Powered by Deep Web Technologies
Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

Scottsdale, AZ  

Science Conference Proceedings (OSTI)

... Vice President, Communications, and Chief Marketing Officer, Henry ... Sonora Quest Laboratories Rose Glenn Arizona State Award ... Scottsdale, AZ d ...

2012-10-12T23:59:59.000Z

2

Tucson, AZ  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0 0 Tucson, AZ New coal technologies could lower utility costs By Richaed T. Newesnb lee uf( Engineerlng, and the national posslblity orst lest doubllng the with Its reactor safty and wast dis tility deregulallun hls laborstorlee, such as Los Alasn, net efficiency of cool-bMed power towal problemas. ralied public concerns conlinr the easiteoce of Innovative generetion while at the ame time The mpUctlons In all ofthis for bhout meneng the demunds solutlon in the form of low- and producing a ream of carbon dior- Arlaoes are tignlfcant. Our state for electricity t remaonable cot In zero emlsslon dclan coal (ZEC) tch- Ide that can be aely and poertu has both a wU-elenblhd coal growing states such Arizona with- nolngle. nently sequestered urndrgrouwmL ndustry and a reputatlon for clean

3

Category:Wichita, KS | Open Energy Information  

Open Energy Info (EERE)

KS KS Jump to: navigation, search Go Back to PV Economics By Location Media in category "Wichita, KS" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Wichita KS Westar Energy Inc.png SVFullServiceRestauran... 60 KB SVHospital Wichita KS Westar Energy Inc.png SVHospital Wichita KS ... 64 KB SVLargeHotel Wichita KS Westar Energy Inc.png SVLargeHotel Wichita K... 59 KB SVLargeOffice Wichita KS Westar Energy Inc.png SVLargeOffice Wichita ... 64 KB SVMediumOffice Wichita KS Westar Energy Inc.png SVMediumOffice Wichita... 62 KB SVMidriseApartment Wichita KS Westar Energy Inc.png SVMidriseApartment Wic... 61 KB SVOutPatient Wichita KS Westar Energy Inc.png SVOutPatient Wichita K... 62 KB SVPrimarySchool Wichita KS Westar Energy Inc.png

4

Category:Goodland, KS | Open Energy Information  

Open Energy Info (EERE)

KS KS Jump to: navigation, search Go Back to PV Economics By Location Media in category "Goodland, KS" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Goodland KS Westar Energy Inc.png SVFullServiceRestauran... 60 KB SVHospital Goodland KS Westar Energy Inc.png SVHospital Goodland KS... 63 KB SVLargeHotel Goodland KS Westar Energy Inc.png SVLargeHotel Goodland ... 59 KB SVLargeOffice Goodland KS Westar Energy Inc.png SVLargeOffice Goodland... 65 KB SVMediumOffice Goodland KS Westar Energy Inc.png SVMediumOffice Goodlan... 63 KB SVMidriseApartment Goodland KS Westar Energy Inc.png SVMidriseApartment Goo... 60 KB SVOutPatient Goodland KS Westar Energy Inc.png SVOutPatient Goodland ... 63 KB SVPrimarySchool Goodland KS Westar Energy Inc.png

5

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use

6

Category:Tucson, AZ | Open Energy Information  

Open Energy Info (EERE)

Tucson, AZ Tucson, AZ Jump to: navigation, search Go Back to PV Economics By Location Media in category "Tucson, AZ" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Tucson AZ Arizona Public Service Co.png SVFullServiceRestauran... 75 KB SVHospital Tucson AZ Arizona Public Service Co.png SVHospital Tucson AZ A... 88 KB SVLargeHotel Tucson AZ Arizona Public Service Co.png SVLargeHotel Tucson AZ... 82 KB SVLargeOffice Tucson AZ Arizona Public Service Co.png SVLargeOffice Tucson A... 86 KB SVMediumOffice Tucson AZ Arizona Public Service Co.png SVMediumOffice Tucson ... 75 KB SVMidriseApartment Tucson AZ Arizona Public Service Co.png SVMidriseApartment Tuc... 73 KB SVOutPatient Tucson AZ Arizona Public Service Co.png SVOutPatient Tucson AZ...

7

Category:Phoenix, AZ | Open Energy Information  

Open Energy Info (EERE)

AZ AZ Jump to: navigation, search Go Back to PV Economics By Location Media in category "Phoenix, AZ" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Phoenix AZ Arizona Public Service Co.png SVFullServiceRestauran... 75 KB SVHospital Phoenix AZ Arizona Public Service Co.png SVHospital Phoenix AZ ... 88 KB SVLargeHotel Phoenix AZ Arizona Public Service Co.png SVLargeHotel Phoenix A... 85 KB SVLargeOffice Phoenix AZ Arizona Public Service Co.png SVLargeOffice Phoenix ... 87 KB SVMediumOffice Phoenix AZ Arizona Public Service Co.png SVMediumOffice Phoenix... 75 KB SVMidriseApartment Phoenix AZ Arizona Public Service Co.png SVMidriseApartment Pho... 73 KB SVOutPatient Phoenix AZ Arizona Public Service Co.png SVOutPatient Phoenix A...

8

Category:Flagstaff, AZ | Open Energy Information  

Open Energy Info (EERE)

AZ AZ Jump to: navigation, search Go Back to PV Economics By Location Media in category "Flagstaff, AZ" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Flagstaff AZ Salt River Project.png SVFullServiceRestauran... 70 KB SVHospital Flagstaff AZ Salt River Project.png SVHospital Flagstaff A... 83 KB SVLargeHotel Flagstaff AZ Salt River Project.png SVLargeHotel Flagstaff... 77 KB SVLargeOffice Flagstaff AZ Salt River Project.png SVLargeOffice Flagstaf... 83 KB SVMediumOffice Flagstaff AZ Salt River Project.png SVMediumOffice Flagsta... 73 KB SVMidriseApartment Flagstaff AZ Salt River Project.png SVMidriseApartment Fla... 70 KB SVOutPatient Flagstaff AZ Salt River Project.png SVOutPatient Flagstaff... 74 KB SVPrimarySchool Flagstaff AZ Salt River Project.png

9

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Gasoline and Diesel Fuel Update (EIA)

176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY...

10

AZ Biodiesel | Open Energy Information  

Open Energy Info (EERE)

AZ Biodiesel AZ Biodiesel Jump to: navigation, search Name AZ Biodiesel Place Chandler, Arizona Zip 85225 Product AZ Biodiesel is a biodiesel producer that announced plans in July 2008 to relocate and reopen its main processing facility to Gilbert, Arizona. Coordinates 32.307977°, -95.479539° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":32.307977,"lon":-95.479539,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

11

Douglas, AZ Natural Gas Pipeline Exports to Mexico (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) Douglas, AZ Natural Gas Pipeline Exports to Mexico (Million Cubic Feet) Douglas, AZ Natural Gas Pipeline Exports to Mexico...

12

Nogales, AZ Natural Gas Pipeline Exports to Mexico (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) Nogales, AZ Natural Gas Pipeline Exports to Mexico (Million Cubic Feet) Nogales, AZ Natural Gas Pipeline Exports to Mexico...

13

US Mnt(S) AZ Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

Mnt(S) AZ Mnt(S) AZ Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US Mnt(S) AZ Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 3,000 6,000 9,000 12,000 15,000 US Mnt(S) AZ Site Consumption kilowatthours $0 $500 $1,000 $1,500 $2,000 US Mnt(S) AZ Expenditures dollars ELECTRICITY ONLY average per household * Arizona households use 66 million Btu of energy per home, 26% less than the U.S. average. * The combination of lower than average site consumption of all energy, but above average electricity which is relatively expensive, results in Arizona households spending 3% less for energy than the U.S. average. * More reliance on air conditioning keeps average site electricity consumption in the state high relative to other parts of the U.S.

14

US Mnt(S) AZ Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

Mnt(S) AZ Mnt(S) AZ Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US Mnt(S) AZ Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 3,000 6,000 9,000 12,000 15,000 US Mnt(S) AZ Site Consumption kilowatthours $0 $500 $1,000 $1,500 $2,000 US Mnt(S) AZ Expenditures dollars ELECTRICITY ONLY average per household * Arizona households use 66 million Btu of energy per home, 26% less than the U.S. average. * The combination of lower than average site consumption of all energy, but above average electricity which is relatively expensive, results in Arizona households spending 3% less for energy than the U.S. average. * More reliance on air conditioning keeps average site electricity consumption in the state high relative to other parts of the U.S.

15

DOE - Office of Legacy Management -- Spencer Chemical Co - KS 0-01  

Office of Legacy Management (LM)

KS 0-01 KS 0-01 FUSRAP Considered Sites Site: SPENCER CHEMICAL CO. (KS.0-01 ) Eliminated from further consideration under FUSRAP - an AEC licensed operation Designated Name: Not Designated Alternate Name: Jayhawk Works KS.0-01-1 Location: Pittsburg , Kansas KS.0-01-1 Evaluation Year: 1985 KS.0-01-2 Site Operations: Processed enriched uranium (UF-6) and scrap to produce primarily uranium dioxide (UO-2) under AEC licenses. KS.0-01-3 KS.0-01-4 Site Disposition: Eliminated - No Authority - AEC licensed KS.0-01-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Normal and Enriched Uranium; Thorium KS.0-01-6 Radiological Survey(s): Yes KS.0-01-5 Site Status: Eliminated from further consideration under FUSRAP - an AEC licensed operation

16

Waste Toolkit A-Z Light bulbs  

E-Print Network (OSTI)

Waste Toolkit A-Z Light bulbs Can I recycle light bulbs? It depends what type of bulbs you have for the `hazardous' symbol on the packaging or on the light bulb (crossed out wheelie bin symbol). How can I recycle light bulbs? Standard filament bulbs Put in the waste bin (landfill waste) as these are not classified

Melham, Tom

17

Waste Toolkit A-Z Battery recycling  

E-Print Network (OSTI)

Waste Toolkit A-Z Battery recycling How can I recycle batteries? The University Safety Office is responsible for arranging battery recycling for departments (see Contact at bottom of page). Colleges must make their own arrangements through a registered hazardous waste carrier. Batteries must not be put

Melham, Tom

18

Tank 241-AZ-102 tank characterization plan  

Science Conference Proceedings (OSTI)

The Defense Nuclear Facilities Safety Board has advised the DOE to concentrate the near-term sampling and analysis activities on identification and resolution of safety issues. The Data Quality Objective (DQO) process was chosen as a tool to be used in the resolution of safety issues. As a result, a revision in the Federal Facilities Agreement and Consent Order (Tri-Party Agreement) milestone M-44 has been made, which states that ``A Tank Characterization Plan (TCP) will also be developed for each double-shell tank (DST) and single-shell tank (SST) using the DQO process ... Development of TCPs by the DQO process is intended to allow users to ensure their needs will be met and that resources are devoted to gaining only necessary information``. This document satisfies that requirement for tank 241-AZ-102 (AZ-102) sampling activities. Tank AZ-102 is currently a non-Watch List tank, so the only DQOs applicable to this tank are the safety screening DQO and the compatibility DQO, as described below. The current contents of Tank AZ-102, as of October 31, 1994, consisted of 3,600 kL (950 kgal) of dilute non-complexed waste and aging waste from PUREX (NCAW, neutralized current acid waste). Tank AZ-102 is expected to have two primary layers. The bottom layer is composed of 360 kL of sludge, and the top layer is composed of 3,240 kL of supernatant, with a total tank waste depth of approximately 8.9 meters.

Schreiber, R.D.

1995-02-06T23:59:59.000Z

19

Tank 241-AZ-101 tank characterization plan  

Science Conference Proceedings (OSTI)

The Defense Nuclear Facilities Safety Board has advised the DOE to concentrate the near-term sampling and analysis activities on identification and resolution of safety issues. The Data Quality Objective (DQO) process was chosen as a tool to be used in the resolution of safety issues. As a result, A revision in the Federal Facilities Agreement and Consent Order (Tri-Party Agreement) milestone M-44 has been made, which states that ``A Tank Characterization Plan (TCP) will also be developed for each double-shell tank (DST) and single-shell tank (SST) using the DQO process. Development of TCPs by the DQO process is intended to allow users to ensure their needs will be met and that resources are devoted to gaining only necessary information``. This document satisfies that requirement for Tank 241-AZ-101 (AZ-101) sampling activities. Tank AZ-101 is currently a non-Watch List tank, so the only DQOs applicable to this tank are the safety screening DQO and the compatibility DQO, as described below. The contents of Tank AZ-101, as of October 31, 1994, consisted of 3,630 kL (960 kgal) of dilute non-complexed waste and aging waste from PUREX (NCAW, neutralized current acid waste). Tank AZ-101 is expected to have two primary layers. The bottom layer is composed of 132 kL of sludge, and the top layer is composed of 3,500 kL of supernatant, with a total tank waste depth of approximately 8.87 meters.

Schreiber, R.D.

1995-02-06T23:59:59.000Z

20

Formation of Vanadate Conversion Coating on AZ31 Magnesium Alloy  

Science Conference Proceedings (OSTI)

In the present investigation, a chromate-free, corrosion-resistant conversion coating using vanadium based solution was applied to AZ31 magnesium alloy.

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

ANALYSIS RESULTS FOR BUILDING 241 702-AZ A TRAIN  

Science Conference Proceedings (OSTI)

This report presents the analyses results for three samples obtained under RPP-PLAN-28509, Sampling and Analysis Plan for Building 241 702-AZ A Train. The sampling and analysis was done in response to problem evaluation request number PER-2004-6139, 702-AZ Filter Rooms Need Radiological Cleanup Efforts.

DUNCAN JB; FRYE JM; COOKE CA; LI SW; BROCKMAN FJ

2006-12-13T23:59:59.000Z

22

241-AZ Farm Annulus Extent of Condition Baseline Inspection  

Science Conference Proceedings (OSTI)

This report provides the results of the comprehensive annulus visual inspection for tanks 241- AZ-101 and 241-AZ-102 performed in fiscal year 2013. The inspection established a baseline covering about 95 percent of the annulus floor for comparison with future inspections. Any changes in the condition are also included in this document.

Engeman, Jason K.; Girardot, Crystal L.; Vazquez, Brandon J.

2013-05-15T23:59:59.000Z

23

702AZ aging waste ventilation facility year 2000 test procedure  

SciTech Connect

This test procedure was developed to determine if the 702AZ Tank Ventilation Facility system is Year 2000 Compliant. The procedure provides detailed instructions for performing the operations necessary and documenting the results. This verification procedure will document that the 702AZ Facility Systems are year 2000 compliant and will correctly meet the criteria established in this procedure.

Winkelman, W.D.

1998-07-22T23:59:59.000Z

24

Tank 241-AZ-101 and Tank 241-AZ-102 Airlift Circulator Operation Vapor Sampling and Analysis Plan  

DOE Green Energy (OSTI)

This sampling and analysis plan (SAP) identifies characterization objectives pertaining to sample collection, laboratory analytical evaluation, and reporting requirements for vapor samples obtained during the operation of the tank 241-AZ-101 and 241-AZ-102 airlift circulators (ALCs) and during the initial operation (''bump'') of the tank 241-AZ-101 mixer pumps. The purpose of the ALC operation is to support portions of the operational test procedure (OTP) for Project W-030 (OTP-W030-001) and to perform functional test in support of Project W-151. Project W-030 is the 241-A-702 ventilation upgrade project (241-142-702) and Project W-151 is the 241-AZ-101 Mixer Pump Test. The functional tests will check the operability of the tank 241-AZ-101 ALCs. Process Memo's No. 2E98-082 and No. 2E99-001 (LMHC 1999a, LMHC 1999b) direct the operation of the ALCs and the Industrial Hygiene monitoring respectively. A series of tests will be conducted in which the ALCs in tanks 241-AZ-101 and 241-AZ-102 will be operated at different air flow rates. Vapor samples will be obtained to determine constituents that may be present in the tank headspace during ALC operation at tanks 241-AZ-101 and 241-AZ-102 as the waste is disturbed. During the testing, vapor samples will be obtained from the headspace of tanks 241-AZ-101 and 241-AZ-102 via the unused port on the standard hydrogen monitoring system (SHMS). In addition the last two vapor samples will be collected from the headspace of tank 241-AZ-101 during the operation of the mixer pumps. Each mixer pump will be operated for approximately 5 minutes. Results will be used to provide the waste feed delivery program with environmental air permitting data for tank waste disturbing activities. Because of radiological concerns, the samples will be filtered for particulates. It is recognized that this may remove some organic compounds. The following sections provide the general methodology and procedures to be used in the preparation, retrieval, transport, analysis, and reporting of results from vapor samples retrieved during the ALC testing.

TEMPLETON, A.M.

1999-12-07T23:59:59.000Z

25

Enhancing Tensile and Compressive Strength of AZ41 Magnesium ...  

Science Conference Proceedings (OSTI)

Al and 1 wt.% Al with 1.5 vol.% nano-sized Al2O3 (50 nm) particulates in to AZ31 magnesium alloy, respectively, using disintegrated melt deposition technique.

26

Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...

27

US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

28

US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

29

RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.

30

Influence of Cerium on Stress Corrosion Cracking in AZ91D  

Science Conference Proceedings (OSTI)

This paper considers the effect of cerium additions on the stress corrosion cracking in the Mg-Al-Zn alloy AZ91D. The two dominant phases in the AZ91D...

31

City of Williams - AZ, Arizona (Utility Company) | Open Energy Information  

Open Energy Info (EERE)

Williams - AZ, Arizona (Utility Company) Williams - AZ, Arizona (Utility Company) Jump to: navigation, search Name City of Williams - AZ Place Arizona Utility Id 56535 Utility Location Yes Ownership M NERC Location WECC NERC WECC Yes Activity Buying Transmission Yes Activity Distribution Yes Activity Buying Distribution Yes References EIA Form EIA-861 Final Data File for 2010 - File1_a[1] LinkedIn Connections CrunchBase Profile No CrunchBase profile. Create one now! This article is a stub. You can help OpenEI by expanding it. Utility Rate Schedules Grid-background.png City owned Lights(20,000 Lumens,400 W MV-Pole) Lighting City owned Lights(4,000 Lumens-Pole) Lighting City owned Lights(7,000 Lumens, 175 W MV-Pole) Lighting Customer owned Lights(20,000 Lumens 400 W MV-Pole) Commercial Customer owned Lights(4,000 Lumens-Pole) Lighting

32

AZ-101 Mixer Pump Test Qualification Test Procedures (QTP)  

SciTech Connect

Describes the Qualification test procedure for the AZ-101 Mixer Pump Data Acquisition System (DAS). The purpose of this Qualification Test Procedure (QTP) is to confirm that the AZ-101 Mixer Pump System has been properly programmed and hardware configured correctly. This QTP will test the software setpoints for the alarms and also check the wiring configuration from the SIMcart to the HMI. An Acceptance Test Procedure (ATP), similar to this QTP will be performed to test field devices and connections from the field.

THOMAS, W.K.

2000-01-10T23:59:59.000Z

33

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. ...

34

A new limit on the CP violating decay KS -> 3pi0 with the KLOE experiment  

E-Print Network (OSTI)

We have carried out a new direct search for the CP violating decay KS -> 3pi0 with 1.7 fb^-1 of e+e- collisions collected by the KLOE detector at the phi-factory DAFNE. We have searched for this decay in a sample of about 5.9 x 10^8 KS KL events tagging the KS by means of the KL interaction in the calorimeter and requiring six prompt photons. With respect to our previous search, the analysis has been improved by increasing of a factor four the tagged sample and by a more effective background rejection of fake KS tags and spurious clusters. We find no candidates in data and simulated background samples, while we expect 0.12 standard model events. Normalizing to the number of KS -> 2pi0 events in the same sample, we set the upper limit on BR(KS -> 3pi0 < 2.6 x 10^-8 at 90% C.L., five times lower than the previous limit. We also set the upper limit on the eta_000 parameter, |eta_000 | < 0.0088 at 90% C.L., improving by a factor two the latest direct measurement.

Babusci, D; Balwierz-Pytko, I; Bencivenni, G; Bini, C; Bloise, C; Bossi, F; Branchini, P; Budano, A; Balkestahl, L Caldeira; Capon, G; Ceradini, F; Ciambrone, P; Curciarello, F; Czerwinski, E; Dane, E; De Leo, V; De Lucia, E; De Robertis, G; De Santis, A; Di Domenico, A; Di Donato, C; Di Salvo, R; Domenici, D; Erriquez, O; Fanizzi, G; Fantini, A; Felici, G; Fiore, S; Franzini, P; Gauzzi, P; Giardina, G; Giovannella, S; Gonnella, F; Graziani, E; Happacher, F; Heijkenskjold, L; Hoistad, B; Iafolla, L; Jacewicz, M; Johansson, T; Kacprzak, K; Kupsc, A; Lee-Franzini, J; Leverington, B; Loddo, F; Loffredo, S; Mandaglio, G; Martemianov, M; Martini, M; Mascolo, M; Messi, R; Miscetti, S; Morello, G; Moricciani, D; Moskal, P; Nguyen, F; Passeri, A; Patera, V; Longhi, I Prado; Ranieri, A; Redmer, C F; Santangelo, P; Sarra, I; Schioppa, M; Sciascia, B; Silarski, M; Taccini, C; Tortora, L; Venanzoni, G; Wislicki, W; Wolke, M; Zdebik, J

2013-01-01T23:59:59.000Z

35

Nogales, AZ Liquefied Natural Gas Exports to Mexico (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Million Cubic Feet) Nogales, AZ Liquefied Natural Gas Exports to Mexico (Million Cubic Feet) Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2012 8.938 8.916 5.241 3.570 4.280...

36

Mixer pump test plan for double shell tank AZ-101  

Science Conference Proceedings (OSTI)

Mixer pump systems have been chosen as the method for retrieval of tank wastes contained in double shell tanks at Hanford. This document describes the plan for testing and demonstrating the ability of two 300 hp mixer pumps to mobilize waste in tank AZ-101. The mixer pumps, equipment and instrumentation to monitor the test were installed by Project W-151.

STAEHR, T.W.

1999-05-12T23:59:59.000Z

37

Control of Well Ks-8 in the Kilauea Lower East Rift Zone | Open Energy  

Open Energy Info (EERE)

of Well Ks-8 in the Kilauea Lower East Rift Zone of Well Ks-8 in the Kilauea Lower East Rift Zone Jump to: navigation, search OpenEI Reference LibraryAdd to library Conference Paper: Control of Well Ks-8 in the Kilauea Lower East Rift Zone Abstract In June 1991, a well located in Hawaii kicked and unloaded at 3,476 ft (1,059 m). This well was estimatedto have a possible bottomhole temperature of 650°F (343°C)and a reservoir pressure approaching 2,300 psi 5,858 Immediate attempts to kill the well were unsuccessful, and the long processof well control was started. Besides the harsh geological and reservoir conditions encountered,the scarce availability of materials in a remote location and long distance transportation of necessary equipment figured heavily in to the time delay of the final kill procedure of the

38

DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility

39

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed

40

241-AZ Tank Farm Construction Extent of Condition Review for Tank Integrity  

SciTech Connect

This report provides the results of an extent of condition construction history review for tanks 241-AZ-101 and 241-AZ-102. The construction history of the 241-AZ tank farm has been reviewed to identify issues similar to those experienced during tank AY-102 construction. Those issues and others impacting integrity are discussed based on information found in available construction records, using tank AY-102 as the comparison benchmark. In the 241-AZ tank farm, the second DST farm constructed, both refractory quality and tank and liner fabrication were improved.

Barnes, Travis J.; Boomer, Kayle D.; Gunter, Jason R.; Venetz, Theodore J.

2013-07-30T23:59:59.000Z

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A-Z Topics lists topics with relevance to a broad cross-section of our Web site's audiences. The items are representative of popular topics or publications, ...

42

Safety analysis for tank 241-AZ-101 mixer pump process test  

Science Conference Proceedings (OSTI)

This document establishes the safety envelope for Project W-151,the process test of two mixer pumps in AWF waste tank 241-AZ-101.

Milliken, N.J., Westinghouse Hanford

1996-08-01T23:59:59.000Z

43

ICME Modeling of a Super Vacuum Die Cast (SVDC) AZ91 ...  

Science Conference Proceedings (OSTI)

... of a super vacuum die cast (SVDC) AZ91 automotive shock tower component. .... PI-7: A Three-dimensional Lattice Boltzmann Model for Columnar Dendrite...

44

MI  

NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)

45

COUNTRY INSTITUTION DATE WEB ADDRESS AZERBAIJAN Azerbaijan Medical University 15.03.2011 http://amu.edu.az/  

E-Print Network (OSTI)

COUNTRY INSTITUTION DATE WEB ADDRESS AZERBAIJAN Azerbaijan Medical University 15.03.2011 http://amu.edu.az/ AZERBAIJAN Baku State University 23.09.2011 http://bsu.edu.az/en/ AZERBAIJAN University of Architecture

Di Pillo, Gianni

46

Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper

2012-02-20T23:59:59.000Z

47

File:USDA-CE-Production-GIFmaps-KS.pdf | Open Energy Information  

Open Energy Info (EERE)

KS.pdf KS.pdf Jump to: navigation, search File File history File usage Kansas Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 317 KB, MIME type: application/pdf) Description Kansas Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Kansas External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:14, 27 December 2010 Thumbnail for version as of 16:14, 27 December 2010 1,650 × 1,275 (317 KB) MapBot (Talk | contribs) Automated bot upload

48

DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4

49

DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

50

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...

51

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...

52

DOE Challenge Home Case Study, Mandalay Homes, Phoenix, AZ, Affordable  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mandalay Mandalay Homes Phoenix, AZ BUILDING TECHNOLOGIES OFFICE DOE Challenge Home builders are in the top 1% of builders in the country meeting the extraordinary levels of excellence and quality specifi ed by the U.S. Department of Energy. Every DOE Challenge Home starts with ENERGY STAR for Homes Version 3 for an energy-effi cient home built on a solid foundation of building science research. Then, even more advanced technologies are designed in for a home that goes above and beyond current code to give you the superior quality construction, HVAC, appliances, indoor air quality, safety, durability, comfort, and solar-ready components along with ultra-low or no utility bills. This provides homeowners with a quality home that will last for generations to come.

53

Influence of Aluminum Content on Grain Refinement and Strength of AZ31 Magnesium GTA Weld Metal  

SciTech Connect

The goal is to characterize the effect of Al content on AZ31 weld metal, the grain size and strength, and examine role of Al on grain refinement. The approach is to systematically vary the aluminum content of AZ31 weld metal, Measure average grain size in weld metal, and Measure cross-weld tensile properties and hardness. Conclusions are that: (1) increased Al content in AZ31 weld metal results in grain refinement Reason: higher undercooling during solidification; (2) weld metal grain refinement resulted in increased strength & hardness Reason: grain boundary strengthening; and (3) weld metal strength can be raised to wrought base metal levels.

Babu, N. Kishore [Singapore Institute of Manufacturing Technology; Cross, Carl E. [Los Alamos National Laboratory

2012-06-28T23:59:59.000Z

54

DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.

55

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either

56

DOE - Office of Legacy Management -- Monument Valley Mill Site - AZ 0-01  

Office of Legacy Management (LM)

Monument Valley Mill Site - AZ 0-01 Monument Valley Mill Site - AZ 0-01 FUSRAP Considered Sites Site: Monument Valley Mill Site (AZ.0-01) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: Also see Monument Valley, Arizona, Processing Site Documents Related to Monument Valley Mill Site Data Validation Package for the June 2009 Water Sampling at the Monument Valley, Arizona, Processing Site; LMS/MON/S0609; October 2009 Natural and Enhanced Attenuation of Soil and Ground Water at Monument Valley, Arizona, and Shiprock, New Mexico 2006 Status Report June 2008 Data Validation Package for 2007 Groundwater Sampling at the Monument Valley, AZ Processing Site

57

A Review on Severe Plastic Deformation of the Magnesium Alloy AZ31  

Science Conference Proceedings (OSTI)

... Ukraine, Poland, Korea, Iran, Israel and China. In this paper an effort is made to review the work done on AZ31 using SPD processes to improve its properties.

58

System Description for Tank 241-AZ-101 Waste Retrieval Data Acquisition System  

SciTech Connect

The proposed activity provides the description of the Data Acquisition System for Tank 241-AZ-101. This description is documented in HNF-5572, Tank 241-AZ-101 Waste Retrieval Data Acquisition System (DAS). This activity supports the planned mixer pump tests for Tank 241-AZ-101. Tank 241-AZ-101 has been selected for the first full-scale demonstration of a mixer pump system. The tank currently holds over 960,000 gallons of neutralized current acid waste, including approximately 12.7 inches of settling solids (sludge) at the bottom of the tank. As described in Addendum 4 of the FSAR (LMHC 2000a), two 300 HP mixer pumps with associated measurement and monitoring equipment have been installed in Tank 241-AZ-101. The purpose of the Tank 241-AZ-101 retrieval system Data Acquisition System (DAS) is to provide monitoring and data acquisition of key parameters in order to confirm the effectiveness of the mixer pumps utilized for suspending solids in the tank. The suspension of solids in Tank 241-AZ-101 is necessary for pretreatment of the neutralized current acid waste and eventual disposal as glass via the Hanford Waste Vitrification Plant. HNF-5572 provides a basic description of the Tank 241-AZ-101 retrieval system DAS, including the field instrumentation and application software. The DAS is provided to fulfill requirements for data collection and monitoring. This document is not an operations procedure or is it intended to describe the mixing operation. This USQ screening provides evaluation of HNF-5572 (Revision 1) including the changes as documented on ECN 654001. The changes include (1) add information on historical trending and data backup, (2) modify DAS I/O list in Appendix E to reflect actual conditions in the field, and (3) delete IP address in Appendix F per Lockheed Martin Services, Inc. request.

ROMERO, S.G.

2000-02-14T23:59:59.000Z

59

Final results of double-shell tank 241-AZ-101 ultrasonic inspection  

SciTech Connect

This document presents the results and documentation of the nondestructive ultrasonic examination of tank 241-AZ-101. A tank inspection supplier was retained to provide and use an ultrasonic examination system (equipment, procedures, and inspectors) to scan a limited area of double-shell tank 241-AZ-101 primary tank wall and welds. The inspection found one reportable indication of thinning and no reportable pitting, corrosion, or cracking.

JENSEN, C.E.

1999-08-23T23:59:59.000Z

60

DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated

62

Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...

63

Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY

64

Benchmarks for the New-Physics Search through CP Violation in B^0->pi^0 K_S  

E-Print Network (OSTI)

Using isospin relations, we predict the Standard-Model correlation between S_{pi^0 K_S}=(sin 2beta)_{pi^0 K_S} and A_{pi^0 K_S}, the mixing-induced and direct CP asymmetries of B^0-> pi^0 K_S. The calculation uses flavour SU(3) only to fix the isospin-3/2 amplitude through the B^\\pm->pi^\\pm pi^0 branching ratio, and thus has a small irreducible theoretical error. It can reach percent level precision thanks to expected future lattice-QCD progress for the calculation of the relevant SU(3)-breaking form-factor ratio, and serves as a benchmark for new-physics searches. We obtain an interesting picture in the A_{pi^0 K_S} - S_{pi^0 K_S} plane, where the current experimental data show a discrepancy with the Standard Model, and comment on the direct CP asymmetries of B^0->pi^-K^+ and B^+ -> pi^0 K^+. A modified electroweak penguin with a large new CP-violating phase can explain the discrepancy and allows us to accommodate also the corresponding data for other b->s penguin-dominated decays.

Robert Fleischer; Sebastian Jager; Dan Pirjol; Jure Zupan

2008-06-18T23:59:59.000Z

65

C:\\ANNUAL\\VENTCHAP.V8\\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

4 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99...

66

C:\\ANNUAL\\VENTCHAP.V8\\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

0 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy...

67

NGA98fin5.vp  

Annual Energy Outlook 2012 (EIA)

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99...

68

MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab

2008-10-01T23:59:59.000Z

69

DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

70

Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)

2012-01-01T23:59:59.000Z

71

DOE - Office of Legacy Management -- Tuba City Mill Site - AZ 0-02  

Office of Legacy Management (LM)

Mill Site - AZ 0-02 Mill Site - AZ 0-02 FUSRAP Considered Sites Site: Tuba City Mill Site (AZ.0-02 ) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: Also see Tuba City, Arizona, Disposal Site Documents Related to Tuba City Mill Site 2012 Annual Site Inspection and Monitoring Report for Uranium Mill Tailings Radiation Control Act Title I Disposal Sites-Tuba City, Arizona, Disposal Site. LMS/S09461. February 2013 2008 UMTRCA Title I Annual Report January 2009 Tuba City, Arizona February 2009 Groundwater and Surface Water Sampling at the Tuba City, Arizona Disposal Site May 2009 This fact sheet provides information about the Uranium Mill Tailings

72

DOE Solar Decathlon: News Blog » AZ State/New Mexico  

NLE Websites -- All DOE Office Websites (Extended Search)

AZ State/New Mexico AZ State/New Mexico Below you will find Solar Decathlon news from the AZ State/New Mexico archive, sorted by date. Transportation Issues Challenge Teams on the Second Day of Assembly Tuesday, September 24, 2013 By Richard King On the second day of assembly, everyone seems to be settling in for the long haul. Either they were exhausted from working 18 hours straight on Monday or the adrenalin of the first day excitement had worn off. Either way, there was a constant but steadier pace to the work today. The U.S. Department of Energy Solar Decathlon is a marathon, not a sprint, and the teams understand that. Photo of two decathletes wearing hard hats, safety glasses, and safety vests. Safety is our number one priority. Here, two members of the Vienna University of Technology team display their safety equipment, including

73

EIS-0440: Quartzsite Solar Energy Project, La Paz County, AZ | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

0: Quartzsite Solar Energy Project, La Paz County, AZ 0: Quartzsite Solar Energy Project, La Paz County, AZ EIS-0440: Quartzsite Solar Energy Project, La Paz County, AZ Summary This EIS evaluates the environmental impacts of interconnecting a proposed 100-megawatt concentrating solar power plant to Western's Bouse-Kofa 161-kilovolt transmission line. The proposal includes amending the Bureau of Land Management Resource Management Plan. Cooperating agencies in the preparation of this EIS are Bureau of Land Management (Yuma Field Office ), U.S. Army Corps of Engineers, U.S. Army Garrison (Yuma Proving Grounds), Arizona Game and Fish Department, and the Arizona Department of Environmental Quality. Further information is available for this Project on the Western Area Power Administration Website Public Comment Opportunities

74

Tank 241-AZ-101 Mixer Pump Test Vapor Sampling and Analysis Plan  

Science Conference Proceedings (OSTI)

This sampling and analysis plan (SAP) identifies characterization objectives pertaining to sample collection, laboratory analytical evaluation, and reporting requirements for vapor samples obtained during the operation of mixer pumps in tank 241-AZ-101. The primary purpose of the mixer pump test (MPT) is to demonstrate that the two 300 horsepower mixer pumps installed in tank 241-AZ-101 can mobilize the settled sludge so that it can be retrieved for treatment and vitrification. Sampling will be performed in accordance with Tank 241-AZ-101 Mixer Pump Test Data Quality Objective (Banning 1999) and Data Quality Objectives for Regulatory Requirements for Hazardous and Radioactive Air Emissions Sampling and Analysis (Mulkey 1999). The sampling will verify if current air emission estimates used in the permit application are correct and provide information for future air permit applications.

TEMPLETON, A.M.

2000-03-06T23:59:59.000Z

75

Tank 241-AZ-101 Mixer Pump Test Vapor Sampling and Analysis Plan  

Science Conference Proceedings (OSTI)

This sampling and analysis plan (SAP) identifies characterization objectives pertaining to sample collection, laboratory analytical evaluation, and reporting requirements for vapor samples obtained during the operation of mixer pumps in tank 241-AZ-101. The primary purpose of the mixer pump test (MPT) is to demonstrate that the two 300 horsepower mixer pumps installed in tank 241-AZ-101 can mobilize the settled sludge so that it can be retrieved for treatment and vitrification. Sampling will be performed in accordance with Tank 241-AZ-101 Mixer Pump Test Data Quality Objective (Banning 1999) and Data Quality Objectives for Regulatory Requirements for Hazardous and Radioactive Air Emissions Sampling and Analysis (Mulkey 1999). The sampling will verify if current air emission estimates used in the permit application are correct and provide information for future air permit applications.

TEMPLETON, A.M.

2000-04-10T23:59:59.000Z

76

Tank 241-AZ-101 Mixer Pump Test Vapor Sampling and Analysis Plan  

SciTech Connect

This sampling and analysis plan (SAP) identifies characterization objectives pertaining to sample collection, laboratory analytical evaluation, and reporting requirements for vapor samples obtained during the operation of mixer pumps in tank 241-AZ-101. The primary purpose of the mixer pump test (MPT) is to demonstrate that the two 300 horsepower mixer pumps installed in tank 241-AZ-101 can mobilize the settled sludge so that it can be retrieved for treatment and vitrification Sampling will be performed in accordance with Tank 241-AZ-101 Mixer Pump Test Data Quality Objective (Banning 1999) and Data Quality Objectives for Regulatory Requirements for Hazardous and Radioactive Air Emissions Sampling and Analysis (Mulkey 1999). The sampling will verify if current air emission estimates used in the permit application are correct and provide information for future air permit applications.

TEMPLETON, A.M.

2000-01-31T23:59:59.000Z

77

EIS-0440: Quartzsite Solar Energy Project, La Paz County, AZ | Department  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

40: Quartzsite Solar Energy Project, La Paz County, AZ 40: Quartzsite Solar Energy Project, La Paz County, AZ EIS-0440: Quartzsite Solar Energy Project, La Paz County, AZ Summary This EIS evaluates the environmental impacts of interconnecting a proposed 100-megawatt concentrating solar power plant to Western's Bouse-Kofa 161-kilovolt transmission line. The proposal includes amending the Bureau of Land Management Resource Management Plan. Cooperating agencies in the preparation of this EIS are Bureau of Land Management (Yuma Field Office ), U.S. Army Corps of Engineers, U.S. Army Garrison (Yuma Proving Grounds), Arizona Game and Fish Department, and the Arizona Department of Environmental Quality. Further information is available for this Project on the Western Area Power Administration Website Public Comment Opportunities

78

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

79

H2A.Z Acidic Patch Couples Chromatin Dynamics to Regulation of Gene Expression Programs during ESC Differentiation  

E-Print Network (OSTI)

The histone H2A variant H2A.Z is essential for embryonic development and for proper control of developmental gene expression programs in embryonic stem cells (ESCs). Divergent regions of amino acid sequence of H2A.Z likely ...

Subramanian, Vidya

80

Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio

2010-02-01T23:59:59.000Z

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png

82

Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls

83

CESIUM REMOVAL FROM TANKS 241-AN-103 & 241-SX-105 & 241-AZ-101 & 241AZ-102 COMPOSITE FOR TESTING IN BENCH SCALE STEAM REFORMER  

SciTech Connect

This report documents the preparation of three actual Hanford tank waste samples for shipment to the Savannah River National Laboratory (SRNL). Two of the samples were dissolved saltcakes from tank 241-AN-103 (hereafter AN-103) and tank 241-SX-105 (hereafter SX-105); one sample was a supernate composite from tanks 241-AZ-101 and 241-AZ-102 (hereafter AZ-101/102). The preparation of the samples was executed following the test plans LAB-PLAN-10-00006, Test Plan for the Preparation of Samples from Hanford Tanks 241-SX-105, 241-AN-103, 241-AN-107, and LAB-PLN-l0-00014, Test Plan for the Preparation of a Composite Sample from Hanford Tanks 241-AZ-101 and 241-AZ-102 for Steam Reformer Testing at the Savannah River National Laboratory. All procedural steps were recorded in laboratory notebook HNF-N-274 3. Sample breakdown diagrams for AN-103 and SX-105 are presented in Appendix A. The tank samples were prepared in support of a series of treatability studies of the Fluidized Bed Steam Reforming (FBSR) process using a Bench-Scale Reformer (BSR) at SRNL. Tests with simulants have shown that the FBSR mineralized waste form is comparable to low-activity waste glass with respect to environmental durability (WSRC-STI-2008-00268, Mineralization of Radioactive Wastes by Fluidized Bed Steam Reforming (FBSR): Comparisons to Vitreous Waste Forms and Pertinent Durability Testing). However, a rigorous assessment requires long-term performance data from FBSR product formed from actual Hanford tank waste. Washington River Protection Solutions, LLC (WRPS) has initiated a Waste Form Qualification Program (WP-5.2.1-2010-001, Fluidized Bed Steam Reformer Low-level Waste Form Qualification) to gather the data required to demonstrate that an adequate FBSR mineralized waste form can be produced. The documentation of the selection process of the three tank samples has been separately reported in RPP-48824, Sample Selection Process for Bench-Scale Steam Reforming Treatability Studies Using Hanford Waste Samples.

DUNCAN JB; HUBER HJ

2011-04-21T23:59:59.000Z

84

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. G. Gabon Country Energy Profile;

85

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. L. Landfill Gas; Laos Country Energy Profile ;

86

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A. Abbreviations, energy related; About U.S ...

87

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. F. Factors Affecting Natural Gas Prices ...

88

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. D. Daily Spot Prices of Crude Oil; Dealer Tank Wagon ...

89

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. O. Ocean Thermal Energy Conversion ...

90

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A-Z Index. A B C D E F G H I J K L M N O P Q R S T U V W XYZ. A. Abbreviations, energy related; About ...

91

Tank 241-AZ-101 criticality assessment resulting from pump jet mixing: Sludge mixing simulation  

SciTech Connect

Tank 241-AZ-101 (AZ-101) is one of 28 double-shell tanks located in the AZ farm in the Hanford Site`s 200 East Area. The tank contains a significant quantity of fissile materials, including an estimated 9.782 kg of plutonium. Before beginning jet pump mixing for mitigative purposes, the operations must be evaluated to demonstrate that they will be subcritical under both normal and credible abnormal conditions. The main objective of this study was to address a concern about whether two 300-hp pumps with four rotating 18.3-m/s (60-ft/s) jets can concentrate plutonium in their pump housings during mixer pump operation and cause a criticality. The three-dimensional simulation was performed with the time-varying TEMPEST code to determine how much the pump jet mixing of Tank AZ-101 will concentrate plutonium in the pump housing. The AZ-101 model predicted that the total amount of plutonium within the pump housing peaks at 75 g at 10 simulation seconds and decreases to less than 10 g at four minutes. The plutonium concentration in the entire pump housing peaks at 0.60 g/L at 10 simulation seconds and is reduced to below 0.1 g/L after four minutes. Since the minimum critical concentration of plutonium is 2.6 g/L, and the minimum critical plutonium mass under idealized plutonium-water conditions is 520 g, these predicted maximums in the pump housing are much lower than the minimum plutonium conditions needed to reach a criticality level. The initial plutonium maximum of 1.88 g/L still results in safety factor of 4.3 in the pump housing during the pump jet mixing operation.

Onishi, Y.; Recknagle, K.

1997-04-01T23:59:59.000Z

92

,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

93

,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

94

Anemometer Data (Wind Speed, Direction) for Pascua Yaqui, AZ (2003 - 2004)  

Open Energy Info (EERE)

Pascua Yaqui, AZ (2003 - 2004) Pascua Yaqui, AZ (2003 - 2004) Dataset Summary Description Wind data collected from Pascua Yaqui Indian Reservation in Arizona from an anemometer as part of the Native American anemometer loan program. Monthly mean wind speed is available for 2003 through 2004, as is wind direction and turbulence data. Data is reported from a height of 20 m. The data was originally made available by Wind Powering America, a DOE Office of Energy Efficiency & Renewable Energy (EERE) program. A dynamic map displaying all available data from DOE anemometer loan programs is available http://www.windpoweringamerica.gov/anemometerloans/projects.asp. Source EERE Date Released December 02nd, 2010 (3 years ago) Date Updated December 02nd, 2010 (3 years ago) Keywords wind

95

File:NREL-az-80m.pdf | Open Energy Information  

Open Energy Info (EERE)

az-80m.pdf az-80m.pdf Jump to: navigation, search File File history File usage Arizona Annual Average Wind Speed at 80 Meters Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 1.24 MB, MIME type: application/pdf) Description Arizona Annual Average Wind Speed at 80 Meters Sources National Renewable Energy Laboratory Related Technologies Wind Creation Date 2010-01-15 Extent State Countries United States UN Region Northern America States Arizona File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 15:00, 21 December 2010 Thumbnail for version as of 15:00, 21 December 2010 1,275 × 1,650 (1.24 MB) MapBot (Talk | contribs) Automated upload from NREL's "mapsearch" data

96

File:USDA-CE-Production-GIFmaps-AZ.pdf | Open Energy Information  

Open Energy Info (EERE)

AZ.pdf AZ.pdf Jump to: navigation, search File File history File usage Arizona Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 249 KB, MIME type: application/pdf) Description Arizona Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Arizona External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:11, 27 December 2010 Thumbnail for version as of 16:11, 27 December 2010 1,650 × 1,275 (249 KB) MapBot (Talk | contribs) Automated bot upload

97

DOE - Office of Legacy Management -- Tuba City AEC Ore Buying Station - AZ  

NLE Websites -- All DOE Office Websites (Extended Search)

AEC Ore Buying Station - AEC Ore Buying Station - AZ 0-02A FUSRAP Considered Sites Site: Tuba City AEC Ore Buying Station (AZ.0-02A) Designated Name: Alternate Name: Location: Evaluation Year: Site Operations: Site Disposition: Radioactive Materials Handled: Primary Radioactive Materials Handled: Radiological Survey(s): Site Status: The history of domestic uranium procurement under U.S. Atomic Energy Commission (AEC) contracts identifies a number of ore buying stations (sampling and storage sites) that were operated during the period late-1949 through the mid-1960s. During this period the AEC established ore-buying stations in new uranium producing areas where it appeared that ore production would be sufficient to support a uranium milling operation. The ideal scenario was to accumulate a sufficient stockpile of ore and

98

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA) Indexed Site

A-Z Index A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ A Abbreviations, energy related About U.S. Natural Gas Pipelines (U.S. & state) Acid rain (U.S., Census division, & state) Definition Emissions data Overview Acquisitions and Divestitures by Foreign Direct Investors in U.S. Energy (report) Activities for kids Additions to storage (natural gas; includes U.S. & state) Underground, by all operators Underground, by storage type Liquefied natural gas additions and withdrawals Addresses of electric companies Utility Nonutility AEO (See Annual Energy Outlook) AER (Annual Energy Review - report with annual U.S. data back to 1949) Afghanistan Country Analysis Brief Africa - Country Analysis Briefs Air-conditioning, number of households with

99

Inclusive production of $\\Lambda$, $K^0_s$ and exotic narrow resonances for systems $K_s^0 p$, $K_s^0 \\Lambda$, $\\Lambda p$ from p+propane interactions at 10 GeV/c  

E-Print Network (OSTI)

Experimental data from the 2m propane bubble chamber for production of $\\Lambda$, $K^0_s$ have been used to search of exotic baryon states, in the $K_s^0 p$, $K_s^0 \\Lambda$ and $\\Lambda p$ decay mode for the reaction p+propane at 10 GeV/c. The estimation of experimental inclusive cross sections for $\\Lambda$ and $K^0_s$ production in the p$^{12}C$ collision is equal to $\\sigma_{\\Lambda}$= 13.3$\\pm$1.7 mb and $\\sigma_{K^0_s}$= 3.8$\\pm$0.6 mb, respectively. The measured $\\Lambda /\\pi^+$ ratio from pC reaction is equal to (5.3$\\pm0.8)*10^{-2}$. The experimental $\\Lambda /\\pi^+$ ratio from the pC reaction is approximately two times larger than the $\\Lambda /\\pi^+$ ratio simulated by FRITIOF model from the pC reaction. The invariant mass spectrum $\\Lambda K^0_s$ registered narrow peaks in regions of 1750 and 1795 MeV/$c^2$. The statistical significance of these peaks has been estimated as 5.6 and 3.3 S.D., respectively. These would be candidates for the $N^0$ or the $\\Xi^0$ pentaquark states. The $pK^0_s$ invaria...

Aslanyan, P Z

2005-01-01T23:59:59.000Z

100

Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

Evaluation of 241-AZ tank farm supporting phase 1 privatization waste feed delivery  

Science Conference Proceedings (OSTI)

This evaluation is one in a series of evaluations determining the process needs and assessing the adequacy of existing and planned equipment in meeting those needs at various double-shell tank farms in support of Phase 1 privatization. A number of tank-to-tank transfers and waste preparation activities are needed to process and feed waste to the private contractor in support of Phase 1 privatization. The scope of this evaluation is limited to process needs associated with 241-AZ tank farm during the Phase 1 privatization.

CARLSON, A.B.

1998-11-19T23:59:59.000Z

102

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:

103

RELAP5/MOD3.2 Assessment Using CHF Data from the KS-1 and V-200 Experiment Facilities  

SciTech Connect

The RELAP/MOD3.2 computer code has been assessed using rod bundle critical heat flux data from the KS-1 and V-200 facilities. This work was performed as part of the U.S. Department of Energys International Nuclear Safety Program, and is part of the effort addressing the capability of the RELAP5/MOD3.2 code to model transients in Soviet-designed reactors. Designated VVER Standard Problem 7, these tests addressed one of the important phenomena related to VVER behavior that the code needs to simulate well, core heat transfer. The code was judged to be in minimal agreement with the experiment data, consistently overpredicting the measured critical heat flux. It is recommended that a model development effort be undertaken to develop a critical heat flux model for RELAP5 that better represents the behavior in VVER rod bundles.

Bayless, Paul David

2001-07-01T23:59:59.000Z

104

The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.

2005-05-01T23:59:59.000Z

105

CSER 96-014: criticality safety of project W-151, 241-AZ-101 retrieval system process test  

Science Conference Proceedings (OSTI)

This Criticality Safety Evaluation Report (CSER) documents a review of the criticality safety implications of a process test to be performed in tank 241-AZ-101 (101-AZ). The process test will determine the effectiveness of the retrieval system for mobilization of solids and the practicality of the system for future use in the underground storage tanks at Hanford. The scope of the CSER extends only to the testing and operation of the mixer pumps and does not include the transfer of waste from the tank. Justification is provided that a nuclear criticality is extremely unlikely, if not impossible, in this tank.

Vail, T.S., Fluor Daniel Hanford

1997-02-06T23:59:59.000Z

106

DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP

107

DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;

108

DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co

109

Archaeological data recovery at drill hole U19az, Nevada Test Site, Nye County, Nevada  

Science Conference Proceedings (OSTI)

At the request of the Department of Energy, Nevada Field Office (DOE/NV), the Desert Research Institute (DRI) conducted archaeological data recovery at drill hole U19az on the Nevada Test Site in February 1988 and April 1990. The work focused on a site that was recommended as eligible to the National Register of Historic Places. DOE/NV chose to mitigate adverse impacts to the site though a data recovery program. The mapping and collection of artifacts took place in two discrete areas, covering almost 10 hectares (24.71 acres). In addition to surface collection, 11 test pits and 12 surface scrapes were excavated. Information was sought to address four research questions concerned with the age of the site, the subsistence and demography of the site's inhabitants, and the behavioral implications of their lithic technology. This report describes and presents the results of the data recovery at drill hole U19az. The analyses of the artifacts indicate that the site was inhabited between 5,000 years ago and historic times. Relative artifact abundance indicates the most intense use occurred from about 4,000 to 1,500 years ago.

Lancaster, J.

1992-01-01T23:59:59.000Z

110

Archaeological data recovery at drill hole U19az, Nevada Test Site, Nye County, Nevada  

SciTech Connect

At the request of the Department of Energy, Nevada Field Office (DOE/NV), the Desert Research Institute (DRI) conducted archaeological data recovery at drill hole U19az on the Nevada Test Site in February 1988 and April 1990. The work focused on a site that was recommended as eligible to the National Register of Historic Places. DOE/NV chose to mitigate adverse impacts to the site though a data recovery program. The mapping and collection of artifacts took place in two discrete areas, covering almost 10 hectares (24.71 acres). In addition to surface collection, 11 test pits and 12 surface scrapes were excavated. Information was sought to address four research questions concerned with the age of the site, the subsistence and demography of the site`s inhabitants, and the behavioral implications of their lithic technology. This report describes and presents the results of the data recovery at drill hole U19az. The analyses of the artifacts indicate that the site was inhabited between 5,000 years ago and historic times. Relative artifact abundance indicates the most intense use occurred from about 4,000 to 1,500 years ago.

Lancaster, J.

1992-12-31T23:59:59.000Z

111

Pump Jet Mixing and Pipeline Transfer Assessment for High-Activity Radioactive Wastes in Hanford Tank 241-AZ-102  

SciTech Connect

The authors evaluated how well two 300-hp mixer pumps would mix solid and liquid radioactive wastes stored in Hanford double-shell Tank 241-AZ-102 (AZ-102) and confirmed the adequacy of a three-inch (7.6-cm) pipeline system to transfer the resulting mixed waste slurry to the AP Tank Farm and a planned waste treatment (vitrification) plant on the Hanford Site. Tank AZ-102 contains 854,000 gallons (3,230 m{sup 3}) of supernatant liquid and 95,000 gallons (360 m{sup 3}) of sludge made up of aging waste (or neutralized current acid waste). The study comprises three assessments: waste chemistry, pump jet mixing, and pipeline transfer. The waste chemical modeling assessment indicates that the sludge, consisting of the solids and interstitial solution, and the supernatant liquid are basically in an equilibrium condition. Thus, pump jet mixing would not cause much solids precipitation and dissolution, only 1.5% or less of the total AZ-102 sludge. The pump jet mixing modeling indicates that two 300-hp mixer pumps would mobilize up to about 23 ft (7.0 m) of the sludge nearest the pump but would not erode the waste within seven inches (0.18 m) of the tank bottom. This results in about half of the sludge being uniformly mixed in the tank and the other half being unmixed (not eroded) at the tank bottom.

Y Onishi; KP Recknagle; BE Wells

2000-08-09T23:59:59.000Z

112

WM'05 Conference, February 27 March 3, 2005, Tucson, AZ WM-5202 INTERNATIONAL APPROACH TO MONITORING FOR RADIOACTIVELY  

E-Print Network (OSTI)

acceptable scrap metal radiation monitoring and response protocol. Second, international training programs radiation exposure to workers and the public, this unwanted radioactive scrap material causes environmentalWM'05 Conference, February 27 ­ March 3, 2005, Tucson, AZ WM-5202 1 INTERNATIONAL APPROACH

113

DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on

114

DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:

115

Florence & Oracle Junction, Pinal County, AZ, RECORD OF CATEGORICAL EXCLUSION DETERMINATION  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

emergency wood pole emergency wood pole replacement at 59 structures located along the Coolidge-Oracle 115-kV T.L. , near Cooiidge, Florence & Oracle Junction, Pinal County, AZ, RECORD OF CATEGORICAL EXCLUSION DETERMINATION A. Proposed Action: Western plans to replace deteriorated wood poles, cross arms and X-braces at 59 existing H-frame or 3-pole-turning structures (Table 1) located along the Coolidge-Oracle 115-kV Transmission Line in Pinal County, Arizona (Figure 1), Built in 1943, its aging components are beyond repair and require replacement. These poles performed poorly during structural tests, and we consider them unstable, This project ensures the safety of Western's workers and the public as well as reliability of the bulk electric system, Western will accomplish the work by clearing vegetation and blading a level pad at

116

Recipient: County ut Pinal, AZ ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

5 5 Recipient: County ut Pinal, AZ ENERGY EFFICIENCY AND CONSERVATION BLOCK GRANTS NEPA COMPLIANCE FORM Activities Determination/ Categorical Exclusion Reviewer's Specific Instructions and Rationale (Restrictions and Allowable Activity) Activity 1 - Energy Efficiency Audits A9, All This NEPA determination is limited to conducting audits/compiling the results of the audits/and making recommendations only. (see Activity 4 for audit implementation activities) Activity 2 - Energy Efficiency Municipal Partnership A9, All, B5.1 Waste Stream Clause Historic Preservation Clause Engineering clause Activity 3 - Ironwood-Gantzel Roadway Traffic Lights Synchronization A9 None Activity 4 - Energy Efficiency Corrective Measures Implementation A9, All, B5.1 Waste Stream Clause Historic Preservation Clause

117

Evaluation of cracking in the 241-AZ tank farm ventilation line at the Hanford Site  

Science Conference Proceedings (OSTI)

In the period from April to October of 1988, a series of welding operations on the outside of the AZ Tank Farm ventilation line piping at the Hanford Site produced unexpected and repeated cracking of the austenitic stainless steel base metal and of a seam weld in the pipe. The ventilation line is fabricated from type 304L stainless steel pipe of 24 inch diameter and 0.25 inch wall thickness. The pipe was wrapped in polyethylene bubble wrap and buried approximately 12 feet below grade. Except for the time period between 1980 and 1987, impressed current cathodic protection has been applied to the pipe since its installation in 1974. The paper describes the history of the cracking of the pipe, the probable cracking mechanisms, and the recommended future action for repair/replacement of the pipe.

ANANTATMULA, R.P.

1999-10-20T23:59:59.000Z

118

Tank 241-AZ-101 prototype corrosion probe four month status report  

SciTech Connect

High-level nuclear wastes at the Hanford Site are stored underground in carbon steel double-shell and single-shell tanks. The installation of a prototype corrosion monitoring system into double-shell tank 241-AZ-101 was completed in August, 1996. The system monitors fluctuations in corrosion current and potential (electrochemical noise) occurring on three electrode arrays immersed in the waste liquid and in the vapor space above the waste. The system also supports the use of Tafel and linear polarization resistance testing. By monitoring and analyzing the data from these techniques, changes in the corrosive characteristics of the waste have been rapidly detected and correlated with operational changes in the tank.

Edgemon, G.L., Westinghouse Hanford

1996-12-12T23:59:59.000Z

119

REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

120

MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-10-01T23:59:59.000Z

122

Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel

2010-01-01T23:59:59.000Z

123

MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-12-01T23:59:59.000Z

124

Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)

2011-12-01T23:59:59.000Z

125

241-AZ-101 Mixer Pump Demonstration Test Gamma Cart Acceptance Test Procedure and Quality Test Plan (ATP and QTP)  

Science Conference Proceedings (OSTI)

Shop Test of the Gamma Cart System to be used in the AZ-101 Mixer Pump Demonstration Test. Tests hardware and software. This procedure involves testing the Instrumentation involved with the Gamma Cart System, local and remote, including: depth indicators, speed controls, interface to data acquisition software and the raising and lowering functions. This Procedure will be performed twice, once for each Gamma Cart System. This procedure does not test the accuracy of the data acquisition software.

WHITE, D.A.

2000-03-01T23:59:59.000Z

126

241-AZ-101 Mixer Pump Demonstration Test Gamma Cart Acceptance Test Procedure and Quality Test Plan (ATP and QTP)  

SciTech Connect

Shop test of the sludge mobilization cart system to be used in the AZ-101 Mixer Pump Demonstration Test Tests hardware and software. This procedure involves testing the Instrumentation involved with the Gamma Cart System, local and remote, including depth indicators, speed controls, interface to data acquisition software and the raising and lowering functions. This Procedure will be performed twice, once for each Gamma Cart System. This procedure does not test the accuracy of the data acquisition software.

WHITE, D.A.

2000-01-27T23:59:59.000Z

127

BASIN BLAN CO BLAN CO S OT ERO IGNAC IO-BLANCO AZ TEC BALLAR  

U.S. Energy Information Administration (EIA) Indexed Site

BOE Reserve Class BOE Reserve Class No 2001 reserves 0.1 - 10 MBOE 10.1 - 100 MBOE 100.1 - 1,000 MBOE 1,000.1- 10,000 MBOE 10,000.1 - 100,000 MBOE > 100,000 MBOE Basin Outline AZ UT NM CO 1 2 Index Map for 2 Paradox-San Juan Panels 2001 Reserve Summary for All Paradox-San Juan Basin Fields Total Total Total Number Liquid Gas BOE of Reserves Reserves Reserves Fields (Mbbl) (MMcf) (Mbbl) Paradox-San Juan 250 174,193 20,653,622 3,616,464 Basin CO NM IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO BASIN BASIN BLAN CO BLAN CO BASIN BASIN BASIN BASIN BASIN BASIN BISTI BAL LAR D BASIN BISTI BLA NCO S OT ERO BAL LAR D LIND RITH W BASIN BLA NCO BLA NCO S BLA NCO S TAPAC ITO GAVIL AN BASIN BLA NCO The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by

128

BASIN BLAN CO BLAN CO S OT ERO IGNAC IO-BLANCO AZ TEC BALLAR  

U.S. Energy Information Administration (EIA) Indexed Site

Liquids Reserve Class Liquids Reserve Class No 2001 liquids reserves 0.1 - 10 Mbbl 10.1 - 100 Mbbl 100.1 - 1,000 Mbbl 1,000.1- 10,000 Mbbl 10,000.1 - 100,000 Mbbl Basin Outline AZ UT NM CO 1 2 Index Map for 2 Paradox-San Juan Panels 2001 Reserve Summary for All Paradox-San Juan Basin Fields Total Total Total Number Liquid Gas BOE of Reserves Reserves Reserves Fields (Mbbl) (MMcf) (Mbbl) Paradox-San Juan 250 174,193 20,653,622 3,616,464 Basin CO NM IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO BASIN BASIN BLAN CO BLAN CO BASIN BASIN BASIN BASIN BASIN BASIN BISTI BAL LAR D BASIN BISTI BLA NCO S OT ERO BAL LAR D LIND RITH W BASIN BLA NCO BLA NCO S BLA NCO S TAPAC ITO GAVIL AN BASIN BLA NCO The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by

129

BASIN BLAN CO BLAN CO S OT ERO IGNAC IO-BLANCO AZ TEC BALLAR  

U.S. Energy Information Administration (EIA) Indexed Site

Gas Reserve Class Gas Reserve Class No 2001 gas reserves 0.1 - 10 MMCF 10.1 - 100 MMCF 100.1 - 1,000 MMCF 1,000.1- 10,000 MMCF 10,000.1 - 100,000 MMCF > 100,000 MMCF Basin Outline AZ UT NM CO 1 2 Index Map for 2 Paradox-San Juan Panels 2001 Reserve Summary for All Paradox-San Juan Basin Fields Total Total Total Number Liquid Gas BOE of Reserves Reserves Reserves Fields (Mbbl) (MMcf) (Mbbl) Paradox-San Juan 250 174,193 20,653,622 3,616,464 Basin CO NM IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO IGNAC IO-BLANCO BASIN BASIN BLAN CO BLAN CO BASIN BASIN BASIN BASIN BASIN BASIN BISTI BAL LAR D BASIN BISTI BLA NCO S OT ERO BAL LAR D LIND RITH W BASIN BLA NCO BLA NCO S BLA NCO S TAPAC ITO GAVIL AN BASIN BLA NCO The mapped oil and gas field boundary outlines were created by the Reserves and Production Division, Office of Oil and Gas, Energy Information Administration pursuant to studies required by

130

A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)

2012-07-15T23:59:59.000Z

131

Print http://us.mg4.mail.yahoo.com/neo/launch?.rand=deOsgk04ks40i Subject: RE: [s-w-h] b Solar verses wind efficiency  

E-Print Network (OSTI)

.yahoo.com/neo/launch?.rand=deOsgk04ks40i Subject: RE: [s-w-h] b Solar verses wind efficiency From: Michael Klemen (wind4energy;Print http://us.rng4.mail.yahoo.comlneo/launch?.rand=deOsgko4ks4 energy in the wind is proportional://www.ndsu.edu/ndsu/klemen/Perfect_Turbine.htm You can see that for an ideal real life wind turbine ("good turbine") the increase in energy

132

Estimate of the Distribution of Solids Within Mixed Hanford Double-Shell Tank AZ-101: Implications for AY-102  

SciTech Connect

This paper describes the current level of understanding of the suspension of solids in Hanford double-shell waste tanks while being mixed with the baseline configuration of two 300-horsepower mixer pumps. A mixer pump test conducted in Tank AZ-101 during fiscal year 2000 provided the basis for this understanding. Information gaps must be filled to demonstrate the capability of the baseline feed delivery system to effectively mix, sample, and deliver double-shell tank waste to the Hanford Tank Waste Treatment and Immobilization Plant (WTP) for vitrification.

Wells, Beric E.; Ressler, Jennifer J.

2009-04-29T23:59:59.000Z

133

Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.

1997-10-01T23:59:59.000Z

134

3610 N. 44th Street, Suite 250, Phoenix, AZ 85018 ● Phone 602-808-2004 ●  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

10 N. 44th Street, Suite 250, Phoenix, AZ 85018 ● Phone 602-808-2004 ● Fax 602-808-2099 ● www.sunzia.net 10 N. 44th Street, Suite 250, Phoenix, AZ 85018 ● Phone 602-808-2004 ● Fax 602-808-2099 ● www.sunzia.net October 17, 2013 Transmitted via electronic mail to juliea.smith@hq.doe.gov and christopher.lawrence@hq.doe.gov Subject: SunZia Southwest Transmission Project comments on Department of Energy's August 29, 2013 Federal Register Notice regarding Improving Performance of Federal Permitting and Review of Infrastructure Projects. The following comments are provided to the Department of Energy (DOE) in response to the agency's request for information on (RFI) the draft Integrated Interagency Pre-Application (IIP) Process. These comments reflect the views and suggestions of the SunZia Southwest Transmission Project (SunZia). The Bureau of Land Management is the lead agency for processing our right-of-

135

OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown

2013-10-01T23:59:59.000Z

136

In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma

2013-06-01T23:59:59.000Z

137

NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk

138

Hybrid Al/SiC Composite Optics for IFE Applications W. Kowbel, MER Corp., Tucson, AZ And M. Tillack, UCSD, La Jolla, CA  

E-Print Network (OSTI)

Hybrid Al/SiC Composite Optics for IFE Applications W. Kowbel, MER Corp., Tucson, AZ And M. Tillack support of the mirror is a SiC composite. The SiC composite is chosen for the following reasons: 1) Very the mechanical deformations of the mirror's surface are minimized. 3) SiC is a low activation material, so

Tillack, Mark

139

Evaluating the improvement of corrosion residual strength by adding 1.0 wt.% yttrium into an AZ91D magnesium alloy  

SciTech Connect

The influence of yttrium on the corrosion residual strength of an AZ91D magnesium alloy was investigated detailedly. Scanning electron microscope was employed to analyze the microstructure and the fractography of the studied alloys. The microstructure of AZ91D magnesium alloy is remarkably refined due to the addition of yttrium. The electrochemical potentiodynamic polarization curve of the studied alloy was performed with a CHI 660b electrochemical station in the three-electrode system. The result reveals that yttrium significantly promotes the overall corrosion resistance of AZ91D magnesium alloy by suppressing the cathodic reaction in corrosion process. However, the nucleation and propagation of corrosion pits on the surface of the 1.0 wt.% Y modified AZ91D magnesium alloy indicate that pitting corrosion still emerges after the addition of yttrium. Furthermore, stress concentration caused by corrosion pits should be responsible for the drop of corrosion residual strength although the addition of yttrium remarkably weakens the effect of stress concentration at the tip of corrosion pits in loading process.

Wang Qiang [Key Laboratory of Automobile Materials (Jilin University), Ministry of Education, College of Materials Science and Engineering, Jilin University, Changchun, 130025 (China); Liu Yaohui, E-mail: liuyaohui2005@yahoo.com [Key Laboratory of Automobile Materials (Jilin University), Ministry of Education, College of Materials Science and Engineering, Jilin University, Changchun, 130025 (China); Fang Shijie [Department of Mechanical and Electrical Engineering, Luoyang Institute of Science and Technology, Luoyang 471023 (China); Song Yulai; Zhang Dawei; Zhang Lina; Li Chunfang [Key Laboratory of Automobile Materials (Jilin University), Ministry of Education, College of Materials Science and Engineering, Jilin University, Changchun, 130025 (China)

2010-06-15T23:59:59.000Z

140

Real-Time Cardiac Imaging at 3 Tesla K.S. NAYAK, C.H. CUNNINGHAM, J.M. SANTOS, J.M. PAULY, AND D.G. NISHIMURA  

E-Print Network (OSTI)

Real-Time Cardiac Imaging at 3 Tesla K.S. NAYAK, C.H. CUNNINGHAM, J.M. SANTOS, J.M. PAULY, AND D are shown in Figure 2. Conclusions We have demonstrated real-time cardiac imaging at 3 Tesla with high SNR

Nayak, Krishna

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay

142

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....

143

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA

144

FINAL REPORT DM1200 TESTS WITH AZ 101 HLW SIMULANTS VSL-03R3800-4 REV 0 2/17/04  

SciTech Connect

This report documents melter and off-gas performance results obtained on the DM 1200 HLW Pilot Melter during processing of simulated HLW AZ-101 feed. The principal objectives of the DM1200 melter testing were to determine the achievable glass production rates for simulated HLW AZ-101 feed; determine the effect of bubbling rate and feed solids content on production rate; characterize melter off-gas emissions; characterize the performance of the prototypical off-gas system components as well as their integrated performance; characterize the feed, glass product, and off-gas effluents; and to perform pre- and post-test inspections of system components. The test objectives (including test success criteria), along with how they were met, are outlined in a table.

KRUGER AA; MATLACK KS; BARDAKCI T; D'ANGELO NA; GONG W; KOT WK; PEGG IL

2011-12-29T23:59:59.000Z

145

HLW Feed Delivery AZ101 Batch Transfer to the Private Contractor Transfer and Mixing Process Improvements [Initial Release at Rev 2  

SciTech Connect

The primary purpose of this business case is to provide Operations and Maintenance with a detailed transfer process review for the first High Level Waste (HLW) feed delivery to the Privatization Contractor (PC), AZ-101 batch transfer to PC. The Team was chartered to identify improvements that could be implemented in the field. A significant penalty can be invoked for not providing the quality, quantity, or timely delivery of HLW feed to the PC.

DUNCAN, G.P.

2000-02-28T23:59:59.000Z

146

Characterization of High Strain Rate Mechanical behavior of AZ31 magnesium alloy using 3D Digital Image Correlation  

Science Conference Proceedings (OSTI)

Characterization of the material mechanical behavior at sub-Hopkinson regime (0.1 to 1000 s{sup -1}) is very challenging due to instrumentation limitations and the complexity of data analysis involved in dynamic loading. In this study, AZ31 magnesium alloy sheet specimens are tested using a custom designed servo-hydraulic machine in tension at nominal strain rates up to 1000 s{sup -1}. In order to resolve strain measurement artifacts, the specimen displacement is measured using 3D Digital Image correlation instead from actuator motion. The total strain is measured up to {approx} 30%, which is far beyond the measurable range of electric resistance strain gages. Stresses are calculated based on the elastic strains in the tab of a standard dog-bone shaped specimen. Using this technique, the stresses measured for strain rates of 100 s{sup -1} and lower show little or no noise comparing to load cell signals. When the strain rates are higher than 250 s{sup -1}, the noises and oscillations in the stress measurements are significantly decreased from {approx} 250 to 50 MPa. Overall, it is found that there are no significant differences in the elongation, although the material exhibits slight work hardening when the strain rate is increased from 1 to 100 s{sup -1}.

Wang, Yanli [ORNL; Xu, Hanbing [ORNL; ERDMAN III, DONALD L [ORNL; Starbuck, J Michael [ORNL; Simunovic, Srdjan [ORNL

2011-01-01T23:59:59.000Z

147

CESIUM REMOVAL FROM TANKS 241-AN-103 & 241-SX-105 & 241-AZ-101/102 COMPOSITE FOR TESTING IN BENCH SCALE STEAM REFORMER  

SciTech Connect

This report documents the preparation of three actual Hanford tank waste samples for shipment to the Savannah River National Laboratory (SRNL). Two of the samples were dissolved saltcakes from tank 241-AN-103 (hereafter AN-103) and tank 241-SX-105 (hereafter SX-105); one sample was a supernate composite from tanks 241-AZ-101 and 241-AZ-102 (hereafter AZ-101/102). The preparation of the samples was executed following the test plans LAB-PLAN-10-00006, Test Plan for the Preparation of Samples from Hanford Tanks 241-SX-105, 241-AN-103, 241-AN-107, and LAB-PLN-10-00014, Test Plan for the Preparation of a Composite Sample from Hanford Tanks 241-AZ-101 and 241-AZ-102 for Steam Reformer Testing at the Savannah River National Laboratory. All procedural steps were recorded in laboratory notebook HNF-N-274 3. Sample breakdown diagrams for AN-103 and SX-105 are presented in Appendix A. The tank samples were prepared in support of a series of treatability studies of the Fluidized Bed Steam Reforming (FBSR) process using a Bench-Scale Reformer (BSR) at SRNL. Tests with simulants have shown that the FBSR mineralized waste form is comparable to low-activity waste glass with respect to environmental durability (WSRC-STI-2008-00268, Mineralization of Radioactive Wastes by Fluidized Bed Steam Reforming (FBSR): Comparisons to Vitreous Waste Forms and Pertinent Durability Testing). However, a rigorous assessment requires long-term performance data from FB SR product formed from actual Hanford tank waste. Washington River Protection Solutions, LLC (WRPS) has initiated a Waste Form Qualification Program (WP-S.2.1-20 1 0-00 1, Fluidized Bed Steam Reformer Low-level Waste Form Qualification) to gather the data required to demonstrate that an adequate FBSR mineralized waste form can be produced. The documentation of the selection process of the three tank samples has been separately reported in RPP-48824, 'Sample Selection Process for Bench-Scale Steam Reforming Treatability Studies Using Hanford Waste Samples.'

DUNCAN JB; HUBER HJ

2011-06-08T23:59:59.000Z

148

miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li

2009-01-01T23:59:59.000Z

149

Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)

2010-01-01T23:59:59.000Z

150

DEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE  

E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.

151

Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)

2012-07-01T23:59:59.000Z

152

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

153

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural

154

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration

155

Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.

156

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.

157

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure

158

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of

159

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

160

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost

162

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure

163

C:\ANNUAL\VENTCHAP.V8\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure

164

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."

165

A-Z Index  

NLE Websites -- All DOE Office Websites (Extended Search)

Demand Response Demand Response Quick Assessment Tool (DRQAT) DER-CAM Design Intent Tool Distributed Energy DOE-2...

166

A-Z Index  

NLE Websites -- All DOE Office Websites (Extended Search)

China Energy Group Climate Combustion Technologies Group Commercial Buildings Commercial Buildings Communications Office Contact Us Cookstove Efficiency and Emissions Testing...

167

A-Z Index  

NLE Websites -- All DOE Office Websites (Extended Search)

BATT Fabrication Laboratory Batteries and Fuel Cells Building Controls Virtual Test Bed Building Technology and Urban Systems Buildings Energy Efficiency...

168

A-Z Index  

NLE Websites -- All DOE Office Websites (Extended Search)

Electricity Grid Electricity Markets Electricity Reliability Electrochemical Technologies Group Electronics, Lighting and Networks Group Energy Analysis Energy Analysis and...

169

A-Z Index  

NLE Websites -- All DOE Office Websites (Extended Search)

Productivity High Technology and Industrial Systems Home Energy Saver for Consumers Home Energy Saver for Professionals...

170

U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office

171

File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload

172

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See Block 16C I  

National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

173

MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.

2011-05-01T23:59:59.000Z

174

Time-Temperature-Transformation Study of Simulated Hanford Tank Waste (AZ-101) and Optimization of Glass Formulation for Processing Such Waste  

SciTech Connect

This paper presents the current results of a study for the optimization of the quality of the wasteform to be produced by vitrification of Hanford High Level Waste (HLW). A simulant of the content of Hanford Tank AZ-101 has been used for the experiments. A first phase of the research focused on the wasteform composition and showed that a high quality and chemical-resistant wasteform can be formed incorporating 60 weight % of dried waste into a borosilicate glass enriched with zinc oxide and boric acid and provided some indication about the heat treatment of the melt. A second phase of the study, still in progress, refines these findings. A detailed crystallinity survey of the waste form after various heat treatments has been performed, culminating in the development of a time-temperature-transformation (TTT) diagram. The results of the first phase of research and preliminary results from the second phase are described.

Ramsey, W. G.; Kauffman, B. M.; Bricka, M.; Meaker, T. F.; Giordana, A.; Smith, J. D.; Miller, F. S.; Bohannan, E.; Powell, J.; Reich, M.; Jordan, J.; Venter, L.; Barletta, R. E.; Ramsey, A. A.; Maise, G. M.; Manowitz, B.; Steinberg, M.; Salzano, F.

2003-02-26T23:59:59.000Z

175

The Role of Friction Stir Welding on the Microstructure and Mechanical Properties of AZ31B-H24 Mg alloy  

Science Conference Proceedings (OSTI)

In this study, an attempt was made to join AZ31B magnesium alloy by friction stir welding (FSW) process. A single tool with cylindrical screw threaded pin was used to investigate the effect of welding parameters on microstructure and mechanical properties of stir zone (SZ). Several welds were made at different rotational ({omega}) and traverse ({upsilon}) speeds, while the {omega}/{upsilon} ratios were kept constant. The optical and scanning electron microscopy were used to study the variation of microstructure across the welds. Moreover, micro-hardness and tensile tests were carried out to evaluate the mechanical properties of joints. It was found that {omega} plays more significant role on the resulted grain structure than {upsilon}, and at a constant {omega}/{upsilon} ratio, decreasing rotational speed decreased the size of grains, and hence, improved the hardness value and the tensile strength of the SZ.

Darzi, Kh.; Saeid, T. [Advanced Materials Research Center - Faculty of Materials Engineering, Sahand University of Technology - Tabriz (Iran, Islamic Republic of)

2011-12-26T23:59:59.000Z

176

Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab

2007-03-01T23:59:59.000Z

177

Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A

2008-01-01T23:59:59.000Z

178

Origins of the extragalactic background at 1mm from a combined analysis of the AzTEC and MAMBO data in GOODS-N  

E-Print Network (OSTI)

We present a study of the cosmic infrared background, which is a measure of the dust obscured activity in all galaxies in the Universe. We venture to isolate the galaxies responsible for the background at 1mm; with spectroscopic and photometric redshifts we constrain the redshift distribution of these galaxies. We create a deep 1.16mm map (sigma ~ 0.5mJy) by combining the AzTEC 1.1mm and MAMBO 1.2mm datasets in GOODS-N. This combined map contains 41 secure detections, 13 of which are new. By averaging the 1.16mm flux densities of individually undetected galaxies with 24um flux densities > 25uJy, we resolve 31--45 per cent of the 1.16mm background. Repeating our analysis on the SCUBA 850um map, we resolve a higher percentage (40--64 per cent) of the 850um background. A majority of the background resolved (attributed to individual galaxies) at both wavelengths comes from galaxies at z > 1.3. If the ratio of the resolved submillimeter to millimeter background is applied to a reasonable scenario for the origins o...

Penner, Kyle; Chapin, Edward L; Greve, Thomas R; Bertoldi, Frank; Brodwin, Mark; Chary, Ranga-Ram; Conselice, Christopher J; Coppin, Kristen; Giavalisco, Mauro; Hughes, David H; Ivison, Rob J; Perera, Thushara; Scott, Douglas; Scott, Kimberly; Wilson, Grant

2010-01-01T23:59:59.000Z

179

Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:

180

T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab

2012-02-11T23:59:59.000Z

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester

2012-07-01T23:59:59.000Z

182

PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos

2008-06-27T23:59:59.000Z

183

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance

184

FINAL REPORT TESTS ON THE DURAMELTER 1200 HLW PILOT MELTER SYSTEM USING AZ-101 HLW SIMULANTS VSL-02R0100-2 REV 1 2/17/03  

Science Conference Proceedings (OSTI)

This document provides the final report on data and results obtained from a series of nine tests performed on the one-third scale DuraMelter{trademark} 1200 (DM1200) HLW Pilot Melter system that has been installed at VSL with an integrated prototypical off-gas treatment system. That system has replaced the DM1000 system that was used for HLW throughput testing during Part B1 [1]. Both melters have similar melt surface areas (1.2 m{sup 2}) but the DM1200 is prototypical of the present RPP-WTP HLW melter design whereas the DM1000 was not. These tests were performed under a corresponding RPP-WTP Test Specification and associated Test Plans. The nine tests reported here were preceded by an initial series of short-duration tests conducted to support the start-up and commissioning of this system. This report is a followup to the previously issued Preliminary Data Summary Reports. The DM1200 system was deployed for testing and confirmation of basic design, operability, flow sheet, and process control assumptions as well as for support of waste form qualification and permitting. These tests include data on processing rates, off-gas treatment system performance, recycle stream compositions, as well as process operability and reliability. Consequently, this system is a key component of the overall HLW vitrification development strategy. The primary objective of the present series of tests was to determine the effects of a variety of parameters on the glass production rate in comparison to the RPP-WTP HL W design basis of 400 kg/m{sup 2}/d. Previous testing on the DMIOOO system [1] concluded that achievement of that rate with simulants of projected WTP melter feeds (AZ-101 and C-106/AY-102) was unlikely without the use of bubblers. As part of those tests, the same feed that was used during the cold-commissioning of the West Valley Demonstration Project (WVDP) HLW vitrification system was run on the DM1000 system. The DM1000 tests reproduced the rates that were obtained at the larger WVDP facility, lending confidence to the tests results [1]. Since the inclusion or exclusion of a bubbler has significant design implications, the Project commissioned further tests to address this issue. In an effort to identify factors that might increase the glass production rate for projected WTP melter feeds, a subsequent series of tests was performed on the DM100 system. Several tests variables led to glass production rate increases to values significantly above the 400 kg/m2/d requirement. However, while small-scale melter tests are useful for screening relative effects, they tend to overestimate absolute glass production rates, particularly for un-bubbled tests. Consequently, when scale-up effects were taken into account, it was not clear that any of the variables investigated would conclusively meet the 400 kg/m{sup 2}/d requirement without bubbling. The present series of tests was therefore performed on the DM1200 one-third scale HLW pilot melter system to provide the required basis for a final decision on whether bubblers would be included in the HLW melter. The present tests employed the same AZ-101 waste simulant and glass composition that was used for previous testing for consistency and comparability with the results from the earlier tests.

KRUGER AA; MATLACK KS; KOT WK; BARDAKCI T; GONG W; D'ANGELO NA; SCHATZ TR; PEGG IL

2011-12-29T23:59:59.000Z

185

regionalmaps  

Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana

186

regionalmaps  

Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming

187

Microsoft Word - Gage-KS.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Intercomparisons of Cloud Observations Intercomparisons of Cloud Observations from the AL S-band Profiler and the ETL K-band Millimeter-Wave Cloud Radar on the R/V Ronald H. Brown during Nauru99 K. S. Gage and D. A. Carter National Oceanic and Atmospheric Administration Aeronomy Laboratory Boulder, Colorado P. E. Johnston and C. R. Williams Cooperative Institute for Research in Environmental Sciences University of Colorado Boulder, Colorado M. Ryan Science Technology Corporation Boulder, Colorado D. Hazen and B. W. Orr National Oceanic and Atmospheric Administration Environmental Technology Laboratory Boulder, Colorado Introduction Nauru99 took place in the western and central Pacific during June and July 1999. During Nauru99, a diverse suite of instruments was located on the research vessel (R/V) Ronald H. Brown to measure cloud

188

Ks-BAND DETECTION OF THERMAL EMISSION AND COLOR CONSTRAINTS TO CoRoT-1b: A LOW-ALBEDO PLANET WITH INEFFICIENT ATMOSPHERIC ENERGY REDISTRIBUTION AND A TEMPERATURE INVERSION  

SciTech Connect

We report the detection in Ks-band of the secondary eclipse of the hot Jupiter CoRoT-1b from time series photometry with the ARC 3.5 m telescope at Apache Point Observatory. The eclipse shows a depth of 0.336 +- 0.042% and is centered at phase 0.5022{sup +0.0023}{sub -0.0027}, consistent with a zero eccentricity orbit (e cos omega = 0.0035{sup +0.0036}{sub -0.0042}). We perform the first optical to near-infrared multi-band photometric analysis of an exoplanet's atmosphere and constrain the reflected and thermal emissions by combining our result with the recent 0.6, 0.71, and 2.09 mum secondary eclipse detections by Snellen et al., Gillon et al., and Alonso et al. Comparing the multi-wavelength detections to state-of-the-art radiative-convective chemical-equilibrium atmosphere models, we find the near-infrared fluxes difficult to reproduce. The closest blackbody-based and physical models provide the following atmosphere parameters: a temperature T = 2460{sup +80}{sub -160} K; a very low Bond albedo A{sub B} = 0.000{sup +0.081}{sub -0.000}; and an energy redistribution parameter P{sub n} = 0.1, indicating a small but nonzero amount of heat transfer from the day to nightside. The best physical model suggests a thermal inversion layer with an extra optical absorber of opacity kappa{sub e} = 0.05 cm{sup 2} g{sup -1}, placed near the 0.1 bar atmospheric pressure level. This inversion layer is located 10 times deeper in the atmosphere than the absorbers used in models to fit mid-infrared Spitzer detections of other irradiated hot Jupiters.

Rogers, Justin C. [Department of Physics and Astronomy, Johns Hopkins University, 366 Bloomberg Center, 3400 N. Charles Street, Baltimore, MD 21218 (United States); Apai, Daniel [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Lopez-Morales, Mercedes [Department of Terrestrial Magnetism, Carnegie Institution of Washngton, 5241 Broad Branch Rd. NW, Washington, DC 20015 (United States); Sing, David K. [UPMC Univ Paris 06, CNRS, Institut d'Astrophysique de Paris, 98bis boulevard Arago, F-75014 Paris (France); Burrows, Adam, E-mail: rogers@pha.jhu.ed [Department of Astrophysical Sciences, Princeton University, Peyton Hall, Princeton, NJ 08544 (United States)

2009-12-20T23:59:59.000Z

189

Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects

190

Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012

191

Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central

192

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.

193

Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.

2003-12-01T23:59:59.000Z

194

FINAL REPORT INTEGRATED DM1200 MELTER TESTING OF BUBBLER CONFIGURATIONS USING HLW AZ-101 SIMULANTS VSL-04R4800-4 REV 0 10/5/04  

SciTech Connect

This report documents melter and off-gas performance results obtained on the DM1200 HLW Pilot Melter during processing of AZ-101 HLW simulants. The tests reported herein are a subset of six tests from a larger series of tests described in the Test Plan for the work; results from the other tests have been reported separately. The solids contents of the melter feeds were based on the WTP baseline value for the solids content of the feeds from pretreatment which changed during these tests from 20% to 15% undissolved solids resulting in tests conducted at two feed solids contents. Based on the results of earlier tests with single outlet 'J' bubblers, initial tests were performed with a total bubbling rate of 651 pm. The first set of tests (Tests 1A-1E) addressed the effects of skewing this total air flow rate back and forth between the two installed bubblers in comparison to a fixed equal division of flow between them. The second set of tests (2A-2D) addressed the effects of bubbler depth. Subsequently, as the location, type and number of bubbling outlets were varied, the optimum bubbling rate for each was determined. A third (3A-3C) and fourth (8A-8C) set of tests evaluated the effects of alternative bubbler designs with two gas outlets per bubbler instead of one by placing four bubblers in positions simulating multiple-outlet bubblers. Data from the simulated multiple outlet bubblers were used to design bubblers with two outlets for an additional set of tests (9A-9C). Test 9 was also used to determine the effect of small sugar additions to the feed on ruthenium volatility. Another set of tests (10A-10D) evaluated the effects on production rate of spiking the feed with chloride and sulfate. Variables held constant to the extent possible included melt temperature, plenum temperature, cold cap coverage, the waste simulant composition, and the target glass composition. The feed rate was increased to the point that a constant, essentially complete, cold cap was achieved, which was used as an indicator of a maximized feed rate for each test. The first day of each test was used to build the cold cap and decrease the plenum temperature. The remainder of each test was split into two- to six-day segments, each with a different bubbling rate, bubbler orientation, or feed concentration of chloride and sulfur.

KRUGER AA; MATLACK KS; GONG W; BARDAKCI T; D'ANGELO NA; LUTZE W; CALLOW RA; BRANDYS M; KOT WK; PEGG IL

2011-12-29T23:59:59.000Z

195

U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT

196

U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT

197

fcmlbig - Energy Information Administration  

U.S. Energy Information Administration (EIA)

256821 TX Freeman-Martin 256852 MI Freeman-Redding 256914 WV Freemansburg 256945 IL Freemanspur 256976 KS Freemeyer 257007 CA Fremont Landing 257038 OK Freeny

198

Other Participants 1999 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

MI Shawnee Mission South High School , Shawnee Mission , KS Skyline High School , Idaho Falls, ID Smoky Hill High School, Aurora, CO St. James High School , Montgomery , AL...

199

"FERC423",2005,1,195,"Alabama Power Co",3,"Barry","AL","C",,...  

U.S. Energy Information Administration (EIA) Indexed Site

"Holcomb","KS","F",,"Gas","NG",,,,,,"AQUILLA",3006,0.993,0,0,585 "FERC423",2005,1,803,"Arizona Public Service Co",113,"Cholla","AZ","C",,"Coal","SUB",18,"NM","S","McKinley",31,"MCK...

200

AZ CO2 Storage Pilot  

NLE Websites -- All DOE Office Websites (Extended Search)

CO2 Storage Pilot Regional Carbon Sequestration Partnerships Initiative Review Meeting Pittsburgh, Pennsylvania October 7, 2008 John Henry Beyer, Ph.D. WESTCARB Program Manager, Geophysicist 510-486-7954, jhbeyer@lbl.gov Lawrence Berkeley National Laboratory Earth Sciences Division, MS 90-1116 Berkeley, CA 94720 2 WESTCARB region has major CO2 point sources 3 WESTCARB region has many deep saline formations - candidates for CO2 storage WESTCARB also created GIS layers for oil/gas fields and deep coal basins Source: DOE Carbon Sequestration Atlas of the United States and Canada 4 - Aspen Environmental - Bevilacqua-Knight, Inc. Arizona Utilities CO2 Storage Pilot Contracting and Funding Flow Department of Energy National Energy Technology Laboratory Lawrence Berkeley National

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

State Laboratory Contact Information AZ  

Science Conference Proceedings (OSTI)

... David Pfahler Brad Stover ... Joe Benavides Harvey Fischer Daniel Gibbons Preston Adachi Philip Wright Shauna Pereiro Lisa Corn Pat Sanders ...

2013-01-07T23:59:59.000Z

202

FINAL REPORT INTEGRATED DM1200 MELTER TESTING OF REDOX EFFECTS USING HLW AZ-101 AND C-106/AY-102 SIMULANTS VSL-04R4800-1 REV 0 5/6/  

SciTech Connect

This report documents melter and off-gas performance results obtained on the DM1200 HLW Pilot Melter during processing of AZ-101 and C-106/AY-102 HLW simulants. The tests reported herein are a subset of three tests from a larger series of tests described in the Test Plan for the work; results from the remaining tests will be reported separately. Three nine day tests, one with AZ-101 and two with C-106/AY-102 feeds were conducted with variable amounts of added sugar to address the effects of redox. The test with AZ-101 included ruthenium spikes to also address the effects of redox on ruthenium volatility. One of tests addressed the effects of increased flow-sheet nitrate levels using C-106/AY-102 feeds. With high nitrate/nitrite feeds (such as WTP LAW feeds), reductants are required to prevent melt foaming and deleterious effects on glass production rates. Sugar is the baseline WTP reductant for this purpose. WTP HLW feeds typically have relatively low nitrate/nitrite content in comparison to the organic carbon content and, therefore, have typically not required sugar additions. However, HLW feed variability, particularly with respect to nitrate levels, may necessitate the use of sugar in some instances. The tests reported here investigate the effects of variable sugar additions to the melter feed as well as elevated nitrate levels in the waste. Variables held constant to the extent possible included melt temperature, bubbling rate, plenum temperature, cold cap coverage, the waste simulant composition, and the target glass composition. The principal objectives of the DM1200 melter testing were to determine the achievable glass production rates for simulated HLW feeds with variable amounts of added sugar and increased nitrate levels; characterize melter off-gas emissions; characterize the performance of the prototypical off-gas system components as well as their integrated performance; characterize the feed, glass product, and off-gas effluents; and perform pre- and post test inspections of system components. The specific objectives (including test success criteria) of this testing, along with how each objective was met, are outlined in a table.

KRUGER AA; MATLACK KS; GONG W; BARDAKCI T; D'ANGELO NA; LUTZE W; BIZOT PM; CALLOW RA; BRANDYS M; KOT WK; PEGG IL

2011-12-29T23:59:59.000Z

203

Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available

2011-10-01T23:59:59.000Z

204

Search for the decay B^+ \\to K_S^0 K_S^0 \\pi ^+  

SciTech Connect

The authors search for charmless decays of charged B mesons to the three-body final state K{sub S}{sup 0}K{sub S}{sup 0}{pi}{sup +}. Using a data sample of 423.7 fb{sup -1} collected at the {Upsilon}(4S) resonance with the BABAR detector, corresponding to (465.1 {+-} 5.1) x 10{sup 6} B{bar B} pairs, they find no significant signal and determine a 90% confidence level upper limit on the branching fraction of 5.1 x 10{sup -7}.

Aubert, B.; Bona, M.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Lopez, L.; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Cahn, R.N.; Jacobsen, R.G.; /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /Frascati /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Karlsruhe U., EKP /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT, LNS /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /INFN, Naples /Naples U. /INFN, Naples /INFN, Naples /Naples U. /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /Pennsylvania U. /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison

2009-02-23T23:59:59.000Z

205

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

206

Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-

2009-01-01T23:59:59.000Z

207

Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan

2008-01-01T23:59:59.000Z

208

Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah

2011-04-21T23:59:59.000Z

209

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI

2012-06-01T23:59:59.000Z

210

FINAL REPORT INTEGRATED DM1200 MELTER TESTING USING AZ 102 AND C 106/AY-102 HLW SIMULANTS: HLW SIMULANT VERIFICATION VSL-05R5800-1 REV 0 6/27/05  

Science Conference Proceedings (OSTI)

The principal objectives of the DM1200 melter tests were to determine the effects of feed rheology, feed solid content, and bubbler configuration on glass production rate and off-gas system performance while processing the HLW AZ-101 and C-106/AY-102 feed compositions; characterize melter off-gas emissions; characterize the performance of the prototypical off-gas system components, as well as their integrated performance; characterize the feed, glass product, and off-gas effluents; and perform pre- and post test inspections of system components. The specific objectives (including test success criteria) of this testing, along with how each objective was met, are outlined in a table. The data provided in this Final Report address the impacts of HLW melter feed rheology on melter throughput and validation of the simulated HLW melter feeds. The primary purpose of this testing is to further validate/verify the HLW melter simulants that have been used for previous melter testing and to support their continued use in developing melter and off-gas related processing information for the Project. The primary simulant property in question is rheology. Simulants and melter feeds used in all previous melter tests were produced by direct addition of chemicals; these feed tend to be less viscous than rheological the upper-bound feeds made from actual wastes. Data provided here compare melter processing for the melter feed used in all previous DM100 and DM1200 tests (nominal melter feed) with feed adjusted by the feed vendor (NOAH Technologies) to be more viscous, thereby simulating more closely the upperbounding feed produced from actual waste. This report provides results of tests that are described in the Test Plan for this work. The Test Plan is responsive to one of several test objectives covered in the WTP Test Specification for this work; consequently, only part of the scope described in the Test Specification was addressed in this particular Test Plan. For the purpose of comparison, the tests reported here were performed with AZ-102 and C-106/AY-102 HLW simulants and glass compositions that are essentially the same as those used for recent DM1200 tests. One exception was the use of an alternate, higher-waste-loading C-106/AY-102 glass composition that was used in previous DM100 tests to further evaluate the performance of the optimized bubbler configuration.

KRUGER AA; MATLACK KS; GONG W; BARDAKCI T; D'ANGELO NA; BRANDYS M; KOT WK; PEGG IL

2011-12-29T23:59:59.000Z

211

A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.

2008-06-01T23:59:59.000Z

212

FINAL REPORT START-UP AND COMMISSIONING TESTS ON THE DURAMELTER 1200 HLW PILOT MELTER SYSTEM USING AZ-101 HLW SIMULANTS VSL-01R0100-2 REV 0 1/20/03  

Science Conference Proceedings (OSTI)

This document provides the final report on data and results obtained from commissioning tests performed on the one-third scale DuraMelter{trademark} 1200 (DM 1200) HLW Pilot Melter system that has been installed at VSL with an integrated prototypical off-gas treatment system. That system has replaced the DM1000 system that was used for HLW throughput testing during Part BI [1]. Both melters have similar melt surface areas (1.2 m{sup 2}) but the DM1200 is prototypical of the present RPP-WTP HLW melter design whereas the DM1000 was not. These tests were performed under a corresponding RPP-WTP Test Specification and associated Test Plan. This report is a followup to the previously issued Preliminary Data Summary Report. The DM1200 system will be used for testing and confirmation of basic design, operability, flow sheet, and process control assumptions as well as for support of waste form qualification and permitting. This will include data on processing rates, off-gas treatment system performance, recycle stream compositions, as well as process operability and reliability. Consequently, this system is a key component of the overall HLW vitrification development strategy. The results presented in this report are from the initial series of short-duration tests that were conducted to support the start-up and commissioning of this system prior to conducting the main body of development tests that have been planned for this system. These tests were directed primarily at system 'debugging,' operator training, and procedure refinement. The AZ-101 waste simulant and glass composition that was used for previous testing was selected for these tests.

KRUGER AA; MATLACK KS; KOT WK; BRANDYS M; WILSON CN; SCHATZ TR; GONG W; PEGG IL

2011-12-29T23:59:59.000Z

213

Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan

2008-09-30T23:59:59.000Z

214

EV Project Chevrolet Volt Vehicle Summary Report  

NLE Websites -- All DOE Office Websites (Extended Search)

events (mi) 25.8 Avg number of charging events per day when the vehicle was driven 1.4 EV Project Chevrolet Volt Vehicle Summary Report Region: Phoenix, AZ Metropolitan Area...

215

NONPROFIT ORG DETROIT, MI  

E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor

216

FINAL REPORT MELTER TESTS WITH AZ-101 HLW SIMULANT USING A DURAMELTER 100 VITRIFICATION SYSTEM VSL-01R10N0-1 REV 1 2/25/02  

Science Conference Proceedings (OSTI)

This report provides data, analyses, and conclusions from a series of tests that were conducted at the Vitreous State Laboratory of The Catholic of America (VSL) to determine the processing rates that are achievable with AZ-101 HLW simulants and corresponding melter feeds on a DuraMelter 100 (DM100) vitrification system. One of the most critical pieces of information in determining the required size of the RPP-WTP HLW melter is the specific glass production rate in terms of the mass of glass that can be produced per unit area of melt surface per unit time. The specific glass production rate together with the waste loading (essentially, the ratio of waste-in to glass-out, which is determined from glass formulation activities) determines the melt area that is needed to achieve a given waste processing rate with due allowance for system availability. Tests conducted during Part B1 (VSL-00R2590-2) on the DM1000 vitrification system installed at the Vitreous State Laboratory of The Catholic University of America showed that, without the use of bubblers, glass production rates with AZ-101 and C-106/AY-102 simulants were significantly lower than the Project design basis rate of 0.4 MT/m{sup 2}/d. Conversely, three-fold increases over the design basis rate were demonstrated with the use of bubblers. Furthermore, an un-bubbled control test using a replica of the melter feed used in cold commissioning tests at West Valley reproduced the rates that were observed with that feed on the WVDP production melter. More recent tests conducted on the DM1200 system, which more closely represents the present RPP-WTP design, are in general agreement with these earlier results. Screening tests conducted on the DM10 system have provided good indications of the larger-scale processing rates with bubblers (for both HL W and LAW feeds) but significantly overestimated the DM1000 un-bubbled rate observed for C-106/AY-102 melter feeds. This behavior is believed to be a consequence of the role of heat transfer in rate attainment and the much greater role of wall effects in heat transfer when the melt pool is not agitated. The DM100 melter used for the present tests has a surface area of 0.108 m{sup 2}, which is approximately 5 times larger than that of the DM10 (0.021 m{sup 2}) and approximately 11 times smaller than that of the DM1000 (1.2 m{sup 2}) (the DM1000 has since been replaced by a pilot-scale prototypical HLW melter, designated the DM1200, which has the same surface area as the DM1000). Testing on smaller melters is the most economical method for obtaining data over a wide range of operating conditions (particularly at extremes) and for guiding the more expensive tests that are performed at pilot-scale. Thus, one objective of these tests was to determine whether the DM100 melters are sufficiently large to reproduce the un-bubbled melt rates observed at the DM1000 scale, or to determine the extent of any off-set. DM100-scale tests can then be used to screen feed chemistry variations that may serve to increase the un-bubbled production rates prior to confirmation at pilot scale. Finally, extensive characterization data obtained on simulated HLW melter feeds formed from various glass forming additives indicated that there may be advantages in terms of feed rheology and stability to the replacement of some of the hydroxides by carbonates. A further objective of the present tests was therefore to identify any deleterious processing effects of such a change before adopting the carbonate feed as the baseline. Data from the WVDP melter using acidified (nitrated) feeds, and without bubbling, showed productions rates that are higher than those observed with the alkaline RPP feeds at the VSL. Therefore, the effect of feed acidification on production rate also was investigated. This work was performed under Test Specification, 'TSP-W375-00-00019, Rev 0, 'HLW-DM10 and DM100 Melter Tests' dated November 13, 2000 and the corresponding Test Plan. It should be noted, however, that the RPP-WTP Project directed a series of changes to the Test Plan as the result

KRUGER AA; MATLACK KS; KOT WK; PEGG IL

2011-12-29T23:59:59.000Z

217

Orion Mark Graf University of Kansas, Lawrence, KS 2010-Present  

E-Print Network (OSTI)

Distributions, Origins, and their Association with Y-chromosome Markers in the Aleutian Archipelago Advisor) "Surname Distributions and their Association with Y-chromosome Markers in the Aleutian Islands" Human in the Aleutian Archipelago: Evidence from Y- chromosome markers and historical accounts" Poster presentation

Peterson, Blake R.

218

Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use

219

DIPLOMAMUNKA Az RkpK fehrje termeltetse  

E-Print Network (OSTI)

.................................................................................5 1.3.3. A nif és fix gének

220

POWGEN EXPERIMENT A-Z-2013B  

NLE Websites -- All DOE Office Websites (Extended Search)

POWGEN POWGEN E XPERIMENT Before y ou a rrive/Send y our s amples: 1. C onfirmation: The c onfirmation o f a ll r elevant i nformation f or y our b eamtime i s d one t hrough o ur I ntegrated Proposal T racking S ystem ( IPTS: h ttp://www.ornl.gov/sci/iums/ipts/). B efore a rriving f or b eamtime, you w ill n eed t o c onfirm 1 ) L ab n eeds, 2 ) S amples, 3 ) S ample E nvironment, 4 ) S afety a nd 4 ) Experiment t ime. This i s y our f inal c hance t o e nter t he c orrect s ample i nformation a nd a nything t hat i s n ot c onfirmed cannot b e m easured d uring y our b eamtime. A dding s imilar s amples a s s tated i n y our p roposal w ill most l ikely t rigger n o a dditional r eview. H owever, r emember i f y ou a re e ntering d rastically d ifferent samples f rom y our a pproved p roposal t hey w ill g o t hrough a f urther a pproval a nd

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.

222

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

,833 ,833 35 Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2009 (Million Cubic Feet) Norway Trinidad/ Tobago Trinidad/ Tobago Egypt Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 111,144 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates

223

AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP

224

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 (Million Cubic Feet) Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 42,411 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2006 253,214 690,780 634,185 658,523 134,764 63,063 526,726 121,049 34,531 492,655 101,101 23,154 40,113 1,496,283 68,601

225

U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013

226

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value

227

DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256

228

Microsoft Word - figure_14.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 14. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2010 (Million Cubic Feet) Norway India Trinidad/ Tobago Egypt Yemen Japan Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 53,122 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada Gulf of Mexico Canada Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates based on historical data. Energy Information

229

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)

230

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

18 18 Energy Information Administration / Natural Gas Annual 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 0 1 2 3 4 5 6 7 T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o A l a b a m a K a n s a s A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 1997 1998 1999 2000 2001 2001 16. Marketed Production of Natural Gas in Selected States, 1997-2001 Figure Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI

231

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423

232

Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8

233

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

1 1 55 0 2 4 6 8 10 Residential Onsystem Commercial Onsystem Industrial Onsystem Vehicle Fuel Electric Utilities Dollars per Thousand Cubic Feet 0 30 60 90 120 150 180 210 240 270 300 330 Dollars per Thousand Cubic Meters 1997 1998 1999 2000 2001 25. Average Price of Natural Gas Delivered to Consumers in the United States, 1997-2001 Figure Note: Prices are calculated from onsystem sales. Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition" and Federal Energy Regulatory Commission (FERC), Form FERC- 423, "Monthly Report of Cost and Quality of Fuels for Electric Plants." Energy Information Administration / Natural Gas Annual 2001 56 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA

234

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848

235

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type

236

Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006

237

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2008 (Million Cubic Feet) Norway Trinidad/ Tobago Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 45,772 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates.

238

Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC

239

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity

240

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 (Million Cubic Feet) 24,891 2,895 Nigeria WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico Algeria C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada N i g e r i a O m a n Qatar Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Malaysia 2,986 Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2005 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 335,380 634,982 664,318 612,297 125,202 33,223 531,868 103,624

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product

242

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FOA-0000028 FOA-0000028 Prime: Cascade Sierra Solutions EE DE-EE0002613 PMC/PVT 2011 John Jason Conley 07/2011 - 02/20/2014 Multiple sites, Multiple states Interstate Electrification Improvement (SUMMARY CX) Install truck stop electrification hardware at multiple (30) truck stops nationwide. Locations in UT, IA, NM, WY, AZ, MO, VA, MA, MI, TX, AL, WA, CA, NC, NY, MT, FL, KS. 08 17 2011 John Jason Conley Digitally signed by John Jason Conley DN: cn=John Jason Conley, o=DOE, ou=NETL, email=John.Conley@netl.doe.gov, c=US Date: 2011.08.17 13:25:08 -04'00' 10 18 2011 john ganz Digitally signed by john ganz DN: cn=john ganz, o=netl, ou=environmental compliance division, email=john.ganz@netl.doe.gov, c=US Date: 2011.10.18 13:52:43 -04'00' Sub: Shorepower Technologies. Funded by DE-FOA-0000028, "Recovery Act - Transportation

243

San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC

244

eb surface alloying of magnesium alloys az31 b and az91 d  

Science Conference Proceedings (OSTI)

Jul 20, 2012 ... If the price of this product displays as $0.00 for your customer category, you may download it for free. You must, however, add it to your cart and...

245

U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

1 Regional maps Figure F4. Oil and gas supply model regions Figure F4. Oil and Gas Supply Model Regions Atlantic WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA...

246

A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada

2005-09-01T23:59:59.000Z

247

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","ng_prod_whv_a_epg0_vgm_mmcf_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/ng/ng_prod_whv_a_epg0_vgm_mmcf_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"12/19/2013 6:54:27 AM" "Back to Contents","Data 1: Natural Gas Marketed Production " "Sourcekey","N9050US2","N9050FX2","N9050AL2","N9050AK2","N9050AZ2","N9050AR2","N9050CA2","N9050CO2","N9050FL2","N9050IL2","N9050IN2","N9050KS2","N9050KY2","N9050LA2","N9050MD2","N9050MI2","N9050MS2","N9050MO2","N9050MT2","N9050NE2","N9050NV2","N9050NM2","N9050NY2","N9050ND2","N9050OH2","N9050OK2","N9050OR2","N9050PA2","N9050SD2","N9050TN2","N9050TX2","N9050UT2","N9050VA2","N9050WV2","N9050WY2"

248

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:

249

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:

250

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly

251

Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management

252

CHARACTERIZATION OF AZ91E-Si ALLOYS: MICROSTRUCTURE ...  

Science Conference Proceedings (OSTI)

Jul 20, 2012 ... If the price of this product displays as $0.00 for your customer category, you may download it for free. You must, however, add it to your cart and...

253

Nogales, AZ Liquefied Natural Gas Exports to Mexico  

Gasoline and Diesel Fuel Update (EIA)

250 282 2006-2012 Pipeline Prices 6.79 7.88 4.04 4.86 4.47 3.31 2006-2012 Liquefied Natural Gas Volumes 16 0 0 0 0 34 1998-2012 Liquefied Natural Gas Prices 15.27 -- -- -- --...

254

Dynamic Response of Magnesium Alloy AZ31B and Aluminum ...  

Science Conference Proceedings (OSTI)

Symposium, Measurements and Modeling of Advanced Automotive and Structural Materials at Intermediate and High Strain Rates. Presentation Title, Dynamic...

255

132- Microstructure and Composition Modifications in a Mg AZ80 ...  

Science Conference Proceedings (OSTI)

086- Improvement in Gas Tightness of YSZ Coatings Produced by Atmospheric Plasma ... 145- The Synergy of XRD and XRF in a Shale and Slate Analysis.

256

Corrosion Mechanism of Anodized AZ91D and Its Biological ...  

Science Conference Proceedings (OSTI)

... Templates Facilitates Neural Stem Cell Adhesion, Proliferation and Differentiation ... Improving the Resistance of Ceramic Surfaces to Biofilm Formation ... Sol-Gel Synthesis of Bio-Active Nanoporous Sodium Zirconate Coated on 316L...

257

Nogales, AZ Liquefied Natural Gas Exports to Mexico  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Exports by Point of Exit (Volumes in Million Cubic Ft., Prices in Dollars per Thousand Cubic Ft.)

258

SME Annual Meeting Feb. 28-Mar. 03, 2010, Phoenix, AZ  

E-Print Network (OSTI)

-066 DESIGNING AND MODELING WIRELESS MESH COMMUNICATIONS IN UNDERGROUND COAL MINES K. R. Griffin, Virginia Tech recent regulatory developments in underground coal communication systems, the implementation of these new technologies were limited. After several coal mining accidents in early 2006, the United States Congress

259

SME Annual Meeting Feb. 28-Mar. 03, 2010, Phoenix, AZ  

E-Print Network (OSTI)

-090 DECREASED CARBON FOOTPRINT THROUGH EFFECTIVE COAL DEGASIFICATION S. Keim, Virginia Tech, Blacksburg, VA K industry sector. Specifically, the combustion of one ton of coal produces between one and three tons of carbon dioxide, dependent upon the carbon content and heating value of the combusted coal. Additionally

260

Anemometer Data (Wind Speed, Direction) for Pascua Yaqui, AZ...  

Open Energy Info (EERE)

Powering America, a DOE Office of Energy Efficiency & Renewable Energy (EERE) program. A dynamic map displaying all available data from DOE anemometer loan programs...

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

Improving Melt Cleanliness and Mechanical Properties of AZ91E ...  

Science Conference Proceedings (OSTI)

Conference Tools for COM 2011 ... Presenter/Author Tools ... that has been linked to changing weather patterns and other extreme weather phenomenon.

262

DOE Research and Development Accomplishments Site Index (A-Z...  

Office of Scientific and Technical Information (OSTI)

A - Z Index A B C D E F G H I J K L M N O P Q R S T U V W X Y Z A Abrikosov, Alexei Abrikosov, Alexei: Publications activated complex theory of reaction rates adenosine...

263

Tatyana V. Wilds, Most Pure Heart of Mary School, Topeka, KS  

E-Print Network (OSTI)

in San Francisco Stalin, Churchill/Attlee meet in Potsdam US drops Atomic Bomb on Hiroshima and Nagasaki) Churchill's "Iron Curtain" speech in Fulton, Missouri 1949 Soviets detonate their first Atomic Bomb in the Cold War. For example, what if Truman had not fired General Macarthur and he had decided to drop bombs

Peterson, Blake R.

264

# workstation-ks.cfg # version 1.0.0 2011-09-30 # Copyright ...  

Science Conference Proceedings (OSTI)

... 9 (Rows 2 - 6) volgroup vgroup1 pv.01 logvol ... row 134) -sysklogd rsyslog # Post-install commands # Some post-installation configuration can ...

2013-05-30T23:59:59.000Z

265

KS-REPORT(7-24-87} The Eigenvalue Problem for an N-Sector Ring  

E-Print Network (OSTI)

\\.., -.. ·~.t~ -..-7. -..-.. ~ -,.. -')It · · ... ,.- J ·· ··· 5 ·· ··· :-O' ··· ··· leee -7. 10 · ttl L(H · ,01

Kemner, Ken

266

Search for Lepton Flavour Violating Decays Tau -> l Ks with the BABAR Detector  

SciTech Connect

We present the search for the lepton flavour violating decay {tau} {yields} lK{sup 0}{sub s} with the BaBar experiment data. This process and many other lepton flavour violating {tau} decays, like {tau} {yields} {mu}{gamma} and {tau} {yields} lll, are one of the most promising channel to search for evidence of new physics. According to the Standard Model and the neutrino mixing parameters, branching fractions are estimated well below 10{sup -14}, but many models of new physics allow for branching fractions values close to the present experimental sensitivity. This analysis is based on a data sample of 469fb{sup -1} collected by BABAR detector at the PEP-II storage ring from 1999 to 2007, equivalent to 431 millions of {tau} pairs. the BABAR experiment, initially designed for studying CP violation in B mesons, has demonstrated to be one of the most suitable environments for studying {tau} decays. The tracking system, the calorimeter and the particle identification of BABAR, together with the knowledge of the {tau} initial energy, allow an extremely powerful rejection of background events that, for this analysis, is better than 10{sup -9}. Being {tau} {yields} lK{sup 0}{sub s} a decay mode without neutrinos, the signal {tau} decay can be fully reconstructed. Kinematical constraints are used in a fit that provides a decay tree reconstruction with a high resolution. For this analysis MC simulated events play a decisive role for estimating the signal efficiency and study the residual background. High statistics MC sample are produced simulating detector conditions for different periods of data collection, in order to reduce any discrepancies with the data. When discrepancies can not be removed, we perform studies to compute a correction factor or an estimation of systematic errors that need to be included in the final measurement. A significant improvement of the current result can be reached only with a higher statistics and, therefore, with a new collider providing a luminosity from 10 to 100 times more than PEP-II. A new detector, with improved performance and able to collect data in a high background environment, is also requested to fully exploit the capability of such amount of data. In fact, only keeping the efficiency and the background as similar as possible to present ones, we will be able to scale almost linearly the estimated upper limit according to the luminosity. The strong potential of improvement for the search of lepton flavour violation {tau} decays makes the building of such a machine highly desirable.

Cenci, Riccardo; /SLAC

2009-03-20T23:59:59.000Z

267

Search for CP Violation in the Decay D+/- to Ks pi+/-  

SciTech Connect

We report on a search for CP violation in the decay D{sup {+-}} {yields} K{sub S}{sup 0}{pi}{sup {+-}} using a data set corresponding to an integrated luminosity of 469 fb{sup -1} collected with the BABAR detector at the PEP-II asymmetric energy e{sup +}e{sup -} storage rings. The CP-violating decay rate asymmetry A{sub CP} is determined to be (-0.44 {+-} 0.13(stat) {+-} 0.10(syst))%, consistent with zero at 2.7 {sigma} and with the standard model prediction of (-0.332 {+-} 0.006)%. This is currently the most precise measurement of this parameter.

del Amo Sanchez, P.; Lees, J.P.; Poireau, V.; Prencipe, E.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Martinelli, M.; /INFN, Bari /Bari U.; Milanes, D.A.; /INFN, Bari; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Brown, D.N.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G.; Osipenkov, I.L.; /UC, Berkeley; Koch, H.; Schroeder, T.; /Ruhr U., Bochum /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UC, Riverside /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /Frascati /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /Indian Inst. Tech., Guwahati /Harvard U. /Harvey Mudd Coll. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa State U. /Iowa State U. /Johns Hopkins U. /Paris U., VI-VII /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Royal Holloway, U. of London /Louisville U. /Mainz U., Inst. Kernphys. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /INFN, Naples /Naples U. /NIKHEF, Amsterdam /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /Rostock U. /Rutherford /DAPNIA, Saclay /SLAC /South Carolina U. /Southern Methodist U. /Stanford U., Phys. Dept. /SUNY, Albany /Tel Aviv U. /Tennessee U. /Texas Nuclear Corp., Austin /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U. /Victoria U. /Warwick U. /Wisconsin U., Madison

2011-08-22T23:59:59.000Z

268

Demonstration Assessment of Light-Emitting Diode (LED) Parking Lot Lighting in Leavenworth, KS  

SciTech Connect

This report describes the process and results of a demonstration of solid-state lighting (SSL) technology in a commercial parking lot lighting application, under the U.S. Department of Energy (DOE) Solid-State Lighting Technology GATEWAY Demonstration Program. The parking lot is for customers and employees of a Walmart Supercenter in Leavenworth, Kansas and this installation represents the first use of the LED Parking Lot Performance Specification developed by the DOEs Commercial Building Energy Alliance. The application is a parking lot covering more than a half million square feet, lighted primarily by light-emitting diodes (LEDs). Metal halide wall packs were installed along the building facade. This site is new construction, so the installed baseline(s) were hypothetical designs. It was acknowledged early on that deviating from Walmarts typical design would reduce the illuminance on the site. Walmart primarily uses 1000W pulse-start metal halide (PMH) lamps. In order to provide a comparison between both typical design and a design using conventional luminaires providing a lower illuminance, a 400W PMH design was also considered. As mentioned already, the illuminance would be reduced by shifting from the PMH system to the LED system. The Illuminating Engineering Society of North America (IES) provides recommended minimum illuminance values for parking lots. All designs exceeded the recommended illuminance values in IES RP-20, some by a wider margin than others. Energy savings from installing the LED system compared to the different PMH systems varied. Compared to the 1000W PMH system, the LED system would save 63 percent of the energy. However, this corresponds to a 68 percent reduction in illuminance as well. In comparison to the 400W PMH system, the LED system would save 44 percent of the energy and provide similar minimum illuminance values at the time of relamping. The LED system cost more than either of the PMH systems when comparing initial costs. However, when the life-cycle costs from energy and maintenance were factored into the scenario, the LED system had lower costs at the end of a 10-year analysis period. The LED system had a 6.1 year payback compared to the 1000W PMH system and a 7.5 year payback versus the 400W PMH system. The costs reflect high initial cost for the LED luminaire, plus more luminaires and (subsequently) more poles for the LED system. The other major issue affecting cost effectiveness was that Leavenworth, Kansas has very low electricity costs. The melded rate for this site was $0.056 per kWh for electricity. However, if the national electricity rate of $0.1022/kWh was used the payback would change to between four and five years for the LED system. This demonstration met the GATEWAY requirements of saving energy, matching or improving illumination, and being cost effective. The project also demonstrated that the Commercial Building Energy Alliance (CBEA) specification works in practice. Walmart appreciated having an entire site lighted by LEDs to gain more experience with the technology. Walmart is reviewing the results of the demonstration as they consider their entire real estate portfolio.

Myer, Michael; Kinzey, Bruce R.; Curry, Ku'uipo

2011-05-06T23:59:59.000Z

269

Search for Lepton Flavour Violating Decays tau- to l- Ks with the BaBar experiment  

SciTech Connect

A search for the lepton flavor violating decays {tau}{sup -} {yields} l{sup -} K{sub S}{sup 0} (l = e or {mu}) has been performed using a data sample corresponding to an integrated luminosity of 469 fb{sup -1}, collected with the BABAR detector at the SLAC PEP-II e{sup +}e{sup -} asymmetric energy collider. No statistically significant signal has been observed in either channel and the estimated upper limits on branching fractions are {Beta}({tau}{sup -} {yields} e{sup -} K{sub S}{sup 0}) < 3.3 x 10{sup -8} and {Beta}({tau}{sup -} {yields} {mu}{sup -}K{sub S}{sup 0}) < 4.0 x 10{sup -8} at 90% confidence level.

Aubert, B.; Bona, M.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Lopez, L.; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Cahn, R.N.; Jacobsen, R.G.; /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /Frascati /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Karlsruhe U., EKP /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT, LNS /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /INFN, Naples /Naples U. /INFN, Naples /INFN, Naples /Naples U. /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /Pennsylvania U. /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison

2009-01-06T23:59:59.000Z

270

Measurement of Time-Dependent CP Asymmetry in B0 --> KS pi0 gamma Decays  

SciTech Connect

The authors measure the time-dependent CP asymmetry in B{sup 0} {yields} K{sub S}{sup 0}{pi}{sup 0}{gamma} decays for two regions of K{sub S}{sup 0}-{pi}{sup 0} invariant mass, m(K{sub S}{sup 0}{pi}{sup 0}), using the final BABAR data set of 467 x 10{sup 6} B{bar B} pairs collected at the PEP-II e{sup +}e{sup -} collider at SLAC. They find 339 {+-} 24 B{sup 0} {yields} K*{sup 0}{gamma} candidates and measure S{sub K*{gamma}} = -0.03 {+-} 0.29 {+-} 0.03 and C{sub K*{gamma}} = -0.14 {+-} 0.16 {+-} 0.03. In the range 1.1 < m(K{sub S}{sup 0}{pi}{sup 0}) < 1.8 GeV/c{sup 2} they find 133 {+-} 20 B{sup 0} {yields} K{sub S}{sup 0}{pi}{sup 0}{gamma} candidates and measure S{sub K{sub S}{sup 0}{pi}{sup 0}{gamma}} = -0.78 {+-} 0.59 {+-} 0.09 and C{sub K{sub S}{sup 0}{pi}{sup 0}{gamma}} = -0.36 {+-} 0.33 {+-} 0.04. The uncertainties are statistical and systematic, respectively.

Aubert, Bernard; Bona, M.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Lopez, L.; Palano, Antimo; Pappagallo, M.; /Bari U. /INFN, Bari; Eigen, G.; Stugu, Bjarne; Sun, L.; /Bergen U.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Cahn, Robert N.; Jacobsen, R.G.; /LBL, Berkeley /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /Ferrara U. /INFN, Ferrara /Frascati /Genoa U. /INFN, Genoa /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Karlsruhe U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /Consorzio Milano Ricerche /INFN, Milan /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /Napoli Seconda U. /INFN, Naples /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /Padua U. /INFN, Padua /Paris U., VI-VII /Pennsylvania U. /Perugia U. /INFN, Perugia /INFN, Pisa /Princeton U. /Banca di Roma /Frascati /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /Turin U. /INFN, Turin /Trieste U. /INFN, Trieste /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison

2008-10-20T23:59:59.000Z

271

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...

272

C:\\ANNUAL\\VENTCHAP.V8\\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...

273

Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997

274

MI ROPYROLIZER FOR RAPID IOIDENTIFI ATION  

POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...

275

MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2

276

Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...

277

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...

278

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...

279

Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...

280

Obama Administration Announces Additional $63,817,400 for Local...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

AZ Mohave County 408,700 AZ Navajo County 473,900 AZ Pima County 3,981,900 AZ Pinal County 2,060,800 AZ Yavapai County 548,200 AZ Yuma County 427,700 In addition,...

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

Measurement of $D^0-overline{D}^0$ mixing parameters using $D^0 \\to K_S^0 \\pi^ \\pi^-$ and $D^0 \\to K_S^0 K^ K^-$ decays  

Science Conference Proceedings (OSTI)

We report a direct measurement of D{sup 0}-{bar D}{sup 0} mixing parameters through a time-dependent amplitude analysis of the Dalitz plots of D{sup 0} {yields} K{sub S}{sup 0}{pi}{sup +}{pi}{sup -} and, for the first time, D{sup 0} {yields} K{sub S}{sup 0}K{sup +}K{sup -} decays. The low-momentum pion {pi}{sub s}{sup +} in the decay D*{sup +} {yields} D{sup 0}{pi}{sub s}{sup +} identifies the flavor of the neutral D meson at its production. Using 468.5 fb{sup -1} of e{sup +}e{sup -} colliding-beam data recorded near {radical}s = 10.6 GeV by the BABAR detector at the PEP-II asymmetric-energy collider at SLAC, we measure the mixing parameters x = [1.6 {+-} 2.3 (stat.) {+-} 1.2 (syst.) {+-} 0.8 (model)] x 10{sup -3}, and y = [5.7 {+-} 2.0 (stat.) {+-} 1.3 (syst.) {+-} 0.7 (model)] x 10{sup -3}. These results provide the best measurement to date of x and y. The knowledge of the value of x, in particular, is crucial for understanding the origin of mixing.

del Amo Sanchez, P.; Lees, J.P.; Poireau, V.; Prencipe, E.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Martinelli, M.; Palano, A.; Pappagallo, M.; /Bari U. /INFN, Bari; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Battaglia, M.; Brown, D.N.; Hooberman, B.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G.; Osipenkov, I.L.; Tanabe, T.; /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UC, Riverside /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /Ferrara U. /INFN, Ferrara /Frascati /Columbus Supercond., Genova /INFN, Genoa /Indian Inst. Tech., Guwahati /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa State U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Mainz U., Inst. Kernphys. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /Consorzio Milano Ricerche /INFN, Milan /Mississippi U. /Montreal U. /Napoli Seconda U. /INFN, Naples /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /Padua U. /INFN, Padua /Paris U., VI-VII /Perugia U. /INFN, Perugia /INFN, Pisa /Princeton U. /Banca di Roma /INFN, Rome /Rostock U. /Rutherford /DAPNIA, Saclay /SLAC /South Carolina U. /Southern Methodist U. /Stanford U., Phys. Dept. /SUNY, Albany /Tel Aviv U. /Tennessee U. /Texas U. /Texas U., Dallas /Turin U. /INFN, Turin /Trieste U. /INFN, Trieste /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison

2011-08-19T23:59:59.000Z

282

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Gasoline and Diesel Fuel Update (EIA)

accomplishments accomplishments are impressive in themselves, and associ- ated with each milestone is the expansion of future produc- tion opportunities as another technical barrier is overcome. The extension of recovery opportunities into deep water has established the deep offshore as an area of considerable national significance. A second source of increased supply is gas from coalbed formations. Natural gas production from coalbed methane fields continued to grow in 1996 as projects initiated mainly in the early to mid 1990's matured through the dewatering phase into higher rates of gas production. Coalbed forma- tions contribute almost 1 trillion cubic feet, roughly 5 per- cent, to total U.S. production. Continued production growth from coalbeds is not likely in light of the precipitous drop in new wells completed in coalbed formations since the termination of the production tax

283

Mycologia, 96(4), 2004, pp. 866878. 2004 by The Mycological Society of America, Lawrence, KS 66044-8897  

E-Print Network (OSTI)

66044-8897 Two new Ophiostoma species with Sporothrix anamorphs from Austria and Azerbaijan Dilzara N with Sporothrix anamorphs recently collected in Austria and Azerbaijan. The isolates were charac- terized based and Azerbaijan. Growth at 25 C and morphology revealed some differences between the two groups, and supported

284

Mycologia, 96(3), 2004, pp. 548557. 2004 by The Mycological Society of America, Lawrence, KS 66044-8897  

E-Print Network (OSTI)

exorientia. Rhizoidaceae structurae absentes. Stip- ites erectus, pallide brunnei vel atro-brunnei, 1

285

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Annual Energy Outlook 2012 (EIA)

857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 15. Average City Gate Price of Natural...

286

Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)

T I D O R W Y ND SD C A N V U T CO NE KS A Z NM OK TX MN WI MI IA I L IN OH MO AR M S AL GA T N KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI A K J a p a n Mexico M e x...

287

dynamic characterization of az31b and zek100 magnesium alloy ...  

Science Conference Proceedings (OSTI)

Jul 20, 2012 ... If the price of this product displays as $0.00 for your customer category, you may download it for free. You must, however, add it to your cart and...

288

assessment of hot cracking susceptibility in az91e using the ...  

Science Conference Proceedings (OSTI)

Jul 20, 2012 ... If the price of this product displays as $0.00 for your customer category, you may download it for free. You must, however, add it to your cart and...

289

GRED III Final Report Clifton Hot Springs Geothermal Greenlee County, AZ  

SciTech Connect

Black & Veatch Corporation has prepared this report for Arizona Public Service Company, Salt River Project, and Tucson Electric Power Company (APS/SRP/TEP). The purpose of this report is to assess the prospects for significant renewable energy development in Arizona. The scope of the study is limited to Arizona projects that would export power to the grid (that is, not distributed energy projects). This study includes a review of the current status of renewable energy in Arizona, characterization of renewable power generation technologies, assessment of Arizona''s renewable resources, and an assessment of key risk factors. This section summarizes the key findings in these areas.

Brown, David E.

2006-06-15T23:59:59.000Z

290

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

What is the role of coal in the United States? ... Ancillary Services (Electricity) ... The EIA Glossary includes definitions of technical terms.

291

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Commercial Buildings Energy Consumption Survey (CBECS ) (# of buildings, ... Consumption of Petroleum (Petroleum Products Supplied; includes U.S. & International)

292

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Alternative fuels survey forms; ... Availability and Price of Petroleum and Petroleum Products Produced in Countries Other Than Iran, The ; Average diesel fuel price

293

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

NERC (North American Electric Reliability Corporation; includes U.S. and Canada) Definition; Map; NERC Web Site (Leave EIA Site)

294

An A-Z of offshore oil and gas. Second ed  

Science Conference Proceedings (OSTI)

This is an illustrated international glossary and reference guide to the offshore oil and gas industries, and their technology. It contains more than 4,000 terms in current use, with 20 full-page maps and 200 line drawings, plus extensive appendices. The new edition has been considerably expanded, revised and updated. There are new features on subjects such as: new drilling rigs, fire and gas detection, gas dehydration, accommodation platforms, new articulated loading platforms, acoustic enclosures, and more. There are additional tables and maps as well as many more terms which have now come into practical use.

Whitehead, H.

1983-01-01T23:59:59.000Z

295

Evaluation of Plug Power Gensys 5C Fuel Cell System in Mesa, AZ: Final Report  

Science Conference Proceedings (OSTI)

A pre-commercial Plug Power Gensys 5C fuel cell was installed at the Arizona State University - Photovoltaic Testing Laboratory (ASU-PTL). The proton exchange membrane (PEM) fuel cell is fueled with natural gas and exports up to 5 kW to the local electrical grid. The overall performance and maintenance history over 18 months of operation is chronicled. PEM fuel cells are being positioned by Plug Power and other vendors as residential power generators.

2006-01-25T23:59:59.000Z

296

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Biofuels: Ethanol & Biodiesel ... Wholesale Electricity (See Electric Sales for Resale) Wholesale Market Data (Electricity) Why are gasoline prices higher in some ...

297

NEWS SPORT WEATHER WORLD SERVICE A-Z INDEX SEARCH You are in: Science/Nature  

E-Print Network (OSTI)

99 | Science/Nature Should the cold fusion dream die? 11 Sep 00 | Festival of science Arthur C Clarke demands cold fusion rethink Internet links: Nature Science Kenneth Suslick Oak Ridge National Laboratory Thursday, 25 July, 2002, 11:15 GMT 12:15 UK Fusion experiment disappoints The idea that we could build

Suslick, Kenneth S.

298

ABOUT CALENDAR FEES ENROLLMENT RECORDS University Home MyUCSC People Calendars A-Z Index  

E-Print Network (OSTI)

. Paul, Jr. Art Kirk Willis History 1999 Noel Fallows Romance Languages (postponed until end of headship Geography Bernard Dauenhauer Philosophy & Religion Paul Edmonston Art Mary Legler Music William Free English Art Frank K. Gibson Political Science Richard Hill Chemistry Charles Patterson English Warren Spencer

California at Santa Cruz, University of

299

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Think of it like the index of a book. It is structured so that synonyms, acronyms, and cross-referencing provide multiple ways for you to access information.

300

The Effects of Nickel in Oxide Layers on the AZ91 Mg Alloys ...  

Science Conference Proceedings (OSTI)

Aerosol Route Synthesis of Copper Oxide Nanoparticles Using Copper Nitrate Solution AlGaAs-Based Optical ... Defect Energetics and Fission Product Transport in ZrC ... Enhancing Mineral Beneficiation by High Intensity Power Ultrasound.

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Energy Information Administration - EIA - Official Energy Statistics from the U.S. Government ... Alternative Fuels. Includes hydropower, solar, wind, geothermal, ...

302

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Aluminum Industry Analysis Brief ; American Clean Energy and Security Act of 2009 - Analysis of Energy Market and Economic Impacts of H.R. 2454 ;

303

double-sided arc welding of az31b magnesium alloy sheet  

Science Conference Proceedings (OSTI)

Jul 20, 2012... tailor-welded blanks for forming automotive structural components. ... initial investigations suggest that visually acceptable symmetrical welds...

304

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Energy Information Administration ... solar, wind, geothermal, biomass and ethanol. ... EIS: Environmental Impact Statement;

305

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Petroleum & Other Liquids. Crude oil, gasoline, heating oil, diesel, propane, and other liquids including biofuels and natural gas liquids. ...

306

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Energy use in homes, commercial buildings, manufacturing, and transportation. ... Jobs (With the Energy Information Administration) Jordan Country ...

307

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Air-Conditioning, Number of Households With; Air Pollution Abatement Equipment; Air Pollution Emissions Data (Leave EIA) Alabama Energy Profile; Alaska ...

308

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

SPP: small power producer; SPR: ... VAWT: vertical-axis wind turbine; VLCC: very large crude carrier; VMT: vehicle miles traveled; VOC: volatile ...

309

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Petroleum & Other Liquids. Crude oil, gasoline, heating oil, diesel, propane, and other liquids including biofuels and natural gas liquids. Natural Gas

310

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Copyright & Reuse Accessibility. Related Sites U.S. Department of Energy USA.gov FedStats. Stay Connected Facebook Twitter YouTube Email Updates RSS Feeds ...

311

Solidification Heat Transfer Analysis of AZ91D Cast Strip by Using a ...  

Science Conference Proceedings (OSTI)

The heat transfer coefficient between the molten magnesium ally and copper roll is important to cast magnesium strip. In the present study investigate the heat...

312

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Electricity. Sales, revenue and prices, power plants, fuel use, stocks, ... Petroleum Cost to Electric Power Industry (U.S., Census Divsion & State) Annual;

313

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Analysis & Projections. Monthly and yearly energy forecasts, analysis of energy topics, financial analysis, Congressional reports. Markets & ...

314

SIAM Conference on Numerical Combustion Sedona, AZ May 9-12, 2004  

Science Conference Proceedings (OSTI)

The Society for Industrial and Applied Mathematics hosted the Tenth International Conference on Numerical Combustion held May 9-12, 2004 in Sedona, Arizona. This distinguished conference series began in 1985 in Sophia Antipolis, France and was followed by conferences in San Francisco, California (1987), Juan les Pins, France (1989), St. Petersburg Beach, Florida (1991), Garmisch, Germany (1993), New Orleans, Louisiana (1996), York, England (1998), Amelia Island, Florida (2000), and Sorrento, Italy (2002). SIAM is widely recognized as the originator and the U.S. anchor of this important meeting whose topics concerns the applied mathematics and computation associated with combustion and reactive flow. In particular, the International Numerical Combustion Symposiums have become one of the international major venues for research on direct simulation and modeling turbulent reacting flow. It is also one of the major international venues for theoretical work in reacting flows. This meeting drew approximately 200 participants from 30 countries whose research included the topics in turbulence, kinetics, detonation, flames, pollution, microgravity, micro-combustion, ignition, applications of parallel processing, tera-scale computation of combustion applications, material synthesis, droplets and sprays, heterogeneous combustion, energetic materials (propellants and explosives), engine and furnace combustion, fires, numerical methods and, software engineering for combustion applications.

None

2004-09-23T23:59:59.000Z

315

Maintenance of Open Chromatin States by Histone H3 Eviction and H2A.Z  

E-Print Network (OSTI)

coregulator occupancy and chromatin modification. Proc Natlsuggested that 30-50% of chromatin-bound H3 undergoesa broad range of chromatin-based phenotypes, including

Lombardi, Laura

2011-01-01T23:59:59.000Z

316

Lattice Strain Evolution during In-situ Deformation of AZ31 Alloy ...  

Science Conference Proceedings (OSTI)

Based on the deviation of the lattice strain from its linear elastic trajectory, basal slip is identified in (10-12) and (10-13) grains at ~ 75 and 90 MPa respectively.

317

deformation behaviour of az80 subject to multi-axial tensile loading  

Science Conference Proceedings (OSTI)

Jul 20, 2012 ... If the price of this product displays as $0.00 for your customer category, you may download it for free. You must, however, add it to your cart and...

318

Ethanol Addition for Enhancing Denitrification at the Uranium Mill Tailing Site in Monument Valley, AZ  

Science Conference Proceedings (OSTI)

Uranium mining and processing near Monument Valley, Arizona resulted in the formation of a large nitrate plume in a shallow alluvial aquifer. The results of prior field characterization studies indicate that the nitrate plume is undergoing a slow rate of attenuation via denitrification, and the results of bench-scale studies suggest that denitrification rates can potentially be increased by an order of magnitude with the addition of ethanol as a carbon substrate. The objective of the study was to investigate the potential of ethanol amendment for enhancing the natural denitrification occurring in the alluvial aquifer. Pilot tests were conducted using the single well, push-pull method and a natural-gradient test. The results showed that the concentration of nitrate decreased, while the concentration of nitrous oxide (a product of denitrification) increased. In addition, changes in aqueous concentrations of sulfate, iron, and manganese indicate the ethanol amendment effected a change in prevailing redox conditions. The results of compound-specific stable isotope analysis for nitrogen indicated that the nitrate concentration reductions were biologically mediated. Continued monitoring after completion of the pilot tests has shown that nitrate concentrations in the injection zone have remained at levels three orders of magnitude lower than the initial values, indicating that the impacts of the pilot tests have been sustained for several months.

Borden, A. K.; Brusseau, M. L.; Carroll, Kenneth C.; McMillan, Andrew; Akyol, N. H.; Berkompas, J.; Miao, Z.; Jordan, F.; Tick, Geoff; Waugh, W. J.; Glenn, E. P.

2012-01-01T23:59:59.000Z

319

Microsoft Word - WESTCARB AZ Pilot FactSheet--BKi 10-28.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

yet the area hosts one of the West's largest concentration of baseload coal-fired power plants, making it an ideal location for future CO 2 capture and storage projects....

320

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Exploration and reserves, storage, imports and exports, production, prices, sales ... State Energy Data System ... provide multiple ways for you to access ...

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

The EIA Glossary includes definitions of technical terms. Please use the glossary to find the meanings of words. What items are included?

322

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

R. Rack Prices (Gasoline; includes U.S., PADD & State) Data; Definition; Rack Sales (Gasoline; includes U.S., PADD & State) Data; Definition; Railroad ...

323

Wahlfach II: ,,Ansthesie von A-Z Von der Prmedikation bis zur postoperativen Visite"  

E-Print Network (OSTI)

://www.bmbf.de/pub/begabtenfoerderungswerke.pdf Handbuch Promotion: Forschung - Förderung ­ Finanzierung Ansgar Nünning/Roy Sommer (Hrsg.) Verlag: Metzler

Manstein, Dietmar J.

324

C22 Twinning Behavior in AZ31-B Polycrystal Texture Subjected to ...  

Science Conference Proceedings (OSTI)

A37 Unconventional Method of Nitriding of 316l Austenitic Steel A38 Role of ..... I24 The Study of Cotton Finishing by Artemsia Argyi Oil Microcapsules.

325

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Major Coal Consumer (Manufacturers and Coke Plants) Major Coal Mines ... Miles Driven per Vehicle; Miles per Gallon; Minnesota Energy Profile ; ...

326

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Smart Grid (Electrical System) Study; SO 2 Emissions (Electricity Industry) Solar Electricity Generation; Solar Energy Potential (map) Photovoltaic; Solar ...

327

A-Z Index - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Electric Power Grid; Electric Power Industry Maps; Electric Power Monthly (Report; ... Electrical System Smart Grid Study; Electricity (Main Electricity Web Page)

328

Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P

2003-01-01T23:59:59.000Z

329

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...

330

Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...

331

A FUNDAMENTAL REAKTHROUGH IN HEAT TRANSFER TE HNOLOGY FOR MI ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION

332

Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)

333

Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael

2008-01-01T23:59:59.000Z

334

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as

335

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake

336

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1996  

E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.

337

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1994  

E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.

338

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...

339

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...

340

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...

342

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...

343

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...

344

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...

345

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...

346

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...

347

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...

348

St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...

349

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...

350

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...

351

St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...

352

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...

353

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...

354

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...

355

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...

356

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...

357

ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks

358

miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha

2012-01-01T23:59:59.000Z

359

Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.

360

Better Buildings Neighborhood Program: Fayette County, Pennsylvania  

NLE Websites -- All DOE Office Websites (Extended Search)

Fayette Fayette County, Pennsylvania to someone by E-mail Share Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Facebook Tweet about Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Twitter Bookmark Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Google Bookmark Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Delicious Rank Better Buildings Neighborhood Program: Fayette County, Pennsylvania on Digg Find More places to share Better Buildings Neighborhood Program: Fayette County, Pennsylvania on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Better Buildings Neighborhood Program: Better Buildings Partners  

NLE Websites -- All DOE Office Websites (Extended Search)

Better Better Buildings Partners to someone by E-mail Share Better Buildings Neighborhood Program: Better Buildings Partners on Facebook Tweet about Better Buildings Neighborhood Program: Better Buildings Partners on Twitter Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Google Bookmark Better Buildings Neighborhood Program: Better Buildings Partners on Delicious Rank Better Buildings Neighborhood Program: Better Buildings Partners on Digg Find More places to share Better Buildings Neighborhood Program: Better Buildings Partners on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY

362

Better Buildings Neighborhood Program: Bainbridge Island, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Bainbridge Bainbridge Island, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Bainbridge Island, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Bainbridge Island, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Bainbridge Island, Washington on Google Bookmark Better Buildings Neighborhood Program: Bainbridge Island, Washington on Delicious Rank Better Buildings Neighborhood Program: Bainbridge Island, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Bainbridge Island, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO

363

Better Buildings Neighborhood Program: Jacksonville, Florida  

NLE Websites -- All DOE Office Websites (Extended Search)

Jacksonville, Jacksonville, Florida to someone by E-mail Share Better Buildings Neighborhood Program: Jacksonville, Florida on Facebook Tweet about Better Buildings Neighborhood Program: Jacksonville, Florida on Twitter Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Google Bookmark Better Buildings Neighborhood Program: Jacksonville, Florida on Delicious Rank Better Buildings Neighborhood Program: Jacksonville, Florida on Digg Find More places to share Better Buildings Neighborhood Program: Jacksonville, Florida on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC

364

Better Buildings Neighborhood Program: Communities Throughout Oregon  

NLE Websites -- All DOE Office Websites (Extended Search)

Communities Communities Throughout Oregon to someone by E-mail Share Better Buildings Neighborhood Program: Communities Throughout Oregon on Facebook Tweet about Better Buildings Neighborhood Program: Communities Throughout Oregon on Twitter Bookmark Better Buildings Neighborhood Program: Communities Throughout Oregon on Google Bookmark Better Buildings Neighborhood Program: Communities Throughout Oregon on Delicious Rank Better Buildings Neighborhood Program: Communities Throughout Oregon on Digg Find More places to share Better Buildings Neighborhood Program: Communities Throughout Oregon on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO

365

Better Buildings Neighborhood Program: Indianapolis, Indiana  

NLE Websites -- All DOE Office Websites (Extended Search)

Indianapolis, Indianapolis, Indiana to someone by E-mail Share Better Buildings Neighborhood Program: Indianapolis, Indiana on Facebook Tweet about Better Buildings Neighborhood Program: Indianapolis, Indiana on Twitter Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Google Bookmark Better Buildings Neighborhood Program: Indianapolis, Indiana on Delicious Rank Better Buildings Neighborhood Program: Indianapolis, Indiana on Digg Find More places to share Better Buildings Neighborhood Program: Indianapolis, Indiana on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC

366

Measurement of Branching Fractions and CP Asymmetries in B -> wK Decays and First Evidence of CP Violation in B0 -> wKS0  

E-Print Network (OSTI)

We present a measurement of the branching fractions and charge-parity (CP) violating parameters in B --> omega K decays. The results are obtained from the final data sample containing 772 million BBbar pairs collected at the {\\Upsilon}(4S) resonance with the Belle detector at the KEKB asymmetric-energy e+e- collider. We obtain the branching fractions, B(B0 --> omega K0) = (4.5+/- 0.4 (stat) +/- 0.3 (syst)) x 10^-6, B(B+ --> omega K+) = (6.8 +/- 0.4 (stat) +/- 0.4 (syst)) x 10^-6, which are in agreement with their respective current world averages. For the CP violating parameters we obtain, A (B0 --> omega K0S) = -0.36 +/- 0.19 (stat) +/- 0.05 (syst), S (B0 --> omega K0S) = +0.91 +/- 0.32 (stat) +/- 0.05 (syst), A (B+ --> omega K+) = -0.03 +/- 0.04 (stat) +/- 0.01 (syst), where A and S represent the direct and mixing-induced CP asymmetry, respectively. We find no evidence of CP violation in the decay channel B+ --> omega K+; however, we obtain the first evidence of CP violation in the B0 --> omega K0 decay channel at the level of 3.1 standard deviations.

V. Chobanova; J. Dalseno; C. Kiesling; I. Adachi; H. Aihara; D. M. Asner; V. Aulchenko; T. Aushev; T. Aziz; A. M. Bakich; A. Bala; Y. Ban; K. Belous; B. Bhuyan; A. Bobrov; G. Bonvicini; A. Bozek; M. Bra?ko; T. E. Browder; D. ?ervenkov; V. Chekelian; A. Chen; B. G. Cheon; K. Chilikin; R. Chistov; K. Cho; Y. Choi; D. Cinabro; M. Danilov; Z. Doleal; Z. Drsal; D. Dutta; K. Dutta; S. Eidelman; S. Esen; H. Farhat; J. E. Fast; T. Ferber; V. Gaur; N. Gabyshev; S. Ganguly; A. Garmash; R. Gillard; Y. M. Goh; B. Golob; J. Haba; K. Hayasaka; X. H. He; Y. Horii; Y. Hoshi; W. -S. Hou; Y. B. Hsiung; H. J. Hyun; T. Iijima; K. Inami; A. Ishikawa; Y. Iwasaki; T. Iwashita; I. Jaegle; T. Julius; J. H. Kang; E. Kato; H. Kawai; T. Kawasaki; D. Y. Kim; H. J. Kim; J. B. Kim; J. H. Kim; M. J. Kim; Y. J. Kim; K. Kinoshita; J. Klucar; B. R. Ko; P. Kody; S. Korpar; P. Krokovny; B. Kronenbitter; T. Kuhr; T. Kumita; A. Kuzmin; J. S. Lange; S. -H. Lee; J. Li; Y. Li; L. Li Gioi; J. Libby; D. Liventsev; P. Lukin; D. Matvienko; K. Miyabayashi; H. Miyake; H. Miyata; R. Mizuk; G. B. Mohanty; A. Moll; N. Muramatsu; R. Mussa; E. Nakano; M. Nakao; Z. Natkaniec; M. Nayak; E. Nedelkovska; C. Ng; N. K. Nisar; S. Nishida; O. Nitoh; S. Ogawa; S. Okuno; P. Pakhlov; G. Pakhlova; C. W. Park; H. Park; H. K. Park; T. K. Pedlar; T. Peng; R. Pestotnik; M. Petri?; L. E. Piilonen; M. Ritter; M. Rhrken; A. Rostomyan; H. Sahoo; T. Saito; Y. Sakai; L. Santelj; T. Sanuki; V. Savinov; O. Schneider; A. J. Schwartz; D. Semmler; K. Senyo; O. Seon; M. E. Sevior; M. Shapkin; T. -A. Shibata; J. -G. Shiu; B. Shwartz; A. Sibidanov; F. Simon; Y. -S. Sohn; S. Stani?; M. Stari?; M. Steder; K. Sumisawa; T. Sumiyoshi; U. Tamponi; G. Tatishvili; Y. Teramoto; K. Trabelsi; M. Uchida; T. Uglov; Y. Unno; S. Uno; C. Van Hulse; P. Vanhoefer; G. Varner; K. E. Varvell; A. Vinokurova; V. Vorobyev; M. N. Wagner; C. H. Wang; M. -Z. Wang; P. Wang; M. Watanabe; Y. Watanabe; K. M. Williams; E. Won; H. Yamamoto; Y. Yamashita; S. Yashchenko; Z. P. Zhang; V. Zhilich; V. Zhulanov; A. Zupanc

2013-11-26T23:59:59.000Z

367

Print http://us.mg4.mail.yahoo.comfneo/launch?.rand=deOsgk04ks40i Subject: Re: [s-w-h] Solar verses wind efficiency  

E-Print Network (OSTI)

& Pltry Sci-AS-PHD PHD ANA 11ANP 11ANPPHD Animl Sci & Pltry Sci-PS-PHD PHD ANA 11ANS 11ANSMR Animal Sci

368

Modeling Solid-Particle Erosion of Ductile Alloys B.F. LEVIN, K.S. VECCHIO, J.N. DuPONT, and A.R. MARDER  

E-Print Network (OSTI)

hardening **HASTELLOY and STELLITE are trademarks of Stoody Deloro Stel- lite, Inc., Industry, CA. HAYNES.removal. Only a few attempts have been made to measure the STELLITE**-6, and 316L SS) and commercially pure Cu repre- variation in mechanical properties. The Stellite-6 alloy con- sent a measure of energy absorbed

DuPont, John N.

369

Carbon Sequestration  

NLE Websites -- All DOE Office Websites (Extended Search)

David a. Lang David a. Lang Project Manager National Energy Technology Laboratory 626 Cochrans Mill Road P.O. Box 10940 Pittsburgh, PA 15236 412-386-4881 david.lang@netl.doe.gov andrew chizmeshya Arizona State University Center for Solid State Science Tempe, AZ 85287-1704 480-965-6072 chizmesh@asu.edu A Novel ApproAch to MiNerAl cArboNAtioN: eNhANciNg cArboNAtioN While AvoidiNg MiNerAl pretreAtMeNt process cost Background Carbonation of the widely occurring minerals of the olivine group, such as forsterite (Mg 2 SiO 4 ), is a potential large-scale sequestration process that converts CO 2 into the environmentally benign mineral magnesite (MgCO 3 ). Because the process is exothermic, it inherently offers low-cost potential. Enhancing carbonation reactivity is the key to economic viability. Previous

370

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" 9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Appliances",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Cooking Appliances" "Stoves (Units With Both" "an Oven and a Cooktop)"

371

The Fatigue Behavior of AZ91D/SiCp and 2XXX/SiCp Composites  

Science Conference Proceedings (OSTI)

Effect of Strain Rate and Triaxiality on the Constitutive Response of Super ... High Energy Density Film-on-foil Capacitor Fabrication Utilizing Electrostatic...

372

Analysis of IECC (2003, 2006, 2009) and ASHRAE 90.1-2007 Commercial Energy Code Requirements for Mesa, AZ.  

Science Conference Proceedings (OSTI)

This report summarizes code requirements and energy savings of commercial buildings in Climate Zone 2B built to the 2009 IECC and ASHRAE Standard 90.1-2007 when compared to the 2003 IECC and the 2006 IECC. In general, the 2009 IECC and ASHRAE Standard 90.1-2007 have higher insulation requirements for exterior walls, roof, and windows and have higher efficiency requirements for HVAC equipment. HVAC equipment efficiency requirements are governed by National Appliance Conversion Act of 1987 (NAECA), and are applicable irrespective of the IECC version adopted. The energy analysis results show that commercial buildings meeting the 2009 IECC requirements save 4.4% to 9.5% site energy and 4.1% to 9.9% energy cost when compared to the 2006 IECC; and save 10.6% to 29.4% site energy and 10.3% to 29.3% energy cost when compared to the 2003 IECC. Similar analysis comparing ASHRAE Standard 90.1-2007 requirements to the 2006 IECC shows that the energy savings are in the 4.0% to 10.7% for multi-family and retail buildings, but less than 2% for office buildings. Further comparison of ASHRAE Standard 90.1-2007 requirements to the 2003 IECC show site energy savings in the range of 7.7% to 30.6% and energy cost savings range from 7.9% to 30.3%. Both the 2009 IECC and ASHRAE Standard 90.1-2007 have the potential to save energy by comparable levels for most building types.

Huang, Yunzhi; Gowri, Krishnan

2011-02-28T23:59:59.000Z

373

Computer software configuration management plan for the 241-AY and 241-AZ tank farm MICON automation system  

SciTech Connect

Software configuration items pertaining to the process control systems, of the ventilation systems of the tank farms, are identified and configuration controls are defined.

Teats, M.C.

1995-04-01T23:59:59.000Z

374

Superfund record of decision (EPA Region 9): Yuma Marine Corps Air Station, Operable Unit 2, Yuma, AZ, December 2, 1997  

SciTech Connect

This Record of Decision (ROD) for Operable Unit (OU2) documents the remedial action plan for OU2 at Marine Corps Air Station (MCAS), Yuma, Arizona. On the basis of the data collected at the OU2 sites, no further action is necessary for 12 of the 18 CAOCs included in OU2, because these sites do not pose a threat to human health or the environment. However, remedial action is required to protect human health and comply with regulatory requirements at three of the CAOCs in OU2 because of the presence of ACM. Under this alternative, ACM fragment visible on soil surfaces would be collected manually. Collection would include removing approximately the upper inch of soil beneath the ACM to reduce the potential for asbestos fibers remaining behind in the soil. The ACM and soils would be stockpiled, manifested, loaded, transported, and disposed of at a permitted facility.

NONE

1998-10-01T23:59:59.000Z

375

Vitrification and Product Testing of C-104 and AZ-102 Pretreated Sludge Mixed with Flowsheet Quantities of Secondary Wastes  

Science Conference Proceedings (OSTI)

The U.S. Department of Energy (DOE) Office of River Protection (ORP) has acquired Hanford tank waste treatment services at a demonstration scale. The River Protection Project Waste Treatment Plant (RPP-WTP) team is responsible for producing an immobilized (vitrified) high-level waste (IHLW) waste form. Pacific Northwest National Laboratory, hereafter referred to as PNNL, has been contracted to produce and test a vitrified IHLW waste form from two Envelope D high-level waste (HLW) samples previously supplied to the RPP-WTP project by DOE.

Smith, Gary L.; Bates, Derrick J.; Goles, Ronald W.; Greenwood, Lawrence R.; Lettau, Ralph C.; Piepel, Gregory F.; Schweiger, Michael J.; Smith, Harry D.; Urie, Michael W.; Wagner, Jerome J.

2001-02-01T23:59:59.000Z

376

Zoning, Land-use Fragmentation And Environmental Justice In Early Phoenix, AZ Euclidean Zoning adopted by Phoenix in 1930 to  

E-Print Network (OSTI)

(6) Planing and flour mills, industrial steam laundries, ice manufacturing and cold storage, chemical

Hall, Sharon J.

377

Superfund Record of Decision (EPA Region 9): Tucson International Airport Area (volume 1 and 2), Tucson, AZ, September 30, 1997  

SciTech Connect

This Record of Decision (ROD) addresses the contamination at the Tucson International Airport Property (hereafter referred to as the `Airport Property`), Burr-Brown Corporation property (Burr-Brown Property) and the former West-Cap Arizona Company property (former West-Cap Property) located within the Tucson International Airport Area Superfund Site in Tucson, Arizona (TIAA Site). This ROD addresses soils and shallow groundwater contaminated with volatile organic compounds (VOCs), soil and sludges contaminated with polychlorinated biphenyls (PCBs), and closure of the Tucson Airport Authority Landfill (TAA Landfill).

NONE

1998-01-01T23:59:59.000Z

378

Building America Top Innovations Hall of Fame Profile … Community Scale High-Performance with Solar: Pulte Homes, Tucson, AZ  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Pulte Homes' Civano project in Tucson, Pulte Homes' Civano project in Tucson, Arizona, is one of the few communities in the United States to integrate passive and active solar with a comprehensive building science strategy. Many builders remain resistant to adopting high-performance innovations based on misconceptions about high cost and design challenges. Thus, Building America projects such as Pulte Homes' Civano project in Tucson, Arizona, have an extraordinary impact, demonstrating the business case for adopting proven energy-efficiency measures along with solar energy systems for an entire community. Building America has shown in numerous field demonstrations that critical economies of scale and maximum energy benefits can be realized when production builders select energy-efficiency

379

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

5 5 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 138,239,378 5.94 Pub Svc Elec and Gas Co........................ NJ 69,738,220 5.26 Southern California Gas Co ..................... CA 63,758,073 7.26 Pacific Gas and Elec Co........................... CA 58,646,965 7.84 Keyspan Energy Del Co ........................... NY 53,501,565 7.32 Consumers Energy Co ............................. MI 51,663,333 4.26 TXU Gas Distribution................................ TX 48,112,344 5.86 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 45,021,338 7.87 Con Edison Co of New York Inc............... NY 44,076,359 8.02 Michigan Consol Gas Co.......................... MI 40,342,797 5.39 Pub Svc Co of Colorado........................... CO 39,697,152 5.22 East Ohio Gas Co ....................................

380

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

2000 2000 Southern California Gas Co ..................... CA 251,452,001 8.32 Nicor Gas ................................................. IL 221,009,522 6.68 Pacific Gas and Elec Co........................... CA 211,181,852 7.98 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 184,692,129 7.53 Consumers Energy Co ............................. MI 176,663,600 4.76 Michigan Consol Gas Co.......................... MI 136,124,328 5.41 Keyspan Energy Del Co ........................... NY 134,055,940 10.75 Pub Svc Elec and Gas Co........................ NJ 132,611,115 6.32 East Ohio Gas Co .................................... OH 131,187,521 7.49 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 130,622,887 8.82 Peoples Gas Lt and Coke Co................... IL 103,856,141 8.60 Pub Svc Co of Colorado...........................

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

,"Arizona Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

,"N3050AZ3","N3010AZ3","N3020AZ3","N3035AZ3","NA1570SAZ3","N3045AZ3" "Date","Arizona Natural Gas Wellhead Price (Dollars per Thousand Cubic Feet)","Price of Arizona Natural Gas...

382

Scenes of Sun City  

E-Print Network (OSTI)

City, AZ, August 29th, 2010. Brian Knecht Photo 4: Sun City4, Sun City, AZ, August 29th, 2010.Scenes of Sun Valley Photo 5: Sun City 5, Sun City, AZ,

Knecht, Brian

2013-01-01T23:59:59.000Z

383

PDF: Automotive Magnesium Applications and Life Cycle ...  

Science Conference Proceedings (OSTI)

Feb 11, 2007 ... This presentation includes images of a die cast magnesium steering wheel, AZ91D cam cover, AZ91D transmission housing, AM50 door inner,...

384

DOE - Office of Legacy Management -- University of Arizona Southwest...  

Office of Legacy Management (LM)

University of Arizona Southwest Experiment Station Buildings - AZ 01 FUSRAP Considered Sites Site: UNIVERSITY OF ARIZONA (SOUTHWEST EXPERIMENT STATION BUILDINGS) (AZ.01) Eliminated...

385

South Africa - Analysis - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Short-Term Energy Outlook ... Search EIA .gov. A-Z Index; A-Z ... African Independent Power Producers Association has noted that there are regulatory barriers ...

386

South Africa - Analysis - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z ... In the short-term, ... African Independent Power Producers Association has noted that there are regulatory barriers ...

387

Short-Term Energy Outlook - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Short-Term Energy Outlook ... Search EIA .gov. A-Z Index; A-Z ... Arizona's 250-megawatt Solana generation station became the first major solar ...

388

District of Columbia - State Energy Profile Analysis - U.S ...  

U.S. Energy Information Administration (EIA)

Short-Term Energy Outlook ... Search EIA.gov. A-Z Index; A-Z Index ... No interstate pipelines enter the District.

389

India - Analysis - U.S. Energy Information Administration ...  

U.S. Energy Information Administration (EIA)

Search EIA .gov. A-Z Index; A-Z ... Indian companies use both long-term supply contracts and ... the government has encouraged private and foreign ...

390

U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index ... Short-Term Energy Outlook. Annual Energy Outlook. International Energy Outlook. Learn About Energy. Energy ...

391

Three-dimensional shape analysis of coarse aggregates ...  

Science Conference Proceedings (OSTI)

... Rock/Mineral Identification. IN. Natural river gravel. Indiana. Limestone,shale- siltstone, siliceous (eg, quartz, chert). AZ/az. Natural river gravel. Arizona ...

2005-06-06T23:59:59.000Z

392

Better Buildings Neighborhood Program: San Diego  

NLE Websites -- All DOE Office Websites (Extended Search)

Diego to Diego to someone by E-mail Share Better Buildings Neighborhood Program: San Diego on Facebook Tweet about Better Buildings Neighborhood Program: San Diego on Twitter Bookmark Better Buildings Neighborhood Program: San Diego on Google Bookmark Better Buildings Neighborhood Program: San Diego on Delicious Rank Better Buildings Neighborhood Program: San Diego on Digg Find More places to share Better Buildings Neighborhood Program: San Diego on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Diego County, California Energy Upgrade California Motivates Home Improvements in San Diego County

393

Members2004 2005 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

2005 2005 Nuclear Science Advisory Committee (NSAC) NSAC Home Meetings Members Charges/Reports Charter .pdf file (629KB) NP Committees of Visitors NP Home Members NSAC Members 2004 2005 Print Text Size: A A A RSS Feeds FeedbackShare Page NSAC Members for 2012 | 2011 |2010 | 2009 | 2008 | 2007 | 2006 | 2004-5 | 2004 | 2003 | 2001-2 | 2000-1 DOE/NSF Nuclear Science Advisory Committee Membership List 2004-5 Ricardo Alarcon Dept. of Physics and Astronomy Arizona State University Tempe, AZ 85287 Phone: (480) 965-8549 Fax: (480) 965-7954 Email: Ricardo.alarcon@asu.edu Thomas Glasmacher National Superconducting Cyclotron Laboratory Michigan State University East Lansing , MI 48824-1321 Phone: (517) 333-6418 Fax: (517) 353-5967 Email: glasmacher@nscl.msu.edu Kimberley Thomas (ACS) Los Alamos National Laboratory

394

Better Buildings Neighborhood Program: Los Angeles County, California  

NLE Websites -- All DOE Office Websites (Extended Search)

Los Angeles Los Angeles County, California to someone by E-mail Share Better Buildings Neighborhood Program: Los Angeles County, California on Facebook Tweet about Better Buildings Neighborhood Program: Los Angeles County, California on Twitter Bookmark Better Buildings Neighborhood Program: Los Angeles County, California on Google Bookmark Better Buildings Neighborhood Program: Los Angeles County, California on Delicious Rank Better Buildings Neighborhood Program: Los Angeles County, California on Digg Find More places to share Better Buildings Neighborhood Program: Los Angeles County, California on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO

395

Better Buildings Neighborhood Program: Alabama - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Alabama - Alabama - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Alabama - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Alabama - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Google Bookmark Better Buildings Neighborhood Program: Alabama - SEP on Delicious Rank Better Buildings Neighborhood Program: Alabama - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Alabama - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Alabama - SEP Alabama Program Takes a Dual Approach to Energy Efficiency Upgrades

396

Better Buildings Neighborhood Program: Virginia - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

Virginia - Virginia - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Virginia - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Virginia - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Google Bookmark Better Buildings Neighborhood Program: Virginia - SEP on Delicious Rank Better Buildings Neighborhood Program: Virginia - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Virginia - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Virginia - SEP Virginia's Regional Energy Alliances Help Forge a State Program for

397

Better Buildings Neighborhood Program: Austin, Texas  

NLE Websites -- All DOE Office Websites (Extended Search)

Austin, Texas Austin, Texas to someone by E-mail Share Better Buildings Neighborhood Program: Austin, Texas on Facebook Tweet about Better Buildings Neighborhood Program: Austin, Texas on Twitter Bookmark Better Buildings Neighborhood Program: Austin, Texas on Google Bookmark Better Buildings Neighborhood Program: Austin, Texas on Delicious Rank Better Buildings Neighborhood Program: Austin, Texas on Digg Find More places to share Better Buildings Neighborhood Program: Austin, Texas on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Austin, Texas Austin Energy Accelerates Residential and Multifamily Efficiency Upgrades

398

Better Buildings Neighborhood Program: Michigan - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Michigan - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Michigan - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Google Bookmark Better Buildings Neighborhood Program: Michigan - SEP on Delicious Rank Better Buildings Neighborhood Program: Michigan - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Michigan - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Michigan - SEP Better Buildings Means Better Business for Michigan

399

Better Buildings Neighborhood Program: Toledo, Ohio  

NLE Websites -- All DOE Office Websites (Extended Search)

Toledo, Ohio Toledo, Ohio to someone by E-mail Share Better Buildings Neighborhood Program: Toledo, Ohio on Facebook Tweet about Better Buildings Neighborhood Program: Toledo, Ohio on Twitter Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Google Bookmark Better Buildings Neighborhood Program: Toledo, Ohio on Delicious Rank Better Buildings Neighborhood Program: Toledo, Ohio on Digg Find More places to share Better Buildings Neighborhood Program: Toledo, Ohio on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Toledo, Ohio A Broad Approach to Energy Efficiency in Northwest Ohio

400

Better Buildings Neighborhood Program: San Jose  

NLE Websites -- All DOE Office Websites (Extended Search)

San Jose to San Jose to someone by E-mail Share Better Buildings Neighborhood Program: San Jose on Facebook Tweet about Better Buildings Neighborhood Program: San Jose on Twitter Bookmark Better Buildings Neighborhood Program: San Jose on Google Bookmark Better Buildings Neighborhood Program: San Jose on Delicious Rank Better Buildings Neighborhood Program: San Jose on Digg Find More places to share Better Buildings Neighborhood Program: San Jose on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI San Jose, California San Jose Leverages Partnerships to Improve Low-Income Households' Energy

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

Better Buildings Neighborhood Program: Maine - SEP  

NLE Websites -- All DOE Office Websites (Extended Search)

- SEP to - SEP to someone by E-mail Share Better Buildings Neighborhood Program: Maine - SEP on Facebook Tweet about Better Buildings Neighborhood Program: Maine - SEP on Twitter Bookmark Better Buildings Neighborhood Program: Maine - SEP on Google Bookmark Better Buildings Neighborhood Program: Maine - SEP on Delicious Rank Better Buildings Neighborhood Program: Maine - SEP on Digg Find More places to share Better Buildings Neighborhood Program: Maine - SEP on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA WA | WI Maine - SEP Maine Makes Multifamily Units Energy-Efficient and Cost-Effective

402

Better Buildings Neighborhood Program: Seattle, Washington  

NLE Websites -- All DOE Office Websites (Extended Search)

Seattle, Seattle, Washington to someone by E-mail Share Better Buildings Neighborhood Program: Seattle, Washington on Facebook Tweet about Better Buildings Neighborhood Program: Seattle, Washington on Twitter Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Google Bookmark Better Buildings Neighborhood Program: Seattle, Washington on Delicious Rank Better Buildings Neighborhood Program: Seattle, Washington on Digg Find More places to share Better Buildings Neighborhood Program: Seattle, Washington on AddThis.com... Better Buildings Residential Network Progress Stories Interviews Videos Events Quick Links to Partner Information AL | AZ | CA | CO | CT FL | GA | IL | IN | LA ME | MD | MA | MI | MO NE | NV | NH | NJ | NY NC | OH | OR | PA | SC TN | TX | VT | VI | VA

403

SEMIPERMEA LE MEM RANES FOR MI ROMA HINED SILI ON SURFA ES 5 US ...  

co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...

404

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

405

ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George

406

UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...

407

May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po

2012-01-01T23:59:59.000Z

408

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

May ________. A vistas la pornografa. Primera Hora, 22la medida contra la pornografa. El Nuevo Da, 13 Junecomunicacin contra la pornografa. El Nuevo Da, 16 May

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

409

Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer

410

Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.

1993-03-01T23:59:59.000Z

411

Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas

2009-01-01T23:59:59.000Z

412

Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan

2013-01-01T23:59:59.000Z

413

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

Puertorriquea. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

414

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetn. Based on ethnographic and archival research in San Juan, Puerto Rico, (more)

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

415

Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois

416

Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.

417

Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela

418

Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clment Jamin; Pierre-Marie Gandoin; Samir Akkouche

2009-08-01T23:59:59.000Z

419

LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2013-10084P

420

Notice of Intent to Prepare an Environmental Impact Statement for the proposed Griffith Power Plant and Transmission Line Project, Mojave County, AZ  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

96 96 Federal Register / Vol. 63, No. 64 / Friday, April 3, 1998 / Notices Metered Entities the ISO and Alta Power Generation, L.L.C., for acceptance by the Commission. The ISO states that this filing has been served on all parties listed on the official service list in Docket Nos. EC96- 19-003 and ER96-1663-003, including the California Public Service Commission. Comment date: April 9, 1998, in accordance with Standard Paragraph E at the end of this notice. 16. Allegheny Power Service Corp., on Behalf of Monongahela Power The Potomac Edison Company, and West Penn Power Company (Allegheny Power) [Docket No. ER98-2307-000] Take notice that on March 24, 1998, Allegheny Power Service Corporation on behalf of Monongahela Power Company, The Potomac Edison Company and West Penn Power

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

DOE Radiation Exposure Monitoring System (REMS) Data Update Presented at the 32nd Annual International Dosimetry and Records Symposium, June 3-6, Scottsdale, AZ  

Science Conference Proceedings (OSTI)

This slide-show presents the 2012 draft data for DOE occupational radiation exposure, compares those data with last year and the last five years, and clarifies reporting data.

none,

2013-01-01T23:59:59.000Z

422

IMPACT-GENERATED TSUNAMIS: AN OVER-RATED HAZARD. H. J. Melosh, Lunar and Planetary Lab, University of Arizona, Tucson AZ 85721 (jmelosh@lpl.arizona.edu).  

E-Print Network (OSTI)

's oceans might cause widespread devastation to coastal cities. If correct, this suggests that asteroids proposed by waves generated by nuclear explosions in the ocean. Authored by tsunami expert William Van Dorn in the case when the initial crater is less deep than the ocean itself, their two effects tend to cancel one

Melosh, H. Jay

423

WM '04 Conference, February 29 March 4, 2004, Tucson, AZ WM-4085 METAL MATRIX IMMOBILISATION OF SEALED RADIOACTIVE SOURCES FOR SAFE  

E-Print Network (OSTI)

to about 70% by weight of BFS are now well established in the construction industry and fully characterised.1°C. At higher temperatures a silicone-oil filled bath and stainless steel cells were used

Sheffield, University of

424

Analysis of natural gases, Rocky Mtn. Region (AZ, CO, MT, NM, UT and WY), 1951-1991 (for microcomputers). Data file  

Science Conference Proceedings (OSTI)

The U.S. Bureau of Mines diskette contains analysis and related source data for 2,545 natural gas samples collected from Rocky Mountain Region, which include the following states: Arizona, Colorado, Montana, New Mexico, Utah, and Wyoming. All samples were obtained and analyzed as part of the Bureau's investigations of the occurrences of helium in natural gases of countries with free market economies. The survey has been conducted since 1917. The analysis contained on the diskette: READ.ME, RCKMTN.TXT, RCKMTN.DBF, USHEANAL.DBF, and BASINCDE.TXT. The READ.ME file contains documentation. The RCKMTN.TXT file contains 2,545 natural gas analysis records in ASCII nondelimited, fixed-length format. The length of each record is 411 characters.

Not Available

1991-01-01T23:59:59.000Z

425

WM2008 Conference, February 24-28, 2008, Phoenix, AZ Shielded Payload Containers Will Enhance the Safety and Efficiency of the DOE's Remote Handled  

E-Print Network (OSTI)

the Safety and Efficiency of the DOE's Remote Handled Transuranic Waste Disposal Operations - 8199 R. A for Remote Handled (RH) waste. CH waste is emplaced in a variety of payload container configurations. This robust configuration provides an overpack for waste that otherwise would be remotely handled. Up to a 3

426

ELECTROCHEMICAL CORROSION REPORT FOR TANKS 241-AW-103 & 241-AZ-102 & 241-AN-106 & 241-AN-107 & 241-AY-101 & 241-AY-102  

SciTech Connect

Corrosion rates using supernatant samples retrieved from near the top of the liquid layer were determined for the tanks. Corrosion rates using settled solids (saltcake) were determined. The supernatant samples were tested as received without argon sparging. The settled solid sample segments were extruded under anaerobic condition and kept under a sweep of humidified argon gas during 'the electrochemical corrosion testing. The class of steel used to construct the tank in question was used, and test coupons were allowed to equilibrate for a minimum of 18 hours before a Tafel scan was initiated. The coupons were scanned from -250 mV to +250 mV from the rest or open circuit potential. The corrosion rate is reported along with the corrosion current measurement, open circuit potential, and a chi-square statistic generated by the instrument controlling and analysis algorithm.

DUNCAN JB

2007-08-22T23:59:59.000Z

427

NETL: NEPA Categorical Exclusions - July 2011 to September 2011  

NLE Websites -- All DOE Office Websites (Extended Search)

1 to September 2011 1 to September 2011 Archive (November 2009 - July 2011) ARRA Date Title Recipient Name Location DOE/NETL Sponsors N 9/30/2011 IGCC Affordability and Availability (Houston) General Electric Company Houston, TX FE/Gasification Division N 9/30/2011 IGCC Affordability and Availability (Schenectady) General Electric Company Schenectady, NY FE/Gasification Division Y 9/30/2011 Geothermal Incentive Program Connecticut Wallingford, CT EE/PMC/IPOD Y 9/29/2011 Midwest Region Alternative Fuels Project Metropolitan Energy Center Kansas City, KS EE/PMC/PVT Y 9/28/2011 Ohio Advanced Transportation Partnership/Roush CleanTech LPG Conversions of Frito Lay Vehicles Clean Fuels Ohio Plymouth Twp., MI EE/PVT/Clean Cities Y 9/28/2011 Ohio Advanced Transportation Partnership/Frito Lay Columbus Propane Fueling Infrastructure Clean Fuels Ohio Columbus, OH EE/PVT/Clean Cities

428

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" 9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Computers and Other Electronics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Computers" "Number of Computers" 0,27.4,6.7,4.7,1.1,1.1,0.6,2,2,0.6,1,0.5

429

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" 9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Fuels Used and End Uses",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Fuels Used for Any Use" "Electricity",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8

430

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Televisions",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Televisions" "Number of Televisions" 0,1.5,0.3,0.2,"Q","Q","Q","Q",0.1,"Q","Q","Q"

431

Related Links | Building Energy Codes Program  

NLE Websites -- All DOE Office Websites (Extended Search)

Related Links Related Links Regional Energy Efficiency Organizations MEEA NEEP NEEA SEEA SWEEP SPEER Midwest Energy Efficiency Alliance (MEEA) IL, IN, IA, KS, KY, ND, NE, MI, MN, MO, OH, SD, WI The Midwest Energy Efficiency Alliance (MEEA) is a collaborative network advancing energy efficiency in the Midwest to support sustainable economic development and environmental preservation. MEEA raises awareness, facilitates energy efficiency programs and strengthens policy across the nine-state region. MEEA brings together a respected network of members, partners, board and staff, and inspires others to create new technologies, new products and new ways of thinking when it comes to energy efficiency. Codes Contact Isaac Elnecave Senior Policy Manager ielnecave@mwalliance.org phone: (312)784-7253

432

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" 9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" "Structural and Geographic Characteristics",,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" ,,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Urban and Rural2" "Urban",88.1,19.9,14.6,4.1,2.9,1.8,5.8,5.3,1.6,2.4,1.4

433

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" 9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Household Demographics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Household Members" "1 Person",31.3,7.4,5.1,1.4,1,0.6,2.1,2.3,0.6,1.1,0.6

434

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,,,,,"IA, MN, ND, SD" "Water Heating",,,,"IL","MI","WI","IN, OH",,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Storage Tank Water Heaters" 0,2.9,0.4,0.3,"Q","Q","Q","Q",0.1,"Q","Q","Q"

435

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" 9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Air Conditioning",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Air Conditioning Equipment" "Use Air Conditioning Equipment",94,22.4,15,4.3,3.1,1.8,5.9,7.4,2.3,3.4,1.7

436

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" " ",,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Space Heating",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Space Heating Equipment" "Use Space Heating Equipment",110.1,25.8,17.8,4.7,3.8,2.3,7,8.1,2.3,3.9,1.8

437

Jacoby Carter and Billy P. Leonard Abstract We conducted a literature review of coypu (Myocastor coypus) introduction and eradi-  

E-Print Network (OSTI)

. Aghayeva Institute of Botany, Azerbaijan National Academy of Sciences, Badamdar 40, Baku AZ1073, Azerbaijan

438

The male germ cell gene regulator CTCFL is functionally different from CTCF and binds CTCF-like consensus sites in a nucleosome composition-dependent manner  

E-Print Network (OSTI)

2010, 3:19. 15. Nativio R, Wendt KS, Ito Y, Huddleston JE,2008, Page 20 of 21 17. Wendt KS, Yoshida K, Itoh T, Bando

2012-01-01T23:59:59.000Z

439

Microsoft Word - Mar EA w Jun Apps  

NLE Websites -- All DOE Office Websites (Extended Search)

Office 5020 Tuttle Creek Blvd Manhattan, KS 66502 USFWS Ecological Services Mike LeValley Project Leader 2609 Anderson Ave Manhattan, KS 66502 FAA, ATO Obstruction Evaluation...

440

Expect  

Science Conference Proceedings (OSTI)

... 9, No. 3, R&D Publications, Lawrence, KS, March, 1991. Libes ... 9, No. 1, R&D Publications, Lawrence, KS, January 1991. Libes ...

2013-05-17T23:59:59.000Z

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

Table. 11 Summary of U.S. Natural Gas Exports By Point of Exit, 1997-2001 (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet) Imports and Exports - Table 11 Pipeline (Canada) Detroit, MI................ 31,080 2.55 24,908 2.26 25,049 2.30 36,007 3.74 35,644 4.57 Marysville, MI .......... 5,286 2.36 3,377 2.17 691 2.47 5,320 2.91 3,651 3.92 St. Clair, MI.............. 20,080 2.51 11,397 2.23 11,258 2.51 29,654 3.73 122,293 3.82 Babb, MT................. NA NA NA NA NA NA NA NA 549 3.55 Harve, MT................ NA NA NA NA 1,510 2.05 1,606 3.25 2,428 3.40 Niagara Falls, NY .... NA NA NA NA NA NA NA NA 594 2.49 Sumas, WA ............. NA NA 208 2.80 NA NA NA NA 1,529 4.44 Total........................ 56,447 2.52 39,891 2.25 38,508 2.35 72,586 3.66 166,690 3.97 Pipeline (Mexico) Douglas, AZ............. 3,901 2.38 4,133 1.89 4,041 2.37 8,829 4.23 8,050 3.50 Calexico,CA.............

442

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

Table. 11 Summary of U.S. Natural Gas Exports By Point of Exit, 1996-2000 (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet) Imports and Exports - Table 11 Pipeline (Canada) Detroit, MI................. 30,410 2.36 31,080 2.55 24,908 2.26 25,049 2.30 36,007 3.74 Marysville, MI ........... 638 2.97 5,286 2.36 3,377 2.17 691 2.47 5,320 2.91 St. Clair, MI............... 19,315 3.13 20,080 2.51 11,397 2.23 11,258 2.51 29,654 3.73 Babb, MT.................. 91 1.53 NA NA NA NA NA NA NA NA Harve, MT................. NA NA NA NA NA NA 1,510 2.05 1,606 3.25 Sumas, WA .............. 1,451 2.81 NA NA 208 2.80 NA NA NA NA Total......................... 51,905 2.67 56,447 2.52 39,891 2.25 38,508 2.35 72,586 3.66 Pipeline (Mexico) Douglas, AZ.............. 3,405 1.92 3,901 2.38 4,133 1.89 4,041 2.37 8,829 4.23 Clexico,CA................ NA NA 308 3.15 2,067 2.58 3,724

443

Integration of Molecular Networks in the Shoot Apical Meristem that Controls Floral Specification in Arabidopsis thaliana  

E-Print Network (OSTI)

lycopersicum_miR156b Solanum_lycopersicum_miR156c Sorghum_bicolor_miR156a Sorghum_bicolor_miR156b Sorghum_bicolor_miR156c Sorghum_

Lal, Shruti

2011-01-01T23:59:59.000Z

444

Strategic Standardization  

Science Conference Proceedings (OSTI)

... Program Strategic Standardization Curriculum (CMGT 564 - 2010) ... com. Curriculum ks eport, 1992), Grading (Research paper, ...

2012-12-03T23:59:59.000Z

445

Atliekinio fosfogipso panaudojimas sunki?j? metal? immobilizacijai nuotek? dumble ir dumblo-dirvoemio miiniuose.  

E-Print Network (OSTI)

??Nuotek? dumble esan?i? sunki?j? metal? neigiam? poveik? aplinkai bei mogaus sveikatai galima sumainti apribojant metal? judrum? aplinkoje. Magistro darbe tiriamas sunki?j? metal? judrumas ir j? (more)

Puodi?nas,; Marius

2009-01-01T23:59:59.000Z

446

Creative Reconstruction in the City: An Analysis of Art, Shrinking, and the Story of the American Dream in Detroit, MI.  

E-Print Network (OSTI)

??A right to the city is a human right that is overlooked in American cities. Cities reflect humanity in collective form, but are manipulated by (more)

Marotta, Stephen J.

2011-01-01T23:59:59.000Z

447

1996 Department of Energy pre-freshman enrichment program at GMI Engineering and Management Institute, Flint, MI  

SciTech Connect

This document reports on a summer program to encourage students to pursue scientific or engineering professions. The topics of the report include a description of the recruitment program, selection criteria for participants, workshops, nine follow up activities, research projects and student`s presentation, and field trips. Course descriptions and schedule are included as appendices.

1996-12-31T23:59:59.000Z

448

I Volume 5, Number 2 Spring 1992 A Ne\\izsletter for the RLE Community at MI'T  

E-Print Network (OSTI)

:l XI:~ri:l Ticchi. Inq~tiriesmay he ;~ddrcsscdto: RLE undercurrents Rescarcli Lahor:ltory of Electrc

449

Volume 2, Number 2 June 1989 A Nelr-sletter for the KL,t.: Communitv at MI'1'  

E-Print Network (OSTI)

Lahoratory of Electrc~nicsfor the RLE community at MIT. The following individuals contributed their time ancl

450

Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available

1987-01-01T23:59:59.000Z

451

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 2002 Place Time Name Group Group  

E-Print Network (OSTI)

37 192 19:28.7 John Wool 40-49 men 48 193 19:32.4 Jaimin Wan page 7 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS 1st

452

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 1996 Dummy first body page  

E-Print Network (OSTI)

-59 59 668 34:20.7 Seung-yu Rah 30-39 157 669 34:21.4 John Wool 40-49 120 670 34:25.6 Manny Gonzalez 30:42.8 Pete Valerio HISTORY OF LBL RUNAROUND WINNERS

453

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 14, 1990 Place Time Name Group Group  

E-Print Network (OSTI)

:56.4 John Wool 30­39 105 483 30:00.0 David O'Neill ) Group Time Name Overall Place Place 1 24:24.3 John Magee 373 2 25:41.9 Edward Lofgren 400 HISTORY OF LBL

454

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 22, 1995 Dummy first body page  

E-Print Network (OSTI)

198 16:04.7 Alan Meier 40-49 30 199 16:05.7 John Wool 40-49 31 200 16:07.5 Ginny Lackner 50-59F 1 201 Don Krieger Frances Mann Peter Morley Bob Shilling HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION

455

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 10, 1997 Place Time Name Group  

E-Print Network (OSTI)

Larnon, Frank 50-59 13 156 15:17.4 157 15:18.0 Bartholomew, J 50-59 14 158 15:18.4 Wool, John 40-49 18 159 15 Time Name Group Group Place HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN

456

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 15, 1989 Envel. Time Name Group Group  

E-Print Network (OSTI)

40-49 8 67 12:51.4 Desiderio Kovar Wool 30-39 20 69 12:56.7 Antoine Mensch Envelope Place Number 1 21:59.8 John L. Magee 354 2 26:14.8 Ed Lofgren 427 HISTORY OF LBL RUNAROUND WINNERS

457

LBL RUNAROUND RESULTS 2.95 km (1.84 mi) September 16, 1988 Envelope Time Name Group Group  

E-Print Network (OSTI)

120 14:08.2 Z. Mei 30-39 26 121 14:09.5 John Wool 30-39 27 122 14:10.3 Timothy Edberg 30-39 28 123 14 Time Name Envelope Place Number 1 30:14.0 Peter Endt 447 HISTORY OF LBL RUNAROUND WINNERS Year Distance

458

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 11, 1992 Place Time Name Group Group  

E-Print Network (OSTI)

14:26.2 Barry Freifeld Wool 30-39 39 122 14:28.2 Ken Woolfe 40-49 18 123 14 Williams HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS

459

I Volume 7, Number 2 Spring 1994 A Newsleccer for the RLE Communitv at MI'I'  

E-Print Network (OSTI)

Robert J. Birgeneau, Dean of the School of Science and a principal investigator in RLE's Surfaces has his blue belt in karate. Seventh grader Amanda's bowl~ngteam competed in the state finals

460

Corrosion mechanisms of low level vitrified radioactive waste in a loamy soil M.I. Ojovan1  

E-Print Network (OSTI)

Topic: Briefings by environmental groups, industry groups, pub- lic policy groups, and state, is the central authority responsi- ble for evaluating and supervising the nuclear industry's research and 1.95 meters in diameter. It is fabricated from forged steel with a stainless steel coating. The cask

Sheffield, University of

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

Informa(on and Resources Prac&ces for Mi&ga&ng Urban Pes&cide Runoff  

E-Print Network (OSTI)

. Producers can then use these records to analyze the effectiveness of past pesticide applications a documentation system for determining crop replant, rotation and #12;Pesticide Recordkeeping 2 prePI-20 Pesticide Recordkeeping 1 Michael Aerts, O. Norman Nesheim, and Frederick M. Fishel2 1

Hammock, Bruce D.

462

Microsoft Word - Sample Abstract and Format Instructions.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Dearborn, MI 48128, Wayne State University 2 , Department of Physics and Astronomy, Detroit, MI 48202, Kettering University 3 , Flint, MI 48504, University of Paris-Sud 4 ,...

463

Language Assimilation Today: Bilingualism Persists More Than in the Past, But English Still Dominates  

E-Print Network (OSTI)

Somerset- Hunterdon, NJ Detroit, MI Table 2 Childrens homeSomerset- Hunterdon, NJ Detroit, MI Bergen-Passaic, NJSomerset- Hunterdon, NJ Detroit, MI Appendix Table 2

Alba, Richard

2004-01-01T23:59:59.000Z

464

Former Worker Program - Defunct Beryllium Vendor Screening Program  

NLE Websites -- All DOE Office Websites (Extended Search)

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Wolverine Tube Division (Detroit, MI); National Beryllia (Haskell, NJ);...

465

Beryllium Vender Screening Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Speedring Systems, Inc. (Detroit, MI); Wolverine Tube Division...

466

Meteorological Data Report for the Pascua Yaqui Indian Reservation  

Open Energy Info (EERE)

Pascua Yaqui Tribe Pascua Yaqui Tribe Description: Data from file(s) Y:\shared\Anemometer_Loan_Programs\WPA.NA.Loans\Pascua Yaqui - AZ\Pascua Yaqui 040107.N04 Y:\shared\Anemometer_Loan_Programs\WPA.NA.Loans\Pascua Yaqui - AZ\Pascua Yaqui 030528.N03 Y:\shared\Anemometer_Loan_Programs\WPA.NA.Loans\Pascua Yaqui - AZ\Pascua Yaqui 040217.N04 Y:\shared\Anemometer_Loan_Programs\WPA.NA.Loans\Pascua Yaqui - AZ\Pascua Yaqui 030805.N03 Y:\shared\Anemometer_Loan_Programs\WPA.NA.Loans\Pascua Yaqui - AZ\Pascua Yaqui 030710.N03 Y:\shared\Anemometer_Loan_Programs\WPA.NA.Loans\Pascua Yaqui - AZ\Pascua Yaqui 031104.N03 Y:\shared\Anemometer_Loan_Programs\WPA.NA.Loans\Pascua Yaqui - AZ\Pascua Yaqui 031001.N03 Y:\shared\Anemometer_Loan_Programs\WPA.NA.Loans\Pascua Yaqui - AZ\Pascua Yaqui 040401.N04

467

_MainReportGM  

NLE Websites -- All DOE Office Websites (Extended Search)

Events Performed Electricity Consumed (AC MWh) Phoenix, AZ Metropolitan Area 524 59,284 456.28 Tucson, AZ Metropolitan Area 145 16,694 119.53 Los Angeles, CA Metropolitan Area 528...

468

Power Technologies Energy Data Book: Fourth Edition, Chapter...  

NLE Websites -- All DOE Office Websites (Extended Search)

APS Solar Partners Program central PV 1997 17.6kWh AZ Salt River Project EarthWise Energy central PV, wind, landfill gas, small hydro, geothermal 1998 2001 3.0kWh AZ Tucson...

469

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","11292013" ,"Excel File Name:","n9050az2a.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn9050az2a.htm" ,"Source:","Energy Information...

470

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","11292013" ,"Excel File Name:","n9050az2m.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn9050az2m.htm" ,"Source:","Energy Information...

471

Environment/Health/Safety/Security (EHSS)  

NLE Websites -- All DOE Office Websites (Extended Search)

Lawrence Berkeley National Laboratory masthead Search Jobs Phone Book U.S. Department of Energy logo Berkeley Lab masthead A-Z Index SEARCH EHSS FIND LAB EMPLOYEE EHSS A-Z Site Map...

472

Environment/Health/Safety/Security (EHSS): Operations  

NLE Websites -- All DOE Office Websites (Extended Search)

Lawrence Berkeley National Laboratory masthead Search Jobs Phone Book U.S. Department of Energy logo Berkeley Lab masthead A-Z Index SEARCH EHSS FIND LAB EMPLOYEE EHSS A-Z Site Map...

473

Press Room - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Press Room. Glossary ...

474

Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E ... The rise of Marcellus production in both absolute terms and as a share of total U.S. production is ...

475

Gasoline and Diesel Fuel Update - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Petroleum & Other Liquids. Glossary ...

476

EIA to release new Drilling Productivity Report - Today in ...  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Today in Energy. Glossary ...

477

EIA launches new electricity-focused web page - Today in ...  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Today in Energy. Glossary ...

478

Cuba - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ Countries Cuba Glossary ...

479

State gasoline taxes average 23.5 cents per gallon but vary ...  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Today in Energy. Glossary ...

480

Environment - U.S. Energy Information Administration (EIA) - U ...  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Environment Glossary ...

Note: This page contains sample records for the topic "ks mi az" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

State-level retail gasoline taxes vary significantly - Today ...  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Today in Energy. Glossary ...

482

EIA now delivers monthly electricity data in interactive data ...  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Today in Energy. Glossary ...

483

Coal News and Markets - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Coal. Glossary ...

484

Access to alternative transportation fuel stations varies ...  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Today in Energy. Glossary ...

485

U. S. monthly coal production - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Coal. Glossary ...

486

Over one-third of natural gas produced in North Dakota is ...  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Today in Energy. Glossary ...

487

EIA - State Electricity Profiles - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Electricity. Glossary ...

488

Demand for electricity changes through the day - Today in ...  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Today in Energy. Glossary ...

489

Natural Gas Year-in-Review - Energy Information Administration  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Natural Gas. Glossary ...

490

Petroleum & Other Liquids - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Petroleum & Other Liquids. Glossary ...

491

Countries - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Countries. Glossary ...

492

Exhibition Pre-Show Directory  

Science Conference Proceedings (OSTI)

Power Generation. Clayburn owns and ..... abroad (SaAz & BrAz in Russia). HART has implemented a third ..... can be cast in one set-up. Less than 1 percent of.

493

- Today in Energy - U.S. Energy Information Administration (EIA)  

U.S. Energy Information Administration (EIA)

Search EIA.gov. A-Z Index; A-Z Index A B C D E F G H I J K L M N O P Q R S T U V W XYZ. Today in Energy. Glossary ...

494

Wind for Schools Portal Comparison | Open Energy Information  

Open Energy Info (EERE)

Comparison Comparison Jump to: navigation, search Wind for Schools Portal Home Comparison Motion Chart Educational Resources Select a wind turbineAK - Mt. Edgecumbe High School Wind ProjectAK - Juneau School District Wind ProjectAK - Sherrod Elementary Wind ProjectAZ - Williams Elementary and Middle School Wind Project

495

Assessment of Nuclear Resonance Fluorescence for Spent Nuclear Fuel Assay  

E-Print Network (OSTI)

of the Institute of Nuclear Material Management, Tucson, AZ,Assay, Institute of Nuclear Materials Management 51st Annual

Quiter, Brian

2012-01-01T23:59:59.000Z

496

Robert Amaro  

Science Conference Proceedings (OSTI)

... mechanical engineering firms. 2005-2007: Partner, Monsoon Ventures design/build engineering firm, Tucson AZ. 1999-2003 ...

2012-10-01T23:59:59.000Z

497

NIST Technical Note ####  

Science Conference Proceedings (OSTI)

... Oswald Mesa (AZ) Fire Department, especially Josh Friedman Mink Hollow Systems, especially Todd Wilson Tempest Technologies, especially ...

2009-04-14T23:59:59.000Z

498

"2012 Non-Utility Power Producers- Customers"  

U.S. Energy Information Administration (EIA) Indexed Site

Customers" Customers" "(Data from form EIA-861U)" ,,,"Number of Customers" "Entity","State","Ownership","Residential","Commercial","Industrial","Transportation","Total" "Riceland Foods Inc.","AR","Non_Utility",".",".",1,".",1 "Constellation Solar Arizona LLC","AZ","Non_Utility",".",".",1,".",1 "FRV SI Transport Solar LP","AZ","Non_Utility",".",1,".",".",1 "MFP Co III, LLC","AZ","Non_Utility",".",1,".",".",1 "RV CSU Power II LLC","AZ","Non_Utility",".",1,".",".",1

499

Energy Efficiency and Conservation Block Grant Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

U.S. Department of Energy Categorical Exclusion Determination Form Project Title Program or Field Office: AZ-TRIBE-HAVASUPAI INDIAN TRIBE Energy Efficiency and Conservation Block Grant Program Location: Tribe AZ-TRIBE- HAVASUPAI INDIAN TRIBE AZ American Recovery and Reinvestment Act: Proposed Action or Project Description The Havasupai Indian Tribe of Arkansas proposes to purchase an insulation blower and insulation and

500

Proceedings of COLING 2012: Technical Papers, pages 30893104, COLING 2012, Mumbai, December 2012.  

E-Print Network (OSTI)

Azerbaijan, or other entries in KB that have the same name. Most previous studies on entity linking used Scottsdale, AZ. ...; Cq: {c1: state of Arizona, c2: Azerbaijan, ..., cN : Alitalia}, automatically creating State; US- AZ; 48th State; AZ (U.S. state); The Copper State; Arizona, United States; ... c2 Azerbaijan