013 FY 2014 Congressional Request House Mark Senate Mark SMR Licensing Technical Support 62,999 70,000 110,000 70,000 Small Modular Reactor R&D 23,958 20,000 20,000 20,000 Next Generation Nuclear Plant 38,720 0 0 0 LWR Sustainability 24,218 21,500 21,500 21,500 Advanced Reactor Concepts 21,178 31,000 45,000 21,000 Reactor Concepts RD&D 108,075 72,500 86,500 62,500 Modeling and Simulation Hub 24,588 24,300 24,300 24,300 Crosscutting Technology Development 17,242 13,901 27,885 25,437 NEAMS 13,646 9,536 National Scientific Users Facility 14,563 14,563 14,563 14,563 Nuclear Energy Enabling Technologies 70,040 62,300 66,748 62,300



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


NE - Nuclear Energy - Energy Conservation Plan  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NUCLEAR ENERGY (NE) NUCLEAR ENERGY (NE) ENERGY CONSERVATION PLAN NE has heavily emphasized the use of flexiplace, both regular and situational. Since approximately 56 percent of NE staff use flexiplace, our plan is based on the Forrestal/Germantown (FORS/GTN) office spaces, and flexiplace office space. There are other common sense actions and policies that will be used to improve energy efficiency in the offices at both FORS and GTN. In the FORS/GTN office space: 1. Use flexiplace to the maximum extent possible. Saving an average of 1.5 gallons of gasoline per day per person (e.g., 13 miles per work x 2 = 26 miles, an average of 17 mpg), on a normal workday, NE employees save (56 percent of 145 = 71 times 1.2 days per pay period = 85.2 workdays x 1.5 gals = 127.8 gallons/pay


DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


Interatomic Coulombic decay following Ne 1s Auger decay in NeAr  

SciTech Connect

Using momentum-resolved electron-ion multicoincidence spectroscopy, we have investigated interatomic Coulombic decay (ICD) in the heteronuclear NeAr dimer following Ne 1s Auger decay. The measured intensity ratio for the three ICD transitions Ne{sup 2+}(2s{sup -1}2p{sup -1} {sup 1}P)Ar to Ne{sup 2+}(2p{sup -2} {sup 1}S)-Ar{sup +}(3p{sup -1}), Ne{sup 2+}(2s{sup -1}2p{sup -1} {sup 1}P)Ar to Ne{sup 2+}(2p{sup -2} {sup 1}D)-Ar{sup +}(3p{sup -1}), and Ne{sup 2+}(2s{sup -1}2p{sup -1} {sup 3}P)Ar to Ne{sup 2+}(2p{sup -2} {sup 3}P)-Ar{sup +}(3p{sup -1}) reasonably agree with predictions. The kinetic energy release distribution for the fragmentation to Ne{sup 2+}(2p{sup -2} {sup 1}D)-Ar{sup +}(3p{sup -1}) after the ICD transition from singlet Ne{sup 2+}(2s{sup -1}2p{sup -1} {sup 1}P)Ar state, which is a mirror image of the kinetic energy distribution of the emitted ICD electrons, suggests that the corresponding ICD rate is roughly two times lower than predicted by ab initio calculations.

Ouchi, T.; Sakai, K.; Fukuzawa, H.; Ueda, K. [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai 980-8577 (Japan); Higuchi, I.; Tamenori, Y. [Japan Synchrotron Radiation Research Institute, Sayo, Hyogo 679-5198 (Japan); Demekhin, Ph. V.; Chiang, Y.-C.; Stoychev, S. D.; Kuleff, A. I. [Theoretische Chemie, Universitaet Heidelberg, D-69120 Heidelberg (Germany); Mazza, T. [Institute of Multidisciplinary Research for Advanced Materials, Tohoku University, Sendai 980-8577 (Japan); Cimaina and Dipartimento di Fisica, Universita degli Studi di Milano, via Celoria 16, I-20133 Milano (Italy); Schoeffler, M. [Chemical Sciences Division, Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Nagaya, K.; Yao, M. [Department of Physics, Kyoto University, Kyoto 606-8502 (Japan); Saito, N. [National Institute of Advanced Industrial Science and Technology, National Meteorology Institute of Japan, Tsukuba 305-8568 (Japan)


Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab




Gasoline and Diesel Fuel Update (EIA)



Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...



Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...



Gasoline and Diesel Fuel Update (EIA)




Annual Energy Outlook 2012 (EIA)



U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)



NE SARE Arbuscular Mycorrhiza Research following canola  

E-Print Network (OSTI)

NE SARE Arbuscular Mycorrhiza Research Corn grown following canola Corn grown following soybeans The planting of canola, a non-mycorrhizal crop, has been shown to reduce arbuscular mycorrhizal fungi following canola. To address this problem, we intercropped canola with oats, a mycorrhizal crop

Kaye, Jason P.


DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state



NLE Websites -- All DOE Office Websites (Extended Search)

ataTechnologySpecificUnitedStatesWindHighResolutionKentuckyWindHighResolution.zip> Description: Abstract: Annual average wind resource potential for the state of...


Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



The MiniBooNE detector technical design report  

SciTech Connect

The MiniBooNE experiment [1] is motivated by the LSND observation, [2] which has been interpreted as {nu}{sub {mu}} {yields} {nu}{sub e} oscillations, and by the atmospheric neutrino deficit, [3,4,5] which may be ascribed to {nu}{sub {mu}} oscillations into another type of neutrino. MiniBooNE is a single-detector experiment designed to: obtain {approx} 1000 {nu}{sub {mu}} {yields} {nu}{sub e} events if the LSND signal is due to {nu}{sub {mu}} {yields} {nu}{sub e} oscillations, establishing the oscillation signal at the > 5{sigma} level as shown in Fig. 1.1; extend the search for {nu}{sub {mu}} {yields} {nu}{sub e} oscillations significantly beyond what has been studied previously if no signal is observed; search for {nu}{sub {mu}} disappearance to address the atmospheric neutrino deficit with a signal that is a suppression of the rate of {nu}{sub {mu}}C {yields} {mu}N events from the expected 600,000 per year; measure the oscillation parameters as shown in Fig. 1.2 if oscillations are observed; and test CP conservation in the lepton sector if oscillations are observed by running with separate {nu}{sub {mu}} and {bar {nu}}{sub {mu}} beams. The detector will consist of a spherical tank 6.1 m (20 feet) in radius, as shown in Fig. 1.3, that stands in a 45-foot diameter cylindrical vault. An inner tank structure at 5.75 m radius will support 1280 8-inch phototubes (10% coverage) pointed inward and optically isolated from the outer region of the tank. The tank will be filled with 807 t of mineral oil, resulting in a 445 t fiducial volume. The outer tank volume will serve as a veto shield for identifying particles both entering and leaving the detector with 240 phototubes mounted on the tank wall. Above the detector tank will be an electronics enclosure that houses the fast electronics and data acquisition system and a utilities enclosure that houses the plumbing, overflow tank, and calibration laser. The detector will be located {approx} 550 m from the Booster neutrino source. The neutrino beam, produced using 8 GeV protons from the Booster at FNAL, will consist of a target within a focusing system, followed by a {approx}50 m long pion decay volume. The low energy, high intensity and 1 {micro}s time-structure of a neutrino beam produced from the Booster beam are ideal for this experiment. We assume that the Booster can reliably deliver protons for a typical run which is two-thirds of a calendar year. The sensitivities discussed above assume the experiment receives 5 x 10{sup 20} protons per year. This Booster experiment is compatible with the Fermilab collider and MI programs. The Booster must run at 7.5 Hz to accommodate the MiniBooNE and collider programs simultaneously. The current schedule calls for data-taking to begin by the end of calendar year 2001.

I. Stancu et al.



Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls


I Volume 5, Number 2 Spring 1992 A Ne\\izsletter for the RLE Community at MI'T  

E-Print Network (OSTI)

:l XI:~ri:l Ticchi. Inq~tiriesmay he ;~ddrcsscdto: RLE undercurrents Rescarcli Lahor:ltory of Electrc


NE Blog Archive | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Blog Archive Blog Archive NE Blog Archive RSS December 31, 2013 GIF Policy Group Meeting in Brussels, Belgium, November 2013 Generation IV International Forum Updates Technology Roadmap and Builds Future Collaboration The Generation IV International Forum (GIF) held its 36th Policy Group (PG) meeting on November 21-22 in Brussels, Belgium. The PG reviewed progress on a number of on-going actions and received progress reports from the GIF Experts Group (EG) and the GIF Senior Industry Advisory Panel (SIAP). December 12, 2013 The basics of small modular reactor technology explained. | Infographic by Sarah Gerrity, Energy Department. Advancing Small Modular Reactors: How We're Supporting Next-Gen Nuclear


Microsoft PowerPoint - NE- Milton  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

University University Program (NEUP) Presentation to Vice Presidents of Research and Development of Historically Black Colleges and Universities Ingrid M. Milton Department of Energy Office of Nuclear Energy July 9, 2009 195725 (2) Overview The Office of Nuclear Energy (NE) is committed to strengthening the Nation's educational programs in nuclear science and engineering. * Established the Nuclear Energy University Program (NEUP). * Award grants and contracts through competitive selection process. NEUP enables universities to maintain and expand their nuclear science curriculum and programs to ensure future availability of technical experts for U.S. nuclear programs. * NEUP is managed by the Center for Advanced Energy Studies (CAES). 2 195725 (3) Nuclear Energy University Program -


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


The role of the N*(1535) resonance and the pi^- p --> KY amplitudes in the OZI forbidden pi N --> phi N reaction  

E-Print Network (OSTI)

We study the pi N --> phi N reaction close to the phi N threshold within the chiral unitary approach, by combining the pi^- p --> K^+ Sigma^-, pi^- p --> K^0 Sigma^0 and pi^- p --> K^0 Lambda amplitudes with the coupling of the phi to the K components of the final states of these reactions via quantum loops. We obtain a good agreement with experiment when the dominant pi^- p --> K^0 Lambda amplitude is constrained with its experimental cross section. We also evaluate the coupling of the N*(1535) to phi N and find a moderate coupling as a consequence of partial cancellation of the large KY components of the N*(1535). We also show that the N*(1535) pole approximation is too small to reproduce the measured cross section for the pi N --> phi N reaction.

M. Dring; E. Oset; B. S. Zou



NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Press Releases Press Releases NE Press Releases RSS December 12, 2013 Energy Department Announces New Investment in Innovative Small Modular Reactor The Energy Department tannounced an award to NuScale Power LLC to support a new project to design, certify and help commercialize innovative small modular reactors in the United States. November 12, 2013 Public Invited to Comment on Draft Environmental Assessment for the Resumption of Transient Testing of Nuclear Fuels and Materials The U.S. Department of Energy invites the public to read and comment on a draft environmental assessment it has prepared for a proposal to resume transient testing of nuclear fuels and materials at either Idaho National Laboratory (INL) or Sandia National Laboratories (SNL). November 4, 2013 Factsheet: Second Meeting of the United States-Japan Bilateral Commission


Notices 888 First Street, NE., Washington, DC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

11 Federal Register 11 Federal Register / Vol. 76, No. 122 / Friday, June 24, 2011 / Notices 888 First Street, NE., Washington, DC 20426. The filings in the above-referenced proceeding are accessible in the Commission's eLibrary system by clicking on the appropriate link in the above list. They are also available for review in the Commission's Public Reference Room in Washington, DC. There is an eSubscription link on the Web site that enables subscribers to receive e-mail notification when a document is added to a subscribed docket(s). For assistance with any FERC Online service, please e-mail FERCOnlineSupport@ferc.gov or call (866) 208-3676 (toll free). For TTY, call (202) 502-8659. Dated: June 20, 2011. Kimberly D. Bose, Secretary. [FR Doc. 2011-15859 Filed 6-23-11; 8:45 am]


Notices 888 First Street NE., Washington, DC  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

53 Federal Register 53 Federal Register / Vol. 78, No. 56 / Friday, March 22, 2013 / Notices 888 First Street NE., Washington, DC 20426. This filing is accessible on-line at http://www.ferc.gov, using the ''eLibrary'' link and is available for review in the Commission's Public Reference Room in Washington, DC. There is an ''eSubscription'' link on the Web site that enables subscribers to receive email notification when a document is added to a subscribed docket(s). For assistance with any FERC Online service, please email FERCOnlineSupport@ferc.gov, or call (866) 208-3676 (toll free). For TTY, call (202) 502-8659. Comment Date: 5:00 p.m. Eastern Time on April 2, 2013. Dated: March 15, 2013. Kimberly D. Bose, Secretary. [FR Doc. 2013-06602 Filed 3-21-13; 8:45 am] BILLING CODE 6717-01-P


Mr. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

suite 7900,955 L%l/onr Plaza, S. W., Washingion, D.C. 20024.?174,, Telephone: (202) 488.~ suite 7900,955 L%l/onr Plaza, S. W., Washingion, D.C. 20024.?174,, Telephone: (202) 488.~ Mr. Andrew Wallo, III, NE-23 Division of Facility & Site Decommissioning Projects U.S. Department of Energy Germantown, Maryland 20545 7117~03.87.dy.43 23 September 1987 I j / Dear Mr. Wallo: I ELIMINATION RECOMMENDATION -- COLLEGES AND UN&ITIES I . The attached elimination recommendation was prepared in accordance with your suggestion during our meeting on 22 September!. The recommend includes 26 colleges and universities identified,in Enclosure 4 to Aerospace letter subject: Status of Actions 27 May 1987; three institutions (Tufts and the University of Washington) currently list of sites under consideration; and six institutions tified during a search of Hanford records.


M r. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

300.955 L*Enfom Plaza, S. Iv.. Washrhington. D.C. 200242174, Tekphonc (202) 300.955 L*Enfom Plaza, S. Iv.. Washrhington. D.C. 200242174, Tekphonc (202) 7117-03.87.cdy.43 23 September 1987 M r. Andrew Wallo, III, NE-23 Division of Facility & Site Deconnnissioning Projects U.S. Department of Energy Germantown, Maryland 20545 Dear M r. Wallo: ELIMINATION RECOMMENDATION -- COLLEGES AND UNIVERSITIES The attached elimination recommendation was prepared in accordi with your suggestion during our meeting on 22 September. The reconu includes 26 colleges and universities identified.in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Sites List, da: 27 May 1987; three institutions.(Tufts College, University of Virgil and the University of Washington) currently identified'on the FUSFN list of sites under consideration; and six.institutions recently idI


Mr. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

9% L'Enfam Plaza, S, W.. Warhin@on, D.C. 2002ijl74j Tekphow (202) 488ddO 9% L'Enfam Plaza, S, W.. Warhin@on, D.C. 2002ijl74j Tekphow (202) 488ddO 7117-03.87.cdy.'i3 23 September 1967 ~ s ~ Mr. Andrew Wallo, III, NE-23 Oivision of Facility & Site Decommissioning Projects U.S. Department of Energy Germantown, Maryland 20545 Dear Mr. Wallo: ELIMINATION RECOMMENDATION -- COLLEGES AND IJNIVFRSITIES , The attached elimination reconnnendation was prepar!ad in accordance with your suggestion during our meeting on 22 September! The recommendation includes 26 colleges and universities identified,in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Site List, dated 27 May 1987; three institutions (Tufts College, University of Virginia, and the University of Washington) currently identified!on ithe FUSRAP list of sites under consideration; and six institutions recently iden-



Office of Legacy Management (LM)

N\I&?' d,' g N\I&?' d,' g 4 DATE. fdov 2 5 1980 REPLY TO ATTN OF NE-301 .* - memoraadu SUBJECT Remedial Action for Linde Air Products Plant, Tonawanda, New York TO W. E. Mott, EV In view of the General Counsel's reconsideration of the authority to proceed with remedial action on this site and your determination that remedial action is needed to protect the public health and safety, we will include this site in our program for remedial action. of this memorandum. Oak Ridge is requested to do so by copy I am somewhat surprised at the urgency of remedial action which you implied in your memorandum since your previous memorandum designating this site stated that it has a low priority. The site radiological survey report DOE/EV-005/5 concludes that air and water contamination were below the non-occupational


MiniBooNE Oscillation Results 2011  

SciTech Connect

The MiniBooNE neutrino oscillation search experiment at Fermilab has recently updated results from a search for {bar {nu}}{sub {mu}} {yields} {bar {nu}}{sub e} oscillations, using a data sample corresponding to 8.58 x 10{sup 20} protons on target in anti-neutrino mode. This high statistics result represent an increase in statistics of 52% compared to result published in 2010. An excess of 57.7 {+-} 28.5 events is observed in the energy range 200 MeV < E{sub {nu}} < 3000 MeV. The data favor LSND-like {bar {nu}}{sub {mu}} {yields} {bar {nu}}{sub e} oscillations over a background only hypothesis at 91.1% confidence level in the energy range 475 < E{sub {nu}} < 3000 MeV.

Djurcic, Zelimir



NE-23 List of California Sites NE-23 Hattie Car-well, SAN/NSQA Division  

Office of Legacy Management (LM)

NE-23 NE-23 Hattie Car-well, SAN/NSQA Division Attached for your information is the list of California sites we identified in our search of Manhattdn Engineer District records for the Formerly Utilized Sites Remedial Action Program (FUSRAP). None of the facilities listed qualified"fbr'FUSRAP:'~- The only site in California,that was included in FUSRAP was Gilman Hall on the University of California-Berkeley Campus. All California sites that are in our Surplus Facilities Management Prcgram are under San Francisco Operations and are at the Santa Susana Field Laboratory or the University of California-Davis. If you have questions on any of the sites on the list, please call me at FTS 233-5439. /ct( Andrew Walls III. Desiynation and Certification Manager


Version 1.0 Lithium hyper ne splitting  

E-Print Network (OSTI)

Version 1.0 Lithium hyper#12;ne splitting Krzysztof Pachucki #3; Institute of Theoretical Physics approach for the calculation of relativistic m#11; 6 corrections to the lithium ground state hyper#12;ne problem. We will concentrate on lithium as the simplest alkali-metal atom, for which several precise

Pachucki, Krzysztof


Traffic Flow Measurement: Experiences with NeTraMet  

Science Conference Proceedings (OSTI)

This memo records experiences in implementing and using the Traffic Flow Measurement Architecture and Meter MIB. It discusses the implementation of NeTraMet (a traffic meter) and NeMaC (a combined manager and meter reader), considers the writing of ...

N. Brownlee



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


Nuclear deformation of {sup 20}Ne from {sup 20}Ne(105 MeV)+{sup 208}Pb scattering  

Science Conference Proceedings (OSTI)

We have measured differential cross section for quasielastic scattering of {sup 20}Ne+{sup 208}Pb at a lab energy of 105 MeV. The data are analyzed by a rotational-model coupled-channels calculation including the 0{sup +} ground state, 2{sup +} and 4{sup +} states of {sup 20}Ne.

Strojek, I.; Czarnacki, W.; Keeley, N. [Department of Nuclear Reaction, The Andrzej Soltan Institute for Nuclear Studies, 00681 Warsaw (Poland); Kisielinski, M.; Piasecki, E.; Rusek, K. [Department of Nuclear Reaction, The Andrzej Soltan Institute for Nuclear Studies, 00681 Warsaw (Poland); Heavy Ion Laboratory, Warsaw University, 02093 Warsaw (Poland); Kliczewski, S.; Siudak, R. [Niewodniczanski Institute of Nuclear Physics PAN, 31342 Cracow (Poland); Kordiasz, A.; Trzcinska, A. [Heavy Ion Laboratory, Warsaw University, 02093 Warsaw (Poland); Koshchiy, E. [V. N. Karazin Kharkiv National University, 61077 Kharkiv (Ukraine); Kowalczyk, M. [Heavy Ion Laboratory, Warsaw University, 02093 Warsaw (Poland); Faculty of Physics, Warsaw University, 00681 Warsaw (Poland); Piorkowska, A.; Stuad, A. [University of Silesia, 40007 Katowice (Poland)



CA Mr. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

?9OQ, 95.5 L'E&nt Plaza, SW.. W.ashin@.m, D.C. 20024.2174, Tekphone: (202) 488AQOO ?9OQ, 95.5 L'E&nt Plaza, SW.. W.ashin@.m, D.C. 20024.2174, Tekphone: (202) 488AQOO 7117-03.B7.cdy.43 23 September 1987 CA Mr. Andrew Wallo, III, NE-23 Division of Facility & Site Decommissioning Projects U.S. Oepartment of Energy Germantown, Maryland 20545 Dear Mr. Wallo: ELIMINATION RECOMMENDATION -- COLLEGES AND UNIVERSITIES zh/ ! o-01 lM!tl5 ML)!o-05 PI 77!0> The attached elimination recoannendation was prepared in accordance . -1 rlL.0~ with your suggestion during our meeting on 22 September. The recommendation flD.o-02 includes 26 colleges and universities identified~in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Site List, dated MO.07. 27 May 1987; three institutions (Tufts College, University of Virginia, UCIIOJ and the University of Washington) currently identified on the FUSRAP


Pion inelastic scattering from sup 20 Ne  

SciTech Connect

Angular distributions for {sup 20}Ne({pi}{sup {plus minus}}, {pi}{sup {plus minus}}{prime}) were measured on the Energetic Pion Channel and Spectrometer (EPICS) at the Clinton P. Anderson Meson Physics Facility (LAMPF). Data were taken with both {pi}{sup {plus}} and {pi}{sup {minus}} over an angular range of 12{degree} to 90{degree} for T{sub {pi}}=180 MeV and with {pi}{sup +} from 15{degree} to 90{degree} for T{sub {pi}}=120 MeV. The data were analyzed using both the distorted-wave impulse approximation (DWIA) and the coupled-channels impulse approximation (CCIA) with collective transition densities. In addition, microscopic transition densities were used in the DWIA analysis for states in the lowest rotational bands. The transitions to the 6.73-MeV 0{sup +} and several 1{sup {minus}} states, including the states at 5.79 MeV and 8.71 MeV, were studied using several models for the transition density. Strong evidence for the importance of two-step routes in pion inelastic scattering was seen in several angular distributions, including the 5.79-MeV 1{sup {minus}}, the first three 4{sup +} states, and the 8.78-MeV 6{sup +}. 100 refs., 81 figs., 33 tabs.

Burlein, M. (Pennsylvania Univ., Philadelphia, PA (USA). Dept. of Physics)



Property:EIA/861/IsoNe | Open Energy Information  

Open Energy Info (EERE)

IsoNe IsoNe Jump to: navigation, search Property Name ISO_NE Property Type Boolean Description Indicates that the organization conducts operations in the New England ISO region [1] References ↑ "EIA Form EIA-861 Final Data File for 2010 - 861 Webfile Layout for 2010.doc" Pages using the property "EIA/861/IsoNe" Showing 25 pages using this property. (previous 25) (next 25) B Bangor Hydro-Electric Co + true + Barton Village, Inc (Utility Company) + true + Bozrah Light & Power Company + true + C Central Maine Power Co + true + Central Vermont Pub Serv Corp + true + CinCap IV, LLC + true + CinCap V LLC + true + Cinergy Capital & Trading, Inc + true + City of Chicopee, Massachusetts (Utility Company) + true + City of Holyoke, Massachusetts (Utility Company) + true +


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


Neutral Current Elastic Interactions in MiniBooNE  

SciTech Connect

Neutral Current Elastic (NCE) interactions in MiniBooNE are discussed. In the neutrino mode MiniBooNE reported: the flux averaged NCE differential cross section as a function of four-momentum transferred squared, an axial mass (M{sub A}) measurement, and a measurement of the strange quark spin content of the nucleon, {Delta}s. In the antineutrino mode we present the background-subtracted data which is compared with the Monte Carlo predictions.

Dharmapalan, Ranjan; /Alabama U.


Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


D:\NE WEB Sites\NE\nerac\nov2001minutes.wpd  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

November 5-6, 2001, DoubleTree Hotel, Arlington, Virginia November 5-6, 2001, DoubleTree Hotel, Arlington, Virginia NERAC members present: John Ahearne Robert Long Joseph Comfort Warren F. Miller, Jr. Michael L. Corradini Benjamin F. Montoya Jose Luis Cortez Sekazi Mtingwa Allen Croff Lura Powell James Duderstadt (Chair) Richard Reba Marvin Fertel Joy Rempe Beverly Hartline John Taylor Andrew Klein Charles E. Till Dale Klein (Monday only) Neil Todreas NERAC members absent: Thomas Cochran Allen Sessoms Maureen S. Crandall Daniel C. Sullivan Steve Fetter C. Bruce Tarter Leslie Hartz Ashok Thadani (ad hoc) J. Bennett Johnston Joan Woodard Linda C. Knight Also present: Robert Card, Under Secretary, USDOE Nancy Carder, NERAC Staff Charles Forsberg, Researcher, Oak Ridge National Laboratory Norton Haberman, Senior Technical Advisor, NE, USDOE


Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)



DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


An Audiomagnetotelluric Survey Over The Chaves Geothermal Field (Ne  

Open Energy Info (EERE)

Page Page Edit History Facebook icon Twitter icon » An Audiomagnetotelluric Survey Over The Chaves Geothermal Field (Ne Portugal) Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Journal Article: An Audiomagnetotelluric Survey Over The Chaves Geothermal Field (Ne Portugal) Details Activities (0) Areas (0) Regions (0) Abstract: In an attempt to define the resistivity model of the Chaves geothermal field in NE Portugal, a detailed survey with scalar audiomagnetotelluric measurements was performed. The soundings were made in the frequency range from 2300 to 4.1 Hz. Electrical resistivity models were derived from the application of 1-D inversion, 2-D trial and error modeling and 2-D inversion procedures. The resistivities inside the geothermal field are low, reaching not more than 30 Ωm and increasing up to 60-150 Ωm


Municipal Energy Agency of NE | Open Energy Information  

Open Energy Info (EERE)

Municipal Energy Agency of NE Municipal Energy Agency of NE Jump to: navigation, search Name Municipal Energy Agency of NE Place Nebraska Utility Id 21352 Utility Location Yes Ownership P NERC Location MRO NERC MRO Yes NERC SPP Yes NERC WECC Yes RTO SPP Yes ISO MISO Yes Operates Generating Plant Yes Activity Generation Yes Activity Buying Transmission Yes Activity Wholesale Marketing Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png No rate schedules available. Average Rates No Rates Available References ↑ "EIA Form EIA-861 Final Data File for 2010 - File1_a" Retrieved from


SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012" Coal Consumers in the Manufacturing and Coke Sectors, 2012" "Company Name","Plant Location" "Top Ten Manufacturers" "American Crystal Sugar Co","MN, ND" "Archer Daniels Midland","IA, IL, MN, ND, NE" "Carmeuse Lime Stone Inc","AL, IL, IN, KY, MI, OH, PA, TN, VA, WI" "Cemex Inc","AL, CA, CO, FL, GA, KY, OH, TN, TX" "Dakota Gasification Company","ND" "Eastman Chemical Company","TN" "Georgia-Pacific LLC","AL, GA, OK, VA, WI" "Holcim (US) Inc","AL, CO, MD, MO, MT, OK, SC, TX, UT" "NewPage Corporation","MD, MI, WI" "U S Steel Corporation","AL, IN, MI, MN"


U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012 Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 25. Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Company Name Plant Location Top Ten Manufacturers American Crystal Sugar Co MN, ND Archer Daniels Midland IA, IL, MN, ND, NE Carmeuse Lime Stone Inc AL, IL, IN, KY, MI, OH, PA, TN, VA, WI Cemex Inc AL, CA, CO, FL, GA, KY, OH, TN, TX Dakota Gasification Company ND Eastman Chemical Company TN Georgia-Pacific LLC AL, GA, OK, VA, WI Holcim (US) Inc AL, CO, MD, MO, MT, OK, SC, TX, UT NewPage Corporation MD, MI, WI U S Steel Corporation AL, IN, MI, MN Other Major Manufacturers Ash Grove Cement Co


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



19Ne levels studied with the 18F(d,n)19Ne*(18F+p) reaction  

Science Conference Proceedings (OSTI)

A good understanding of the level structure of 19Ne around the proton threshold is critical to estimating the destruction of long-lived 18F in novae. Here we report the properties of levels in 19Ne in the excitation energy range of 6.9 Ex 8.4 MeV studied via the proton-transfer 18F(d, n)Ne reaction at the Holifield Radioactive Ion Beam Facility. The populated 19Ne levels decay by breakup into p + 18F and + 15O particles. The results presented in this manuscript are those of levels that are simultaneously observed from the breakup into both channels. An s-wave state is observed at 1468 keV above the proton threshold, which is a potential candidate for a predicted broad J = 1/2+ state. The proton and partial widths are deduced to be p = 228 50 keV and = 130 30 keV for this state.

Adekola, A. S. [Ohio University, Athens; Brune, C. R. [Ohio University; Bardayan, Daniel W [ORNL; Blackmon, Jeffery C [Louisiana State University; Chae, K. Y. [University of Tennessee, Knoxville (UTK); Cizewski, J. A. [Rutgers University; Jones, K. L. [University of Tennessee, Knoxville (UTK); Kozub, R. L. [Tennessee Technological University; Massey, T. [Ohio University; Nesaraja, Caroline D [ORNL; Pain, Steven D [ORNL; ShrinerJr., J. F. [Tennessee Technological University; Smith, Michael Scott [ORNL; Thomas, J. S. [Rutgers University



Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)


Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


File:EIA-Williston-NE-Gas.pdf | Open Energy Information  

Open Energy Info (EERE)

Williston-NE-Gas.pdf Williston-NE-Gas.pdf Jump to: navigation, search File File history File usage Williston Basin, Northeast Part By 2001 Gas Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 5.95 MB, MIME type: application/pdf) Description Williston Basin, Northeast Part By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Montana, North Dakota, South Dakota File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment


MiniBooNE "Windows on the Universe"  

Science Conference Proceedings (OSTI)

Progress in the last few decades has left neutrino physics with several vexing issues. Among them are the following questions: (1) Why are lepton mixing angles so different from those in the quark sector? (2) What is the most probable range of the reactor mixing angle? (3) Is the atmospheric mixing angle maximal? (4) What is the number of fermion generations? These are some of the issues that neutrino science hopes to study; this article will explore these questions as part of a more general scientific landscape, and will discuss the part MiniBooNE might play in this exploration. We discuss the current state of measurements taken by MiniBooNE, and emphasize the uniqueness of neutrino oscillations as an important probe into the 'Windows on the Universe.'

Stefanski, Ray; /Fermilab



Overview of DOE-NE Proliferation and Terrorism Risk Assessment  

SciTech Connect

Research objectives are: (1) Develop technologies and other solutions that can improve the reliability, sustain the safety, and extend the life of current reactors; (2) Develop improvements in the affordability of new reactors to enable nuclear energy; (3) Develop Sustainable Nuclear Fuel Cycles; and (4) Understand and minimize the risks of nuclear proliferation and terrorism. The goal is to enable the use of risk information to inform NE R&D program planning. The PTRA program supports DOE-NE's goal of using risk information to inform R&D program planning. The FY12 PTRA program is focused on terrorism risk. The program includes a mix of innovative methods that support the general practice of risk assessments, and selected applications.

Sadasivan, Pratap [Los Alamos National Laboratory



A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



Ne IX emission-line ratios in solar active regions  

Science Conference Proceedings (OSTI)

Emission-line ratios for Ne IX are derived and compared with observational data for solar active regions obtained with the SOLEX B spectrometer on the P78-1 satellite. Excellent agreement is obtained, providing support for the atomic data adopted in the calculations and resolving discrepancies between existing theoretical calculations and solar data. The calculated R-ratio for the low-density limit agrees well with the SOLEX observations. 47 references.

Keenan, F.P.; Mccann, S.M.; Kingston, A.E.; Mckenzie, D.L.



Neutrino and Antineutrino Cross sections at MiniBooNE  

SciTech Connect

The MiniBooNE experiment has reported a number of high statistics neutrino and anti-neutrino cross sections -among which are the charged current quasi-elastic (CCQE) and neutral current elastic (NCE) neutrino scattering on mineral oil (CH2). Recently a study of the neutrino contamination of the anti-neutrino beam has concluded and the analysis of the anti-neutrino CCQE and NCE scattering is ongoing.

Dharmapalan, Ranjan; /Alabama U.



Vanishing N=20 Shell Gap: Study of Excited States in {sup 27,28}Ne  

Science Conference Proceedings (OSTI)

This Letter reports on the {sup 1}H({sup 28}Ne,{sup 28}Ne) and {sup 1}H({sup 28}Ne,{sup 27}Ne) reactions studied at intermediate energy using a liquid hydrogen target. From the cross section populating the first 2{sup +} excited state of {sup 28}Ne, and using the previously determined B(E2) value, the neutron quadrupole transition matrix element has been calculated to be M{sub n}=13.8{+-}3.7 fm{sup 2}. In the neutron knockout reaction, two low-lying excited states were populated in {sup 27}Ne. Only one of them can be interpreted by the sd shell model while the additional state may intrude from the fp shell. These experimental observations are consistent with the presence of fp shell configurations at low excitation energy in {sup 27,28}Ne nuclei caused by a vanishing N=20 shell gap at Z=10.

Dombradi, Zs.; Fueloep, Zs. [Institute of Nuclear Research of the Hungarian Academy of Sciences, P.O. Box 51, Debrecen, H-4001 (Hungary); Elekes, Z. [Institute of Nuclear Research of the Hungarian Academy of Sciences, P.O. Box 51, Debrecen, H-4001 (Hungary); Institute of Physical and Chemical Research, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan); Saito, A.; Baba, H.; Demichi, K.; Gomi, T.; Hasegawa, H.; Kanno, S.; Kawai, S.; Kurita, K.; Matsuyama, Y.; Sakai, H.K.; Takeshita, E.; Togano, Y.; Yamada, K. [Rikkyo University, 3 Nishi-Ikebukuro, Toshima, Tokyo 171 (Japan); Aoi, N.; Ishihara, M.; Kishida, T.; Kubo, T. [Institute of Physical and Chemical Research, 2-1 Hirosawa, Wako, Saitama 351-0198 (Japan)] (and others)



50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office


Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



2013 Annual DOE-NE Materials Research Coordination Meeting | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2013 Annual DOE-NE Materials Research Coordination Meeting 2013 Annual DOE-NE Materials Research Coordination Meeting 2013 Annual DOE-NE Materials Research Coordination Meeting The Reactor Materials element of the Nuclear Energy Enabling Technologies (NEET) program conducted its FY 2013 coordination meeting as a series of four web-conferences to act as a forum for the nuclear materials research community. The purpose of this meeting was to report on current and planned nuclear materials research, identify new areas of collaboration and promote greater coordination among the various Office of Nuclear Energy (NE) programs. Currently, materials research is performed in several NE programs, including NE Advanced Modeling and Simulation (NEAMS), Fuel Cycle Research and Development (FCRD), Advanced Reactor Technologies


2013 Annual DOE-NE Materials Research Coordination Meeting | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

2013 Annual DOE-NE Materials Research Coordination Meeting 2013 Annual DOE-NE Materials Research Coordination Meeting 2013 Annual DOE-NE Materials Research Coordination Meeting The Reactor Materials element of the Nuclear Energy Enabling Technologies (NEET) program conducted its FY 2013 coordination meeting as a series of four web-conferences to act as a forum for the nuclear materials research community. The purpose of this meeting was to report on current and planned nuclear materials research, identify new areas of collaboration and promote greater coordination among the various Office of Nuclear Energy (NE) programs. Currently, materials research is performed in several NE programs, including NE Advanced Modeling and Simulation (NEAMS), Fuel Cycle Research and Development (FCRD), Advanced Reactor Technologies


R-Process in Collapsing O/Ne/Mg Cores  

E-Print Network (OSTI)

Several circumstantial arguments point to the formation of the third r-process peak at A about 190, near platinum, in stars of mass of about 8-10 solar masses: 1) The delayed production of europium with respect to iron imposes a time scale that restricts the progenitor stars to less than about 10 solar masses; 2) the r-process demands a dominant robust mechanism at least for barium and above, since the relative abundance pattern of those r-process elements in low-metallicity stars is consistent with the solar pattern; 3) stars of about 8-10 solar masses produce nearly identical degenerate O/Ne/Mg cores that collapse due to electron capture; and 4) the resulting low-mass cores may produce both an r-process in a prompt explosion and a subsequent r-process in a neutrino driven wind. The prompt explosion of an O/Ne/Mg core yields low entropy and low electron fraction, and hence may produce a reasonable r-process peak at A about 190 as well as all of the r-process elements with Z greater than 56. The possible diff...

Wheeler, J C; Hillebrandt, W; Cowan, John J.; Hillebrandt, Wolfgang



R-Process in Collapsing O/Ne/Mg Cores  

E-Print Network (OSTI)

Several circumstantial arguments point to the formation of the third r-process peak at A about 190, near platinum, in stars of mass of about 8-10 solar masses: 1) The delayed production of europium with respect to iron imposes a time scale that restricts the progenitor stars to less than about 10 solar masses; 2) the r-process demands a dominant robust mechanism at least for barium and above, since the relative abundance pattern of those r-process elements in low-metallicity stars is consistent with the solar pattern; 3) stars of about 8-10 solar masses produce nearly identical degenerate O/Ne/Mg cores that collapse due to electron capture; and 4) the resulting low-mass cores may produce both an r-process in a prompt explosion and a subsequent r-process in a neutrino driven wind. The prompt explosion of an O/Ne/Mg core yields low entropy and low electron fraction, and hence may produce a reasonable r-process peak at A about 190 as well as all of the r-process elements with Z greater than 56. The possible differences in the neutrino-driven wind and associated r-process due to the low-mass neutron stars expected in this mass range are also discussed.

J. Craig Wheeler; John J. Cowan; Wolfgang Hillebrandt



A Case Study For Geothermal Exploration In The Ne German Basin...  

Open Energy Info (EERE)

icon Twitter icon A Case Study For Geothermal Exploration In The Ne German Basin- Integrated Interpretation Of Seismic Tomography, Litho-Stratigraphy, Salt Tectonics, And...


Participants: William Naughton, COHMED Bill Sherman, NE HLRW Task Force  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

conference call May 27, 1998 conference call May 27, 1998 Participants: William Naughton, COHMED Bill Sherman, NE HLRW Task Force Bob Fronczak, AAR Mike Butler, UETC Ray English, DOE-NR George Ruberg, UETC Kevin Blackwell, FRA Markus Popa, DOE-RW Sandy Covi, UP The Rail Topic Group is currently in a transitional mode, moving simultaneously toward closure of the two rail information matrices, Comparison of CVSA Recommended National Procedures and Out-Of-Service Criteria for the Enhanced Safety Inspection of Commercial Highway Vehicles Transporting Transuranics, Spent Nuclear Fuel, and High Level Waste to Rail Inspection Standards, and Rail and Highway Regulations Relative to the Transportation of Radioactive Materials and their Applicability to States, Tribes, Shippers, and Carriers, (both


PNM Resources 2401 Aztec NE, MS-Z100  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

PNM Resources PNM Resources 2401 Aztec NE, MS-Z100 Albuquerque, NM 87107 505-241-2025 Fax 505 241-2384 PNMResources.com October 29, 2013 Mr. Christopher Lawrence Office of Electricity Delivery and Energy Reliability (OE-20) U.S. Department of Energy 1000 Independence Avenue, SW Washington, DC 20585 Submitted electronically via email to: Christopher.Lawrence@hq.doe.gov Dear Mr. Lawrence: Subject: Department of Energy (DOE)- Improving Performance of Federal Permitting and Review of Infrastructure Projects, Request for Information, 78 Fed. Reg. 53436 (Aug. 29, 2013) PNM Resources (PNMR) is an energy holding company with 2012 consolidated operating revenues of $1.3 billion. Through its regulated utilities, PNM and TNMP, PNMR serves electricity to more than 739,000 homes and businesses in New


CA M r. Andrew Wallo, III. NE-23  

Office of Legacy Management (LM)

i5W 95.5 L' i5W 95.5 L' E&nt plom. S. W.:. Washingr on. D.C. ZOOX2i74, Tekphm: (202) 488-6OGb 7II7-03.87.cdy.43 23 September 1987. Ii CA M r. Andrew Wallo, III. NE-23 Division of Facility & Site Decommissioning Projects U.S. Department of Energy Germantown, Maryland 20545 Dear M r. Wallo: ELIMINATION RECOMMENDATION -- COLLEGES AND UNIVERSITIES pqq.0' 05 PI ;p.03- The attached elimination recommendation was prepared in accordance ,I ML.05 with your suggestion during our meeting on 22 September. The recommendation flO.O-02 includes 26 colleges and universities identified in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Site List, dated 27 May 1987; three institutions (Tufts College, University of Virginia, and the University of Washington) currently identified on the FUSRAP


Idaho National Laboratory DOE-NE's National Nuclear Capability-  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

4-2023 4-2023 Idaho National Laboratory DOE-NE's National Nuclear Capability- Developing and Maintaining the INL Infrastructure TEN-YEAR SITE PLAN DOE/ID-11474 Final June 2012 Sustainable INL continues to exceed DOE goals for reduction in the use of petroleum fuels - running its entire bus fleet on biodiesel while converting 75% of its light-duty fleet to E85 fuel. The Energy Systems Laboratory (ESL), slated for completion this year, will be a state-of-the-art laboratory with high-bay lab space where leading bioenergy feedstock processing, advanced battery testing, and hybrid energy systems integration research will be conducted. The Advanced Test Reactor is the world's most advanced nuclear research capability - crucial to (1) the ongoing development of safe, efficient


NE-24 Unlverslty of Chicayo Remedial Action Plan  

Office of Legacy Management (LM)

(YJ 4 tlsj .?I2 (YJ 4 tlsj .?I2 416 17 1983 NE-24 Unlverslty of Chicayo Remedial Action Plan 22&d 7 IA +-- E. I.. Keller, Director Technical Services Division Oak Ridge Operations Ufflce In response to your memorandum dated July 29, 1983, the Field Task Proposal/Agreement (FTP/A) received frw Aryonne National Laboratory (ANL) appears to be satisfactory, and this office concurs in the use of ANL to provide the decontamination effort as noted in the FTP/A. The final decontaminatton report should Include the data needed for certiff- cation of the cleanup and any contamination left In place, e.g., sewer lines should be so documented in the permanent records of the University as well as the certification documents and reports. The remedial action to be conducted appears to be clearly InsIgnifIcant from an environmental

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft PowerPoint - NEAC Battelle NE Capabilities 062408.ppt  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

R&D Facility Requirements NEAC Meeting Progress Report June 24, 2008 2 Facilitization of U.S. Nuclear R&D Infrastructure Three-step study process: * First, ASNE requested Battelle Memorial Institute to develop Industry- and-University-supported list of capabilities and facilities necessary to conduct a comprehensive nuclear R&D program. (Draft, June 12, 2008) * Second, INL, using input from all DOE and other sources, will determine current facilities and their condition and availability to support next 20 years of nuclear R&D. (Draft, June 30, 2008) * Third, recommendations will be made on priorities and on existing facilities to be maintained/preserved or otherwise supported by NE regardless of location or ownership. (Executive Team Meeting, July 1, 2008)


The DA{Phi}NE beam position monitors  

SciTech Connect

The beam diagnostics network of DA{Phi}NE, the Frascati {Phi}-factory, includes more than 110 beam position monitors divided between button monitors and striplines. The shape of the vacuum chamber changes along the accelerator implying several different geometries for these monitors. Moreover, in the two interaction regions of the collider where the electron and positron beams pass into the same chamber, a six-button configuration has been used. A bench calibration of each family of BPMs and striplines is being performed. A polynomial correction function has been derived by fitting the calibration results. An analytical-numerical analysis of the buttons` geometry has been done in order to compare the experimental with the theoretical results. {copyright} {ital 1997 American Institute of Physics.}

Ghigo, A.; Sannibale, F.; Serio, M.; Vaccarezza, C. [INFN Laboratori Nazionali di Frascati-00044 Frascati (Roma)-Italy



Charged-Current Interaction Measurements in MiniBooNE  

SciTech Connect

Neutrino oscillation is the only known phenomenon for physics beyond the standard model. To investigate this phenomenon, the understanding of low energy neutrino scattering (200NE finds that a simple Fermi gas model, with appropriate adjustments, accurately characterizes the CCQE events on carbon. The extracted parameters include an effective axial mass, MA=1.23 {+-} 0.20 GeV, and a Pauli-blocking parameter, kappa = 1.019 {+-} 0.011.

Katori, Teppei; /Indiana U.




Office of Legacy Management (LM)

EBJG EBJG -ENERGY MEASUREMENTS GROUP EG&G SURVEY REPORT NE-F-003 FEBRUARY 1983 NJT& THE REMOTE SENSING lRtlORlllORY OF THE UNITED STATES DEPARTMENT OF ENERGY AN AERIAL RADIOLOGICAL SURVEY OF AN AREA SURROUNDING THE FORMER M IDDLESEX SAMPLING PLANT IN M IDDLESEX, N E W JERSEY DATE OF SURVEY: M A Y 1978 DISCLAIMER This report was prepared as an account of work sponsored by an agency of the United States Government. Neither the United States Government nor any agency thereof, nor any of their employees, makes any warranty, express or implied, or assumes any legal liability or responsibility for the accuracy, completeness, or usefulness of any information, apparatus, product, or process disclosed, or represents that its use would not infringe privately owned rights. Reference herein to any specific commercial product, process, or


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


EA-1909: South Table Wind Project, Kimball County, NE | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

09: South Table Wind Project, Kimball County, NE 09: South Table Wind Project, Kimball County, NE EA-1909: South Table Wind Project, Kimball County, NE Summary DOE's Western Area Power Administration is preparing this EA to evaluate the environmental impacts of interconnecting the proposed South Table Wind Project, which would generate approximately 60 megawatts from about 40 turbines, to Western's existing Archer-Sidney 115-kV Transmission Line in Kimball County, Nebraska. Public Comment Opportunities None available at this time. Documents Available for Download August 28, 2012 EA-1909: Finding of No Significant Impact South Table Wind Project, Kimball County, NE July 16, 2012 EA-1909: Final Environmental Assessment South Table Wind Project, Kimball County, NE February 29, 2012 EA-1909: Draft Environmental Assessment


CA CAIOlf Mr. Andrew Wallo. III, NE-23  

Office of Legacy Management (LM)

kire 7900. 955 L*E,,fa,u PLUG S. W.. Washin@ on. D.C. 20024-2174, Tekphme: (202) 488-6000 kire 7900. 955 L*E,,fa,u PLUG S. W.. Washin@ on. D.C. 20024-2174, Tekphme: (202) 488-6000 7117-03.87.cdy.43 23 September 1987 CA CAIOlf Mr. Andrew Wallo. III, NE-23 Division of Facility & Site Decommissioning Projects U.S. Department of Energy Germantown, Maryland 20545 CT.05 FL .0-o/ lti.Ob id.Or Dear Mr. Wallo: In/. O-01 flA.05 ELIMINATION RECOMMENDATION -- COLLEGES AND UNIVERSITIES Mbj.o-03 I4 v.o+ The attached elimination recommendation was prepared in accordance ML.o= with your suggestion during our meeting on 22 September. The recommendation nO.O-02 includes 26 colleges and universities identified.in Enclosure 4 to Aerospace letter subject: Status of Actions - FUSRAP Site List, dated N0.63' 27 May 1987; three institutions (Tufts College, University of Virginia, kfC900


{sup 17}O({alpha},{gamma}){sup 21}Ne and {sup 17}O({alpha},n){sup 20}Ne for the weak s process  

Science Conference Proceedings (OSTI)

The ratio of the reaction rates of the competing channels {sup 17}O({alpha}{gamma}){sup 21}Ne and {sup 17}O({alpha},n){sup 20}Ne determines the efficiency of {sup 16}O as a neutron poison in the s process in low metallicity rotating stars. It has a large impact on the element production, either producing elements to the mass range of A=90 in case of a significant poisoning effect or extending the mass range up to the region of A=150 if the {gamma} channel is of negligible strength. We present an improved study of the reaction {sup 17}O({alpha},n){sup 20}Ne, including an independent measurement of the {sup 17}O({alpha},n{sub 1}){sup 20}Ne channel. A simultaneous R-Matrix fit to both the n{sub 0} and the n{sub 1} channels has been performed. New reaction rates, including recent data on the {sup 17}O({alpha},{gamma}){sup 21}Ne reaction, have been calculated and used as input for stellar network calculations and their impact on the s process in rotating massive stars is discussed.

Best, A.; Goerres, J.; Beard, M.; Couder, M.; Boer, R. de; Falahat, S.; Gueray, R. T.; Kontos, A.; Kratz, K.-L.; LeBlanc, P. J.; Li, Q.; O'Brien, S.; Oezkan, N.; Pignatari, M.; Sonnabend, K.; Talwar, R.; Tan, W.; Uberseder, E.; Wiescher, M. [Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States); Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States) and Department for Biogeochemistry, Max-Planck-Institute for Chemistry, 55020 Mainz (Germany); Department of Physics, Kacaeli University, Umuttepe 41380, Kocaeli (Turkey); Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States); Department for Biogeochemistry, Max-Planck-Institute for Chemistry, 55020 Mainz (Germany); Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States); Department of Physics, Kacaeli University, Umuttepe 41380, Kocaeli (Turkey); Department of Physics, University of Basel, Basel 4056 (Switzerland); Institute for Applied Physics, Goethe-University Frankfurt, 60325 Frankfurt (Germany); Department of Physics, University of Notre Dame, Notre Dame, IN 46556 (United States)



Level-resolved R-matrix calculations for the electron-impact excitation of Ne{sup 3+} and Ne{sup 6+}  

SciTech Connect

Large-scale R-matrix calculations are carried out for the electron-impact excitation of Ne{sup 3+} and Ne{sup 6+}. For Ne{sup 3+}, a 581-LSJ-level R-matrix intermediate coupling frame transformation calculation is made for excitations up to the n=4 shell. For some transitions, large effective collision strength differences are found with current 23-jKJ-level Breit-Pauli R-matrix and earlier 22-LSJ-level R-matrix jj omega (JAJOM) calculations. For Ne{sup 6+}, a 171-jKJ-level Breit-Pauli R-matrix calculation is made for excitations up to the n=5 shell. For some transitions, large effective collision strength differences are found with current 46-jKJ-level Breit-Pauli R-matrix and earlier 46-LSJ-level R-matrix JAJOM calculations. Together with existing R-matrix calculations for other ion stages, high-quality excitation data are now available for astrophysical and laboratory plasma modeling along the entire Ne isonuclear sequence.

Ludlow, J. A.; Lee, T. G.; Ballance, C. P.; Loch, S. D.; Pindzola, M. S. [Department of Physics, Auburn University, Auburn, Alabama 36849 (United States)



miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


A Case Study For Geothermal Exploration In The Ne German Basin- Integrated  

Open Energy Info (EERE)

Geothermal Exploration In The Ne German Basin- Integrated Geothermal Exploration In The Ne German Basin- Integrated Interpretation Of Seismic Tomography, Litho-Stratigraphy, Salt Tectonics, And Thermal Structure Jump to: navigation, search GEOTHERMAL ENERGYGeothermal Home Conference Proceedings: A Case Study For Geothermal Exploration In The Ne German Basin- Integrated Interpretation Of Seismic Tomography, Litho-Stratigraphy, Salt Tectonics, And Thermal Structure Details Activities (0) Areas (0) Regions (0) Abstract: Unavailable Author(s): K. Bauer, I. Moeck, B. Norden, A. Schulze, M. H. Weber Published: Publisher Unknown, 2009 Document Number: Unavailable DOI: Unavailable Retrieved from "http://en.openei.org/w/index.php?title=A_Case_Study_For_Geothermal_Exploration_In_The_Ne_German_Basin-_Integrated_Interpretation_Of_Seismic_Tomography,_Litho-Stratigraphy,_Salt_Tectonics,_And_Thermal_Structure&oldid=390106"


EcoCAR: The NeXt Challenge | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EcoCAR: The NeXt Challenge EcoCAR: The NeXt Challenge EcoCAR: The NeXt Challenge May 18, 2010 - 7:30am Addthis While most college students' experience with vehicles goes no further than the beater they picked up for a few thousand dollars, students participating in the EcoCAR: The NeXT Challenge competition get to experience the cutting-edge of driving technology. The competition, which was established by the U.S. Department of Energy and General Motors, is a three year advanced vehicle engineering contest. Yesterday, May 17, was the first day of their Year 2 judging sessions. In EcoCAR, students from 16 universities across North America are competing against each other to build the most environmentally sustainable and practical vehicle. This year's teams have adopted a number of advanced


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1-07 0 1-07 0 USS Honolulu (SSN 718) and Locals 280 miles from North Pole PROGRAM RECORD * Program founded in 1948 * 5,800 reactor- years of safe operations * 136,000,000 miles safely steamed * 103 operating naval reactors * Welcomed in over 150 ports worldwide and 50 countries BROAD RESPONSIBILITIES * Research, Development, Design * Acquisition, Specification, Construction, Testing * Operation, Training, Maintenance * Overhaul, Refueling, Disposal * Reactor Safety, Radiological Controls, Environmental Safety, Occupational Health * Security, Nuclear Safeguards, Transportation * Administration (Public Information) NAVAL NUCLEAR PROPULSION PROGRAM TEC 1-07 1 WA OR ID MT ND SD WY NE MN WI IA IL MI IN OH KY


Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



Towards a study of the {sup 22}Ne(p,{gamma}){sup 23}Na reaction at LUNA  

SciTech Connect

The {sup 22}Ne(p,{gamma}){sup 23}Na reaction is a part of the hydrogen burning NeNa cycle. In second-generation stars hydrogen burning may proceed via this cycle. The rate of the {sup 22}Ne(p,{gamma}){sup 23}Na reaction depends on the strength of several resonances in the energy range of the LUNA 400 kV accelerator which have never been observed in direct experiments. A related study is under preparation at LUNA.

Cavanna, Francesca; Depalo, Rosanna; Menzel, Marie-Luise [Dipartimento di fisica, Universita di Genova, and INFN Sezione di Genova, Genova (Italy); Dipartimento di fisica, Universita di Padova, and INFN Sezione di Padova, Padova (Italy); Helmholtz Zentrum Dresden-Rossendorf, Dresden (Germany); Collaboration: LUNA Collaboration


Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Analysis of ISO NE Balancing Requirements: Uncertainty-based Secure Ranges for ISO New England Dynamic Inerchange Adjustments  

SciTech Connect

The document describes detailed uncertainty quantification (UQ) methodology developed by PNNL to estimate secure ranges of potential dynamic intra-hour interchange adjustments in the ISO-NE system and provides description of the dynamic interchange adjustment (DINA) tool developed under the same contract. The overall system ramping up and down capability, spinning reserve requirements, interchange schedules, load variations and uncertainties from various sources that are relevant to the ISO-NE system are incorporated into the methodology and the tool. The DINA tool has been tested by PNNL and ISO-NE staff engineers using ISO-NE data.

Etingov, Pavel V.; Makarov, Yuri V.; Wu, Di; Hou, Zhangshuan; Sun, Yannan; Maslennikov, S.; Luo, X.; Zheng, T.; George, S.; Knowland, T.; Litvinov, E.; Weaver, S.; Sanchez, E.



DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE-NE Light Water Reactor Sustainability Program and EPRI DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term Operations Program - Joint Research and Development Plan DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term Operations Program - Joint Research and Development Plan Nuclear power has contributed almost 20% of the total amount of electricity generated in the United States over the past two decades. High capacity factors and low operating costs make nuclear power plants (NPPs) some of the most economical power generators available. Further, nuclear power remains the single largest contributor (nearly 70%) of non-greenhouse gas-emitting electric power generation in the United States. Even when major refurbishments are performed to extend operating life, these plants continue to represent cost-effective, low-carbon assets to the nation's


DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DOE-NE Light Water Reactor Sustainability Program and EPRI DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term Operations Program - Joint Research and Development Plan DOE-NE Light Water Reactor Sustainability Program and EPRI Long-Term Operations Program - Joint Research and Development Plan Nuclear power has contributed almost 20% of the total amount of electricity generated in the United States over the past two decades. High capacity factors and low operating costs make nuclear power plants (NPPs) some of the most economical power generators available. Further, nuclear power remains the single largest contributor (nearly 70%) of non-greenhouse gas-emitting electric power generation in the United States. Even when major refurbishments are performed to extend operating life, these plants continue to represent cost-effective, low-carbon assets to the nation's


ARM - Field Campaign - 1996 NARSTO Northeast Field Study (NARSTO-NE)  

NLE Websites -- All DOE Office Websites (Extended Search)

6 NARSTO Northeast Field Study (NARSTO-NE) 6 NARSTO Northeast Field Study (NARSTO-NE) Comments? We would love to hear from you! Send us a note below or call us at 1-888-ARM-DATA. Send Campaign : 1996 NARSTO Northeast Field Study (NARSTO-NE) 1996.07.01 - 1996.07.28 Lead Scientist : Larry Kleinman For data sets, see below. Description The DOE G-1 aircraft was deployed in the New York City metropolitan area as part of the North American Research Strategy for Tropospheric Ozone-Northeast effort to determine the causes of elevated ozone levels in the northeastern United States. Measurements of ozone, ozone precursors, and other photochemically active trace gases were made upwind and downwind of New York City with the objective of characterizing the ozone formation process and its dependence on ambient levels of NOx and volatile organic


Microsoft PowerPoint - Freeze.NE PA Overview_052511.ppt  

NLE Websites -- All DOE Office Websites (Extended Search)

Used Fuel Disposition Campaign Used Fuel Disposition Campaign Summary of DOE-NE PA Modeling for Storage and Disposal of Used Nuclear Fuel (UNF), High-Level Radioactive Waste (HLW), and Low-Level Waste (LLW) Geoff Freeze Sandia National Laboratories PA Community of Practice Technical Exchange May 25-26, 2011 Print Close Used Fuel Disposition 2 DOE-Nuclear Energy (NE) - PA Modeling Activities NE Advanced Modeling and Simulation (NEAMS) Waste Integrated Performance and Safety Codes (Waste IPSC) Used Fuel Disposition (UFD) Generic Performance Assessment Model (GPAM) *** Initial modeling focus in both campaigns in on UNF/HLW disposal Print Close Used Fuel Disposition 3  UFD GPAM  Short time horizon (2-3 yrs) - Simplified generic system models (i.e., PA-fidelity using GoldSim) - Current computing capabilities


Skåne County, Sweden: Energy Resources | Open Energy Information  

Open Energy Info (EERE)

Skåne County, Sweden: Energy Resources Skåne County, Sweden: Energy Resources Jump to: navigation, search Name Skåne County, Sweden Equivalent URI DBpedia GeoNames ID 3337385 Coordinates 55.98333°, 13.5° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":55.98333,"lon":13.5,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}


Charged-Current Neutral Pion production at SciBooNE  

SciTech Connect

SciBooNE, located in the Booster Neutrino Beam at Fermilab, collected data from June 2007 to August 2008 to accurately measure muon neutrino and anti-neutrino cross sections on carbon below 1 GeV neutrino energy. SciBooNE is studying charged current interactions. Among them, neutral pion production interactions will be the focus of this poster. The experimental signature of neutrino-induced neutral pion production is constituted by two electromagnetic cascades initiated by the conversion of the {pi}{sup 0} decay photons, with an additional muon in the final state for CC processes. In this poster, I will present how we reconstruct and select charged-current muon neutrino interactions producing {pi}{sup 0}'s in SciBooNE.

Catala-Perez, J.; /Valencia U., IFIC



First Direct Measurement of the {sup 17}F(p,{gamma}){sup 18}Ne Cross Section  

SciTech Connect

The rate of the {sup 17}F(p,{gamma}){sup 18}Ne reaction is important in various astrophysical events. A previous {sup 17}F(p,p){sup 17}F measurement identified a 3{sup +} state providing the strongest resonance contribution, but the resonance strength was unknown. We have directly measured the {sup 17}F(p,{gamma}){sup 18}Ne reaction using a mixed beam of {sup 17}F and {sup 17}O at ORNL. The resonance strength for the 3{sup +} resonance in {sup 18}Ne was found to be {omega}{gamma}=33{+-}14(stat){+-}17(syst) meV, corresponding to a {gamma} width of {gamma}{sub {gamma}}=56{+-}24(stat){+-}30(syst) meV. An upper limit on the direct capture of S(E){<=}65 keV b was determined at an energy of 800 keV.

Chipps, K. A.; Greife, U. [Colorado School of Mines, Golden, Colorado 80401 (United States); Bardayan, D. W.; Smith, M. S. [Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); Blackmon, J. C. [Louisiana State University, Baton Rouge, Louisiana 70803 (United States); Chae, K. Y.; Moazen, B. H.; Pittman, S. T. [University of Tennessee, Knoxville, Tennessee 37996 (United States); Hatarik, R.; Peters, W. A. [Rutgers University, New Brunswick, New Jersey 08901 (United States); Kozub, R. L.; Shriner, J. F. Jr. [Tennessee Technological University, Cookeville, Tennessee 38505 (United States); Matei, C. [Oak Ridge Associated Universities, Oak Ridge, Tennessee 37830 (United States); Nesaraja, C. D.; Pain, S. D. [Oak Ridge National Laboratory, Oak Ridge, Tennessee 37831 (United States); University of Tennessee, Knoxville, Tennessee 37996 (United States)




NLE Websites -- All DOE Office Websites (Extended Search)

NE NE EX XT T G GE EN NE ER RA AT TI IO ON N S SA AF FE EG GU UA AR RD DS S I IN NI IT TI IA AT TI IV VE E ( (N NG GS SI I) ) O OP PP PO OR RT TU UN NI IT TI IE ES S F FO OR R S ST TU UD DE EN NT TS S A AN ND D Y YO OU UN NG G P PR RO OF FE ES SS SI IO ON NA AL LS S I IN NT TE ER RE ES ST TE ED D I IN N S SA AF FE EG GU UA AR RD DS S/ /N NO ON NP PR RO OL LI IF FE ER RA AT TI IO ON N The Next Generation Safeguards Initiative (NGSI) was launched by the National Nuclear Security Administration (NNSA) in FY 2008 to develop the policies, concepts, technologies, expertise, and infrastructure necessary to strengthen and sustain the international safeguards system as it evolves to meet new challenges over the next 25 years. NGSI's Human Capital Development subprogram 1 aims to revitalize and expand the international safeguards human capital base in the United States by attracting, educating, training, and retaining


MiniBooNE as related to Windows on the Universe  

SciTech Connect

The measurement of absolute neutrino and anti-neutrino cross-sections, the observation of a 'low energy anomaly' in the neutrino sector, the constraints placed on the LSND effect by a non-observation of neutrino oscillations, the search for neutrino and anti-neutrino appearance, and for the possible existence of new heavy particles makes MiniBooNE a major contributor to the current view of the Universe. This paper addresses specific model constraints set by the MiniBooNE data, and explores expectations for further remaining analysis of the data.

Stefanski, Ray; /Fermilab



A generic network interface architecture for a networked processor array (NePA)  

Science Conference Proceedings (OSTI)

Recently Network-on-Chip (NoC) technique has been proposed as a promising solution for on-chip interconnection network. However, different interface specification of integrated components raises a considerable difficulty for adopting NoC techniques. ... Keywords: interconnection network, multiprocessor systemon-chip (MPSoC), network interface, network-on-chip (NoC), networked processor array (NePA)

Seung Eun Lee; Jun Ho Bahn; Yoon Seok Yang; Nader Bagherzadeh




E-Print Network (OSTI)

THERMALIZATION OF THE ION KINETIC ENERGY IN A Ne GAS PUFF PINCH MODEL* J. L. Giuliani, J. W Department of Energy/NNSA, Washington DC USA Full understanding of the dynamics, population kinetics, and energy budget of a K-shell radiating Z-pinch remains a challenging problem in high energy density plasma


Km3NeT, a Deep Sea Challenge for Neutrino Astronomy  

Science Conference Proceedings (OSTI)

The groups presently pursuing neutrino telescope projects in the Mediterranean Sea; ANTARES, NEMO, and NESTOR, have formed the new KM3NeT consortium to study the construction of a cubic kilometre-scale neutrino telescope for the Northern hemisphere. ...

Ciro Bigongiari




E-Print Network (OSTI)

36 SEPTEMBER | 2012 WiNd TURbiNE CAPACiTY FRONTiER FROM SCAdA ThE WORld hAS SEEN A significant contributor to this growth. The wind turbine generated energy depends on the wind potential and the turbine of wind turbines. Supervi- sory control and data acquisition (SCADA) systems record wind turbine

Kusiak, Andrew


Charged current single pion cross section measurement at MiniBooNE  

SciTech Connect

We present MiniBooNE's preliminary {nu}{sub {mu}} CC1{pi}{sup +} cross section measurement, calculated using the ratio of CC1{pi}{sup +} to CCQE events. We find the inclusive CC1{pi}{sup +} measurement to be below the nuance [1] and NEUGEN [2] expectations.

Wascko, M.O.; /Louisiana State U.



Nonuniformity of CBF response to NE-or ANG II-induced hypertension in rabbits  

SciTech Connect

The regional response of brain vasculature to moderate hypertension was investigated using two hypertensive drugs, norepinephrine (NE) and angiotensin II (ANG II), infused intravenously at low concentrations (increase in blood pressure 15-40 mmHg). Regional cerebral blood flow (rCBF) was measured in unanesthetized and anesthetized rabbits using the (/sup 14/C)ethanol saturation technique. (1) In both groups of animals, NE and ANG II induced regional differences in the flow changes as compared with controls, confirming a regional (or segmental) heterogeneity in the regulatory mechanisms to hypertension. (2) The responses to identical rises in blood pressure (BP) in most of the structures analyzed depended on the drug used. In the unanesthetized rabbits, the increase in vascular resistance induced by NE was greater than that induced by ANG II. (3) With the two drugs, there was no correlation between the flow changes in any of the structures considered and either the BP increase or the BP level in unanesthetized animals. However, these flow changes were correlated with the BP increase in anesthetized animals, although differences between the effects of NE and ANG II were again observed. This study suggests that cerebrovascular regulatory mechanisms in hypertension are probably more complex than a simple myogenic reaction. Their heterogeneity and their dependence both on the cause of hypertension and on the presence of anesthetics suggest the intervention of an integrating pathway.

Reynier-Rebuffel, A.M.; Aubineau, P.; Issertial, O.; Seylaz, J.



NE-Rank: A Novel Graph-Based Keyphrase Extraction in Twitter  

Science Conference Proceedings (OSTI)

The massive growth of the micro-blogging service Twitter has shed the light on the challenging problem of summarizing a collection of large number of tweets. This paper attempts to extract topical key phrases that would represent topics in tweets. Due ... Keywords: Keyphrase Extraction, Graph-based Ranking, Hashtag, Twitter, PageRank, TextRank, NE-Rank

Abdelghani Bellaachia; Mohammed Al-Dhelaan



Zwischenbericht zum DFG-Forschungsvorhaben NE 902/2-1 SCHR 570/6-1  

E-Print Network (OSTI)

.3 Anwendungsperspektiven. . . . . . . . . . . . . . . . . . . . . . . . . . . . 8 4 Arbeits- und Ergebnisbericht 10 4.3 Wissenschaftliche Mitarbeiter/in Dipl.-Ing. Vera Ebbing Besch¨aftigungszeitraum: seit 1. Oktober 2006 1.4 Fachgebiet;Zwischenbericht zum DFG-Forschungsvorhaben NE 902/2-1 SCHR 570/6-1 10 4 Arbeits- und Ergebnisbericht Basierend auf

Neff, Patrizio


Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural



Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration


Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.



Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential



Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."


Searches for New Physics at MiniBooNE: Sterile Neutrinos and Mixing Freedom  

SciTech Connect

The MiniBooNE experiment was designed to perform a search for {nu}{sub {mu}} {yields} {nu}{sub e} oscillations in a region of {Delta}m{sup 2} and sin{sup 2} 2{theta} very different from that allowed by standard, three-neutrino oscillations, as determined by solar and atmospheric neutrino experiments. This search was motivated by the LSND experimental observation of an excess of {bar {nu}}{sub e} events in a {bar {nu}}{sub {mu}} beam which was found compatible with two-neutrino oscillations at {Delta}m{sup 2} {approx} 1 eV{sup 2} and sin{sup 2} 2{theta} < 1%. If confirmed, such oscillation signature could be attributed to the existence of a light, mostly-sterile neutrino, containing small admixtures of weak neutrino eigenstates. In addition to a search for {nu}{sub {mu}} {yields} {nu}{sub e} oscillations, MiniBooNE has also performed a search for {bar {nu}}{sub {mu}} {yields} {bar {nu}}{sub e} oscillations, which provides a test of the LSND two-neutrino oscillation interpretation that is independent of CP or CPT violation assumptions. This dissertation presents the MiniBooNE {nu}{sub {mu}} {yields} {nu}{sub e} and {bar {nu}}{sub {mu}} {yields} {bar {nu}}{sub e} analyses and results, with emphasis on the latter. While the neutrino search excludes the two-neutrino oscillation interpretation of LSND at 98% C.L., the antineutrino search shows an excess of events which is in agreement with the two-neutrino {bar {nu}}{sub {mu}} {yields} {bar {nu}}{sub e} oscillation interpretation of LSND, and excludes the no oscillations hypothesis at 96% C.L. Even though the neutrino and antineutrino oscillation results from MiniBooNE disagree under the single sterile neutrino oscillation hypothesis, a simple extension to the model to include additional sterile neutrino states and the possibility of CP violation allows for differences between neutrino and antineutrino oscillation signatures. In view of that, the viability of oscillation models with one or two sterile neutrinos is investigated in global fits to MiniBooNE and LSND data, with and without constraints from other oscillation experiments with similar sensitivities to those models. A general search for new physics scenarios which would lead to effective non-unitarity of the standard 3 x 3 neutrino mixing matrix, or mixing freedom, is also performed using neutrino and antineutrino data available from MiniBooNE.

Karagiorgi, Georgia S.; /MIT



Strategic Plan for Nuclear Energy -- Knowledge Base for Advanced Modeling and Simulation (NE-KAMS)  

SciTech Connect

The Nuclear Energy Computational Fluid Dynamics Advanced Modeling and Simulation (NE-CAMS) system is being developed at the Idaho National Laboratory (INL) in collaboration with Bettis Laboratory, Sandia National Laboratory (SNL), Argonne National Laboratory (ANL), Utah State University (USU), and other interested parties with the objective of developing and implementing a comprehensive and readily accessible data and information management system for computational fluid dynamics (CFD) verification and validation (V&V) in support of nuclear energy systems design and safety analysis. The two key objectives of the NE-CAMS effort are to identify, collect, assess, store and maintain high resolution and high quality experimental data and related expert knowledge (metadata) for use in CFD V&V assessments specific to the nuclear energy field and to establish a working relationship with the U.S. Nuclear Regulatory Commission (NRC) to develop a CFD V&V database, including benchmark cases, that addresses and supports the associated NRC regulations and policies on the use of CFD analysis. In particular, the NE-CAMS system will support the Department of Energy Office of Nuclear Energy Advanced Modeling and Simulation (NEAMS) Program, which aims to develop and deploy advanced modeling and simulation methods and computational tools for reliable numerical simulation of nuclear reactor systems for design and safety analysis. Primary NE-CAMS Elements There are four primary elements of the NE-CAMS knowledge base designed to support computer modeling and simulation in the nuclear energy arena as listed below. Element 1. The database will contain experimental data that can be used for CFD validation that is relevant to nuclear reactor and plant processes, particularly those important to the nuclear industry and the NRC. Element 2. Qualification standards for data evaluation and classification will be incorporated and applied such that validation data sets will result in well-defined, well-characterized data. Element 3. Standards will be established for the design and operation of experiments for the generation of new validation data sets that are to be submitted to NE-CAMS that addresses the completeness and characterization of the dataset. Element 4. Standards will be developed for performing verification and validation (V&V) to establish confidence levels in CFD analyses of nuclear reactor processes; such processes will be acceptable and recognized by both CFD experts and the NRC.

Kimberlyn C. Mousseau



Ronald E. Gill (NE), Scoville, ID - Level I Curtis Roth (EM), Idaho  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

E. Gill (NE), E. Gill (NE), Scoville, ID - Level I Curtis Roth (EM), Idaho Falls, ID - Level I Jared T. Howerton (NNSA), Oak Ridge, TN - Level I Richard L. Person (NNSA), DOE HQ - Level I Phillip (Tony) A. Polk (EM), Aiken, SC (Savannah River) - Level IV Jane Powell-Dolan (LM), Cincinnati, OH - Level I Eric M. Thompson (NNSA), Oak Ridge, TN - Level II Congratulations to our newly certified FPDs! The Certification Review Board (CRB or 'the Board') convened on Friday, Sep- tember 24 to review certifi- cation candidates and dis- cuss several topics. The Department of Energy (DOE) met the FY2010 tar- gets for the Root Cause Analysis, Corrective Action Plan metrics 7 and 8, as fol- lows: DOE surpassed the target for Metric #7 (95% of pro-


DOE-NE-STD-1004-92; Root Cause Analysis Guidance Document  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

NE-STD-1004-92 NE-STD-1004-92 DOE GUIDELINE ROOT CAUSE ANALYSIS GUIDANCE DOCUMENT February 1992 U.S. Department of Energy Office of Nuclear Energy Office of Nuclear Safety Policy and Standards Washington, D.C. 20585 ii ABSTRACT DOE Order 5000.3A, "Occurrence Reporting and Processing of Operations Information," investigation and reporting of occurrences (including the performance of root cause analysis) requires the and the selection, implementation, and follow-up of corrective actions. The level of effort expended should be based on the significance attached to the occurrence. Most off-normal occurrences need only a scaled- down effort while most emergency occurrences should be investigated using one or more of the formal analytical models. A discussion of methodologies, instructions, and worksheets in this document guides


File:USDA-CE-Production-GIFmaps-NE.pdf | Open Energy Information  

Open Energy Info (EERE)

NE.pdf NE.pdf Jump to: navigation, search File File history File usage Nebraska Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 278 KB, MIME type: application/pdf) Description Nebraska Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Nebraska External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:18, 27 December 2010 Thumbnail for version as of 16:18, 27 December 2010 1,650 × 1,275 (278 KB) MapBot (Talk | contribs) Automated bot upload


ANL/NE-13/9 SHARP Assembly-Scale Multiphysics Demonstration  

NLE Websites -- All DOE Office Websites (Extended Search)

NE-13/9 NE-13/9 SHARP Assembly-Scale Multiphysics Demonstration Simulations Mathematics and Computation Division & Nuclear Engineering Division About Argonne National Laboratory Argonne is a U.S. Department of Energy laboratory managed by UChicago Argonne, LLC under contract DE-AC02-06CH11357. The Laboratory's main facility is outside Chicago, at 9700 South Cass Avenue, Argonne, Illinois 60439. For information about Argonne and its pioneering science and technology programs, see www.anl.gov. Availability of This Report This report is available, at no cost, at http://www.osti.gov/bridge. It is also available on paper to the U.S. Department of Energy and its contractors, for a processing fee, from: U.S. Department of Energy Office of Scientific and Technical Information

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Neutron Transfer Studied with a Radioactive beam of 24Ne, using TIARA at SPIRAL  

E-Print Network (OSTI)

A general experimental technique for high resolution studies of nucleon transfer reactions using radioactive beams is briefly described, together with the first new physics results that have been obtained with the new TIARA array. These first results from TIARA are for the reaction 24Ne(d,p)25Ne, studied in inverse kinematics with a pure radioactive beam of 100,000 pps from the SPIRAL facility at GANIL. The reaction probes the energies of neutron orbitals relevant to very neutron rich nuclei in this mass region and the results highlight the emergence of the N=16 magic number for neutrons and the associated disappearance of the N=20 neutron magic number for the very neutron rich neon isotopes.

W. N. Catford; C. N. Timis; R. C. Lemmon; M. Labiche; N. A. Orr; L. Caballero; R. Chapman; M. Chartier; M. Rejmund; H. Savajols; for the TIARA Collaboration



NE-23 Disposal of Offsite-Generated Defense Radioactive Waste, Ventron  

Office of Legacy Management (LM)

pi/L +3 pi/L +3 *3L 52. NE-23 Disposal of Offsite-Generated Defense Radioactive Waste, Ventron FUSRAP Site Jill E. Lytle, DP-12 NE-23 The Office of Remedial Action and Waste Technology has received a request from the Technical Services Division, DOE-Oak Ridge Operations Office, for a determination of the appropriate disposal location for the material which will result from remedial action of the Ventron site in Beverly, Massachusetts. The Ventron site was used from 1942 to 1948 under contract to the ME0 and AEC for converting uranium oxide to uranium metal powder, as well as later operations involving recovery of uranium from scrap uranium and turnings from the fuel fabrication plant at Hanford, Washington. Full-scale remedial action, anticipated to result in approximately 5,000


Constraints on electromagnetic properties of sterile neutrinos from MiniBooNE results  

E-Print Network (OSTI)

Among the class of models with small mixing angles between sterile and active neutrinos, we place constraints on the effective muon-to-sterile neutrino magnetic and electric dipole transition moments from the combined MiniBooNE results for the sterile neutrino mass range of $10\\;\\mathrm{MeV}distribution as a function of polar angle. However, good agreement with the anomalous event distribution in reconstructed energy can be achieved for some values of magnetic and electric moments.

Alexander Radionov



A combined muon-neutrino and electron-neutrino oscillation search at MiniBooNE  

SciTech Connect

MiniBooNE seeks to corroborate or refute the unconfirmed oscillation result from the LSND experiment. If correct, the result implies that a new kind of massive neutrino, with no weak interactions, participates in neutrino oscillations. MiniBooNE searches for {nu}{sub {mu}} {yields} {nu}{sub e} oscillations with the Fermi National Accelerator Laboratory 8 GeV beam line, which produces a {nu}{sub {mu}} beam with an average energy of {approx} 0.8 GeV and an intrinsic {nu}{sub e} content of 0.4%. The neutrino detector is a 6.1 m radius sphere filled with CH{sub 2}, viewed by 1540 photo-multiplier tubes, and located 541 m downstream from the source. This work focuses on the estimation of systematic errors associated with the neutrino flux and neutrino interaction cross section predictions, and in particular, on constraining these uncertainties using in-situ MiniBooNE {nu}{sub {mu}} charged current quasielastic (CCQE) scattering data. A data set with {approx} 100,000 events is identified, with 91% CCQE purity. This data set is used to measure several parameters of the CCQE cross section: the axial mass, the Fermi momentum, the binding energy, and the functional dependence of the axial form factor on four-momentum transfer squared. Constraints on the {nu}{sub {mu}} and {nu}{sub e} fluxes are derived using the {nu}{sub {mu}} CCQE data set. A Monte Carlo study of a combined {nu}{sub {mu}} disappearance and {nu}{sub e} appearance oscillation fit is presented, which improves the {nu}{sub {mu}} {yields} {nu}{sub e} oscillation sensitivity of MiniBooNE with respect to a {nu}{sub e} appearance-only fit by 1.2-1.5{sigma}, depending on the value of {Delta}m{sup 2}.

Monroe, Jocelyn R.; /Columbia U.



File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



The Sound Emission Board of the KM3NeT Acoustic Positioning System  

E-Print Network (OSTI)

We describe the sound emission board proposed for installation in the acoustic positioning system of the future KM3NeT underwater neutrino telescope. The KM3NeT European consortium aims to build a multi-cubic kilometre underwater neutrino telescope in the deep Mediterranean Sea. In this kind of telescope the mechanical structures holding the optical sensors, which detect the Cherenkov radiation produced by muons emanating from neutrino interactions, are not completely rigid and can move up to dozens of meters in undersea currents. Knowledge of the position of the optical sensors to an accuracy of about 10 cm is needed for adequate muon track reconstruction. A positioning system based on the acoustic triangulation of sound transit time differences between fixed seabed emitters and receiving hydrophones attached to the kilometre-scale vertical flexible structures carrying the optical sensors is being developed. In this paper, we describe the sound emission board developed in the framework of KM3NeT project, whi...

Llorens, C D; Sogorb, T; Bou--Cabo, M; Martnez-Mora, J A; Larosa, G; Adrin-Martnez, S



Collapse and expansion in the bright-rimmed cloud SFO 11NE  

E-Print Network (OSTI)

We report the results of a search for the double-peaked blue-skewed infall signature in the bright-rimmed cloud core SFO 11NE SMM1. Observations of the optically thick HCO$^{+}$ and optically thin H$^{13}$CO$^{+}$ J=3--2 lines reveal that there is indeed a characteristic double-peaked line profile, but skewed to the red rather than the blue. Modelling of the dust continuum emission and line profiles show that the motions within SFO 11NE SMM1 are consistent with a collapsing central core surrounded by an expanding outer envelope. We show that the collapse is occurring at a similar rate to that expected onto a single solar-mass protostar and is unlikely to represent the large-scale collapse of gas onto the infrared cluster seen at the heart of SFO 11NE SMM1. The outer envelope is expanding at a much greater rate than that expected for a photoevaporated flow from the cloud surface. The modelled expansion is consistent with the bulk cloud re-expansion phase predicted by radiative-driven implosion models of cometary clouds.

M. A Thompson; G. J. White



Benthic biological and biogeochemical patterns and processes across an oxygen minimum zone (Pakistan margin, NE Arabian Sea)  

E-Print Network (OSTI)

(Pakistan margin, NE Arabian Sea) Gregory L. Cowie a,?, Lisa A. Levin b a The Sir John Murray Laboratories), and organic matter (OM) availability on benthic communities and processes across the Pakistan Margin

Levin, Lisa


Strategic Plan for Nuclear Energy -- Knowledge Base for Advanced Modeling and Simulation (NE-KAMS)  

SciTech Connect

NE-KAMS knowledge base will assist computational analysts, physics model developers, experimentalists, nuclear reactor designers, and federal regulators by: (1) Establishing accepted standards, requirements and best practices for V&V and UQ of computational models and simulations, (2) Establishing accepted standards and procedures for qualifying and classifying experimental and numerical benchmark data, (3) Providing readily accessible databases for nuclear energy related experimental and numerical benchmark data that can be used in V&V assessments and computational methods development, (4) Providing a searchable knowledge base of information, documents and data on V&V and UQ, and (5) Providing web-enabled applications, tools and utilities for V&V and UQ activities, data assessment and processing, and information and data searches. From its inception, NE-KAMS will directly support nuclear energy research, development and demonstration programs within the U.S. Department of Energy (DOE), including the Consortium for Advanced Simulation of Light Water Reactors (CASL), the Nuclear Energy Advanced Modeling and Simulation (NEAMS), the Light Water Reactor Sustainability (LWRS), the Small Modular Reactors (SMR), and the Next Generation Nuclear Power Plant (NGNP) programs. These programs all involve computational modeling and simulation (M&S) of nuclear reactor systems, components and processes, and it is envisioned that NE-KAMS will help to coordinate and facilitate collaboration and sharing of resources and expertise for V&V and UQ across these programs. In addition, from the outset, NE-KAMS will support the use of computational M&S in the nuclear industry by developing guidelines and recommended practices aimed at quantifying the uncertainty and assessing the applicability of existing analysis models and methods. The NE-KAMS effort will initially focus on supporting the use of computational fluid dynamics (CFD) and thermal hydraulics (T/H) analysis for M&S of nuclear reactor systems, components and processes, and will later expand to include materials, fuel system performance and other areas of M&S as time and funding allow.

Rich Johnson; Kimberlyn C. Mousseau; Hyung Lee



Astrophysically Important 19Ne States Studied with the 2H(18F,alpha+15O)n Reaction  

Science Conference Proceedings (OSTI)

The nuclear structure of {sup 19}Ne near the proton threshold is of interest for understanding the rates of proton-induced reactions on {sup 18}F in novae. Analogues for several states in the mirror nucleus {sup 19}F have not yet been identified in {sup 19}Ne indicating the level structure of {sup 19}Ne in this region is incomplete. The {sup 18}F(d;n){sup 19}Ne and {sup 18}F(d,p){sup 19}F reactions have been measured simultaneously at E{sub c.m.} = 14.9 MeV. The experiments were performed at the Holifield Radioactive Ion Beam Facility (HRIBF) of Oak Ridge National Laboratory (ORNL) by bombarding a 720-mg/cm{sub 2} CD{sub 2} target with a radioactive {sup 18}F beam. The {sup 19}Ne states of interest near the proton threshold decay by breakup into a and {sup 15}O particles. These decay products were detected in coincidence with position-sensitive E-{Delta}E silicon telescopes. The {alpha} and {sup 15}N particles from the break up of the mirror nucleus {sup 19}F were also measured with these detectors. Particle identification, coincidence, and Q-value requirements enable us to distinguish the reaction of interest from other reactions. The reconstruction of relative energy of the detected particles reveals the excited states of {sup 19}Ne and {sup 19}F which are populated. The neutron (proton) angular distributions for states in {sup 19}Ne ({sup 19}F) were extracted using momentum conservation. The observed states in {sup 19}Ne and {sup 19}F will be presented.

Adekola, Aderemi S [ORNL; Bardayan, Daniel W [ORNL; Blackmon, Jeff C [ORNL; Brune, C. [Ohio University; Chae, K. Y. [University of Tennessee, Knoxville (UTK); Champagne, A. E. [University of North Carolina, Chapel Hill; Domizioli, Carlo P [ORNL; Greife, U. [Colorado School of Mines, Golden; Heinen, Z. [Ohio University; Hornish, M. [Ohio University; Johnson, Micah [ORNL; Jones, K. L. [University of Tennessee, Knoxville (UTK); Kapler, R. [University of Tennessee, Knoxville (UTK); Livesay, Jake [ORNL; Ma, Zhanwen [ORNL; Massey, T. [Ohio University; Moazen, Brian [University of Tennessee, Knoxville (UTK); Nesaraja, Caroline D [ORNL; Pain, Steven D [ORNL; ShrinerJr., J. F. [Tennessee Technological University; Thomas, J. S. [Rutgers University; Smith, Nathan A [ORNL; Smith, Michael Scott [ORNL; Visser, D. W. [University of North Carolina, Chapel Hill; Voinov, A. [Ohio University



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab




Office of Legacy Management (LM)

s,' s,' Whidd Pk. Yilljam West West Orange Tennis Club, Inc. 200 Pleasant Valley Way West Orange, New Jersey 07052 Dear Mr. West: The Department of Energy (DOE), as part of its Formerly Utilized Sites Remedial Action Program (FUSRAP), has reviewed information on Vitro Laboratories, formerly located on what is now property of the West Orange Tennis Club, to determine whether it contains residual radioactivity traceable to activities conducted on behalf of the Atomic Energy Commission (a predecessor to DOE). A radiological survey indicated that the radiation levels and radionuclide concentrations are at or near natural background levels. Therefore, no remedial action is required, and DOE is eliminating the former Vitro site from further consideration under FL&RAP.



Office of Legacy Management (LM)

the Bureau of Hines Site at Albany, Oregon, for Remedial the Bureau of Hines Site at Albany, Oregon, for Remedial Action Under the Formerly Utilized Sites Remedial Action Program I L@ _I' J.-La&one, Manager Oak Ridge Operations Office Based on the data in the attached draft reports, it has been determined that the subject site is contaminated with residual radioactive material ' as a result of Manhattan Engineer District/Atomic Energy Commission operations P * at this site. The contamination is in excess of the acceptable guidelines and warrants some form of remedial action under the Fornlerly Utilized Sites Reriledial Action Program. It should be noted that the attached reports are draft reports and although subject to change, the changes expected will not effect the designation of the site; therefore, the reports are Suitable for -



E-Print Network (OSTI)

doxycycline make a difference? Maybe, but here was the catch: To slow IMHA's destruction of red blood cells- tion. How to get out of this catch-22? Start the doxycycline but "contin- ue to treat the IMHA because

Tufts University


1 Summary: NE cod FSP survey 2003-08 The trawler Abbie Lee was  

E-Print Network (OSTI)

chartered in October/November 2008 to carry out the sixth in a series of FSP surveys of cod and other gadoids off the NE coast of England. Surveys since 2005 have utilised tows spread out over the survey area, with additional tows in defined areas with coarser seabed types (hard ground) where cod abundance is expected to be greatest. As in previous FSP surveys, cod were most abundant on or near the hard ground, whereas haddock were mainly on the softer seabed sediments offshore. Whiting distribution showed no clear relationship with seabed type. 6 5

Jos De Oliveira; Guy Pasco; Mike Armstrong; Peter Randall; Cefas Lowestoft



Temperature Effects on the Perturber Induced Shift of Dopant Ionization Energies in He and Ne  

SciTech Connect

In this Letter, temperature effects on the perturber induced shift {Delta}{sub D}({rho}{sub P}) [{rho}{sub P} {equivalent_to} perturber number density] of the dopant ionization energy in the repulsive gases Ne and He are investigated at low to medium perturber densities (i.e., {rho}{sub P} {<=} 6.0 x 10{sup 21} cm{sup -3}). We show that these effects arise form changes in the ensemble averaged dopant/perturber polarization energy rather than from changes in the energy of the quasi-free electron.

C Evans; Y Lushtak; X Shi; L Li; G Findley



DOE-NE Proliferation and Terrorism Risk Assessment: FY12 Plans Update  

SciTech Connect

This presentation provides background information on FY12 plans for the DOE Office of Nuclear Energy Proliferation and Terrorism Risk Assessment program. Program plans, organization, and individual project elements are described. Research objectives are: (1) Develop technologies and other solutions that can improve the reliability, sustain the safety, and extend the life of current reactors; (2) Develop improvements in the affordability of new reactors to enable nuclear energy; (3) Develop Sustainable Nuclear Fuel Cycles; and (4) Understand and minimize the risks of nuclear proliferation and terrorism - Goal is to enable the use of risk information to inform NE R&D program planning.

Sadasivan, Pratap [Los Alamos National Laboratory



Helioseismic Constraints on the Solar Ne/O Ratio and Heavy Element Abundances  

E-Print Network (OSTI)

We examine the constraints imposed by helioseismic data on the solar heavy element abundances. In prior work we argued that the measured depth of the surface convection zone R_CZ and the surface helium abundance Y_surf were good metallicity indicators which placed separable constraints on light metals (CNONe) and the heavier species with good relative meteoritic abundances. The resulting interiors-based abundance scale was higher than some published studies based on 3D model atmospheres at a highly significant level. In this paper we explore the usage of the solar sound speed in the radiative interior as an additional diagnostic, and find that it is sensitive to changes in the Ne/O ratio even for models constructed to have the same R_CZ and Y_surf. Three distinct helioseismic tests (opacity in the radiative core, ionization in the convection zone, and the core mean molecular weight) yield consistent results. Our preferred O, Ne and Fe abundances are 8.86 +/-0.04, 8.15 +/-0.17 and 7.50 +/-0.05 respectively. Th...

Delahaye, F; Pinsonneault, L; Zeippen, C J


Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Light charged particle emission from hot $^{32}$S$^{*}$ formed in $^{20}$Ne + $^{12}$C reaction  

E-Print Network (OSTI)

Inclusive energy distributions for light charged particles ($p, d, t$ and $\\alpha$) have been measured in the $^{20}$Ne (158, 170, 180, 200 MeV) + $^{12}$C reactions in the angular range 10$^{o}$ -- 50$^{o}$. Exclusive light charged particle energy distribution measurements were also done for the same system at 158 MeV bombarding energy by in-plane light charged particle -- fragment coincidence. Pre-equilibrium components have been separated out from proton energy spectra using moving source model considering two sources. The data have been compared with the predictions of the statistical model code CASCADE. It has been observed that significant deformation effects were needed to be introduced in the compound nucleus in order to explain the shape of the evaporated $d, t$ energy spectra. For protons, evaporated energy spectra were rather insensitive to nuclear deformation, though angular distributions could not be explained without deformation. Decay sequence of the hot $^{32}$S nucleus has been investigated through exclusive light charged particle measurements using the $^{20}$Ne (158 MeV) + $^{12}$C reaction. Information on the sequential decay chain has been extracted through comparison of the experimental data with the predictions of the statistical model. It is observed from the present analysis that exclusive light charged particle data may be used as a powerful tool to probe the decay sequence of hot light compound systems.

Aparajita Dey; S. Bhattacharya; C. Bhattacharya; K. Banerjee; T. K. Rana; S. Kundu; S. R. Banerjee; S. Mukhopadhyay; D. Gupta; R. Saha



Characterization of nonthermal Ne-N{sub 2} mixture radio frequency discharge  

Science Conference Proceedings (OSTI)

This paper deals with optical emission spectroscopic studies of low pressure (p=0.1{yields}0.5 mbar) Ne-N{sub 2} capacitively coupled radio frequency (rf) plasma that can be used for plasma nitriding, etc. It reports the methods to calculate the electron temperature (T{sub e}) in nonthermal plasmas. Since, the selected Ne I lines, used to calculate electron temperature, are found in corona balance; therefore, it allows us to use modified Boltzmann technique to calculate electron temperature. Langmuir probe is also used to calculate electron temperature and electron energy distribution functions (EEDFs). The measurements are worked out for different discharge parameters like neon percentage, filling pressure and RF power. It is found that electron temperature increases with the increase in neon percentage and decreases with the increase in pressure, whereas excitation temperature (T{sub exc}) increases with power, neon percentage, and decreases with pressure. It is also observed that electron temperature measured by Langmuir probe technique is slightly greater than the one measured via modified Boltzmann plot method. The tails of the EEDFs gain height and extend toward the higher energy with the increase in neon percentage in the mixture.

Rehman, N. U.; Zakaullah, M. [Department of Physics, Quaid-i-Azam University, 45320 Islamabad (Pakistan); Khan, F. U. [Department of Physics, Gomal University, 29050 D.I. Khan (Pakistan); Naseer, S. [Department of Physics, Peshawar University, 25120 Peshawar (Pakistan)



Radiative rates and electron impact excitation rate coefficients for Ne-like selenium, Se XXV  

Science Conference Proceedings (OSTI)

In this article we report calculations of energy levels, radiative rates, electron impact collision strengths, and effective collision strengths for transitions among the 241 fine-structure levels arising from 2l{sup 8} and 2l{sup 7}n{sup '}l{sup '} (n{sup '{241 levels. The effective collision strengths are reported for all 28920 transitions among the 241 levels over a wide temperature range up to 10 keV. To assess the reliability and accuracy of the present collisional data, we have performed a 27-state close-coupling calculation, employing the Dirac R-matrix theory. The results from the close-coupling calculation and the independent-process calculation for the identical target states are found to be in good agreement. - Highlights: {yields} Radiative and collisional atomic data are presented for the lowest 241 fine-structure levels in Ne-like Se. {yields} Calculations are performed using the FAC package. {yields} Resonances enhance significantly a large amount of transitions. {yields} Radiative damping effects are significant for many transitions. {yields} Close-coupling effects are small in Ne-like Se.

Wang, K.; Chen, C.Y., E-mail: chychen@fudan.edu.cn; Huang, M.; Wang, Y.S.; Zou, Y.M.



Photoionization-pumped, Ne II, x-ray laser studies project. Final report  

SciTech Connect

The energetics of this pumping scheme are shown. Short-pulse (50 to 100 ps) laser irradiation of an appropriate x-ray flashlamp medium generates broad-band emission in the range of 300 to 800 eV which preferentially photoionizes Ne to the /sup 2/S state of Ne II creating an inversion at approximately 27 eV. Although this approach does not depend on precise spectral overlap between the x-ray pump radiation and the medium to be pumped, it does require that the x-ray medium remain un-ionized prior to photoionization by the soft x-ray emission. Well-controlled focus conditions are required to ensure that the x-ray medium is not subjected to electron or x-ray preheat prior to irradiation by the soft x-ray source. The magnitude of the population inversion is predicted to be critically dependent upon rapid photoionization of the two states; therefore, ultra-short pulse irradiation of the laser flashlamps is required.

Richardson, M.C.; Hagelstein, P.L.; Eckart, M.J.; Forsyth, J.M.; Gerrassimenko, M.; Soures, J.M.



A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Measurement of the nu(mu)-CCQE cross-section in the SciBooNE experiment  

SciTech Connect

SciBooNE is a neutrino and anti-neutrino cross-section experiment at Fermilab, USA. The SciBooNE experiment is summarized and two independent CCQE analyses are described. For one of the analyses, an absolute {nu}{sub {mu}}-CCQE cross section in the neutrino energy region (0.6-1.6) GeV is shown and the technique developed for such a purpose is also explained. The total cross section measured over this energy range agrees well with expectations, based on the NEUT event generator and using a value of 1.21 GeV for the CCQE axial mass.

Alcaraz-Aunion, Jose Luis; /Barcelona, IFAE; Walding, Joseph; /Imperial Coll., London



New Results from MiniBooNE Charged-Current Quasi-Elastic Anti-Neutrino Data  

SciTech Connect

MiniBooNE anti-neutrino charged-current quasi-elastic (CCQE) data is compared to model predictions. The main background of neutrino-induced events is examined first, where three independent techniques are employed. Results indicate the neutrino flux is consistent with a uniform reduction of {approx}20% relative to the largely uncertain prediction. After background subtraction, the Q{sup 2} shape of {bar v}{sub {mu}} CCQE events is consistent with the model parameter MA = 1.35 GeV determined from MiniBooNE v{sub {mu}} CCQE data, while the normalization is {approx} 20% high compared to the same prediction.

Grange, Joseph



Markus Popa, DOE (OCRWM) Bill Sherman, NE HLRW Task Force Robert Holden, NCAI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Minutes Monday, November 3rd 2:00-3:00 p.m. (EST) Minutes Monday, November 3rd 2:00-3:00 p.m. (EST) Participants included: Markus Popa, DOE (OCRWM) Bill Sherman, NE HLRW Task Force Robert Holden, NCAI Mike Butler, UETC Bob Fronczak, AAR Kevin Blackwell, FRA Mike Butler (UETC) greeted participants and informed the group of previous notification by Robert Light (Mescalero Apache Tribe), Robert Centracco (FRA), and Mike Calhoun (FRA) that they would be unable to join the call. Mr. Butler began the call with a brief update on the status of Matrix 1, now entitled "Summary of Rail and Highway Regulations and their Applicability to States, Tribes, Shippers, and Carriers." He informed the group that he had completed an initial draft of the matrix, but that he was making substantial revisions to it and therefore he had not distributed it to the entire group for


Laser Rock Drilling on the History Channel - The NE Multimedia Collection  

NLE Websites -- All DOE Office Websites (Extended Search)

Departments > System Technologies & Diagnostics > Videos Departments > System Technologies & Diagnostics > Videos Laser Oil & Gas Well Drilling: Laser Rock Drilling on the History Channel Argonne's Laser Applications Lab and researcher Claude Reed (NE) appeared in the History Channel program "Modern Marvels: Drilling" (May 10, 2006). "Modern Marvels" relates the ingenuity, invention and imagination behind everyday items, technological breakthroughs and man-made wonders. :: Please wait until video loads completely :: Argonne Experts Dr. Claude B. Reed is one of the Experts featured in the Argonne Experts Guide. The video is in mp4 format. Closed Captioning Transcript Live Closed captioning of the video is not available; however -as an alternative- we provide a transcript of the audio portion of this video as a separate web page.


Effect of supplementation on vitamin A and zinc nutriture of children in northeast (NE) Thailand  

SciTech Connect

Previous surveys of the nutritional status of young children in NE Thailand suggested that they may benefit from vitamin A (VA) and/or zinc (Zn) supplementation. 140 children, with low plasma retinol concentrations were entered in a double-blind study. They were randomized and supplemented with either VA, Zn, VA + Zn or placebo each weekday for 6 mos. All subjects consumed their usual diet that provided adequate protein, less than recommended calories, fat, Zn and VA. Biochemical indices of VA and Zn status increased significantly. The children had adequate VA liver stores as assessed by relative dose response. Zn supplementation resulted in improvement of vision restoration time in dim light using rapid dark adaptometry. VA and Zn synergistically normalized conjunctival epithelium after a 6 mo supplementation. Data suggest that functional improvements of populations with suboptimal VA and Zn nutriture can be accomplished by supplementation with {lt}2 times of RDA of these nutrients.

Udomkesmalee, E.; Dhanamitta, S.; Charoenklatkul, S.; Tantipopipat, S.; Banjong, O.; Rojroongwasinkul, N.; Kramer, T.R.; Smith, J.C. Jr. (Mahidol Univ., Nakhon Pathom (Thailand) USDA, Beltsville, MD (United States))



First direct measurement of resonance strengths in {sup 17}O({alpha},{gamma}){sup 21}Ne  

SciTech Connect

The reaction {sup 17}O({alpha},{gamma}){sup 21}Ne has been measured by in-beam {gamma} spectroscopy for the first time in the energy range E{sub {alpha}=}750-1650 keV using highly enriched anodized Ta{sub 2}({sup 17}O){sub 5} targets. Resonances were found at E{sub {alpha}=} 1002, 1386, and 1619 keV. Their strengths and primary {gamma}-ray branchings are given. The new results exclude the low reaction rate of Descouvemont and support the rate of Caughlan and Fowler. Implications for the neutron poisoning efficiency of {sup 16}O in the weak s-process are discussed.

Best, A.; Goerres, J.; Couder, M.; Boer, R. de; Falahat, S.; Kontos, A.; LeBlanc, P. J.; Li, Q.; O'Brien, S.; Sonnabend, K.; Talwar, R.; Uberseder, E.; Wiescher, M. [Department of Physics, University of Notre Dame, Notre Dame, Indiana 46556 (United States)



KM3NeT:a large underwater neutrino telescope in the Mediterranean Sea  

E-Print Network (OSTI)

High energy neutrinos produced in astrophysical processes will allow for a new way of studying the universe. In order to detect the expected flux of high energy neutrinos from specific astrophysical sources, neutrino telescopes of a scale of a km^3 of water will be needed. A Northern Hemisphere detector is being proposed to be sited in a deep area of the Mediterranean Sea. This detector will provide complimentary sky coverage to the IceCube detector being built at the South Pole. The three neutrino telescope projects in the Mediterranean (ANTARES, NEMO and NESTOR) are partners in an effort to design, and build such a km^3 size neutrino telescope, the KM3NeT. The EU is funding a 3-year Design Study; the status of the Design Study is presented and some technical issues are discussed.

P. A. Rapidis; for the KM3NeT consortium




Science Conference Proceedings (OSTI)

We present extensive computations of photoabsorption and photoionization cross sections across the K-edge of Ne, Mg, Si, S, Ar, and Ca ions with less than 11 electrons. The calculations are performed using the Breit-Pauli R-matrix method and include the effects of radiative and Auger damping by means of an optical potential. The wave functions are constructed from single-electron orbital bases obtained using a Thomas-Fermi-Dirac statistical model potential. Configuration interaction is considered among all fine-structure levels within the n = 2 complex. The damping processes affect the resonances converging to the K thresholds causing them to display symmetric profiles of constant width that smear the otherwise sharp edge at the photoionization thresholds.

Witthoeft, M. C.; Kallman, T. R. [NASA Goddard Space Flight Center, Code 662, Greenbelt, MD 20771 (United States); Bautista, M. A. [Department of Physics, Virginia Polytechnic and State University, Blacksburg, VA 24061 (United States); Mendoza, C. [Centro de Fisica, Instituto Venezolano de Investigaciones CientIficas (IVIC), Caracas 1020A (Venezuela, Bolivarian Republic of); Palmeri, P.; Quinet, P. [Astrophysique et Spectroscopie, Universite de Mons-Hainaut, B-7000 Mons (Belgium)], E-mail: bautista@vt.edu



NE-24 R&D Decontamination Projects Under the Formerly Utilized Sites Remedial  

Office of Legacy Management (LM)

" _ ,' ,:.' : " _ ,' ,:.' : NE-24 R&D Decontamination Projects Under the Formerly Utilized Sites Remedial Action Program (FUSRAP) '. * * ,~~'.'J.' L.aGrone, Manager Oak Ridge Operations O fffce As a result of the House-Senate Conference Report and the Energy and W a ter Appropriations Act for FY 1984, and based on the data in the attached reports indicating radioactive contamination In excess of acceptable guidelines, the sites listed In the attachment and their respectfve vicinity properties (contaminated with radioactive materials from these sites) are being designated as decontamination research and development projects under the FUSRAP. Each site and the associated vicinity properties should be treated as a separate project. . . -_ The objectjve of each project is to decontaminate the vicinity properties


NE-23 Elimination of the Chupadera Mesa and Los Alamos County Industrial Waste  

Office of Legacy Management (LM)

AM? 2 2 1986 AM? 2 2 1986 NE-23 Elimination of the Chupadera Mesa and Los Alamos County Industrial Waste Line Sites from Further Consideration for FUSRAP Inclusion Carlos E. Garcia, Director Environmental Safety and Health Division Albuquerque Operations Office The enclosed material is being provided to you to document the final actions taken under the Department's Formerly Utilized Sites Remedial Action Program (FUSRAP) for the Chupadera Mesa area and the Los Alamos County Industrial Waste Lines, New Mexico. Copies of designation/ elimination reviews for each of the sites are enclosed for your records. We have determined that neither site warrants inclusion in the remedial action program. Primary sources of data for this determination were two survey reports prepared through your Division, LA-10256-MS, "Radiological


T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC


PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


BP Studentship* in the Department of Earth Sciences of the University of Oxford Tectonic evolution of the Parnaiba cratonic basin, NE Brazil  

E-Print Network (OSTI)

of the Parnaiba cratonic basin, NE Brazil Supervisors: Prof. A. B. Watts and Dr. M. Daly (BP) * Subject to funding structure and petroleum play. The focus will be on the Parnaiba basin in NE Brazil, one of the world in Brazil and the UK, will involve the acquisition of seismic reflection and refraction profile data along


Using MiniBooNE neutral current elastic cross section results to constrain 3+1 sterile neutrino models  

E-Print Network (OSTI)

The MiniBooNE Neutral Current Elastic (NCEL) cross section results are used to extract limits in the $\\Delta m^{2}-\\sin^{2}\\vartheta_{\\mu s}$ plane for a 3+1 sterile neutrino model with a mass splitting $0.1 \\leq \\Delta m^{2} \\leq 10.0$ eV$^{2}$. GENIE is used with a cross section model close to the one employed by MiniBooNE to make event rate predictions using simulations on the MiniBooNE target material CH$_{2}$. The axial mass is a free parameter in all fits. Sterile modifications to the flux and changes to the cross section in the simulation relate the two and allow limits to be set on sterile neutrino mixing using cross section results. The large axial mass problem makes it necessary for experiments to perform their own axial mass fits, but a prior fit to the same dataset could mask a sterile oscillation signal. Results are given with and without a penalty term on the axial mass from a prior fit. We find that a simultaneous fit to the axial mass and the sterile neutrino parameters favours very high axial mass values. The general problems that the current uncertainty on charged-current quasi-elastic (CCQE) cross sections at MiniBooNE energies pose for sterile neutrino measurements are discussed.

Callum Wilkinson; Susan Cartwright; Lee Thompson



Measurements of nuclear $?$-ray line emission in interactions of protons and $?$ particles with N, O, Ne and Si  

E-Print Network (OSTI)

$\\gamma$-ray production cross sections have been measured in proton irradiations of N, Ne and Si and $\\alpha$-particle irradiations of N and Ne. In the same experiment we extracted also line shapes for strong $\\gamma$-ray lines of $^{16}$O produced in proton and $\\alpha$-particle irradiations of O. For the measurements gas targets were used for N, O and Ne and a thick foil was used for Si. All targets were of natural isotopic composition. Beams in the energy range up to 26 MeV for protons and 39 MeV for $\\alpha$-particles have been delivered by the IPN-Orsay tandem accelerator. The $\\gamma$ rays have been detected with four HP-Ge detectors in the angular range 30$^{\\circ}$ to 135$^{\\circ}$. We extracted 36 cross section excitation functions for proton reactions and 14 for $\\alpha$-particle reactions. For the majority of the excitation functions no other data exist to our knowledge. Where comparison with existing data was possible usually a very good agreement was found. It is shown that these data are very interesting for constraining nuclear reaction models. In particular the agreement of cross section calculations in the nuclear reaction code TALYS with the measured data could be improved by adjusting the coupling schemes of collective levels in the target nuclei $^{14}$N, $^{20,22}$Ne and $^{28}$Si. The importance of these results for the modeling of nuclear $\\gamma$-ray line emission in astrophysical sites is discussed.

H. Benhabiles-Mezhoud; J. Kiener; J. -P. Thibaud; V. Tatischeff; I. Deloncle; A. Coc; J. Duprat; C. Hamadache; A. Lefebvre-Schuhl; J. -C. Dalouzy; F. De Grancey; F. De Oliveira; F. Dayras; N. De Srville; M. -G. Pellegriti; L. Lamia; S. Ouichaoui



First Direct Measurement of the 17F(p,gamma)18Ne Cross Section  

SciTech Connect

The rate of the 17F(p,gamma)18Ne reaction is of significant importance in astrophysical events like novae and x-ray bursts. A previous 17F(p,p)17F measurement identified the 3+ state in 18Ne predicted to dominate the rate above 0.2 GK at a center of mass energy of 599.8 keV, but the resonance strength for proton capture was unknown. We have directly measured the 17F(p,gamma)18Ne reaction with the Daresbury Recoil Separator, using a mixed beam of radioactive 17F and stable 17O from the HRIBF at ORNL. The resonance strength for the 599.8 keV resonance in 18Ne was found to be = 33 14(stat) 17(sys) meV, corresponding to a width of = 56 24(stat) 30(sys) meV. Additionally, an upper limit on the direct capture S factor of S(E) < 65 keV b was determined at an intermediate energy of 800 keV.

Chipps, K. [Colorado School of Mines, Golden; Bardayan, Daniel W [ORNL; Blackmon, Jeff C [ORNL; Chae, K. Y. [University of Tennessee, Knoxville (UTK); Greife, U. [Colorado School of Mines, Golden; Hatarik, Robert [Rutgers University; Kozub, R. L. [Tennessee Technological University; Matei, Catalin [Oak Ridge Associated Universities (ORAU); Moazen, Brian [University of Tennessee, Knoxville (UTK); Nesaraja, Caroline D [ORNL; Pain, Steven D [ORNL; Peters, W. A. [Rutgers University; Pittman, S. T. [University of Tennessee, Knoxville (UTK); ShrinerJr., J. F. [Tennessee Technological University; Smith, Michael Scott [ORNL



Demonstration Assessment of LED Roadway Lighting: NE Cully Boulevard Portland, OR  

Science Conference Proceedings (OSTI)

A new roadway lighting demonstration project was initiated in late 2010, which was planned in conjunction with other upgrades to NE Cully Boulevard, a residential collector road in the northeast area of Portland, OR. With the NE Cully Boulevard project, the Portland Bureau of Transportation hoped to demonstrate different light source technologies and different luminaires side-by-side. This report documents the initial performance of six different newly installed luminaires, including three LED products, one induction product, one ceramic metal halide product, and one high-pressure sodium (HPS) product that represented the baseline solution. It includes reported, calculated, and measured performance; evaluates the economic feasibility of each of the alternative luminaires; and documents user feedback collected from a group of local Illuminating Engineering Society (IES) members that toured the site. This report does not contain any long-term performance evaluations or laboratory measurements of luminaire performance. Although not all of the installed products performed equally, the alternative luminaires generally offered higher efficacy, more appropriate luminous intensity distributions, and favorable color quality when compared to the baseline HPS luminaire. However, some products did not provide sufficient illumination to all areasvehicular drive lanes, bicycle lanes, and sidewalksor would likely fail to meet design criteria over the life of the installation due to expected depreciation in lumen output. While the overall performance of the alternative luminaires was generally better than the baseline HPS luminaire, cost remains a significant barrier to widespread adoption. Based on the cost of the small quantity of luminaires purchased for this demonstration, the shortest calculated payback period for one of the alternative luminaire types was 17.3 years. The luminaire prices were notably higher than typical prices for currently available luminaires purchased in larger quantities. At prices that are more typical, the payback would be less than 10 years. In addition to the demonstration luminaires, a networked control system was installed for additional evaluation and demonstration purposes. The capability of control system to measure luminaire input power was explored in this study. A more exhaustive demonstration and evaluation of the control system will be the subject of future GATEWAY report(s).

Royer, Michael P.; Poplawski, Michael E.; Tuenge, Jason R.



Particle decay branching ratios for states of astrophysical importance in 19Ne  

E-Print Network (OSTI)

We have measured proton and alpha-particle branching ratios of excited states in 19Ne formed using the 19F(3He,t) reaction at a beam energy of 25 MeV. These ratios have a large impact on the astrophysical reaction rates of 15O(alpha,gamma), 18F(p,gamma) and 18F(p,alpha), which are of interest in understanding energy generation in x-ray bursts and in interpreting anticipated gamma-ray observations of novae. We detect decay protons and alpha-particles using a silicon detector array in coincidence with tritons measured in the focal plane detector of our Enge split-pole spectrograph. The silicon array consists of five strip detectors of the type used in the Louvain-Edinburgh Detector Array, subtending angles from 130 degrees to 165 degrees with approximately 14% lab efficiency. The correlation angular distributions give additional confidence in some prior spin-parity assignments that were based on gamma branchings. We measure Gamma_p/Gamma=0.387+-0.016 for the 665 keV proton resonance, which agrees well with the direct measurement of Bardayan et al.

D. W. Visser; J. A. Caggiano; R. Lewis; W. B. Handler; A. Parikh; P. D. Parker



Color transparency after the NE18 and E665 experiments: Outllok and perspectives at CEBAF  

E-Print Network (OSTI)

CEBAF is a high-luminocity factory of virtual photons with variable virtuality $Q^{2}$ and transverse size. This makes CEBAF, in particular after the energy upgrade to (8-12)GeV, an ideal facility for uncovering new phenomena, and opening new windows, at the interface of the perturbative and nonperturbative QCD. We discuss color transparency as the case for a broad program on electroproduction of vector mesons $\\rho^{0},\\,\\omega^{0},\\,\\phi^{0}$ and their radial excitations $\\rho',\\,\\omega',\\,\\phi'$ at CEBAF. We also comment on the second generation of experiments on color transparency in $^{4}He(e,e'p)$ scattering, which are also feasible at CEBAF. In 1994, we can make more reliable projections into future because our understanding of the onset of color transparency has greatly been augmented by two experiments completed in 1993:\\\\ i) no effect of CT was seen in the SLAC NE18 experiment on $A(e,e'p)$ scattering at virtualities of the exchanged photon $Q^{2} \\lsim 7$ GeV$^{2}$, \\\\ ii) strong signal of CT was observed in the FNAL E665 experiment on exclusive $\\rho^{0}$- meson production in deep inelastic scattering in the same range of $Q^{2}$. \\\\ We discuss the impact of these observations on the CEBAF experimental program. We argue they both are good news, both were anticipated theoretically, and both rule in the correct QCD mechanism of the onset of CT.

J. Nemchik; N. N. Nikolaev; B. G. Zakharov



An intensity-modulated dual-wavelength He-Ne laser for remote sensing of methane  

SciTech Connect

The differential absorption laser radar for methane sensing detects a leakage of methane gas by emitting into the atmosphere the light of a wavelength absorbable by methane, receiving the light returning after being reflected or scattered on a road or wall surface, etc., and measuring the light intensity lost during the travel. This methane detection system is highly practicable as it makes an instantaneous remote detection possible. The authors have developed a new He-Ne laser that could be used as the light source for the above system. This device emits a two-wavelength laser beam (one wavelength absorbable by methane and the other not absorbable by methane but used for referential purposes) from a single plasma tube, and there is no possibility of the axes of the two-wavelength component deviating from each other. Further, using this laser, they have developed a vehicle-mounted type differential absorption laser radar system which has successfully detected low density methane leakage while the vehicle was moving.

Ueki, T.; Tanaka, H.; Uehara, K.



Fine structure collision strengths and line ratios for [Ne V] in infrared and optical sources  

E-Print Network (OSTI)

Improved collisions strengths for the mid-infrared and optical transitions in Ne V are presented. Breit-Pauli R-Matrix calculations for electron impact excitation are carried out with fully resolved near-threshold resonances at very low energies. In particular, the fine structure lines at 14 micron and 24 micron due to transitions among the ground state levels 1s^22s^22p^3 (^3P_{0,1,2}), and the optical/near-UV lines at 2973, 3346 and 3426 Angstrom transitions among the ^3P_{0,1,2}, ^1D_2, ^1S_0 levels are described. Maxwellian averaged collision strengths are tabulated for all forbidden transistion within the ground configuration. Significant differences are found in the low temperature range Te < 10000 K for both the FIR and the opitcal transitions compared to previous results. An analysis of the 14/24 line ratio in low-energy-density (LED) plasma conditions reveals considerable variation; the effective rate coefficient may be dominated by the very low-energy behaviour rather than the maxwellian averaged...

Dance, Michael; Nahar, Sultana N; Pradhan, Anil K



Controlling the nonlinear intracavity dynamics of large He-Ne laser gyroscopes  

E-Print Network (OSTI)

A model based on Lamb's theory of gas lasers is applied to a He-Ne ring laser gyroscope in order to estimate and remove the laser dynamics contribution from the rotation measurements. The intensities of the counter-propagating laser beams exiting one cavity mirror are continuously observed together with a monitor of the laser population inversion. These observables, once properly calibrated with a dedicated procedure, allow us to estimate cold cavity and active medium parameters driving the main part of the nonlinearities of the system. The parameters identification and noise subtraction procedure has been verified by means of a Monte Carlo study of the system, and experimentally tested on the G-Pisa ring laser oriented with the normal to the ring plane almost parallel to the Earth rotation axis. In this configuration the Earth rotation-rate provides the maximum Sagnac effect while the contribution of the orientation error is reduced at minimum. After the subtraction of laser dynamics by a Kalman filter, the ...

Cuccato, Davide; Belfi, Jacopo; Beverini, Nicol; Ortolan, Antonello; Di Virgilio, Angela



A Measurement of the Neutrino Neutral Current Pi0 Cross Section at MiniBooNE  

SciTech Connect

The MiniBooNE neutrino beam and detector at Fermilab are used to study the production of neutral current {pi}{sup 0} events. The cross sections for neutrino interactions with mineral oil (CH{sub 2}) are reported for resonantly produced and coherently produced single {pi}{sup 0} events. We measure a resonant single {pi}{sup 0} cross section of {sigma}({nu}{sub {mu}} N {pi}{sup 0}) = (0.0129 {+-} 0.0011(stat.) {+-} 0.0043(syst.)) x 10{sup -36} cm{sup 2}/CH{sub 2} at a mean neutrino energy of 1.26 GeV. We measure a coherent single {pi}{sup 0} cross section of {sigma}({nu}{sub {mu}} A {yields} {nu}{sub {mu}} A {pi}{sup 0}) = (0.00077 {+-} 0.00016 (stat.) {+-} 0.00036 (syst.)) x 10{sup -36} cm{sup 2}/CH{sub 2} at mean neutrino energy 1.12 GeV.

Raaf, Jennifer Lynne; /Cincinnati U.



High Level Requirements for the Nuclear Energy -- Knowledge Base for Advanced Modeling and Simulation (NE-KAMS)  

Science Conference Proceedings (OSTI)

The US Department of Energy, Office of Nuclear Energy (DOE-NE), has been tasked with the important mission of ensuring that nuclear energy remains a compelling and viable energy source in the U.S. The motivations behind this mission include cost-effectively meeting the expected increases in the power needs of the country, reducing carbon emissions and reducing dependence on foreign energy sources. In the near term, to ensure that nuclear power remains a key element of U.S. energy strategy and portfolio, the DOE-NE will be working with the nuclear industry to support safe and efficient operations of existing nuclear power plants. In the long term, to meet the increasing energy needs of the U.S., the DOE-NE will be investing in research and development (R&D) and working in concert with the nuclear industry to build and deploy new, safer and more efficient nuclear power plants. The safe and efficient operations of existing nuclear power plants and designing, licensing and deploying new reactor designs, however, will require focused R&D programs as well as the extensive use and leveraging of advanced modeling and simulation (M&S). M&S will play a key role in ensuring safe and efficient operations of existing and new nuclear reactors. The DOE-NE has been actively developing and promoting the use of advanced M&S in reactor design and analysis through its R&D programs, e.g., the Nuclear Energy Advanced Modeling and Simulation (NEAMS) and Consortium for Advanced Simulation of Light Water Reactors (CASL) programs. Also, nuclear reactor vendors are already using CFD and CSM, for design, analysis, and licensing. However, these M&S tools cannot be used with confidence for nuclear reactor applications unless accompanied and supported by verification and validation (V&V) and uncertainty quantification (UQ) processes and procedures which provide quantitative measures of uncertainty for specific applications. The Nuclear Energy Knowledge base for Advanced Modeling and Simulation (NE-KAMS) is being developed at the Idaho National Laboratory in conjunction with Bettis Laboratory, Sandia National Laboratories, Argonne National Laboratory, Utah State University and others with the objective of establishing a comprehensive and web-accessible knowledge base that will provide technical services and resources for V&V and UQ of M&S in nuclear energy sciences and engineering. The knowledge base will serve as an important resource for technical exchange and collaboration that will enable credible and reliable computational models and simulations for application to nuclear reactor design, analysis and licensing. NE-KAMS will serve as a valuable resource for the nuclear industry, academia, the national laboratories, the U.S. Nuclear Regulatory Commission (NRC) and the public and will help ensure the safe, economical and reliable operation of existing and future nuclear reactors. From its inception, NE-KAMS will directly support nuclear energy research, development and demonstration programs within the U.S. Department of Energy (DOE), including the CASL, NEAMS, Light Water Reactor Sustainability (LWRS), Small Modular Reactors (SMR), and Next Generation Nuclear Power Plant (NGNP) programs. These programs all involve M&S of nuclear reactor systems, components and processes, and it is envisioned that NE-KAMS will help to coordinate and facilitate collaboration and sharing of resources and expertise for V&V and UQ across these programs.

Rich Johnson; Hyung Lee; Kimberlyn C. Mousseau



The Search for Meterorites with Complex Exposure Histories Amoung Ordinary Chondrites with Low 3HE/21NE Ratios  

DOE Green Energy (OSTI)

In calculating cosmic-ray exposure ages of meteorites it is generally assumed that the meteoroids were expelled from a shielded position within their parent body and then experienced a single stage exposure before colliding with Earth. The combination of noble gas and radionuclide measurements in several large meteorites, such as Jilin and Bur Ghelaui, have revealed complex exposure histories: i.e. an initial exposure on the surface of an asteroid (or within meter-sized meteoroid), followed by a second exposure as a smaller object. In fact, orbital dynamics calculations predicted that at least 30% of the meteorites arriving on Earth experienced two- or multiple-stage exposure histories [1]. More recently, after the recognition that the Yarkovsky effect plays an important role in delivering meteorites from the asteroid belt to Earth-crossing orbits, it was confirmed that complex exposure histories should be common [2]. Nevertheless, despite the ability to measure a wide range of radionuclides with accelerator mass spectrometry (AMS), only a few meteorites with complex exposure histories have been identified [e.g. 3,4]. The question is whether the relatively paucity of complex exposure histories is real or have we simply overlooked complex-exposure histories. In this work we focus on meteorites with low {sup 3}He/{sup 21}Ne ratios, since it is known that most meteorites with complex exposure histories have relatively low {sup 3}He/{sup 21}Ne ratios, i.e. the {sup 3}He/{sup 21}Ne ratio is below the ''Bern-line''. Several hypotheses have been suggested for these low {sup 3}He/{sup 21}Ne ratios, including solar heating in low-perihelion orbits, shock-related diffusion of He during the collision that ejected the meteoroid, or an artifact of high shielding conditions [4]. The first two hypotheses seem to be supported by low radiogenic {sup 4}He concentrations in samples with low {sup 3}He, whereas Monte Carlo calculations have shown that some of the low {sup 3}He/{sup 21}Ne ratios may be due to high shielding conditions in objects with radii > 1m [5]. To elucidate these issues, we selected 15 samples with known noble gas concentrations [6] for radionuclide studies and obtained aliquots of the samples adjacent to those measured for noble gases. The specific goal is the identification of complex exposure histories among samples having low {sup 3}He/{sup 21}Ne ratios. All samples have {sup 3}He deficiencies of >20% relative to the ''Bern-line'' (Table 1). Most of the selected samples also have low {sup 22}Ne/{sup 21}Ne ratios ({le}1.1), indicative of high shielding during most of their cosmic-ray exposure (Table 1), whereas one sample (Suizhou) was selected because of its relatively low {sup 81}Kr concentration [7]. In addition, we selected QUE 93021, for which initial radionuclide results suggested a short exposure age. Here we present cosmogenic {sup 10}Be, {sup 26}Al and {sup 36}Cl in stone and metal fractions for the 16 ordinary chondrites listed in Table 1.

Welton, K C; Nishiizumi, K; Caffee, M W



Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



A measurement of the neutral current neutrino-nucleon elastic cross section at MiniBooNE  

SciTech Connect

The neutral current neutrino-nucleon elastic interaction {nu} N {yields} {nu} N is a fundamental process of the weak interaction ideally suited for characterizing the structure of the nucleon neutral weak current. This process comprises {approx}18% of neutrino events in the neutrino oscillation experiment, MiniBooNE, ranking it as the experiment's third largest process. Using {approx}10% of MiniBooNE's available neutrino data, a sample of these events were identified and analyzed to determine the differential cross section as a function of the momentum transfer of the interaction, Q{sup 2}. This is the first measurement of a differential cross section with MiniBooNE data. From this analysis, a value for the nucleon axial mass M{sub A} was extracted to be 1.34 {+-} 0.25 GeV consistent with previous measurements. The integrated cross section for the Q{sup 2} range 0.189 {yields} 1.13 GeV{sup 2} was calculated to be (8.8 {+-} 0.6(stat) {+-} 0.2(syst)) x 10{sup -40} cm{sup 2}.

Cox, David Christopher; /Indiana U.



Related Links | Building Energy Codes Program  

NLE Websites -- All DOE Office Websites (Extended Search)

Related Links Related Links Regional Energy Efficiency Organizations MEEA NEEP NEEA SEEA SWEEP SPEER Midwest Energy Efficiency Alliance (MEEA) IL, IN, IA, KS, KY, ND, NE, MI, MN, MO, OH, SD, WI The Midwest Energy Efficiency Alliance (MEEA) is a collaborative network advancing energy efficiency in the Midwest to support sustainable economic development and environmental preservation. MEEA raises awareness, facilitates energy efficiency programs and strengthens policy across the nine-state region. MEEA brings together a respected network of members, partners, board and staff, and inspires others to create new technologies, new products and new ways of thinking when it comes to energy efficiency. Codes Contact Isaac Elnecave Senior Policy Manager ielnecave@mwalliance.org phone: (312)784-7253


Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects


Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012


Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Determination of the {sup 22}Ne{sub nucl}/{sup 4}He{sub rad} ratio in natural uranium-rich fluorite by mass spectrometry  

Science Conference Proceedings (OSTI)

A determination by noble gas mass spectrometry of {sup 22}Ne production through the combined reactions {sup 19}F({alpha},n){sup 22}Na({beta}{sup +}){sup 22}Ne and {sup 19}F({alpha},p){sup 22}Ne on natural calcium fluoride is made for the first time. Six samples of U-rich fluorite from a fluorspar deposit in Mexico were used to determine the {sup 22}Ne{sub nucl}/{sup 4}He{sub rad} ratio generated by the spontaneous decay of U during the last 32 Ma. The obtained ratio (1.33 {+-} 0.11) x10{sup -5} (95% confidence), is compared to other experimental data on natural uranium oxides and theoretical values.

Sole, Jesus; Pi, Teresa [Instituto de Geologia, Universidad Nacional Autonoma de Mexico, Cd. Universitaria, Coyoacan, 04510 Mexico D.F. (Mexico)



Figure 11. Shale gas proved reserves by selected states, wet after ...  

U.S. Energy Information Administration (EIA)

Figure 11 Shale_History_Summary state Alabama AL Arkansas AR CA Colorado CO Kentucky KY Louisiana LA Michigan MI Montana MT North Dakota ND NM Oklahoma OK Pennsylvania


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


Measurement of the reaction O-17(?,n)Ne-20 and its impact on the s process in massive stars  

E-Print Network (OSTI)

The ratio between the rates of the reactions O-17(\\alpha,n)Ne-20 and O-17(\\alpha,\\gamma)Ne-21 determines whether O-16 is an efficient neutron poison for the s process in massive stars, or if most of the neutrons captured by O-16(n,\\gamma) are recycled into the stellar environment. This ratio is of particular relevance to constrain the s process yields of fast rotating massive stars at low metallicity. Recent results on the (\\alpha,\\gamma) channel have made it necessary to measure the (\\alpha,n) reaction more precisely and investigate the effect of the new data on s process nucleosynthesis in massive stars. We present a new measurement of the O-17(\\alpha, n) reaction using a moderating neutron detector. In addition, the (\\alpha, n_1) channel has been measured independently by observation of the characteristic 1633 keV \\gamma-transition in Ne-20. The reaction cross section was determined with a simultaneous R-matrix fit to both channels. (\\alpha,n) and (\\alpha, \\gamma) resonance strengths of states lying below the covered energy range were estimated using their known properties from the literature. A new O-17(\\alpha,n) reaction rate was deduced for the temperature range 0.1 GK to 10 GK. It was found that in He burning conditions the (\\alpha,\\gamma) channel is strong enough to compete with the neutron channel. This leads to a less efficient neutron recycling compared to a previous suggestion of a very weak (\\alpha,\\gamma) channel. S process calculations using our rates confirm that massive rotating stars do play a significant role in the production of elements up to Sr, but they strongly reduce the s process contribution to heavier elements.

A. Best; M. Beard; J. Grres; M. Couder; R. deBoer; S. Falahat; R. T. Gray; A. Kontos; K. -L. Kratz; P. J. LeBlanc; Q. Li; S. O'Brien; N. zkan; M. Pignatari; K. Sonnabend; R. Talwar; W. Tan; E. Uberseder; M. Wiescher



Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:


Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Measuring the speed of light using beating longitudinal modes in an open-cavity HeNe laser  

E-Print Network (OSTI)

We describe an undergraduate laboratory that combines an accurate measurement of the speed of light, a fundamental investigation of a basic laser system, and a nontrivial use of statistical analysis. Students grapple with the existence of longitudinal modes in a laser cavity as they change the cavity length of an adjustable-cavity HeNe laser and tune the cavity to produce lasing in the TEM$_{00}$ mode. For appropriate laser cavity lengths, the laser gain curve of a HeNe laser allows simultaneous operation of multiple longitudinal modes. The difference frequency between the modes is measured using a self-heterodyne detection with a diode photodetector and a radio frequency spectrum analyzer. Asymmetric effects due to frequency pushing and frequency pulling, as well as transverse modes, are minimized by simultaneously monitoring and adjusting the mode structure as viewed with a Fabry-Perot interferometer. The frequency spacing of longitudinal modes is proportional to the inverse of the cavity length with a prop...

D'Orazio, Daniel J; Schultz, Justin T; Sidor, Daniel; Best, Micheal; Goodfellow, Kenneth; Scholten, Robert E; White, James D; 10.1119/1.3299281



A Measurement of the muon neutrino charged current quasielastic interaction and a test of Lorentz violation with the MiniBooNE experiment  

SciTech Connect

The Mini-Booster neutrino experiment (MiniBooNE) at Fermi National Accelerator Laboratory (Fermilab) is designed to search for {nu}{sub {mu}} {yields} {nu}{sub e} appearance neutrino oscillations. Muon neutrino charged-current quasi-elastic (CCQE) interactions ({nu}{sub {mu}} + n {yields} {mu} + p) make up roughly 40% of our data sample, and it is used to constrain the background and cross sections for the oscillation analysis. Using high-statistics MiniBooNE CCQE data, the muon-neutrino CCQE cross section is measured. The nuclear model is tuned precisely using the MiniBooNE data. The measured total cross section is {sigma} = (1.058 {+-} 0.003 (stat) {+-} 0.111 (syst)) x 10{sup -38} cm{sup 2} at the MiniBooNE muon neutrino beam energy (700-800 MeV). {nu}{sub e} appearance candidate data is also used to search for Lorentz violation. Lorentz symmetry is one of the most fundamental symmetries in modern physics. Neutrino oscillations offer a new method to test it. We found that the MiniBooNE result is not well-described using Lorentz violation, however further investigation is required for a more conclusive result.

Katori, Teppei; /Indiana U.



The Uncertainties in the 22Ne + alpha-capture Reaction Rates and the Production of the Heavy Magnesium Isotopes in Asymptotic Giant Branch Stars of Intermediate Mass  

E-Print Network (OSTI)

We present new rates for the 22Ne(alpha, n)25Mg and 22Ne(alpha,gamma)26Mg reactions, with uncertainties that have been considerably reduced compared to previous estimates, and we study how these new rates affect the production of the heavy magnesium isotopes in models of intermediate mass Asymptotic Giant Branch (AGB) stars of different initial compositions. All the models have deep third dredge-up, hot bottom burning and mass loss. Calculations have been performed using the two most commonly used estimates of the 22Ne + alpha rates as well as the new recommended rates, and with combinations of their upper and lower limits. The main result of the present study is that with the new rates, uncertainties on the production of isotopes from Mg to P coming from the 22Ne + alpha-capture rates have been considerably reduced. We have therefore removed one of the important sources of uncertainty to effect models of AGB stars. We have studied the effects of varying the mass-loss rate on nucleosynthesis and discuss other uncertainties related to the physics employed in the computation of stellar structure, such as the modeling of convection, the inclusion of a partial mixing zone and the definition of convective borders. These uncertainties are found to be much larger than those coming from 22Ne + alpha-capture rates, when using our new estimates. Much effort is needed to improve the situation for AGB models.

A. Karakas; M. Lugaro; M. Wiescher; J. Goerres; C. Ugalde



DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256


Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Direct Total Cross Section Measurement of the 16O(?,?)20Ne Reaction at Ec.m. = 2.26 MeV  

Science Conference Proceedings (OSTI)

In stellar helium burning, (16)O represents the endpoint of the helium-burning sequence due to the low rate of (16)O(alpha,gamma)(20)Ne. We present a new direct measurement of the total capture reaction rate of (16)O(alpha,gamma)(20)Ne at E(c.m.) = 2.26MeV employing the DRAGON recoil separator. For the first time, the total S factor and its contributing direct capture transitions could be determined in one experiment.

Hager, Ulrike; Brown, James R.; Buchmann, Lothar R.; Carmona-Gallardo, Mariano; Erikson, Luke E.; Fallis, Jennifer S.; Greife, Uwe; Hutcheon, Dave; Ottewell, Dave; Ruiz, Chris; Sjue, Sky; Vockenhuber, Cristof



AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP


1995-2011 | LS-LAMP IMPACT REPORT uniVersity of neW orLeAns | new orleans, la  

E-Print Network (OSTI)

.S., mathematics, michigan State University, East Lansing, mI m.S., Statistical Science, Baylor University, waco was the second place winner of the 2010 Joint statistical meetings (Jsm) stat Bowl. she was also named oustanding Graduate stu- dent (2010) by Baylor university's Department of statistical sciences. she has also

Kulp, Mark


Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



REP&V TO ATTNJF: NE-23 SUWECC Commercial Facilities Used by National Lead Company of Ohio in Support  

Office of Legacy Management (LM)

REP&V TO REP&V TO ATTNJF: NE-23 SUWECC Commercial Facilities Used by National Lead Company of Ohio in Support 'of FMPC Operations TO: Robert E. Lynch Procuresnent and CorXracts Division, AD-42 Oak Ridge Operations Office The Division of Facility and Site Decormnissioning Projects (DFSP) is responsible for managing the Department's Formerly Utilized Sites Remedial Action Program (FUSRAP). The purposes of FUSRAP are (1) to identify facilities formerly operated for or by the Manhattan Engineer District (NED) and Atomic Energy Commission (AEC) which may have been radioactively contaminated as a result of these operations, (2) to determine if the facilities require remedial action, and (3) where DOE has authority, to conduct the remedial action. Authority for remedial action under FUSRAP is


REP&V TO ATTNOF: NE-23 SUBJECT: Commercial Facilities Used by National Lead Company of Ohio in Support  

Office of Legacy Management (LM)

x:Y" x:Y" . .' 3023 I\ \ 'a' '. Unita? -&&s Coverament , ,Q,.l. ),&, ,(>.. Department of Energy riGmorandum / d6a 2/. $3 DATE: JL(L 2 8 ;;$5 co. /3 .-J/ co,/3 REP&V TO ATTNOF: NE-23 SUBJECT: Commercial Facilities Used by National Lead Company of Ohio in Support of FMPC Operations TO: Robert E. Lynch Procuremnent and Contracts Division, AD-42 Oak Ridge Operations Office The Division of Facility and Site Decommissioning Projects (DFSD) is responsible for managing the Department's Formerly Utilized Sites Remedial Action Program (FuSRAP). The purposes of FUSRAP are (1) to identify facilities formerly operated for or by the Manhattan Engineer District (NED) and Atomic Energy Commission (AEC) which may have been radioactively contaminated as a result of these operations, (2) to determine if the



Office of Legacy Management (LM)

COFibE, Series A. COFibE, Series A. - U. S. ATOXIC ENERGY CCMMISSION r'C Cj NE# YORK OPERATIONS OFFICE HEkLTH AND SAFETY DIVISION (Merril Eicsnbud, Dirsator) MONTHLY REPORT OF FIELD ACTIVITIES (This report%v,rs%~~~nth period) Indusorial Ii~iene Branoh m a . . 0 . . c . . . o W. B. Harris, Chief Radiation Branch . y y e 0e . e . e . . . . e . . . Hanson Blatz, Chief Fi:e and Accident Branch D e a o o . . . ..s . . B. J. Kehoe, Chief Medical Advioer, Dr. J. A. Quiglsy Siometrician, Dr. A. E. Brandt TABLF OF COEpTmS PRODUCTION COWTRACTORS ._ Feed Nabrlals Production Centor '$iiddlcsexSampling Plnnt Harshaw ChuoicalCompa~ Wlin&rodt Chen!icrl Works tie. Ontario Storage Area b Vit*o Mnufacturing CompaW B4ikhem Steel F'lrnt - IpcknuMnr Clifton Roducts CompvIy Drush Bcx@.Uun~ Company - Luckcy

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Using the X-FEL to photo-pump X-ray laser transitions in He-like Ne  

SciTech Connect

Nearly four decades ago H-like and He-like resonantly photo-pumped laser schemes were proposed for producing X-ray lasers. However, demonstrating these schemes in the laboratory has proved to be elusive because of the difficulty of finding a strong resonant pump line. With the advent of the X-ray free electron laser (X-FEL) at the SLAC Linac Coherent Light Source (LCLS) we now have a tunable X-ray laser source that can be used to replace the pump line in previously proposed laser schemes and allow researchers to study the physics and feasibility of resonantly photo-pumped laser schemes. In this paper we use the X-FEL at 1174 eV to photo-pump the singly excited 1s2p state of He-like Ne to the doubly excited 2p3p state and model gain on the 2p3p-2p2s transition at 175 eV and the 2p3p-1s3p transition at 1017 eV. One motivation for studying this scheme is to explore possible quenching of the gain due to strong non-linear coupling effects from the intense X-FEL beam We compare this scheme with photo-pumping the He-like Ne ground state to the 1s3p singly excited state followed by lasing on the 3p-2s and 3d-2p transitions at 158 and 151 eV. Experiments are being planned at LCLS to study these laser processes and coherent quantum effects.

Nilsen, J; Rohringer, N



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.




Science Conference Proceedings (OSTI)

Read and Stevens has proposed the evaluation of the waterflood potential from the Cherry Canyon formation in the NE Lea Field in lea County, New Mexico. Much of the development in this area is approaching primary recovery limitations; additional recovery of remaining oil reserves by waterflood needs to be evaluated. The Cherry Canyon formation is composed of fine grained sandstone, containing clay material which results in high water saturation, and also has the tendency to swell and reduce reservoir permeability--the ability of fluid to flow through the rock pores and fractures. There are also abundant organic materials that interfere with obtaining reliable well logs. These complications have limited oil in place calculations and identification of net pay zones, presenting a challenge to the planned waterflood. Core analysis of the Cherry Canyon should improve the understanding of existing well logs and possibly indicate secondary recovery measures, such as waterflood, to enhance field recovery. Lacking truly representative core to provide accurate analyses, Read and Stevens will obtain and preserve fresh core. The consulting firm of T. Scott Hickman and Associates will then collaborate on special core analyses and obtain additional well logs for a more detailed analysis of reservoir properties. The log interpretation will be compared to the core analysis results, and the entire collected data set will be used to assess the potential and economic viability of successfully waterflooding the identified oil zones. Successful results from the project will improve accuracy of log interpretation and establish a methodology for evaluating secondary recovery by waterflood.

T. Scott Hickman



Measurements of nuclear $\\gamma$-ray line emission in interactions of protons and $\\alpha$ particles with N, O, Ne and Si  

E-Print Network (OSTI)

$\\gamma$-ray production cross sections have been measured in proton irradiations of N, Ne and Si and $\\alpha$-particle irradiations of N and Ne. In the same experiment we extracted also line shapes for strong $\\gamma$-ray lines of $^{16}$O produced in proton and $\\alpha$-particle irradiations of O. For the measurements gas targets were used for N, O and Ne and a thick foil was used for Si. All targets were of natural isotopic composition. Beams in the energy range up to 26 MeV for protons and 39 MeV for $\\alpha$-particles have been delivered by the IPN-Orsay tandem accelerator. The $\\gamma$ rays have been detected with four HP-Ge detectors in the angular range 30$^{\\circ}$ to 135$^{\\circ}$. We extracted 36 cross section excitation functions for proton reactions and 14 for $\\alpha$-particle reactions. For the majority of the excitation functions no other data exist to our knowledge. Where comparison with existing data was possible usually a very good agreement was found. It is shown that these data are very in...

Benhabiles-Mezhoud, H; Thibaud, J -P; Tatischeff, V; Deloncle, I; Coc, A; Duprat, J; Hamadache, C; Lefebvre-Schuhl, A; Dalouzy, J -C; De Grancey, F; De Oliveira, F; Dayras, F; De Srville, N; Pellegriti, M -G; Lamia, L; Ouichaoui, S




SciTech Connect

We present a Monte Carlo calculation of the astrophysical rate of the {sup 15}O({alpha}, {gamma}){sup 19}Ne reaction based on an evaluation of published experimental data. By considering the likelihood distributions of individual resonance parameters derived from measurements, estimates of upper and lower limits on the reaction rate at the 99.73% confidence level are derived in addition to the recommended, median value. These three reaction rates are used as input for three separate calculations of Type I X-ray bursts (XRBs) using spherically symmetric, hydrodynamic simulations of an accreting neutron star. In this way the influence of the {sup 15}O({alpha}, {gamma}){sup 19}Ne reaction rate on the peak luminosity, recurrence time, and associated nucleosynthesis in models of Type I XRBs is studied. Contrary to previous findings, no substantial effect on any of these quantities is observed in a sequence of four bursts when varying the reaction rate between its lower and upper limits. Rather, the differences in these quantities are comparable to the burst-to-burst variations with a fixed reaction rate, indicating that uncertainties in the {sup 15}O({alpha}, {gamma}){sup 19}Ne reaction rate do not strongly affect the predictions of this Type I XRB model.

Davids, Barry [TRIUMF, Vancouver, BC V6T 2A3 (Canada); Cyburt, Richard H. [Joint Institute for Nuclear Astrophysics and National Superconducting Cyclotron Laboratory, Michigan State University, East Lansing, MI (United States); Jose, Jordi [Departament de Fisica i Enginyeria Nuclear, Universitat Politecnica de Catalunya and Institut d'Estudis Espacials de Catalunya, Barcelona (Spain); Mythili, Subramanian [Physics Department, George Mason University, Fairfax, VA (United States)



Measurement of Neutrino-Nucleon Neutral-Current Elastic Scattering Cross-section at SciBooNE  

SciTech Connect

In this thesis, results of neutrino-nucleon neutral current (NC) elastic scattering analysis are presented. Neutrinos interact with other particles only with weak force. Measurement of cross-section for neutrino-nucleon reactions at various neutrino energy are important for the study of nucleon structure. It also provides data to be used for beam flux monitor in neutrino oscillation experiments. The cross-section for neutrino-nucleon NC elastic scattering contains the axial vector form factor G{sub A}(Q{sup 2}) as well as electromagnetic form factors unlike electromagnetic interaction. G{sub A} is propotional to strange part of nucleon spin ({Delta}s) in Q{sup 2} {yields} 0 limit. Measurement of NC elastic cross-section with smaller Q{sup 2} enables us to access {Delta}s. NC elastic cross-sections of neutrino-nucleon and antineutrino-nucleon were measured earlier by E734 experiment at Brookheaven National Laboratory (BNL) in 1987. In this experiment, cross-sections were measured in Q{sup 2} > 0.4 GeV{sup 2} region. Result from this experiment was the only published data for NC elastic scattering cross-section published before our experiment. SciBooNE is an experiment for the measurement of neutrino-nucleon scattering cross-secitons using Booster Neutrino Beam (BNB) at FNAL. BNB has energy peak at 0.7 GeV. In this energy region, NC elastic scattering, charged current elastic scattering, charged current pion production, and neutral current pion production are the major reaction branches. SciBar, electromagnetic calorimeter, and Muon Range Detector are the detectors for SciBooNE. The SciBar consists of finely segmented scintillators and 14336 channels of PMTs. It has a capability to reconstruct particle track longer than 8 cm and separate proton from muons and pions using energy deposit information. Signal of NC elastic scattering is a single proton track. In {nu}p {yields} {nu}p process, the recoil proton is detected. On the other hand, most of {nu}n {yields} {nu}n is invisible because there are only neutral particles in final state, but sometimes recoil neutron is scattered by proton and recoil proton is detected. Signal of this event is also single proton track. Event selection for the single proton track events using geometrical and dE/dx information of reconstructed track is performed. After the event selection, NC elastic scattering data sample is obtained. They includes {nu}p {yields} {nu}p and {nu}n {yields} {nu}n is obtained. Absolute cross-section as a function of Q{sup 2} is evaluated from this NC elastic scattering data sample.

Takei, Hideyuki; /Tokyo Inst. Tech.




Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana



Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming


NE Press Releases  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

press-releases 1000 Independence Ave. SWWashington DC press-releases 1000 Independence Ave. SWWashington DC 20585202-586-5000 en Energy Department Announces New Investment in Innovative Small Modular Reactor http://energy.gov/articles/energy-department-announces-new-investment-innovative-small-modular-reactor Energy Department Announces New Investment in Innovative Small Modular Reactor


NE photo galleries  

NLE Websites -- All DOE Office Websites (Extended Search)

Analysis (11) Programs: Advanced Fuel Cycle Initiative (6) Engineering and Structural Mechanics (3) Heat Transfer and Fluid Mechanics (6) Risk Methodology and Evaluation (2)...


Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan



A survey of Existing V&V, UQ and M&S Data and Knowledge Bases in Support of the Nuclear Energy - Knowledge base for Advanced Modeling and Simulation (NE-KAMS)  

SciTech Connect

The Nuclear Energy - Knowledge base for Advanced Modeling and Simulation (NE-KAMS) is being developed at the Idaho National Laboratory in conjunction with Bettis Laboratory, Sandia National Laboratories, Argonne National Laboratory, Oak Ridge National Laboratory, Utah State University and others. The objective of this consortium is to establish a comprehensive knowledge base to provide Verification and Validation (V&V) and Uncertainty Quantification (UQ) and other resources for advanced modeling and simulation (M&S) in nuclear reactor design and analysis. NE-KAMS will become a valuable resource for the nuclear industry, the national laboratories, the U.S. NRC and the public to help ensure the safe operation of existing and future nuclear reactors. A survey and evaluation of the state-of-the-art of existing V&V and M&S databases, including the Department of Energy and commercial databases, has been performed to ensure that the NE-KAMS effort will not be duplicating existing resources and capabilities and to assess the scope of the effort required to develop and implement NE-KAMS. The survey and evaluation have indeed highlighted the unique set of value-added functionality and services that NE-KAMS will provide to its users. Additionally, the survey has helped develop a better understanding of the architecture and functionality of these data and knowledge bases that can be used to leverage the development of NE-KAMS.

Hyung Lee; Rich Johnson, Ph.D.; Kimberlyn C. Moussesau




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Research Needs for Magnetic Fusion Energy Sciences. Report of the Research Needs Workshop (ReNeW) Bethesda, Maryland, June 8-12, 2009  

SciTech Connect

Nuclear fusion - the process that powers the sun - offers an environmentally benign, intrinsically safe energy source with an abundant supply of low-cost fuel. It is the focus of an international research program, including the ITE R fusion collaboration, which involves seven parties representing half the world's population. The realization of fusion power would change the economics and ecology of energy production as profoundly as petroleum exploitation did two centuries ago. The 21st century finds fusion research in a transformed landscape. The worldwide fusion community broadly agrees that the science has advanced to the point where an aggressive action plan, aimed at the remaining barriers to practical fusion energy, is warranted. At the same time, and largely because of its scientific advance, the program faces new challenges; above all it is challenged to demonstrate the timeliness of its promised benefits. In response to this changed landscape, the Office of Fusion Energy Sciences (OFES ) in the US Department of Energy commissioned a number of community-based studies of the key scientific and technical foci of magnetic fusion research. The Research Needs Workshop (ReNeW) for Magnetic Fusion Energy Sciences is a capstone to these studies. In the context of magnetic fusion energy, ReNeW surveyed the issues identified in previous studies, and used them as a starting point to define and characterize the research activities that the advance of fusion as a practical energy source will require. Thus, ReNeW's task was to identify (1) the scientific and technological research frontiers of the fusion program, and, especially, (2) a set of activities that will most effectively advance those frontiers. (Note that ReNeW was not charged with developing a strategic plan or timeline for the implementation of fusion power.) This Report presents a portfolio of research activities for US research in magnetic fusion for the next two decades. It is intended to provide a strategic framework for realizing practical fusion energy. The portfolio is the product of ten months of fusion-community study and discussion, culminating in a Workshop held in Bethesda, Maryland, from June 8 to June 12, 2009. The Workshop involved some 200 scientists from Universities, National Laboratories and private industry, including several scientists from outside the US. Largely following the Basic Research Needs model established by the Office of Basic Energy Sciences (BES ), the Report presents a collection of discrete research activities, here called 'thrusts.' Each thrust is based on an explicitly identified question, or coherent set of questions, on the frontier of fusion science. It presents a strategy to find the needed answers, combining the necessary intellectual and hardware tools, experimental facilities, and computational resources into an integrated, focused program. The thrusts should be viewed as building blocks for a fusion program plan whose overall structure will be developed by OFES , using whatever additional community input it requests. Part I of the Report reviews the issues identified in previous fusion-community studies, which systematically identified the key research issues and described them in considerable detail. It then considers in some detail the scientific and technical means that can be used to address these is sues. It ends by showing how these various research requirements are organized into a set of eighteen thrusts. Part II presents a detailed and self-contained discussion of each thrust, including the goals, required facilities and tools for each. This Executive Summary focuses on a survey of the ReNeW thrusts. The following brief review of fusion science is intended to provide context for that survey. A more detailed discussion of fusion science can be found in an Appendix to this Summary, entitled 'A Fusion Primer.'




Research Needs for Magnetic Fusion Energy Sciences. Report of the Research Needs Workshop (ReNeW) Bethesda, Maryland, June 8-12, 2009  

SciTech Connect

Nuclear fusion - the process that powers the sun - offers an environmentally benign, intrinsically safe energy source with an abundant supply of low-cost fuel. It is the focus of an international research program, including the ITE R fusion collaboration, which involves seven parties representing half the world's population. The realization of fusion power would change the economics and ecology of energy production as profoundly as petroleum exploitation did two centuries ago. The 21st century finds fusion research in a transformed landscape. The worldwide fusion community broadly agrees that the science has advanced to the point where an aggressive action plan, aimed at the remaining barriers to practical fusion energy, is warranted. At the same time, and largely because of its scientific advance, the program faces new challenges; above all it is challenged to demonstrate the timeliness of its promised benefits. In response to this changed landscape, the Office of Fusion Energy Sciences (OFES ) in the US Department of Energy commissioned a number of community-based studies of the key scientific and technical foci of magnetic fusion research. The Research Needs Workshop (ReNeW) for Magnetic Fusion Energy Sciences is a capstone to these studies. In the context of magnetic fusion energy, ReNeW surveyed the issues identified in previous studies, and used them as a starting point to define and characterize the research activities that the advance of fusion as a practical energy source will require. Thus, ReNeW's task was to identify (1) the scientific and technological research frontiers of the fusion program, and, especially, (2) a set of activities that will most effectively advance those frontiers. (Note that ReNeW was not charged with developing a strategic plan or timeline for the implementation of fusion power.) This Report presents a portfolio of research activities for US research in magnetic fusion for the next two decades. It is intended to provide a strategic framework for realizing practical fusion energy. The portfolio is the product of ten months of fusion-community study and discussion, culminating in a Workshop held in Bethesda, Maryland, from June 8 to June 12, 2009. The Workshop involved some 200 scientists from Universities, National Laboratories and private industry, including several scientists from outside the US. Largely following the Basic Research Needs model established by the Office of Basic Energy Sciences (BES ), the Report presents a collection of discrete research activities, here called 'thrusts.' Each thrust is based on an explicitly identified question, or coherent set of questions, on the frontier of fusion science. It presents a strategy to find the needed answers, combining the necessary intellectual and hardware tools, experimental facilities, and computational resources into an integrated, focused program. The thrusts should be viewed as building blocks for a fusion program plan whose overall structure will be developed by OFES , using whatever additional community input it requests. Part I of the Report reviews the issues identified in previous fusion-community studies, which systematically identified the key research issues and described them in considerable detail. It then considers in some detail the scientific and technical means that can be used to address these is sues. It ends by showing how these various research requirements are organized into a set of eighteen thrusts. Part II presents a detailed and self-contained discussion of each thrust, including the goals, required facilities and tools for each. This Executive Summary focuses on a survey of the ReNeW thrusts. The following brief review of fusion science is intended to provide context for that survey. A more detailed discussion of fusion science can be found in an Appendix to this Summary, entitled 'A Fusion Primer.'



Direct total cross section measurement of the {sup 16}O({alpha}, {gamma}){sup 20}Ne reaction at E{sub c.m.}=2.26 MeV  

Science Conference Proceedings (OSTI)

In stellar helium burning, {sup 16}O represents the endpoint of the helium-burning sequence due to the low rate of {sup 16}O({alpha},{gamma}){sup 20}Ne. We present a new direct measurement of the total capture reaction rate of {sup 16}O({alpha},{gamma}){sup 20}Ne at E{sub c.m.}=2.26 MeV employing the DRAGON recoil separator. For the first time, the total S factor and its contributing direct capture transitions could be determined in one experiment.

Hager, U.; Greife, U. [Colorado School of Mines, Golden, Colorado (United States); Brown, J. R. [Department of Physics, University of York, York, YO10 5DD (United Kingdom); Buchmann, L.; Fallis, J.; Hutcheon, D.; Ottewell, D.; Ruiz, C.; Sjue, S. [TRIUMF, Vancouver, Canada V6T 2A3 (Canada); Carmona-Gallardo, M. [Instituto de Estructura de la Materia, CSIC E-28006 Madrid (Spain); Erikson, L. [Pacific Northwest National Laboratory, Richland, WA (United States); Vockenhuber, C. [ETH Zurich, Zurich (Switzerland)



REP&" TO A~NOF: NE-23 SUBJECT: Commercial Facilities Used by National Lead Company of Ohio iin Support  

Office of Legacy Management (LM)

tifr'itG!'l' &i&s Coverament tifr'itG!'l' &i&s Coverament --_ , ,&,.i +.&r, ,' ,T.L ' Department of Energy / REP&" TO A~NOF: NE-23 SUBJECT: Commercial Facilities Used by National Lead Company of Ohio iin Support of FMPC Operations TO: Robert E. Lynch Procuremnent and Contracts Division, AD-42 Oak Ridge Operations Office , / I I The Division of Facility and Site Oecomnissioning Projects (OF%) is responsible for managing the Department's Formerly Utilized Sites Remedial Action Program (FUSRAP). The purposes of FUSRAP are (1) to identify facilities formerly operated for or by the Manhattan Engineer District (WED) and Atomic Energy Commission (AEC) which may have been'radioactively contaminated as a result of these operations, (5) to determine if the

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Clouds, Aerosols and Precipitation in the Marine Boundary Layer (CAP-MBL) AMF Deployment Graciosa Island, Azores, NE Atlantic Ocean May 2009-December 2010  

NLE Websites -- All DOE Office Websites (Extended Search)

the Marine Boundary Layer (CAP-MBL) Graciosa Island, Azores, NE Atlantic Ocean May 2009-December 2010 Rob Wood, University of Washington CAP-MBL Proposal Team AMF Deployment Team Thanks to Mark Miller: AMF Site Scientist Kim Nitschke: AMF Site Manager Importance of Low-Clouds for Climate Imperative that we understand the processes controlling the formation, maintenance and dissipation of low clouds in order to improve their representation in climate models. Which clouds matter for climate sensitivity? Climate Feedbacks Model Intercomparison Project (CFMIP) 12 slab ocean models 2xCO 2 - control Correlation of global mean CRF with local values Mark Webb, Hadley Center 90 N 45 N 0 45 S 90S 0 90 E 180 90 W 0


Idaho National Laboratory Ten-year Site Plan (2012 through 2021) -- DOE-NE's National Nuclear Capability -- Developing and Maintaining the INL Infrastructure  

Science Conference Proceedings (OSTI)

To meet long-term objectives to transform the Idaho National Laboratory (INL), we are providing an integrated, long-term vision of infrastructure requirements that support research, development and demonstration (RD&D) goals outlined in the DOE strategic plans, including the NE Roadmap and reports such as Facilities for the Future of Nuclear Energy Research: A Twenty-year Outlook. The goal of the INL Ten-year Site Plan (TYSP) is to clearly link RD&D mission goals and INL core capabilities with infrastructure requirements (single and multi-program), establish the 10-year end-state vision for INL complexes, identify and prioritize infrastructure and capability gaps, as well as the most efficient and economic approaches to closing those gaps.

Cal Ozaki



Enhanced T-lymphocyte blastogenic response to tuberculin (PPD) in children of northeast (NE) Thailand supplemented with vitamin A (VA) and zinc (Zn)  

SciTech Connect

Beneficial effects of Va and/or Zn supplementation of children in NE Thailand are described in a companion abstract. In the same study, blastogenic response (BR) of T-lymphocytes to concanavalin-A (ConA) and PPD were assayed in cultures containing mononuclear cells (MNC) or whole blood (WB). Methods were previously described. Children were previously vaccinated with BCG. BR to ConA of MNC or WB from children supplemented with VA, Zn, VA + Zn or placebo were similar. BR to PPD of MNC was higher in children receiving VA + Zn than placebo, but not in children supplemented with VA or Zn alone. Data indicate that children with suboptimal VA and Zn nutriture supplemented with < 2 times RDA of these nutrients showed enhanced cellular immunity to PPD. This observation is relevant to BCG immunization program and thus may benefit public health.

Kramer, T.R.; Udomkesmalee, E.; Dhanamitta, S.; Sirisinha, S.; Charoenkiatkul, S.; Tantipopipat, S.; Banjong, O.; Rojroongwasinkul, N.; Smith, J.C. Jr. (Dept. of Agriculture, Beltsville, MD (United States) Mahidol Univ., Nakhon Pathom (Thailand))



Ne{sup +} ion sputtering effect on amorphous Ga-In-Zn-O thin-film surface investigated by high-resolution XPS  

Science Conference Proceedings (OSTI)

The effect of Ne{sup +} ion sputtering on amorphous Ga-In-Zn-O (a-GIZO) thin films was investigated by using surface-sensitive, synchrotron-radiation-based, high-resolution X-ray photoelectron spectroscopy (XPS). a-GIZO thin films having different compositions (Ga{sub 2}O{sub 3}:In{sub 2}O{sub 3}:ZnO = 1:1:1, 2:2:1, 3:2:1, 4:2:1) were investigated. It was found out that the amounts of the In and Zn contents relative to that of Ga decreased noticeably after sufficient sputtering, and that there occurred a subgap state above the valence band maximum and metallic states at the In 3d and 4d core levels as well as at the Fermi edge.

Kang, Se-Jun; Lee, Mi Ji [Department of Physics, POSTECH, Pohang 790-784 (Korea, Republic of); Baik, Jae Yoon; Kim, Hyeong-Do; Thakur, Anup [Pohang Accelerator Laboratory, POSTECH, Pohang 790-784 (Korea, Republic of); Shin, Hyun-Joon [Department of Physics, POSTECH, Pohang 790-784 (Korea, Republic of); Pohang Accelerator Laboratory, POSTECH, Pohang 790-784 (Korea, Republic of); Chung, JaeGwan; Lee, Eunha; Lee, Jaecheol; Lee, JaeHak [A E Group, Samsung Advanced Institute of Technology, Yongin-si 440-712 (Korea, Republic of)



Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.


U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Frankfort, KY Frankfort, KY Proposed Action Description: Frankfort, KY proposes to replace the roof on city hall with an energy efficient roof. The city hall is listed on the on the Historic Register. This ex determination is conditioned on the submission of documentation of the KY SHPO approval of the particular rood replacement on this city hall to the DOE. No physical war!< on the project may begin until the DOE has reviewed and accepted such documentation. The no extraordinary conditions determination is dependent on meeting this condition. Categorical Exclusion(s) Applied: 85.1 - Actions to conseNe energy or water For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, including the full text of each categorical exclusion, see Subpart D of 10 CFR Part 102 1.


Nuclear Energy -- Knowledge Base for Advanced Modeling and Simulation (NE-KAMS) Code Verification and Validation Data Standards and Requirements: Fluid Dynamics Version 1.0  

SciTech Connect

V&V and UQ are the primary means to assess the accuracy and reliability of M&S and, hence, to establish confidence in M&S. Though other industries are establishing standards and requirements for the performance of V&V and UQ, at present, the nuclear industry has not established such standards or requirements. However, the nuclear industry is beginning to recognize that such standards are needed and that the resources needed to support V&V and UQ will be very significant. In fact, no single organization has sufficient resources or expertise required to organize, conduct and maintain a comprehensive V&V and UQ program. What is needed is a systematic and standardized approach to establish and provide V&V and UQ resources at a national or even international level, with a consortium of partners from government, academia and industry. Specifically, what is needed is a structured and cost-effective knowledge base that collects, evaluates and stores verification and validation data, and shows how it can be used to perform V&V and UQ, leveraging collaboration and sharing of resources to support existing engineering and licensing procedures as well as science-based V&V and UQ processes. The Nuclear Energy Knowledge base for Advanced Modeling and Simulation (NE-KAMS) is being developed at the Idaho National Laboratory in conjunction with Bettis Laboratory, Sandia National Laboratories, Argonne National Laboratory, Utah State University and others with the objective of establishing a comprehensive and web-accessible knowledge base to provide V&V and UQ resources for M&S for nuclear reactor design, analysis and licensing. The knowledge base will serve as an important resource for technical exchange and collaboration that will enable credible and reliable computational models and simulations for application to nuclear power. NE-KAMS will serve as a valuable resource for the nuclear industry, academia, the national laboratories, the U.S. Nuclear Regulatory Commission (NRC) and the public and will help ensure the safe, economical and reliable operation of existing and future nuclear reactors.

Greg Weirs; Hyung Lee



Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

,833 ,833 35 Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2009 (Million Cubic Feet) Norway Trinidad/ Tobago Trinidad/ Tobago Egypt Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 111,144 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 (Million Cubic Feet) Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 42,411 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2006 253,214 690,780 634,185 658,523 134,764 63,063 526,726 121,049 34,531 492,655 101,101 23,154 40,113 1,496,283 68,601


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value


Microsoft Word - figure_14.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 14. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2010 (Million Cubic Feet) Norway India Trinidad/ Tobago Egypt Yemen Japan Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 53,122 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada Gulf of Mexico Canada Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates based on historical data. Energy Information


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)



Gasoline and Diesel Fuel Update (EIA)

18 18 Energy Information Administration / Natural Gas Annual 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 0 1 2 3 4 5 6 7 T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o A l a b a m a K a n s a s A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 1997 1998 1999 2000 2001 2001 16. Marketed Production of Natural Gas in Selected States, 1997-2001 Figure Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI



Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423


Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8



Gasoline and Diesel Fuel Update (EIA)

1 1 55 0 2 4 6 8 10 Residential Onsystem Commercial Onsystem Industrial Onsystem Vehicle Fuel Electric Utilities Dollars per Thousand Cubic Feet 0 30 60 90 120 150 180 210 240 270 300 330 Dollars per Thousand Cubic Meters 1997 1998 1999 2000 2001 25. Average Price of Natural Gas Delivered to Consumers in the United States, 1997-2001 Figure Note: Prices are calculated from onsystem sales. Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition" and Federal Energy Regulatory Commission (FERC), Form FERC- 423, "Monthly Report of Cost and Quality of Fuels for Electric Plants." Energy Information Administration / Natural Gas Annual 2001 56 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848



Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type


Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2008 (Million Cubic Feet) Norway Trinidad/ Tobago Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 45,772 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates.


Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC



Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 (Million Cubic Feet) 24,891 2,895 Nigeria WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico Algeria C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada N i g e r i a O m a n Qatar Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Malaysia 2,986 Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2005 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 335,380 634,982 664,318 612,297 125,202 33,223 531,868 103,624


Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product


U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...


A confirmative spin-parity assignment for the key 6.15 MeV state in $^{18}$Ne of astrophysical importance  

E-Print Network (OSTI)

Proton resonant states in $^{18}$Ne have been investigated by the resonant elastic scattering of $^{17}$F+$p$. The $^{17}$F beam was separated by the CNS radioactive ion beam separator (CRIB), and bombarded a thick H$_2$ gas target at 3.6 MeV/nucleon. The recoiled light particles were measured by using three sets of ${\\Delta}$E-E Si telescope at scattering angles of $\\theta$$_{lab}$$\\approx 3^\\circ$, 10$^\\circ$ and 18$^\\circ$, respectively. Four resonances, {\\it i.e.}, at $E_{x}$=6.15, 6.30, 6.85, and 7.05 MeV, were observed clearly. By $R$-matrix analysis of the excitation functions, $J^{\\pi}$=1$^-$ was firmly assigned to the 6.15 MeV state which is a key state in calculating the reaction rate of $^{14}$O($\\alpha$,$p$)$^{17}$F reaction. This reaction was thought to be one of the most probable key reactions for the breakout from the hot-CNO cycle to the $rp$-process in type I x-ray bursts In addition, a new excited state observed at $E_{x}$=6.85 MeV was tentatively assigned as 0$^{-}$, which could be the analog state of 6.880 MeV, 0$^{-}$ in mirror $^{18}$O.

J. Hu; J. J. He; S. W. Xu; H. Yamaguchi; K. David; P. Ma; J. Su; H. W. Wang; T. Nakao; Y. Wakabayashi; T. Teranishi; J. Y. Moon; H. S. Jung; T. Hashimoto; A. Chen; D. Irvine; S. Kubono



File:EIA-Appalach7-TN-KY-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

Kentucky and Tennessee By 2001 BOE Reserve Class Kentucky and Tennessee By 2001 BOE Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 18.57 MB, MIME type: application/pdf) Description Appalachian Basin, Kentucky and Tennessee By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Kentucky, Tennessee File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 17:43, 20 December 2010 Thumbnail for version as of 17:43, 20 December 2010 5,100 × 6,600 (18.57 MB) MapBot (Talk | contribs) Automated bot upload


File:EIA-Appalach7-TN-KY-GAS.pdf | Open Energy Information  

Open Energy Info (EERE)

Kentucky and Tennessee By 2001 Gas Reserve Class Kentucky and Tennessee By 2001 Gas Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 18.6 MB, MIME type: application/pdf) Description Appalachian Basin, Kentucky and Tennessee By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Kentucky, Tennessee File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 17:44, 20 December 2010 Thumbnail for version as of 17:44, 20 December 2010 5,100 × 6,600 (18.6 MB) MapBot (Talk | contribs) Automated bot upload


appalachian studies uniVeRsitY OF KentucKY  

E-Print Network (OSTI)

% of kentucky's electricity. Approximately 78% of kentucky's coal is mined in eastern kentucky. eastern kentucky miners make up 84% of the state's coal mining work force.* *Kentucky Coal Association The cre-1884 Ashland Coal & Iron Railway Co. Mines Ledger, 1888-1889 EDUCATION AND LITERACY Country Life Schools

Kim, Mi-Ok


Mountain Association for Community Economic Development- How$martKY On Bill Financing Energy Efficiency Program  

Energy.gov (U.S. Department of Energy (DOE))

Four rural utility cooperatives in Eastern Kentucky (Big Sandy RECC, Fleming-Mason RECC, Grayson RECC, and Jackson Energy) work with MACED to provide energy retrofits as part of utility service...


GE Appliance Park Louisville, KY Plant Wide Assessment Final Report October 25th, 2007  

SciTech Connect

Used a team of experts to analyze and model major systems at a large industrial appliance manufacturer. During the data gathering stage, the team specifically looked for baselining the efficiency of the systems as well as developing short term and longer term efficiency projects. Electrical distribution, Compressed air generation and thermal heat recovery for the production facility and front office heating and cooling optimization were all baselined during the study.

Chandon Rao; Richard Urschel



Energy for the future with Ris from nuclear power to sustainable energy Ris NatioNal laboRatoRy foR sustaiNable eNeRgy  

E-Print Network (OSTI)

Energy for the future ­ with Risø from nuclear power to sustainable energy Risø NatioNal laboRatoRy foR sustaiNable eNeRgy edited by MoRteN JastRup #12;Energy for the future #12;Energy for the future ­ with Risø from nuclear power to sustainable energy Translated from 'Energi til fremtiden ­ med Risø fra


Research Needs for Fusion-Fission Hybrid Systems. Report of the Research Needs Workshop (ReNeW) Gaithersburg, Maryland, September 30 - October 2, 2009  

Science Conference Proceedings (OSTI)

Largely in anticipation of a possible nuclear renaissance, there has been an enthusiastic renewal of interest in the fusion-fission hybrid concept, driven primarily by some members of the fusion community. A fusion-fission hybrid consists of a neutron-producing fusion core surrounded by a fission blanket. Hybrids are of interest because of their potential to address the main long-term sustainability issues related to nuclear power: fuel supply, energy production, and waste management. As a result of this renewed interest, the U.S. Department of Energy (DOE), with the participation of the Office of Fusion Energy Sciences (OFES), Office of Nuclear Energy (NE), and National Nuclear Security Administration (NNSA), organized a three-day workshop in Gaithersburg, Maryland, from September 30 through October 2, 2009. Participants identified several goals. At the highest level, it was recognized that DOE does not currently support any R&D in the area of fusion-fission hybrids. The question to be addressed was whether or not hybrids offer sufficient promise to motivate DOE to initiate an R&D program in this area. At the next level, the workshop participants were asked to define the research needs and resources required to move the fusion-fission concept forward. The answer to the high-level question was given in two ways. On the one hand, when viewed as a standalone concept, the fusion-fission hybrid does indeed offer the promise of being able to address the sustainability issues associated with conventional nuclear power. On the other hand, when participants were asked whether these hybrid solutions are potentially more attractive than contemplated pure fission solutions (that is, fast burners and fast breeders), there was general consensus that this question could not be quantitatively answered based on the known technical information. Pure fission solutions are based largely on existing both fusion and nuclear technology, thereby prohibiting a fair side-by-side comparison. Another important issue addressed at the conference was the time scale on which long-term sustainability issues must be solved. There was a wide diversity of opinion and no consensus was possible. One group, primarily composed of members of the fission community, argued that the present strategies with respect to waste management (on-site storage) and fuel supply (from natural uranium) would suffice for at least 50 years, with the main short-term problem being the economics of light water reactors (LWRs). Many from the fusion community believed that the problems, particularly waste management, were of a more urgent nature and that we needed to address them sooner rather than later. There was rigorous debate on all the issues before, during, and after the workshop. Based on this debate, the workshop participants developed a set of high-level Findings and Research Needs and a companion set of Technical Findings and Research Needs. In the context of the Executive Summary it is sufficient to focus on the high-level findings which are summarized.




Examination and experimental constraints of the stellar reaction rate factor $N_A $ of the $^{18}$Ne($?$,$p$)$^{21}$Na reaction at temperatures of X-Ray Bursts  

E-Print Network (OSTI)

The $^{18}$Ne($\\alpha$,$p$)$^{21}$Na reaction is one key for the break-out from the hot CNO-cycles to the $rp$-process. Recent papers have provided reaction rate factors $N_A $ which are discrepant by at least one order of magnitude. The compatibility of the latest experimental results is tested, and a partial explanation for the discrepant $N_A$ is given. A new rate factor is derived from the combined analysis of all available data. The new rate factor is located slightly below the higher rate factor by Matic {\\it et al.}\\ at low temperatures and significantly below at higher temperatures whereas it is about a factor of five higher than the lower rate factor recently published by Salter {\\it et al.}

P. Mohr; A. Matic



Heavy isotope production by multinucleon transfer reactions with /sup 254/Es. [101 MeV /sup 16/O, 98 MeV /sup 18/O, 127 MeV /sup 22/Ne  

Science Conference Proceedings (OSTI)

Fast automated on-line and quasi-on-line radiochemical techniques were applied to search for new isotopes, to measure their decay characteristics, and to study the cross sections of the heaviest, most neutron-rich actinide isotopes in reactions of /sup 16,18/O and /sup 22/Ne projectiles with /sup 254/Es as a target. The measured yields for isotopes up to Lr-260 are three or more orders of magnitude higher than in any other reaction used so far. A comparison with data for similar transfers from /sup 248/Cm targets is made. Transfer cross sections are extrapolated for the production of unknown, neutron-rich isotopes of elements 101 through 105, and the unique potential of /sup 254/Es as a target to make these exoctic nuclei accessible is demonstrated. 18 refs., 2 figs., 1 tab.

Schaedel, M.; Bruechle, W.; Bruegger, M.; Gaeggeler, H.; Moody, K.J.; Schardt, D.; Suemmerer, K.; Hulet, E.K.; Douran, A.D.; Dougan, R.J.



Please cite this article in press as: Gilfillan, S.M.V., et al., He and Ne as tracers of natural CO2 migration up a fault from a deep reservoir. Int. J. Greenhouse Gas Control (2011), doi:10.1016/j.ijggc.2011.08.008  

E-Print Network (OSTI)

of Greenhouse Gas Control journal homepage: www.elsevier.com/locate/ijggc He and Ne as tracers of natural CO22 Noble gases Carbon isotopes Geological storage of CO2 Natural analogues a b s t r a c t Capture that could arise from a diffuse leakage of CO2 from a storage site. This is because there are many natural


Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","ng_prod_whv_a_epg0_vgm_mmcf_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/ng/ng_prod_whv_a_epg0_vgm_mmcf_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"12/19/2013 6:54:27 AM" "Back to Contents","Data 1: Natural Gas Marketed Production " "Sourcekey","N9050US2","N9050FX2","N9050AL2","N9050AK2","N9050AZ2","N9050AR2","N9050CA2","N9050CO2","N9050FL2","N9050IL2","N9050IN2","N9050KS2","N9050KY2","N9050LA2","N9050MD2","N9050MI2","N9050MS2","N9050MO2","N9050MT2","N9050NE2","N9050NV2","N9050NM2","N9050NY2","N9050ND2","N9050OH2","N9050OK2","N9050OR2","N9050PA2","N9050SD2","N9050TN2","N9050TX2","N9050UT2","N9050VA2","N9050WV2","N9050WY2"



Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

21. Domestic Crude Oil First Purchase Prices 21. Domestic Crude Oil First Purchase Prices (Dollars per Barrel) Year Month U.S. Average PAD District I PAD District II U.S. Average Less AK North Slope Average NY PA WV Average IL IN KS KY MI NE 1978 ..................... 9.00 9.56 12.25 W 14.72 14.48 11.91 13.81 13.70 13.20 13.73 11.86 11.40 1979 ..................... 12.64 13.01 14.30 W 24.13 23.35 18.33 23.49 23.28 21.57 22.55 14.47 18.13 1980 ..................... 21.59 22.65 22.66 W 37.46 36.92 30.12 35.78 35.91 34.20 34.98 23.54 30.60 1981 ..................... 31.77 33.71 35.22 W 36.03 35.63 35.63 36.03 36.07 35.80 35.90 35.74 35.32 1982 ..................... 28.52 30.43 31.77 30.91 30.77 29.98 31.65 31.69 31.66 30.79 31.19 31.80 30.98 1983 ..................... 26.19 28.00 28.32 28.19 28.28 27.27 29.17 29.12 29.06 28.45 28.60 28.93 28.58 1984 ..................... 25.88



Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly



Gasoline and Diesel Fuel Update (EIA)

Table 18. Domestic Crude Oil First Purchase Prices Table 18. Domestic Crude Oil First Purchase Prices (Dollars per Barrel) Year Month U.S. Average PAD District I PAD District II U.S. Average Less AK North Slope Average NY PA WV Average IL IN KS KY MI NE 1983 ..................... 26.19 28.00 28.32 28.19 28.28 27.27 29.17 29.12 29.06 28.45 28.60 28.93 28.58 1984 ..................... 25.88 27.59 27.76 27.70 27.71 26.90 28.62 28.76 28.72 27.99 28.24 28.54 27.83 1985 ..................... 24.09 25.74 25.88 25.19 25.05 24.35 25.94 26.90 26.82 25.33 26.20 26.16 25.42 1986 ..................... 12.51 14.13 14.76 16.03 15.77 14.68 14.30 14.70 14.55 14.02 14.20 14.61 13.70 1987 ..................... 15.40 16.83 16.52 17.40 17.43 16.56 17.42 17.53 17.49 17.37 17.19 17.63 17.08 1988 ..................... 12.58 13.97 14.21 W 15.26 14.35 14.65 14.79 14.78 14.55 14.58 14.92 14.08 1989 .....................


Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management



U.S. Energy Information Administration (EIA) Indexed Site

1 1 U.S. Energy Information Administration/Petroleum Marketing Monthly December 2013 Table 18. Domestic Crude Oil First Purchase Prices (Dollars per Barrel) Year Month U.S. Average PAD District I PAD District II U.S. Average Less AK North Slope Average NY PA WV Average IL IN KS KY MI NE 1985 .............. 24.09 25.74 25.88 25.19 25.05 24.35 25.94 26.90 26.82 25.33 26.20 26.16 25.42 1986 .............. 12.51 14.13 14.76 16.03 15.77 14.68 14.30 14.70 14.55 14.02 14.20 14.61 13.70 1987 .............. 15.40 16.83 16.52 17.40 17.43 16.56 17.42 17.53 17.49 17.37 17.19 17.63 17.08 1988 .............. 12.58 13.97 14.21 W 15.26 14.35 14.65 14.79 14.78 14.55 14.58 14.92 14.08 1989 .............. 15.86 17.13 17.16 W 18.15 17.18 18.04 18.36 18.37 18.18 18.36 18.06 17.36 1990 .............. 20.03 21.57 22.06 23.32 23.00 22.16 22.88 23.36 23.46 23.21 23.20



Gasoline and Diesel Fuel Update (EIA)

accomplishments accomplishments are impressive in themselves, and associ- ated with each milestone is the expansion of future produc- tion opportunities as another technical barrier is overcome. The extension of recovery opportunities into deep water has established the deep offshore as an area of considerable national significance. A second source of increased supply is gas from coalbed formations. Natural gas production from coalbed methane fields continued to grow in 1996 as projects initiated mainly in the early to mid 1990's matured through the dewatering phase into higher rates of gas production. Coalbed forma- tions contribute almost 1 trillion cubic feet, roughly 5 per- cent, to total U.S. production. Continued production growth from coalbeds is not likely in light of the precipitous drop in new wells completed in coalbed formations since the termination of the production tax


Building America Top Innovations Hall of Fame Profile … High Performance Without Increased Cost: Urbane Homes, Louiseville KY  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Urbane's first Urbane's first home, built for $36 per ft 2 in 2008, incorporated both energy efficiency and strategies to reduce building costs. The home won two EnergyValue Housing Awards, and homebuyers began seeking out the builder for energy-efficient, high-quality homes. Building America field projects that demonstrated minimal or cost-neutral impacts for high-performance homes have significantly influenced the housing industry to apply advanced technologies and best practices. In 2006, the U.S. Department of Energy's Building America program set a goal of proving that cost-neutral energy savings of 40% over code were possible at a production scale for new home builders in every U.S. climate zone. Between 2005 and 2010, Building America research partners worked with 34 builders to



Annual Energy Outlook 2012 (EIA)

857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 15. Average City Gate Price of Natural...


Fermilab | Science at Fermilab | Experiments & Projects | Proposed...  

NLE Websites -- All DOE Office Websites (Extended Search)

Frontier Proposed Projects and Experiments LBNE Mu2e Project X NOvA MicroBooNE MICE Dark Energy Survey LSST The MINERvA Full Module Prototype plane moves into the NuMI...


Electron-Cloud Build-Up: Theory and Data  

E-Print Network (OSTI)

of Titanium Nitride Coating For SNS Ring Vac- uum Chambers,High-Current Proton Rings (SNS/LANL, Santa Fe, NM, 4-7 MarchSPS, APS, RHIC, Tevatron, MI, SNS, CESRTA, DA?NE and most

Furman, M. A.




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

KY Kentucky Total Sum City, County, and SEO Allocations KY Kentucky Total Sum City, County, and SEO Allocations All $ 25,382,500 KY Kentucky State Energy Office $ 10,427,000 KY Bowling Green City $ 585,600 KY Covington City $ 188,500 KY Florence City $ 126,400 KY Frankfort City $ 132,100 KY Henderson City $ 123,100 KY Hopkinsville City $ 143,600 KY Lexington-Fayette City $ 2,753,800 KY Louisville/Jefferson City $ 7,000,400 KY Owensboro City $ 557,200 KY Richmond City $ 145,600 KY Boone County $ 368,100 KY Bullitt County $ 289,900 KY Campbell County $ 351,600 KY Hardin County $ 426,500 KY Kenton County $ 465,200


KENTUCKY - Energy Information Administration  

U.S. Energy Information Administration (EIA)

beech fork school db martin ky 159 004679 n 1941 beech grove mclean ky 149 051681 o 1948 beech grove east mclean ky 149 051712 o 1950


NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

July 8, 2010 July 8, 2010 Department of Energy Announces more than $18 Million to Strengthen Nuclear Education at U.S. Universities and Colleges Awards $5 million for 117 scholarships and fellowships, and $13.2 million for infrastructure upgrades for university nuclear programs June 21, 2010 Global Nuclear Energy Partnership Steering Group Members Approve Transformation to the International Framework for Nuclear Energy Cooperation The Global Nuclear Energy Partnership Steering Group met in Accra, Ghana on June 16-17, 2010, and approved unanimously several transformative changes to reflect global developments that have occurred since the Partnership was established in 2007. June 2, 2010 International Working Group Meeting Focuses on Nuclear Power Infrastructure Development and Needs


NE Blog Archive | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

January 30, 2008 January 30, 2008 Artist's concept of the New Horizons spacecraft during its planned encounter with Pluto and its moon, Charon. The craft's miniature cameras, radio science experiment, ultraviolet and infrared spectrometers and space plasma experiments are run by the Department of Energy's Radioisotope Thermoelectric Generator (RTG). | Photo courtesy of Johns Hopkins University Applied Physics Laboratory/Southwest Research Institute (JHUAPL/SwRI) New Horizons Mission Powered by Space Radioisotope Power Systems The New Horizons spacecraft utilized a Radioisotope Thermoelectric Generator (RTG) to provide electricity and heat to the science instruments and other spacecraft components. January 29, 2008 Mars Science Laboratory, aka Curiosity, is part of NASA's Mars Exploration Program, a long-term program of robotic exploration of the Red Planet. It's powered by the Multi-Mission Radioisotope Thermoelectric Generator (MMRTG). Photo courtesy of NASA/JPL-Caltech.


NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

September 29, 2011 September 29, 2011 United States and Czech Republic Join Together to Announce Bilateral Nuclear Energy Research and Development Efforts PRAGUE, Czech Republic - The U.S. Department of Energy recently joined with the Řež Nuclear Research Institute, the U.S. September 28, 2011 Department of Energy Issues FY 2012 Request for Pre-Applications from U.S. Universities for Nuclear Energy Research and Development Proposals The U.S. Department of Energy today announced that its Nuclear Energy University Programs is now accepting pre-applications from universities interested in conducting nuclear energy research and development projects. September 21, 2011 Department of Energy Announces $17 Million to Bolster University-Led Nuclear Energy Research and Development


NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

March 23, 2010 March 23, 2010 DOE Announces Cooperative Agreement with USEC for American Centrifuge Demonstration Project The U.S. Department of Energy today announced that it finalized a cost-shared $90 million cooperative agreement with USEC Inc. to provide support for the continued development and demonstration of the American Centrifuge technology. March 17, 2010 U.S. and India hold the Third Meeting of the Indo-United States Civil Nuclear Energy Working Group India hosted the third meeting of the Indo-United States Civil Nuclear Energy Working Group in Mumbai, on Feb. 3-4, 2010. March 17, 2010 INL User Facility welcomes three new experiments The number of universities conducting nuclear energy experiments in Idaho National Laboratory's one-of-a-kind research reactor has now reached an


NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

February 17, 2010 February 17, 2010 Deputy Secretary Poneman Addresses Nuclear Deterrence Summit Alexandria, VA - U.S. Deputy Secretary of Energy Daniel Poneman today addressed the opening session of the second annual Nuclear Deterrence Summit and discussed the Department of Energy's commitment to helping achieve the President's goals of reducing nuclear dangers and expanding the use of nuclear energy in a manner that minimizes the risks of proliferation. The Deputy Secretary also spoke about the Department's commitment to management excellence. February 16, 2010 Obama Administration Announces Loan Guarantees to Construct New Nuclear Power Reactors in Georgia President Obama today announced that the Department of Energy has offered conditional commitments for a total of $8.33 billion in loan guarantees for


NE Blog Archive | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

June 1, 2012 June 1, 2012 Navy personnel stationed in Idaho Falls, Idaho, in the mid 1950s learn how to operate the Nautilus S1W, the prototype of the Navy's first nuclear-powered submarine. | Photo courtesy of Idaho National Laboratory Veteran Leadership Strong at Idaho's Laboratory Idaho National Lab has played a large role in building fission reactors for Navy vessels - and then training those military personnel on how to use the equipment. February 15, 2012 Secretary Chu traveled to Waynesboro, Georgia, to visit the Vogtle nuclear power plant, the site of what will be the first new nuclear reactors to be built in the United States in three decades. | Image credit: Southern Company. Secretary Chu Visits Vogtle Nuclear Power Plant Secretary Chu traveled to Waynesboro, Georgia, to visit the Vogtle nuclear


NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

April 15, 2011 April 15, 2011 Dr. Peter B. Lyons Confirmed as Assistant Secretary for Nuclear Energy Washington, D.C. - Dr. Peter B. Lyons was confirmed by the Senate on Thursday, April 14, as the Department of Energy's Assistant Secretary for Nuclear Energy. February 28, 2011 U.S. Department of Energy Issues Fiscal Year 2011 Funding Opportunity Announcements to Enhance Nuclear Energy Education Infrastructure The U.S. Department of Energy today announced two new fiscal year 2011 Funding Opportunity Announcements to support university and college efforts to build or expand their school's nuclear science and engineering basic research or education capabilities. February 18, 2011 Department of Energy Issues Call for Proposals to U.S. Universities for Nuclear Energy-Related Integrated Research Project Proposals


NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

January 20, 2012 January 20, 2012 Energy Department Takes First Step to Spur U.S. Manufacturing of Small Modular Nuclear Reactors Through the draft Funding Opportunity Announcement announced today, the Department will establish cost-shared agreements with private industry to support the design and licensing of SMRs. January 20, 2012 Energy Department Takes First Step to Spur U.S. Manufacturing of Small Modular Nuclear Reactors New Funding Opportunity Announcement Will Support SMR Design and Licensing for Widespread Commercial Use December 22, 2011 Secretary Chu Statement on AP1000 Reactor Design Certification U.S. Energy Secretary Steven Chu issued the following statement today in support of the Nuclear Regulatory Commission's (NRC) decision to certify Westinghouse Electric's AP1000 nuclear reactor design, a significant step

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


LLNL's NeMS: Network Mapping System  

High Performance Computing Innovation Center (Building 6475)located in LLNL's Livermore Valley Open Campus (LVOC) Seating is limited, Pre-registration ...



Science Conference Proceedings (OSTI)

... Scott"; "Bloomberg News Service", later just "Bloomberg").The broadcast news transcriptions are not segmented into discourse units in any clearly ...



COURSE NOTES: Nuclear Materials (NE120)  

Science Conference Proceedings (OSTI)

Feb 10, 2007 ... This resource provides PDF lecture notes and readings for an undergraduate course covering materials issues in nuclear power systems.


NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

September 27, 2012 Energy Department Announces New Investments in University-Led Nuclear Energy Innovation Three University-Led Projects to Develop Next Generation Technologies,...


NE Press Releases | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

next generation of nuclear scientists and engineers. May 6, 2009 Secretary Chu Announces Funding for 71 University-Led Nuclear Research and Development Projects U.S. Energy...


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


Agriculture and Natural Resources Family and Consumer Sciences 4-H Youth Development Community and Economic Development COOPERATIVE EXTENSION SERVICE UNIVERSITY OF KENTUCKY COLLEGE OF AGRICULTURE, LEXINGTON, KY, 40546  

E-Print Network (OSTI)

.S. gasoline supply is a blend of at least 10 percent ethanol. Bio- dieselisanotherbiofuelthatisbecoming more to heat a home or co-firing bales of biomass with coal in power plants to create electricity. Biomass also

Hayes, Jane E.


First measurement of VuT & Ve events in an off-axis horn-focused neutrino beam  

SciTech Connect

We report the first observation of off-axis neutrino interactions in the MiniBooNE detector from the NuMI beamline at Fermilab. The MiniBooNE detector is located 745 m distance from the NuMI production target, at 110 mrad angle (6.3{sup o}) with respect to the NuMI beam axis. Samples of charged current quasi-elastic {nu}{sub {mu}} and {nu}{sub e} interactions are analyzed and found to be in agreement with expectation. This provides a direct verification of the expected pion and kaon contributions to the neutrino flux and validates modeling of the NuMI off-axis beam.

Louis, William C [Los Alamos National Laboratory



,"Kentucky Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050KY3","N3010KY3","N3020KY3","N3035KY3","N3045KY3" "Date","Natural Gas Citygate Price in Kentucky (Dollars per Thousand Cubic Feet)","Kentucky Price of...



Gasoline and Diesel Fuel Update (EIA)

8 8 Southern California Gas Co ..................... CA 269,739,909 7.31 Pacific Gas and Elec Co........................... CA 224,402,286 6.32 Northern Illinois Gas Co ........................... IL 196,608,329 4.63 Consumers Pwr Co .................................. MI 153,128,350 4.92 Columbia Gas Dist Co.............................. OH,KY,PA,MD 138,064,908 7.21 Pub Svc Elec and Gas Co........................ NJ 126,142,540 6.61 Michigan Consol Gas Co.......................... MI 125,456,377 5.35 East Ohio Gas Co .................................... OH 117,574,196 6.21 Peoples Gas Lt and Coke Co................... IL 89,685,006 6.81 Atlanta Gas Lt Co ..................................... GA 89,103,601 6.69 Lone Star Gas Co..................................... TX 84,559,915 5.95 Brooklyn Union Gas Co............................ NY


Northern Illinois Gas Co IL  

Gasoline and Diesel Fuel Update (EIA)

Northern Northern Illinois Gas Co ............................ IL 254,574,988 4.60 Southern California Gas Co ...................... CA 233,632,354 6.89 Columbia Gas Dist Co............................... OH,KY,PA,MD 196,322,935 6.64 Pacific Gas and Elec Co............................ CA 190,864,262 5.83 Consumers Pwr Co ................................... MI 188,587,672 4.81 Michigan Consol Gas Co........................... MI 160,809,168 5.16 East Ohio Gas Co ..................................... OH 146,802,045 5.44 Pub Svc Elec and Gas Co......................... NJ 140,712,209 6.62 Peoples Gas Lt and Coke Co.................... IL 126,356,925 6.40 Brooklyn Union Gas Co............................. NY 106,349,594 9.43 Atlanta Gas Lt Co ...................................... GA 106,075,815 6.66 Lone Star Gas Co......................................



Gasoline and Diesel Fuel Update (EIA)

5 5 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 138,239,378 5.94 Pub Svc Elec and Gas Co........................ NJ 69,738,220 5.26 Southern California Gas Co ..................... CA 63,758,073 7.26 Pacific Gas and Elec Co........................... CA 58,646,965 7.84 Keyspan Energy Del Co ........................... NY 53,501,565 7.32 Consumers Energy Co ............................. MI 51,663,333 4.26 TXU Gas Distribution................................ TX 48,112,344 5.86 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 45,021,338 7.87 Con Edison Co of New York Inc............... NY 44,076,359 8.02 Michigan Consol Gas Co.......................... MI 40,342,797 5.39 Pub Svc Co of Colorado........................... CO 39,697,152 5.22 East Ohio Gas Co ....................................



Gasoline and Diesel Fuel Update (EIA)

4 4 Con Edison Co. of New York Inc.............. NY 88,830,005 5.25 Pub Svc Elec and Gas Co........................ NJ 70,705,783 5.28 Columbia Gas Dist Co.............................. OH,KY,PA,MD 63,746,659 7.11 Southern California Gas Co ..................... CA 57,000,043 6.63 Minnegasco .............................................. MN 55,213,151 4.69 Pacific Gas and Elec Co........................... CA 54,854,821 6.15 Entex Div of Noram Energy Corp ............. LA,MS,TX 51,551,370 5.31 Consumers Pwr Co .................................. MI 50,657,354 4.44 Michigan Consol Gas Co.......................... MI 50,589,626 5.55 Northern Illinois Gas Co ........................... IL 47,159,304 5.26 Pub Svc Co. of Colorado.......................... CO 46,479,502 3.88 East Ohio Gas Co .................................... OH 41,561,614 5.92



Gasoline and Diesel Fuel Update (EIA)

3 3 Con Edison Co of New York Inc............... NY 102,311,001 3.84 Pub Svc Elec and Gas Co........................ NJ 73,839,186 3.05 Southern California Gas Co ..................... CA 62,380,076 5.55 Pacific Gas and Elec Co........................... CA 58,692,831 6.82 Keyspan Energy Del Co ........................... NY 53,162,984 6.07 Minnegasco .............................................. MN 52,910,769 4.25 Entex Div of Noram Energy Corp ............. TX,LA,MS 47,337,378 4.81 Lone Star Gas Co..................................... TX 45,843,050 4.67 Consumers Energy Co ............................. MI 45,391,308 4.50 Michigan Consol Gas Co.......................... MI 41,336,416 5.38 Pub Svc Co of Colorado........................... CO 39,230,403 4.47 Columbia Gas Dist Co.............................. KY,PA,MD,OH 35,550,535 6.78

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

2000 2000 Southern California Gas Co ..................... CA 251,452,001 8.32 Nicor Gas ................................................. IL 221,009,522 6.68 Pacific Gas and Elec Co........................... CA 211,181,852 7.98 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 184,692,129 7.53 Consumers Energy Co ............................. MI 176,663,600 4.76 Michigan Consol Gas Co.......................... MI 136,124,328 5.41 Keyspan Energy Del Co ........................... NY 134,055,940 10.75 Pub Svc Elec and Gas Co........................ NJ 132,611,115 6.32 East Ohio Gas Co .................................... OH 131,187,521 7.49 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 130,622,887 8.82 Peoples Gas Lt and Coke Co................... IL 103,856,141 8.60 Pub Svc Co of Colorado...........................



Gasoline and Diesel Fuel Update (EIA)

Energy Information Administration / Natural Gas Annual 1999 Southern California Gas Co ..................... CA 275,767,714 6.50 Pacific Gas and Elec Co........................... CA 234,195,449 6.61 Nicor Gas ................................................. IL 211,147,988 4.71 Consumers Energy Co ............................. MI 167,318,229 4.89 Michigan Consol Gas Co.......................... MI 134,432,032 5.42 Pub Svc Elec and Gas Co........................ NJ 133,426,119 6.86 East Ohio Gas Co .................................... OH 127,141,913 5.81 Keyspan Energy Del Co ........................... NY 125,709,092 9.79 Columbia Gas Dist Co.............................. KY,PA,MD,OH 121,011,064 7.32 Peoples Gas Lt and Coke Co................... IL 98,758,164 6.77 Pub Svc Co of Colorado........................... CO 84,115,032 5.28



Gasoline and Diesel Fuel Update (EIA)

3 3 Northern Illinois Gas Co ........................... IL 241,353,299 5.25 Southern California Gas Co ..................... CA 237,581,205 7.28 Pacific Gas and Elec Co........................... CA 191,919,171 6.12 Consumers Pwr Co .................................. MI 178,690,154 4.80 Columbia Gas Dist Co.............................. OH,KY,PA,MD 178,512,589 7.64 Michigan Consol Gas Co.......................... MI 152,111,213 5.59 East Ohio Gas Co .................................... OH 147,197,186 6.36 Pub Svc Elec and Gas Co........................ NJ 138,404,765 7.58 Peoples Gas Lt and Coke Co................... IL 113,561,765 6.96 Lone Star Gas Co..................................... TX 100,079,759 6.13 Atlanta Gas Lt Co ..................................... GA 96,381,162 7.41 Brooklyn Union Gas Co............................


Pub Svc Elec  

Gasoline and Diesel Fuel Update (EIA)

Pub Pub Svc Elec and Gas Co......................... NJ 81,712,678 5.82 Columbia Gas Dist Co............................... OH,KY,PA,MD 76,048,915 5.95 Con Edison Co. of New York Inc............... NY 69,809,658 5.99 Consumers Pwr Co ................................... MI 58,661,306 4.46 Pacific Gas and Elec Co............................ CA 57,793,522 5.67 Minnegasco ............................................... MN 57,154,912 4.57 Southern California Gas Co ...................... CA 54,772,058 6.16 Michigan Consol Gas Co........................... MI 53,635,433 5.16 Entex Div of Noram Energy Corp.............. LA,TX,MS 49,485,836 4.80 Northern Illinois Gas Co ............................ IL 48,165,624 4.62 Pub Svc Co. of Colorado........................... CO 47,339,959 3.51 Atlanta Gas Lt Co ......................................


FC Master List.vp:CorelVentura 7 - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

022306 Appalachian KY 159 Martin Alias for: (063516) Big Sandy[ALTER] 022306 Appalachian KY 195 Pike Alias for: (116230) Canada DBS[ALTER] 024081 Argo KY 195 Pike 1956 N


Microsoft Word - N01221_NE Site IRAP final.doc  

Office of Legacy Management (LM)

Northeast Site Northeast Site August 2008 Office of Legacy Management LMS/PIN/N01221 Work Performed Under DOE Contract No. for the U.S. Department of Energy Office of Legacy Management. DE-AM01-07LM00060 Approved for public release; distribution is unlimited. Office of Legacy Management Office of Legacy Management Office of Legacy Management U.S. Department of Energy This page intentionally left blank LMS/PIN/N01221 Pinellas Environmental Restoration Project Interim Remedial Action Plan for Source Removal at the Northeast Site August 2008 This page intentionally left blank U.S. Department of Energy Interim Remedial Action Plan for Source Removal at the Northeast Site August 2008 Doc. No. N0122100 Page iii Contents Acronyms and Abbreviations .........................................................................................................



Office of Legacy Management (LM)

0 0 ACTION: SSDP Project Charter Revision CONCURRENCES RTG SYMBOL James W. Vaughan, Jr. N-923 Acting Assistant Secretary . for Nuclear Energy Murphi Attached for your signature is a revised Project Charter for the 1/ 86 Shippingport Station Decommissioning Project (SSDP). Since our original M determination in July that there was a need to revise the SSDP Charter, we N K23 have been in discussion with the Richland Operations Field Office (RL). INe Significant differences in management philosophy surfaced between RL and DeLaney Headquarters that required discussions up to and including the RL Manager DAE/86 and myself. I now feel that the revised Charter reflects a mutually acceptable working arrangement between the appropriate organizations. The RTGSYMBOL general roles and responsibilities defined in this Charter will facilitate


File:EIA-Williston-NE-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

Northeast Part By 2001 BOE Reserve Class Northeast Part By 2001 BOE Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 5.94 MB, MIME type: application/pdf) Description Williston Basin, Northeast Part By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Montana, North Dakota, South Dakota File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 18:49, 20 December 2010 Thumbnail for version as of 18:49, 20 December 2010 6,600 × 5,100 (5.94 MB) MapBot (Talk | contribs) Automated bot upload


File:EIA-Williston-NE-Liquids.pdf | Open Energy Information  

Open Energy Info (EERE)

Liquids.pdf Liquids.pdf Jump to: navigation, search File File history File usage Williston Basin, Northeast Part By 2001 Liquids Reserve Class Size of this preview: 776 × 600 pixels. Full resolution ‎(6,600 × 5,100 pixels, file size: 5.95 MB, MIME type: application/pdf) Description Williston Basin, Northeast Part By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Montana, North Dakota, South Dakota File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment


NE-24 Gilman Hall, University of California, Certification Documentation  

Office of Legacy Management (LM)

Gilman Hall, University of California, Gilman Hall, University of California, Certification Documentation Berkeley, California, Conditional Verlette Gatlin, MA-232 I am attaching for entry into the Public Document Room, two copies of the subject documentation. These documents are the backup data for the conditional certification that the site is radiologically acceptable for restricted use as noted in the certification statement published in the Federal Register. Inasmuch as the conditional certification is made public through the Federal Register, it is prudent that the attached backup documentation also be available to the public. The docket consists of: 1. Introduction: Introduction to the certification docket for Gilman Hall, University of California, Berkeley, California. 2. Exhibit I: Summary of activities at Gilman Hall, University of


Microsoft Word - 2.8.12 NE Final Testimony  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Peter Lyons Peter Lyons Assistant Secretary for Nuclear Energy U.S. Department of Energy Before the Committee on Science, Space, and Technology U.S. House of Representatives Assessing America's Nuclear Future- A review of the Blue Ribbon Commission's Report to the Secretary of Energy February 8, 2012 Chairman Hall, Ranking Member Johnson, and Members of the Committee, thank you for the opportunity to appear before you today to discuss the Blue Ribbon Commission's (BRC) Report to the Secretary of Energy. The Commissioners worked collaboratively and constructively - through a public, open and transparent process - on recommendations to support a new strategy for the back end of the nuclear fuel cycle. The Administration commends the Commission for its


NE-24 Designation of Universal Cyclops, Inc., Titusville Plant  

Office of Legacy Management (LM)

Universal Cyclops, Inc., Titusville Plant Universal Cyclops, Inc., Titusville Plant Pennsylvania, for Remedial iiction under the Formerly Uti Remedial Action Program (FUSRAP) J. LaGrone, Manager Oak Ridge Operations Office Aliquippa, iized Sites pg!. " * 1 ' j---' R , 7. Based on the data in the attached report, it has been determined that the subject site is contaminated with radioactive residues as a result of Manhattan Engineer District/Atomic Energy Commission operations at the site. The contamination is in excess of acceptable guidelines and warrants designation for remedial action under the FUSRAP, Although the contamirta- tion levels exceed guidelines, the risk of exposure and associated health effects are low under current use and/or potential future use of the site; therefore, the site is designated as a low priority site for remedial -


Aussie LNG players target NE Asia in expansion bid  

SciTech Connect

Australia's natural gas players, keen to increase their presence in world liquefied natural gas trade, see Asia as their major LNG market in the decades to come. That's despite the fact that two spot cargoes of Australian Northwest Shelf LNG were shipped to Europe during the last 12 months and more are likely in 1994. Opportunities for growth are foreseen within the confines of the existing Northwest Shelf gas project for the rest of the 1990s. But the main focus for potential new grassroots project developers and expansions of the existing LNG plant in Australia is the expected shortfall in contract volumes of LNG to Japan, South Korea, and Taiwan during 2000--2010. Traditionally the price of crude oil has been used as a basis for calculating LNG prices. This means the economics of any new 21st century supply arrangements are delicately poised because of the current low world oil prices, a trend the market believes is likely to continue. In a bid to lessen the effect of high initial capital outlays and still meet projected demand using LNG from new projects and expansion of the existing plant, Australia's gas producers are working toward greater cooperation with prospective Asian buyers.

Not Available



Nuclear Engineering (NE) and the Energy Engineering and Systems...  

NLE Websites -- All DOE Office Websites (Extended Search)

Achievements Highlights Fact Sheets, Brochures & Other Documents Multimedia Library About Nuclear Energy Nuclear Reactors Designed by Argonne Argonne's Nuclear Science and...


Microsoft Word - NE Brief#70 Summary (10-12)  

NLE Websites -- All DOE Office Websites (Extended Search)

nuclear engineering or in an option program equivalent to a major. Thirty-two academic programs reported having nuclear engineering programs during 2011, and data was received from...


CCpi0 Event Reconstruction at MiniBooNE  

SciTech Connect

We describe the development of a fitter to reconstruct {nu}{sub {mu}} induced Charged-Current single {pi}{sup 0} (CC{pi}{sup 0}) events in an oil Cerenkov detector (CH{sub 2}). These events are fit using a generic muon and two photon extended track hypothesis from a common event vertex. The development of ring finding and particle identification are described. Comparisons between data and Monte Carlo are presented for a few kinematic distributions.

Nelson, Robert H.; /Colorado U.



NE researchers win two R&D 100 Awards  

NLE Websites -- All DOE Office Websites (Extended Search)

Nuclear Safety Materials Disposition Decontamination & Decommissioning Nuclear Criticality Safety Nuclear Data Program Nuclear Waste Form Modeling Departments Engineering...


Publications Dipl.-Ing. Ing. Hana Krsn (ne Spickov)  

E-Print Network (OSTI)

analýzu VLBI dat. Konferenz des CEDR ­ Center for Earth's Dynamic Research. Trest, Czech Republic, 14 ­ 16

Schuh, Harald


Ne?gali? asmen? ?sidarbinimo galimyb?s aptarnavimo sferoje.  

E-Print Network (OSTI)

??There are choice aspects of disabled people, of them profession territory in the post graduate. There are introduced with resolve and possibility of disabled (more)

Ivanauskait?,; Irma



2010 Annual Planning Summary for Nuclear Energy (NE) | Department...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Annual Planning Summary for National Nuclear Security Administration Service Center (NNSA-SC) 2010 Annual Planning Summary for Defense Nuclear Nonproliferation (NA-20) 2010 Annual...

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Science Conference Proceedings (OSTI)

... in which a limited set of entities is introduced and then re- ferred to in various ways (eg, Winston Scott, later just Scott; Bloomberg News Service ...



ne Minute Guide to ... COMPENDEX on EiVillage  

E-Print Network (OSTI)

(*), Autostemming AND, OR, NOT (OR inserted between terms by default) "Author Affiliation" searches only the refine results feature. Click on Easy Search tab, enter keyword. * Refine results by clicking on the links under the listed subject headings. Under Search Results click the to delete the term SEARCH

California at Los Angeles, University of


CA CAIOlf Mr. Andrew Wallo. III, NE-23  

Office of Legacy Management (LM)

sites under consideration; and six institutions recently iden- q J-05 tified during a search of Hanford records. py&m I ;y. 2 8 The attached was prepared to document the...


CA M r. Andrew Wallo, III, NE-23  

Office of Legacy Management (LM)

sites under consideration; and six institutions recently iden- hy .0-q tified during a search of Hanford records. ply&D r.'y. 2. g The attached was prepared to document the...


Microsoft PowerPoint - NEAC Battelle NE Capabilities 062408.ppt  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

R&D Facility Requirements NEAC Meeting Progress Report June 24, 2008 2 Facilitization of U.S. Nuclear R&D Infrastructure Three-step study process: * First, ASNE requested Battelle...


Status of conversion of NE standards to national consensus standards  

SciTech Connect

This report is a summary of the activities that have evolved to effect conversion of nuclear energy standards to national consensus standards, and the status of current conversion activities.

Hudson, R.C.; McKee, R.O.



Laser glazing of flat steel surface - The NE Multimedia Collection  

NLE Websites -- All DOE Office Websites (Extended Search)

flat steel surface Laser glazing of flat surface of steel parts is shown in the movie clip by moving the required beam over the surface at a constant speed...


Laser Rock Drilling Demo - The NE Multimedia Collection  

NLE Websites -- All DOE Office Websites (Extended Search)

Demo A high power pulsed Nd:YAG laser beam at Argonne's Laser Applications Lab is being shown in this movie to drill oil reservoir rock, a potential application in gas and oil well...


Laser Rock Perforation Demo - The NE Multimedia Collection  

NLE Websites -- All DOE Office Websites (Extended Search)

rock perforation demo High power laser beam can be used in oil well completion application for perforating oil reservoir rock and increasing rock's permeability for high oil...


Confronting mass-varying neutrinos with MiniBooNE  

E-Print Network (OSTI)

We study the proposal that mass-varying neutrinos could provide an explanation for the LSND signal for \\bar\

V. Barger; D. Marfatia; K. Whisnant



Success Story Harshaw Trane and Hardin County Schools  

NLE Websites -- All DOE Office Websites (Extended Search)

Story Service and Product Provider Partner Customer Harshaw Trane Hardin County Schools 12700 Plantside Drive 65 W. A. Jenkins Road Louisville, KY 40299 Elizabethtown, KY...



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

L. Duvall 042009-043012 Kentucky KY Rev2 - Kentucky Energy Efficiency Program for Schools (KEEPS) Helps KY school districts reduce energy consumption & operating expenses....


Statewide Systematic Evaluation of Sudden, Unexpected Infant Death Classification: Results from a National Pilot Project  

E-Print Network (OSTI)

of Public Health, University of Kentucky, 333 Waller Ave. ,and Biostatistics, University of Kentucky, Lexington, KY,of Public Health, University of Kentucky, Lexington, KY, USA

Walsh, Sabrina L.; Kryscio, Richard; Holsinger, James W.; Krous, Henry F.



Energy Department Announces Student Teams, New Location for Solar...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Calgary (Calgary, Alberta, Canada) University of Louisville, Ball State University and University of Kentucky (Louisville, Ky.; Muncie, Ind.; and Lexington, Ky.) University...


Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael


Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake



E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...


St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...


Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...


Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...


ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks


miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha



Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.


Adherence to Scheduled Sessions in a Randomized Field Trial of Case Management: The Criminal JusticeDrug Abuse Treatment Studies Transitional Case Management Study  

E-Print Network (OSTI)

Alcohol Research, University of Kentucky, Lexington, KY, USAAlcohol Studies; University of Kentucky, Center on Drug and



Housing, Credit Constraints, and Macro Stability: The Secondary Mortgage Market and Reduced Cyclicality of Residential Investment  

E-Print Network (OSTI)

of Business & Economics University of Kentucky Lexington, KYBusiness & Economics, University of Kentucky, Lexington, KY

Peek, Joe; Wilcox, James A.



Rig 'dzin Tshe dbang mchog grub (1761-1829) et la constitution du rNying ma rgyud 'bum de sDe dge  

E-Print Network (OSTI)

les textes en une collection Ug palung, le fief de la ligne Zur3. Un article plus rcent encore de Mi Nyag Thubbstan chos dar fait le point sur les diverses versions existantes, mentionnantdailleurs un certain nombre dentre elles qui ne sont... and the Bai-ro- rgyud-bum, p. 9. 4 Mi nyag Thub bstan chos dar, rNying ma rgyud 'bum gyi mtshams sbyor, passim. 5 Voir Achard, La liste des Tantras du rNying mai rgyud bum selon ldition tablie par Kun mkhyen Jigs med gling pa, Revue d...

Achard, Jean-Luc



A propos de l'usage des termes nyin et srib dans le mDo smad chos 'byung  

E-Print Network (OSTI)

l'dition mDo smad chos 'byung, Lanzhou, Kan su'u mi rigs dpe skrun khang, 1982. 2 J'en ai dj trait, pour un autre point ("A propos de notations gographiques dans l'A mdo chos 'byung", Tibet, Past and Present, Tibetan Studies I, Leiden... 63 : " sPu rang nas shar smad kyi phyogs su mi ring bar Klo bo sMan thang zer ba'i yul yod pa": "Not far in a direction down eastward from Spu-rangs is the region called Klo-bo sman-thang"), elle ne l'est pas pour une rgion moins connue ou des...

Chayet, Anne



Utility-Scale Smart Meter Deployments, Plans & Proposals  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

edisonfoundation.net/IEE edisonfoundation.net/IEE Utility-Scale Smart Meter Deployments, Plans & Proposals April 2010 Utility State Target Number of Meters Notes Resources AEP 1 IN, KY, MI, OH, OK, TX, VA, WV 5,000,000 AEP plans on deploying smart meters to all customers within their service territory and have deployed 10,000 meters to customers in South Bend, IN, and are presently deploying another 700,000 to AEP-Texas customers. Timing for the remaining deployments will depend on specific conditions in each of the seven operating company subsidiaries. AEP Corporate Sustainability Report 2009 2 Allegheny Power MD, PA, WV 700,000 Allegheny launched pilots in Morgantown, WV and Urbana, MD to test smart meters and thermostats (1,140 meters installed). In PA, Act 129 (2008)


Louisville, KY Led by Debbie Grusenmeyer (Extension Associate/ PRO-DAIRY Youth Specialist) and Matt Young (Cornell Animal Science '02) a team of New York 4-H youth recently won the National 4-H  

E-Print Network (OSTI)

) and Matt Young (Cornell Animal Science '02) a team of New York 4-H youth recently won the National 4-H Dairy Quiz Bowl Championship title for the 10th time. The 33rd annual North American Invitational 4-H Dairy Quiz Bowl Contest was held at the North American International Livestock Exposition in Louisville

Keinan, Alon


EIA - Natural Gas Pipeline Network - Largest Natural Gas Pipeline Systems  

U.S. Energy Information Administration (EIA) Indexed Site

Interstate Pipelines Table Interstate Pipelines Table About U.S. Natural Gas Pipelines - Transporting Natural Gas based on data through 2007/2008 with selected updates Thirty Largest U.S. Interstate Natural Gas Pipeline Systems, 2008 (Ranked by system capacity) Pipeline Name Market Regions Served Primary Supply Regions States in Which Pipeline Operates Transported in 2007 (million dekatherm)1 System Capacity (MMcf/d) 2 System Mileage Columbia Gas Transmission Co. Northeast Southwest, Appalachia DE, PA, MD, KY, NC, NJ, NY, OH, VA, WV 1,849 9,350 10,365 Transcontinental Gas Pipeline Co. Northeast, Southeast Southwest AL, GA, LA, MD, MS, NC, NY, SC, TX, VA, GM 2,670 8,466 10,450 Northern Natural Gas Co. Central, Midwest Southwest IA, IL, KS, NE, NM, OK, SD, TX, WI, GM 1,055 7,442 15,874 Texas Eastern Transmission Corp.


Abstract for David Chamulak  

NLE Websites -- All DOE Office Websites (Extended Search)

Michigan State University, East Lansing, MI Michigan State University, East Lansing, MI The Effect of Ne-22 on the Thermonuclear Processes in White Dwarf Supernovae Type Ia supernovae (SNe Ia) are among the most luminous events in the universe. A single SN Ia at maximum light is as bright as its host galaxy. This property along with the ability to calibrate their light curves has made SNe Ia the premier standard candle for measuring cosmological distances. SNe Ia have recently been found to fall into two populations, a "prompt", and a "tardy" type. The "prompt" type supernovae have been observed to be on average brighter then their "tardy" relatives. It is currently unknown what causes the dispersion in the brightness of SNe Ia, but one idea could be the composition of the progenitor star. Ne-22 is the


Les bKa'brgyad - Sources canoniques et tradition de Nyangral Nyima 'od zer  

E-Print Network (OSTI)

la Pense, li la famille du bouddha Ak?obhya (Thugs Mi bskyod pa'i rigs) nomm dPal Heruka snying rje rol pa'i rgyud (?r?-heruka-karu??kr??ita-tantra), tabli par l'?c?rya H??- kara12 , venu de l'Inde de l'est, prs de Zahor (Est du Bengale) (r... mi tra, Pra chen ha ti, Rum bu ghu ya dhe ba, Dha na sang tri, Shan ting ghar ba. 21 'Ju mi pham (s.d., vol. 21 : 15) mentionne galement cette neuvime cassette, dont les autres gter ston qui ont dcouvert des cycles de bKa' brgyad ne parlent pas...

Sampel, Tenzin




NLE Websites -- All DOE Office Websites (Extended Search)

Full data base of agricultural experiments used in this study. Full data base of agricultural experiments used in this study. Site ID 1 Tillage 2 Crop 3 Fertilizer (kg/ha/yr) Sample year Sampling Depth (cm) Depth increment (cm) 4 SOC (%) 4 SOC (g/m^2) KY01 n/a sod n/a 1975 0-5 5 2.70 KY01 n/a sod n/a 1975 5-15 10 1.39 KY01 n/a sod n/a 1975 15-30 15 0.79 KY01 n/a sod n/a 1980 0-5 5 3.81 KY01 n/a sod n/a 1980 5-15 10 1.73 KY01 n/a sod n/a 1980 15-30 15 0.90 KY01 n/a sod n/a 1989 0-5 5 3.11 KY01 n/a sod n/a 1989 5-15 10 1.41 KY01 n/a sod n/a 1989 15-30 15 1.11 KY01 CT corn 0 1975 0-5 5 1.33 KY01 CT corn 0 1975 5-15 10 1.24 KY01 CT corn 0 1975 15-30 15 0.68 KY01 CT corn 0 1980 0-5 5 1.25 KY01 CT corn 0 1980 5-15 10 1.38 KY01 CT corn 0 1980 15-30 15 0.78 KY01 CT corn 0 1989 0-5 5 1.31 KY01 CT corn 0 1989 5-15 10 1.55



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Kentucky EE SEP ARRA PMC 2009 Vicki L. Duvall 042009-043012 Kentucky KY Rev2 Green Bank of KY Revolving loan program for EE measures in buildings. Corrected NEPA determination...



U.S. Energy Information Administration (EIA) Indexed Site

City of","KY",91,1,907,15235,455,6879,1517,26862,55,774,2934,49750 5748,"Electric Energy Inc","KY",91,1,0,0,0,0,12926,698742,0,0,12926,698742 6708,"Frankfort City...


Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","11292013" ,"Excel File Name:","n9050ky2a.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn9050ky2a.htm" ,"Source:","Energy Information...



U.S. Energy Information Administration (EIA) Indexed Site

","KY",97,1,45204,811671,10520,195006,19029,468302,729,14444,75483,1489422 5748,"Electric Energy Inc","KY",97,1,0,0,0,0,14568,813077,0,0,14568,813077 7604,"Green River Electric...

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


FetterGroup: Award Recipient for the ENERGY STAR Challenge for...  

NLE Websites -- All DOE Office Websites (Extended Search)

Award Recipient for the ENERGY STAR Challenge for Industry FetterGroup Headquarters Facility 700 Locust Lane Louisville, KY 40217 Fetter was founded in Louisville, KY in 1888, and...


DOE Solar Decathlon: 2009 University of Kentucky  

NLE Websites -- All DOE Office Websites (Extended Search)

logo on the left chest. Behind the team is a promotional sign for the s*ky blue house. Kentucky team members say their s*ky blue house is designed by Kentucky but for the...


JOURNALOF NEUROPHYSIOLOGY Vol. 76, No. 2, August 1996. Printed in U.S.A.  

E-Print Network (OSTI)

;GERVAIS, KLEINFELD. DELANEY, AND GELPERIN Depol. 0 - .Ww,t) F(KY) Hyperpol. 12 3456 7 Spatial Uniform

Kleinfeld, David


Superalloy Recycling 1976-1986  

Science Conference Proceedings (OSTI)

NY, Princeton,. KY ........ Spectrum Alloys Inc., Los Angeles, CA ........................ Stoody Deloro Stellite,. Inc., Industry,. CA ................... Suissman and Blumenthal,


Is U3Ni3Sn4 best described as near a quantum critical point?  

E-Print Network (OSTI)

and Astronomy, University of Kentucky, Lexington, KY 40506-76SF00098. Work at the University of Kentucky was supported

Booth, C.H.; Shlyk, L.; Nenkov, K.; Huber, J.G.; De Long, L.E.



Predicting the Service-Life of Concrete Structures Exposed to ...  

Laval University CEMENTITIOUS MATERIALS FOR WASTE TREATMENT, ... KY) Questions? Multi-ionic model. Transport properties Modeling the effect of ...


Tuesday Morning Sessions - TMS  

Science Conference Proceedings (OSTI)

February 6, 1996 Location: Anaheim Convention Center. Session Chairperson: James G. Morris, 175 Anderson Hall, University of Kentucky, Lexington, KY...


Wednesday Afternoon Sessions  

Science Conference Proceedings (OSTI)

Program Organizer: Professor James G. Morris, Chemical & Materials Engineering, Director, Light Metals Research Labs., University of Kentucky, Lexington, KY...


Technology Commercialization Showcase 2008: Office of the ...  

South Dakota State University, Brookings, SD. Cornell University, Ithaca, NY. University of Tennessee, Knoxville, TN. ... KY) Mascoma (Monroe County, ...


Welcome to the second edition of C&W's Energy and Sustainability Task Force Ne  

NLE Websites -- All DOE Office Websites (Extended Search)

second edition of C&W's Energy and Sustainability Task Force Newsletter. This second edition of C&W's Energy and Sustainability Task Force Newsletter. This publication illustrates how C&W is delivering on its commitment to enhance the environmental performance of commercial real estate. C&W Managed Properties Earn LEED Volume Certification In January 2010, 18 properties under C&W management earned LEED (Leadership in Energy and Environmental Design) certification utilizing the U.S. Green Building Council's (USGBC) Portfolio Program and volume certification process. More than half of the properties certified at the Platinum and Gold levels. Working closely with our clients, C&W is


Klein-NERAC NE education taskforce report 5-18-04  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Department of Department of Nuclear Engineering & Radiation Health Physics Report of the Nuclear Energy Research Advisory Committee Nuclear Power Engineering Curriculum Task Force April 7, 2004 Department of Nuclear Engineering & Radiation Health Physics Task Force Members * Andrew C. Klein, Chair, Oregon State University * James F. Stubbins, University of Illinois, Champaign-Urbana * Gilbert Brown, University of Massachusetts, Lowell * Harold Ray, Southern California Edison * Eugene S. Grecheck, Dominion Energy Department of Nuclear Engineering & Radiation Health Physics Primary Concern Expressed * Nuclear engineering curricula had changed over recent times * No longer producing engineers with training optimal to the needs of the power industry Department of Nuclear Engineering


Microsoft PowerPoint - NE FY2012 Budget, SMR, and BRC 121311.pptx  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Update Update Dr. Peter Lyons Assistant Secretary for Nuclear Energy U.S. Department of Energy Nuclear Energy Advisory Committee Washington, DC December 13, 2011 2 Overview of NEAC Rotation Policy NEAC Statistics * Prior to new members being added in 2009, the average term for the Committee was about 10 years * Reappointed all 16 members with 5 rotating out by September 30 th 2012 * Rotating Members: John Ahearne (Vice-Chair), Marv Fertel, Thomas Cochran, Allen Sessoms, and Neil Todreas * Added Members: Matthew Bunn, Margaret Chu, Susan Eisenhower, Mujid Kazimi, Regis Matzie, Richard Meserve, and Alfred Sattelberger * Disciplines of new members include: Applied Physics, Fuel Element Design, Energy Efficiency, National Security, Advanced Reactor Development, and Nuclear Non-proliferation Issues.



Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

R. Shane Johnson R. Shane Johnson Chief Operating Officer for Nuclear Energy U.S. Department of Energy before the Subcommittee on Energy Senate Committee on Energy and Natural Resources on S. 3233, the Surplus Uranium Disposition Act of 2010 June 15, 2010 Introduction Thank you, Madam Chairman, Ranking Member Risch, and Members of the Subcommittee. I appreciate this opportunity to appear before you and comment on legislation under consideration by the Committee, as well as to provide information on the Department of Energy's management and disposition of its excess uranium. The Administration continues to view nuclear power as an important element in its strategy to increase energy security and combat climate change. A strong domestic nuclear industry supports the expansion of clean, carbon-free nuclear energy in the


NE-23 List of California Sites Hattie Carwell. SAN/NSQA Division  

Office of Legacy Management (LM)

Hattie Carwell. SAN/NSQA Division Hattie Carwell. SAN/NSQA Division Attached for your information is the list Of Callfornia sites we identified in our search of Manhattdn Engineer District records for the Formerly Utilized Sites Remedial Action Program (FUSRAP). None of the facilities listed qualified for FUSRAP. The only site in California that was included in FUSRAP was Gilman Hall on the University of California-Berkeley Campus. All California sites that are in our Surplus Facilities Management Program are under San Francisco Operations and are at the Santa Susana Field Laboratory or the University of California-Davis. If you have questions on any of the sites on th*? list, please call me at FTS 233-5439. Andrew Wallo III, Designation and Certification Manager Division of Facilitv and Site


Microsoft Word - N01401_NE and 4-5 Closure Mon Plan.doc  

Office of Legacy Management (LM)

Closure Monitoring Plan for the Closure Monitoring Plan for the Northeast Site and 4.5 Acre Site August 2009 LMS/PIN/N01401 This page intentionally left blank LMS/PIN/N01401 Pinellas Environmental Restoration Project Closure Monitoring Plan for the Northeast Site and 4.5 Acre Site August 2009 This page intentionally left blank U.S. Department of Energy Closure Monitoring Plan for the Northeast Site and 4.5 Acre Site July 2009 Doc. No. N01401 Page i Contents 1.0 Introduction......................................................................................................................... 1 2.0 Summary of Source Removal Activities............................................................................. 1 3.0 Delineation of Contaminant Plumes ...................................................................................



E-Print Network (OSTI)

and J. R. Huizenga, Nuclear Fission, Academic Press, N.Y. ,nuclear properties such as particle emission, and the systematics of fission

Moulton, James Bennett



TransForum v8n1 - EcoCAR: The NeXt Challenge  

NLE Websites -- All DOE Office Websites (Extended Search)

Mike Wahlstrom and DOEs Steven Boyd perform a safety inspection on U. Tennessees vehicle at the Challenge X Winter Workshop in Los Angeles. EcoCAR logo Argonnes Mike...


Overview of DOE-NE Structural Materials Research, Materials Challenges and Operating Conditions  

Science Conference Proceedings (OSTI)

This presentation summarized materials conditions for application of nanomaterials to reactor components. Material performance is essential to reactor performance, economics, and safety. A modern reactor design utilizes many different materials and material systems to achieve safe and reliable performance. Material performance in these harsh environments is very complex and many different forms of degradation may occur (often together in synergistic fashions). New materials science techniques may also help understand degradation modes and develop new manufacturing and fabrication techniques.

Maloy, Stuart A. [Los Alamos National Laboratory; Busby, Jeremy T. [ORNL



OMAHA, NE, DISTRICT This district comprises portions of Montana, Wyoming, North Dakota, South Dakota, Minnesota, Colorado,  

E-Print Network (OSTI)

operation and maintenance activities continued. In FY09 an ARRA contract was awarded to perform testing

US Army Corps of Engineers


EcoCAR: The NeXt Challenge North America's Premier Collegiate...  

NLE Websites -- All DOE Office Websites (Extended Search)

and demonstration of advanced propulsion and alternative fuel technologies and to train the next generation of engineers to lead the industry in the 21st century. A...

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Ne?gali? asmen? sociokult?rinis ugdymas Utenos miesto bendruomen?je.  

E-Print Network (OSTI)

??After Lithuania has entered the world community not equal position of some social groups in society, especially disabled, came to light. Although disabled people are (more)

Treinien?,; Daiva



Geophysical imaging methods for analysis of the Krafla Geothermal Field, NE Iceland  

E-Print Network (OSTI)

Joint geophysical imaging techniques have the potential to be reliable methods for characterizing geothermal sites and reservoirs while reducing drilling and production risks. In this study, we applied a finite difference ...

Parker, Beatrice Smith



Magnetostratigraphy and small mammals of the Late Oligocene Banovii basin in NE Bosnia and Herzegovina  

E-Print Network (OSTI)

(AFEM) Berlin 08/14/61 06/01/63 X X X X X Bosnia and Herzegovina (Joint Endeavor) 11/20/95 12/20/96 X X X X X Bosnia and Herzegovina (Joint Guard) 12/20/96 Present X X X X X Cambodia 03/29/73 08/15/73 X X

Utrecht, Universiteit


Microsoft Word - N01357_NE Site Final LDA Report.doc  

Office of Legacy Management (LM)

Florida Statutes, and Rule 62-621.300(4), F.A.C., pursuant to FDEP's federally approved National Pollutant Discharge Elimination System storm water regulatory program. An FDEP...


NE Scientists Chien, Sheen, Raptis and Wang win R&D 100 Award  

NLE Websites -- All DOE Office Websites (Extended Search)

environment. The Argonne PAS System can also be used for environmental monitoring, crime scene forensics and cargo and food inspections. Photoacoustic Spectroscopy (PAS)...


Synthetic studies toward palau򡭩ne and enantioselective total synthesis of biogenetically related (+)-phakellin and (+)-monobromophakellin  

E-Print Network (OSTI)

Oroidin alkaloids, also known as pyrrole-imidazole alkaloids, have become a hot area of chemical and biological research due to their diverse and intriguing structural features and biological activities. Palau'amine (i), one of the hexacyclic oroidin-derived secondary metabolites, contains a fully substituted chloro-cyclopentane ring, a piperazinone moiety and two cyclic guanidines. With the uniqueness and complexity of its structure, palauamine has been a synthetic challenge and has not yet succumbed to total synthesis. The overall objective of this work was to explore synthetic pathways toward palauamine and biogenetically related congeners. Most of the work was focused on developing a synthetic pathway for the palauamine structure proposed in its isolation report dated back to 1993. Starting from a Diels-Alder adduct (iii), oxidation/chlorination followed by phakellin (ii) annulation afforded an advanced pentacyclic intermediate possessing all the carbon framework and all but one ring system of palauamine. Recently, however, a series of reports questioned the originally proposed palauamine structure and called for a revision of the stereochemistry of two carbon centers (iv). Now palauamine has an identical chlorocyclopentane core with axinellamine (vi). With the target changed, we devised a new biomimetic pathway toward both natural products via a common intermediate (v), which was synthesized in 12 steps from the Diels-Alder adduct (iii).

Wang, Shaohui



EcoCAR: The NeXt Challenge | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

hybrid electric drives. The teams using plug-in hybrid electric and extended-range electric drives have also adapted their vehicles to run on either E85 (85% ethanol, 15%...


Does plant richness influence animal richness? the mammals of Catalonia (NE Spain)  

E-Print Network (OSTI)

B.A. & Porter, E.E. (2003) Does herbivore diversity depend247252 BIODIVERSITY RESEARCH Does plant richness influencenot directly causal. This does not mean that plants do not

Hawkins, Bradford A.; Pausas, J G



NE-23 List of California Sites Hattie Carwell. SAN/NSQA Division  

Office of Legacy Management (LM)

Attached for your information is the list Of Callfornia sites we identified in our search of Manhattdn Engineer District records for the Formerly Utilized Sites Remedial Action...


Solubility of Gases in Glass. II. He, Ne, and H2 in Fused Silica  

Science Conference Proceedings (OSTI)

The statistical thermodynamics of the gas?in?glass system provides a basic model of both physical and chemical solubility. The physical solubility result is essentially equivalent to that for monatomic solubility. The chemical solubility result is dependent upon the specific system involved. The model was compared with experiment for a variety of systems. Helium and neon in fused silica were examples of the physical solubility of monatomic gases. Variations of the thermal history of the fused silica did not appear to have a measurable effect on physical solubility as evidenced in the helium data. Hydrogen in fused silica was an example of the physical solubility of polyatomic gases. Physical solubility was measured by a modified Seiverts technique and was characterized by a linear dependence on pressure. Binding energies for the physically dissolved species were of the order expected for van der Waals bonding. Vibrational frequencies were on the order of 1013 sec?1 with the heavier species having the lower frequencies. Hydrogen in fused silica was also an example of the chemical solubility of polyatomic gases. The literature gave data for the chemical solution of hydrogen in fused silica

James F. Shackelford; Perry L. Studt; Richard M. Fulrath



ANL/NE-12/43 Light Water Reactor Sustainability (LWRS)  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ANLNE-1243 Light Water Reactor Sustainability (LWRS) Program - R&D Roadmap for Non-Destructive Evaluation (NDE) of Fatigue Damage in Piping ...


Klein-NERAC NE education taskforce report 5-18-04  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

of radiation with matter, radiation protection, reactor physics and theory, reactor thermal hydraulics, nuclear engineering design. * Most also include nuclear reactor...


DOE-NE Light Water Reactor Sustainability Program and EPRI Long...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- Joint Research and Development Plan April 2013 U.S. Department of Energy Office of Nuclear Energy DISCLAIMER This information was prepared as an account of work sponsored by an...



co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...


Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George


UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...


May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po



"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

May ________. A vistas la pornografa. Primera Hora, 22la medida contra la pornografa. El Nuevo Da, 13 Junecomunicacin contra la pornografa. El Nuevo Da, 16 May

Rivera, Petra Raquel



Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer

Note: This page contains sample records for the topic "ky mi ne" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.
