Powered by Deep Web Technologies
Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY...


Category:Wichita, KS | Open Energy Information  

Open Energy Info (EERE)

KS KS Jump to: navigation, search Go Back to PV Economics By Location Media in category "Wichita, KS" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Wichita KS Westar Energy Inc.png SVFullServiceRestauran... 60 KB SVHospital Wichita KS Westar Energy Inc.png SVHospital Wichita KS ... 64 KB SVLargeHotel Wichita KS Westar Energy Inc.png SVLargeHotel Wichita K... 59 KB SVLargeOffice Wichita KS Westar Energy Inc.png SVLargeOffice Wichita ... 64 KB SVMediumOffice Wichita KS Westar Energy Inc.png SVMediumOffice Wichita... 62 KB SVMidriseApartment Wichita KS Westar Energy Inc.png SVMidriseApartment Wic... 61 KB SVOutPatient Wichita KS Westar Energy Inc.png SVOutPatient Wichita K... 62 KB SVPrimarySchool Wichita KS Westar Energy Inc.png


Category:Goodland, KS | Open Energy Information  

Open Energy Info (EERE)

KS KS Jump to: navigation, search Go Back to PV Economics By Location Media in category "Goodland, KS" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Goodland KS Westar Energy Inc.png SVFullServiceRestauran... 60 KB SVHospital Goodland KS Westar Energy Inc.png SVHospital Goodland KS... 63 KB SVLargeHotel Goodland KS Westar Energy Inc.png SVLargeHotel Goodland ... 59 KB SVLargeOffice Goodland KS Westar Energy Inc.png SVLargeOffice Goodland... 65 KB SVMediumOffice Goodland KS Westar Energy Inc.png SVMediumOffice Goodlan... 63 KB SVMidriseApartment Goodland KS Westar Energy Inc.png SVMidriseApartment Goo... 60 KB SVOutPatient Goodland KS Westar Energy Inc.png SVOutPatient Goodland ... 63 KB SVPrimarySchool Goodland KS Westar Energy Inc.png



Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use


DOE - Office of Legacy Management -- Spencer Chemical Co - KS 0-01  

Office of Legacy Management (LM)

KS 0-01 KS 0-01 FUSRAP Considered Sites Site: SPENCER CHEMICAL CO. (KS.0-01 ) Eliminated from further consideration under FUSRAP - an AEC licensed operation Designated Name: Not Designated Alternate Name: Jayhawk Works KS.0-01-1 Location: Pittsburg , Kansas KS.0-01-1 Evaluation Year: 1985 KS.0-01-2 Site Operations: Processed enriched uranium (UF-6) and scrap to produce primarily uranium dioxide (UO-2) under AEC licenses. KS.0-01-3 KS.0-01-4 Site Disposition: Eliminated - No Authority - AEC licensed KS.0-01-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Normal and Enriched Uranium; Thorium KS.0-01-6 Radiological Survey(s): Yes KS.0-01-5 Site Status: Eliminated from further consideration under FUSRAP - an AEC licensed operation


Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...


US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.


RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.


A new limit on the CP violating decay KS -> 3pi0 with the KLOE experiment  

E-Print Network (OSTI)

We have carried out a new direct search for the CP violating decay KS -> 3pi0 with 1.7 fb^-1 of e+e- collisions collected by the KLOE detector at the phi-factory DAFNE. We have searched for this decay in a sample of about 5.9 x 10^8 KS KL events tagging the KS by means of the KL interaction in the calorimeter and requiring six prompt photons. With respect to our previous search, the analysis has been improved by increasing of a factor four the tagged sample and by a more effective background rejection of fake KS tags and spurious clusters. We find no candidates in data and simulated background samples, while we expect 0.12 standard model events. Normalizing to the number of KS -> 2pi0 events in the same sample, we set the upper limit on BR(KS -> 3pi0 < 2.6 x 10^-8 at 90% C.L., five times lower than the previous limit. We also set the upper limit on the eta_000 parameter, |eta_000 | < 0.0088 at 90% C.L., improving by a factor two the latest direct measurement.

Babusci, D; Balwierz-Pytko, I; Bencivenni, G; Bini, C; Bloise, C; Bossi, F; Branchini, P; Budano, A; Balkestahl, L Caldeira; Capon, G; Ceradini, F; Ciambrone, P; Curciarello, F; Czerwinski, E; Dane, E; De Leo, V; De Lucia, E; De Robertis, G; De Santis, A; Di Domenico, A; Di Donato, C; Di Salvo, R; Domenici, D; Erriquez, O; Fanizzi, G; Fantini, A; Felici, G; Fiore, S; Franzini, P; Gauzzi, P; Giardina, G; Giovannella, S; Gonnella, F; Graziani, E; Happacher, F; Heijkenskjold, L; Hoistad, B; Iafolla, L; Jacewicz, M; Johansson, T; Kacprzak, K; Kupsc, A; Lee-Franzini, J; Leverington, B; Loddo, F; Loffredo, S; Mandaglio, G; Martemianov, M; Martini, M; Mascolo, M; Messi, R; Miscetti, S; Morello, G; Moricciani, D; Moskal, P; Nguyen, F; Passeri, A; Patera, V; Longhi, I Prado; Ranieri, A; Redmer, C F; Santangelo, P; Sarra, I; Schioppa, M; Sciascia, B; Silarski, M; Taccini, C; Tortora, L; Venanzoni, G; Wislicki, W; Wolke, M; Zdebik, J




NLE Websites -- All DOE Office Websites (Extended Search)

MoWiTT: Mobile Window Thermal Test Facility The window has come a long way since the days when it was a single pane of glass in a wood frame. Low-emissivity windows were designed...


Control of Well Ks-8 in the Kilauea Lower East Rift Zone | Open Energy  

Open Energy Info (EERE)

of Well Ks-8 in the Kilauea Lower East Rift Zone of Well Ks-8 in the Kilauea Lower East Rift Zone Jump to: navigation, search OpenEI Reference LibraryAdd to library Conference Paper: Control of Well Ks-8 in the Kilauea Lower East Rift Zone Abstract In June 1991, a well located in Hawaii kicked and unloaded at 3,476 ft (1,059 m). This well was estimatedto have a possible bottomhole temperature of 650°F (343°C)and a reservoir pressure approaching 2,300 psi 5,858 Immediate attempts to kill the well were unsuccessful, and the long processof well control was started. Besides the harsh geological and reservoir conditions encountered,the scarce availability of materials in a remote location and long distance transportation of necessary equipment figured heavily in to the time delay of the final kill procedure of the


DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed


File:USDA-CE-Production-GIFmaps-KS.pdf | Open Energy Information  

Open Energy Info (EERE)

KS.pdf KS.pdf Jump to: navigation, search File File history File usage Kansas Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 317 KB, MIME type: application/pdf) Description Kansas Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Kansas External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:14, 27 December 2010 Thumbnail for version as of 16:14, 27 December 2010 1,650 × 1,275 (317 KB) MapBot (Talk | contribs) Automated bot upload



NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)


Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper



DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4


DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP


Thermodynamic Assessment of Ce-Mo, Mo-La, Mo-Y, Ce-V, La-V ...  

Science Conference Proceedings (OSTI)

In this work, six binary systems, Ce-Mo, Mo-La, Mo-Y, Ce-V, La-V and V-Y were thermodynamically assessed based on available experimental data in the...

Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...



National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)


US WNC MO Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

WNC MO WNC MO Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US WNC MO Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 3,000 6,000 9,000 12,000 15,000 US WNC MO Site Consumption kilowatthours $0 $300 $600 $900 $1,200 $1,500 US WNC MO Expenditures dollars ELECTRICITY ONLY average per household * Missouri households consume an average of 100 million Btu per year, 12% more than the U.S. average. * Average household energy costs in Missouri are slightly less than the national average, primarily due to historically lower residential electricity prices in the state. * Missouri homes are typically larger than homes in other states and are more likely to be attached or detached single-family housing units.



NLE Websites -- All DOE Office Websites (Extended Search)

4 4 Myriam Perez De la Rosa1, Gilles Berhault2, Apurva Mehta3, and Russell R. Chianelli1 1University of Texas at El Paso, Materials Research Technology Institute, El Paso, TX 2Institut de Recherches sur la Catalyse, CNRS, Villeurbanne cedex, France 3Stanford Synchrotron Radiation Laboratory, Menlo Park, CA Figure 1: MoS2 layered structure. As the world economy continues to expand the demand for petroleum based fuel increases and the price of these fuels rises. The rising price of fuel has another consequence: refiners tend to purchase cheaper fuels of poorer quality. These poor quality fuels contain increasing amounts of sulfur and other pollutants leading to a decline in air quality worldwide. A recent New York Times article described the major impact a growing Chinese economy


DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.


miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either


Benchmarks for the New-Physics Search through CP Violation in B^0->pi^0 K_S  

E-Print Network (OSTI)

Using isospin relations, we predict the Standard-Model correlation between S_{pi^0 K_S}=(sin 2beta)_{pi^0 K_S} and A_{pi^0 K_S}, the mixing-induced and direct CP asymmetries of B^0-> pi^0 K_S. The calculation uses flavour SU(3) only to fix the isospin-3/2 amplitude through the B^\\pm->pi^\\pm pi^0 branching ratio, and thus has a small irreducible theoretical error. It can reach percent level precision thanks to expected future lattice-QCD progress for the calculation of the relevant SU(3)-breaking form-factor ratio, and serves as a benchmark for new-physics searches. We obtain an interesting picture in the A_{pi^0 K_S} - S_{pi^0 K_S} plane, where the current experimental data show a discrepancy with the Standard Model, and comment on the direct CP asymmetries of B^0->pi^-K^+ and B^+ -> pi^0 K^+. A modified electroweak penguin with a large new CP-violating phase can explain the discrepancy and allows us to accommodate also the corresponding data for other b->s penguin-dominated decays.

Robert Fleischer; Sebastian Jager; Dan Pirjol; Jure Zupan



Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...


DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical


DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated


MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab



Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)



DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP


RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state


Compaction and Sintering of Mo Powders  

SciTech Connect

To support the development of Mo-99 production by NorthStar Medical Technologies, LLC, Mo metal powders were evaluated for compaction and sintering characteristics as they relate to Mo-100 accelerator target disk fabrication. Powders having a natural isotope distribution and enriched Mo-100 powder were examined. Various powder characteristics are shown to have an effect on both the compaction and sintering behavior. Natural Mo powders could be cold pressed directly to >90% density. All of the powders, including the Mo-100 samples, could be sintered after cold pressing to >90% density. As an example, a compacted Mo-100 disk reached 89.7% density (9.52 g/cm3) after sintering at 1000 C for 1 hr. in flowing Ar/4%H2. Higher sintering temperatures were required for other powder samples. The relationships between processing conditions and the resulting densities of consolidated Mo disks will be presented.

Nunn, Stephen D [ORNL; Kiggans, Jim [ORNL; Bryan, Chris [ORNL



Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio



DOE - Office of Legacy Management -- St Louis Airport - MO 01  

Office of Legacy Management (LM)

Airport - MO 01 Airport - MO 01 FUSRAP Considered Sites St. Louis Airport, MO Alternate Name(s): Airport Site St. Louis Airport Storage Site (SLAPS) Former Robertson Storage Area Robertson Airport MO.01-1 MO.01-2 Location: Brown Road, Robertson, Missouri MO.01-2 Historical Operations: Stored uranium process residues containing uranium, radium, and thorium for the MED and AEC. MO.01-2 MO.01-3 MO.01-4 Eligibility Determination: Eligible MO.01-1 MO.01-7 Radiological Survey(s): Assessment Surveys MO.01-4 MO.01-5 Site Status: Cleanup in progress by U.S. Army Corps of Engineers. MO.01-6 USACE Website Long-term Care Requirements: To be determined upon completion. Also see Documents Related to St. Louis Airport, MO MO.01-1 - DOE Memorandum; Coffman to LaGrone; Subject: Authorization


Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png


Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls

Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


DOE - Office of Legacy Management -- Latty Avenue Site - MO 04  

NLE Websites -- All DOE Office Websites (Extended Search)

Latty Avenue Site - MO 04 Latty Avenue Site - MO 04 FUSRAP Considered Sites Latty Avenue Site, MO Alternate Name(s): Futura Coatings Futura Chemical Company Facility Hazelwood Interim Storage Site (HISS) Former Cotter Site, Latty Avenue Properties Contemporary Metals Corp. Continental Mining and Milling MO.04-1 MO.04-2 MO.04-5 MO.04-6 MO.06-8 MO.06-11 Location: 9200 Latty Avenue, Hazelwood, Missouri MO.04-1 Historical Operations: Received, stored, and processed uranium residues for the AEC. Storage and processing were licensed by the AEC and NRC and resulted in contamination of uranium and thorium. MO.04-5 MO.04-6 Eligibility Determination: Eligible MO.04-3 MO.04-4 Radiological Survey(s): Assessment Surveys MO.04-2 MO.04-7 MO.04-8 MO.04-9 MO.04-10 MO.04-11 Site Status: Cleanup in progress by U.S. Army Corps of Engineers. MO.04-12


,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...


Inclusive production of $\\Lambda$, $K^0_s$ and exotic narrow resonances for systems $K_s^0 p$, $K_s^0 \\Lambda$, $\\Lambda p$ from p+propane interactions at 10 GeV/c  

E-Print Network (OSTI)

Experimental data from the 2m propane bubble chamber for production of $\\Lambda$, $K^0_s$ have been used to search of exotic baryon states, in the $K_s^0 p$, $K_s^0 \\Lambda$ and $\\Lambda p$ decay mode for the reaction p+propane at 10 GeV/c. The estimation of experimental inclusive cross sections for $\\Lambda$ and $K^0_s$ production in the p$^{12}C$ collision is equal to $\\sigma_{\\Lambda}$= 13.3$\\pm$1.7 mb and $\\sigma_{K^0_s}$= 3.8$\\pm$0.6 mb, respectively. The measured $\\Lambda /\\pi^+$ ratio from pC reaction is equal to (5.3$\\pm0.8)*10^{-2}$. The experimental $\\Lambda /\\pi^+$ ratio from the pC reaction is approximately two times larger than the $\\Lambda /\\pi^+$ ratio simulated by FRITIOF model from the pC reaction. The invariant mass spectrum $\\Lambda K^0_s$ registered narrow peaks in regions of 1750 and 1795 MeV/$c^2$. The statistical significance of these peaks has been estimated as 5.6 and 3.3 S.D., respectively. These would be candidates for the $N^0$ or the $\\Xi^0$ pentaquark states. The $pK^0_s$ invaria...

Aslanyan, P Z



Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.


RELAP5/MOD3.2 Assessment Using CHF Data from the KS-1 and V-200 Experiment Facilities  

SciTech Connect

The RELAP/MOD3.2 computer code has been assessed using rod bundle critical heat flux data from the KS-1 and V-200 facilities. This work was performed as part of the U.S. Department of Energys International Nuclear Safety Program, and is part of the effort addressing the capability of the RELAP5/MOD3.2 code to model transients in Soviet-designed reactors. Designated VVER Standard Problem 7, these tests addressed one of the important phenomena related to VVER behavior that the code needs to simulate well, core heat transfer. The code was judged to be in minimal agreement with the experiment data, consistently overpredicting the measured critical heat flux. It is recommended that a model development effort be undertaken to develop a critical heat flux model for RELAP5 that better represents the behavior in VVER rod bundles.

Bayless, Paul David



Category:Kansas City, MO | Open Energy Information  

Open Energy Info (EERE)

MO MO Jump to: navigation, search Go Back to PV Economics By Location Media in category "Kansas City, MO" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Kansas City MO Union Electric Co.png SVFullServiceRestauran... 74 KB SVHospital Kansas City MO Union Electric Co.png SVHospital Kansas City... 66 KB SVLargeHotel Kansas City MO Union Electric Co.png SVLargeHotel Kansas Ci... 66 KB SVLargeOffice Kansas City MO Union Electric Co.png SVLargeOffice Kansas C... 65 KB SVMediumOffice Kansas City MO Union Electric Co.png SVMediumOffice Kansas ... 65 KB SVMidriseApartment Kansas City MO Union Electric Co.png SVMidriseApartment Kan... 74 KB SVOutPatient Kansas City MO Union Electric Co.png SVOutPatient Kansas Ci... 66 KB SVPrimarySchool Kansas City MO Union Electric Co.png


Thermophysical Properties of U-10MO Alloy  

Science Conference Proceedings (OSTI)

This report provides an overview of thermophysical properties of unirradiated uranium alloyed with ten weight percent molybdenum (U 10Mo), with particular focus on those material properties needed for modeling of new fuels for HPRRs (High Performance Research Reactors). The report contains both historical data available in the literature on U-10Mo, as well as more recent results conducted by the Global Threat Reduction Initiative fuel development program. The main use of the report is intended as a standard U-10Mo alloy properties reference for reactor models and simulations.

A. M. Phillips; G. S. Mickum; D. E. Burkes



What is MoWiTT  

NLE Websites -- All DOE Office Websites (Extended Search)

the net energy flow through two window samples in side-by-side tests using ambient weather conditions. MoWiTT characterizes the net energy flow as a function of time and...


St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:


DOE - Office of Legacy Management -- Petrolite Corp - MO 08  

Office of Legacy Management (LM)

Petrolite Corp - MO 08 Petrolite Corp - MO 08 FUSRAP Considered Sites Site: PETROLITE CORP (MO.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: St. Louis , Missouri MO.08-1 Evaluation Year: 1987 MO.08-4 Site Operations: Research involving test quantities of radioactive materials. MO.08-2 Site Disposition: Eliminated - Licensed - Potential for contamination remote MO.08-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Flouride & Thorium Oxide MO.08-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to PETROLITE CORP MO.08-1 - Summary Paper; Title: License History for Petrolite Corporation, St. Louis (MO.8); dated 07/16/93; with three attachments (3


The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.



DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;


DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP


DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co


DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on


DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:


MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units


REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}



Gasoline and Diesel Fuel Update (EIA)


Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...



Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...



Gasoline and Diesel Fuel Update (EIA)




Annual Energy Outlook 2012 (EIA)



Accelerator Production Options for 99MO  

SciTech Connect

Shortages of {sup 99}Mo, the most commonly used diagnostic medical isotope, have caused great concern and have prompted numerous suggestions for alternate production methods. A wide variety of accelerator-based approaches have been suggested. In this paper we survey and compare the various accelerator-based approaches.

Bertsche, Kirk; /SLAC



Mo Type Phase in Long-Term Aged INCONEL Alloy  

Science Conference Proceedings (OSTI)

FORMATION OF A PtzMo TYPE PHASE IN LONG-TERM AGED lNCONEL@ ALLOY 686. Michael G. ... formation of a low-temperature iutermetallic Pt*Mo type .


MoWiTT: The Mobile Window Thermal Test Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

Airflow schematic MoWiTT: The Mobile Window Thermal Test Facility In the MoWiTT facility, efficient window-and-frame systems are measured to understand the flow of energy through...


Role of SrMoO{sub 4} in Sr{sub 2}MgMoO{sub 6} synthesis  

Science Conference Proceedings (OSTI)

Here we investigate the elemental and phase compositions during the solid-state synthesis of the promising SOFC-anode material, Sr{sub 2}MgMoO{sub 6}, and demonstrate that molybdenum does not notably evaporate under the normal synthesis conditions with temperatures up to 1200 {sup o}C due to the formation of SrMoO{sub 4} as an intermediate product at low temperatures, below 600 {sup o}C. However, partial decomposition of the Sr{sub 2}MgMoO{sub 6} phase becomes evident at the higher temperatures ({approx}1500 {sup o}C). The effect of SrMoO{sub 4} on the electrical conductivity of Sr{sub 2}MgMoO{sub 6} is evaluated by preparing a series of Sr{sub 2}MgMoO{sub 6} samples with different amounts of additional SrMoO{sub 4}. Under the reducing operation conditions of an SOFC anode the insulating SrMoO{sub 4} phase is apparently reduced to the highly conductive SrMoO{sub 3} phase. Percolation takes place with 20-30 wt% of SrMoO{sub 4} in a Sr{sub 2}MgMoO{sub 6} matrix, with a notable increase in electrical conductivity after reduction. Conductivity values of 14, 60 and 160 S/cm are determined at 800 {sup o}C in 5% H{sub 2}/Ar for the Sr{sub 2}MgMoO{sub 6} samples with 30, 40 and 50 wt% of added SrMoO{sub 4}, respectively. -- Graphical abstract: SrMoO{sub 4} is formed at low temperatures during the synthesis of Sr{sub 2}MgMoO{sub 6}, which prevents the volatilization of Mo from typical precursor mixtures of this promising SOFC anode material. SrMoO{sub 4} is insulating and it is often found as an impurity in Sr{sub 2}MgMoO{sub 6} samples. It is however readily reduced to highly conducting SrMoO{sub 3}. Composites of Sr{sub 2}MgMoO{sub 6} and SrMoO{sub 3} show increased electrical conductivities compared to pure Sr{sub 2}MgMoO{sub 6} under the reductive operation conditions of an SOFC anode. Display Omitted Highlights: {yields} Sr{sub 2}MgMoO{sub 6} is a promising SOFC anode material. {yields} During the Sr{sub 2}MgMoO{sub 6} synthesis SrMoO{sub 4} is formed at low temperatures. {yields} Formation of SrMoO{sub 4} effectively prevents volatilization of Mo at high temperatures. {yields} Insulating SrMoO{sub 4} reduces to highly conductive SrMoO{sub 3} under SOFC-anode conditions. {yields} Composites of Sr{sub 2}MgMoO{sub 6} and SrMoO{sub 3} show high electrical conductivities.

Vasala, S.; Yamauchi, H. [Laboratory of Inorganic Chemistry, Department of Chemistry, School of Chemical Technology, Aalto University, P.O. Box 16100, FI-00076 Aalto (Finland); Karppinen, M., E-mail: maarit.karppinen@aalto.f [Laboratory of Inorganic Chemistry, Department of Chemistry, School of Chemical Technology, Aalto University, P.O. Box 16100, FI-00076 Aalto (Finland)



Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel



MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani



Missouri Department of National Resources Energy Center Mo DNR | Open  

Open Energy Info (EERE)

Department of National Resources Energy Center Mo DNR Department of National Resources Energy Center Mo DNR Jump to: navigation, search Name Missouri Department of National Resources Energy Center (Mo DNR) Place Jefferson City, Missouri Zip 65102 Product Mo DNR manages the Energy Revolving Fund which assists public organisations in Missouri in financing energy efficient projects for their facilities. References Missouri Department of National Resources Energy Center (Mo DNR)[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Missouri Department of National Resources Energy Center (Mo DNR) is a company located in Jefferson City, Missouri . References ↑ "Missouri Department of National Resources Energy Center (Mo


Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)



Print http://us.mg4.mail.yahoo.com/neo/launch?.rand=deOsgk04ks40i Subject: RE: [s-w-h] b Solar verses wind efficiency  

E-Print Network (OSTI)

.yahoo.com/neo/launch?.rand=deOsgk04ks40i Subject: RE: [s-w-h] b Solar verses wind efficiency From: Michael Klemen (wind4energy;Print http://us.rng4.mail.yahoo.comlneo/launch?.rand=deOsgko4ks4 energy in the wind is proportional://www.ndsu.edu/ndsu/klemen/Perfect_Turbine.htm You can see that for an ideal real life wind turbine ("good turbine") the increase in energy


A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)



DOE - Office of Legacy Management -- United Nuclear Corp - MO 0-03  

Office of Legacy Management (LM)

United Nuclear Corp - MO 0-03 United Nuclear Corp - MO 0-03 FUSRAP Considered Sites Site: UNITED NUCLEAR CORP. (MO.0-03) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mallinckrodt Chemical Works Mallinckrodt Nuclear Corporation MO.0-03-1 MO.0-03-2 Location: Hematite , Missouri MO.0-03-1 Evaluation Year: Circa 1987 MO.0-03-3 Site Operations: Commercial fuel fabrication operation. Licensed to reclaim unirradiated enriched uranium from scrap generated in fuel fabrication and fuel material preparation. MO.0-03-1 MO.0-03-2 MO.0-03-3 MO.0-03-4 Site Disposition: Eliminated - NRC licensed - Commercial operations MO.0-03-3 MO.0-03-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MO.0-03-3 Radiological Survey(s): None Indicated


MoNDian Dark Matter, Entropic Gravity, and Infinite Statistics  

E-Print Network (OSTI)

We propose the concept of MoNDian dark matter which behaves like cold dark matter at cluster and cosmic scales but emulates modified Newtonian dynamics at the galactic scale. The connection between global physics and local galactic dynamics is implemented via entropic gravity. We also give an alternative formulation of MoNDian dark matter by using an effective gravitational Born-Infeld theory. In the latter approach, we show that the quanta of MoNDian dark matter obey infinite statistics.

Y. Jack Ng



Microstructure Characterization and Processing of U-Mo Alloy Fuels ...  

Science Conference Proceedings (OSTI)

molybdenum (Mo) fuels have been identified as a potential replacement for highly enriched uranium (HEU) dispersion fuels in high performance research...


Interdiffusion between Zr Diffusion Barrier and U-Mo Alloy  

Science Conference Proceedings (OSTI)

U-Mo alloys are being developed as low enrichment uranium fuels under the Reduced Enrichment for Research and Test Reactor (RERTR) program. Significant reactions have been observed between U-Mo fuels and Al or Al alloy matrix. Refractory metal Zr has been proposed as barrier material to reduce the interactions. In order to investigate the compatibility and barrier effects between U-Mo alloy and Zr, solid-to-solid U-10wt.%Mo vs. Zr diffusion couples were assembled and annealed at 600, 700, 800, 900 and 1000 C for various times. The microstructures and concentration profiles due to interdiffusion and reactions were examined via scanning electron microscopy and electron probe microanalysis, respectively. Intermetallic phase Mo2Zr was found at the interface and its population increased when annealing temperature decreased. Diffusion paths were also plotted on the U-Mo-Zr ternary phase diagrams with good consistency. The growth rate of interdiffusion zone between U-10wt.%Mo and Zr was also calculated under the assumption of parabolic diffusion, and was determined to be about 103 times lower than the growth rate of diffusional interaction layer found in diffusion couples U-10wt.%Mo vs. Al or Al-Si alloy. Other desirable physical properties of Zr as barrier material, such as neutron adsorption rate, melting point and thermal conductivity are presented as supplementary information to demonstrate the great potential of Zr as the diffusion barrier for U-Mo fuel systems in RERTR.

K. Huang; Y. Park; Y. H. Sohn



Balancing the Properties of Structural Mo-Borosilicide Alloys for ...  

Science Conference Proceedings (OSTI)

Symposium, Advanced Protective Coatings for Refractory Metals and Alloys. Presentation Title, Balancing the Properties of Structural Mo-Borosilicide Alloys for...

Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.



Co-Mo Electric Cooperative - Residential Energy Efficiency Rebate Program |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Co-Mo Electric Cooperative - Residential Energy Efficiency Rebate Co-Mo Electric Cooperative - Residential Energy Efficiency Rebate Program Co-Mo Electric Cooperative - Residential Energy Efficiency Rebate Program < Back Eligibility Commercial Residential Savings Category Heating & Cooling Commercial Heating & Cooling Heat Pumps Appliances & Electronics Water Heating Cooling Maximum Rebate Geothermal Heat Pumps: 10 ton maximum for Residential, 50 ton maximum for Commercial Program Info State Missouri Program Type Utility Rebate Program Rebate Amount Room AC: $50 Water Heater: $50 Air Source Heat Pumps: $150 per ton Dual Fuel Air Source Heat Pumps: $300 per ton Geothermal Heat Pumps (Closed Loop): up to $850 per ton Geothermal Heat Pumps (Open Loop or Replacement): $150 per ton Provider Co-Mo Electric Cooperative Co-Mo Electric Cooperative provides rebates to residential and commercial


Microsoft Word - Poster Abstract_2010_MO-SCI.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

* * Presenter High-Temperature Viscous Sealing Glasses for Solid Oxide Fuel Cells Cheol-Woon Kim * , Cindy L. Schwartz, Joe Szabo, Kevin S. Barr, and Ted E. Day MO-SCI Corporation, Rolla, MO 65401 * ckim@mo-sci.com; (573) 364-2338 Richard K. Brow ** and Zhongzhi Tang Department of Materials Science and Engineering and the Graduate Center for Materials Research, Missouri University of Science and Technology, Rolla, MO 65409-1170 ** brow@mst.edu; (573) 341-6812 MO-SCI Corporation and the Missouri University of Science and Technology successfully identified and tested several glass compositions that could be used as viscous seals for Solid Oxide Fuel Cells (SOFCs) through a SBIR Phase I project (DE-SC0002491). The glasses possess desirable viscosity characteristics- that is, they have softening points in the temperature range


DOE - Office of Legacy Management -- Rogers Iron Works Co - MO 10  

Office of Legacy Management (LM)

Rogers Iron Works Co - MO 10 Rogers Iron Works Co - MO 10 FUSRAP Considered Sites Site: ROGERS IRON WORKS CO. (MO.10 ) Elimination from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Rogers Iron Co. MO.10-1 Location: Joplin , Missouri MO.10-1 Evaluation Year: 1990 MO.10-2 MO.10-3 Site Operations: Tested C-liner crushing methods. MO.10-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantities of material handled MO.10-3 MO.10-4 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium (Trace Amounts) MO.10-2 Radiological Survey(s): None Indicated Site Status: Elimination from consideration under FUSRAP Also see Documents Related to ROGERS IRON WORKS CO. MO.10-1 - National Lead Company of Ohio Analytical Data Sheet 9908;


Mo Year Report Period: EIA ID NUMBER:  

U.S. Energy Information Administration (EIA) Indexed Site

Version No: 2013.01 Mo Year Report Period: EIA ID NUMBER: http://www.eia.gov/survey/form/eia_14/instructions.pdf Mailing Address: Secure File Transfer option available at: (e.g., PO Box, RR) https://signon.eia.doe.gov/upload/noticeoog.jsp Electronic Transmission: The PC Electronic Zip Code - Data Reporting Option (PEDRO) is available. If interested in software, call (202) 586-9659. Email form to: OOG.SURVEYS@eia.doe.gov - - - - Fax form to: (202) 586-9772 Mail form to: Oil & Gas Survey Email address: U.S. Department of Energy Ben Franklin Station PO Box 279 Washington, DC 20044-0279 Questions? Call toll free: 1-800-638-8812 PADD 4 Type of Report (Check One ): (Thousands of dollars) (Thousands of barrels) PADD 2 PADD 3 PAD DISTRICT (a) Revision to Report:



National Nuclear Security Administration (NNSA)

Thomas R Mattsson Thomas R Mattsson Sandia National Laboratories Albuquerque, NM, USA Nils Sandberg -- KTH, Stockholm Richard Armiento -- Univ. Bayreuth, Germany Ann Mattsson -- Sandia National Laboratories Self-diffusion in Mo using the AM05 density functional Sandia is a multiprogram laboratory operated by Sandia Corporation, a Lockheed Martin Company, for the United States Department of Energy's National Nuclear Security Administration under contract DE-AC04-94AL85000. Joint U.S. Russia Conference on Advances in Materials Science Prague, Czech Republic Aug 31-Sept 3, 2009 SAND 2009-2197 C, 2009-3883 C, 2009-4713 C, and 2002-1323 P Vacancy mediated diffusion is the main mechanism for mass transport in solids *Vacancies are important for *Self-diffusion *Defect migration *Radiation damage/ swelling


DOE - Office of Legacy Management -- Tyson Valley Powder Farm - MO 11  

Office of Legacy Management (LM)

Tyson Valley Powder Farm - MO 11 Tyson Valley Powder Farm - MO 11 FUSRAP Considered Sites Site: TYSON VALLEY POWDER FARM (MO.11) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: St. Louis County , Missouri MO.11-1 Evaluation Year: 1987 MO.11-2 Site Operations: Storage of C-Special material (residue from production of uranium metal). MO.11-1 MO.11-2 MO.11-3 Site Disposition: Eliminated - Referred to Army Corps of Engineers MO.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MO.11-3 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to TYSON VALLEY POWDER FARM MO.11-1 - Letter; Dickenson to Duff; Subject: Granted continued use


DOE - Office of Legacy Management -- Spencer Chemical Co - MO 0-01  

Office of Legacy Management (LM)

MO 0-01 MO 0-01 FUSRAP Considered Sites Site: SPENCER CHEMICAL CO. (MO.0-01) Eliminated from further consideration under FUSRAP - an AEC licensed operation Designated Name: Not Designated Alternate Name: Jayhawk Works MO.0-01-1 Location: Joplin , Missouri MO.0-01-1 Evaluation Year: 1985 MO.0-01-2 Site Operations: Processed enriched uranium (UF-6) and scrap to produce primarily uranium dioxide (UO-2) under AEC licenses. MO.0-01-3 MO.0-01-4 Site Disposition: Eliminated - No Authority MO.0-01-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Normal and Enriched Uranium, Thorium MO.0-01-6 Radiological Survey(s): Yes MO.0-01-5 Site Status: Eliminated from further consideration under FUSRAP - an AEC licensed operation Also see Documents Related to SPENCER CHEMICAL CO.


OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown



In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma



NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk


Real-Time Cardiac Imaging at 3 Tesla K.S. NAYAK, C.H. CUNNINGHAM, J.M. SANTOS, J.M. PAULY, AND D.G. NISHIMURA  

E-Print Network (OSTI)

Real-Time Cardiac Imaging at 3 Tesla K.S. NAYAK, C.H. CUNNINGHAM, J.M. SANTOS, J.M. PAULY, AND D are shown in Figure 2. Conclusions We have demonstrated real-time cardiac imaging at 3 Tesla with high SNR

Nayak, Krishna


(Mo,Cr) in HASTELLOY C-22HS Alloy, a  

Science Conference Proceedings (OSTI)

debate (with question marks in the phase diagrams) such as ?CrMo4Ni5, ? ... diagram at 500, 620 and 700C show the existence of P phase and. OP6 phase[5


9 Cr-- 1 Mo steel material for high temperature application  

DOE Patents (OSTI)

One or more embodiments relates to a high-temperature, titanium alloyed, 9 Cr-1 Mo steel exhibiting improved creep strength and oxidation resistance at service temperatures up to 650.degree. C. The 9 Cr-1 Mo steel has a tempered martensite microstructure and is comprised of both large (0.5-3 .mu.m) primary titanium carbides and small (5-50 nm) secondary titanium carbides in a ratio of. from about 1:1.5 to about 1.5:1. The 9 Cr-1 Mo steel may be fabricated using exemplary austenizing, rapid cooling, and tempering steps without subsequent hot working requirements. The 9 Cr-1 Mo steel exhibits improvements in total mass gain, yield strength, and time-to-rupture over ASTM P91 and ASTM P92 at the temperature and time conditions examined.

Jablonski, Paul D; Alman, David; Dogan, Omer; Holcomb, Gordon; Cowen, Christopher



Future design mindful of the MoRAS  

Science Conference Proceedings (OSTI)

As human-computer interaction (HCI) expands its scope, the proper context for the design of information technology (IT) is increasingly an interconnected mosaic of responsive adaptive systems (MoRAS) including people's heads, organizations, communities, ...

George W. Furnas



Developments in realistic design for aperiodic Mo/Si multilayermirrors  

Science Conference Proceedings (OSTI)

Aperiodic multilayers have been designed for various applications, using numeric algorithms and analytical solutions, for many years with varying levels of success. This work developed a more realistic model for simulating aperiodic Mo/Si multilayers to be used in these algorithms by including the formation of MoSi{sub 2}. Using a genetic computer code we were able to optimize a 45{sup o} multilayer for a large bandpass reflection multilayer that gave good agreement with the model.

Aquila, A.L.; Salmassi, F.; Dollar, F.; Liu, Y.; Gullikson, E.M.



The comparison of sulfide CoMo/?-Al2O3 and NiMo/?-Al2O3 catalysts in methyl palmitate and methyl heptanoate hydrodeoxygenation  

Science Conference Proceedings (OSTI)

The hydrodeoxygenation of methyl palmitate and methyl heptanoate as the model compounds of bio-oil in the presence of sulfided CoMo/?-Al2O3 and NiMo/?-Al2O3 catalysts was studied at the temperature ... Keywords: CoMoS/?-Al2O3, NiMoS/?-Al2O3, biofuels, hydrodeoxygenation, methyl heptanoate, methyl palmitate

Irina V. Deliy; Evgenia N. Vlasova; Alexey L. Nuzhdin; Galina A. Bukhtiyarova




Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA


miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay



NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....

Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


MoWiTT:Mobile Window Thermal Test Facility  

NLE Websites -- All DOE Office Websites (Extended Search)

0 0 MoWiTT: Mobile Window Thermal Test Facility The window has come a long way since the days when it was a single pane of glass in a wood frame. Low-emissivity windows were designed to help buildings retain some of the energy that would have leaked out of less efficient windows. Designing efficient window-and-frame systems requires accurate measurement of the flow of energy through windows in realistic conditions, a capability provided by the Mobile Window Thermal Test facility. Consisting of a pair of outdoor, room-sized calorimeters, MoWiTT measures the net energy flow through two window samples in side-by-side tests using ambient weather conditions. MoWiTT characterizes the net energy flow as a function of time and measures the temperatures, solar fluxes, and


Co-Mo Electric Coop Inc | Open Energy Information  

Open Energy Info (EERE)

Mo Electric Coop Inc Mo Electric Coop Inc Jump to: navigation, search Name Co-Mo Electric Coop Inc Place Missouri Utility Id 4063 Utility Location Yes Ownership C NERC Location SERC NERC MRO Yes Activity Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png Commercial Multi-Phase Commercial Commercial Single-Phase Over 200 Amps Commercial Commercial Single-Phase Up To 200 Amps Commercial Industrial Industrial Outdoor Lighting HPS 100 W Lighting Outdoor Lighting HPS 150 W Lighting Outdoor Lighting HPS 400 W Lighting Residential Multi-Phase Residential Residential Single-Phase Over 200 Amps Residential


DOE - Office of Legacy Management -- Medart Co - MO 09  

Office of Legacy Management (LM)

Medart Co - MO 09 Medart Co - MO 09 FUSRAP Considered Sites Site: MEDART CO. (MO.09 ) Eliminated from consideration under FUSRAP - Facility believed to be torn down and the original site built over Designated Name: Not Designated Alternate Name: None Location: 180 Potomoc Street , St. Louis , Missouri MA.09-4 Evaluation Year: Circa 1990 MA.09-3 Site Operations: Conducted test machining operations on uranium bar stock during the early 1950s. MA.09-2 Site Disposition: Eliminated - Potential for contamination considered remote due limited duration of operations and to site reconstruction MA.09-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal (test quantities) MA.09-3 Radiological Survey(s): Health and safety monitoring during operations MA.09-3


Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY


Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)



U-Mo Plate Blister Anneal Interim Report  

SciTech Connect

Blister thresholds in fuel elements have been a longstanding performance parameter for fuel elements of all types. This behavior has yet to be fully defined for the RERTR U-Mo fuel types. Blister anneal studies that began in 2007 have been expanded to include plates from more recent RERTR experiments. Preliminary data presented in this report encompasses the early generations of the U-Mo fuel systems and the most recent but still developing fuel system. Included is an overview of relevant dispersion fuel systems for the purposes of comparison.

Francine J. Rice; Daniel M. Wachs; Adam B. Robinson; Dennis D. Keiser Jr.; Jan-Fong Jue; Danielle M. Perez; Ross Finlay



¿Cómo funcionan los Híbridos?  

NLE Websites -- All DOE Office Websites (Extended Search)

¿Cómo funcionan los Híbridos? ¿Cómo funcionan los Híbridos? Diagrama de los componentes de un híbrido completo, incluyen (1) un motor de combustión interna (2) un motor eléctrico, (3) un generador, (4) una aparato de cambio de motor, and (5) una batería de gran capacidad. en inglés Flash Animation: ¿Cómo funcionan los Híbridos? (Requiere versión Flash 6.0 o superior) HTML Version: ¿Cómo funcionan los Híbridos? Los vehículos Híbridos-eléctricos (VHEs) combinan las ventajas de los motores de gasolina con los motores eléctricos y se pueden configurar para diferentes objetivos, como mejorar el ahorro de combustible, aumentar su fuerza, o proveer fuerza adicional para el uso del sistema eléctrico o los componentes electrónicos. Algunas de las tecnologías avanzadas que usan los híbridos típicamente


ProMoVer: modular verification of temporal safety properties  

Science Conference Proceedings (OSTI)

This paper describes ProMoVer, a tool for fully automated procedure-modular verification of Java programs equipped with method-local and global assertions that specify safety properties of sequences of method invocations. Modularity at the procedure-level ...

Siavash Soleimanifard; Dilian Gurov; Marieke Huisman



Domestic production of medical isotope Mo-99 moves a step closer  

NLE Websites -- All DOE Office Websites (Extended Search)

Domestic production of medical isotope Mo-99 Domestic production of medical isotope Mo-99 moves a step closer Irradiated uranium fuel has been recycled and reused for molybdenum-99...


Large-Scale Synthesis of MoS2/ Polymer Derived Ceramic ...  

Science Conference Proceedings (OSTI)

Applications of MoS2 as lithium ion battery anode material are also being explored. Here, we demonstrate exfoliation of MoS2 into single and few layers.


Elevated Temperature Compression Testing of the U-10 wt% Mo Alloy  

Science Conference Proceedings (OSTI)

Abstract Scope, In order to satisfy non-proliferation treaties the metallic U-10 wt% Mo (U-10Mo) alloy in low enrichments is under development to replace highly...


miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li



On the Reaction Mechanism of Acetaldehyde Decomposition on Mo(110)  

Science Conference Proceedings (OSTI)

The strong Mo-O bond strength provides promising reactivity of Mo-based catalysts for the deoxygenation of biomass-derived oxygenates. Combining the novel dimer saddle point searching method with periodic spin-polarized density functional theory calculations, we investigated the reaction pathways of a acetaldehyde decomposition on the clean Mo(110) surface. Two reaction pathways were identified, a selective deoxygenation and a nonselective fragmentation pathways. We found that acetaldehyde preferentially adsorbs at the pseudo 3-fold hollow site in the ?2(C,O) configuration on Mo(110). Among four possible bond (?-C-H, ?-C-H, C-O and C-C) cleavages, the initial decomposition of the adsorbed acetaldehyde produces either ethylidene via the C-O bond scission or acetyl via the ?-C-H bond scission while the C-C and the ?-C-H bond cleavages of acetaldehyde leading to the formation of methyl (and formyl) and formylmethyl are unlikely. Further dehydrogenations of ethylidene into either ethylidyne or vinyl are competing and very facile with low activation barriers of 0.24 and 0.31 eV, respectively. Concurrently, the formed acetyl would deoxygenate into ethylidyne via the C-O cleavage rather than breaking the C-C or the C-H bonds. The selective deoxygenation of acetaldehyde forming ethylene is inhibited by relatively weaker hydrogenation capability of the Mo(110) surface. Instead, the nonselective pathway via vinyl and vinylidene dehydrogenations to ethynyl as the final hydrocarbon fragment is kinetically favorable. On the other hand, the strong interaction between ethylene and the Mo(110) surface also leads to ethylene decomposition instead of desorption into the gas phase. This work was financially supported by the National Advanced Biofuels Consortium (NABC). Computing time was granted by a user project (emsl42292) at the Molecular Science Computing Facility in the William R. Wiley Environmental Molecular Sciences Laboratory (EMSL). This work was financially supported by the National Advanced Biofuels Consortium (NABC). Computing time was granted by a user project (emsl42292) at the Molecular Science Computing Facility in the William R. Wiley Environmental Molecular Sciences Laboratory (EMSL). The EMSL is a U.S. Department of Energy (DOE) national scientific user facility located at Pacific Northwest National Laboratory (PNNL) and supported by the DOE Office of Biological and Environmental Research. Pacific Northwest National Laboratory is operated by Battelle for the U.S. Department of Energy.

Mei, Donghai; Karim, Ayman M.; Wang, Yong



Graphitization in C and C-Mo Steels  

Science Conference Proceedings (OSTI)

Following the recent carbon (C) and carbon-molybdenum (C-Mo) steel graphitization experience reported by several Electric Power Research Institute (EPRI) members, it became apparent that the industry could benefit from better predictive guidance to prioritize component inspections and examinations for graphitization. This research effort collected and analyzed the additional experience gained since the last EPRI project on the subject and focused on developing suitably conservative time-temperature predi...



Single Phase Melt Processed Powellite (Ba,Ca) MoO{sub 4} For The Immobilization Of Mo-Rich Nuclear Waste  

SciTech Connect

Crystalline and glass composite materials are currently being investigated for the immobilization of combined High Level Waste (HLW) streams resulting from potential commercial fuel reprocessing scenarios. Several of these potential waste streams contain elevated levels of transition metal elements such as molybdenum (Mo). Molybdenum has limited solubility in typical silicate glasses used for nuclear waste immobilization. Under certain chemical and controlled cooling conditions, a powellite (Ba,Ca)MoO{sub 4} crystalline structure can be formed by reaction with alkaline earth elements. In this study, single phase BaMoO{sub 4} and CaMoO{sub 4} were formed from carbonate and oxide precursors demonstrating the viability of Mo incorporation into glass, crystalline or glass composite materials by a melt and crystallization process. X-ray diffraction, photoluminescence, and Raman spectroscopy indicated a long range ordered crystalline structure. In-situ electron irradiation studies indicated that both CaMoO{sub 4} and BaMoO{sub 4} powellite phases exhibit radiation stability up to 1000 years at anticipated doses with a crystalline to amorphous transition observed after 1 X 10{sup 13} Gy. Aqueous durability determined from product consistency tests (PCT) showed low normalized release rates for Ba, Ca, and Mo (<0.05 g/m{sup 2}).

Brinkman, Kyle [Savannah River Site (SRS), Aiken, SC (United States); Marra, James [Savannah River Site (SRS), Aiken, SC (United States); Fox, Kevin [Savannah River Site (SRS), Aiken, SC (United States); Reppert, Jason [Savannah River Site (SRS), Aiken, SC (United States); Crum, Jarrod [Paci fic Northwest National Laboratory , Richland, WA (United States); Tang, Ming [Los Alamos National Laboratory , Los Alamos, NM (United States)



Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)



Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)




E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.


Fracture and fatigue properties of Mo-Mo{sub 3}Si-Mo{sub 5}SiB{sub 2} refractory intermetallic alloys at ambient to elevated temperatures (25-1300 degrees Centigrade)  

Science Conference Proceedings (OSTI)

The need for structural materials with high-temperature strength and oxidation resistance coupled with adequate lower-temperature toughness for potential use at temperatures above {approx} 1000 degrees C has remained a persistent challenge in materials science. In this work, one promising class of intermetallic alloys is examined, namely boron-containing molybdenum silicides, with compositions in the range Mo (bal), 12-17 at. percentSi, 8.5 at. percentB, processed using both ingot (I/M) and powder (P/M) metallurgy methods. Specifically, the oxidation (''pesting''), fracture toughness and fatigue-crack propagation resistance of four such alloys, which consisted of {approx}21 to 38 vol. percent a-Mo phase in an intermetallic matrix of Mo3Si and Mo5SiB2 (T2), were characterized at temperatures between 25 degrees and 1300 degrees C. The boron additions were found to confer superior ''pest'' resistance (at 400 degrees to 900 degrees C) as compared to unmodified molybdenum silicides, such as Mo5Si3. Moreover , although the fracture and fatigue properties of the finer-scale P/M alloys were only marginally better than those of MoSi2, for the I/M processed microstructures with coarse distributions of the a-Mo phase, fracture toughness properties were far superior, rising from values above 7 MPa sqrt m at ambient temperatures to almost 12 MPa sqrt m at 1300 degrees C.

Choe, Heeman; Schneibel, J.H.; Ritchie, R.O.



Statistical pairing fluctuation and phase transition in $^{94}Mo$  

E-Print Network (OSTI)

In the framework of BCS model, we have applied the isothermal probability distribution to take into account the statistical fluctuations in calculation of thermodynamical properties of nuclei. The energy and the heat capacity are calculated in $^{94}Mo$ nucleus using the mean gap parameter. The results are compared with the values obtained based on the most probable values, experimental data as well as some other theoretical models. We have shown that heat capacity versus temperature behaves smoothly instead of singular behaviour predicted by the standard BCS model. Also a smooth peak in heat capacity is observed which is a signature of transition from normal to super fluid phase.

Z. Kargar; V. Dehghani


Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Statistical pairing fluctuation and phase transition in $^{94}Mo$  

E-Print Network (OSTI)

In the framework of BCS model, we have applied the isothermal probability distribution to take into account the statistical fluctuations in calculation of thermodynamical properties of nuclei. The energy and the heat capacity are calculated in $^{94}Mo$ nucleus using the mean gap parameter. The results are compared with the values obtained based on the most probable values, experimental data as well as some other theoretical models. We have shown that heat capacity versus temperature behaves smoothly instead of singular behaviour predicted by the standard BCS model. Also a smooth peak in heat capacity is observed which is a signature of transition from normal to super fluid phase.

Kargar, Z



Greenfield Alternative Study LEU-Mo Fuel Fabrication Facility  

Science Conference Proceedings (OSTI)

This report provides the initial first look of the design of the Greenfield Alternative of the Fuel Fabrication Capability (FFC); a facility to be built at a Greenfield DOE National Laboratory site. The FFC is designed to fabricate LEU-Mo monolithic fuel for the 5 US High Performance Research Reactors (HPRRs). This report provides a pre-conceptual design of the site, facility, process and equipment systems of the FFC; along with a preliminary hazards evaluation, risk assessment as well as the ROM cost and schedule estimate.

Washington Division of URS



Upper critical field of Mo-Ni heterostructures  

SciTech Connect

Upper critical field and its anisotropy have been measured on two very short wavelength Mo-Ni heterostructures of different degrees of perfection, lambda = 13.8A (disordered structure) and lambda = 16.6A (layered structure). In both cases the parallel critical field has an unexpected temperature dependence, a large and temperature dependent anisotropy, and over 60% enhancement over the Clogston-Chandrasekhar limit. Data are fit to the Werthamer-Helfand-Hohenberg theory and the spin-orbit scattering times are found to be 1.79 x 10 T s and 2 x 10 T s, respectively.

Uher, C.; Watson, W.J.; Cohn, J.L.; Schuller, I.K.



Studying the Effect of Carbon on DU-Mo Foil Fabrication for the ...  

Science Conference Proceedings (OSTI)

In support of this program, efforts are ongoing to develop and validate a monolithic depleted uranium molybdenum (DU-Mo) foil fabrication process adaptable for...


Surface Structures of Cubo-octahedral Pt-Mo Catalyst Nanoparticles from Monte Carlo Simulations  

E-Print Network (OSTI)

of Cubo-octahedral Pt-Mo Catalyst Nanoparticles from Montefuel cells, new electrode catalysts that have less preciousto designing Pt bimetallic catalysts is knowledge of the

Wang, Guofeng; Van Hove, M.A.; Ross, P.N.; Baskes, M.I.



Pressure Water Leaching Molybdenum and Nickel from Mo-Ni ore of ...  

Science Conference Proceedings (OSTI)

Presentation Title, Pressure Water Leaching Molybdenum and Nickel from Mo-Ni ore of Black Shale without Reagent. Author(s), Zhigan Deng. On-Site Speaker...


Disorder effects in half-metallic Sr 2 FeMoO 6 single crystals  

Science Conference Proceedings (OSTI)

Double perovskites such as Sr 2 FeMoO 6 (SFMO) have been predicted to be half-metallic (100% spin polarized). However

Raghava P. Panguluri; Sheng Xu; Yutaka Moritomo; I. V. Solovyev; B. Nadgorny



Synthesis of molybdenum disulfide (MoS{sub 2}) for lithium ion battery applications  

Science Conference Proceedings (OSTI)

This paper reports the use of a rheological phase reaction method for preparing MoS{sub 2} nanoflakes. The characterization by powder X-ray diffraction indicated that MoS{sub 2} had been formed. High resolution electron microscopy observation revealed that the as-prepared MoS{sub 2} nanoflakes had started to curve and partly form MoS{sub 2} nanotubes. The lithium intercalation/de-intercalation behavior of as-prepared MoS{sub 2} nanoflake electrode was also investigated. It was found that the MoS{sub 2} nanoflake electrode exhibited higher specific capacity, with very high cycling stability, compared to MoS{sub 2} nanoparticle electrode. The possible reasons for the high electrochemical performance of the nanoflakes electrodes are also discussed. The outstanding electrochemical properties of MoS{sub 2} nanoflakes obtained by this method make it possible for MoS{sub 2} to be used as a promising anode material.

Feng Chuanqi [Key Laboratory for Synthesis and Applications of Organic Functional Molecules, Hubei University, Wuhan 430062 (China); Institute for Superconducting and Electronic Materials, University of Wollongong, NSW 2522 (Australia); Ma Jun; Li Hua [Key Laboratory for Synthesis and Applications of Organic Functional Molecules, Hubei University, Wuhan 430062 (China); Zeng Rong [Institute for Superconducting and Electronic Materials, University of Wollongong, NSW 2522 (Australia); Guo Zaiping, E-mail: zguo@uow.edu.au [School of Mechanical, Materials and Mechatronic Engineering, University of Wollongong, NSW 2522 (Australia); Institute for Superconducting and Electronic Materials, University of Wollongong, NSW 2522 (Australia); ARC Centre of Excellence for Electromaterials Science, University of Wollongong, NSW 2522 (Australia); Liu Huakun [Institute for Superconducting and Electronic Materials, University of Wollongong, NSW 2522 (Australia); ARC Centre of Excellence for Electromaterials Science, University of Wollongong, NSW 2522 (Australia)



Ageing and Toughness of a Mn-Ni-Mo PWR Steel  

Science Conference Proceedings (OSTI)

Abstract Scope, Mn-Ni-Mo steels are widely used in the fabrication of pressurisers, steam generators and pressure vessels of pressurised water reactors (PWR).


Utilization of Recycled MoO3 and Mill Scale for Synthesis of High ...  

Science Conference Proceedings (OSTI)

... by ammonia gas neutralization method and reduced by hydrogen to produce a high ... Molybdenum and Nickel from Mo-Ni ore of Black Shale without Reagent.


New limit on the neutrinoless double beta decay of /sup 100/Mo  

SciTech Connect

A search for the neutrinoless double beta decay of /sup 100/Mo was conducted using thin Mo films and solid state Si detectors. The experiment has collected 3500 hours of data operating underground in a deep silver mine (3290 M.W.E.). Only one event was found to be consistent with neutrinoless double beta decay. Using this one event, a limit of greater than or equal to 1 x 10/sup 22/ years (1 sigma) is set on the /sup 100/Mo half-life. This is approximately five times larger than the best previous /sup 100/Mo limit.

Krivicich, J.M.



Experimental activities supporting commercial U.S. accelerator production of 99-Mo  

Science Conference Proceedings (OSTI)

{sup 99m}Tc, the daughter product of {sup 99}Mo, is the most commonly used radioisotope for nuclear medicine in the U.S. Experiments are being performed at Los Alamos National Laboratory and Argonne National Laboratory to demonstrate production of {sup 99}Mo using accelerators. The {sup 100}Mo({gamma},n){sup 99}Mo reaction in an enriched {sup 100}Mo target is currently under investigation. Three scaled low-power production experiments using a 20-MeV electron linac at Argonne have been performed to date. Two of these experiments used natural Mo targets and produced a total of 613 {mu}C of {sup 99}Mo. The third experiment used an enriched {sup 100}Mo target and produced 10.5 mCi of {sup 99}Mo. Following irradiation the targets were dissolved and the low specific activity solution was processed through an ARSII generator from NorthStar Medical Radioisotopes. Yields of {sup 99m}Tc >95% have been observed.

Dale, Gregory E [Los Alamos National Laboratory; Chemerisov, Sergey D [ANL; Vandegrift, George F [ANL



mo funcionan las Células de Combustible  

NLE Websites -- All DOE Office Websites (Extended Search)

mo funcionan las Células de Combustible Cómo funcionan las Células de Combustible Diagrama: Como funciona un MPE de combustible de célula. 1. El combustible de hidrógeno es canalizado a través de un campo de placas de flujo para el ánodo al otro lado de la pila de combustible, mientras que el oxígeno del aire se canaliza hacia el cátodo del otro lado de la celda. 2. En el ánodo, un catalizador de platino hace que el hidrógeno se divida en iones positivos de hidrógeno (protones) y electrones de carga negativa. 3. La Membrana de Electrolito Polimérico (MPE) sólo permite que los iones de carga positiva pasen a través de ella hacia el cátodo. Los electrones de carga negativa deben viajar a lo largo de un circuito externo hacia el cátodo, creando una corriente eléctrica. 4. En el cátodo, los electrones y los iones positivos de hidrógeno se combinan con el oxígeno para formar agua, que fluye fuera de la célula.


Characterization of U-Mo Foils for AFIP-7  

SciTech Connect

Twelve AFIP in-process foil samples, fabricated by either Y-12 or LANL, were shipped from LANL to PNNL for potential characterization using optical and scanning electron microscopy techniques. Of these twelve, nine different conditions were examined to one degree or another using both techniques. For this report a complete description of the results are provided for one archive foil from each source of material, and one unirradiated piece of a foil of each source that was irradiated in the Advanced Test Reactor. Additional data from two other LANL conditions are summarized in very brief form in an appendix. The characterization revealed that all four characterized conditions contained a cold worked microstructure to different degrees. The Y-12 foils exhibited a higher degree of cold working compared to the LANL foils, as evidenced by the highly elongated and obscure U-Mo grain structure present in each foil. The longitudinal orientations for both of the Y-12 foils possesses a highly laminar appearance with such a distorted grain structure that it was very difficult to even offer a range of grain sizes. The U-Mo grain structure of the LANL foils, by comparison, consisted of a more easily discernible grain structure with a mix of equiaxed and elongated grains. Both materials have an inhomogenous grain structure in that all of the characterized foils possess abnormally coarse grains.

Edwards, Danny J.; Ermi, Ruby M.; Schemer-Kohrn, Alan L.; Overman, Nicole R.; Henager, Charles H.; Burkes, Douglas; Senor, David J.



Development of FeNiMoB thin film materials for microfabricated magnetoelastic sensors  

Science Conference Proceedings (OSTI)

Metglas{sup TM} 2826MB foils of 25-30 {mu}m thickness with the composition of Fe{sub 40}Ni{sub 38}Mo{sub 4}B{sub 18} have been used for magnetoelastic sensors in various applications over many years. This work is directed at the investigation of {approx}3 {mu}m thick iron-nickel-molybdenum-boron (FeNiMoB) thin films that are intended for integrated microsystems. The films are deposited on Si substrate by co-sputtering of iron-nickel (FeNi), molybdenum (Mo), and boron (B) targets. The results show that dopants of Mo and B can significantly change the microstructure and magnetic properties of FeNi materials. When FeNi is doped with only Mo its crystal structure changes from polycrystalline to amorphous with the increase of dopant concentration; the transition point is found at about 10 at. % of Mo content. A significant change in anisotropic magnetic properties of FeNi is also observed as the Mo dopant level increases. The coercivity of FeNi films doped with Mo decreases to a value less than one third of the value without dopant. Doping the FeNi with B together with Mo considerably decreases the value of coercivity and the out-of-plane magnetic anisotropy properties, and it also greatly changes the microstructure of the material. In addition, doping B to FeNiMo remarkably reduces the remanence of the material. The film material that is fabricated using an optimized process is magnetically as soft as amorphous Metglas{sup TM} 2826MB with a coercivity of less than 40 Am{sup -1}. The findings of this study provide us a better understanding of the effects of the compositions and microstructure of FeNiMoB thin film materials on their magnetic properties.

Liang Cai; Gooneratne, Chinthaka; Cha, Dongkyu; Chen Long; Kosel, Jurgen [Computer Electrical and Mathematical Sciences and Engineering, King Abdullah University of Science and Technology, 4700 KAUST, Thuwal 23955 (Saudi Arabia); Gianchandani, Yogesh [Department of Electrical Engineering and Computer Science, 1301 Beal Ave., University of Michigan, Ann Arbor, Michigan 48109 (United States)



File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload


MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.



Electrodeposition and characterization of nanocrystalline Ni-Mo catalysts for hydrogen production  

Science Conference Proceedings (OSTI)

Ni-Mo nanocrystalline deposits (7-43 nm) with a nodular morphology were prepared by electrodeposition using direct current from citrate-ammonia solutions. They exhibited a single Ni-Mo solid solution phase. The size of the nodules increased as electroplating ...

J. Halim; R. Abdel-Karim; S. El-Raghy; M. Nabil; A. Waheed



Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab



Domestic production of medical isotope Mo-99 moves a step closer  

NLE Websites -- All DOE Office Websites (Extended Search)

Domestic production of medical isotope Mo-99 Domestic production of medical isotope Mo-99 Domestic production of medical isotope Mo-99 moves a step closer Irradiated uranium fuel has been recycled and reused for molybdenum-99 (Mo-99) production, with virtually no losses in Mo-99 yields or uranium recovery. May 13, 2013 From left, Los Alamos scientists Roy Copping, Sean Reilly, and Daniel Rios. Copping examines the Buchi Multivapor P-12 Evaporator, and Reilly and Rios are at the Agilent Technologies Cary 60 UV-Vis Spectrometer. From left, Los Alamos scientists Sean Reilly, Roy Copping, and Daniel Rios. Sean is looking at the Buchi Multivapor P-12 Evaporator, and Roy and Daniel are at the Agilent Technologies Cary 60 UV-Vis Spectrometer. Contact Nancy Ambrosiano Communications Office (505) 667-0471

Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Exfoliated MoS2 Nanocomposite as an Anode Material for Lithium Ion Batteries  

DOE Green Energy (OSTI)

Nanocomposites of molybdenum disulfide (MoS2) and poly(ethylene oxide) (PEO) were prepared by the exfoliation/absorption method that involved the hydrolysis of lithiated MoS2 in an aqueous solution of PEO. The absorption and subsequent interaction of PEO on the colloidal MoS2 formed a nanocomposite which restacked into layered secondary particles. X-ray diffraction and high resolution TEM indicated that highly disordered nanocomposites were produced when the Lix(PEO)yMoS2 stoichiometry was limited to y < 1. An improvement of greater than 5x in capacity accompanied by high cycle stability and efficiency was observed for the disordered nanocomposites providing a novel approach to utilize low-cost MoS2 and similar materials for a high capacity energy storage system.

Xiao, Jie; Choi, Daiwon; Cosimbescu, Lelia; Koech, Phillip K.; Liu, Jun; Lemmon, John P.



Development of LEU targets for {sup 99}Mo production and their chemical processing status 1993  

SciTech Connect

Most of the world`s supply of {sup 99m}{Tc} for medical purposes is currently produced from {sup 99}Mo derived from the fastening of high enriched uranium (HEU). Substitution of low enriched uranium (LEU) silicide fuel for the HEU alloy and aluminide fuels used in current target designs will allow equivalent {sup 99}Mo yields with little change in target geometries. Substitution of uranium metal for uranium oxide films in other target designs will also allow the substitution of LEU for HEU. In 1993, DOE renewed funding that was terminated in 1990 for development of LEU targets for {sup 99}Mo production. During the past year, our efforts were to (1) renew contact with {sup 99}Mo producers, (2) define the means to test our process for recovering {sup 99}Mo from irradiated LEU-silicide targets, and (3) begin to test our process on spent LEU-silicide miniplates stored at ANL from past fuel development studies.

Vandegrift, G.F.; Hutter, J.C.; Srinivasan, B.; Matos, J.E.; Snelgrove, J.L.



Structural evolution in crystalline MoO{sub 3} nanoparticles with tunable size  

SciTech Connect

In this study MoO{sub 3} nanoparticles were prepared in porous Vycor glass by impregnation-decomposition cycles (IDC) with molybdenum(VI) 2-ethylhexanoate. X-ray diffraction data show that the nanoparticles are crystalline and are in the orthorhombic {alpha}-MoO{sub 3} phase. Raman spectroscopy data also indicate the formation of this phase. The profiles in the Raman spectra changed with the number of IDC, indicating a structural evolution of the MoO{sub 3} nanoparticles. The IDC methodology promoted a linear mass increase and allowed tuning the nanoparticle size. Analysis of HRTEM images revealed that for 3, 5 and 7 IDC, the MoO{sub 3} nanoparticle average diameters are 3.2, 3.6 and 4.2 nm. Diffuse reflectance spectroscopy indicates a consistent red shift in the band gap from 3.35 to 3.29 eV as the size increases from 3.2 to 4.2 nm. This observed red shift in the band gap of the MoO{sub 3} nanoparticles is presumably due to quantum confinement effects. - Graphical abstract: Modification of profile Raman spectra for crystalline MoO{sub 3} nanoparticles in function of the particle size. Highlights: Black-Right-Pointing-Pointer Structural evolution of the MoO{sub 3} nanoparticles as a function of the crystallite size. Black-Right-Pointing-Pointer Tunable optical properties by controlling the MoO{sub 3} nanoparticle size. Black-Right-Pointing-Pointer The impregnation-decomposition methodology allowed tuning the nanoparticle size. Black-Right-Pointing-Pointer The red shift in the band gap of the MoO{sub 3} nanoparticles is due to quantum size effect. Black-Right-Pointing-Pointer The short-distance order in MoO{sub 3} nanoparticle is function to area/volume ratio.

Barros Santos, Elias de; Aparecido Sigoli, Fernando [Functional Materials Laboratory, Institute of Chemistry, University of Campinas, UNICAMP, PO Box 6154, Zip Code 13083-970 Campinas, SP (Brazil); Odone Mazali, Italo, E-mail: mazali@iqm.unicamp.br [Functional Materials Laboratory, Institute of Chemistry, University of Campinas, UNICAMP, PO Box 6154, Zip Code 13083-970 Campinas, SP (Brazil)



Mo-99/Tc-99m Separation: An Assessment of Technical Options  

Science Conference Proceedings (OSTI)

Several strategies for the effective separation of 99mTc from 99Mo have been developed and validated. Due to the success of column chromatographic separation using acidic alumina coupled with high specific activity fission 99Mo (F 99Mo) for production of 99Mo/99mTc generators, however, most technologies until recently have generated little interest. The reduced availability of F 99Mo and consequently the shortage of 99Mo/99mTc column generators in the recent past have resurrected interest in the production of 99Mo as well as 99mTc by alternate routes. Most of these alternative production processes require separation techniques capable of providing clinical grade 99mTc from low specific activity 99Mo or irradiated Mo targets. For this reason there has been renewed interest in alternate separation routes. This paper reviews the reported separation technologies which include column chromatography, solvent extraction, sublimation and gel systems that have been traditionally used for the fabrication of 99Mo/99mTc generator systems. The comparative advantage, disadvantage, and technical challenges toward adapting the emerging requirements are discussed. New developments such as solid-phase column extraction, electrochemical separation, extraction chromatography, supported liquid membrane (SLM) and thermochromatographic techniques are also being evaluated for their potential application in the changed scenario of providing 99mTc from alternate routes. Based on the analysis provided in this review, it appears that some proven separation technologies can be quickly resurrected for the separation of clinical grade 99mTc from macroscopic levels of reactor or cyclotron irradiated molybdenum targets. Furthermore, emerging technologies can be developed further to respond to the expected changing modes of 99mTc production.

Dash, A [Bhabha Atomic Research Centre, Mumbai, India; Pillai, M R A [Bhabha Atomic Research Centre, Mumbai, India; Knapp Jr, Russ F [ORNL



Mo-containing tetrahedral amorphous carbon deposited by dual filtered cathodic vacuum arc with selective pulsed bias voltage  

E-Print Network (OSTI)

only. Fig.2 (a) Electrical resistivity of ta-C:Mo films as aC plasma pulses; (b) Electrical resistivity of the ta-C:MoIt found that the electrical resistivity decreases with an

Pasaja, Nitisak; Sansongsiri, Sakon; Anders, Andre; Vilaithong, Thiraphat; Intasiri, Sawate



The oxidation of Ba dosed Mo(100) surfaces with O/sub 2/ at moderately high temperatures  

DOE Green Energy (OSTI)

The oxidation of Mo(100) and Ba-covered Mo(100) by O/sub 2/ have been examined at moderately high temperature (700 to 1400/sup 0/K) using x-ray photoelectron spectroscopy. Results indicate that the Ba or BaO overlayer retards but does not prevent oxidation of the underlying Mo surface. The high temperature surface chemistry of the O/Ba/Mo surface is described. 11 refs., 3 figs.

Rogers, J.W. Jr.; Blair, D.S.; Paffett, M.T.



Electrochemically Induced High Capacity Displacement Reaction of PEO/MoS2/Graphene Nanocomposites with Lithium  

SciTech Connect

MoS2/PEO/graphene composite is successfully prepared and the discharge mechanism of MoS2 as an anode material for Li-ion batteries has been investigated systematically in this work. The simultaneous formation of Li2S and Mo at deep discharge depth has been shown for the first time. The deposition of Mo metal with Li residing on the defects after the first discharge increases the intrinsic electronic conductivity of the electrode leading to a superior cycling stability for over 185 cycles. After the first discharge the amorphous Mo matrix allows a large amount of Li+ ions to repeatedly deposit and being oxidized during cycling while the transition between Li2S and S contribute to the capacity above 2.0 V. The interactions between as-formed Mo and S prevents the dissolution of the intermediate polysulfide thus providing clues to immobilize the soluble species in a Li-S battery. Excellent rate performances are achieved in this MoS2/PEO/graphene composite indicating a fast diffusion path of Li+ ions existing not only in the bulk material but also in the interface between the electrode and the electrolyte.

Xiao, Jie; Wang, Xaojian; Yang, Xiao-Qing; Xun, Shidi; Liu, Gao; Koech, Phillip K.; Liu, Jun; Lemmon, John P.



Surface Structures of Cubo-octahedral Pt-Mo Catalyst Nanoparticles from Monte Carlo Simulations  

DOE Green Energy (OSTI)

The surface structures of cubo-octahedral Pt-Mo nanoparticles have been investigated using the Monte Carlo method and modified embedded atom method potentials that we developed for Pt-Mo alloys. The cubo-octahedral Pt-Mo nanoparticles are constructed with disordered fcc configurations, with sizes from 2.5 to 5.0 nm, and with Pt concentrations from 60 to 90 at. percent. The equilibrium Pt-Mo nanoparticle configurations were generated through Monte Carlo simulations allowing both atomic displacements and element exchanges at 600 K. We predict that the Pt atoms weakly segregate to the surfaces of such nanoparticles. The Pt concentrations in the surface are calculated to be 5 to 14 at. percent higher than the Pt concentrations of the nanoparticles. Moreover, the Pt atoms preferentially segregate to the facet sites of the surface, while the Pt and Mo atoms tend to alternate along the edges and vertices of these nanoparticles. We found that decreasing the size or increasing the Pt concentration leads to higher Pt concentrations but fewer Pt-Mo pairs in the Pt-Mo nanoparticle surfaces.

Wang, Guofeng; Van Hove, M.A.; Ross, P.N.; Baskes, M.I.



Systematics of magnetic dipole strength in the stable even-mass Mo isotopes  

SciTech Connect

The nuclides {sup 92}Mo, {sup 98}Mo, and {sup 100}Mo have been studied in photon-scattering experiments by using bremsstrahlung produced at an electron energy of 6 MeV at the ELBE accelerator of the Forschungszentrum Rossendorf and at electron energies from 3.2 to 3.8 MeV at the Dynamitron accelerator at the University of Stuttgart. Six dipole transitions in {sup 98}Mo and 19 in {sup 100}Mo were observed for the first time in the energy range from 2 to 4 MeV. The experimental results are compared with predictions of the shell model and with predictions of the quasiparticle random-phase approximation (QRPA) in a deformed basis. The latter show significant contributions of isovector-orbital and isovector-spin vibrations. The change of the magnetic dipole strength in the isotopic chain of the even-mass isotopes from {sup 92}Mo to {sup 100}Mo is discussed. The calculations within the QRPA are extrapolated to the particle-separation energies to estimate the possible influence of M1 strength on the stability of the nuclides against photodissociation in cosmic scenarios.

Rusev, G. [Institut fuer Kern- und Hadronenphysik, Forschungszentrum Rossendorf, D-01314 Dresden (Germany); Institute for Nuclear Research and Nuclear Energy, BAS, BG-1784 Sofia (Bulgaria); Schwengner, R.; Doenau, F.; Erhard, M.; Grosse, E.; Junghans, A.R.; Kaeubler, L.; Kosev, K.; Mallion, S.; Schilling, K.D.; Wagner, A. [Institut fuer Kern- und Hadronenphysik, Forschungszentrum Rossendorf, D-01314 Dresden (Germany); Frauendorf, S. [Institut fuer Kern- und Hadronenphysik, Forschungszentrum Rossendorf, D-01314 Dresden (Germany); Department of Physics, University of Notre Dame, Notre Dame, Indiana 46556 (United States); Kostov, L.K. [Institute for Nuclear Research and Nuclear Energy, BAS, BG-1784 Sofia (Bulgaria); Garrel, H. von; Kneissl, U.; Kohstall, C.; Kreutz, M.; Pitz, H.H.; Scheck, M.; Stedile, F. [Institut fuer Strahlenphysik, Universitaet Stuttgart, D-70569 Stuttgart (Germany)] (and others)



Reactor physics calculations for {sup 99}Mo production at the Annular Core Research Reactor  

SciTech Connect

The isotope {sup 99}Mo would be produced at Sandia using ACRR and the collocated Hot Cell Facility. {sup 99}Mo would be produced by irradiating targets coated with {sup 235}U in the form of highly enriched U{sub 3}O{sub 8}; after 7 days, the target would be removed and the isotope extracted using the Cintichem process. The Monte Carlo neutronics computer code MCNP was used to determine the optimum configuration for production, using various fractions of the US demand. Although ACRR operates at a low power level, the US demand for {sup 99}Mo can be easily met using a reasonable number of targets.

Parma, E.J.



Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A



Forming 6061 Al HIP-Clad DU10Mo Monolithic Fuel Plates  

Science Conference Proceedings (OSTI)

Small scale trials with multi-layer 6061 Al HIP-clad DU10Mo (depleted uranium), co-rolled with Zr, have been performed. Important results include springback...


NTT DoCoMo's competition strategy (before and) after the introduction of the flat rate  

E-Print Network (OSTI)

NTT DoCoMo, which was spun off from NTT in 1992, grew rapidly by increasing the number of subscribers and successfully implementing a new data communication, i-mode. However, when a competitor introduced a flat rate for ...

Yajima, Masaaki



Solution-reactor-produced Mo-99 using activated carbon to remore I-131  

SciTech Connect

The production of {sup 99}Mo in a solution reactor was explored. Activated charcoal was used to filter the {sup 131}I contaminant from an irradiated fuel solution. Gamma spectroscopy confirmed that the activated carbon trapped a significant amount of {sup 131}I, as well as notable amounts of {sup 133}Xe, {sup 105}Rb, and {sup 140}Ba; the carbon trapped a diminutive amount of {sup 99}Mo. The results promote the idea of solution-reactor-produced {sup 99}Mo. Solution reactors are favorable both energetically and environmentally. A solution reactor could provide enough {sup 99}Mo/{sup 99m}Te to support both the current and future radiopharmaceutical needs of the U.S.

Kitten, S.; Cappiello, C.



The Thermodynamics of Titanium Formation in 95CrMo Steel  

Science Conference Proceedings (OSTI)

... on the fatigue life of 95CrMo steel which was applied in producing drilling rod. ... Analysis of Residence Time Distribution (RTD) of Fluid Flows in a Four Strand ...


Production of Mixed Alcohols from Bio-syngas over Mo-based Catalyst  

Science Conference Proceedings (OSTI)

A series of Mo-based catalysts prepared by sol-gel method using citric acid as complexant were successfully applied in the high efficient production of mixed alcohols from bio-syngas

Song-bai Qiu; Wei-wei Huang; Yong Xu; Lu Liu; Quan-xin Li



Electrochemical properties of sputter-deposited MoO{sub 3} films in lithium microbatteries  

Science Conference Proceedings (OSTI)

Molybdenum oxide (MoO{sub 3}) films were prepared by magnetron sputtering using an Mo target. The films were sputtered in the reactive atmosphere of an argon-oxygen gas mixture under various substrate temperatures, T{sub s}, and oxygen partial pressures, p(O{sub 2}). The effects of the growth conditions on the microstructure were examined using reflection high-energy electron diffraction and x-ray photoelectron spectroscopy. The analyses indicate that stoichiometric and polycrystalline MoO{sub 3} films were obtained at T{sub s} = 445 Degree-Sign C and p(O{sub 2}) = 61%. The applicability of the sputtered MoO{sub 3} films for lithium microbattery application has been demonstrated. The discharge-charge profiles, the kinetics of lithium intercalation process in the film, and the cycling behavior have been investigated in detail to understand the effect of microstructure on the electrochemical performance.

Ramana, C. V.; Atuchin, V. V.; Groult, H.; Julien, C. M. [Department of Mechanical Engineering, University of Texas at El Paso, El Paso, Texas 79968 (United States); Institute of Semiconductor Physics, SB RAS, Novosibirsk, 630090 (Russian Federation); Physicochimie des Electrolytes, Colloiedes et Systemes Analytiques (PECSA), Universite Pierre et Marie Curie-Paris 6, UMR 7195, 4 place Jussieu, 75005 Paris (France)




DOE Patents (OSTI)

An improved solvent extraction process is described whereby U may be extracted by a water immiscible organic solvent from an aqueous solution of uranyl nitrate. It has been found that Mo in the presence of phosphate ions appears to form a complex with the phosphate which extracts along with the U. This extraction of Mo may be suppressed by providing ferric ion in the solution prior to the extraction step. The ferric ion is preferably provided in the form of ferric nitrate.

Clark, H.M.; Duffey, D.



Photoluminescent BaMoO{sub 4} nanopowders prepared by complex polymerization method (CPM)  

SciTech Connect

The BaMoO{sub 4} nanopowders were prepared by the Complex Polymerization Method (CPM). The structure properties of the BaMoO{sub 4} powders were characterized by FTIR transmittance spectra, X-ray diffraction (XRD), Raman spectra, photoluminescence spectra (PL) and high-resolution scanning electron microscopy (HR-SEM). The XRD, FTIR and Raman data showed that BaMoO{sub 4} at 300 deg. C was disordered. At 400 deg. C and higher temperature, BaMoO{sub 4} crystalline scheelite-type phases could be identified, without the presence of additional phases, according to the XRD, FTIR and Raman data. The calculated average crystallite sizes, calculated by XRD, around 40 nm, showed the tendency to increase with the temperature. The crystallite sizes, obtained by HR-SEM, were around of 40-50 nm. The sample that presented the highest intensity of the red emission band was the one heat treated at 400 deg. C for 2 h, and the sample that displayed the highest intensity of the green emission band was the one heat treated at 700 deg. C for 2 h. The CPM was shown to be a low cost route for the production of BaMoO{sub 4} nanopowders, with the advantages of lower temperature, smaller time and reduced cost. The optical properties observed for BaMoO{sub 4} nanopowders suggested that this material is a highly promising candidate for photoluminescent applications.

Azevedo Marques, Ana Paula de [Laboratorio de Analise Termica e Materiais, Departamento de Quimica, Universidade Federal do Rio Grande do Norte, 59072-970 Natal, RN (Brazil)]. E-mail: apamarques@liec.ufscar.br; Melo, Dulce M.A. de [Laboratorio de Analise Termica e Materiais, Departamento de Quimica, Universidade Federal do Rio Grande do Norte, 59072-970 Natal, RN (Brazil); Paskocimas, Carlos A. [Departamento de Engenharia Mecanica, Universidade Federal do Rio Grande do Norte, 59072-970 Natal, RN (Brazil); Pizani, Paulo S. [Laboratorio de Semicondutores, Departamento de Fisica, Universidade Federal de Sao Carlos, 13565-905 Sao Carlos, SP (Brazil); Joya, Miryam R. [Laboratorio de Semicondutores, Departamento de Fisica, Universidade Federal de Sao Carlos, 13565-905 Sao Carlos, SP (Brazil); Leite, Edson R. [Laboratorio Interdisciplinar de Eletroquimica e Ceramica, CMDMC, Departamento de Quimica, Universidade Federal de Sao Carlos 13565-905, Sao Carlos, SP (Brazil); Longo, Elson [CMDMC, LIEC, Instituto de Quimica, Universidade Estadual Paulista, 14801-907 Araraquara, SP (Brazil)



Solution-reactor-produced-{sup 99}Mo using activated carbon to remove {sup 131}I  

SciTech Connect

This research explores the idea of producing {sup 99}Mo in a solution reactor. The Solution High Energy Burst Assembly (SHEBA), located at the Los Alamos Critical Assembly Facility, was used to facilitate this study. The goal of this study was to build on work previously completed and to investigate a possible mode of radioactive contaminant removal prior to a {sup 99}Mo extraction process. Prior experiments, performed using SHEBA and a single-step sorption process, showed a significant amount of {sup 131}I present along with the {sup 99}Mo on the alumina that was used to isolate the {sup 99}Mo. A high concentration of {sup 131}I and/or other contaminants present in a sample prohibits the Food and Drug Administration from approving an extraction of that nature for radiopharmaceutical use. However, if it were possible to remove the {sup 131}I and other contaminants prior to a {sup 99}Mo extraction, a simple column extraction process might be feasible. Activated charcoal was used to try to filter the {sup 131}I contaminant from an irradiated fuel solution. Gamma spectroscopy confirmed that the activated carbon trapped a significant amount of the {sup 131}I, as well as notable amounts of {sup 133}Xe, {sup 105}Rb, and {sup 140}Ba. Most importantly, the carbon traps a diminutive amount of {sup 99}Mo.

Kitten, S.; Cappiello, C. [Los Alamos National Lab., NM (United States)


Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Substrate recovery of Mo-Si multilayer coated optics  

Science Conference Proceedings (OSTI)

Imaging optics in a soft x-ray projection lithography (SXPL) system must meet stringent requirements to achieve high throughput and diffraction limited performance. Errors in the surface figure must be kept to less than {approximately}1 nm and the rms surface roughness must be less than 0.1 nm. The ML coatings must provide high reflectivity (> 60%) at wavelengths in the vicinity of 13 nm. The reflectivity bandpasses of the optics must be aligned within 0.05 nm. Each coating must be uniform across the surface of the optic to within 0.5%. These specifications challenge the limits of the current capabilities in optics fabrication and ML deposition. Consequently a set of qualified SXPL imaging optics is expected to be expensive, costing in the range of 100--250 k$. If the lifetime of the imaging optics is short, the replacement cost could significantly impact the economic competitiveness of the technology. The most likely failure modes for the imaging optics are mechanisms that degrade the ML coatings, but which leave the substrates intact. A potentially low cost solution for salvaging the imaging optics could be to strip the damaged ML coating to recover the substrate and then deposit a new coating. In this paper the authors report on the use of reactive ion etching (RIE) to remove Mo-Si ML coatings from precision optical substrates. The goal of this work was to characterize the etching process both in the ML film and at the substrate, and to determine the effects of the etching on the surface figure and finish of the substrate.

Stearns, D.G.; Baker, S.L.



MCNPX-CINDER'90 Simulation of Photonuclear Mo-99 Production Experiments  

SciTech Connect

The MCNPX and CINDER'90 codes were used to support design of experiments investigating Mo-99 production with a 20-MeV electron beam. Bremsstrahlung photons produced by the electron beam interacting with the target drive the desired Mo-100({gamma},n)Mo-99 reaction, as well as many undesired reactions important to accurate prediction of radiation hazards. MCNPX is a radiation transport code and CINDER'90 is a transmutation code. They are routinely used together for accelerator activation calculations. Low energy neutron fluxes and production rates for nonneutron and high energy neutron induced reactions computed using MCNPX are inputs to CINDER'90. CINDER'90 presently has only a neutron reaction cross section library up to 25 MeV and normally the other reaction rates come from MCNPX physics models. For this work MCNPX photon flux tallies modified by energy response functions prepared from evaluated photonuclear cross section data were used to tally the reaction rates for CINDER'90 input. The cross section evaluations do not provide isomer to ground state yield ratios so a spin based approximation was used. Post irradiation dose rates were calculated using MCNPX with CINDER'90 produced decay photon spectra. The sensitivity of radionuclide activities and dose rates to beam parameters including energy, position, and profile, as well as underlying isomer assumptions, was investigated. Three experimental production targets were irradiated, two natural Mo and one Mo-100 enriched. Natural Mo foils upstream of the targets were used to analyze beam position and profile by exposing Gafchromic film to the foils after each irradiation. Activation and dose rate calculations were rerun after the experiments using measured beam parameters for comparison with measured Mo-99 activities and dose rates.

Kelsey, Charles T. IV [Los Alamos National Laboratory; Chemerizov, Sergey D. [Argonne National Laboratory; Dale, Gregory E. [Los Alamos National Laboratory; Harvey, James T. [NorthStar Medical Radioisotopes; Tkac, Peter [Argonne National Laboratory; Vandegrift, George R III [Argonne National Laboratory



Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester



T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab



PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos



LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance


Microsoft Word - Gage-KS.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Intercomparisons of Cloud Observations Intercomparisons of Cloud Observations from the AL S-band Profiler and the ETL K-band Millimeter-Wave Cloud Radar on the R/V Ronald H. Brown during Nauru99 K. S. Gage and D. A. Carter National Oceanic and Atmospheric Administration Aeronomy Laboratory Boulder, Colorado P. E. Johnston and C. R. Williams Cooperative Institute for Research in Environmental Sciences University of Colorado Boulder, Colorado M. Ryan Science Technology Corporation Boulder, Colorado D. Hazen and B. W. Orr National Oceanic and Atmospheric Administration Environmental Technology Laboratory Boulder, Colorado Introduction Nauru99 took place in the western and central Pacific during June and July 1999. During Nauru99, a diverse suite of instruments was located on the research vessel (R/V) Ronald H. Brown to measure cloud



SciTech Connect

We report the detection in Ks-band of the secondary eclipse of the hot Jupiter CoRoT-1b from time series photometry with the ARC 3.5 m telescope at Apache Point Observatory. The eclipse shows a depth of 0.336 +- 0.042% and is centered at phase 0.5022{sup +0.0023}{sub -0.0027}, consistent with a zero eccentricity orbit (e cos omega = 0.0035{sup +0.0036}{sub -0.0042}). We perform the first optical to near-infrared multi-band photometric analysis of an exoplanet's atmosphere and constrain the reflected and thermal emissions by combining our result with the recent 0.6, 0.71, and 2.09 mum secondary eclipse detections by Snellen et al., Gillon et al., and Alonso et al. Comparing the multi-wavelength detections to state-of-the-art radiative-convective chemical-equilibrium atmosphere models, we find the near-infrared fluxes difficult to reproduce. The closest blackbody-based and physical models provide the following atmosphere parameters: a temperature T = 2460{sup +80}{sub -160} K; a very low Bond albedo A{sub B} = 0.000{sup +0.081}{sub -0.000}; and an energy redistribution parameter P{sub n} = 0.1, indicating a small but nonzero amount of heat transfer from the day to nightside. The best physical model suggests a thermal inversion layer with an extra optical absorber of opacity kappa{sub e} = 0.05 cm{sup 2} g{sup -1}, placed near the 0.1 bar atmospheric pressure level. This inversion layer is located 10 times deeper in the atmosphere than the absorbers used in models to fit mid-infrared Spitzer detections of other irradiated hot Jupiters.

Rogers, Justin C. [Department of Physics and Astronomy, Johns Hopkins University, 366 Bloomberg Center, 3400 N. Charles Street, Baltimore, MD 21218 (United States); Apai, Daniel [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Lopez-Morales, Mercedes [Department of Terrestrial Magnetism, Carnegie Institution of Washngton, 5241 Broad Branch Rd. NW, Washington, DC 20015 (United States); Sing, David K. [UPMC Univ Paris 06, CNRS, Institut d'Astrophysique de Paris, 98bis boulevard Arago, F-75014 Paris (France); Burrows, Adam, E-mail: rogers@pha.jhu.ed [Department of Astrophysical Sciences, Princeton University, Peyton Hall, Princeton, NJ 08544 (United States)



" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" 9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Appliances",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Cooking Appliances" "Stoves (Units With Both" "an Oven and a Cooktop)"


Elementary Steps of Syngas Reactions on Mo2C(001): Adsorption Thermochemistry and Bond Dissociation  

SciTech Connect

Density functional theory (DFT) and ab initio thermodynamics are applied in order to investigate the most stable surface and subsurface terminations of Mo{sub 2}C(001) as a function of chemical potential and in the presence of syngas. The Mo-terminated (001) surface is then used as a model surface to evaluate the thermochemistry and energetic barriers for key elementary steps in syngas reactions. Adsorption energy scaling relations and Broensted-Evans-Polanyi relationships are established and used to place Mo{sub 2}C into the context of transition metal surfaces. The results indicate that the surface termination is a complex function of reaction conditions and kinetics. It is predicted that the surface will be covered by either C{sub 2}H{sub 2} or O depending on conditions. Comparisons to transition metals indicate that the Mo-terminated Mo{sub 2}C(001) surface exhibits carbon reactivity similar to transition metals such as Ru and Ir, but is significantly more reactive towards oxygen.

Medford, Andrew



FeAl and Mo-Si-B Intermetallic Coatings Prepared by Thermal Spraying  

SciTech Connect

FeAl and Mo-Si-B intermetallic coatings for elevated temperature environmental resistance were prepared using high-velocity oxy-fuel (HVOF) and air plasma spray (APS) techniques. For both coating types, the effect of coating parameters (spray particle velocity and temperature) on the microstructure and physical properties of the coatings was assessed. Fe-24Al (wt.%) coatings were prepared using HVOF thermal spraying at spray particle velocities varying from 540 m/s to 700 m/s. Mo-13.4Si-2.6B coatings were prepared using APS at particle velocities of 180 and 350 m/s. Residual stresses in the HVOF FeAl coatings were compressive, while stresses in the APS Mo-Si-B coatings were tensile. In both cases, residual stresses became more compressive with increasing spray particle velocity due to increased peening imparted by the spray particles. The hardness and elastic moduli of FeAl coatings also increased with increasing particle velocity, again due to an increased peening effect. For Mo-Si-B coatings, plasma spraying at 180 m/s resulted in significant oxidation of the spray particles and conversion of the T1 phase into amorphous silica and {alpha}-Mo. The T1 phase was retained after spraying at 350 m/s.

Totemeier, T.C.; Wright, R.N.; Swank, W.D.



van der Waals Epitaxy of MoS2 Layers Using Graphene As Growth Templates  

SciTech Connect

We present a method for synthesizing MoS{sub 2}/Graphene hybrid heterostructures with a growth template of graphene-covered Cu foil. Compared to other recent reports, a much lower growth temperature of 400 C is required for this procedure. The chemical vapor deposition of MoS{sub 2} on the graphene surface gives rise to single crystalline hexagonal flakes with a typical lateral size ranging from several hundred nanometers to several micrometers. The precursor (ammonium thiomolybdate) together with solvent was transported to graphene surface by a carrier gas at room temperature, which was then followed by post annealing. At an elevated temperature, the precursor self-assembles to form MoS{sub 2} flakes epitaxially on the graphene surface via thermal decomposition. With higher amount of precursor delivered onto the graphene surface, a continuous MoS{sub 2} film on graphene can be obtained. This simple chemical vapor deposition method provides a unique approach for the synthesis of graphene heterostructures and surface functionalization of graphene. The synthesized two-dimensional MoS{sub 2}/Graphene hybrids possess great potential toward the development of new optical and electronic devices as well as a wide variety of newly synthesizable compounds for catalysts.

Shi, Yumeng [Massachusetts Institute of Technology (MIT); Zhou, Wu [Vanderbilt University; Lu, Ang-Yu [Academia Sinica, Hefei, China; Fang, Wenjing [Massachusetts Institute of Technology (MIT); Lee, Yi-Hsien [Massachusetts Institute of Technology (MIT); Hsu, Allen Long [Massachusetts Institute of Technology (MIT); Kim, Soo Min [Massachusetts Institute of Technology (MIT); Kim, Ki Kang [Massachusetts Institute of Technology (MIT); Yang, Hui Ying [Singapore University of Technology and Design; Liang, Lain-Jong [Academia Sinica, Hefei, China; Idrobo Tapia, Juan C [ORNL; Kong, Jing [Massachusetts Institute of Technology (MIT)



Method for the production of {sup 99m}Tc compositions from {sup 99}Mo-containing materials  

DOE Patents (OSTI)

An improved method is described for producing {sup 99m}Tc compositions from {sup 99}Mo compounds. {sup 100}Mo metal or {sup 100}MoO{sub 3} is irradiated with photons in a particle (electron) accelerator to ultimately produce {sup 99}MoO{sub 3}. This composition is then heated in a reaction chamber to form a pool of molten {sup 99}MoO{sub 3} with an optimum depth of 0.5--5 mm. A gaseous mixture thereafter evolves from the molten {sup 99}MoO{sub 3} which contains vaporized {sup 99}MoO{sub 3}, vaporized {sup 99m}TcO{sub 3}, and vaporized {sup 99m}TcO{sub 2}. This mixture is then combined with an oxidizing gas (O{sub 2(g)}) to generate a gaseous stream containing vaporized {sup 99m}Tc{sub 2}O{sub 7} and vaporized {sup 99}MoO{sub 3}. Next, the gaseous stream is cooled in a primary condensation stage in the reaction chamber to remove vaporized {sup 99}MoO{sub 3}. Cooling is undertaken at a specially-controlled rate to achieve maximum separation efficiency. The gaseous stream is then cooled in a sequential secondary condensation stage to convert vaporized {sup 99m}Tc{sub 2}O{sub 7} into a condensed {sup 99m}Tc-containing reaction product which is collected. 1 fig.

Bennett, R.G.; Christian, J.D.; Grover, S.B.; Petti, D.A.; Terry, W.K.; Yoon, W.Y.



EA-1947: Transfer of the Kansas City Plant, Kansas City, MO | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EA-1947: Transfer of the Kansas City Plant, Kansas City, MO EA-1947: Transfer of the Kansas City Plant, Kansas City, MO EA-1947: Transfer of the Kansas City Plant, Kansas City, MO SUMMARY This EA evaluates potential environmental impacts of a proposal to transfer the NNSA's KCP property either in whole or in part. This includes considering the No Action Alternative, where NNSA relocates operations from the KCP and maintains ownership of its property; and the Proposed Action Alternative, where NNSA transfers the KCP property for mixed use (industrial, warehouse, commercial, office). Under the proposed action, the EA addresses the potential direct, indirect, and cumulative impacts of using the KCP property for uses consistent with current zoning. NNSA also analyzes the potential environmental impacts of partial and/or complete


EA-1947: Transfer of the Kansas City Plant, Kansas City, MO | Department of  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EA-1947: Transfer of the Kansas City Plant, Kansas City, MO EA-1947: Transfer of the Kansas City Plant, Kansas City, MO EA-1947: Transfer of the Kansas City Plant, Kansas City, MO SUMMARY This EA evaluates potential environmental impacts of a proposal to transfer the NNSA's KCP property either in whole or in part. This includes considering the No Action Alternative, where NNSA relocates operations from the KCP and maintains ownership of its property; and the Proposed Action Alternative, where NNSA transfers the KCP property for mixed use (industrial, warehouse, commercial, office). Under the proposed action, the EA addresses the potential direct, indirect, and cumulative impacts of using the KCP property for uses consistent with current zoning. NNSA also analyzes the potential environmental impacts of partial and/or complete


EIS-0475: Disposition of the Bannister Federal Complex, Kansas City, MO |  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EIS-0475: Disposition of the Bannister Federal Complex, Kansas EIS-0475: Disposition of the Bannister Federal Complex, Kansas City, MO EIS-0475: Disposition of the Bannister Federal Complex, Kansas City, MO Summary NNSA/DOE announces its intent to prepare an EIS for the disposition of the Bannister Federal Complex, Kansas City, MO. NNSA previously decided in a separate NEPA review (EA-1592) to relocate its operations from the Bannister Federal Complex to a newly constructed industrial campus eight miles from the current location. NOTE: On November 30, 2012, DOE announced the cancellation of this EIS and its intent to prepare an Environmental Assessment (EA-1947). Public Comment Opportunities None available at this time. Documents Available for Download November 30, 2012 EA-1947: Notice of Intent to Prepare an Environmental Assessment and


DOE - Office of Legacy Management -- Weldon Spring Chemical Co - MO 03  

NLE Websites -- All DOE Office Websites (Extended Search)

Weldon Spring Chemical Co - MO 03 Weldon Spring Chemical Co - MO 03 FUSRAP Considered Sites Site: Weldon Spring Chemical Co. (MO.03) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: Also see Weldon Spring, Missouri, Site Documents Related to Weldon Spring Chemical Co. Summary of Work Session - Focus Area: Monitoring and Maintenance. Summary of Weldon Spring Long-Term Stewardship Plan Public Workshop. Summary of Work Session - Focus Area: Communication and Public Involvement. Land Use and Institutional Controls and Homeland SecurityFocus Area Work SessionWeldon Spring SiteInterpretive CenterDecember 5, 20022 Agenda7:00 p.m.Welcome, Pam Thompson, Manager, Weldon SpringObjective of


The development of uranium foil farication technology utilizing twin roll method for Mo-99 irradiation target  

E-Print Network (OSTI)

MDS Nordion in Canada, occupying about 75% of global supply of Mo-99 isotope, has provided the irradiation target of Mo-99 using the rod-type UAl sub x alloys with HEU(High Enrichment Uranium). ANL (Argonne National Laboratory) through co-operation with BATAN in Indonesia, leading RERTR (Reduced Enrichment for Research and Test Reactors) program substantially for nuclear non-proliferation, has designed and fabricated the annular cylinder of uranium targets, and successfully performed irradiation test, in order to develop the fabrication technology of fission Mo-99 using LEU(Low Enrichment Uranium). As the uranium foils could be fabricated in laboratory scale, not in commercialized scale by hot rolling method due to significant problems in foil quality, productivity and economic efficiency, attention has shifted to the development of new technology. Under these circumstances, the invention of uranium foil fabrication technology utilizing twin-roll casting method in KAERI is found to be able to fabricate LEU or...

Kim, C K; Park, H D



Progress in chemical processing of LEU targets for {sup 99}Mo production -- 1997  

SciTech Connect

Presented here are recent experimental results of the continuing development activities associated with converting current processes for producing fission-product {sup 99}Mo from targets using high-enriched uranium (HEU) to low-enriched uranium (LEU). Studies were focused in four areas: (1) measuring the chemical behavior of iodine, rhodium, and silver in the LEU-modified Cintichem process, (2) performing experiments and calculations to assess the suitability of zinc fission barriers for LEU metal foil targets, (3) developing an actinide separations method for measuring alpha contamination of the purified {sup 99}Mo product, and (4) developing a cooperation with Sandia National Laboratories and Los Alamos National Laboratory that will lead to approval by the US Federal Drug Administration for production of {sup 99}Mo from LEU targets. Experimental results continue to show the technical feasibility of converting current HEU processes to LEU.

Vandegrift, G.F.; Conner, C.; Sedlet, J.; Wygmans, D.G. [Argonne National Lab., IL (United States); Wu, D. [Univ. of Illinois, Urbana, IL (United States); Iskander, F.; Landsberger, S. [Univ. of Texas, Austin, TX (United States)



An experimental investigation of double beta decay of /sup 100/Mo  

SciTech Connect

New limits on half-lives for several double beta decay modes of /sup 100/Mo were obtained with a novel experimental system which included thin source films interleaved with a coaxial array of windowless silicon detectors. Segmentation and timing information allowed backgrounds originating in the films to be studied in some detail. Dummy films containing /sup 96/Mo were used to assess remaining backgrounds. With 0.1 mole years of /sup 100/Mo data collected, the lower half-life limits at 90% confidence were 2.7 /times/ 10/sup 18/ years for decay via the two-neutrino mode, 5.2 /times/10/sup 19/ years for decay with the emission of a Majoron, and 1.6 /times/ 10/sup 20/ years and 2.2 /times/ 10/sup 21/ years for neutrinoless 0/sup +/ ..-->.. 2/sup +/ and 0/sup +/ ..-->.. 0/sup +/ transitions, respectively. 50 refs., 38 figs., 11 tabs.

Dougherty, B.L.


Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Substitution of modified 9 Cr-1 Mo steel for austentic stainless steels  

SciTech Connect

This report describes the current program to develop a high-strength ferritic-martensitic steel. The alloy is essentially Fe-9% Cr-1% Mo with small additions of V and Nb and is known as modifed 9 Cr-1 Mo steel. Its elevated-temperature properties and design allowable stresses match those of type 304 stainless steel for temperatures up to 600/sup 0/C and exceed those of other ferritic steels by factors of 2 to 3. The improved strength of this alloy permits its use in place of stainless steels for many applications.

Sikka, V. K.



Effect of Mo Back Contact on Na Out-Diffusion and Device Performance of Mo/Cu(In,Ga)Se2/CdS/ZnO Solar Cells: Preprint  

DOE Green Energy (OSTI)

This conference paper describes the molybdenum thin films that were deposited on soda lime glass (SLG) substrates using direct-current planar magnetron sputtering, with a sputtering power density of 1.2 W/cm2. The working gas (Ar) pressure was varied from 0.6 to 16 mtorr to induce changes in the Mo films' morphology and microstructure. Thin films of Cu(In,Ga)Se2 (CIGS) were deposited on the Mo-coated glass using the 3-stage co-evaporation process. The morphology of both the Mo-coated SLG and the CIGS thin films grown on it was examined using high-resolution scanning electron microscopy. Na was depth profiled in the Mo and CIGS films by secondary ion mass spectrometry. The device performance was evaluated under standard conditions of 1000 W/m2 and 25 C. Optimum device performance is found for an intermediate Mo sputtering pressure.

Al-Thani, H. A.; Hasoon, F. S.; Young, M.; Asher, S.; Alleman, J. L.; Al-Jassim, M. M.; Williamson, D. L.



Soft X-ray Spectroscopy of C60/Copper Phthalocyanine/MoO3 Interfaces: Role of Reduced MoO3 on Energetic Band Alignment and Improved Performance  

Science Conference Proceedings (OSTI)

The interfacial electronic structure of C{sub 60}/copper phthalocyanine (CuPc)/molybdenum trioxide (MoO{sub 3}) thin films grown in situ on indium tin oxide (ITO) substrates has been studied using synchrotron radiation-excited photoelectron spectroscopy in an attempt to understand the influence of oxide interlayers on the performance of small molecule organic photovoltaic devices. The MoO{sub 3} layer on ITO is found to significantly increase the work function of the substrate and induces large interface dipoles and band bending at the CuPc/MoO{sub 3} interface. The large band bending confirms the formation of an internal potential that assists hole extraction from the CuPc layer to the electrode. The electronic structure of the MoO{sub 3} layer on ITO was also examined using various soft X-ray spectroscopies to probe the conductive nature of the MoO{sub 3} thin film.

S Cho; L Piper; A DeMasi; A Preston; K Smith; K Chauhan; R Hatton; T Jones



fcmlbig - Energy Information Administration  

U.S. Energy Information Administration (EIA)

256821 TX Freeman-Martin 256852 MI Freeman-Redding 256914 WV Freemansburg 256945 IL Freemanspur 256976 KS Freemeyer 257007 CA Fremont Landing 257038 OK Freeny


Other Participants 1999 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

MI Shawnee Mission South High School , Shawnee Mission , KS Skyline High School , Idaho Falls, ID Smoky Hill High School, Aurora, CO St. James High School , Montgomery , AL...


Semesterplan WS 2012/13 Chemie (VL) fr Zahnmediziner (1. FS) Stand. 02.10.2012 Mo 22. Okt.  

E-Print Network (OSTI)

Semesterplan WS 2012/13 Chemie (VL) für Zahnmediziner (1. FS) Stand. 02.10.2012 Mo 22. Okt;Semesterplan WS 2012/13 Chemie (VL) für Zahnmediziner (1. FS) Stand. 02.10.2012 Mo 17. Dez. 10.15 11

Gollisch, Tim


Small non-polar complexes exhibiting significant piezoelectric properties: Solvothermal synthesis and crystal structures of MO{sub 5}V(tren){center_dot}H{sub 2}O (M=Mo and W; tren=tris(2-aminoethyl)amine)  

SciTech Connect

The two isostructural complexes MO{sub 5}V(tren){center_dot}H{sub 2}O (M=Mo (1) and W (2)) were synthesized under solvothermal conditions at pH Almost-Equal-To 12 crystallizing in the non-centrosymmetric space group P2{sub 1}2{sub 1}2{sub 1}. The structures are constructed by a distorted tetrahedral [MO{sub 4}]{sup 2-} anion bound via one shared oxygen atom to a severely distorted [V{sup IV}N{sub 4}O]{sup 2+} complex completing the octahedral coordination around the V centre. The two O atoms in the VN{sub 4}O{sub 2} octahedron are in cis position. The two compounds represent rare examples where the [MO{sub 4}]{sup 2-} anion is acting as a ligand. Both compounds exhibit a piezoelectric effect which is more pronounced for M=Mo. The samples are further characterized with IR and UV/Vis spectroscopy and thermal analysis. - Graphical abstract: The complexes [(V(tren)O)(MO4)]{center_dot}H2O (M = Mo, W; tren = tris(2-aminoethyl)amine)) composed of vertex-linked [MO4]{sup 2-} tetrahedron and [VN4O6]{sup 2+}octahedron. Highlights: Black-Right-Pointing-Pointer [MO{sub 4}]{sup 2-} tetrahedron (M=Mo, W) acting as ligand. Black-Right-Pointing-Pointer Jahn-Teller and steric distortion of the [VN{sub 4}O{sub 2}]{sup 2+} octahedron. Black-Right-Pointing-Pointer Non-centrosymmetric complexes exhibiting pronounced piezoelectric effect.

Rasmussen, M.; Naether, C. [Institut fuer Anorganische Chemie, Christian-Albrechts-Universitaet Kiel, Max-Eyth-Str. 2, D-24118 Kiel (Germany)] [Institut fuer Anorganische Chemie, Christian-Albrechts-Universitaet Kiel, Max-Eyth-Str. 2, D-24118 Kiel (Germany); Bismayer, U. [Mineralogisch-Petrographisches Institut, Universitaet Hamburg, Grindelallee 48 20146 Hamburg (Germany)] [Mineralogisch-Petrographisches Institut, Universitaet Hamburg, Grindelallee 48 20146 Hamburg (Germany); Bensch, W., E-mail: wbensch@ac.uni-kiel.de [Institut fuer Anorganische Chemie, Christian-Albrechts-Universitaet Kiel, Max-Eyth-Str. 2, D-24118 Kiel (Germany)



Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.



MoSi2 and Other Silicides as High Temperature Structural Materials  

Science Conference Proceedings (OSTI)

... R.W. Stusrud, R.A. MacKay,. D.L. Anton, T. Khan, R.D. Kissinger, D.L. Klarstmm ..... 'I. 3 10-S d. 5. Q. H. 3 10= g. 5. E a. E m-7. 'E 5, .- z. 10-8 '. 5 c:3si MoSi2. //II.


MoCha-pi, an exogenous coordination calculus based on mobile channels  

Science Conference Proceedings (OSTI)

In this paper we present MoCha-?, an exogenous coordination calculus that is based on mobile channels. A mobile channel is a coordination primitive that allows anonymous point-to-point communication between processes. Our calculus is an extension ... Keywords: calculus, coordination, distributed mobile channels

Juan Guillen-Scholten; Farhad Arbab; Frank de Boer; Marcello Bonsangue



The MoLE project: an international experiment about mobile learning environment  

Science Conference Proceedings (OSTI)

This paper aims to present an international project, called the MoLE Project, which provided learning resources and tools for personnel in disaster or emergency situations. Thus, it illustrates the interpenetration of e-Learning and field workers with ... Keywords: education, mobile technologies, system evaluation

Marie-Hlne Ferrer, Jacob Hodges, Nathalie Bonnardel




E-Print Network (OSTI)

It is argued that the magnetic behavior of Sr2MnMoO6 is determined by the existence of two total energy minima corresponding to the metallic ferromagnetic and insulating antiferromagnetic states, which may be nearly degenerate depending on the magnitude of the breathing distortion. PACS: 71.20.Be; 71.70.Gm; 72.25.Ba; 75.30.Et

I. V. Solovyev



High-field superconductivity in some bcc Ti-Mo and Nb-Zr alloys  

Science Conference Proceedings (OSTI)

Zero electrical resistance at unusually high magnetic field strengths has been observed in the bcc alloys Ti-16 a/o (atomic percent) Mo, Nb-12 a/o Zr, and Nb-25 a/o Zr. The maximum highfield zero-resistance current density, Jc, in these ...

R. R. Hake; T. G. Berlincourt; D. H. Leslie



Spectroscopy of low energy solar neutrinos by MOON -Mo Observatory Of Neutrinos-  

E-Print Network (OSTI)

Spectroscopy of low energy solar neutrinos by MOON -Mo Observatory Of Neutrinos- R. Hazamaa , P Be solar 's. The present status of MOON for the low energy solar experiment is briefly discussed the pp solar flux with good accuracy. 1. INTRODUCTION Realtime studies of the high-energy component of 8

Washington at Seattle, University of


To appear in the ACM SIGGRAPH conference proceedings Jeong-Mo Hong  

E-Print Network (OSTI)

To appear in the ACM SIGGRAPH conference proceedings ? ??? ????? Ð? ? Jeong-Mo Hong£ Korea of viscosity influences the shape of air bubbles in water. In this paper, we extend previous fluid simulation

Frey, Pascal


Aqueous Phase Glycerol Reforming by PtMo Bimetallic Nano-Particle Catalyst: Product Selectivity and Structural Characterization  

Science Conference Proceedings (OSTI)

A carbon supported PtMo aqueous phase reforming catalyst for producing hydrogen from glycerol was characterized by analysis of the reaction products and pathway, TEM, XPS and XAS spectroscopy. Operando X-ray absorption spectroscopy (XAS) indicates the catalyst consists of bimetallic nano-particles with a Pt rich core and a Mo rich surface. XAS of adsorbed CO indicates that approximately 25% of the surface atoms are Pt. X-ray photoelectron spectroscopy indicates that there is unreduced and partially reduced Mo oxide (MoO{sub 3} and MoO{sub 2}), and Pt-rich PtMo bimetallic nano-particles. The average size measured by transmission electron microscopy of the fresh PtMo nano-particles is about 2 nm, which increases in size to 5 nm after 30 days of glycerol reforming at 31 bar and 503 K. The catalyst structure differs from the most energetically stable structure predicted by density functional theory (DFT) calculations for metallic Pt and Mo atoms. However, DFT indicates that for nano-particles composed of metallic Pt and Mo oxide, the Mo oxide is at the particle surface. Subsequent reduction would lead to the experimentally observed structure. The aqueous phase reforming reaction products and intermediates are consistent with both C-C and C-OH bond cleavage to generate H{sub 2}/CO{sub 2} or the side product CH{sub 4}. While the H{sub 2} selectivity at low conversion is about 75%, cleavage of C-OH bonds leads to liquid products with saturated carbon atoms. At high conversions (to gas), these will produced additional CH{sub 4} reducing the H{sub 2} yield and selectivity.

Stach E. A.; Dietrich, P.J.; Lobo-Lapidus, R.J.; Wu, T.; Sumer, A.; Akatay, M.C.; Fingland, B.R.; Guo, N.; Dumesic, J.A.; Marshall, C.L.; Jellinek, J.; Delgass, W.N.; Ribeiro, F.H.; Miller, J.T.



Microstructural Analysis of Irradiated U-Mo Fuel Plates: Recent Results  

Science Conference Proceedings (OSTI)

Microstructural characterization of irradiated dispersion and monolithic RERTR fuel plates using scanning electron microscopy (SEM) is being performed in the Electron Microscopy Laboratory at the Idaho National Laboratory. The SEM analysis of samples from U-Mo dispersion fuel plates focuses primarily on the behavior of the Si that has been added to the Al matrix to improve the irradiation performance of the fuel plate and on the overall behavior of fission gases (e.g., Xe and Kr) that develop as bubbles in the fuel microstructure. For monolithic fuel plates, microstructural features of interest, include those found in the U-Mo foil and at the U-Mo/Zr and Zr/6061 Al cladding interfaces. For both dispersion and monolithic fuel plates, samples have been produced using an SEM equipped with a Focused Ion Beam (FIB). These samples are of very high quality and can be used to uncover some very unique microstructural features that are typically not observed when characterizing samples produced using more conventional techniques. Overall, for the dispersion fuel plates with matrices that contained Si, narrower fuel/matrix interaction layers are typically observed compared to the fuel plates with pure Al matrix, and for the monolithic fuel plates microstructural features have been observed in the U-10Mo foil that are similar to what have been observed in the fuel particles found in U-Mo dispersion fuels. Most recently, more prototypic monolithic fuel samples have been characterized and this paper describes the microstructures that have been observed in these samples.

D. D. Keiser, Jr.; J. Jue; B. D. Miller; J. Gan; A. B. Robinson; P. V. Medvedev



Unprecedented {sup 1}/{sub {infinity}}[{beta}-Mo{sub 8}O{sub 26}]{sup 4-} polymeric chains and four novel organic-inorganic hybrids based on Mo-POMs and azaheterocycles templates  

Science Conference Proceedings (OSTI)

Abstrct: Four novel organic-inorganic hybrid materials based on Mo-POMs and organic templates, namely [DEB] [{beta}-Mo{sub 8}O{sub 26}] [NH{sub 4}]{sub 2} (1), [BMIM] [{beta}-Mo{sub 8}O{sub 26}]{sub 0.5}{center_dot}H{sub 2}O (2), [BMIM] [1D-Mo{sub 8}O{sub 26}]{sub 0.5} (3) and {l_brace}3D-[Cu(DIE){sub 2}] [1D-Mo{sub 8}O{sub 26}]{sub 0.5}{r_brace}{sub {infinity}} (4) [DEB= 1,1 Prime -diethyl-4,4 Prime -bipyridinium, BMIM=1,1 Prime -bis(1-methylimidazolium)methylene, DIE=1,2-diimidazoloethane] have been hydrothermally synthesized and characterized by elemental analyses, IR spectroscopy, thermal gravimetric analysis(TGA) and single-crystal X-ray diffraction. Both compounds 1 and 2 are POMs-based supramolecular compounds consisted of independent [{beta}-Mo{sub 8}O{sub 26}]{sup 4-} anions and [DEB]{sup 2+} or [BMIM]{sup 2+} organic cations. Compound 3 is the first external template example of Mo-POMs-based supramolecular network incorporated with novel {sup 1}/{sub {infinity}}[{beta}-Mo{sub 8}O{sub 26}]{sup 4-} polymeric chains. Compound 4 is a rare supramolecular structure that contains octamolybdate {sup 1}/{sub {infinity}}[{beta}-Mo{sub 8}O{sub 26}]{sup 4-} polymeric chains interconnected via DIE ligands to form a 3D net. Moreover, it was indicated that these polyacid compounds had definite catalytic activities on the probe reaction of acetaldehyde oxidation to acetic acid with H{sub 2}O{sub 2}. - Graphical abstract: Four novel organic templated polyoxometalates comprising of 0D, 1D and 3D supramolecular frameworks together with the catalytic activities on the acetaldehyde oxidation to acetic acid were reported. Highlights: Using cation templated self-assembly four novel polyoxometalates were prepared. Compounds 1 and 2 consisted of independent [{beta}-Mo{sub 8}O{sub 26}]{sup 4-} anions and organic cations. Compound 3 is the first external template-assisted POMs with {sup 1}/{sub {infinity}}[{beta}-Mo{sub 8}O{sub 26}]{sup 4-} chain. Compound 4 is a rare 3D net containing {sup 1}/{sub {infinity}}[{beta}-Mo{sub 8}O{sub 26}]{sup 4-} 1D chain and DIE ligands. These compounds had definite catalytic activities on the acetaldehyde oxidation.

Du Haijuan; Zunzhe Shu [College of Chemistry and Molecular Engineering, Zhengzhou University, Zhengzhou 450001 (China); Niu Yunyin, E-mail: niuyy@zzu.edu.cn [College of Chemistry and Molecular Engineering, Zhengzhou University, Zhengzhou 450001 (China); Song Lisha; Zhu Yu [College of Chemistry and Molecular Engineering, Zhengzhou University, Zhengzhou 450001 (China)



Microstructural Characterization of U-7Mo/Al-Si Alloy Matrix Dispersion Fuel Plates Fabricated at 500C  

Science Conference Proceedings (OSTI)

The starting microstructure of a dispersion fuel plate will impact the overall performance of the plate during irradiation. To improve the understanding of the as-fabricated microstructures of UMo dispersion fuel plates, particularly the interaction layers that can form between the fuel particles and the matrix, scanning electron microscopy (SEM) and transmission electron microscopy (TEM) analyses have been performed on samples from depleted U7Mo (U7Mo) dispersion fuel plates with either Al2 wt.% Si(Al2Si) or AA4043 alloy matrix. It was observed that in the thick interaction layers, U(Al, Si)3 and U6Mo4Al43 were present, and in the thin interaction layers, (U, Mo) (Al, Si)3, U(Al, Si)4, U3Si3Al2, U3Si5, and possibly USi-type phases were observed. The U3Si3Al2 phase contained some Mo. Based on the results of this investigation, the time that a dispersion fuel plate is exposed to a relatively high temperature during fabrication will impact the nature of the interaction layers around the fuel particles. Uniformly thin, Si-rich layers will develop around the U7Mo particles for shorter exposure times, and thicker, Si-depleted layers will develop for the longer exposure times.

Dennis D. Keiser, Jr.; Jan-Fong Jue; Bo Yao; Emmanuel Perez; Yongho Sohn; Curtis R. Clark



Search for the decay B^+ \\to K_S^0 K_S^0 \\pi ^+  

SciTech Connect

The authors search for charmless decays of charged B mesons to the three-body final state K{sub S}{sup 0}K{sub S}{sup 0}{pi}{sup +}. Using a data sample of 423.7 fb{sup -1} collected at the {Upsilon}(4S) resonance with the BABAR detector, corresponding to (465.1 {+-} 5.1) x 10{sup 6} B{bar B} pairs, they find no significant signal and determine a 90% confidence level upper limit on the branching fraction of 5.1 x 10{sup -7}.

Aubert, B.; Bona, M.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Lopez, L.; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Cahn, R.N.; Jacobsen, R.G.; /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /Frascati /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Karlsruhe U., EKP /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT, LNS /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /INFN, Naples /Naples U. /INFN, Naples /INFN, Naples /Naples U. /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /Pennsylvania U. /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison


Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental



Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural



Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration


Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.



Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost



Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."



Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure



Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of


File:USDA-CE-Production-GIFmaps-MO.pdf | Open Energy Information  

Open Energy Info (EERE)

MO.pdf MO.pdf Jump to: navigation, search File File history File usage Missouri Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 377 KB, MIME type: application/pdf) Description Missouri Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Missouri External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,650 × 1,275 (377 KB) MapBot (Talk | contribs) Automated bot upload


Laser Welding and Post Weld Treatment of Modified 9Cr-1MoVNb Steel [Laser  

NLE Websites -- All DOE Office Websites (Extended Search)

Laser Welding of Metals > Laser Welding of Metals > Laser Welding and Post Weld Treatment of Modified 9Cr-1MoVNb Steel Capabilities Engineering Experimentation Reactor Safety Experimentation Aerosol Experiments System Components Laser Applications Overview Laser Oil & Gas Well Drilling Laser Heat Treatment Laser Welding of Metals On-line Monitoring Laser Beam Delivery Laser Glazing of Railroad Rails High Power Laser Beam Delivery Decontamination and Decommissioning Refractory Alloy Welding Robots Applications Other Facilities Other Capabilities Work with Argonne Contact us For Employees Site Map Help Join us on Facebook Follow us on Twitter NE on Flickr Laser Applications Laboratory Laser Welding of Metals Laser Welding and Post Weld Treatment of Modified 9Cr-1MoVNb Steel Zhiyue Xu Nuclear Engineering Division of Argonne National Laboratory


Improved performance of U-Mo dispersion fuel by Si addition in Al matrix.  

SciTech Connect

The purpose of this report is to collect in one publication and fit together work fragments presented in many conferences in the multi-year time span starting 2002 to the present dealing with the problem of large pore formation in U-Mo/Al dispersion fuel plates first observed in 2002. Hence, this report summarizes the excerpts from papers and reports on how we interpreted the relevant results from out-of-pile and in-pile tests and how this problem was dealt with. This report also provides a refined view to explain in detail and in a quantitative manner the underlying mechanism of the role of silicon in improving the irradiation performance of U-Mo/Al.

Kim, Y S; Hofman, G L [Nuclear Engineering Division



Mo-6%Nb single crystal alloy creep strength demonstration for long life thermionic power systems  

DOE Green Energy (OSTI)

Experimental results of one- and two-dimensional creep testing for single crystal Mo-6%Nb alloy are presented. Three 1-D specimens were creep-tested for up to 3000 hours at 1873 to 1973 K and 5 to 15 MPa. One 2-D specimen tube was creep-tested for 2000 hours at 1873 K/15MPa. Results confirm the high creep strength of Mo-6%Nb for long life (10 to 15 year) TFE emitter application in thermionic space nuclear power systems. After the initial transition stage (about 1000 hours), quasi-steady state 1-D and 2-D creep rates were within 20% of each other suggesting little significant effect of anisotropy. More data points will be needed to define the Sherby-Dom parameters with statistical accuracy. {copyright} 1995 {ital American} {ital Institute} {ital of} {ital Physics}

Rhee, H.S.; Zheng, C.; Kent Koester, J. [Space Power, Inc., 621 River Oaks Parkway, San Jose, California 95134 (United States); Yastrebkov, A.; Nikolaev, Y.; Gontar, A. [Scientific Industrial Association Lutch, Podolsk, Moscow Region (Russian Federation)




Gasoline and Diesel Fuel Update (EIA)

2000 2000 Southern California Gas Co ..................... CA 251,452,001 8.32 Nicor Gas ................................................. IL 221,009,522 6.68 Pacific Gas and Elec Co........................... CA 211,181,852 7.98 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 184,692,129 7.53 Consumers Energy Co ............................. MI 176,663,600 4.76 Michigan Consol Gas Co.......................... MI 136,124,328 5.41 Keyspan Energy Del Co ........................... NY 134,055,940 10.75 Pub Svc Elec and Gas Co........................ NJ 132,611,115 6.32 East Ohio Gas Co .................................... OH 131,187,521 7.49 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 130,622,887 8.82 Peoples Gas Lt and Coke Co................... IL 103,856,141 8.60 Pub Svc Co of Colorado...........................


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office



Gasoline and Diesel Fuel Update (EIA)

5 5 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 138,239,378 5.94 Pub Svc Elec and Gas Co........................ NJ 69,738,220 5.26 Southern California Gas Co ..................... CA 63,758,073 7.26 Pacific Gas and Elec Co........................... CA 58,646,965 7.84 Keyspan Energy Del Co ........................... NY 53,501,565 7.32 Consumers Energy Co ............................. MI 51,663,333 4.26 TXU Gas Distribution................................ TX 48,112,344 5.86 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 45,021,338 7.87 Con Edison Co of New York Inc............... NY 44,076,359 8.02 Michigan Consol Gas Co.......................... MI 40,342,797 5.39 Pub Svc Co of Colorado........................... CO 39,697,152 5.22 East Ohio Gas Co ....................................

Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Continuing investigations for technology assessment of /sup 99/Mo production from LEU (low enriched Uranium) targets  

SciTech Connect

Currently much of the world's supply of /sup 99m/Tc for medical purposes is produced from /sup 99/Mo derived from the fissioning of high enriched uranium (HEU). The need for /sup 99m/Tc is continuing to grow, especially in developing countries, where needs and national priorities call for internal production of /sup 99/Mo. This paper presents the results of our continuing studies on the effects of substituting low enriched Uranium (LEU) for HEU in targets for the production of fission product /sup 99/Mo. Improvements in the electrodeposition of thin films of uranium metal are reported. These improvements continue to increase the appeal for the substitution of LEU metal for HEU oxide films in cylindrical targets. The process is effective for targets fabricated from stainless steel or hastaloy. A cost estimate for setting up the necessary equipment to electrodeposit uranium metal on cylindrical targets is reported. Further investigations on the effect of LEU substitution on processing of these targets are also reported. Substitution of uranium silicides for the uranium-aluminum alloy or uranium aluminide dispersed fuel used in other current target designs will allow the substitution of LEU for HEU in these targets with equivalent /sup 99/Mo-yield per target and no change in target geometries. However, this substitution will require modifications in current processing steps due to (1) the insolubility of uranium silicides in alkaline solutions and (2) the presence of significant quantities of silicate in solution. Results to date suggest that both concerns can be handled and that substitution of LEU for HEU can be achieved.

Vandergrift, G.F.; Kwok, J.D.; Marshall, S.L.; Vissers, D.R.; Matos, J.E.



Production and Characterization of Atomized U-Mo Powder by the Rotating Electrode Process  

SciTech Connect

In order to produce feedstock fuel powder for irradiation testing, the Idaho National Laboratory has produced a rotating electrode type atomizer to fabricate uranium-molybdenum alloy fuel. Operating with the appropriate parameters, this laboratory-scale atomizer produces fuel in the desired size range for the RERTR dispersion experiments. Analysis of the powder shows a homogenous, rapidly solidified microstructure with fine equiaxed grains. This powder has been used to produce irradiation experiments to further test adjusted matrix U-Mo dispersion fuel.

C.R. Clark; B.R. Muntifering; J.F. Jue



High strength Sn-Mo-Nb-Zr alloy tubes and method of making same  

DOE Patents (OSTI)

Tubes for use in nuclear reactors fabricated from a quaternary alloy comprising 2.5-4.0 wt% Sn, 0.5-1.5 wt% Mo, 0.5-1.5 wt% Nb, balance essentially Zr. The tubes are fabricated by a process of hot extrusion, heat treatment, cold working to size and age hardening, so as to produce a microstructure comprising elongated .alpha. grains with an acicular transformed .beta. grain boundary phase.

Cheadle, Brian A. (Deep River, CA)



Electrical tuning of valley magnetic moment through symmetry control in bilayer MoS2  

SciTech Connect

Crystal symmetry governs the nature of electronic Bloch states. For example, in the presence of time-reversal symmetry, the orbital magnetic moment and Berry curvature of the Bloch states must vanish unless inversion symmetry is broken1. In certain two-dimensional electron systems such as bilayer graphene, the intrinsic inversion symmetry can be broken simply by applying a perpendicular electric field2,3. In principle, this offers the possibility of switching on/off and continuously tuning the magnetic moment and Berry curvature near the Dirac valleys by reversible electrical control4,5. Here we investigate this possibility using polarization-resolved photoluminescence of bilayer MoS2, which has the same symmetry as bilayer graphene but has a bandgap in the visible spectrum6,7 allowing direct optical probing5,8 12. We find that in bilayer MoS2 the circularly polarized photoluminescence can be continuously tuned from 15% to 15% as a function of gate voltage, whereas in structurally non-centrosymmetric monolayer MoS2 the photoluminescence polarization is gate independent. The observations are well explained as resulting from the continuous variation of orbital magnetic moments between positive and negative values through symmetry control.

Wu, Sanfeng [University of Washington, Seattle; Ross, Jason [University of Washington, Seattle; Liu, G. B. [University of Hong Kong, The; Aivazian, Grant [University of Washington, Seattle; Jones, Aaron [University of Washington, Seattle; Fei, Zaiyao [University of Washington, Dept Phys, Seattle, WA; Zhu, Wenguang [University of Tennessee, Knoxville (UTK); Xiao, Di [ORNL; Yao, Wang [University of Hong Kong, The; Cobden, David [University of Washington, Dept Phys, Seattle, WA; Xu, Xiaodong [University of Washington



Ni6Cr5MoO18: A compensated half metal predicted from first-principles  

Science Conference Proceedings (OSTI)

NiCrO3 is semiconducting. It contains six molecular units in the conventional cell. By substituting one of the six Cr atoms with Mo in the conventional cell

Jing Wang; Ningning Zu; Zhijian Wu



Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available



Electrical properties of a-C:Mo films produced by dual-cathode filtered cathodic arc plasma deposition  

SciTech Connect

Molybdenum-containing amorphous carbon (a-C:Mo) thin films were prepared using a dual-cathode filtered cathodic arc plasma source with a molybdenum and a carbon (graphite) cathode. The Mo content in the films was controlled by varying the deposition pulse ratio of Mo and C. Film sheet resistance was measured in situ at process temperature, which was close to room temperature, as well as ex situ as a function of temperature (300-515 K) in ambient air. Film resistivity and electrical activation energy were derived for different Mo and C ratios and substrate bias. Film thickness was in the range 8-28 nm. Film resistivity varied from 3.55x10-4 Omega m to 2.27x10-6 Omega m when the Mo/C pulse ratio was increased from 0.05 to 0.4, with no substrate bias applied. With carbon-selective bias, the film resistivity was in the range of 4.59x10-2 and 4.05 Omega m at a Mo/C pulse ratio of 0.05. The electrical activation energy decreased from 3.80x10-2 to 3.36x10-4 eV when the Mo/C pulse ratio was increased in the absence of bias, and from 0.19 to 0.14 eV for carbon-selective bias conditions. The resistivity of the film shifts systematically with the amounts of Mo and upon application of substrate bias voltage. The intensity ratio of the Raman D-peak and G-peak (ID/IG) correlated with the pre-exponential factor (sigma 0) which included charge carrier density and density of states.

Sansongsiri, Sakon; Anders, Andre; Yodsombat, Banchob



TEM Characterization of U-7Mo/Al-2Si Dispersion Fuel Irradiated to Intermediate and High Fission Densities  

SciTech Connect

This paper will discuss the results of TEM analysis that was performed on two samples taken from the low flux and high flux sides of the fuel plate with U-7Mo fuel particles dispersed in U-2Si matrix. The corresponding local fission density of the fuel particles and the peak fuel plate centerline temperature between the low flux and high flux samples are 3.32 x 10{sup 27} f/m{sup 3} and 90 C, and 6.31 x 10{sup 27} f/m{sup 3} and 120 C, respectively. The results of this work showed the presence of a bubble superlattice within the U-7Mo grains that accommodated fission gases (e.g., Xe). The presence of this structure helps the U-7Mo exhibit a stable swelling behavior during irradiation. The Si-rich interaction layers that develop around the fuel particles at the U-7Mo/matrix interface during fuel plate fabrication and irradiation become amorphous during irradiation. The change in bubble distribution at the high fission density suggests that the bubble superlattice is stable as the U-7Mo matrix remains crystalline. It appears that there is a threshold Si content in the fuel particle above which the U-Mo turns to amorphous under irradiation. The threshold Si content is approximately 8 at.% and 4 at.% for low flux and high flux condition, respectively.

J. Gan; D.D. Keiser, Jr.; B.D. Miller; A.B. Robinson; J-F. Jue; P.G. Medvedev; D.M. Wachs



Major DOE Biofuels Project Locations  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(St. Joseph, MO) Abengoa Biochemica Agricultural Residue (Hugoton, KS) DOE Joint Bioenergy Institute (Berkeley, CA) DOE Great Lakes Bioenergy Research Center (Madison, WI) DOE...


The State of Organizing in Midwestern First Suburbs Commentary  

E-Print Network (OSTI)

Cleveland, Columbus, Detroit, Milwaukee, Minneapolis, andCleveland; Columbus, OH; Detroit; Kansas City, KSMO;Number 1: Winter 2006 Dayton Detroit Kansas City Minneapolis

Puentes, Robert



Mkha' 'gro dbang mo'i rnam that, the biography of the gter ston ma bde chen chos kyi dbang mo (1868-1927?)  

E-Print Network (OSTI)

, for example, A 'dzom 'Brug pa 'Gro 'dul dPa' bo rDo rje (1842-1924), a famous rdzogs chen master and treasure revealer (see Namkhai 1986, p. 153), who bestowed upon her a long life empowerment when she was 26 (1893); see dBang mo'i rnam thar, p. 824, passim... , Kvrne and Nagano eds., 2003, p. 323), gCod, A khrid (see Kvrne and Rikey, 1996), Phur pa (see Bon Kanjur, op.cit., pp. 295-297), rDzogs chen Yang rtse Klong chen (Sherab Wangyal, TBMC, New Delhi, 1973), Khro bo rGyud drug gSang ba bSen thub (see Bon...

Rossi, Donatella



A practical grinding-assisted dry synthesis of nanocrystalline NiMoO{sub 4} polymorphs for oxidative dehydrogenation of propane  

Science Conference Proceedings (OSTI)

A practical two-stage reactive grinding-assisted pathway waste-free and cost-effective for the synthesis of NiMoO{sub 4} has been successfully developed. It was demonstrated that proper design in synthetic strategy for grinding plays a crucial role in determining the ultimate polymorph of NiMoO{sub 4}. Specifically, direct grinding (DG) of MoO{sub 3} and NiO rendered {alpha}-NiMoO{sub 4} after annealing, whereas sequential grinding (SG) of the two independently pre-ground oxides followed by annealing generated {beta}-NiMoO{sub 4} solid solution. Characterizations in terms of Raman and X-ray diffraction suggest the creation of {beta}-NiMoO{sub 4} precursor in the latter alternative is the key aspect for the formation of {beta}-NiMoO{sub 4}. The DG-derived {alpha}-NiMoO{sub 4} tested by oxidative dehydrogenation of propane exhibited superior activity in contrast to its analog synthesized via conventional coprecipitation. It is suggested that the favorable chemical composition facilely obtained via grinding in contrast to that by coprecipitation was essential for achieving a more selective production of propylene. - Graphical Abstract: Grinding-assisted synthesis of NiMoO{sub 4} offers higher and more reproducible activities in contrast to coprecipitation for oxidative dehydrogenation of propane, and both {alpha}- and {beta}-NiMoO{sub 4} can be synthesized. Highlights: Black-Right-Pointing-Pointer NiMoO{sub 4} was prepared through grinding-assisted pathway. Black-Right-Pointing-Pointer Direct/sequential grinding rendered {alpha}-, {beta}-NiMoO{sub 4}, respectively. Black-Right-Pointing-Pointer Grinding-derived {alpha}-NiMoO{sub 4} showed high and reproducible activity for oxidative dehydrogenation of propane.

Chen Miao, E-mail: chenmiao@sinochem.com [Shanghai Key Laboratory of Molecular Catalysis and Innovative Materials, Department of Chemistry, Fudan University, Shanghai 200433 (China); Zhejiang Chemical Industry Research Institute, Hangzhou 310023 (China); Wu Jialing; Liu Yongmei [Shanghai Key Laboratory of Molecular Catalysis and Innovative Materials, Department of Chemistry, Fudan University, Shanghai 200433 (China); Cao Yong, E-mail: yongcao@fudan.edu.cn [Shanghai Key Laboratory of Molecular Catalysis and Innovative Materials, Department of Chemistry, Fudan University, Shanghai 200433 (China); Guo Li [Zhejiang Chemical Industry Research Institute, Hangzhou 310023 (China); He Heyong; Fan Kangnian [Shanghai Key Laboratory of Molecular Catalysis and Innovative Materials, Department of Chemistry, Fudan University, Shanghai 200433 (China)



Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.



Mo Zhou  

NLE Websites -- All DOE Office Websites (Extended Search)

and regional government on appliance standard achievement; evaluate the social impact of appliance labeling program; and analysis of appliance price trend and learning rate to...


MO: ZL  

Office of Legacy Management (LM)

Tonawanda, New York," May 1978 (DOEEV-00056). 2. "Radiological Survey of the Ashland Oil Co. (Former Waist Property), Tonewanda, Kew York," May 1978 (DOEEV-00054). 3....


Stability and Lifetime of K-CoMoSx Mixed Alcohol Catalysts  

SciTech Connect

Researchers have studied sulfide-type catalysts for the production of mixed alcohols from synthesis gas for several decades. Despite many advances in the art, these processes are not yet commercial, due in large part to mediocre economics and the added risk associated with uncertainty in catalyst lifetime. This talk will outline some recent studies in the lifetime and stability of K-CoMoSx-type mixed alcohol catalysts. Specifically, studies of long term operation (> 3000h), sulfiding agents, simulated methanol recycle, and morphology (probed via XRD and XPS) will be discussed, with the conclusion that these materials are likely to exhibit acceptable lifetimes in continuous operation.

Hensley, J. E.; Ruddy, D.; Schaidle, J.; Ferrell, J.; Thibodeaux, J.




Science Conference Proceedings (OSTI)

Full-size U10Mo foils are being developed for use in high density LEU monolithic fuel plates. The application of a zirconium barrier layer too the foil is applied using a hot co-rolling process. Aluminum clad fuel plates are fabricated using Hot Isostatic Pressing (HIP) or a Friction Bonding (FB) process. An overview is provided of ongoing technology development activities, including: the co-rolling process, foil shearing/slitting and polishing, cladding bonding processes, plate forming, plate-assembly swaging, and fuel plate characterization. Characterization techniques being employed include, Ultrasonic Testing (UT), radiography, and microscopy.

G. A. Moore; J-F Jue; B. H. Rabin; M. J. Nilles



Beta-decay properties of Zr and Mo neutron-rich isotopes  

E-Print Network (OSTI)

Gamow-Teller strength distributions, beta-decay half-lives, and beta-delayed neutron emission are investigated in neutron-rich Zr and Mo isotopes within a deformed quasiparticle random-phase approximation. The approach is based on a self-consistent Skyrme Hartree-Fock mean field with pairing correlations and residual separable particle-hole and particle-particle forces. Comparison with recent measurements of half-lives stresses the important role that nuclear deformation plays in the description of beta-decay properties in this mass region.

Sarriguren, P



Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan



Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-


Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Properties of DU-10wt%Mo Alloys Subjected to Various Post-Rolling Heat Treatments  

Science Conference Proceedings (OSTI)

Mechanical properties of depleted uranium-molybdenum (U-Mo) alloys subjected to different post-processing treatments have been obtained using microhardness, quasi-static tensile tests, and scanning electron microscopy failure analysis. U-Mo alloy foils are currently under investigation for potential fuel conversion of high power research reactors to low enriched uranium fuel. Although mechanical properties take on a secondary effect during irradiation, an understanding of the alloy behavior during fabrication and the effects of irradiation on the integrity of the fuel is essential. In general, the microhardness was insensitive to annealing temperature but decreased with annealing duration. Yield strength, Youngs modulus and ultimate tensile strength improved with both increasing annealing temperature and duration. The failure mode was also insensitive to annealing conditions, but was significantly controlled by the impurity concentration of the alloy, especially carbon. Values obtained from literature are also provided with reasonable agreement based on extrapolation of annealing duration, even though processing conditions and applications were quite different in some instances.

Douglas E. Burkes; Ramprashad Prabhakaran; Thomas Hartmann; Jan-Fong Jue; Francine J. Rice



Development and processing of LEU targets for {sup 99}Mo production  

SciTech Connect

Most of the world`s supply of {sup 99m}Tc for medical purposes is currently produced from the decay of {sup 99}Mo derived from the fissioning of high-enriched uranium (HEU). Substantial progress has been made in developing targets and chemical processes for producing {sup 99}Mo using low-enriched uranium (LEU). Target development has been focused on a uranium-metal foil target as a replacement for the coated-UO{sub 2} Cintichem-type target. Although the first designs were not successful because of ion mixing-induced bonding of the uranium foil to the target tubes, recent irradiations of modified targets have proven successful. Only minor modifications of the Cintichem chemical process are required for the uranium-metal foil targets. A demonstration using prototypically irradiated targets is anticipated in February 1997. Progress has also been made in basic dissolution of both uranium-metal foil and aluminum-clad U{sub 3}Si{sub 2} dispersion fuel targets.

Snelgrove, J.L.; Vandegrift, G.F.; Hofman, G.L.



Thermal shock behavior of alumina/MoSi2 plasma sprayed laminated composites  

Science Conference Proceedings (OSTI)

Alumina (Al{sub 2}O{sub 3}) is very susceptible to thermal shock, which leads to strength degradation. By reinforcing Al{sub 2}O{sub 3} with molybdenum disilicide (MoSi{sub 2}) layers, the tolerance to damage caused by thermal shock can be improved. The thermal shock resistance of plasma sprayed Al{sub 2}O{sub 3}/MoSi{sub 2} laminated composites were investigated. Three laminate microstructures having different layer thickness were fabricated by atmospheric plasma spraying while maintaining a 50/50-volume fraction. Quenching experiments done on 4-point bend bars showed a gradual decrease in the strength as the change in temperature ({Delta}T) increased. Thermal shock resistant parameters (R{prime} and R-quadruple prime) provided a representative numerical value of the thermal shock resistance for the laminated composites. The corresponding material properties for the different microstructures were determined experimentally in order to calculate the R{prime} and R quadruple prime values. The intermediate layered composite showed the highest R-quadruple prime va1ue at 1061 {micro}m, while the thin layered composite had the highest R{prime} value at 474 W/m.

Castro, R. G. (Richard G.); Petrovic, J. J.; Vaidya, R. U. (Rajendra U.); Mendoza, D. (Daniel)



Experimental study of the electric dipole strength in the even Mo nuclei and its deformation dependence  

E-Print Network (OSTI)

Two methods based on bremsstrahlung were applied to the stable even Mo isotopes for the experimental determination of the photon strength function covering the high excitation energy range above 4 MeV with its increasing level density. Photon scattering was used up to the neutron separation energies Sn and data up to the maximum of the isovector giant resonance(GDR) were obtained by photo-activation. After a proper correction for multi-step processes the observed quasi-continuous spectra of scattered photons show a remarkably good match to the photon strengths derived from nuclear photo effect data obtained previously by neutron detection and corrected in absolute scale using the new activation results. The combined data form an excellent basis to derive a shape dependence of the E1 strength in the even Mo isotopes with increasing deviation from the N = 50 neutron shell, i.e. with the impact of quadrupole deformation and triaxiality. The wide energy coverage of the data allows for a stringent assessment of the dipole sum-rule, and a test of a novel parameterization developed previously which is based upon. This parameterization for the electric dipole strength function in nuclei with A>80 deviates significantly from prescriptions generally used previously. In astrophysical network calculations it may help to quantify the role the p-process plays in the cosmic nucleosynthesis. It also has impact on the accurate analysis of neutron capture data of importance for future nuclear energy systems and waste transmutation.

M. Erhard; A. R. Junghans; C. Nair; R. Schwengner; R. Beyer; J. Klug; K. Kosev; A. Wagner; E. Grosse



Relationships between processing, microstructure, and properties of a Co-Cr-Mo alloy  

SciTech Connect

STELLITE alloy No. 21 was produced via rapid solidification processing (RSP) in a variety of particulate morphologies (coarse and fine powder, flakes, fibers, and ribbons). The various RSP forms showed similar, fine microstructures with only a slight difference in the scale of the microstructural features. These RSP particulates were consolidated by extrusion, dynamic compaction, and rapid omnidirectional compaction (ROC) at two processing temperatures (1077/sup 0/C and 1121/sup 0/C). Dynamic compaction proved to be unacceptable for this alloy because of non-uniform porosity and the inability to develop a metallurgical bond between particulates. A plot of elongation versus yield strength depicted two yield strength/ductility relationships for the Co-Cr-Mo type alloys. As-ROC'd samples had a low yield strength/ductility relationship. Atomized powder size also affected the strength/ductility relationships of the extruded products. Decreasing powder size increased ductility without effecting yield strength. Processing temperature did not affect the yield strength/ductility relationship. Electrochemical polarization tests were not successful in delineating fine differences between the various types of Co-Cr-Mo alloy while immersion-pitting temperature tests were capable of distinguishing between samples processed from fine and coarse powders. These materials proved susceptible to stress corrosion cracking (SCC) in boiling 30% MgCl/sub 2/.

Anand, V.; Hickl, A.J.; Kumar, P.; Boeck, B.A.; Sanders, T.H. Jr.



Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI



Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah



/sup 238/PuO/sub 2//Mo-50 wt% Re compatibility at 800 and 1000/sup 0/C  

DOE Green Energy (OSTI)

The compatibility of Mo-50 wt % Re with /sup 238/PuO/sub 2/ was investigated after heat treatments of up to 720 days at 800/sup 0/C and 180 days at 1000/sup 0/C. At 800/sup 0/C, a 1-..mu..m thick, continuous layer of molybdenum oxide resulted. At 1000/sup 0/C, the oxide reaction product contained some plutonium and did not appear continuous. At 1000/sup 0/C, a layer of intermetallic formed at the Mo-Re edge, beneath the oxide layer, creating a barrier between the Mo-50 wt % Re and the /sup 238/PuO/sub 2/. The intermetallic layer was promoted by the iron impurity in the /sup 238/PuO/sub 2/.

Schaeffer, D.R.; Teaney, P.E.



MoO3 as combined hole injection layer and tapered spacer in combinatorial multicolor microcavity organic light emitting diodes  

SciTech Connect

Multicolor microcavity ({mu}C) organic light-emitting diode (OLED) arrays were fabricated simply by controlling the hole injection and spacer MoO{sub 3} layer thickness. The normal emission was tunable from {approx}490 to 640 nm and can be further expanded. A compact, integrated spectrometer with two-dimensional combinatorial arrays of {mu}C OLEDs was realized. The MoO{sub 3} yields more efficient and stable devices, revealing a new breakdown mechanism. The pixel current density reaches {approx}4 A/cm{sup 2} and a maximal normal brightness {approx}140 000 Cd/m{sup 2}, which improves photoluminescence-based sensing and absorption measurements.

Liu, R.; Xu, Chun; Biswas, Rana; Shinar, Joseph; Shinar, Ruth



Low-spin structure of {sup 96}Mo studied with the (n,n{sup '}{gamma}) reaction  

Science Conference Proceedings (OSTI)

Extensive studies of the low-spin excited states in {sub 42}{sup 96}Mo{sub 54} with the (n,n{sup '}{gamma}) reaction have clarified the level scheme below 3.7 MeV excitation energy and determined detailed information about {sup 96}Mo, including lifetimes from the Doppler-shift attenuation method, branching ratios, and multipole mixing ratios. Also, B(E2) and B(M1) values were determined for many transitions, multiphonon states were identified, and several low-spin states were characterized in terms of collective, mixed-symmetry states.

Lesher, S. R.; Yates, S. W. [Department of Physics and Astronomy, University of Kentucky, Lexington, Kentucky 40506-0055 (United States); Department of Physics, University of Richmond, Richmond, Virginia 23173 (United States); McKay, C. J.; Bandyopadhyay, D.; Boukharouba, N.; Fransen, C.; Orce, J. N.; McEllistrem, M. T. [Department of Physics and Astronomy, University of Kentucky, Lexington, Kentucky 40506-0055 (United States); Mynk, M. [Department of Chemistry, University of Kentucky, Lexington, Kentucky 40506-0055 (United States)



The eects of CO2, CO and H2 co-reactants on methane reactions catalyzed by Mo/H-ZSM-5  

E-Print Network (OSTI)

partial oxidation and autothermal or steam reforming is currently practiced [1±4]. Catalytic pyrolysisThe eects of CO2, CO and H2 co-reactants on methane reactions catalyzed by Mo/H-ZSM-5 Zheng Liu-reactants; methane reactions; Mo/H-ZSM-5 catalyst. 1. Introduction The direct conversion of natural gas

Iglesia, Enrique


Effects of Cr-Mo Infiltration Source Structure on the Thickness of Alloy Layer by Double Glow Plasma Surface Metallurgy Technology  

Science Conference Proceedings (OSTI)

To strengthen the growth characteristics of layer on Q235 steel, a new source structure of Cr-Mo infiltration was proposed by plasma surface metallurgy technology. Comparative experiments were carried out on source polar of scrubbing brush structure ... Keywords: Surface alloying, Cr-Mo infiltrated, Plasma surface metallurgy technology, Thickness of layer

Jinyong Xu; Jingchun Zhang; Yajuan Liu; Cheng Gao



Preparation and structural study from neutron diffraction data of Pr{sub 5}Mo{sub 3}O{sub 16}  

SciTech Connect

The title compound has been prepared as polycrystalline powder by thermal treatments of mixtures of Pr{sub 6}O{sub 11} and MoO{sub 2} in air. In the literature, an oxide with a composition Pr{sub 2}MoO{sub 6} has been formerly described to present interesting catalytic properties, but its true stoichiometry and crystal structure are reported here for the first time. It is cubic, isostructural with CdTm{sub 4}Mo{sub 3}O{sub 16} (space group Pn-3n, Z=8), with a=11.0897(1) A. The structure contains MoO{sub 4} tetrahedral units, with Mo-O distances of 1.788(2) A, fully long-range ordered with PrO{sub 8} polyhedra; in fact it can be considered as a superstructure of fluorite (M{sub 8}O{sub 16}), containing 32 MO{sub 2} fluorite formulae per unit cell, with a lattice parameter related to that of cubic fluorite (a{sub f}=5.5 A) as a{approx}2a{sub f}. A bond valence study indicates that Mo exhibits a mixed oxidation state between 5+ and 6+ (perhaps accounting for the excellent catalytic properties). One kind of Pr atoms is trivalent whereas the second presents a mixed Pr{sup 3+}-Pr{sup 4+} oxidation state. The similarity of the XRD pattern with that published for Ce{sub 2}MoO{sub 6} suggests that this compound also belongs to the same structural type, with an actual stoichiometry Ce{sub 5}Mo{sub 3}O{sub 16}. -- Graphical Abstract: Formerly formulated as Pr{sub 2}MoO{sub 6}, the title compound is a cubic superstructure of fluorite (a=11.0897(1) A, space group Pn-3n) due to the long-range ordering of PrO{sub 8} scalenohedra and MoO{sub 4} tetrahedral units, showing noticeable shifts of the oxygen positions in order to provide a tetrahedral coordination for Mo ions. A mixed valence Mo{sup 5+}-Mo{sup 6+} is identified, which could account for the excellent catalytic properties of this material. Display Omitted

Martinez-Lope, M.J. [Instituto de Ciencia de Materiales de Madrid, C.S.I.C., Cantoblanco, E-28049 Madrid, Spain. (Spain); Alonso, J.A., E-mail: ja.alonso@icmm.csic.e [Instituto de Ciencia de Materiales de Madrid, C.S.I.C., Cantoblanco, E-28049 Madrid, Spain. (Spain); Sheptyakov, D.; Pomjakushin, V. [Laboratory for Neutron Scattering, Paul Scherrer Institut, CH-5232 Villigen PSI (Switzerland)



Toluene 4-Monooxygenase and its Complex with Effector Protein T4moD  

Science Conference Proceedings (OSTI)

Toluene 4-monooxygenase (T4MO) is a multiprotein diiron enzyme complex that catalyzes the regiospecific oxidation of toluene to p-cresol. Catalytic function requires the presence of a small protein, called the effector protein. Effector protein exerts substantial control on the diiron hydroxylase catalytic cycle through protein-protein interactions. High-resolution crystal structures of the stoichometric hydroxylase and effector protein complex described here reveal how protein-protein interactions and reduction of the diiron center produce an active site configuration poised for reaction with O{sub 2}. Further information from crystal structures of mutated isoforms of the hydroxylase and a peroxo adduct is combined with catalytic results to give a fuller picture of the geometry of the enzyme-substrate complex used for the high fidelity oxidation of hydrocarbon substrates.

Bailey, Lucas J.; Fox, Brian G. (UW)



Structure and composition of clean and hydrogen covered MoRe surfaces  

DOE Green Energy (OSTI)

The clean and hydrogen covered (100) and (110) faces of Mo{sub 0.75}Re{sub 0.23} alloy single crystals show 1x1 structures. By means of LEED structure analyses we have determined the interlayer distances as well as the layer concentrations down to the sixth layer. While the clean (110) surface turns out to be nearly bulklike terminated, the clean (100) face is found to exhibit both an extended oscillatory layer relaxation and composition profile. Hydrogen adsorption at low temperatures does not alter the composition profile and removes the small remaining relaxation for the (110) surface. In case of the (100) face a substancial reduction of the relaxation is observed for the outermost layer distances as well, while deeper layer relaxations are preserved indicating a strong coupling off relaxation and composition profiles. Hydrogen is found to adsorb in quasi-threefold coordinated sites for the (110) and bridge sites for the (100) face.

Hammer, L.; Meyer, S.; Rath, C. [and others



Small-scale Specimen Testing of Monolithic U-Mo Fuel Foils  

SciTech Connect

The objective of this investigation is to develop a shear punch testing (SPT) procedure and standardize it to evaluate the mechanical properties of irradiated fuels in a hot-cell so that the tensile behavior can be predicted using small volumes of material and at greatly reduced irradiation costs. This is highly important in the development of low-enriched uranium fuels for nuclear research and test reactors. The load-displacement data obtained using SPT can be interpreted in terms of and correlated with uniaxial mechanical properties. In order to establish a correlation between SPT and tensile data, sub-size tensile and microhardness testing were performed on U-Mo alloys. In addition, efforts are ongoing to understand the effect of test parameters (such as specimen thickness, surface finish, punch-die clearance, crosshead velocity and carbon content) on the measured mechanical properties, in order to rationalize the technique, prior to employing it on a material of unknown strength.

Ramprashad Prabhakaran; Douglas E. Burkes; James I. Cole; Indrajit Charit; Daniel M. Wachs



Synthesis and optical properties of MoS{sub 2} nanoclusters  

DOE Green Energy (OSTI)

Highly crystalline nanoclusters of MoS{sub 2} were synthesized and their optical absorption and photoluminescence spectra were investigated. Key results include: (1) strong quantum confinement effects with decreasing size; (2) preservation of the quasiparticle (or excitonic) nature of the optical response for clusters down to {approximately} 2.5 nm in size which are only two unit cells thick; (3) demonstration that 3-D confinement produces energy shifts which are over an order of magnitude larger than those due to 1-D confinement; (4) observation of large increases in the spin-orbit splittings at the top of the valence band at the K and M points of the Brillouin zone with decreasing cluster size; and (5) observation of photoluminescence due to both direct and surface recombination. Application is to photocatalysts for solar fuel production and detoxification of chemical waste.

Wilcoxon, J.P.; Newcomer, P.P.; Samara, G.A.



Nuclear Sturcture Along the Neutron Dripline: MoNa-LISA and the dinueutron system  

Science Conference Proceedings (OSTI)

Nuclei with extreme neutron-to-proton ratios were found to present different structures from what was known for the stable ones. With the current facilities we can now study nuclei that lie even beyond the neutron drip line. At the National Superconducting Cyclotron Laboratory at Michigan State University we use the MoNA/Sweeper setup to perform such studies of neutron unbound nuclei. In a typical experiment, a radioactive beam is employed to produce the nucleus of interest. This unbound nucleus immediately decays into a neutron and a remaining charged fragment, both of which are detected and used to reconstruct the original nucleus and study its properties. In this Colloquium, new exciting findings from recent experiments will be presented. These include the first observation of a dineutron decay from 16Be, the exploration of the south shore of the Island of Inversion and the first evidence of the decay of the troubling nucleus 26O.

Spyou, Artemis [Michigan State Univeristy



Thermodynamic modeling and experimental validation of the Fe-Al-Ni-Cr-Mo alloy system  

SciTech Connect

NiAl-type precipitate-strengthened ferritic steels have been known as potential materials for the steam turbine applications. In this study, thermodynamic descriptions of the B2-NiAl type nano-scaled precipitates and body-centered-cubic (BCC) Fe matrix phase for four alloys based on the Fe-Al-Ni-Cr-Mo system were developed as a function of the alloy composition at the aging temperature. The calculated phase structure, composition, and volume fraction were validated by the experimental investigations using synchrotron X-ray diffraction and atom probe tomography. With the ability to accurately predict the key microstructural features related to the mechanical properties in a given alloy system, the established thermodynamic model in the current study may significantly accelerate the alloy design process of the NiAl-strengthened ferritic steels.

Teng, Zhenke [ORNL; Zhang, F [CompuTherm LLC, Madison, WI; Miller, Michael K [ORNL; Liu, Chain T [Hong Kong Polytechnic University; Huang, Shenyan [ORNL; Chou, Y.T. [Multi-Phase Services Inc., Knoxville; Tien, R [Multi-Phase Services Inc., Knoxville; Chang, Y A [ORNL; Liaw, Peter K [University of Tennessee, Knoxville (UTK)



Development and processing of LEU targets for {sup 99}Mo production  

SciTech Connect

Substituting LEU for HEU in targets for producing fission-product {sup 99}Mo requires changes in target design and chemical processing. We have made significant progress in developing targets and chemical processes for this purpose. Target development was concentrated on a U- metal foil target as a replacement for the coated-UO{sub 2} Cintichem- type target. Although the first designs were not successful because of ion mixing-induced bonding of the U foil to the target tubes, recent irradiations of modified targets have proven successful. It was shown that only minor modifications of the Cintichem chemical process are required for the U-metal foil targets. A demonstration using prototypically irradiated targets is anticipated by the end of 1996. Progress was also made in basic dissolution of both U-metal foil and Al-clad U{sub 3}Si{sub 2} dispersion fuel targets, and work in this area is also continuing.

Snelgrove, J.L.; Vandergrift, G.F.; Hofman, G.L.


Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microstructural characterization of as-cast biocompatible Co-Cr-Mo alloys  

SciTech Connect

The microstructure of a cobalt-base alloy (Co-Cr-Mo) obtained by the investment casting process was studied. This alloy complies with the ASTM F75 standard and is widely used in the manufacturing of orthopedic implants because of its high strength, good corrosion resistance and excellent biocompatibility properties. This work focuses on the resulting microstructures arising from samples poured under industrial environment conditions, of three different Co-Cr-Mo alloys. For this purpose, we used: 1) an alloy built up from commercial purity constituents, 2) a remelted alloy and 3) a certified alloy for comparison. The characterization of the samples was achieved by using optical microscopy (OM) with a colorant etchant to identify the present phases and scanning electron microscopy (SE-SEM) and energy dispersion spectrometry (EDS) techniques for a better identification. In general the as-cast microstructure is a Co-fcc dendritic matrix with the presence of a secondary phase, such as the M{sub 23}C{sub 6} carbides precipitated at grain boundaries and interdendritic zones. These precipitates are the main strengthening mechanism in this type of alloys. Other minority phases were also reported and their presence could be linked to the cooling rate and the manufacturing process variables and environment. - Research Highlights: {yields}The solidification microstructure of an ASTM-F75 type alloy were studied. {yields}The alloys were poured under an industrial environment. {yields}Carbides and sigma phase identified by color metallography and scanning microscopy (SEM and EDS). {yields}Two carbide morphologies were detected 'blocky type' and 'pearlite type'. {yields}Minority phases were also detected.

Giacchi, J.V., E-mail: jgiacchi@exa.unicen.edu.ar [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Av. Rivadavia 1917, C1033AAJ Buenos Aires (Argentina); Instituto de Fisica de Materiales Tandil (IFIMAT-FCE-CICPBA) Facultad de Ciencias Exactas, Universidad Nacional del Centro de la Provincia de Buenos Aires, Pinto 399 B7000GHG Tandil (Argentina); Morando, C.N.; Fornaro, O. [Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Av. Rivadavia 1917, C1033AAJ Buenos Aires (Argentina); Instituto de Fisica de Materiales Tandil (IFIMAT-FCE-CICPBA) Facultad de Ciencias Exactas, Universidad Nacional del Centro de la Provincia de Buenos Aires, Pinto 399 B7000GHG Tandil (Argentina); Palacio, H.A. [Comision de Investigaciones Cientificas de la Provincia de Buenos Aires (CICPBA), Calle 526 e/10 y 11 B1096APP La Plata (Argentina); Instituto de Fisica de Materiales Tandil (IFIMAT-FCE-CICPBA) Facultad de Ciencias Exactas, Universidad Nacional del Centro de la Provincia de Buenos Aires, Pinto 399 B7000GHG Tandil (Argentina)




Science Conference Proceedings (OSTI)

This article presents assessment of the mechanical behavior of U-10wt% Mo (U10Mo) alloy based monolithic fuel plates subject to irradiation. Monolithic, plate-type fuel is a new fuel form being developed for research and test reactors to achieve higher uranium densities within the reactor core to allow the use of low-enriched uranium fuel in high-performance reactors. Identification of the stress/strain characteristics is important for understanding the in-reactor performance of these plate-type fuels. For this work, three distinct cases were considered: (1) fabrication induced residual stresses (2) thermal cycling of fabricated plates; and finally (3) transient mechanical behavior under actual operating conditions. Because the temperatures approach the melting temperature of the cladding during the fabrication and thermal cycling, high temperature material properties were incorporated to improve the accuracy. Once residual stress fields due to fabrication process were identified, solution was used as initial state for the subsequent simulations. For thermal cycling simulation, elasto-plastic material model with thermal creep was constructed and residual stresses caused by the fabrication process were included. For in-service simulation, coupled fluid-thermal-structural interaction was considered. First, temperature field on the plates was calculated and this field was used to compute the thermal stresses. For time dependent mechanical behavior, thermal creep of cladding, volumetric swelling and fission induced creep of the fuel foil were considered. The analysis showed that the stresses evolve very rapidly in the reactor. While swelling of the foil increases the stress of the foil, irradiation induced creep causes stress relaxation.

Hakan Ozaltun & Herman Shen



Development of an energy-use estimation methodology for the revised Navy Manual MO-303  

SciTech Connect

The U.S. Navy commissioned Pacific Northwest Laboratory (PNL) to revise and/or update the Navy Utilities Targets Manual, NAVFAC MO-303 (U.S. Navy 1972b). The purpose of the project was to produce a current, applicable, and easy-to-use version of the manual for use by energy and facility engineers and staff at all Navy Public Works Centers (PWCs), Public Works Departments (PWDs), Engineering Field Divisions (EFDs), and other related organizations. The revision of the MO-303 manual involved developing a methodology for estimating energy consumption in buildings and ships. This methodology can account for, and equitably allocate, energy consumption within Navy installations. The analyses used to develop this methodology included developing end-use intensities (EUIs) from a vast collection of Navy base metering and billing data. A statistical analysis of the metering data, weather data, and building energy-use characteristics was used to develop appropriate EUI values for use at all Navy bases. A complete Navy base energy reconciliation process was also created for use in allocating all known energy consumption. Initial attempts to use total Navy base consumption values did not produce usable results. A parallel effort using individual building consumption data provided an estimating method that incorporated weather effects. This method produced a set of building EUI values and weather adjustments for use in estimating building energy use. A method of reconciling total site energy consumption was developed based on a {open_quotes}zero-sum{close_quotes} principle. This method provides a way to account for all energy use and apportion part or all of it to buildings and other energy uses when actual consumption is not known. The entire text of the manual was also revised to present a more easily read understood and usable document.

Richman, E.E.; Keller, J.M.; Wood, A.G.; Dittmer, A.L.



Characterization of the Microstructure of Irradiated U-Mo Dispersion Fuel with a Matrix that Contains Si  

SciTech Connect

RERTR U-Mo dispersion fuel plates are being developed for application in research reactors throughout the world. Of particular interest is the irradiation performance of U-Mo dispersion fuels with Si added to the Al matrix. Si is added to improve the performance of U-Mo dispersion fuels. Microstructural examinations have been performed on fuel plates with Al-2Si matrix after irradiation to around 50% LEU burnup. Si-rich layers were observed in many areas around the various U-7Mo fuel particles. In one local area of one of the samples, where the Si-rich layer had developed into a layer devoid of Si, relatively large fission gas bubbles were observed in the interaction phase. There may be a connection between the growth of these bubbles and the amount of Si present in the interaction layer. Overall, it was found that having Si-rich layers around the fuel particles after fuel plate fabrication positively impacted the overall performance of the fuel plate.

D. D. Keiser, Jr.; A. B. Robinson; J. F. Jue; P. Medvedev; M. R. Finlay



Characterization and Hydrodesulfurization Activity of CoMo Catalysts Supported on Boron-Doped Sol-Gel Alumina  

E-Print Network (OSTI)

desulfurization character of the CoMo catalysts supported on the B- Al2O3 supports, because high hydrogenation, the catalysts were kept in a closed vessel during two hours for aging, and then dried overnight in an oven.29 in the HDS of Kuwait gas oil [14], heavy Kuwait residue oil [15], and Kuwait crude oil [25]. They correlated

Paris-Sud XI, Université de


Determining the Specificity of Terms based on Information Theoretic Pum-Mo Ryu and Key-Sun Choi  

E-Print Network (OSTI)

Determining the Specificity of Terms based on Information Theoretic Measures Pum-Mo Ryu and Key@world.kaist.ac.kr, kschoi@world.kaist.ac.kr Abstract This paper introduces new specificity determining methods for terms based on information theoretic measures. The specificity of terms represents the quantity of domain


Gd/sub 2/ (MoO/sub 4/)/sub 3/ longitudinal electrooptic modulator at 6328 A  

SciTech Connect

A Gd/sub 2/(MoO/sub 4/)/sub 3/ light modulator operating at low frequencies, from 100 Hz up to 1 MHz, is examined. Experimental results concerning the thermal behavior and stability, frequency response, and linearity performance characteristics of the system are presented. Advantages and disadvantages of the modulator are discussed.

Theophanous, N.G.



Role of Si on the Diffusional Interactions between U-Mo and Al-Si Alloys at 823 K (550 degrees C)  

Science Conference Proceedings (OSTI)

U-Mo dispersions in Al-alloy matrix and monolithic fuels encased in Al-alloy are under development to fulfill the requirements for research and test reactors to use low-enriched molybdenum stabilized uranium alloys fuels. Significant interaction takes place between the U-Mo fuel and Al during manufacturing and in-reactor irradiation. The interactions products are Al-rich phases with physical and thermal characteristics that adversely affect fuel performance and lead to premature failure. Detailed analysis of the interdiffusion and microstructural development of this system was carried through diffusion couples consisting of U-7wt.%Mo, U-10wt.%Mo and U-12wt.%Mo in contact with pure Al, Al-2wt.%Si, and Al-5wt.%Si, annealed at 823K for 1, 5 and 20 hours. Scanning electron microscopy (SEM) and transmission electron microscopy (TEM) were employed for the analysis. Diffusion couples consisting of U-Mo vs. pure Al contained UAl3, UAl4, U6Mo4Al43, and UMo2Al20 phases. The addition of Si to the Al significantly reduced the thickness of the interdiffusion zone. The interdiffusion zones developed Al and Si enriched regions, whose locations and size depended on the Si and Mo concentrations in the terminal alloys. In the couples, the (U,Mo)(Al,Si)3 phase was observed throughout interdiffusion zone, and the U6Mo4Al43 and UMo2Al20 phases were observed only where the Si concentrations were low.

E. Perez; Y.H. Sohn; D.D. Keiser, Jr.



A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.



M5Si3(M=Ti, Nb, Mo) Based Transition-Metal Silicides for High Temperature Applications  

Science Conference Proceedings (OSTI)

Transition metal silicides are being considered for future engine turbine components at temperatures up to 1600 C. Although significant improvement in high temperature strength, room temperature fracture toughness has been realized in the past decade, further improvement in oxidation resistance is needed. Oxidation mechanism of Ti{sub 5}Si{sub 3}-based alloys was investigated. Oxidation behavior of Ti{sub 5}Si{sub 3}-based alloy strongly depends on the atmosphere. Presence of Nitrogen alters the oxidation behavior of Ti{sub 5}Si{sub 3} by nucleation and growth of nitride subscale. Ti{sub 5}Si{sub 3.2} and Ti{sub 5}Si{sub 3}C{sub 0.5} alloys exhibited an excellent oxidation resistance in nitrogen bearing atmosphere due to limited dissolution of nitrogen and increased Si/Ti activity ratio. MoSi{sub 2} coating developed by pack cementation to protect Mo-based Mo-Si-B composites was found to be effective up to 1500 C. Shifting coating composition to T1+T2+Mo{sub 3}Si region showed the possibility to extend the coating lifetime above 1500 C by more than ten times via formation of slow growing Mo{sub 3}Si or T2 interlayer without sacrificing the oxidation resistance of the coating. The phase equilibria in the Nb-rich portion of Nb-B system has been evaluated experimentally using metallographic analysis and differential thermal analyzer (DTA). It was shown that Nb{sub ss} (solid solution) and NbB are the only two primary phases in the 0-40 at.% B composition range, and the eutectic reaction L {leftrightarrow} Nb{sub SS} + NbB was determined to occur at 2104 {+-} 5 C by DTA.

Zhihong Tang



Method for generating a crystalline {sup 99}MoO{sub 3} product and the isolation {sup 99m}Tc compositions therefrom  

DOE Patents (OSTI)

An improved method is described for producing {sup 99m}Tc compositions. {sup 100}Mo metal is irradiated with photons in a particle (electron) accelerator to produce {sup 99}Mo metal which is dissolved in a solvent. A solvated {sup 99}Mo product is then dried to generate a supply of {sup 99}MoO{sub 3} crystals. The crystals are thereafter heated at a temperature which will sublimate the crystals and form a gaseous mixture containing vaporized {sup 99m}TcO{sub 3} and vaporized {sup 99m}TcO{sub 2} but will not cause the production of vaporized {sup 99}MoO{sub 3}. The mixture is then combined with an oxidizing gas to generate a gaseous stream containing vaporized {sup 99m}Tc{sub 2}O{sub 7}. Next, the gaseous stream is cooled to a temperature sufficient to convert the vaporized {sup 99m}Tc{sub 2}O{sub 7} into a condensed {sup 99m}Tc-containing product. The product has high purity levels resulting from the use of reduced temperature conditions and ultrafine crystalline {sup 99}MoO{sub 3} starting materials with segregated {sup 99m}Tc compositions therein which avoid the production of vaporized {sup 99}MoO{sub 3} contaminants. 1 fig.

Bennett, R.G.; Christian, J.D.; Kirkham, R.J.; Tranter, T.J.



Adsorption of Potassium on the MoS2(100) Surface: A First-Principles Investigation  

DOE Green Energy (OSTI)

Periodic density functional theory calculations were performed to investigate the interaction that potassium with the Mo and S edges of the MoS2(100) surface. Both neutral and cationic (+1) charged potassium-promoted systems at different sulfur coverages were considered. Our calculations indicate that the potassium atom readily donates its single 4s valence electron to the MoS2 structure for the neutral potassium-promoted system, and the neutral and cationic potassium-promoted systems demonstrate a similar adsorption behavior. Moreover, potassium changes the magnetic properties known to occur at the metallic edge surface, which have implications for electron spin dependent surface characterization methods (i.e., electron spin/paramagnetic spectroscopy). Potassium in both the neutral and cationic systems tends to maximize its interactions with the available sulfur atoms at the edge surface, preferring sites over four-fold S hollows on fully sulfided Mo and S edges and over the interstitial gap where two to four edge surface S atoms are available for coordination. As the potassium coverage increases, the adsorption energy per potassium atom, surface work function, and transfer of the K 4s electron to the MoS2(100) surface decreases, which is in line with an increased metallization of the potassium adlayer. The potassium adlayer tends to form chains along the interstitial with K-K distances ~1 , which is notably less than those of bulk bcc K metal (4.61 ). Density of states for the potassium-saturated surface suggests enhanced involvement of broad K 3d states beginning just above the Fermi level. Potassium-promotion of MoS2(100) has implications for alcohol catalysis: increasing the surface basicity by increasing the electron charge of the surface, providing hydrogenation-promoting CO site, blocking edge surface that dissociate CO and lead to methanation, and limiting H2 dissociative adsorption to the edge surface and possibly inhibiting the H2 dissociative adsorption via s character electron repulsion. This research was performed in part using the Molecular Science Computing Facility in the William R. Wiley Environmental Molecular Sciences Laboratory, a U.S. Department of Energy (DOE) national scientific user facility located at the Pacific Northwest National Laboratory (PNNL). PNNL is operated by Battelle for DOE.

Andersen, Amity; Kathmann, Shawn M.; Lilga, Michael A.; Albrecht, Karl O.; Hallen, Richard T.; Mei, Donghai



Microstructural evolution during solution treatment of Co-Cr-Mo-C biocompatible alloys  

SciTech Connect

Three different Co-Cr-Mo-C alloys conforming to ASTM F75 standard were poured in an industrial environment and subjected to a conventional solution treatment at 1225 Degree-Sign C for several time intervals. The microstructural changes and transformations were studied in each case in order to evaluate the way in which treatment time influences the secondary phase fraction and clarify the microstructural changes that could occur. To assess how treatment time affects microstructure, optical microscopy and image analyzer software, scanning electron microscopy and energy dispersion spectrometry analysis were employed. The main phases detected in the as-cast state were: {sigma}-phase, M{sub 6}C, and M{sub 23}C{sub 6} carbides. The latter presented two different morphologies, blocky type and lamellar type. Despite being considered the most detrimental feature to mechanical properties, {sigma}-phase and lamellar carbides dissolution took place in the early stages of solution treatment. M{sub 23}C{sub 6} carbides featured two different behaviors. In the alloy obtained by melting an appropriate quantity of alloyed commercial materials, a decrease in size, spheroidization and transformation into M{sub 6}C carbides were simultaneously observed. In the commercial ASTM F75 alloy, in turn, despite being the same phase, only a marked decrease in precipitates size was noticed. These different behaviors could be ascribed to the initial presence of other phases in the alloy obtained from alloyed materials, such as {sigma}-phase and 'pearlitic' carbides, or to the initial precipitate size which was much larger in the first than in the commercial ASTM F75 alloy studied. M{sub 6}C carbides dissolved directly in the matrix as they could not be detected in samples solution-treated for 15 min. - Highlights: Black-Right-Pointing-Pointer Three different Co-Cr-Mo alloys were poured under an industrial environment. Black-Right-Pointing-Pointer Transformation of existing phases followed during conventional solution treatment. Black-Right-Pointing-Pointer In as-cast/treated samples, phases were identified by color metallography, SEM and EDS. Black-Right-Pointing-Pointer M{sub 23}C{sub 6} {yields} M{sub 6}C transformation was corroborated by SEM and EDS analysis. Black-Right-Pointing-Pointer Carbide spheroidization was also detected prior a noticeably carbide size decreasing.

Giacchi, J.V., E-mail: jgiacchi@exa.unicen.edu.ar [IFIMAT, Instituto de Fisica de Materiales Tandil, Facultad de Ciencias Exactas, Universidad Nacional del Centro de la Provincia de Buenos Aires, Pinto 399, B7000GHG Tandil (Argentina); Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Av. Rivadavia 1917, C1033AA, Buenos Aires (Argentina); Fornaro, O. [IFIMAT, Instituto de Fisica de Materiales Tandil, Facultad de Ciencias Exactas, Universidad Nacional del Centro de la Provincia de Buenos Aires, Pinto 399, B7000GHG Tandil (Argentina); Consejo Nacional de Investigaciones Cientificas y Tecnicas (CONICET), Av. Rivadavia 1917, C1033AA, Buenos Aires (Argentina); Palacio, H. [IFIMAT, Instituto de Fisica de Materiales Tandil, Facultad de Ciencias Exactas, Universidad Nacional del Centro de la Provincia de Buenos Aires, Pinto 399, B7000GHG Tandil (Argentina); Comision de Investigaciones Cientificas de la Provincia de Buenos Aires (CICPBA), Calle 526 e/10 y 11, B1096APP, La Plata (Argentina)



Overview of a Welding Development Program for a Ni-Cr-Mo-Gd Alloy  

Science Conference Proceedings (OSTI)

The National Spent Nuclear Fuel Program (NSNFP), located at the Idaho National Laboratory, coordinates and integrates management and disposal of U.S. Department of Energy-owned spent nuclear fuel. These management functions include using the DOE standardized canister for packaging, storage, treatment, transport, and long-term disposal in the Yucca Mountain Repository. Nuclear criticality must be prevented in the postulated event where a waste package is breached and water (neutron moderator) is introduced into the waste package. Criticality control will be implemented by using a new, weldable, corrosion-resistant, neutron-absorbing material to fabricate the welded structural inserts (fuel baskets) that will be placed in the standardized canister. The new alloy is based on the Ni-Cr-Mo alloy system with a gadolinium addition. Gadolinium was chosen as the neutron absorption alloying element because of its high thermal neutron absorption cross section. This paper describes a weld development program to qualify this new material for American Society of Mechanical Engineers (ASME) welding procedures, develop data to extend the present ASME Code Case (unwelded) for welded construction, and understand the weldability and microstructural factors inherent to this alloy.

W. L. Hurt; R. E. Mizia; D. E. Clark



Coupled spin and valley physics in monolayer MoS2 and group-VI dichalcogenides  

SciTech Connect

We show that inversion symmetry breaking together with spin-orbit coupling leads to coupled spin and valley physics in monolayer MoS2 and group-VI dichalcogenides, making possible controls of spin and valley in these 2D materials. The spin-valley coupling at the valence band edges suppresses spin and valley relaxation, as flip of each index alone is forbidden by the 0.1 eV valley contrasting spin splitting. Valley Hall and spin Hall effects coexist in both electron-doped and hole-doped systems. Optical interband transitions have frequency-dependent polarization selection rules which allow selective photoexcitation of carriers with various combination of valley and spin indices. Photo-induced spin Hall and valley Hall effects can generate long lived spin and valley accumulations on sample boundaries. The physics discussed here provides a route towards the integration of valleytronics and spintronics in multi-valley materials with strong spin-orbit coupling and inversion symmetry breaking.

Xiao, Di [ORNL; Liu, G. B. [University of Hong Kong, The; Feng, wanxiang [Chinese Academy of Sciences; Xu, Xiaodong [University of Washington; Yao, Wang [University of Hong Kong, The



Window nighttime U-values: A comparison between computer calculations and MoWiTT measurements  

SciTech Connect

The proper specification of window U-values has been a controversial area for many years, and current attempts to incorporate more careful treatment of windows into building standards and utility conservation programs and to define window energy labels has heightened the controversy. In a previous paper (Klems 1979) it was argued that current calculation techniques, as embodied in the computer program WINDOW, accurately represented field-measured window U-values, provided frame corrections and surface heat transfer coefficients were correctly estimated, and that in most cases the calculations were also consistent with test laboratory measurements on the same windows. This means that the calculation could serve both as a standard for deriving calculated U-values and as a method of comparing measurements made under different conditions to determine their consistency. This work has now been extended to form a joint US/Canadian collaborative effort to test current computer programs. For six windows the U-values measured with the MoWiTT under field conditions are compared with detailed U-value calculations for the same conditions using the programs WINDOW and ANSYS. There is good agreement between measurements and calculations. 7 refs., 3 figs., 4 tabs.

Klems, J.H.; Reilly, S.



Progress in converting {sup 99}Mo production from high- to low-enriched uranium--1999.  

SciTech Connect

Over this past year, extraordinary progress has been made in executing our charter to assist in converting Mo-99 production worldwide from HEU to LEU. Building on the successful development of the experimental LEU-foil target, we have designed a new, economical irradiation target. We have also successfully demonstrated, in collaboration with BATAN in Indonesia, that LEU can be substituted for HEU in the Cintichem target without loss of product yield or purity; in fact, conversion may make economic sense. We are interacting with a number of commercial producers--we have begun active collaborations with the CNEA and ANSTO; we are working to define the scope of collaborations with MDS Nordion and Mallinckrodt; and IRE has offered its services to irradiate and test a target at the appropriate time. Conversion of the CNEA process is on schedule. Other papers presented at this meeting will present specific results on the demonstration of the LEU-modified Cintichem process, the development of the new target, and progress in converting the CNEA process.

Snelgrove, J. L.; Vandegrift, G. F.; Conner, C.; Wiencek, T. C.; Hofman, G. L.



Glass forming ability of the Mo-Pd system studied by thermodynamic modeling and ion beam mixing  

SciTech Connect

Glass forming ability/range of the Mo-Pd binary metal system was studied by thermodynamic calculations employing Miedema's model and ion beam mixing of multiple metal layers. The thermodynamic calculations predict a narrow composition range of 8-26 at% Pd, within which metallic glass formation is energetically favored, whereas the experimental results showed that ion beam mixing was able to synthesize metallic glasses within a composition range 13-30 at% Pd, which was well in accordance with the prediction. Besides, in the Mo{sub 70}Pd{sub 30} multilayered films, with varying the irradiation dose, a dual-phase metallic glass was formed, and it could be considered as an intermediate state. The possible mechanism for the formation of the metallic glasses was also discussed in terms of the atomic collision theory.

Ding, N.; Li, J. H.; Liu, B. X.



Feasibility study Part I - Thermal hydraulic analysis of LEU target for {sup 99}Mo production in Tajoura reactor  

SciTech Connect

The Renewable Energies and Water Desalination Research Center (REWDRC), Libya, will implement the technology for {sup 99}Mo isotope production using LEU foil target, to obtain new revenue streams for the Tajoura nuclear research reactor and desiring to serve the Libyan hospitals by providing the medical radioisotopes. Design information is presented for LEU target with irradiation device and irradiation Beryllium (Be) unit in the Tajoura reactor core. Calculated results for the reactor core with LEU target at different level of power are presented for steady state and several reactivity induced accident situations. This paper will present the steady state thermal hydraulic design and transient analysis of Tajoura reactor was loaded with LEU foil target for {sup 99}Mo production. The results of these calculations show that the reactor with LEU target during the several cases of transient are in safe and no problems will occur. (author)

Bsebsu, F.M.; Abotweirat, F. [Reactor Department, Renewable Energies and Water Desalination Research Cente, P.O. Box 30878 Tajoura, Tripoli (Libyan Arab Jamahiriya)], E-mail: Bsebso@yahoo.com, E-mail: abutweirat@yahoo.com; Elwaer, S. [Radiochemistry Department, Renewable Energies and Water Desalination Research Cente, P.O. Box 30878 Tajoura, Tripoli (Libyan Arab Jamahiriya)], E-mail: samiwer@yahoo.com



Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan


Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1: Mass asymmetric fission barriers for {sup 98}Mo; 2: Synthesis and characterization of actinide-specific chelating agents  

SciTech Connect

Excitation functions have been measured for complex fragment emission from the compound nucleus {sup 98}Mo, produced by the reaction of {sup 86}Kr with {sup 12}C. Mass asymmetric fission barriers have been obtained by fitting the excitation functions with a transition state formalism. The extracted barriers are {approximately} 5.7 MeV higher, on average, than the calculations of the Rotating Finite Range Model (RFRM). These data clearly show an isospin dependence of the conditional barriers when compared with the extracted barriers from {sup 90}Mo and {sup 94}Mo. Eleven different liquid/liquid extractants were synthesized based upon the chelating moieties 3,2-HOPO and 3,4-HOPO; additionally, two liquid/liquid extractants based upon the 1,2-HOPO chelating moiety were obtained for extraction studies. The Pu(IV) extractions, quite surprisingly, yielded results that were very different from the Fe(III) extractions. The first trend remained the same: the 1,2-HOPOs were the best extractants, followed closely by the 3,2-HOPOs, followed by the 3,4-HOPOs; but in these Pu(IV) extractions the 3,4-HOPOs performed much better than in the Fe(III) extractions. 129 refs.

Veeck, A.C. [Univ. of California, Berkeley, CA (United States). Dept. of Chemistry]|[Lawrence Livermore National Lab., CA (United States). Glenn T. Seaborg Inst. for Transactinium Science]|[Lawrence Berkeley National Lab., CA (United States). Nuclear Science Div.



11/11/2002 1AVS 49th Int'l Symp. MS-MoA7 (Oct. 29, 2002) -Cho Dynamic Simulation and Optimization  

E-Print Network (OSTI)

'l Symp. MS-MoA7 (Oct. 29, 2002) - Cho Scope & Strategy Multilevel modeling & simulation incorporating dynamics &Multilevel modeling & simulation incorporating dynamics & stochasticsstochastics ESH fluctuations Incorporate capability in models for dynamics & stochastics Process & tool Fundamental science Si

Rubloff, Gary W.


Presented at the ASHRAE 2003 Annual Meeting, June 28 July 2, 2003, in Kansas City, MO, and published in ASHRAE Transactions 109, part 2: 733-739  

E-Print Network (OSTI)

LBNL-50219 Presented at the ASHRAE 2003 Annual Meeting, June 28 ­ July 2, 2003, in Kansas City, MO, and published in ASHRAE Transactions 109, part 2: 733-739 The research reported here was funded, in part


Field Evaluation of the Comanagement of Utility Low-Volume Wastes with High-Volume Coal Combustion By-Products: MO Site  

Science Conference Proceedings (OSTI)

This report documents an investigation into the effects of comanagement of low-volume wastes with high-volume coal combustion by-products at the MO site. The MO site is one of 14 investigated by EPRI to provide background information to the United States Environmental Protection Agency (EPA) for the 2000 Regulatory Determination on comanagement under the Resource Conservation and Recovery Act (RCRA).



A high temperature neutron diffraction study of the double perovskite Ba{sub 2}{sup 154}SmMoO{sub 6}  

SciTech Connect

Ba{sub 2}LnMoO{sub 6} double perovskites have been recently shown to display a wide range of interesting magnetic and structural properties; Ba{sub 2}{sup 154}SmMoO{sub 6} exhibits simultaneous antiferromagnetic order and a Jahn-Teller distortion. Here we report a high temperature neutron diffraction study of Ba{sub 2}{sup 154}SmMoO{sub 6} from 353 to 877 K. The results evidence a tetragonal to cubic phase transition at 423 K. Above this temperature the thermal displacement parameters of the oxygen atoms are modelled anisotropically as a result of a transverse vibration of the bridging oxygen. A smooth increase in the cell parameter a is observed with temperature for Ba{sub 2}{sup 154}SmMoO{sub 6}. - Graphical abstract: The high temperature crystal structure of Ba{sub 2}{sup 154}SmMoO{sub 6} evidencing a transverse oxygen vibration. Highlights: Black-Right-Pointing-Pointer A high temperature neutron diffraction study has been performed on an isotopically enriched sample of Ba{sub 2}{sup 154}SmMoO{sub 6}. Black-Right-Pointing-Pointer A cubic-tetragonal phase transition occurs below 423 K. Black-Right-Pointing-Pointer The thermal displacement parameters of the bridging oxygens are modelled anisotropically. Black-Right-Pointing-Pointer There is a transverse vibration of the bridging oxygen.

Wallace, Thomas K. [Department of Chemistry, University of Aberdeen, Meston Walk, Aberdeen AB24 3UE (United Kingdom)] [Department of Chemistry, University of Aberdeen, Meston Walk, Aberdeen AB24 3UE (United Kingdom); Ritter, Clemens [Institut Laue Langevin, 6 rue Jules Horowitz, BP 156, F-38042 Grenoble Cedex 9 (France)] [Institut Laue Langevin, 6 rue Jules Horowitz, BP 156, F-38042 Grenoble Cedex 9 (France); Mclaughlin, Abbie C., E-mail: a.c.mclaughlin@abdn.ac.uk [Department of Chemistry, University of Aberdeen, Meston Walk, Aberdeen AB24 3UE (United Kingdom)



Preparation of anisotropic Nd(Fe,Mo){sub 12}N{sub 1.0} magnetic materials by strip casting technique and direct nitrogenation for the strips  

SciTech Connect

The Nd(Fe,Mo){sub 12}-type alloys are prepared by strip casting technique, and direct nitrogenation of the strips without precrushing is executed in this paper. It is found that 6 h annealing treatment at 1050 deg. C for the strips is enough to obtain the single-phase Nd(Fe,Mo){sub 12} compounds. The strips can be directly nitrogenated at 620 deg. C to obtain interstitial Nd(Fe,Mo){sub 12}N{sub 1.0} materials, and a spontaneous pulverization phenomenon in the strips induced by nitrogenation is found. The results indicate that the nitrogenation process of the strips can be used to prepare Nd(Fe,Mo){sub 12}N{sub 1.0} interstitial nitrides and pulverize the casted strips into fine particles simultaneously. Base on this, we propose a new technical route of preparing Nd(Fe,Mo){sub 12}N{sub X} magnetic powders without precrushing and obtain anisotropic NdFe{sub 10.5}Mo{sub 1.5}N{sub 1.0} powders with a remanence of B{sub r} = 1.08 T, a coercivity of {sub i}H{sub c} = 400 kA/m, and a maximum energy product of (BH){sub max} = 144 kJ/m{sup 3}.

Han Jingzhi; Liu Shunquan; Xing Meiying; Lin Zhong; Kong Xiangpeng; Wang Changsheng; Du Honglin; Yang Yingchang [School of Physics, Peking University, Beijing 100871 (China); Yang Jinbo [School of Physics, Peking University, Beijing 100871 (China); State Key Laboratory for Artificial Microstructure and Mesoscopic Physics, School of Physics, Peking University, Beijing 100871 (China)



A low-temperature extraction-solvothermal route to the fabrication of micro-sized MoS{sub 2} spheres modified by Cyanex 301  

Science Conference Proceedings (OSTI)

Mono-dispersed molybdenum disulfide micro-spheres with the diameter of 1-3 {mu}m have been successfully synthesized via extraction-solvothermal method at 150 deg. C. The extractant Cyanex 301 (di-(2,4,4-trimethylpentyl) dithiophosphinic acid) acted as phase transferring agent, reductant, sulfur source and morphology-controlling agent in the whole procedure. The obtained MoS{sub 2} micro-spheres were characterized by XRD, EDS, SEM, TEM, HRTEM, IR, UV-Vis and TG, respectively. The influences of reaction conditions were discussed while a mechanism was proposed to explain the formation of the micro-spheres. Moreover, the tribological properties of liquid paraffin (LP) containing Cyanex 301-modified MoS{sub 2} micro-spheres were also evaluated on a four-ball machine, showing that the obtained MoS{sub 2} product was an excellent oil additive in LP and such lubricant had good anti-wear and friction-reducing properties. - Graphical abstract: Mono-dispersed MoS{sub 2} micro-spheres with the diameter of 1-3 {mu}m were synthesized in gasoline via extraction-solvothermal method at 150 deg. C. The MoS{sub 2} product could be well dispersed into organic solvents again and the tribological properties of liquid paraffin (LP) containing MoS{sub 2} micro-spheres were improved.

Shi Huaqiang [Qingdao University of Science and Technology, Qingdao, Shandong 266042 (China); Fu Xun [Qingdao University of Science and Technology, Qingdao, Shandong 266042 (China)]. E-mail: fuxun4483@163.com; Zhou Xiaodong [Qingdao University of Science and Technology, Qingdao, Shandong 266042 (China); Wang Debao [Qingdao University of Science and Technology, Qingdao, Shandong 266042 (China); Hu Zhengshui [Qingdao University of Science and Technology, Qingdao, Shandong 266042 (China)



Hydrothermal synthesis and luminescent properties of NaLa(MoO{sub 4}){sub 2}:Dy{sup 3+} phosphor  

SciTech Connect

Pompon-like NaLa(MoO{sub 4}){sub 2}:Dy{sup 3+} phosphors have been successfully prepared via a hydrothermal method using ammonia as pH value regulator. The hydrothermal process was carried out under aqueous condition without the use of any organic solvent, surfactant, and catalyst. The experimental results demonstrate that the obtained NaLa(MoO{sub 4}){sub 2}:Dy{sup 3+} phosphor powders are single-phase scheelite structure with tetragonal symmetry. Moreover, the phosphor under the excitation of 390 and 456 nm exhibited blue emission (486 nm) and yellow emission (574 nm), corresponding to the {sup 4}F{sub 9/2}{yields}{sup 6}H{sub 15/2} transition and {sup 4}F{sub 9/2}{yields}{sup 6}H{sub 13/2} transition of Dy{sup 3+} ions, respectively. In addition, the yellow-to-blue emission intensity ratio (Y/B) can be changed with the doped concentration of Dy{sup 3+} ions. All chromaticity coordinates of the obtained NaLa(MoO{sub 4}){sub 2}:Dy{sup 3+} phosphors are located in the white-light region. The results indicate that this kind of phosphor may has potential applications in the fields of near UV-excited and blue-excited white LEDs. - Graphical abstract: It can be seen from the SEM images that a pompon-like shape was obtained with an average diameter of about 1 {mu}m, and it is composed of many nanoflakes. Highlights: Black-Right-Pointing-Pointer Pompon-like NaLa(MoO{sub 4}){sub 2}:Dy{sup 3+} phosphors have been successfully prepared via a hydrothermal method. Black-Right-Pointing-Pointer Blue emission at 486 nm and yellow emission at 574 nm were obtained from the samples. Black-Right-Pointing-Pointer The yellow-to-blue emission intensity ratio (Y/B) can be changed with the doped concentration of Dy{sup 3+} ions. Black-Right-Pointing-Pointer NaLa(MoO{sub 4}){sub 2}:Dy{sup 3+} can be efficiently excited by the blue light and the near ultraviolet light.

Li Linlin; Zi Wenwen; Li Guanghuan; Lan Shi; Ji Guijuan [College of Chemistry, Jilin University, Changchun 130026 (China); Gan Shucai, E-mail: gansc@jlu.edu.cn [College of Chemistry, Jilin University, Changchun 130026 (China); Zou Haifeng [College of Chemistry, Jilin University, Changchun 130026 (China); Xu Xuechun [College of Earth Sciences, Jilin University, Changchun 130026 (China)



Orion Mark Graf University of Kansas, Lawrence, KS 2010-Present  

E-Print Network (OSTI)

Distributions, Origins, and their Association with Y-chromosome Markers in the Aleutian Archipelago Advisor) "Surname Distributions and their Association with Y-chromosome Markers in the Aleutian Islands" Human in the Aleutian Archipelago: Evidence from Y- chromosome markers and historical accounts" Poster presentation

Peterson, Blake R.


Conformal growth of Mo/Si multilayers on grating substrates using collimated ion beam sputtering  

SciTech Connect

Deposition of multilayers on saw-tooth substrates is a key step in the fabrication of multilayer blazed gratings (MBG) for extreme ultraviolet and soft x-rays. Growth of the multilayers can be perturbed by shadowing effects caused by the highly corrugated surface of the substrates, which results in distortion of the multilayer stack structure and degradation of performance of MBGs. To minimize the shadowing effects we used an ionbeam sputtering machine with a highly collimated atomic flux to deposit Mo/Si multilayers on saw-tooth substrates. The sputtering conditions were optimized by finding a balance between smoothening and roughening processes in order to minimize degradation of the groove profile in the course of deposition and at the same time to keep the interfaces of a multilayer stack smooth enough for high efficiency. An optimal value of energy of 200 eV for sputtering Kr{sup +} ions was found by deposition of test multilayers on flat substrates at a range of ion energies. Two saw-tooth substrates were deposited at energies of 200 eV and 700 eV for the sputtering ions. It was found that reduction of the ion energy improved the blazing performance of the MBG and resulted in a 40% gain in the diffraction efficiency due to better replication of the groove profile by the multilayer. As a result of the optimization performed, an absolute diffraction efficiency of 28.8% was achieved for the 2nd blaze order of the MBG with a groove density of 7350 lines/mm at a wavelength of 13.5 nm. Details of the growth behavior of the multilayers on flat and saw-tooth substrates are discussed in terms of the Linear Continuous Model of film growth.

Gawlitza, Peter; Cambie, Rossana; Dhuey, Scott; Gullikson, Eric; Warwick, Tony; Braun, Stefan; Yashchuk, Valeriy; Padmore, Howard



Laser welding and post weld treatment of modified 9Cr-1MoVNb steel.  

SciTech Connect

Laser welding and post weld laser treatment of modified 9Cr-1MoVNb steels (Grade P91) were performed in this preliminary study to investigate the feasibility of using laser welding process as a potential alternative to arc welding methods for solving the Type IV cracking problem in P91 steel welds. The mechanical and metallurgical testing of the pulsed Nd:YAG laser-welded samples shows the following conclusions: (1) both bead-on-plate and circumferential butt welds made by a pulsed Nd:YAG laser show good welds that are free of microcracks and porosity. The narrow heat affected zone has a homogeneous grain structure without conventional soft hardness zone where the Type IV cracking occurs in conventional arc welds. (2) The laser weld tests also show that the same laser welder has the potential to be used as a multi-function tool for weld surface remelting, glazing or post weld tempering to reduce the weld surface defects and to increase the cracking resistance and toughness of the welds. (3) The Vicker hardness of laser welds in the weld and heat affected zone was 420-500 HV with peak hardness in the HAZ compared to 240 HV of base metal. Post weld laser treatment was able to slightly reduce the peak hardness and smooth the hardness profile, but failed to bring the hardness down to below 300 HV due to insufficient time at temperature and too fast cooling rate after the time. Though optimal hardness of weld made by laser is to be determined for best weld strength, methods to achieve the post weld laser treatment temperature, time at the temperature and slow cooling rate need to be developed. (4) Mechanical testing of the laser weld and post weld laser treated samples need to be performed to evaluate the effects of laser post treatments such as surface remelting, glazing, re-hardening, or tempering on the strength of the welds.

Xu, Z. (Nuclear Engineering Division)



Conformal growth of Mo/Si multilayers on grating substrates using collimated ion beam sputtering  

SciTech Connect

Deposition of multilayers on saw-tooth substrates is a key step in the fabrication of multilayer blazed gratings (MBG) for extreme ultraviolet and soft x-rays. Growth of the multilayers can be perturbed by shadowing effects caused by the highly corrugated surface of the substrates, which results in distortion of the multilayer stack structure and degradation of performance of MBGs. To minimize the shadowing effects, we used an ion-beam sputtering machine with a highly collimated atomic flux to deposit Mo/Si multilayers on saw-tooth substrates. The sputtering conditions were optimized by finding a balance between smoothening and roughening processes in order to minimize degradation of the groove profile in the course of deposition and at the same time to keep the interfaces of a multilayer stack smooth enough for high efficiency. An optimal value of energy of 200 eV for sputtering Kr{sup +} ions was found by deposition of test multilayers on flat substrates at a range of ion energies. Two saw-tooth substrates were deposited at energies of 200 eV and 700 eV for the sputtering ions. It was found that reduction of the ion energy improved the blazing performance of the MBG and resulted in a 40% gain in the diffraction efficiency due to better replication of the groove profile by the multilayer. As a result of the optimization performed, an absolute diffraction efficiency of 28.8% was achieved for the 2nd blaze order of the MBG with a groove density of 7350 lines/mm at a wavelength of 13.5 nm. Details of the growth behavior of the multilayers on flat and saw-tooth substrates are discussed in terms of the linear continuous model of film growth.

Voronov, D. L.; Cambie, R.; Dhuey, S.; Gullikson, E. M.; Warwick, T.; Yashchuk, V. V.; Padmore, H. A. [Lawrence Berkeley National Laboratory, 1 Cyclotron Road, Berkeley, California 94720 (United States); Gawlitza, P.; Braun, S. [Fraunhofer Institute for Material and Beam Technology, Winterbergstrasse 28, 01277 Dresden (Germany)




E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor


Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects


Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" 9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" "Structural and Geographic Characteristics",,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" ,,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Urban and Rural2" "Urban",88.1,19.9,14.6,4.1,2.9,1.8,5.8,5.3,1.6,2.4,1.4


Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" 9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Household Demographics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Household Members" "1 Person",31.3,7.4,5.1,1.4,1,0.6,2.1,2.3,0.6,1.1,0.6


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" 9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Computers and Other Electronics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Computers" "Number of Computers" 0,27.4,6.7,4.7,1.1,1.1,0.6,2,2,0.6,1,0.5

Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" 9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Fuels Used and End Uses",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Fuels Used for Any Use" "Electricity",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Televisions",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Televisions" "Number of Televisions" 0,1.5,0.3,0.2,"Q","Q","Q","Q",0.1,"Q","Q","Q"


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,,,,,"IA, MN, ND, SD" "Water Heating",,,,"IL","MI","WI","IN, OH",,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Storage Tank Water Heaters" 0,2.9,0.4,0.3,"Q","Q","Q","Q",0.1,"Q","Q","Q"


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" 9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Air Conditioning",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Air Conditioning Equipment" "Use Air Conditioning Equipment",94,22.4,15,4.3,3.1,1.8,5.9,7.4,2.3,3.4,1.7


" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" " ",,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Space Heating",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Space Heating Equipment" "Use Space Heating Equipment",110.1,25.8,17.8,4.7,3.8,2.3,7,8.1,2.3,3.9,1.8


Related Links | Building Energy Codes Program  

NLE Websites -- All DOE Office Websites (Extended Search)

Related Links Related Links Regional Energy Efficiency Organizations MEEA NEEP NEEA SEEA SWEEP SPEER Midwest Energy Efficiency Alliance (MEEA) IL, IN, IA, KS, KY, ND, NE, MI, MN, MO, OH, SD, WI The Midwest Energy Efficiency Alliance (MEEA) is a collaborative network advancing energy efficiency in the Midwest to support sustainable economic development and environmental preservation. MEEA raises awareness, facilitates energy efficiency programs and strengthens policy across the nine-state region. MEEA brings together a respected network of members, partners, board and staff, and inspires others to create new technologies, new products and new ways of thinking when it comes to energy efficiency. Codes Contact Isaac Elnecave Senior Policy Manager ielnecave@mwalliance.org phone: (312)784-7253


U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT


Progress and status of the IAEA coordinated research project: production of Mo-99 using LEU fission or neutron activation  

Science Conference Proceedings (OSTI)

Since late 2004, the IAEA has developed and implemented a Coordinated Research Project (CRP) to assist countries interested in initiating indigenous, small-scale production of Mo-99 to meet local nuclear medicine requirements. The objective of the CRP is to provide interested countries with access to non-proprietary technologies and methods to produce Mo-99 using LEU foil or LEU mini-plate targets, or for the utilization of n,gamma neutron activation, e.g. through the use of gel generators. The project has made further progress since the RERTR 2006 meeting, with a Technical Workshop on Operational Aspects of Mo99 Production held 28-30 November 2006 in Vienna and the Second Research Coordination Meeting held in Bucharest, Romania 16-20 April 2007. The paper describes activities carried out as noted above, and as well as the provision of LEU foils to a number of participants, and the progress by a number of groups in preparing for LEU target assembly and disassembly, irradiation, chemical processing, and waste management. The participants' progress in particular on thermal hydraulics computations required for using LEU targets is notable, as also the progress in gel generator plant operations in India and Kazakhstan. Poland has joined as a new research agreement holder and an application by Egypt to be a contract holder is undergoing internal review in the IAEA and is expected to be approved. The IAEA has also participated in several open meetings of the U.S. National Academy of Sciences Study on Producing Medical Radioisotopes without HEU, which will also be discussed in the paper. (author)

Goldman, Ira N.; Adelfang, Pablo [Division of Nuclear Fuel Cycle and Waste Technology, International Atomic Energy Agency, Wagramer Strasse 5, P.O. Box 100, A-1400 Vienna (Austria)], E-mail: I.Goldman@iaea.org, E-mail: P.Adelfang@iaea.org; Ramamoorthy, Natesan [Division of Physical and Chemical Sciences, International Atomic Energy Agency, Wagramer Strasse 5, P.O. Box 100, A-1400 Vienna (Austria)], E-mail: N.Ramamoorthy@iaea.org



Effects of Irradiation on the Microstructure of U-7Mo Dispersion Fuel with Al-2Si Matrix  

SciTech Connect

The Reduced Enrichment for Research and Test Reactor program is developing low-enriched uranium U-Mo dispersion fuels for application in research and test reactors around the world. As part of this development, fuel plates have been irradiated in the Advanced Test Reactor and then characterized using optical metallography (OM) and scanning electron microscopy (SEM) to determine the as-irradiated microstructure. To demonstrate the irradiation performance of U-7Mo dispersion fuel plates with 2 wt% Si added to the matrix, fuel plates were tested to medium burnups at intermediate fission rates as part of the RERTR-6 experiment. Further testing was performed to higher fission rates as part of the RERTR-7A experiment, and very aggressive testing (high temperature, high fission density, high fission rate) was performed in the RERTR-9A, RERTR-9B and AFIP-1 experiments. As-irradiated microstructures were compared to those observed after fabrication to determine the effects of irradiation on the microstructure. Based on comparison of the microstructural characterization results for each irradiated sample, some general conclusions can be drawn about how the microstructure evolves during irradiation: there is growth of the fuel/matrix interaction layer (FMI), which was present in the samples to some degree after fabrication, during irradiation; Si diffuses from the FMI layer to deeper depths in the U-7Mo particles as the irradiation conditions are made more aggressive; lowering of the Si content in the FMI layer results in an increase in the size of the fission gas bubbles; as the FMI layer grows during irradiation more Si diffuses from the matrix to the FMI layer/matrix interface, and interlinking of fission gas bubbles in the fuel plate microstructure that may indicate breakaway swelling is not observed.

Dennis D. Keiser, Jr.; Jan-Fong Jue; Adam B. Robinson; Pavel Medvedev; Jian Gan; Brandon D. Miller; Daniel M. Wachs; Glenn A. Moore; Curtis R. Clark; Mitchell K. Meyer; M. Ross Finlay



Development and processing of LEU targets for {sup 99}Mo production-overview of the ANL program  

SciTech Connect

Most of the world`s supply of {sup 99m}Tc for medical purposes is currently produced from the decay of {sup 99}Mo derived from the fissioning of high-enriched uranium (HEU). Substitution of low-enriched uranium (LEU) silicide fuel for the HEU alloy and aluminide fuels used in most current target designs will allow equivalent {sup 99}Mo yields with little change in target geometries. Substitution of uranium metal for uranium oxide films in other target designs will also allow the substitution of LEU for HEU. During 1995, we have continued to study the modification of current targets and processes to allow the conversion from HEU to LEU. A uranium-metal-foil target was fabricated at ANL and irradiated to prototypic burnup in the Indonesian RSG-GAS reactor. Postirradiation examination indicated that minor design modifications will be required to allow the irradiated foil to be removed for chemical processing. Means to dissolve and process LEU foil have been developed, and a mock LEU foil target was processed in Indonesia. We have also developed means to dissolve the LEU foil in alkaline peroxide, where it can be used to replace HEU targets that are currently dissolved in base before recovering and purifying the {sup 99}Mo. We have also continued work on the dissolution of U{sub 3}Si{sub 2} and have a firm foundation on dissolving these targets in alkaline peroxide. The technology-exchange agreement with Indonesia is well underway, and we hope to expand our international cooperations in 1996.

Snelgrove, J.L.; Hofman, G.L.; Wiencek, T.C. [and others



Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use


Mo-containing tetrahedral amorphous carbon deposited by dualfiltered cathodic vacuum arc with selective pulsed bias voltage  

SciTech Connect

Metal-containing tetrahedral amorphous carbon films were produced by dual filtered cathodic vacuum arc (FCVA) plasma sources operated in sequential pulsed mode. A negatively pulsed bias was applied to the substrate only when carbon plasma was generated. Films thickness was measured after deposition by profilometry. Glass slides with silver pads were used as substrate for the of the measurement sheet resistance. The microstructure and composition of the films were characterized by Raman spectroscopy and Rutherford backscattering, respectively. It found that the electrical resistivity decreases with an increase of the Mo content, which can be ascribed to an increase of sp2 content and an increase of the sp2 cluster size.

Pasaja, Nitisak; Sansongsiri, Sakon; Anders, Andre; Vilaithong,Thiraphat; Intasiri, Sawate



Activation, Heating and Exposure Rates for Mo?99 Experiments with 25?Disk Targets  

Science Conference Proceedings (OSTI)

An MCNPX model of the 25-disk target assembly inside the vacuum cube inside the shielded box was prepared. This was used to calculate heating and photon and neutron fluxes throughout the model. Production rates for photonuclear reaction products were calculated using the photon fluxes and ENDF/B-VII cross sections. Measured isomer to ground state yield ratios were used where available. Where not available the new correlation between spin deficit and isomer to ground state yield ratios presented at AccApp'11 was used. The photonuclear production rates and neutron fluxes were input to CINDER2008 for transmutation calculations. A cross section update file was used to supply (n,n') reactions missing from CINDER2008 libraries. Decay photon spectra produced by CINDER2008 were then used to calculate exposure rates using the MCNPX model. Two electron beam irradiations were evaluated. The first was for a thermal test at 15 MeV with 1300 {micro}A incident on one target end and the second was for a production test at 35 MeV with 350 {micro}A incident on both target ends (700 {micro}A total current on target). For the thermal test 1, 2, 3, 4, 5 and 6 h irradiation times were simulated, each followed by decay time steps out to 42 days. For the production test 6, 12, 18, 24, 30 and 36 h irradiation times were simulated followed by the same decay periods. For all simulations beam FWHMs in x and y were both assumed to be 6 mm. Simulations were run for Mo-100 enriched and natural Mo targets for both tests. It is planned that thermal test will be run for 4 h with natural target disks and production test will be run for 24 h with enriched target disks. Results for these two simulations only are presented in this report. Other results can be made available upon request. Post irradiation exposure rates were calculated at 30 cm distances from left, right, front and back of the following configurations: (1) Shielded box with everything in it (beam pipes, cooling pipes, vacuum cube, target housing weldment and target assembly), (2) Shielded box with everything in it except the target assembly, (3) Shielded box with nothing in it, (4) Target assembly taken outside of shielded box, (5) Target disks in cradle (target assembly with thermocouple weldment and flange removed), (6) Empty cradle, and (7) Target disks alone. Decay photon spectra from the CINDER2008 calculations were used as sources for the exposure rate calculations in the same model used for the flux calculations with beam on. As components were removed to simulate the seven cases considered the material compositions were changed to air and their respective sources were turned off. The MCNPX model geometry is plotted in Figure 1. The left and right detector locations for cases 1, 2 and 3 were 30 cm from the shielded box walls and 30 cm from the beam pipe openings in the left and right sides of the model (they are not in the beam line). A zoomed in plot of the target assembly alone is in Figure 2. Exposure rates for the seven cases are plotted as a function of time after irradiation in Figures 3, 4 and 5. To aid in comparison between the cases, all of these figures have been plotted using the same scale. Figures 3 and 4 are respectively the thermal and production test results for cases 1 through 6. Figure 5 includes case 7 results for both. Differences between cases 1 and 2 for both tests are not statistically significant showing that activation of components other than the target assembly, many of which are also shielding the target assembly, dominates exposure rates outside the shielded box. Case 3 shows the contribution from activation of the shield box itself. In front where shielded box wall is thickest box activation accounts for essentially all of the exposure rate outside. Differences between cases 4 and 5 are also minimal, showing that the contribution to target assembly exposure rates from the thermocouple flange and weldment are small compared to the target disks and cradle. From the numerical results the contribution is about 1%. Results for case 6, the cradle itself, are ini

Kelsey, Charles T. IV [Los Alamos National Laboratory



Development of the local and average structure of a V?Mo?Nb oxide catalyst with Mo[subscript 5]O[subscript 14]-like structure during synthesis from nanostructured precursors  

SciTech Connect

A combination of X-ray and neutron PDF measurements with powder diffraction and EXAFS data was used to determine the structures of a V-Mo-Nb-oxide catalyst and its poorly crystallized precursors that exhibit the strongest catalytic activities. The crystalline material belongs to space group P{bar 4}2{sub 1}m, a = 22.8, c = 4.002, and is build up of pentagonal MeO{sub 7} bipyramids surrounded by edge sharing Me-octahedrons (Me = Mo, V, Nb). In the average structure all MeO{sub 7} units are at the same z-level, while the local structure analysis shows systematic shifts along [001]. Samples synthesized at 300 C and 400 C exhibit a nanostructure, whose local structure predates the final crystalline structure. Initial nanoparticles are spherical and grow predominantly along the c-axis. The successful analysis required a reverse analysis that took the crystalline material as starting model for the samples synthesized at lower temperatures.

Kardash, Tatyana Yu.; Plyasova, Ludmilla M.; Kochubey, Dmitry I.; Bondareva, Valentina M.; Neder, Reinhard B. (Boreskov); (Nurnbergand)



Comparison of Crevice Corrosion of Fe-Based Amorphous Metal and Crystalline Ni-Cr-Mo Alloy  

SciTech Connect

The crevice corrosion behaviors of an Fe-based bulk metallic glass alloy (SAM1651) and a Ni-Cr-Mo crystalline alloy (C-22) were studied in 4M NaCl at 100 C with cyclic potentiodynamic polarization and constant potential tests. The corrosion damage morphologies, corrosion products and the compositions of corroded surfaces of these two alloys were studied with optical 3D reconstruction, Scanning Electron Microscopy (SEM), Energy Dispersive Spectroscopy (EDS) and Auger Electron Spectroscopy (AES). It was found that the Fe-based bulk metallic glass (amorphous alloy) SAM1651 had a more positive breakdown potential and repassivation potential than crystalline alloy C-22 in cyclic potentiodynamic polarization tests and required a more positive oxidizing potential to initiate crevice corrosion in constant potential test. Once crevice corrosion initiated, the corrosion propagation of C-22 was more localized near the crevice border compared to SAM1651, and SAM1651 repassivated more readily than C-22. The EDS results indicated that the corrosion products of both alloys contained high amount of O and were enriched in Mo and Cr. The AES results indicated that a Cr-rich oxide passive film was formed on the surfaces of both alloys, and both alloys were corroded congruently.

Shan, X; Ha, H; Payer, J H



Preliminary investigations for technology assessment of /sup 99/Mo production from LEU (low enriched uranium) targets. [For production of /sup 99m/Tc; by different methods  

SciTech Connect

This paper presents the results of preliminary studies on the effects of substituting low enriched uranium (LEU) for highly enriched uranium (HEU) in targets for the production of fission product /sup 99/Mo. Issues that were addressed are: (1) purity and yield of the /sup 99/Mo//sup 99m/Tc product, (2) fabrication of LEU targets and related concerns, and (3) radioactive waste. Laboratory experimentation was part of the efforts for issues (1) and (2); thus far, radioactive waste disposal has only been addressed in a paper study. Although the reported results are still preliminary, there is reason to be optimistic about the feasibility of utilizing LEU targets for /sup 99/Mo production. 37 refs., 1 fig., 5 tabs.

Vandegrift, G.F.; Chaiko, D.J.; Heinrich, R.R.; Kucera, E.T.; Jensen, K.J.; Poa, D.S.; Varma, R.; Vissers, D.R.



Examination of Na-Doped Mo Sputtering for CIGS Devices: Cooperative Research and Development Final Report, CRADA Number CRD-10-375  

DOE Green Energy (OSTI)

This work has investigated the use of Na doped Mo (MONA) sputtering targets for use in preparing CIGS devices. The Mo:Na material is doped to about 3% Na by weight, implying that a 40 nm layer on top of the standard Mo contact contains sufficient Na to dope a 2.5 ..mu..m CIGS film. The ability to control Na doping independent of both CIGS processing conditions and adhesion is an important gain for industry and research. Manufacturers gain a route to increased manufacturability and performance, while NREL researchers gain a tightened performance distribution of devices and increased process flexibility. Our immediate partner in this work, the Climax Molybdenum Technology Center, gains validation of their product.

Repins, I.



In-situ small-angle X-ray scattering study of the precipitation behavior in a Fe-25 at.%Co-9 at.%Mo alloy  

Science Conference Proceedings (OSTI)

Fe-Co-Mo alloys show extraordinary mechanical properties which make them potential candidates for various high-performance applications. In the present study, for the first time, the precipitation behavior in a Fe-25 at.%Co-9 at.%Mo alloy was studied by small-angle X-ray scattering using high-energy synchrotron radiation. The specimens were isothermally aged in an in-situ furnace. The small-angle X-ray scattering patterns showed scaling behavior and were evaluated by employing a model function from the literature. This approach provides information about the characteristic length scale and the volume fraction of the precipitates in the alloy.

Zickler, Gerald A. [Department of Physical Metallurgy and Materials Testing, Montanuniversitaet Leoben, Franz-Josef-Strasse 18, A-8700 Leoben (Austria); Christian Doppler Laboratory for Early Stages of Precipitation, Montanuniversitaet Leoben, Franz-Josef-Strasse 18, A-8700 Leoben (Austria)], E-mail: gerald.zickler@mu-leoben.at; Eidenberger, Elisabeth [Department of Physical Metallurgy and Materials Testing, Montanuniversitaet Leoben, Franz-Josef-Strasse 18, A-8700 Leoben (Austria); Leitner, Harald [Department of Physical Metallurgy and Materials Testing, Montanuniversitaet Leoben, Franz-Josef-Strasse 18, A-8700 Leoben (Austria); Christian Doppler Laboratory for Early Stages of Precipitation, Montanuniversitaet Leoben, Franz-Josef-Strasse 18, A-8700 Leoben (Austria); Stergar, Erich; Clemens, Helmut [Department of Physical Metallurgy and Materials Testing, Montanuniversitaet Leoben, Franz-Josef-Strasse 18, A-8700 Leoben (Austria); Staron, Peter; Lippmann, Thomas; Schreyer, Andreas [GKSS Research Center Geesthacht, Max-Planck-Strasse 1, D-21502 Geesthacht (Germany)



Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.

Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Progress in developing processes for converting {sup 99}Mo production from high- to low-enriched uranium--1998.  

SciTech Connect

During 1998, the emphasis of our activities was focused mainly on target fabrication. Successful conversion requires a reliable irradiation target; the target being developed uses thin foils of uranium metal, which can be removed from the target hardware for dissolution and processing. This paper describes successes in (1) improving our method for heat-treating the uranium foil to produce a random-small grain structure, (2) improving electrodeposition of zinc and nickel fission-fragment barriers onto the foil, and (3) showing that these fission fragment barriers should be stable during transport of the targets following irradiation. A method was also developed for quantitatively electrodepositing uranium and plutonium contaminants in the {sup 99}Mo. Progress was also made in broadening international cooperation in our development activities.

Conner, C.



Irradiation behavior of the interaction product of U-Mo fuel particle dispersion in an Al matrix.  

Science Conference Proceedings (OSTI)

Irradiation performance of U-Mo fuel particles dispersed in Al matrix is stable in terms of fuel swelling and is suitable for the conversion of research and test reactors from highly enriched uranium (HEU) to low enriched uranium (LEU). However, tests of the fuel at high temperatures and high burnups revealed obstacles caused by the interaction layers forming between the fuel particle and matrix. In some cases, fission gas filled pores grow and interconnect in the interdiffusion layer resulting in fuel plate failure. Postirradiation observations are made to examine the behavior of the interdiffusion layers. The interdiffusion layers show a fluid-like behavior characteristic of amorphous materials. In the amorphous interdiffusion layers, fission gas diffusivity is high and the material viscosity is low so that the fission gas pores readily form and grow. Based on the observations, a pore formation mechanism is proposed and potential remedies to suppress the pore growth are also introduced.

Kim, Y.S.; Hofman, G. (Nuclear Engineering Division)



Effects of hydrogen on the dynamics of the Mo{sub 0.95}Re{sub 0.05}(ll0) surface  

DOE Green Energy (OSTI)

The effect of adsorbed H on the Mo{sub 0.95}Re{sub 0.05}(110) surface has been investigated. Results obtained from low-energy electron diffraction, high-resolution electron energy loss spectroscopy (HREELS) and angle-resolved ultra-violet photoemission spectroscopy are presented. A (2{times}2) LEED pattern is observed for H coverages around {Theta} {approximately} 0.6 ML and is attributed to reconstruction of the substrate. At higher coverages, a (1{times}1) pattern is observed. Two peaks are observed at loss energies of 99 and 153 meV in the HREELS spectra for the H-saturated Mo{sub 0. 95}Re{sub 0.05}(110) surface. Both peaks show an isotopic shift, confirming that they are due to hydrogen vibrational modes and a quasi-trigonal adsorption site is consistent with these observations. A two dimensional Fermi surface was determined for the H-saturated Mo{sub 0.95}Re{sub 0.05}(110) surface. The Fermi-surface nesting vector was observed at the place where theoretical calculations predict it to occur on H-saturated Mo(110) and it may be related to the phonon anomaly observed for this surface.

Okada, M; Plummer, E.W. [Tennessee Univ., Knoxville, TN (United States)]|[Oak Ridge National Lab., TN (United States); Baddorf, A.P.; Zehner, D.M.



Matrix grain characterisation by electron backscattering diffraction of powder metallurgy aluminum matrix composites reinforced with MoSi{sub 2} intermetallic particles  

Science Conference Proceedings (OSTI)

Research highlights: Six extruded PM AA6061/MoSi{sub 2}/15p were processed with and without ball milling {yields} EBSD was used to characterise matrix grain size and grain orientation. {yields} Ball milling decreases matrix grain size to submicrometric level. {yields} Ball milling produces a more equiaxed microstructure and larger misorientation. {yields} Increasing milling time produces matrix texture randomization.

Corrochano, J., E-mail: javier.corrochano.flores@gmail.com; Hidalgo, P.; Lieblich, M.; Ibanez, J.



Solid particle erosion behavior of an Si{sub 3}N{sub 4}-MoSi{sub 2} composite at room and elevated temperatures  

SciTech Connect

The solid particle erosion behavior at room and elevated temperatures (180, 500, 700 and 900 C) of an Si{sub 3}N{sub 4}-MoSi{sub 2} composite was studied. Alumina particles entrained in a stream of nitrogen gas impacted the target material at a velocity of 40 m/s. Impingement angles of either 60, 75 or 90{degree} were used. It was found that the erosion rate for the Si{sub 3}N{sub 4}-MoSi{sub 2} composite (measured at room temperature) was a maximum at the 90{degree} incident angle, erosion behavior typical of brittle materials. The erosion rate of the composite at a 75{degree} impingement angle increased slightly with increasing test temperature up to 700 C (i.e. from 4.1 to 4.9 mm{sup 3}/g). At 900 C, the measured erosion rate decreased to 2.9 mm{sup 3}/g. The erosion behavior of the Si{sub 3}N{sub 4}-MoSi{sub 2} composite was compared to that of commercially available Si{sub 3}N{sub 4}, WC-6%Co, 304 SS, IN-800 (Ni-Fe-Cr alloy) and Stellite-6B (Co-Cr-W-Mo alloy).

Alman, D.E.; Tylczak, J.H.; Hawk, J.A.; Hebsur, M.G.



Solid particle erosion behavior of an Si[sub 3]N[sub 4]-MoSi[sub 2] composite at room and elevated temperatures  

SciTech Connect

The solid particle erosion behavior at room and elevated temperatures (180, 500, 700 and 900 C) of an Si[sub 3]N[sub 4]-MoSi[sub 2] composite was studied. Alumina particles entrained in a stream of nitrogen gas impacted the target material at a velocity of 40 m/s. Impingement angles of either 60, 75 or 90[degree] were used. It was found that the erosion rate for the Si[sub 3]N[sub 4]-MoSi[sub 2] composite (measured at room temperature) was a maximum at the 90[degree] incident angle, erosion behavior typical of brittle materials. The erosion rate of the composite at a 75[degree] impingement angle increased slightly with increasing test temperature up to 700 C (i.e. from 4.1 to 4.9 mm[sup 3]/g). At 900 C, the measured erosion rate decreased to 2.9 mm[sup 3]/g. The erosion behavior of the Si[sub 3]N[sub 4]-MoSi[sub 22048mposite was compared to that of commercially available Si[sub 3]N[sub 4], WC-6%Co, 304 SS, IN-800 (Ni-Fe-Cr alloy) and Stellite-6B (Co-Cr-W-Mo alloy).

Alman, D.E.; Tylczak, J.H.; Hawk, J.A.; Hebsur, M.G.



Morphology and photoluminescence of Ba0.5Sr0.5MoO4 powders by a molten salt method  

Science Conference Proceedings (OSTI)

Ba0.5Sr0.5MoO4 powders with scheelite-type tetragonal structure were successfully synthesized by a molten salt method. The structure, morphology, and luminescent property of the as-prepared powders were characterized ...

Ling Wei; Yunfei Liu; Yinong Lu; Tao Wu



Investigation of the hydroconversion of rancid lard and lard-gas oil mixture on NiMo/Al2O3 catalyst in oxide and in sulphide state  

Science Conference Proceedings (OSTI)

The necessity to maintain mobility and the increasing energy- and environmentally sound demands necessitated the research, development and utilization of engine fuels from renewable resources. Because of the negative features of the already and generally ... Keywords: NiMo/Al2O3, hydroconversion, hydrogenation, lard, triglyceride

P. Baladincz; J. Hancsk



Tuning the interfacial hole injection barrier between p-type organic materials and Co using a MoO{sub 3} buffer layer  

SciTech Connect

We demonstrate that the interfacial hole injection barrier {Delta}{sub h} between p-type organic materials (i.e., CuPc and pentacene) and Co substrate can be tuned by the insertion of a MoO{sub 3} buffer layer. Using ultraviolet photoemission spectroscopy, it was found that the introduction of MoO{sub 3} buffer layer effectively reduces the hole injection barrier from 0.8 eV to 0.4 eV for the CuPc/Co interface, and from 1.0 eV to 0.4 eV for the pentacene/Co interface, respectively. In addition, by varying the thickness of the buffer, the tuning effect of {Delta}{sub h} is shown to be independent of the thickness of MoO{sub 3} interlayer at both CuPc/Co and pentacene/Co interfaces. This Fermi level pinning effect can be explained by the integer charge-transfer model. Therefore, the MoO{sub 3} buffer layer has the potential to be applied in p-type organic spin valve devices to improve the device performance via reducing the interfacial hole injection barrier.

Wang Yuzhan; Wee, Andrew T. S. [Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117542 (Singapore); Cao Liang [Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117542 (Singapore); National Synchrotron Radiation Laboratory, School of Nuclear Science and Technology, University of Science and Technology of China, Hefei, Anhui 230029 (China); Qi Dongchen [Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117542 (Singapore); Institute of Materials Research and Engineering (IMRE), 3 Research Link, Singapore 117602 (Singapore); Chen Wei [Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117542 (Singapore); Department of Chemistry, National University of Singapore, 3 Science Drive 3, Singapore 117543 (Singapore); Gao Xingyu [Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117542 (Singapore); Shanghai Institute of Applied Physics, Chinese Academy of Sciences, P. O. Box 800-204, Shanghai 201800 (China)



Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:


Reduced Pressure Electron Beam Welding Evaluation Activities on a Ni-Cr-Mo Alloy for Nuclear Waste Packages  

SciTech Connect

The current waste package design for the proposed repository at Yucca Mountain Nevada, USA, employs gas tungsten arc welding (GTAW) in fabricating the waste packages. While GTAW is widely used in industry for many applications, it requires multiple weld passes. By comparison, single-pass welding methods inherently use lower heat input than multi-pass welding methods which results in lower levels of weld distortion and also narrower regions of residual stresses at the weld TWI Ltd. has developed a Reduced Pressure Electron Beam (RPEB) welding process which allows EB welding in a reduced pressure environment ({le} 1 mbar). As it is a single-pass welding technique, use of RPEB welding could (1) achieve a comparable or better materials performance and (2) lead to potential cost savings in the waste package manufacturing as compared to GTAW. Results will be presented on the initial evaluation of the RPEB welding on a Ni-Cr-Mo alloy (a candidate alloy for the Yucca Mountain waste packages) in the areas of (a) design and manufacturing simplifications, (b) material performance and (c) weld reliability.

Wong, F; Punshon, C; Dorsch, T; Fielding, P; Richard, D; Yang, N; Hill, M; DeWald, A; Rebak, R; Day, S; Wong, L; Torres, S; McGregor, M; Hackel, L; Chen, H-L; Rankin, J



Microstructural Characterization of Burnable Absorber Materials Being Evaluated for Application in LEU U-Mo Fuel Plates  

SciTech Connect

The starting microstructure of a fuel plate will impact how it performs during irradiation. As a result, microstructural characterization has been performed on as-fabricated monolithic fuel plates to determine the changes in fuel plate microstructure that may result from changes in fabrication parameters. Particular focus has been given to the fuel plate U-10Mo/Zr and Zr/AA6061 cladding interfaces, since the integrity of these interfaces will play a big role in determining the overall performance of the fuel plate during irradiation. In addition, burnable absorber materials for potential incorporation into monolithic fuel plates have been characterized to identify their as-fabricated microstructures. This information will be important when trying to understand the PIE data from fuel plates with burnable absorbers that are irradiated in future irradiation experiments. This paper will focus on the microstructures observed using optical metallography, X-ray diffraction, and scanning and transmission electron microscopy for monolithic fuel plates exposed to different fabrication parameters and for as-fabricated burnable absorber materials.

J. F. Jue; B. Miller; B. Yao; E. Perez; Y. H. Sohn



ANL progress in minimizing effects of LEU conversion on calcination of fission-product {sup 99}Mo acid waste solution.  

SciTech Connect

A partnership between Argonne National Laboratory (ANL), MDS Nordion (MDSN), Atomic Energy Canada Limited (AECL) and SGN (France) has addressed the conversion of the MAPLE Reactor 99Mo production process from high-enriched uranium (HEU) targets to low-enriched uranium (LEU) targets. One effect of the conversion would be to increase the amount of solid uranium waste five-fold; we have worked to minimize the effect of the additional waste on the overall production process and, in particular, solid waste storage. Two processes were investigated for the treatment of the uranium-rich acidic waste solution: direct calcination, and oxalate precipitation as a prelude to calcination. Direct calcination generates a dense UO3 solid that should allow a significantly greater amount of uranium in one waste container than is planned for the HEU process, but doing so results in undesirable sputtering. These results suggest that direct calcination could be adapted for use with LEU targets without a large effect on the uranium waste treatment procedures. The oxalate-calcination generates a lower-density granular U3O8 product; sputtering is not significant during calcination of the uranyl oxalate precipitate. A physical means to densify the product would need to be developed to increase the amount of uranium in each waste container. Future work will focus on the specific chemical reactions that occur during the direct and oxalate calcination processes.

Bakel, A.; Vandegrift, G.; Quigley, K.; Aase, S.; Neylon, M.; Carney, K.



Thermal Decomposition of Bulk K-CoMoSx Mixed Alcohol Catalyst Precursors and Effects on Catalyst Morphology and Performance  

Science Conference Proceedings (OSTI)

Cobalt molybdenum sulfide-type mixed alcohol catalysts were synthesized via calcination of precipitated bulk sulfides and studied with temperature programmed decomposition analysis. Precursors containing aqueous potassium were also considered. Precipitates thermally decomposed in unique events which released ammonia, carbon dioxide, and sulfur. Higher temperature treatments led to more crystalline and less active catalysts in general with ethanol productivity falling from 203 to 97 g (kg cat){sup -1} h{sup -1} when the calcination temperature was increased from 375 to 500 C. The addition of potassium to the precursor led to materials with crystalline potassium sulfides and good catalytic performance. In general, less potassium was required to promote alcohol selectivity when added before calcination. At calcination temperatures above 350 C, segregated cobalt sulfides were observed, suggesting that thermally decomposed sulfide precursors may contain a mixture of molybdenum and cobalt sulfides instead of a dispersed CoMoS type of material. When dimethyl disulfide was fed to the precursor during calcination, crystalline cobalt sulfides were not detected, suggesting an important role of free sulfur during decomposition.

Menart, M. J.; Hensley, J. E.; Costelow, K. E.



Accurate structure analysis of Mo[subscript 6]S[subscript y]I[subscript z] nanowires from atomic pair distribution function (PDF) analysis  

SciTech Connect

The structure of the recently discovered systematically reproducible Mo{sub 6}S{sub y}I{sub z} nanowires has been determined from the atomic pair distribution function (PDF) analysis of powder X-ray diffraction data. This total scattering approach was required because the nanowires are not perfectly crystalline and, therefore, the structure cannot be obtained crystallographically. Several nanotube and nanowire models were fit to the PDF data. The resulting best-fit model structure consists of nanowires of Mo{sub 6} octahedra that are bridged by sulfur and terminated on the outside by iodine. This demonstrates the power of total scattering methods in accurately resolving structural issues in nanostructured materials where traditional crystallographic methods fail.

Paglia, G.; Bozin, E.S.; Vengust, D.; Mihailovic, D.; Billinge, S.J.L. (Joseph Stefan Inst.); (MSU)



STEM HAADF Image Simulation of the Orthorhombic M1 Phase in the Mo-V-Nb-Te-O Propane Oxidation Catalyst  

Science Conference Proceedings (OSTI)

A full frozen phonon multislice simulation of high angle annular dark field scanning transmission electron microscopy (HAADF STEM) images from the M1 phase of the Mo-V-Nb-Te-O propane oxidation catalyst has been performed by using the latest structural model obtained using the Rietveld method. Simulated contrast results are compared with experimental HAADF images. Good agreement is observed at ring sites, however significant thickness dependence is noticed at the linking sites. The remaining discrepancies between the model based on Rietveld refinement and image simulations indicate that the sampling of a small volume element in HAADF STEM and averaging elemental contributions of a disordered site in a crystal slab by using the virtual crystal approximation might be problematic, especially if there is preferential Mo/V ordering near the (001) surface.

D Blom; X Li; S Mitra; T Vogt; D Buttrey



Li6La3SnMO12 (M = Sb, Nb, Ta), a Family of Lithium Garnets with High Li-Ion Conductivity  

Science Conference Proceedings (OSTI)

In order to investigate the influence of covalent bonding within the garnet framework on the conductivity of Li+ in the interstitial space, the Li+ conductivities in the family of Sn-based compounds Li6La3 SnMO12 (M = Sb, Nb, Ta) have been obtained and are compared with those of Li6La3ZrMO12. Refinement of the neutron diffraction pattern of Li6La3 SnNbO12shows that the interstitial tetrahedral sites (24d ) are about half-occupied and most of the Li in the interstitial bridging octahedral sites are displaced from the center position (48g ). The Sb-based compound has the largest lattice parameter while the Ta-based compound has the highest Li+-ion conductivity of 0.42 10 4 Scm 1.

Bridges, Craig A [ORNL; Goodenough, J. B. [University of Texas, Austin; Gupta, Dr Asha [University of Texas, Austin; Nakanishi, Masahiro [ORNL; Paranthaman, Mariappan Parans [ORNL; Sokolov, Alexei P [ORNL; Bi, Zhonghe [ORNL; Li, Yutao [University of Texas, Austin; Han, Jiantao [University of Texas, Austin; Dong, Youzhong [South China University of Technology, Guangzhou, PR China; Wang, Long [University of Texas, Austin; Xu, Maowen [University of Texas, Austin




SciTech Connect

A steam generator, wherein the boiler, steam drum, and superheater are integrated into one single unit, requires the welding of a transition joint between the 2 1/4% Cr-1% Mo steel of the steam drum and the type 316 stainless steel of the superheater. A practicable procedure was developed for the welding of this transition joint and the properties of the weld were evaluated by mechanical testing and metallurgical evaluation. After evaluating the technical aspects of the project and their relation to the fabrication of the generator, it was considered desirable to overlay the welding edge of the 2 1/4% Cr-1% Mo steel with a suitable austenitic weld metul which would subsequently be welded to the type 316 stainless steel of the superheater. Austenitic stainless steel and high-nickel alloy weld metals were evaluated for the overlay; whereas only austenitic stainless steel weld metals were evaluated for the final weld joining the components. It was concluded that type 309 stainless steel weld metal deposited automatically by the submergedarc process is completely satisfactory for cladding the 2 1/4% Cr-1% Mo base metal and for making the final transition weld joining the steam drum and superheater sections of the generator. Supplementary mechanical tests, metallographic examinations, and hardness surveys further attested to the adequacy of the quality of the transition joint resulting from the procedures developed by this program. A detailed fabrication and thermal treatment specification is included for the welding of a transition joint between



An X-ray diffraction study of pressure-induced phase transitions in Bi{sub 2}MoO{sub 6}  

SciTech Connect

Synchrotron based X-ray diffraction through a diamond anvil cell was used to determine the equations of state and pressure-induced phase transitions in Bi{sub 2}MoO{sub 6}. It was observed that Bi{sub 2}MoO{sub 6} undergoes a phase transformation at {approx}6.8 GPa. The high-pressure phase can be indexed to the orthorhombic structure and the transition is reversible on decompression from {approx}47 GPa. The bulk moduli of the low and high-pressure phases were calculated, while holding K Prime =4, to be: K=51{+-}1 GPa and K=141.5 {+-}0.1 GPa, respectively. - Graphical abstract: The material Bi{sub 2}MoO{sub 6} was placed inside a diamond anvil cell and then studied under high pressure at beamline X17C of the National Synchrotron Light source. X-ray diffraction data was analyzed using the Rietveld method. Highlights: Black-Right-Pointing-Pointer A high-pressure study of bismuth molybdate was performed. Black-Right-Pointing-Pointer Pressure-induced phase transitions were observed. Black-Right-Pointing-Pointer The low pressure phase bulk modulus was calculated to be K=51{+-}1 GPa. Black-Right-Pointing-Pointer The high pressure phase bulk modulus was calculated to be B=141.5{+-}0.1 GPa.

Scott, Paul R., E-mail: prscott933@hotmail.com [Department of Physics, University of Missouri-Kansas City, 5110 Rockhill Road, MO 64110 (United States); Crow, J.A. [Department of Physics, University of Missouri-Kansas City, 5110 Rockhill Road, MO 64110 (United States)] [Department of Physics, University of Missouri-Kansas City, 5110 Rockhill Road, MO 64110 (United States); Maczka, M. [Institute of Low Temperature and Structure Research, Polish Academy of Sciences, PO Box 1410, 50-950 Wroclaw 2 (Poland)] [Institute of Low Temperature and Structure Research, Polish Academy of Sciences, PO Box 1410, 50-950 Wroclaw 2 (Poland); Kruger, M.B. [Department of Physics, University of Missouri-Kansas City, 5110 Rockhill Road, MO 64110 (United States)] [Department of Physics, University of Missouri-Kansas City, 5110 Rockhill Road, MO 64110 (United States)



Adsorption of propane, isopropyl, and hydrogen on cluster models of the M1 phase of Mo-V-Te-Nb-O mixed metal oxide catalyst  

Science Conference Proceedings (OSTI)

The Mo-V-Te-Nb-O mixed metal oxide catalyst possessing the M1 phase structure is uniquely capable of directly converting propane into acrylonitrile. However, the mechanism of this complex eight-electron transformation, which includes a series of oxidative H-abstraction and N-insertion steps, remains poorly understood. We have conducted a density functional theory study of cluster models of the proposed active and selective site for propane ammoxidation, including the adsorption of propane, isopropyl (CH{sub 3}CHCH{sub 3}), and H which are involved in the first step of this transformation, that is, the methylene C-H bond scission in propane, on these active site models. Among the surface oxygen species, the telluryl oxo (Te=O) is found to be the most nucleophilic. Whereas the adsorption of propane is weak regardless of the MO{sub x} species involved, isopropyl and H adsorption exhibits strong preference in the order of Te=O > V=O > bridging oxygens > empty Mo apical site, suggesting the importance of TeO{sub x} species for H abstraction. The adsorption energies of isopropyl and H and consequently the reaction energy of the initial dehydrogenation of propane are strongly dependent on the number of ab planes included in the cluster, which points to the need to employ multilayer cluster models to correctly capture the energetics of surface chemistry on this mixed metal oxide catalyst.

Govindasamy, Agalya [University of Cincinnati; Muthukumar, Kaliappan [University of Cincinnati; Yu, Junjun [University of Cincinnati; Xu, Ye [ORNL; Guliants, Vadim V. [University of Cincinnati


Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.



Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming



Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana


Local and average structures of the spin-glass pyrochlore Y2Mo2O7 from neutron diffraction and neutron pair distribution function analysis  

Science Conference Proceedings (OSTI)

The observation of canonical spin-glass behavior in the pyrochlore oxide Y{sub 2}Mo{sub 2}O{sub 7} has been a subject of considerable interest as the original structural studies were interpreted in terms of a well-ordered crystallographic model. It is widely held that the stabilization of the spin-glass state requires some level of positional disorder along with frustration. Recent reports from local probe measurements, extended x-ray-absorption fine structure (EXAFS) and {sup 89}Y NMR, have been interpreted in terms of disorder involving the Mo-Mo distances (EXAFS) and multiple Y sites (NMR). This work reports results from temperature-dependent (15--300 K) neutron diffraction (ND) and neutron pair distribution function studies which can provide from the same data set information on both the average and local structures. The principal findings are that: (1) there is no crystallographic phase transition over the temperature region studied within the resolution of the ND data; (2) the diffraction data are well fitted using a fully ordered model but with large and anisotropic displacement parameters for three of the four atomic sites; (3) the pairwise real-space correlation function G(r) shows clear evidence that the principal source of disorder is associated with the Y-O1 atom pairs rather than the Mo-Mo pairs, in disagreement with the interpretation of the EXAFS results; (4) fits to the G(r) improve significantly when anisotropic displacements for all sites are included; (5) inclusion of a split-site position parameter for O1 improves, slightly, both the G(r) fits and the Rietveld fits to the ND data; and (6) for all models the fits become worse as the temperature decreases and as the fitting range decreases. These results are qualitatively consistent with the {sup 89}Y NMR observations and perhaps recent muon-spin-relaxation studies. The issue of static versus dynamic disorder is not resolved, definitively. An estimate of the distribution of exchange constants due to the disorder is made using spin-dimer analysis and compared with the Saunders-Chalker model for the generation of spin-glass behavior from 'weak' disorder on geometrically frustrated lattices.

Proffen, Thomas Ernst [Los Alamos National Laboratory; Kim, Hyunjeong [Los Alamos National Laboratory; Greedan, John [MCMASTER UNIV; Gout, Delphine [ORNL; Lozano - Gorrin, A D [MCMASTER UNIV; Derahkshan, Shahab [MCMASTER UNIV; Bozin, E [COLUMBIA UNIV; Billinge, S J L [COLUMBIA UNIV



Propane ammoxidation over the Mo-V-Te-Nb-O M1 phase: Reactivity of surface cations in hydrogen abstraction steps  

Science Conference Proceedings (OSTI)

Density functional theory calculations (GGA-PBE) have been performed to investigate the adsorption of C3 (propane, isopropyl, propene, and allyl) and H species on the proposed active center present in the surface ab planes of the bulk Mo-V-Te-Nb-O M1 phase in order to better understand the roles of the different surface cations in propane ammoxidation. Modified cluster models were employed to isolate the closely spaced V=O and Te=O from each other and to vary the oxidation state of the V cation. While propane and propene adsorb with nearly zero adsorption energy, the isopropyl and allyl radicals bind strongly to V=O and Te=O with adsorption energies, {Delta}E, being {le} -1.75 eV, but appreciably more weakly on other sites, such as Mo=O, bridging oxygen (Mo-O-V and Mo-O-Mo), and empty metal apical sites ({Delta}E > -1 eV). Atomic H binds more strongly to Te = O ({Delta}E {le} -3 eV) than to all the other sites, including V = O ({Delta}E = -2.59 eV). The reduction of surface oxo groups by dissociated H and their removal as water are thermodynamically favorable except when both H atoms are bonded to the same Te=O. Consistent with the strong binding of H, Te=O is markedly more active at abstracting the methylene H from propane (E{sub a} {le} 1.01 eV) than V = O (E{sub a} = 1.70 eV on V{sup 5+} = O and 2.13 eV on V{sup 4+} = O). The higher-than-observed activity and the loose binding of Te = O moieties to the mixed metal oxide lattice of M1 raise the question of whether active Te = O groups are in fact present in the surface ab planes of the M1 phase under propane ammoxidation conditions.

Muthukumar, Kaliappan [University of Cincinnati; Yu, Junjun [University of Cincinnati; Xu, Ye [ORNL; Guliants, Vadim V. [University of Cincinnati



A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada



Survey of welding processes for field fabrication of 2 1/4 Cr-1 Mo steel pressure vessels. [128 references  

SciTech Connect

Any evaluation of fabrication methods for massive pressure vessels must consider several welding processes with potential for heavy-section applications. These include submerged-arc and shielded metal-arc, narrow-joint modifications of inert-gas metal-arc and inert-gas tungsten-arc processes, electroslag, and electron beam. The advantage and disadvantages of each are discussed. Electroslag welding can be dropped from consideration for joining of 2 1/4 Cr-1 Mo steel because welds made with this method do not provide the required mechanical properties in the welded and stress relieved condition. The extension of electron-beam welding to sections as thick as 4 or 8 inches (100 or 200 mm) is too recent a development to permit full evaluation. The manual shielded metal-arc and submerged-arc welding processes have both been employed, often together, for field fabrication of large vessels. They have the historical advantage of successful application but present other disadvantages that make them otherwise less attractive. The manual shielded metal-arc process can be used for all-position welding. It is however, a slow and expensive technique for joining heavy sections, requires large amounts of skilled labor that is in critically short supply, and introduces a high incidence of weld repairs. Automatic submerged-arc welding has been employed in many critical applications and for welding in the flat position is free of most of the criticism that can be leveled at the shielded metal-arc process. Specialized techniques have been developed for horizontal and vertical position welding but, used in this manner, the applications are limited and the cost advantage of the process is lost.

Grotke, G.E.



DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256


Using Qualified Energy Conservation Bonds (QECBs) to Fund a Residential Energy Efficiency Loan Program: Case Study on Saint Louis County, MO  

SciTech Connect

Qualified Energy Conservation Bonds (QECBs) are federally-subsidized debt instruments that enable state, tribal, and local government issuers to borrow money to fund a range of qualified energy conservation projects. QECBs offer issuers very attractive borrowing rates and long terms, and can fund low-interest energy efficiency loans for home and commercial property owners. Saint Louis County, MO recently issued over $10 million of QECBs to finance the Saint Louis County SAVES residential energy efficiency loan program. The county's experience negotiating QECB regulations and restrictions can inform future issuers.

Zimring, Mark



Characterization of fundamental catalytic properties of MoS2/WS2 nanotubes and nanoclusters for desulfurization catalysis - a surface temperature study  

DOE Green Energy (OSTI)

The prior project consisted of two main project lines. First, characterization of novel nanomaterials for hydrodesulfurization (HDS) applications. Second, studying more traditional model systems for HDS such as vapor-deposited silica-supported Mo and MoSx clusters. In the first subproject, we studied WS2 and MoS2 fullerene-like nanoparticles as well as WS2 nanotubes. Thiophene (C4H4S) was used as the probe molecule. Interestingly, metallic and sulfur-like adsorption sites could be identified on the silica-supported fullerene-particles system. Similar structures are seen for the traditional system (vapor-deposited clusters). Thus, this may be a kinetics fingerprint feature of modern HDS model systems. In addition, kinetics data allowed characterization of the different adsorption sites for thiophene on and inside WS2 nanotube bundles. The latter is a unique feature of nanotubes that has not been reported before for any inorganic nanotube system; however, examples are known for carbon nanotubes, including prior work of the PI. Although HDS has been studied for decades, utilizing nanotubes as nanosized HDS reactors has never been tried before, as far as we know. This is of interest from a fundamental perspective. Unfortunately, the HDS activity of the nanocatalysts at ultra-high vacuum (UHV) conditions was close to the detection limit of our techniques. Therefore, we propose to run experiments at ambient pressure on related nanopowder samples as part of the renewal application utilizing a now-available GC (gas chromatograph) setup. In addition, Ni and Co doped nanocatalyts are proposed for study. These dopants will boost the catalytic activity. In the second subproject of the prior grant, we studied HDS-related chemistry on more traditional supported cluster catalysts. Mo clusters supported by physical vapor deposition (PVD) on silica have been characterized. Two reaction pathways are evident when adsorbing thiophene on Mo and MoSx clusters: molecular adsorption and dissociation. PVD Mo clusters turned out to be very reactive toward thiophene bond activation. Sulfur and carbon residuals form, which poison the catalyst and sulfide the Mo clusters. Sulfided silica-supported MoSx samples are not reactive toward thiophene bond activation. In addition to S and C deposits, H2, H2S, and small organic molecules were detected in the gas phase. Catalyst reactivation procedures, including O2 and atomic hydrogen treatments, have been tested. Cluster size effects have been seen: thiophene adsorbs molecularly with larger binding energies on smaller clusters. However, larger clusters have smaller activation energy for C4H4S bond activation than smaller clusters. The latter is consistent with early catalysis studies. Kinetics and dynamics parameters have been determined quantitatively. We spent a significant amount of time on upgrades of our equipment. A 2nd-hand refurbished X-ray photoelectron spectrometer (XPS) has been integrated into the existing molecular beam scattering system and is already operational (supported by the DoE supplemental grant available in October 2009). We also added a time of flight (TOF) system to the beam scattering apparatus and improved on the accessible impact energy range (new nozzle heater and gas mixing manifold) for the beam scattering experiments. In addition, a GC-based powder atmospheric flow reactor for studies on powder samples is now operational. Furthermore, a 2nd UHV kinetics system has been upgraded as well. In summary, mostly single crystal systems have so far been considered in basic science studies about HDS. Industrial catalysts, however, can be better approximated with the supported cluster systems that we studied in this project. Furthermore, an entirely new class of HDS systems, namely fullerene-like particles and inorganic nanotubes, has been included. Studying new materials and systems has the potential to impact science and technology. The systems investigated are closely related to energy and environmental-related surface science/catalysis. This prior project, conducted at NDSU by a sma

U. Burghaus



Offering Songs, Festive Songs, Processional Songs mGar-gLu, Khro-Glu, Phebsnga: Tashi Tsering's Music: Chu mo chu lui dukpai, 'How is the water level?'  

E-Print Network (OSTI)

last updated on Monday, 4 April 2011 Accession Form for Individual Recordings: Collection / Collector Name khro glu / Katey Blumenthal Tape No. / Track / Item No. 06_11_2010_Chu mo chu lui dukpai.MP3 Length of track 00:03:06 Title of track Chu... ) Digital Recording Related tracks (include description/relationship if appropriate) Name of recorder (if different from collector) Date of recording 06/11/2010 Place of recording Lo Monthang, Mustang, Nepal Name(s), age, sex, place of birth...

Blumenthal, Katey


Evaluation of 2.25Cr-1Mo Alloy for Containment of LiCl/KCl Eutectic during the Pyrometallurgical Processing of Used Nuclear Fuel  

SciTech Connect

Recovery of uranium from the Mk-IV and Mk-V electrorefiner vessels containing a LiCl/KCl eutectic salt has been on-going for 14 and 12 years, respectively, during the pyrometallurgical processing of used nuclear fuel. Although austenitic stainless steels are typically utilized for LiCl/KCl salt systems, the presence of cadmium in the Mk-IV electrorefiner dictates an alternate material. A 2.25Cr-1Mo alloy (ASME SA-387) was chosen due to the absence of nickel in the alloy which has a considerable solubility in cadmium. Using the transition metal impurities (iron, chromium, nickel, molybdenum, and manganese) in the electrorefined uranium products, an algorithm was developed to derive values for the contribution of the transition metals from the various input sources. Weight loss and corrosion rate data for the Mk-V electrorefiner vessel were then generated based on the transition metal impurities in the uranium products. To date, the corrosion rate of the 2.25Cr-1Mo alloy in LiCl/KCl eutectic is outstanding assuming uniform (i.e. non-localized) conditions.

B.R. Westphal; S.X. Li; G.L. Fredrickson; D. Vaden; T.A. Johnson; J.C. Wass



In situ X-ray Absorption Spectroscopic Investigation of the Electrochemical Conversion Reactions of CuF2-MoO3 Nanocomposite  

DOE Green Energy (OSTI)

We have used X-ray absorption spectroscopy at the Cu K-edge to investigate the electrochemical conversion reaction of 20 nm size 85 wt% CuF{sub 2}-15 wt% MoO{sub 3} nanocomposite under in situ conditions. The nanocomposite was prepared by high energy milling. Upon discharge, the lithiation reaction with the nanocomposite resulted in the formation of nanophase metallic Cu, which is consistent with the conversion of CuF{sub 2} into Cu and LiF. Based on XANES and Fourier transforms of EXAFS spectra, we show that the discharge process proceeded via the formation of highly dispersed Cu particles. Based on the coordination number of the first shell of Cu, the average size of the Cu particles was estimated to be in the 1-3 nm range in the fully discharged state.

A Mansour; F Badway; W Yoon; K Chung; G Amatucci



Measurement of single and double glazing thermal performance under realistic conditions using the mobile window thermal test (MoWiTT) facility  

SciTech Connect

The thermal performance of single glazing, clear double glazing, and double glazing with a low-emissivity coating was measured in both south-facing and north-facing orientations under realistic field conditions using the new MoWiTT field test facility. The time-dependent net heat flow through each fenestration was found to be consistent with the predictions of the standard simplified heat transfer model, provided that an angle-dependent shading coefficient is used and diffuse solar gain is included in the calculation. Summer-condition average U-values were derived for each glazing type and were found to agree with the expected values for both types of double glazing. The measured U-value for single glazing was lower than predicted.

Klems, J.; Keller, H.



Investigation and Evaluation of Geopressured-Geothermal Wells; Detailed Reentry Prognosis for Geopressure-Geothermal Testing of Dr. M.O. Miller No. 1 Well  

DOE Green Energy (OSTI)

This Gruy Federal Type I-A prospect was drilled as the Union Oil Company of California, Dr. M.O. Miller No. 1 and is located in Section 34, T15S, R5W, Cameron Parish, Louisiana. The land belongs to the heirs of Dr. Miller and is unleased. The well site is approximately 350 feet southwest of the northwest corner of Section 34 and approximately 4,000 feet south-southeast of Prospect L-3, Buttes Gas and Oil Co. et al., Gladys McCall No. 1. The former well site is accessible by approximately 2.8 miles of canal levee on which a board road would have to be constructed. In addition, there are two wooden bridges in fair condition to be crossed which will require minor repairs. The well was drilled to a total depth of 18,158 feet and plugged and abandoned as a dry hole mid 1965.




Evaluating and adjusting {sup 239}Pu, {sup 56}Fe, {sup 28}Si and {sup 95}Mo nuclear data with a Monte Carlo technique  

Science Conference Proceedings (OSTI)

In this paper, Monte Carlo optimization and nuclear data evaluation are combined to produce optimal adjusted nuclear data files. The methodology is based on the so-called 'Total Monte Carlo' and the TALYS system. Not only a single nuclear data file is produced for a given isotope, but virtually an infinite number, defining probability distributions for each nuclear quantity. Then each of these random nuclear data libraries is used in a series of benchmark calculations. With a goodness-of-fit estimator, best {sup 239}Pu, {sup 56}Fe, {sup 28}Si and {sup 95}Mo evaluations for that benchmark set can be selected. A few thousands of random files are used and each of them is tested with a large number of fast, thermal and intermediate energy criticality benchmarks. From this, the best performing random file is chosen and proposed as the optimum choice among the studied random set. (authors)

Rochman, D.; Koning, A. J. [Nuclear Research and Consultancy Group, Petten (Netherlands)



On the Corrosion adequacy of the 2 1/4 CR-1Mo steel for LMFBR steam generation system service. Critical literature survey  

SciTech Connect

The focus of this review is on the long-term serviceability of 2 1/4-1 Mo steel under the waterside environmental conditions presented in the steam generator of an LMFBR commercial scale plant. The basic question related to material behavior is to what extent the water side physico-chemical environment will affect the favorable performance of a given material under operating experience. In present light water reactors, the steam generator corrosion problems in part are attributable to complex interactions between the localized secondary environment and the mechanical design of the components (i.e., tube/tube support crevice, tube/tubesheet crevice, flow pattern, etc.) in the steam generating system.

Zima, G.E.



A self-consistent MoD-WM/MM structural refinement method: characterization of hydrogen bonding in the orytricha nova G-1uar  

DOE Green Energy (OSTI)

This paper generalizes the MoD-QM/MM hybrid method, developed for ab initio computations of protein electrostatic potentials [Gasc6n, l.A.; Leung, S.S.F.; Batista, E.R.; Batista, V.S. J. Chem. Theory Comput. 2006,2, 175-186], as a practical algorithm for structural refinement of extended systems. The computational protocol involves a space-domain decomposition scheme for the formal fragmentation of extended systems into smaller, partially overlapping, molecular domains and the iterative self-consistent energy minimization of the constituent domains by relaxation of their geometry and electronic structure. The method accounts for mutual polarization of the molecular domains, modeled as Quantum-Mechanical (QM) layers embedded in the otherwise classical Molecular-Mechanics (MM) environment according to QM/MM hybrid methods. The method is applied to the description of benchmark models systems that allow for direct comparisons with full QM calculations, and subsequently applied to the structural characterization of the DNA Oxytricha nova Guanine quadruplex (G4). The resulting MoD-QM/MM structural model of the DNA G4 is compared to recently reported highresolution X-ray diffraction and NMR models, and partially validated by direct comparisons between {sup 1}H NMR chemical shifts that are highly sensitive to hydrogen-bonding and stacking interactions and the corresponding theoretical values obtained at the density functional theory DFT QM/MM (BH&H/6-31 G*:Amber) level in conjunction with the gauge independent atomic orbital (GIAO) method for the ab initio self consistent-field (SCF) calculation of NMR chemical shifts.

Batista, Enrique R [Los Alamos National Laboratory; Newcomer, Micharel B [YALE UNIV; Raggin, Christina M [YALE UNIV; Gascon, Jose A [YALE UNIV; Loria, J Patrick [YALE UNIV; Batista, Victor S [YALE UNIV



FLIGHT: Clock Calibration Using Fluorescent Lighting Zhenjiang Li1,4, Wenwei Chen1, Cheng Li1, Mo Li1, Xiang-yang Li2, Yunhao Liu3,4  

E-Print Network (OSTI)

FLIGHT: Clock Calibration Using Fluorescent Lighting Zhenjiang Li1,4, Wenwei Chen1, Cheng Li1, Mo propose a novel clock calibration approach called FLIGHT, which leverages the fact that the fluorescent, Performance Keywords Clock calibration, Fluorescent lighting, Energy efficiency 1. INTRODUCTION Maintaining

Liu, Yunhao


Synthesis and photoluminescence properties of the high-brightness Eu{sup 3+}-doped M{sub 2}Gd{sub 4}(MoO{sub 4}){sub 7} (M=Li, Na) red phosphors  

SciTech Connect

A series of red-emitting phosphors Eu{sup 3+}-doped M{sub 2}Gd{sub 4}(MoO{sub 4}){sub 7} (M=Li, Na) have been successfully synthesized at 850 Degree-Sign C by solid state reaction. The excitation spectra of the two phosphors reveal two strong excitation bands at 396 nm and 466 nm, respectively, which match well with the two popular emissions from near-UV and blue light-emitting diode chips. The intensity of the emission from {sup 5}D{sub 0} to {sup 7}F{sub 2} of M{sub 2}(Gd{sub 1-x}Eu{sub x}){sub 4}(MoO{sub 4}){sub 7} phosphors with the optimal compositions of x=0.85 for Li or x=0.70 for Na is about five times higher than that of Y{sub 2}O{sub 3}:Eu{sup 3+}. The quantum efficiencies of the entitled phosphors excited under 396 nm and 466 nm are also investigated and compared with commercial phosphors Sr{sub 2}Si{sub 5}N{sub 8}:Eu{sup 2+} and Y{sub 3}A{sub 5}O{sub 12}:Ce{sup 3+}. The experimental results indicate that the Eu{sup 3+}-doped M{sub 2}Gd{sub 4}(MoO{sub 4}){sub 7} (M=Li, Na) phosphors are promising red-emitting phosphors pumped by near-UV and blue light. - Graphical Abstract: The intensity of the red emission of M{sub 2}(Gd{sub 1-x}Eu{sub x}){sub 4}(MoO{sub 4}){sub 7} (M=Li, Na) phosphors with the optimal compositions is about five times higher than that of Y{sub 2}O{sub 3}:Eu{sup 3+}. Highlights: Black-Right-Pointing-Pointer Two novel Eu{sup 3+}-doped red phosphors (Na{sub 2}Gd{sub 4}(MoO{sub 4}){sub 2}, Li{sub 2}Gd{sub 4}(MoO{sub 4}){sub 7}) were synthesized. Black-Right-Pointing-Pointer Their emission intensities are about five times higher than that of Y{sub 2}O{sub 3}:Eu{sup 3+}. Black-Right-Pointing-Pointer Their quantum efficiencies are higher than that of commercial red phosphor Sr{sub 2}Si{sub 5}N{sub 8}:Eu{sup 2+}.

Zhao Chengchun [Key Laboratory of Materials for High Power Laser, Shanghai Institute of Optics and Fine Mechanics, Chinese Academy of Sciences, Shanghai 201800 (China); Graduate School of Chinese Academy of Sciences, Beijing 100039 (China); Yin Xin [CAS Key Laboratory of Materials for Energy Conversion, Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai 200050 (China); Huang Fuqiang, E-mail: huangfq@mail.sic.ac.cn [CAS Key Laboratory of Materials for Energy Conversion, Shanghai Institute of Ceramics, Chinese Academy of Sciences, Shanghai 200050 (China); Hang Yin, E-mail: yhang@siom.ac.cn [Key Laboratory of Materials for High Power Laser, Shanghai Institute of Optics and Fine Mechanics, Chinese Academy of Sciences, Shanghai 201800 (China)



High temperature oxidation and NaCl-induced accelerated corrosion of hot-dip aluminized 9Cr-1Mo and 310 stainless steel  

E-Print Network (OSTI)

The behaviors of high temperature corrosion on hot-dip aluminized on 9Cr-1Mo and 310 stainless steels when catalyzed by NaCl and cyclic heating environment were studied experimentally. The corrosion behavior and morphological development were investigated by weight gain kinetics, metallographs, depths of attack, metal losses, and X-ray analyses. The results of 310SS deposited with salt mixtures show that weight gain kinetics in simple oxidation reveals a steady-state parabolic rate law after 3 hr, while the kinetics with salt deposits display multi-stage growth rates. NaCl is the main corrosive specie in high-temperature corrosion involving mixtures of NaCl/Na2SO4 and is responsible for the formation of internal attack. Uniform internal attack is the typical morphology of NaCl-induced hot corrosion, while the extent of intergranular attack is more pronounced as the content of Na2SO4 in the mixture is increased. The thermal-cycling test results of 310SS deposited NaCl and coated 7wt%Si/93wt%Al show that the aluminized layers have good corrosion resistance during the first four cycles of testing, while degradation occurs after testing for five cycles. The reason for degradation of aluminized layers is attributed to the formation of interconnecting voids caused by aluminum inward diffusion, chloridation/oxidation cyclic reactions and the penetration of molten NaCl through the voids into the alloy substrate. The 9Cr-1Mo steels coated with 7wt%Si/93wt%Al oxidized at 750, 850, and 950C in static air show that oxidation kinetics followed a parabolic rate law at 750 and 850 C. The cracks propagated through the FexAly layer due to the growth of brittle FeAl2 and Fe2Al5 at 750 and 850C. The voids condensed in the interface of intermetallics and substrate are attributed to the Kirkendall effect. At 950C, the fast growing aluminide layer has a different expansion coefficient than oxide scale, leading to scale cracking, oxygen penetration, and internal oxidized, evidenced by a rapid mass gain.

Tsaur, Charng-Cheng


Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Tatyana V. Wilds, Most Pure Heart of Mary School, Topeka, KS  

E-Print Network (OSTI)

in San Francisco Stalin, Churchill/Attlee meet in Potsdam US drops Atomic Bomb on Hiroshima and Nagasaki) Churchill's "Iron Curtain" speech in Fulton, Missouri 1949 Soviets detonate their first Atomic Bomb in the Cold War. For example, what if Truman had not fired General Macarthur and he had decided to drop bombs

Peterson, Blake R.


# workstation-ks.cfg # version 1.0.0 2011-09-30 # Copyright ...  

Science Conference Proceedings (OSTI)

... 9 (Rows 2 - 6) volgroup vgroup1 pv.01 logvol ... row 134) -sysklogd rsyslog # Post-install commands # Some post-installation configuration can ...



KS-REPORT(7-24-87} The Eigenvalue Problem for an N-Sector Ring  

E-Print Network (OSTI)

\\.., -.. ·~.t~ -..-7. -..-.. ~ -,.. -')It · · ... ,.- J ·· ··· 5 ·· ··· :-O' ··· ··· leee -7. 10 · ttl L(H · ,01

Kemner, Ken


Search for Lepton Flavour Violating Decays tau- to l- Ks with the BaBar experiment  

SciTech Connect

A search for the lepton flavor violating decays {tau}{sup -} {yields} l{sup -} K{sub S}{sup 0} (l = e or {mu}) has been performed using a data sample corresponding to an integrated luminosity of 469 fb{sup -1}, collected with the BABAR detector at the SLAC PEP-II e{sup +}e{sup -} asymmetric energy collider. No statistically significant signal has been observed in either channel and the estimated upper limits on branching fractions are {Beta}({tau}{sup -} {yields} e{sup -} K{sub S}{sup 0}) < 3.3 x 10{sup -8} and {Beta}({tau}{sup -} {yields} {mu}{sup -}K{sub S}{sup 0}) < 4.0 x 10{sup -8} at 90% confidence level.

Aubert, B.; Bona, M.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Lopez, L.; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Cahn, R.N.; Jacobsen, R.G.; /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /Frascati /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Karlsruhe U., EKP /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT, LNS /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /INFN, Naples /Naples U. /INFN, Naples /INFN, Naples /Naples U. /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /Pennsylvania U. /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison



Measurement of Time-Dependent CP Asymmetry in B0 --> KS pi0 gamma Decays  

SciTech Connect

The authors measure the time-dependent CP asymmetry in B{sup 0} {yields} K{sub S}{sup 0}{pi}{sup 0}{gamma} decays for two regions of K{sub S}{sup 0}-{pi}{sup 0} invariant mass, m(K{sub S}{sup 0}{pi}{sup 0}), using the final BABAR data set of 467 x 10{sup 6} B{bar B} pairs collected at the PEP-II e{sup +}e{sup -} collider at SLAC. They find 339 {+-} 24 B{sup 0} {yields} K*{sup 0}{gamma} candidates and measure S{sub K*{gamma}} = -0.03 {+-} 0.29 {+-} 0.03 and C{sub K*{gamma}} = -0.14 {+-} 0.16 {+-} 0.03. In the range 1.1 < m(K{sub S}{sup 0}{pi}{sup 0}) < 1.8 GeV/c{sup 2} they find 133 {+-} 20 B{sup 0} {yields} K{sub S}{sup 0}{pi}{sup 0}{gamma} candidates and measure S{sub K{sub S}{sup 0}{pi}{sup 0}{gamma}} = -0.78 {+-} 0.59 {+-} 0.09 and C{sub K{sub S}{sup 0}{pi}{sup 0}{gamma}} = -0.36 {+-} 0.33 {+-} 0.04. The uncertainties are statistical and systematic, respectively.

Aubert, Bernard; Bona, M.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Lopez, L.; Palano, Antimo; Pappagallo, M.; /Bari U. /INFN, Bari; Eigen, G.; Stugu, Bjarne; Sun, L.; /Bergen U.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Cahn, Robert N.; Jacobsen, R.G.; /LBL, Berkeley /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /Ferrara U. /INFN, Ferrara /Frascati /Genoa U. /INFN, Genoa /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Karlsruhe U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /Consorzio Milano Ricerche /INFN, Milan /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /Napoli Seconda U. /INFN, Naples /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /Padua U. /INFN, Padua /Paris U., VI-VII /Pennsylvania U. /Perugia U. /INFN, Perugia /INFN, Pisa /Princeton U. /Banca di Roma /Frascati /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /Turin U. /INFN, Turin /Trieste U. /INFN, Trieste /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison



Search for Lepton Flavour Violating Decays Tau -> l Ks with the BABAR Detector  

SciTech Connect

We present the search for the lepton flavour violating decay {tau} {yields} lK{sup 0}{sub s} with the BaBar experiment data. This process and many other lepton flavour violating {tau} decays, like {tau} {yields} {mu}{gamma} and {tau} {yields} lll, are one of the most promising channel to search for evidence of new physics. According to the Standard Model and the neutrino mixing parameters, branching fractions are estimated well below 10{sup -14}, but many models of new physics allow for branching fractions values close to the present experimental sensitivity. This analysis is based on a data sample of 469fb{sup -1} collected by BABAR detector at the PEP-II storage ring from 1999 to 2007, equivalent to 431 millions of {tau} pairs. the BABAR experiment, initially designed for studying CP violation in B mesons, has demonstrated to be one of the most suitable environments for studying {tau} decays. The tracking system, the calorimeter and the particle identification of BABAR, together with the knowledge of the {tau} initial energy, allow an extremely powerful rejection of background events that, for this analysis, is better than 10{sup -9}. Being {tau} {yields} lK{sup 0}{sub s} a decay mode without neutrinos, the signal {tau} decay can be fully reconstructed. Kinematical constraints are used in a fit that provides a decay tree reconstruction with a high resolution. For this analysis MC simulated events play a decisive role for estimating the signal efficiency and study the residual background. High statistics MC sample are produced simulating detector conditions for different periods of data collection, in order to reduce any discrepancies with the data. When discrepancies can not be removed, we perform studies to compute a correction factor or an estimation of systematic errors that need to be included in the final measurement. A significant improvement of the current result can be reached only with a higher statistics and, therefore, with a new collider providing a luminosity from 10 to 100 times more than PEP-II. A new detector, with improved performance and able to collect data in a high background environment, is also requested to fully exploit the capability of such amount of data. In fact, only keeping the efficiency and the background as similar as possible to present ones, we will be able to scale almost linearly the estimated upper limit according to the luminosity. The strong potential of improvement for the search of lepton flavour violation {tau} decays makes the building of such a machine highly desirable.

Cenci, Riccardo; /SLAC



Search for CP Violation in the Decay D+/- to Ks pi+/-  

SciTech Connect

We report on a search for CP violation in the decay D{sup {+-}} {yields} K{sub S}{sup 0}{pi}{sup {+-}} using a data set corresponding to an integrated luminosity of 469 fb{sup -1} collected with the BABAR detector at the PEP-II asymmetric energy e{sup +}e{sup -} storage rings. The CP-violating decay rate asymmetry A{sub CP} is determined to be (-0.44 {+-} 0.13(stat) {+-} 0.10(syst))%, consistent with zero at 2.7 {sigma} and with the standard model prediction of (-0.332 {+-} 0.006)%. This is currently the most precise measurement of this parameter.

del Amo Sanchez, P.; Lees, J.P.; Poireau, V.; Prencipe, E.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Martinelli, M.; /INFN, Bari /Bari U.; Milanes, D.A.; /INFN, Bari; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Brown, D.N.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G.; Osipenkov, I.L.; /UC, Berkeley; Koch, H.; Schroeder, T.; /Ruhr U., Bochum /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UC, Riverside /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /Frascati /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /Indian Inst. Tech., Guwahati /Harvard U. /Harvey Mudd Coll. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa State U. /Iowa State U. /Johns Hopkins U. /Paris U., VI-VII /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Royal Holloway, U. of London /Louisville U. /Mainz U., Inst. Kernphys. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /INFN, Naples /Naples U. /NIKHEF, Amsterdam /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /Rostock U. /Rutherford /DAPNIA, Saclay /SLAC /South Carolina U. /Southern Methodist U. /Stanford U., Phys. Dept. /SUNY, Albany /Tel Aviv U. /Tennessee U. /Texas Nuclear Corp., Austin /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U. /Victoria U. /Warwick U. /Wisconsin U., Madison



Demonstration Assessment of Light-Emitting Diode (LED) Parking Lot Lighting in Leavenworth, KS  

SciTech Connect

This report describes the process and results of a demonstration of solid-state lighting (SSL) technology in a commercial parking lot lighting application, under the U.S. Department of Energy (DOE) Solid-State Lighting Technology GATEWAY Demonstration Program. The parking lot is for customers and employees of a Walmart Supercenter in Leavenworth, Kansas and this installation represents the first use of the LED Parking Lot Performance Specification developed by the DOEs Commercial Building Energy Alliance. The application is a parking lot covering more than a half million square feet, lighted primarily by light-emitting diodes (LEDs). Metal halide wall packs were installed along the building facade. This site is new construction, so the installed baseline(s) were hypothetical designs. It was acknowledged early on that deviating from Walmarts typical design would reduce the illuminance on the site. Walmart primarily uses 1000W pulse-start metal halide (PMH) lamps. In order to provide a comparison between both typical design and a design using conventional luminaires providing a lower illuminance, a 400W PMH design was also considered. As mentioned already, the illuminance would be reduced by shifting from the PMH system to the LED system. The Illuminating Engineering Society of North America (IES) provides recommended minimum illuminance values for parking lots. All designs exceeded the recommended illuminance values in IES RP-20, some by a wider margin than others. Energy savings from installing the LED system compared to the different PMH systems varied. Compared to the 1000W PMH system, the LED system would save 63 percent of the energy. However, this corresponds to a 68 percent reduction in illuminance as well. In comparison to the 400W PMH system, the LED system would save 44 percent of the energy and provide similar minimum illuminance values at the time of relamping. The LED system cost more than either of the PMH systems when comparing initial costs. However, when the life-cycle costs from energy and maintenance were factored into the scenario, the LED system had lower costs at the end of a 10-year analysis period. The LED system had a 6.1 year payback compared to the 1000W PMH system and a 7.5 year payback versus the 400W PMH system. The costs reflect high initial cost for the LED luminaire, plus more luminaires and (subsequently) more poles for the LED system. The other major issue affecting cost effectiveness was that Leavenworth, Kansas has very low electricity costs. The melded rate for this site was $0.056 per kWh for electricity. However, if the national electricity rate of $0.1022/kWh was used the payback would change to between four and five years for the LED system. This demonstration met the GATEWAY requirements of saving energy, matching or improving illumination, and being cost effective. The project also demonstrated that the Commercial Building Energy Alliance (CBEA) specification works in practice. Walmart appreciated having an entire site lighted by LEDs to gain more experience with the technology. Walmart is reviewing the results of the demonstration as they consider their entire real estate portfolio.

Myer, Michael; Kinzey, Bruce R.; Curry, Ku'uipo



Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8



Gasoline and Diesel Fuel Update (EIA)

1 1 55 0 2 4 6 8 10 Residential Onsystem Commercial Onsystem Industrial Onsystem Vehicle Fuel Electric Utilities Dollars per Thousand Cubic Feet 0 30 60 90 120 150 180 210 240 270 300 330 Dollars per Thousand Cubic Meters 1997 1998 1999 2000 2001 25. Average Price of Natural Gas Delivered to Consumers in the United States, 1997-2001 Figure Note: Prices are calculated from onsystem sales. Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition" and Federal Energy Regulatory Commission (FERC), Form FERC- 423, "Monthly Report of Cost and Quality of Fuels for Electric Plants." Energy Information Administration / Natural Gas Annual 2001 56 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA


Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848



Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type


Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2008 (Million Cubic Feet) Norway Trinidad/ Tobago Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 45,772 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates.


Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC



Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 (Million Cubic Feet) 24,891 2,895 Nigeria WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico Algeria C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada N i g e r i a O m a n Qatar Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Malaysia 2,986 Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2005 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 335,380 634,982 664,318 612,297 125,202 33,223 531,868 103,624


San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

,833 ,833 35 Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2009 (Million Cubic Feet) Norway Trinidad/ Tobago Trinidad/ Tobago Egypt Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 111,144 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates


AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP

Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 (Million Cubic Feet) Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 42,411 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2006 253,214 690,780 634,185 658,523 134,764 63,063 526,726 121,049 34,531 492,655 101,101 23,154 40,113 1,496,283 68,601


U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value


Microsoft Word - figure_14.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 14. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2010 (Million Cubic Feet) Norway India Trinidad/ Tobago Egypt Yemen Japan Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 53,122 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada Gulf of Mexico Canada Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates based on historical data. Energy Information


Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product


NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FOA-0000028 FOA-0000028 Prime: Cascade Sierra Solutions EE DE-EE0002613 PMC/PVT 2011 John Jason Conley 07/2011 - 02/20/2014 Multiple sites, Multiple states Interstate Electrification Improvement (SUMMARY CX) Install truck stop electrification hardware at multiple (30) truck stops nationwide. Locations in UT, IA, NM, WY, AZ, MO, VA, MA, MI, TX, AL, WA, CA, NC, NY, MT, FL, KS. 08 17 2011 John Jason Conley Digitally signed by John Jason Conley DN: cn=John Jason Conley, o=DOE, ou=NETL, email=John.Conley@netl.doe.gov, c=US Date: 2011.08.17 13:25:08 -04'00' 10 18 2011 john ganz Digitally signed by john ganz DN: cn=john ganz, o=netl, ou=environmental compliance division, email=john.ganz@netl.doe.gov, c=US Date: 2011.10.18 13:52:43 -04'00' Sub: Shorepower Technologies. Funded by DE-FOA-0000028, "Recovery Act - Transportation


Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)


Table 25  

Gasoline and Diesel Fuel Update (EIA)

89 89 Table 25 Created on: 1/3/2014 3:10:33 PM Table 25. Natural gas home customer-weighted heating degree days, New England Middle Atlantic East North Central West North Central South Atlantic Month/Year/Type of data CT, ME, MA, NH, RI, VT NJ, NY, PA IL, IN, MI, OH, WI IA, KS, MN, MO, ND, NE, SD DE, FL, GA, MD, DC, NC, SC, VA, WV November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0 November to November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0



Gasoline and Diesel Fuel Update (EIA)

18 18 Energy Information Administration / Natural Gas Annual 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 0 1 2 3 4 5 6 7 T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o A l a b a m a K a n s a s A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 1997 1998 1999 2000 2001 2001 16. Marketed Production of Natural Gas in Selected States, 1997-2001 Figure Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI



Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423


Materials research and evaluation for geothermal corrosion environments. Progress report, December 15, 1974--December 15, 1975. [Ni Co Cr Mo alloy  

DOE Green Energy (OSTI)

Bent beam and self-stressed specimens have been employed and shown to give results consistent with other types of specimens as reported in the literature. All tests have been conducted in the standard NACE, H/sub 2/S environment for initial screening and then in a 20 percent NaCl modified NACE solution. Among the higher strength corrosion resistant alloys, K Monel at 135 ksi yield strength did not fail in either environment at temperatures up to 425/sup 0/F stressed at the yield strength. Age hardenable A286 failed at 325/sup 0/F when stressed to the 190 ksi yield strength, but did not fail when stressed to an overaged yield strength of 135 ksi. A new NiCoCrMo age hardenable alloy heat treated to 220 ksi yield strength and stressed to this value did not fail in either environment at temperatures up to 420/sup 0/F. Also, this material was substantially ''brighter'' after the tests than either the K-Monel or A286.

Troiano, A.R.; Hehemann, R.F.



Revue dEtudes Tibtaines  

E-Print Network (OSTI)

nouvelles classifications : gshin rje, ma mo, srin po, gnod sbyin, mi' am ci, sa bdag, btsan, bdud ; et lha, btsan, bdud, gza', dmu, srin po, rgyal po, ma mo4. Questionn sur les recoupements, mais aussi les diver- gences que prsentent ces trois listes, il... citant les an- ciens voquent la possibilit pour les klu dapparatre sous la forme dtres surnaturels mi-humains mi-serpents. Les anciens disent que dans la mer vivent des klu et des klu mo ou klu femelles tte et torse d'homme ou de femme et ...

Achard, Jean-Luc



Two-dimensional [sup 1]H-NMR EXSY study of the fluxional behavior of the novel carbenium ion complex [FvMo[sub 2](CO)[sub 4]([mu],[eta][sup 2],[eta][sup 3]-MeC[equivalent to]CCH[sub 2])][BF[sub 4  

SciTech Connect

The title compound [FuMo[sub 2](CO)[sub 4]([mu],[eta][sup 2],[eta][sup 3]-MeC[equivalent to]CCH[sub 2])][BF[sub 4

Amouri, H.E.; Besace, Y.; Vollhardt, K.P.C.; Ball, G.E. (Univ. of California, Berkeley (United States) Lawrence Berkeley Lab., CA (United States)); Vaissermann, J. (Universite Pierre et Marie Curie, Paris (France))



d::;":,",:::,, ST. LOUIS.7. MO,  

Office of Legacy Management (LM)




NLE Websites -- All DOE Office Websites (Extended Search)

breakdown in x-band accelerating structures, we have cleanly-autopsied (no debris added by post-operation structure disassembly) an RF-processed structure. Macroscopic...



U.S. Energy Information Administration (EIA)

PU Kenya KE Lesotho LT Liberia LI Libya LY Madagascar MA Malawi MI Mali ML Mauritania MR Mauritius MP Morocco MO Mozambique MZ Namibia WA Niger NG Nigeria NI Reunion ...


Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997



POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...


MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2


Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...

Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...


Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...


Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...


Electrochemical Studies of Passive Film Stability on Fe48Mo14Cr15Y2C15B Amorphous Metal in Seawater at 90oC and 5M CaCl2 at 105oC  

Science Conference Proceedings (OSTI)

Several Fe-based amorphous metal formulations have been identified that appear to have corrosion resistance comparable to, or better than that of Ni-based Alloy C-22 (UNS N06022), based on measurements of breakdown potential and corrosion rate in seawater. Both chromium (Cr) and molybdenum (Mo) provide corrosion resistance, boron (B) enables glass formation, and rare earths such as yttrium (Y) lower critical cooling rate (CCR). Amorphous Fe{sub 48.0}Cr{sub 15.0}Mo{sub 14.0}B{sub 6.0}C{sub 15.0}Y{sub 2.0} (SAM1651) has a low critical cooling rate (CCR) of less than 80 Kelvin per second, due to the addition of yttrium. The low CCR enables it to be rendered as a completely amorphous material in practical materials processes. While the yttrium enables a low CCR to be achieved, it makes the material relatively difficult to atomize, due to increases in melt viscosity. Consequently, the powders produced thus far have had irregular shape, which had made pneumatic conveyance during thermal spray deposition difficult.

Farmer, J C; Day, S D; Lian, T; Saw, C K; Hailey, P D; Blue, C A; Peters, W; Payer, J H; Perepezko, J H; Hildal, K; Branagan, D J; Buffa, E J; Aprigliano, L



Contract WEC 3. 2. 3 study to optimize Cr-Mo steels to resist hydrogen and temper embrittlement. Quarterly report No. 9, second annual report, January 1-December 31, 1980  

DOE Green Energy (OSTI)

The hydrogen embrittlement susceptibility of commercial 2-1/4 Cr-1Mo steels has been investigated, using H/sub 2/S as the primary environment. After it was found that low strength steels, which had been given a post weld heat treatment, were immune to the test techniques developed, the effect of strength level was studied to establish a lower limit for embrittlement. Similar tests on the peak hardness zone in the heat affected zone of a weld showed that the crack preferred to move to the far heat affected zone where the strength level was below the lower limit established above. It is suggested that residual stresses may account for the anomaly, although other factors such as structural change could be important. In order to assess the low strengh steels, the environment was changed to include saturated water vapor in the H/sub 2/S. It was found that the low strength steels could be readily tested in this environment, thus providing a means of ranking Cr-Mo steels for hydrogen embrittlement susceptibility. Tests on one steel were included to show that the variability in the data using the H/sub 2/S + H/sub 2/O environment was small enough to make the screening test results significant.

Shaw, B.J.



Revue dEtudes Tibtaines  

E-Print Network (OSTI)

. Moscou : Nauka. Zhang Yisun 1993. Bod rgya tshig mdzod chen mo, Pkin : Mi rigs dpe skrun khang LA ROCA BLANCA DE LHANG LHANG Un santuario en Nyag rong Oriol Aguilar En Tbet, el Pas de las Nieves, en el centro de... mi nyag pa en el Nyag rong, procedentes del norte. La predominancia del dialecto mi nyag habra cambiado el antiguo nombre del rea, que era Brag dmar, en Rag dmar8. Tambin facilita los nombres de los diversos centros religiosos desde tiempos...

Achard, Jean-Luc



U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

1 Regional maps Figure F4. Oil and gas supply model regions Figure F4. Oil and Gas Supply Model Regions Atlantic WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA...


WEC 3. 2. 3 study to optimize Cr-Mo steels to resist hydrogen and temper embrittlement. Quarterly report No. 9. Second annual report, January 1-December 31, 1980  

DOE Green Energy (OSTI)

The hydrogen embrittlement susceptibility of commercial 2 1/4Cr - 1Mo steels has been investigated, using H/sub 2/S as the primary environment. After it was found that low strength steels, which had been given a post weld heat treatment, were immune to the test techniques developed, the effect of strength level was studied to establish a lower limit for embrittlement. Similar tests on the peak hardness zone in the heat affected zone of a weld showed that the crack preferred to move to the far heat affected zone where the strength level was below the lower limit established above. It is suggested that residual stresses may account for the anomaly, although other factors such as structural change could be important. In order to assess the low strength steels, the environment was changed to include saturated water vapor in the H/sub 2/S.

Shaw, B.J.



Measurement of $D^0-overline{D}^0$ mixing parameters using $D^0 \\to K_S^0 \\pi^ \\pi^-$ and $D^0 \\to K_S^0 K^ K^-$ decays  

Science Conference Proceedings (OSTI)

We report a direct measurement of D{sup 0}-{bar D}{sup 0} mixing parameters through a time-dependent amplitude analysis of the Dalitz plots of D{sup 0} {yields} K{sub S}{sup 0}{pi}{sup +}{pi}{sup -} and, for the first time, D{sup 0} {yields} K{sub S}{sup 0}K{sup +}K{sup -} decays. The low-momentum pion {pi}{sub s}{sup +} in the decay D*{sup +} {yields} D{sup 0}{pi}{sub s}{sup +} identifies the flavor of the neutral D meson at its production. Using 468.5 fb{sup -1} of e{sup +}e{sup -} colliding-beam data recorded near {radical}s = 10.6 GeV by the BABAR detector at the PEP-II asymmetric-energy collider at SLAC, we measure the mixing parameters x = [1.6 {+-} 2.3 (stat.) {+-} 1.2 (syst.) {+-} 0.8 (model)] x 10{sup -3}, and y = [5.7 {+-} 2.0 (stat.) {+-} 1.3 (syst.) {+-} 0.7 (model)] x 10{sup -3}. These results provide the best measurement to date of x and y. The knowledge of the value of x, in particular, is crucial for understanding the origin of mixing.

del Amo Sanchez, P.; Lees, J.P.; Poireau, V.; Prencipe, E.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Martinelli, M.; Palano, A.; Pappagallo, M.; /Bari U. /INFN, Bari; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Battaglia, M.; Brown, D.N.; Hooberman, B.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G.; Osipenkov, I.L.; Tanabe, T.; /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UC, Riverside /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /Ferrara U. /INFN, Ferrara /Frascati /Columbus Supercond., Genova /INFN, Genoa /Indian Inst. Tech., Guwahati /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa State U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Mainz U., Inst. Kernphys. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /Consorzio Milano Ricerche /INFN, Milan /Mississippi U. /Montreal U. /Napoli Seconda U. /INFN, Naples /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /Padua U. /INFN, Padua /Paris U., VI-VII /Perugia U. /INFN, Perugia /INFN, Pisa /Princeton U. /Banca di Roma /INFN, Rome /Rostock U. /Rutherford /DAPNIA, Saclay /SLAC /South Carolina U. /Southern Methodist U. /Stanford U., Phys. Dept. /SUNY, Albany /Tel Aviv U. /Tennessee U. /Texas U. /Texas U., Dallas /Turin U. /INFN, Turin /Trieste U. /INFN, Trieste /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison



Mycologia, 96(4), 2004, pp. 866878. 2004 by The Mycological Society of America, Lawrence, KS 66044-8897  

E-Print Network (OSTI)

66044-8897 Two new Ophiostoma species with Sporothrix anamorphs from Austria and Azerbaijan Dilzara N with Sporothrix anamorphs recently collected in Austria and Azerbaijan. The isolates were charac- terized based and Azerbaijan. Growth at 25 C and morphology revealed some differences between the two groups, and supported



Gasoline and Diesel Fuel Update (EIA)

accomplishments accomplishments are impressive in themselves, and associ- ated with each milestone is the expansion of future produc- tion opportunities as another technical barrier is overcome. The extension of recovery opportunities into deep water has established the deep offshore as an area of considerable national significance. A second source of increased supply is gas from coalbed formations. Natural gas production from coalbed methane fields continued to grow in 1996 as projects initiated mainly in the early to mid 1990's matured through the dewatering phase into higher rates of gas production. Coalbed forma- tions contribute almost 1 trillion cubic feet, roughly 5 per- cent, to total U.S. production. Continued production growth from coalbeds is not likely in light of the precipitous drop in new wells completed in coalbed formations since the termination of the production tax


Mycologia, 96(3), 2004, pp. 548557. 2004 by The Mycological Society of America, Lawrence, KS 66044-8897  

E-Print Network (OSTI)

exorientia. Rhizoidaceae structurae absentes. Stip- ites erectus, pallide brunnei vel atro-brunnei, 1



Annual Energy Outlook 2012 (EIA)

857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 15. Average City Gate Price of Natural...


Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management


Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","ng_prod_whv_a_epg0_vgm_mmcf_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/ng/ng_prod_whv_a_epg0_vgm_mmcf_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"12/19/2013 6:54:27 AM" "Back to Contents","Data 1: Natural Gas Marketed Production " "Sourcekey","N9050US2","N9050FX2","N9050AL2","N9050AK2","N9050AZ2","N9050AR2","N9050CA2","N9050CO2","N9050FL2","N9050IL2","N9050IN2","N9050KS2","N9050KY2","N9050LA2","N9050MD2","N9050MI2","N9050MS2","N9050MO2","N9050MT2","N9050NE2","N9050NV2","N9050NM2","N9050NY2","N9050ND2","N9050OH2","N9050OK2","N9050OR2","N9050PA2","N9050SD2","N9050TN2","N9050TX2","N9050UT2","N9050VA2","N9050WV2","N9050WY2"



Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:



Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly


Electrochemical Studies of Passive Film Stability on Fe49.7Cr17.7Mn1.9Mo7.4W1.6B15.2C3.8Si2.4 Amorphous Metal in Seawater at 90oCElectrochemical Studies of Passive Film Stability on Fe49.7Cr17.7Mn1.9Mo7.4W1.6B15.2C3.8Si2.4 Amorphous Metal in Seawater at 9  

Science Conference Proceedings (OSTI)

An iron-based amorphous metal, Fe{sub 49.7}Cr{sub 17.7}Mn{sub 1.9}Mo{sub 7.4}W{sub 1.6}B{sub 15.2}C{sub 3.8}Si{sub 2.4} (SAM2X5), with very good corrosion resistance was developed. This material was prepared as a melt-spun ribbon, as well as gas atomized powder and a thermal-spray coating. During electrochemical testing in several environments, including seawater at 90 C, the passive film stability was found to be comparable to that of high-performance nickel-based alloys, and superior to that of stainless steels, based on electrochemical measurements of the passive film breakdown potential and general corrosion rates. This material also performed very well in standard salt fog tests. Chromium (Cr), molybdenum (Mo) and tungsten (W) provided corrosion resistance, and boron (B) enabled glass formation. The high boron content of this particular amorphous metal made it an effective neutron absorber, and suitable for criticality control applications. This material and its parent alloy maintained corrosion resistance up to the glass transition temperature, and remained in the amorphous state during exposure to relatively high neutron doses.

Farmer, J C; Haslam, J; Day, S D; Lian, T; Saw, C K; Hailey, P D; Choi, J S; Rebak, R B; Yang, N; Payer, J H; Perepezko, J H; Hildal, K; Lavernia, E J; Ajdelsztajn, L; Branagan, D J; Buffa, E J; Aprigliano, L F




DOE Patents (OSTI)

A reactor fuel element comprising a gamma-phase alloy consisting of 11 to 16 wt.% of molyhdenum and the balance uranium, annealed between 350 and 525 deg C and quenched to preserve the gamma phase, is reported.

McGeary, R.K.; Justusson, W.M.


Note: This page contains sample records for the topic "ks mi mo" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


U-Mo Corrosion Testing and Characterization  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Nanocrystalline SiC and Ti Nanocrystalline SiC and Ti 3 SiC 2 Alloys for Reactor Materials Chuck Henager, Jr. - PI Co-PIs - Nghiep Nguyen, Yongsoon Shin, Kyle Alvine, Weilin Jiang Tech Interns - Tim Roosendaal, Brennan Borlaug, Shelly Arreguin Description of Project Explore the development of a dense SiC-alloy with Ti 3 SiC 2 having high thermal conductivity, high strength, and good fracture toughness SiC-alloy based on displacement reactions used for SiC joining TiC + Si = Ti 3 SiC 2 Novel use of textured Carbon nanotube (CNT) mats for thermal conductivity and fracture toughness Nano and micro imprinting techniques Nanocrystalline SiC from polycarbosilane polymers, SiC-filled and unfilled Computational models for theory and for experimental guidance Further development of EMTA code for thermal conductivity and


May 22, 2011 Joplin, MO Tornado Study  

Science Conference Proceedings (OSTI)

... (residential or small business) or FEMA 361 (community) safe room ... (Sources: Joplin/Jasper County Emergency Management Agency and FEMA) ...



Release on M&O Selection Final  

NLE Websites -- All DOE Office Websites (Extended Search)

CARLSBAD, N.M., April 20, 2012 - The U.S. Department of Energy (DOE) announced today that Nuclear Waste Partnership LLC (members comprised of URS Energy & Construction, Inc., of...


Quantification of corrosion resistance of a new-class of criticality control materials: thermal-spray coatings of high-boron iron-based amorphous metals - Fe49.7Cr17.7Mn1.9Mo7.4W1.6B15.2C3.8Si2.4  

Science Conference Proceedings (OSTI)

An iron-based amorphous metal, Fe{sub 49.7}Cr{sub 17.7}Mn{sub 1.9}Mo{sub 7.4}W{sub 1.6}B{sub 15.2}C{sub 3.8}Si{sub 2.4} (SAM2X5), with very good corrosion resistance was developed. This material was produced as a melt-spun ribbon, as well as gas atomized powder and a thermal-spray coating. Chromium (Cr), molybdenum (Mo) and tungsten (W) provided corrosion resistance, and boron (B) enabled glass formation. The high boron content of this particular amorphous metal made it an effective neutron absorber, and suitable for criticality control applications. Earlier studies have shown that ingots and melt-spun ribbons of these materials have good passive film stability in these environments. Thermal spray coatings of these materials have now been produced, and have undergone a variety of corrosion testing, including both atmospheric and long-term immersion testing. The modes and rates of corrosion have been determined in the various environments, and are reported here.

Farmer, J C; Choi, J S; Shaw, C K; Rebak, R; Day, S D; Lian, T; Hailey, P; Payer, J H; Branagan, D J; Aprigliano, L F



Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P



St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...


Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...



owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION



Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as



Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake


Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)


Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael




E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.



E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.


Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...


Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...


Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...


Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...


Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...


Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...

Note: This page contains sample records for the top