Powered by Deep Web Technologies
Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


1

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Gasoline and Diesel Fuel Update (EIA)

176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY...

2

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Gasoline and Diesel Fuel Update (EIA)

0.00-1.99 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1996 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1996 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: In 1996, consumption of natural gas for agricultural use

3

?? / Kagaku / ?? /Ky?ri: Science  

E-Print Network (OSTI)

question when considering science and technology in Japanese?? /Kagaku / ?? /Ky?ri: Science Tsukahara T?go Translationto incorporate and develop science and technology from the

Tsukahara, T?go

2012-01-01T23:59:59.000Z

4

Category:Lexington, KY | Open Energy Information  

Open Energy Info (EERE)

Lexington, KY Lexington, KY Jump to: navigation, search Go Back to PV Economics By Location Media in category "Lexington, KY" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Lexington KY Kentucky Utilities Co.png SVFullServiceRestauran... 65 KB SVHospital Lexington KY Kentucky Utilities Co.png SVHospital Lexington K... 61 KB SVLargeHotel Lexington KY Kentucky Utilities Co.png SVLargeHotel Lexington... 61 KB SVLargeOffice Lexington KY Kentucky Utilities Co.png SVLargeOffice Lexingto... 62 KB SVMediumOffice Lexington KY Kentucky Utilities Co.png SVMediumOffice Lexingt... 64 KB SVMidriseApartment Lexington KY Kentucky Utilities Co.png SVMidriseApartment Lex... 59 KB SVOutPatient Lexington KY Kentucky Utilities Co.png SVOutPatient Lexington...

5

LATA KY WEA-2012-01  

Energy.gov (U.S. Department of Energy (DOE))

The Office of Enforcement and Oversight provided the results of the investigation to LATA KY in a report dated November 21, 2011. An enforcement conference was held on January 18, 2012, with LATA KY representatives to discuss the report findings and associated corrective actions. A summary of the conference is enclosed.

6

Category:Wichita, KS | Open Energy Information  

Open Energy Info (EERE)

KS KS Jump to: navigation, search Go Back to PV Economics By Location Media in category "Wichita, KS" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Wichita KS Westar Energy Inc.png SVFullServiceRestauran... 60 KB SVHospital Wichita KS Westar Energy Inc.png SVHospital Wichita KS ... 64 KB SVLargeHotel Wichita KS Westar Energy Inc.png SVLargeHotel Wichita K... 59 KB SVLargeOffice Wichita KS Westar Energy Inc.png SVLargeOffice Wichita ... 64 KB SVMediumOffice Wichita KS Westar Energy Inc.png SVMediumOffice Wichita... 62 KB SVMidriseApartment Wichita KS Westar Energy Inc.png SVMidriseApartment Wic... 61 KB SVOutPatient Wichita KS Westar Energy Inc.png SVOutPatient Wichita K... 62 KB SVPrimarySchool Wichita KS Westar Energy Inc.png

7

Category:Goodland, KS | Open Energy Information  

Open Energy Info (EERE)

KS KS Jump to: navigation, search Go Back to PV Economics By Location Media in category "Goodland, KS" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Goodland KS Westar Energy Inc.png SVFullServiceRestauran... 60 KB SVHospital Goodland KS Westar Energy Inc.png SVHospital Goodland KS... 63 KB SVLargeHotel Goodland KS Westar Energy Inc.png SVLargeHotel Goodland ... 59 KB SVLargeOffice Goodland KS Westar Energy Inc.png SVLargeOffice Goodland... 65 KB SVMediumOffice Goodland KS Westar Energy Inc.png SVMediumOffice Goodlan... 63 KB SVMidriseApartment Goodland KS Westar Energy Inc.png SVMidriseApartment Goo... 60 KB SVOutPatient Goodland KS Westar Energy Inc.png SVOutPatient Goodland ... 63 KB SVPrimarySchool Goodland KS Westar Energy Inc.png

8

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Gasoline and Diesel Fuel Update (EIA)

accomplishments accomplishments are impressive in themselves, and associ- ated with each milestone is the expansion of future produc- tion opportunities as another technical barrier is overcome. The extension of recovery opportunities into deep water has established the deep offshore as an area of considerable national significance. A second source of increased supply is gas from coalbed formations. Natural gas production from coalbed methane fields continued to grow in 1996 as projects initiated mainly in the early to mid 1990's matured through the dewatering phase into higher rates of gas production. Coalbed forma- tions contribute almost 1 trillion cubic feet, roughly 5 per- cent, to total U.S. production. Continued production growth from coalbeds is not likely in light of the precipitous drop in new wells completed in coalbed formations since the termination of the production tax

9

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA  

Annual Energy Outlook 2012 (EIA)

857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 15. Average City Gate Price of Natural...

10

DOE - Office of Legacy Management -- Spencer Chemical Co - KS 0-01  

Office of Legacy Management (LM)

KS 0-01 KS 0-01 FUSRAP Considered Sites Site: SPENCER CHEMICAL CO. (KS.0-01 ) Eliminated from further consideration under FUSRAP - an AEC licensed operation Designated Name: Not Designated Alternate Name: Jayhawk Works KS.0-01-1 Location: Pittsburg , Kansas KS.0-01-1 Evaluation Year: 1985 KS.0-01-2 Site Operations: Processed enriched uranium (UF-6) and scrap to produce primarily uranium dioxide (UO-2) under AEC licenses. KS.0-01-3 KS.0-01-4 Site Disposition: Eliminated - No Authority - AEC licensed KS.0-01-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Normal and Enriched Uranium; Thorium KS.0-01-6 Radiological Survey(s): Yes KS.0-01-5 Site Status: Eliminated from further consideration under FUSRAP - an AEC licensed operation

11

Proceedings, World Of Coal Ash, April 11-15, 2005, Lexington, KY, USA Pultrusion of Fabric Reinforced High Flyash  

E-Print Network (OSTI)

Proceedings, World Of Coal Ash, April 11-15, 2005, Lexington, KY, USA Pultrusion of Fabric Reinforced High Flyash Blended Cement Composites Barzin Mobasher(1) , Alva Peled (2) , and Jitendra of elasticity. #12;Proceedings, World Of Coal Ash, April 11-15, 2005, Lexington, KY, USA In addition to ease

Mobasher, Barzin

12

File:USDA-CE-Production-GIFmaps-KY.pdf | Open Energy Information  

Open Energy Info (EERE)

KY.pdf KY.pdf Jump to: navigation, search File File history File usage Kentucky Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 387 KB, MIME type: application/pdf) Description Kentucky Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Kentucky External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:15, 27 December 2010 Thumbnail for version as of 16:15, 27 December 2010 1,650 × 1,275 (387 KB) MapBot (Talk | contribs) Automated bot upload

13

File:EIA-Appalach7-TN-KY-LIQ.pdf | Open Energy Information  

Open Energy Info (EERE)

Appalach7-TN-KY-LIQ.pdf Appalach7-TN-KY-LIQ.pdf Jump to: navigation, search File File history File usage Appalachian Basin, Kentucky and Tennessee By 2001 Liquids Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 19.31 MB, MIME type: application/pdf) Description Appalachian Basin, Kentucky and Tennessee By 2001 Liquids Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Kentucky, Tennessee File history Click on a date/time to view the file as it appeared at that time.

14

Category:Detroit, MI | Open Energy Information  

Open Energy Info (EERE)

MI" MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Detroit MI Detroit Edison Co.png SVFullServiceRestauran... 63 KB SVHospital Detroit MI Detroit Edison Co.png SVHospital Detroit MI ... 62 KB SVLargeHotel Detroit MI Detroit Edison Co.png SVLargeHotel Detroit M... 61 KB SVLargeOffice Detroit MI Detroit Edison Co.png SVLargeOffice Detroit ... 63 KB SVMediumOffice Detroit MI Detroit Edison Co.png SVMediumOffice Detroit... 58 KB SVMidriseApartment Detroit MI Detroit Edison Co.png SVMidriseApartment Det... 62 KB SVOutPatient Detroit MI Detroit Edison Co.png SVOutPatient Detroit M... 63 KB SVPrimarySchool Detroit MI Detroit Edison Co.png SVPrimarySchool Detroi... 65 KB SVQuickServiceRestaurant Detroit MI Detroit Edison Co.png SVQuickServiceRestaura...

15

US ENC MI Site Consumption  

Gasoline and Diesel Fuel Update (EIA)

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

16

US ENC MI Site Consumption  

U.S. Energy Information Administration (EIA) Indexed Site

MI MI Site Consumption million Btu $0 $500 $1,000 $1,500 $2,000 $2,500 US ENC MI Expenditures dollars ALL ENERGY average per household (excl. transportation) 0 2,000 4,000 6,000 8,000 10,000 12,000 US ENC MI Site Consumption kilowatthours $0 $250 $500 $750 $1,000 $1,250 $1,500 US ENC MI Expenditures dollars ELECTRICITY ONLY average per household * Michigan households use 123 million Btu of energy per home, 38% more than the U.S. average. * High consumption, combined with low costs for heating fuels compared to states with a similar climate, result in Michigan households spending 6% more for energy than the U.S. average. * Less reliance on electricity for heating, as well as cool summers keeps average site electricity consumption in the state low relative to other parts of the U.S.

17

RFP - Ann Arbor, MI  

NLE Websites -- All DOE Office Websites (Extended Search)

This request for proposals is on behalf of the City of Ann Arbor, MI which intends to purchase renewable energy certificates (RECs) for a portion of the their consumption. The City is interested in a purchase of 3,000 - 4,000 MWh per year for a contract length of one or two years. The City of Ann Arbor is also interested in options for additional customers (citizens and businesses in Ann Arbor) to participate in this purchase. The City, along with assistance from the vendor, will market an additional amount of RECs to other energy users in Ann Arbor, including large and small businesses, and residences. The City seeks marketing support from the vendor, and the ability of the vendor to offer such support will be an important consideration in choosing a vendor.

18

Fractal Location and Anomalous Diffusion Dynamics for Oil Wells from the KY Geological Survey  

E-Print Network (OSTI)

Utilizing data available from the Kentucky Geonet (KYGeonet.ky.gov) the fossil fuel mining locations created by the Kentucky Geological Survey geo-locating oil and gas wells are mapped using ESRI ArcGIS in Kentucky single plain 1602 ft projection. This data was then exported into a spreadsheet showing latitude and longitude for each point to be used for modeling at different scales to determine the fractal dimension of the set. Following the porosity and diffusivity studies of Tarafdar and Roy1 we extract fractal dimensions of the fossil fuel mining locations and search for evidence of scaling laws for the set of deposits. The Levy index is used to determine a match to a statistical mechanically motivated generalized probability function for the wells. This probability distribution corresponds to a solution of a dynamical anomalous diffusion equation of fractional order that describes the Levy paths which can be solved in the diffusion limit by the Fox H function ansatz.

Andrew, Keith; Andrew, Kevin A

2009-01-01T23:59:59.000Z

19

A new limit on the CP violating decay KS -> 3pi0 with the KLOE experiment  

E-Print Network (OSTI)

We have carried out a new direct search for the CP violating decay KS -> 3pi0 with 1.7 fb^-1 of e+e- collisions collected by the KLOE detector at the phi-factory DAFNE. We have searched for this decay in a sample of about 5.9 x 10^8 KS KL events tagging the KS by means of the KL interaction in the calorimeter and requiring six prompt photons. With respect to our previous search, the analysis has been improved by increasing of a factor four the tagged sample and by a more effective background rejection of fake KS tags and spurious clusters. We find no candidates in data and simulated background samples, while we expect 0.12 standard model events. Normalizing to the number of KS -> 2pi0 events in the same sample, we set the upper limit on BR(KS -> 3pi0 < 2.6 x 10^-8 at 90% C.L., five times lower than the previous limit. We also set the upper limit on the eta_000 parameter, |eta_000 | < 0.0088 at 90% C.L., improving by a factor two the latest direct measurement.

Babusci, D; Balwierz-Pytko, I; Bencivenni, G; Bini, C; Bloise, C; Bossi, F; Branchini, P; Budano, A; Balkestahl, L Caldeira; Capon, G; Ceradini, F; Ciambrone, P; Curciarello, F; Czerwinski, E; Dane, E; De Leo, V; De Lucia, E; De Robertis, G; De Santis, A; Di Domenico, A; Di Donato, C; Di Salvo, R; Domenici, D; Erriquez, O; Fanizzi, G; Fantini, A; Felici, G; Fiore, S; Franzini, P; Gauzzi, P; Giardina, G; Giovannella, S; Gonnella, F; Graziani, E; Happacher, F; Heijkenskjold, L; Hoistad, B; Iafolla, L; Jacewicz, M; Johansson, T; Kacprzak, K; Kupsc, A; Lee-Franzini, J; Leverington, B; Loddo, F; Loffredo, S; Mandaglio, G; Martemianov, M; Martini, M; Mascolo, M; Messi, R; Miscetti, S; Morello, G; Moricciani, D; Moskal, P; Nguyen, F; Passeri, A; Patera, V; Longhi, I Prado; Ranieri, A; Redmer, C F; Santangelo, P; Sarra, I; Schioppa, M; Sciascia, B; Silarski, M; Taccini, C; Tortora, L; Venanzoni, G; Wislicki, W; Wolke, M; Zdebik, J

2013-01-01T23:59:59.000Z

20

Control of Well Ks-8 in the Kilauea Lower East Rift Zone | Open Energy  

Open Energy Info (EERE)

of Well Ks-8 in the Kilauea Lower East Rift Zone of Well Ks-8 in the Kilauea Lower East Rift Zone Jump to: navigation, search OpenEI Reference LibraryAdd to library Conference Paper: Control of Well Ks-8 in the Kilauea Lower East Rift Zone Abstract In June 1991, a well located in Hawaii kicked and unloaded at 3,476 ft (1,059 m). This well was estimatedto have a possible bottomhole temperature of 650°F (343°C)and a reservoir pressure approaching 2,300 psi 5,858 Immediate attempts to kill the well were unsuccessful, and the long processof well control was started. Besides the harsh geological and reservoir conditions encountered,the scarce availability of materials in a remote location and long distance transportation of necessary equipment figured heavily in to the time delay of the final kill procedure of the

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


21

C:\\ANNUAL\\VENTCHAP.V8\\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

4 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99...

22

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998...

23

C:\\ANNUAL\\VENTCHAP.V8\\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 15. Marketed Production of Natural Gas in the United States, 2001...

24

C:\\ANNUAL\\VENTCHAP.V8\\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

0 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy...

25

NGA98fin5.vp  

Annual Energy Outlook 2012 (EIA)

NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99...

26

DOE - Office of Legacy Management -- Carboloy Co - MI 12  

Office of Legacy Management (LM)

Carboloy Co - MI 12 Carboloy Co - MI 12 FUSRAP Considered Sites Site: Carboloy Co. (MI.12 ) Eliminated from further consideration under FUSRAP - AEC licensed facility Designated Name: Not Designated Alternate Name: General Electric MI.12-1 Location: 11177 E. Eight Mile Road , Detroit , Michigan MI.12-1 MI.12-2 Evaluation Year: 1987-1991 MI.12-3 MI.12-4 MI.12-6 Site Operations: Turned-down the outer diameter of uranium metal slugs and conducted pilot plant scale operations for hot pressing uranium dioxide pellets into different solid shapes of fuel elements. MI.12-1 MI.12-2 Site Disposition: Eliminated - AEC licensed MI.12-5 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.12-1 MI.12-2 Radiological Survey(s): Yes MI.12-2 Site Status: Eliminated from further consideration under FUSRAP - AEC licensed facility

27

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov Columbia University Abstract miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3’UTR of mRNA, inducing either mRNA degradation or mRNA silencing. The most characteristic properties of miRNA are their multi-targeting potential (one miRNA may target many genes). This high information content of miRNAs makes them very important factors in cell reprogramming. Since these are small molecules which can potentially pass through gap junctions, it is logical to consider their role in cell to cell communication. We hypothesized that miRNA transfer between cells is likely to occur under stress conditions. To test this hypothesis we developed a system designed

28

MI  

NLE Websites -- All DOE Office Websites (Extended Search)

Mitio Inokuti Mitio Inokuti 1933-2009 Biographical sketch 1962 Ph. D., University of Tokyo 1962-63 Research Associate, Northwestern University 1963-65 Research Assocoate, Argonne National Laboratory 1965-73 Physicist, Argonne National Laboratory 1973-95 Senior Physicist, Argonne National Laboratory 1995-present Post-retirement research participant, Argonne National Laboratory 1969-70 Visiting Fellow, Joint Institute for Laboratory Astrophysics, University of Colorado and National Bureau of Standards 1980 NORDITA Guest Professor, Odense University 1996-present Visiting Scientist, GSF National Research Center for Environment and Health, Munich 1999 Eminent Scientist, Institute for Physical and Chemical Research (RIKEN), Tokyo Fellow, American Physical Society Fellow, Institute of Physics (London)

29

Ground Motion Studies at NuMI  

Science Conference Proceedings (OSTI)

Ground motion can cause significant deterioration in the luminosity of a linear collider. Vibration of numerous focusing magnets causes continuous misalignments, which makes the beam emittance grow. For this reason, understanding the seismic vibration of all potential LC sites is essential and related efforts in many sites are ongoing. In this document we summarize the results from the studies specific to Fermilab grounds as requested by the LC project leader at FNAL, Shekhar Mishra in FY04-FY06. The Northwestern group focused on how the ground motion effects vary with depth. Knowledge of depth dependence of the seismic activity is needed in order to decide how deep the LC tunnel should be at sites like Fermilab. The measurements were made in the NuMI tunnel, see Figure 1. We take advantage of the fact that from the beginning to the end of the tunnel there is a height difference of about 350 ft and that there are about five different types of dolomite layers. The support received allowed to pay for three months of salary of Michal Szleper. During this period he worked a 100% of his time in this project. That include one week of preparation: 2.5 months of data taking and data analysis during the full period of the project in order to guarantee that we were recording high quality data. We extended our previous work and made more systematic measurements, which included detailed studies on stability of the vibration amplitudes at different depths over long periods of time. As a consequence, a better control and more efficient averaging out of the daytime variation effects were possible, and a better study of other time dependences before the actual depth dependence was obtained. Those initial measurements were made at the surface and are summarized in Figure 2. All measurements are made with equipment that we already had (two broadband seismometers KS200 from GEOTECH and DL-24 portable data recorder). The offline data analysis took advantage of the full Fourier spectra information and the noise was properly subtracted. The basic formalism is summarized if Figure 3. The second objective was to make a measurement deeper under ground (Target hall, Absorber hall and Minos hall - 150 ft to 350 ft), which previous studies did not cover. All results are summarized in Figure 3 and 4. The measurements were covering a frequency range between 0.1 to 50 Hz. The data was taken continuously for at least a period of two weeks in each of the locations. We concluded that the dependence on depth is weak, if any, for frequencies above 1 Hz and not visible at all at lower frequencies. Most of the attenuation (factor of about 2-3) and damping of ground motion that is due to cultural activity at the surface is not detectable once we are below 150 ft underground. Therefore, accelerator currently under consideration can be build at the depth and there is no need to go deeper underground is built at Fermi National Laboratory.

Mayda M. Velasco; Michal Szleper

2012-02-20T23:59:59.000Z

30

File:USDA-CE-Production-GIFmaps-KS.pdf | Open Energy Information  

Open Energy Info (EERE)

KS.pdf KS.pdf Jump to: navigation, search File File history File usage Kansas Ethanol Plant Locations Size of this preview: 776 × 600 pixels. Full resolution ‎(1,650 × 1,275 pixels, file size: 317 KB, MIME type: application/pdf) Description Kansas Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Kansas External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:14, 27 December 2010 Thumbnail for version as of 16:14, 27 December 2010 1,650 × 1,275 (317 KB) MapBot (Talk | contribs) Automated bot upload

31

DOE - Office of Legacy Management -- Oliver Corp - MI 11  

Office of Legacy Management (LM)

Oliver Corp - MI 11 Oliver Corp - MI 11 FUSRAP Considered Sites Site: OLIVER CORP. (MI.11 ) Eliminated from further consideration under FUSRAP - Referred to NRC Designated Name: Not Designated Alternate Name: Behnke Warehousing Incorporated MI.11-1 Location: 433 East Michigan Avenue , Battle Creek , Michigan MI.11-1 Evaluation Year: 1986 MI.11-4 Site Operations: Conducted production scale briquetting of green salt and magnesium blend under AEC license Nos. SNM-591, SUB-579, and C-3725. MI.11-1 MI.11-3 Site Disposition: Eliminated - No Authority - AEC licensed MI.11-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Green Salt (Uranium) MI.11-3 Radiological Survey(s): Yes MI.11-1 Site Status: Eliminated from further consideration under FUSRAP - Referred to NRC MI.11-4

32

DOE - Office of Legacy Management -- Adrian - MI 01  

NLE Websites -- All DOE Office Websites (Extended Search)

Adrian - MI 01 Adrian - MI 01 FUSRAP Considered Sites Adrian, MI Alternate Name(s): Bridgeport Brass Co. Special Metals Extrusion Plant Bridgeport Brass Company General Motors General Motors Company, Adrian MI.01-1 Location: 1450 East Beecher Street, Adrian, Michigan MI.01-3 Historical Operations: Performed uranium extrusion research and development and metal fabrication work for the AEC using uranium, thorium, and plutonium. MI.01-2 Eligibility Determination: Eligible MI.01-1 Radiological Survey(s): Assessment Surveys, Verifcation Surveys MI.01-4 MI.01-5 MI.01-8 Site Status: Certified- Certification Basis, Federal Register Notice included MI.01-6 MI.01-7 Long-term Care Requirements: Long-Term Surveillance and Maintenance Requirements for Remediated FUSRAP Sites S07566_FUSRAP

33

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

View History: Monthly Annual Download Data (XLS File) St. Clair, MI Natural Gas Pipeline Exports to Canada (Million Cubic Feet) St. Clair, MI Natural Gas Pipeline Exports to...

34

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA...

35

DOE - Office of Legacy Management -- Star Cutter Corp - MI 15  

Office of Legacy Management (LM)

Star Cutter Corp - MI 15 Star Cutter Corp - MI 15 FUSRAP Considered Sites Site: STAR CUTTER CORP. (MI.15) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Farmington , Michigan MI.15-1 Evaluation Year: 1991 MI.15-2 Site Operations: Performed a one time uranium slug drilling operation test in 1956. MI.15-3 MI.15-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited scope and quantity of materials handled MI.15-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium MI.15-1 MI.15-3 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.15-1 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to STAR CUTTER CORP.

36

miRNA as Bystander Effect Factor  

NLE Websites -- All DOE Office Websites (Extended Search)

miRNA as Bystander Effect Factor miRNA as Bystander Effect Factor L. Smilenov 1 , M. Grad 2 , D. Attinger 2 and E.Hall 1 1 Center for Radiological Research, Columbia University 2 Department of Mechanical Engineering, Columbia University DOE Grant: DEPS0208ER0820 Abstract: miRNA are 21-23 mer RNA molecules which are essential for organism development and cell functions. They regulate gene expression by binding to the 3'UTR of mRNA, inducing either

37

DOE - Office of Legacy Management -- Michigan Velsicol Chemical Corp - MI  

Office of Legacy Management (LM)

Michigan Velsicol Chemical Corp - Michigan Velsicol Chemical Corp - MI 03 FUSRAP Considered Sites Site: MICHIGAN [VELSICOL] CHEMICAL CORP. (MI.03 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Velsicol Chemical Corp. MI.03-1 Location: St. Louis , Michigan MI.03-2 Evaluation Year: Circa 1987 MI.03-3 Site Operations: Rare earth processing facility. MI.03-2 Site Disposition: Eliminated - No Authority - NRC survey MI.03-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Rare Earths MI.03-3 Radiological Survey(s): Yes MI.03-2 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to MICHIGAN [VELSICOL] CHEMICAL CORP. MI.03-1 - DOE Letter; Mott to Farowe; Subject: Velsicol Chemical

38

DOE - Office of Legacy Management -- University of Michigan - MI 08  

Office of Legacy Management (LM)

Michigan - MI 08 Michigan - MI 08 FUSRAP Considered Sites Site: UNIVERSITY OF MICHIGAN (MI.08) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Ann Arbor , Michigan MI.08-1 Evaluation Year: 1987 MI.08-2 Site Operations: Conducted research with a supersonic reflectroscope to detect flaws within a metal slug and developed methods for testing the adequacy of coatings which are applied to pieces of uranium metal. MI.08-1 MI.08-3 Site Disposition: Eliminated - Potential for contamination considered remote due to limited quantities of materials handled in a controlled environment MI.08-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.08-1 MI.08-3 Radiological Survey(s): None Indicated

39

Category:Houghton-Lake, MI | Open Energy Information  

Open Energy Info (EERE)

Houghton-Lake, MI Houghton-Lake, MI Jump to: navigation, search Go Back to PV Economics By Location Media in category "Houghton-Lake, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Houghton-Lake MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Houghton-Lake MI Detroit Edison Co.png SVHospital Houghton-La... 64 KB SVLargeHotel Houghton-Lake MI Detroit Edison Co.png SVLargeHotel Houghton-... 61 KB SVLargeOffice Houghton-Lake MI Detroit Edison Co.png SVLargeOffice Houghton... 64 KB SVMediumOffice Houghton-Lake MI Detroit Edison Co.png SVMediumOffice Houghto... 61 KB SVMidriseApartment Houghton-Lake MI Detroit Edison Co.png SVMidriseApartment Hou... 65 KB SVOutPatient Houghton-Lake MI Detroit Edison Co.png SVOutPatient Houghton-...

40

Benchmarks for the New-Physics Search through CP Violation in B^0->pi^0 K_S  

E-Print Network (OSTI)

Using isospin relations, we predict the Standard-Model correlation between S_{pi^0 K_S}=(sin 2beta)_{pi^0 K_S} and A_{pi^0 K_S}, the mixing-induced and direct CP asymmetries of B^0-> pi^0 K_S. The calculation uses flavour SU(3) only to fix the isospin-3/2 amplitude through the B^\\pm->pi^\\pm pi^0 branching ratio, and thus has a small irreducible theoretical error. It can reach percent level precision thanks to expected future lattice-QCD progress for the calculation of the relevant SU(3)-breaking form-factor ratio, and serves as a benchmark for new-physics searches. We obtain an interesting picture in the A_{pi^0 K_S} - S_{pi^0 K_S} plane, where the current experimental data show a discrepancy with the Standard Model, and comment on the direct CP asymmetries of B^0->pi^-K^+ and B^+ -> pi^0 K^+. A modified electroweak penguin with a large new CP-violating phase can explain the discrepancy and allows us to accommodate also the corresponding data for other b->s penguin-dominated decays.

Robert Fleischer; Sebastian Jager; Dan Pirjol; Jure Zupan

2008-06-18T23:59:59.000Z

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


41

MI Gap Clearing Kicker Magnet Design Review  

SciTech Connect

The kicker system requirements were originally conceived for the NOvA project. NOvA is a neutrino experiment located in Minnesota. To achieve the desired neutrino flux several upgrades are required to the accelerator complex. The Recycler will be used as a proton pre-injector for the Main Injector (MI). As the Recycler is the same size as the MI, it is possible to do a single turn fill ({approx}11 {micro}sec), minimizing the proton injection time in the MI cycle and maximizing the protons on target. The Recycler can then be filled with beam while the MI is ramping to extract beam to the target. To do this requires two new transfer lines. The existing Recycler injection line was designed for 10{pi} pbar beams, not the 20{pi} proton beams we anticipate from the Booster. The existing Recycler extraction line allows for proton injection through the MI, while we want direct injection from the Booster. These two lines will be decommissioned. The new injection line from the MI8 line into the Recycler will start at 848 and end with injection kickers at RR104. The new extraction line in the RR30 straight section will start with a new extraction kicker at RR232 and end with new MI injection kickers at MI308. Finally, to reduce beam loss activation in the enclosure, a new gap clearing kicker will be used to extract uncaptured beam created during the slip stack injection process down the existing dump line. It was suggested that the MI could benefit from this type of system immediately. This led to the early installation of the gap clearing system in the MI, followed by moving the system to Recycler during NOvA. The specifications also changed during this process. Initially the rise and fall time requirements were 38 ns and the field stability was {+-}1%. The 38 ns is based on having a gap of 2 RF buckets between injections. (There are 84 RF buckets that can be filled from the Booster for each injection, but 82 would be filled with beam. MI and Recycler contain 588 RF buckets.) A rough cost/benefit analysis showed that increasing the number of empty buckets to 3 decreased the kicker system cost by {approx}30%. This could be done while not extending the running time since this is only a 1% reduction in protons per pulse, hence the rise and fall time are now 57 ns. Additionally, the {+-}1% tolerance would have required a fast correction kicker while {+-}3% could be achieved without this kicker. The loosened tolerance was based on experience on wide band damping systems in the MI. A higher power wideband damping system is a better use of the resources as it can be used to correct for multiple sources of emittance growth. Finally, with the use of this system for MI instead of Recycler, the required strength grew from 1.2 mrad to 1.7 mrad. The final requirements for this kicker are listed.

Jensen, Chris; /Fermilab

2008-10-01T23:59:59.000Z

42

DOE - Office of Legacy Management -- Detrex Corp - MI 10  

Office of Legacy Management (LM)

Detrex Corp - MI 10 Detrex Corp - MI 10 FUSRAP Considered Sites Site: Detrex Corp. (MI.10 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.10-1 Evaluation Year: 1987 MI.10-2 Site Operations: Conducted experimental runs relative to pickling/degreasing of one handful of uranium turnings MI.10-1 Site Disposition: Eliminated - Potential for contamination considered remote due to small quantity of material handled - There is no record of Detrex conducting work for the AEC MI.10-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Metal MI.10-2 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP

43

Sequence determinants of pri-miRNA processing  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are short RNAs that regulate many processes in physiology and pathology by guiding the repression of target messenger RNAs. For classification purposes, miRNAs are defined as ~22 nt RNAs that are produced ...

Auyeung, Vincent C. (Vincent Churk-man)

2012-01-01T23:59:59.000Z

44

RECIPIENT:MI Department of Energy, Labor & Economic Growth STATE: MI  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Department of Energy, Labor & Economic Growth STATE: MI MI Department of Energy, Labor & Economic Growth STATE: MI PROJECT TITLE: SEP - Farm Audit Implementation Funding Opportunity Announcement Number Procurement Instrument Number NEPA Control Number CID Number DE-FOA-0000052 DE-EE0000166 GFO-O000166-037 GOO Based on my review ofthe information concerning the proposed action, as NEPA Compliance Officer (authorized under DOE Order 451.1A), I have made the following determination: CX, EA, EIS APPENDIX AND NUMBER: Description: 85.1 Actions to conserve energy, demonstrate potential energy conservation, and promote energy-efficiency that do not increase the indoor concentrations of potentially harmful substances. These actions may involve financial and technical assistance to individuals (such as builders, owners, consultants, designers), organizations (such as utilities), and state

45

KY_50mwind  

NLE Websites -- All DOE Office Websites (Extended Search)

ataTechnologySpecificUnitedStatesWindHighResolutionKentuckyWindHighResolution.zip> Description: Abstract: Annual average wind resource potential for the state of...

46

Identifying human miRNA targets with a genetic algorithm  

Science Conference Proceedings (OSTI)

MicroRNAs (miRNAs) play an important role in eukaryotic gene regulation. Although thousands of miRNAs have been identified in laboratories around the world, most of their targets still remain unknown. Different computational techniques exist to predict ... Keywords: genetic algorithms, miRNA targets, microRNAs

Kalle Karhu; Sami Khuri; Juho Mkinen; Jorma Tarhio

2010-02-01T23:59:59.000Z

47

Category:Traverse City, MI | Open Energy Information  

Open Energy Info (EERE)

City, MI" City, MI" The following 16 files are in this category, out of 16 total. SVFullServiceRestaurant Traverse City MI Detroit Edison Co.png SVFullServiceRestauran... 64 KB SVHospital Traverse City MI Detroit Edison Co.png SVHospital Traverse Ci... 63 KB SVLargeHotel Traverse City MI Detroit Edison Co.png SVLargeHotel Traverse ... 61 KB SVLargeOffice Traverse City MI Detroit Edison Co.png SVLargeOffice Traverse... 64 KB SVMediumOffice Traverse City MI Detroit Edison Co.png SVMediumOffice Travers... 59 KB SVMidriseApartment Traverse City MI Detroit Edison Co.png SVMidriseApartment Tra... 64 KB SVOutPatient Traverse City MI Detroit Edison Co.png SVOutPatient Traverse ... 64 KB SVPrimarySchool Traverse City MI Detroit Edison Co.png SVPrimarySchool Traver... 65 KB SVQuickServiceRestaurant Traverse City MI Detroit Edison Co.png

48

Microsoft Word - figure_8.doc  

Gasoline and Diesel Fuel Update (EIA)

T I D O R W Y ND SD C A N V U T CO NE KS A Z NM OK TX MN WI MI IA I L IN OH MO AR M S AL GA T N KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI A K J a p a n Mexico M e x...

49

Mi-Young Kim - Research Staff - FEERC  

NLE Websites -- All DOE Office Websites (Extended Search)

Mi-Young Kim Mi-Young Kim Post Doctoral Research Associate (F) 865-946-1354 kimm@ornl.gov Professional Highlights Education Ph.D., Applied Chemical Engineering, Chonnam National University, 2008 Miyoung joined the Oak Ridge National Laboratory (ORNL) as a post-doctoral researcher in 2010. She has worked at the Center for Development of Fine Chemicals and the Research Institute for Catalysis in Chonnam National University prior to joining the ORNL. Her research background is in heterogeneous catalysis and highly dispersed noble metal catalysts. She has extensive experience in characterizing catalysts using EXAFS, XPS, XRD, solid NMR and ESR. She is currently involved in automotive catalysis research with an emphasis on monolithic catalysts & materials relevant to lean NOx and cold start emissions controls

50

,"Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Marysville, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

51

,"Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf...  

U.S. Energy Information Administration (EIA) Indexed Site

Of Series","Frequency","Latest Data for" ,"Data 1","Detroit, MI Natural Gas Pipeline Imports From Canada (MMcf)",1,"Annual",2012 ,"Release Date:","172014" ,"Next...

52

The role of the N*(1535) resonance and the pi^- p --> KY amplitudes in the OZI forbidden pi N --> phi N reaction  

E-Print Network (OSTI)

We study the pi N --> phi N reaction close to the phi N threshold within the chiral unitary approach, by combining the pi^- p --> K^+ Sigma^-, pi^- p --> K^0 Sigma^0 and pi^- p --> K^0 Lambda amplitudes with the coupling of the phi to the K components of the final states of these reactions via quantum loops. We obtain a good agreement with experiment when the dominant pi^- p --> K^0 Lambda amplitude is constrained with its experimental cross section. We also evaluate the coupling of the N*(1535) to phi N and find a moderate coupling as a consequence of partial cancellation of the large KY components of the N*(1535). We also show that the N*(1535) pole approximation is too small to reproduce the measured cross section for the pi N --> phi N reaction.

M. Dring; E. Oset; B. S. Zou

2008-05-13T23:59:59.000Z

53

Inclusive production of $\\Lambda$, $K^0_s$ and exotic narrow resonances for systems $K_s^0 p$, $K_s^0 \\Lambda$, $\\Lambda p$ from p+propane interactions at 10 GeV/c  

E-Print Network (OSTI)

Experimental data from the 2m propane bubble chamber for production of $\\Lambda$, $K^0_s$ have been used to search of exotic baryon states, in the $K_s^0 p$, $K_s^0 \\Lambda$ and $\\Lambda p$ decay mode for the reaction p+propane at 10 GeV/c. The estimation of experimental inclusive cross sections for $\\Lambda$ and $K^0_s$ production in the p$^{12}C$ collision is equal to $\\sigma_{\\Lambda}$= 13.3$\\pm$1.7 mb and $\\sigma_{K^0_s}$= 3.8$\\pm$0.6 mb, respectively. The measured $\\Lambda /\\pi^+$ ratio from pC reaction is equal to (5.3$\\pm0.8)*10^{-2}$. The experimental $\\Lambda /\\pi^+$ ratio from the pC reaction is approximately two times larger than the $\\Lambda /\\pi^+$ ratio simulated by FRITIOF model from the pC reaction. The invariant mass spectrum $\\Lambda K^0_s$ registered narrow peaks in regions of 1750 and 1795 MeV/$c^2$. The statistical significance of these peaks has been estimated as 5.6 and 3.3 S.D., respectively. These would be candidates for the $N^0$ or the $\\Xi^0$ pentaquark states. The $pK^0_s$ invaria...

Aslanyan, P Z

2005-01-01T23:59:59.000Z

54

Members of the miRNA-200 Family Regulate Olfactory Neurogenesis  

E-Print Network (OSTI)

MicroRNAs (miRNAs) are highly expressed in vertebrate neural tissues, but the contribution of specific miRNAs to the development and function of different neuronal populations is still largely unknown. We report that miRNAs ...

Choi, Philip S.

55

Category:Utility Rate Impacts on PV Economics By Location | Open Energy  

Open Energy Info (EERE)

Utility Rate Impacts on PV Economics By Location Utility Rate Impacts on PV Economics By Location Jump to: navigation, search Impact of Utility Rates on PV Economics Montgomery, AL Little Rock, AR Flagstaff, AZ Phoenix, AZ Tucson, AZ Arcata, CA LA, CA San Francisco, CA Boulder, CO Eagle County, CO Pueblo, CO Bridgeport, CT Wilmington, DE Miami, FL Tampa, FL Atlanta, GA Savannah, GA Des Moines, IA Mason, IA Boise, ID Chicago, IL Springfield, IL Indianapolis, IN Goodland, KS Wichita, KS Lexington, KY New Orleans, LA Shreveport, LA Boston, MA Baltimore, MD Caribou, ME Portland, ME Detroit, MI Houghton-Lake, MI Traverse City, MI International Falls, MN Minneapolis, MN Kansas City, MO Jackson, MS Billings, MT Greensboro, NC Wilmington, NC Bismarck, ND Minot, ND Omaha, NE Concord, NH Atlantic City, NJ Albuquerque, NM Las Vegas, NV Reno, NV New York, NY

56

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million Cubic Feet) Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9; 1990's: 14,132:

57

RELAP5/MOD3.2 Assessment Using CHF Data from the KS-1 and V-200 Experiment Facilities  

SciTech Connect

The RELAP/MOD3.2 computer code has been assessed using rod bundle critical heat flux data from the KS-1 and V-200 facilities. This work was performed as part of the U.S. Department of Energys International Nuclear Safety Program, and is part of the effort addressing the capability of the RELAP5/MOD3.2 code to model transients in Soviet-designed reactors. Designated VVER Standard Problem 7, these tests addressed one of the important phenomena related to VVER behavior that the code needs to simulate well, core heat transfer. The code was judged to be in minimal agreement with the experiment data, consistently overpredicting the measured critical heat flux. It is recommended that a model development effort be undertaken to develop a critical heat flux model for RELAP5 that better represents the behavior in VVER rod bundles.

Bayless, Paul David

2001-07-01T23:59:59.000Z

58

The NuMI neutrino beam at Fermilab  

Science Conference Proceedings (OSTI)

The Neutrinos at the Main Injector (NuMI) facility at Fermilab began operations in late 2004. NuMI will deliver an intense {nu}{sub {mu}} beam of variable energy (2-20 GeV) directed into the Earth at 58 mrad for short ({approx}1km) and long ({approx}700-900 km) baseline experiments. Several aspects of the design and results from early commissioning runs are reviewed.

Kopp, Sacha E.; /Texas U.

2005-05-01T23:59:59.000Z

59

DOE - Office of Legacy Management -- Mitts-Merrel Co - MI 14  

Office of Legacy Management (LM)

Mitts-Merrel Co - MI 14 Mitts-Merrel Co - MI 14 FUSRAP Considered Sites Site: MITTS-MERREL CO. (MI.14 ) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: Mitts & Merrell Co. MI.14-1 Location: Saginaw , Michigan MI.14-1 Evaluation Year: 1993 MI.14-2 Site Operations: Reduced thorium metal chunks into particle sized pieces on a small test scale during the mid-1950s. MI.14-1 Site Disposition: Eliminated - Potential for contamination considered remote based on limited quantity of materials handled MI.14-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.14-1 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.14-1 Site Status: Eliminated from consideration under FUSRAP

60

DOE - Office of Legacy Management -- Dow Chemical Co - Midland - MI 06  

NLE Websites -- All DOE Office Websites (Extended Search)

Midland - MI 06 Midland - MI 06 FUSRAP Considered Sites Site: Dow Chemical Co. - Midland (MI.06 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Midland , Michigan MI.06-1 Evaluation Year: Circa 1987 MI.06-2 Site Operations: Conducted development work for production of magnesium-thorium alloys. MI.06-1 Site Disposition: Eliminated - AEC licensed site MI.06-1 MI.06-2 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Thorium MI.06-1 Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow Chemical Co. - Midland MI.06-1 - NRC Letter; R. G. Page to William E. Mott; Subject: List of contaminated or potentially contaminated sites; January 22, 1982;

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


61

DOE - Office of Legacy Management -- Baker-Perkins Co - MI 13  

Office of Legacy Management (LM)

Baker-Perkins Co - MI 13 Baker-Perkins Co - MI 13 FUSRAP Considered Sites Site: Baker-Perkins Co (MI 13) Eliminated from consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Saginaw , Michigan MI.13-1 Evaluation Year: 1991 MI.13-1 MI.13-2 Site Operations: Small scale oxide mixing demonstrations and testing in May, 1956. MI.13-2 Site Disposition: Eliminated - Potential for contamination remote based on limited scope of activities at the site MI.13-3 Radioactive Materials Handled: Yes Primary Radioactive Materials Handled: Uranium Oxide MI.13-4 Radiological Survey(s): Yes - health and safety monitoring during operations only MI.13-4 Site Status: Eliminated from consideration under FUSRAP Also see Documents Related to Baker-Perkins Co

62

U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

1 1 Regional maps Figure F6. Coal supply regions Figure F6. Coal Supply Regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming OTHER WEST Rocky Mountain Southwest Northwest KY AK 1000 0 SCALE IN MILES Source: U.S. Energy Information Administration, Office

63

DOE - Office of Legacy Management -- Naval Ordnance Plant - MI 0-03  

Office of Legacy Management (LM)

Plant - MI 0-03 Plant - MI 0-03 FUSRAP Considered Sites Site: NAVAL ORDNANCE PLANT (MI.0-03) Eliminated from further consideration under FUSRAP - Referred to DoD for action Designated Name: Not Designated Alternate Name: None Location: Centerline , Michigan MI.0-03-1 Evaluation Year: 1987 MI.0-03-1 Site Operations: Assembled bomb components. MI.0-03-1 Site Disposition: Eliminated - No Authority - Referred to DoD MI.0-03-1 Radioactive Materials Handled: None Indicated Primary Radioactive Materials Handled: None Radiological Survey(s): None Indicated Site Status: Eliminated from further consideration under FUSRAP - Referred to DoD for action MI.0-03-1 Also see Documents Related to NAVAL ORDNANCE PLANT MI.0-03-1 - DOE Letter; J.Fiore to C.Shafer; Subject: Information on

64

DOE - Office of Legacy Management -- Dow-Detroit Edison Project - MI 0-02  

Office of Legacy Management (LM)

Dow-Detroit Edison Project - MI Dow-Detroit Edison Project - MI 0-02 FUSRAP Considered Sites Site: Dow-Detroit Edison Project (MI.0-02 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate Name: None Location: Detroit , Michigan MI.0-02-1 Evaluation Year: 1987 MI.0-02-1 Site Operations: Performed reference design work for a special fast breeder type reactor. MI.0-02-1 Site Disposition: Eliminated - No radioactive material handled at the site MI.0-02-1 Radioactive Materials Handled: No Primary Radioactive Materials Handled: None MI.0-02-1 Radiological Survey(s): no Site Status: Eliminated from further consideration under FUSRAP Also see Documents Related to Dow-Detroit Edison Project MI.0-02-1 - DOE Memorandum/Checklist; S.Jones to the File; Subject:

65

REC Silicon formerly ASiMI | Open Energy Information  

Open Energy Info (EERE)

Silicon formerly ASiMI Silicon formerly ASiMI Jump to: navigation, search Name REC Silicon (formerly ASiMI) Place Butte, Montana Zip 59750 Product Manufactures and sells polycrystalline silicon. Coordinates 47.838435°, -100.665669° Loading map... {"minzoom":false,"mappingservice":"googlemaps3","type":"ROADMAP","zoom":14,"types":["ROADMAP","SATELLITE","HYBRID","TERRAIN"],"geoservice":"google","maxzoom":false,"width":"600px","height":"350px","centre":false,"title":"","label":"","icon":"","visitedicon":"","lines":[],"polygons":[],"circles":[],"rectangles":[],"copycoords":false,"static":false,"wmsoverlay":"","layers":[],"controls":["pan","zoom","type","scale","streetview"],"zoomstyle":"DEFAULT","typestyle":"DEFAULT","autoinfowindows":false,"kml":[],"gkml":[],"fusiontables":[],"resizable":false,"tilt":0,"kmlrezoom":false,"poi":true,"imageoverlays":[],"markercluster":false,"searchmarkers":"","locations":[{"text":"","title":"","link":null,"lat":47.838435,"lon":-100.665669,"alt":0,"address":"","icon":"","group":"","inlineLabel":"","visitedicon":""}]}

66

MHK Technologies/Mi2 | Open Energy Information  

Open Energy Info (EERE)

Mi2 Mi2 < MHK Technologies Jump to: navigation, search << Return to the MHK database homepage Mi2.jpg Technology Profile Primary Organization Mavi Innovations Inc Technology Resource Click here Current Technology Readiness Level Click here TRL 5 6 System Integration and Technology Laboratory Demonstration Technology Description The turbines convert the kinetic energy of flowing water in tidal or river currents into clean and reliable power At the core of their technology lies a high efficiency turbine module consisting of a vertical axis rotor housed inside a duct Mooring Configuration Depending on the specific application the turbine modules can be either floating gravity mounted or integrated into existing civil infrastructures Optimum Marine/Riverline Conditions Tidal and river sites with mean flows above 5 knots and depths over 8 meters are ideal locations for our turbine units

67

Validation of MCNPX-PoliMi Fission Models  

Science Conference Proceedings (OSTI)

We present new results on the measurement of correlated, outgoing neutrons from spontaneous fission events in a Cf-252 source. 16 EJ-309 liquid scintillation detectors are used to measure neutron-neutron correlations for various detector angles. Anisotropy in neutron emission is observed. The results are compared to MCNPX-PoliMi simulations and good agreement is observed.

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-10-01T23:59:59.000Z

68

Discovery of miRNA-regulated processes in mammalian development  

E-Print Network (OSTI)

The genomes of plants and animals encode hundreds of non-coding ~22nt RNAs termed "microRNAs" (miRNAs). These RNAs guide the sequence-specific inhibition of translation and destabilization of mRNA targets through short ...

Young, Amanda Garfinkel

2010-01-01T23:59:59.000Z

69

MCNPX-PoliMi for Nuclear Nonproliferation Applications  

Science Conference Proceedings (OSTI)

In the past few years, efforts to develop new measurement systems to support nuclear nonproliferation and homeland security have increased substantially. Monte Carlo radiation transport is one of the simulation methods of choice for the analysis of data from existing systems and for the design of new measurement systems; it allows for accurate description of geometries, detailed modeling of particle-nucleus interactions, and event-by-event detection analysis. This paper describes the use of the Monte Carlo code MCNPX-PoliMi for nuclear-nonproliferation applications, with particular emphasis on the simulation of spontaneous and neutron-induced nuclear fission. In fact, of all possible neutron-nucleus interactions, neutron-induced fission is the most defining characteristic of special nuclear material (such as U-235 and Pu-239), which is the material of interest in nuclear-nonproliferation applications. The MCNP-PoliMi code was originally released from the Radiation Safety Shielding Center (RSSIC) at Oak Ridge National Laboratory in 2003 [1]; the MCNPX-PoliMi code contains many enhancements and is based on MCNPX ver. 2.7.0. MCNPX-PoliMi ver. 2.0 was released through RSICC in 2012 as a patch to MCNPX ver. 2.7.0 and as an executable [2].

S. A. Pozzi; S. D. Clarke; W. Walsh; E. C. Miller; J. Dolan; M. Flaska; B. M. Wieger; A. Enqvist; E. Padovani; J. K. Mattingly; D. L. Chichester; P. Peerani

2012-12-01T23:59:59.000Z

70

Radiosensitizing Effects of Ectopic miR-101 on Non-Small-Cell Lung Cancer Cells Depend on the Endogenous miR-101 Level  

SciTech Connect

Purpose: Previously, we showed that ectopic miR-101 could sensitize human tumor cells to radiation by targeting ATM and DNA-PK catalytic subunit (DNA-PKcs) to inhibit DNA repair, as the endogenous miR-101 levels are low in tumors in general. However, the heterogeneity of human cancers may result in an exception. The purpose of this study was to test the hypothesis that a few tumor cell lines with a high level of endogenous miR-101 would prove less response to ectopic miR-101. Methods and Materials: Fourteeen non-small-cell lung cancer (NSCLC) cell lines and one immortalized non-malignant lung epithelial cell line (NL20) were used for comparing endogenous miR-101 levels by real-time reverse transcription-polymerase chain reaction. Based on the different miR-101 levels, four cell lines with different miR-101 levels were chosen for transfection with a green fluorescent protein-lentiviral plasmid encoding miR-101. The target protein levels were measured by using Western blotting. The radiosensitizing effects of ectopic miR-101 on these NSCLC cell lines were determined by a clonogenic assay and xenograft mouse model. Results: The endogenous miR-101 level was similar or lower in 13 NSCLC cell lines but was 11-fold higher in one cell line (H157) than in NL20 cells. Although ectopic miR-101 efficiently decreased the ATM and DNA-PKcs levels and increased the radiosensitization level in H1299, H1975, and A549 cells, it did not change the levels of the miR-101 targets or radiosensitivity in H157 cells. Similar results were observed in xenograft mice. Conclusions: A small number of NSCLC cell lines could have a high level of endogenous miR-101. The ectopic miR-101 was able to radiosensitize most NSCLC cells, except for the NSCLC cell lines that had a much higher endogenous miR-101 level. These results suggest that when we choose one miRNA as a therapeutic tool, the endogenous level of the miRNA in each tumor should be considered.

Chen, Susie; Wang Hongyan; Ng, Wooi Loon; Curran, Walter J. [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States); Wang Ya, E-mail: ywang94@emory.edu [Department of Radiation Oncology, School of Medicine and the Winship Cancer Institute, Emory University, Atlanta, GA (United States)

2011-12-01T23:59:59.000Z

71

A Specific miRNA Signature Correlates With Complete Pathological Response to Neoadjuvant Chemoradiotherapy in Locally Advanced Rectal Cancer  

Science Conference Proceedings (OSTI)

Purpose: MicroRNAs (miRNAs) are small, noncoding RNA molecules that can be down- or upregulated in colorectal cancer and have been associated to prognosis and response to treatment. We studied miRNA expression in tumor biopsies of patients with rectal cancer to identify a specific 'signature' correlating with pathological complete response (pCR) after neoadjuvant chemoradiotherapy. Methods and Materials: A total of 38 T3-4/N+ rectal cancer patients received capecitabine-oxaliplatin and radiotherapy followed by surgery. Pathologic response was scored according to the Mandard TRG scale. MiRNA expression was analyzed by microarray and confirmed by real-time Reverse Transcription Polymerase Chain Reaction (qRT-PCR) on frozen biopsies obtained before treatment. The correlation between miRNA expression and TRG, coded as TRG1 (pCR) vs. TRG >1 (no pCR), was assessed by methods specifically designed for this study. Results: Microarray analysis selected 14 miRNAs as being differentially expressed in TRG1 patients, and 13 were confirmed by qRT-PCR: 11 miRNAs (miR-1183, miR-483-5p, miR-622, miR-125a-3p, miR-1224-5p, miR-188-5p, miR-1471, miR-671-5p, miR-1909 Asterisk-Operator , miR-630, miR-765) were significantly upregulated in TRG1 patients, 2 (miR-1274b, miR-720) were downexpressed. MiR-622 and miR-630 had a 100% sensitivity and specificity in selecting TRG1 cases. Conclusions: A set of 13 miRNAs is strongly associated with pCR and may represent a specific predictor of response to chemoradiotherapy in rectal cancer patients.

Della Vittoria Scarpati, Giuseppina [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Falcetta, Francesca [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); Carlomagno, Chiara, E-mail: chiara.carlomagno@unina.it [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Ubezio, Paolo; Marchini, Sergio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Stefano, Alfonso [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Singh, Vijay Kumar [Cancer Genomics Laboratory, Fondazione 'Edo ed Elvo Tempia Valenta', Biella (Italy); D'Incalci, Maurizio [Laboratory of Cancer Pharmacology, Department of Oncology, 'Mario Negri' Institute for Pharmacological Research, Milan (Italy); De Placido, Sabino [Department of Molecular and Clinical Endocrinology and Oncology, University of Naples Federico II, Naples (Italy); Pepe, Stefano [Division of Oncology, University of Salerno (Italy)

2012-07-15T23:59:59.000Z

72

Print http://us.mg4.mail.yahoo.com/neo/launch?.rand=deOsgk04ks40i Subject: RE: [s-w-h] b Solar verses wind efficiency  

E-Print Network (OSTI)

.yahoo.com/neo/launch?.rand=deOsgk04ks40i Subject: RE: [s-w-h] b Solar verses wind efficiency From: Michael Klemen (wind4energy;Print http://us.rng4.mail.yahoo.comlneo/launch?.rand=deOsgko4ks4 energy in the wind is proportional://www.ndsu.edu/ndsu/klemen/Perfect_Turbine.htm You can see that for an ideal real life wind turbine ("good turbine") the increase in energy

73

Groundwater protection for the NuMI project  

Science Conference Proceedings (OSTI)

The physics requirements for the long base line neutrino oscillation experiment MINOS dictate that the NuMI beamline be located in the aquifer at Fermilab. A methodology is described for calculating the level of radioactivation of groundwater caused by operation of this beamline. A conceptual shielding design for the 750 meter long decay pipe is investigated which would reduce radioactivation of the groundwater to below government standards. More economical shielding designs to meet these requirements are being explored. Also, information on local geology, hydrogeology, government standards, and a glossary have been included.

Wehmann, A.; Smart, W.; Menary, S.; Hylen, J.; Childress, S.

1997-10-01T23:59:59.000Z

74

OrMiS: a tabletop interface for simulation-based training  

Science Conference Proceedings (OSTI)

This paper presents the design of OrMiS, a tabletop application supporting simulation-based training. OrMiS is notable as one of the few practical tabletop applications supporting collaborative analysis, planning and interaction around digital maps. ... Keywords: gis, interaction design, military, simulation, tabletop

Christophe Bortolaso; Matthew Oskamp; T.C. Nicholas Graham; Doug Brown

2013-10-01T23:59:59.000Z

75

In silico analysis of putative miRNAs and their target genes in sorghum Sorghum bicolor  

Science Conference Proceedings (OSTI)

MicroRNAs miRNAs are small endogenous genes regulators which regulate different processes underlying plant adaptation to abiotic stresses. To gain a deep understanding of role of miRNAs in plants, in the present study, we computationally analyzed different ...

Gobind Ram; Arun Dev Sharma

2013-06-01T23:59:59.000Z

76

NuMI Target Station AHIPA09 10/19/09  

E-Print Network (OSTI)

MI Experience Focus of this talk: · Hot handling · Target pile design: thick shielding, maintaining alignment containment, minimal hot handling equipment Enough for target/horn replacement, but very limited repair: installing work cell with remote manipulator arms in C0 building. #12;NuMI Target Station AHIPA09 10

McDonald, Kirk

77

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1998 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

78

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

2000 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-99.99 10.00-11.99 12.00+ 19. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2000 (Dollars per Thousand Cubic Feet) Figure 20. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2000 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural

79

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2002 2002 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA 910, "Monthly Natural Gas Marketer Survey." 17. Average Price of Natural Gas Delivered to U.S. Commercial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration

80

Microsoft Word - Figure_18_19.doc  

Gasoline and Diesel Fuel Update (EIA)

9 9 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2004 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2004 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$2.49 price category.

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


81

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

49 49 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK MD 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Figure 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2003 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Power Consumers, 2003 (Dollars per Thousand Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Note: States where the electric power price has been withheld (see Table 23) are included in the $0.00-$1.99 price category.

82

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

1998 1998 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1998 (Dollars per Thousand Cubic Feet) Figure

83

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 30. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 31. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of

84

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 1999 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost and Quality of Fuels for Electric Plants," and Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental

85

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ 17. Average Price of Natural Gas Delivered to U.S. Residential

86

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2 2 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 18. Average Price of Natural Gas Delivered to U.S. Onsystem Industrial Consumers, 2002 (Dollars per Thousand Cubic Feet) Figure Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 19. Average Price of Natural Gas Delivered to U.S. Electric Utilities, 2002 (Dollars per Thousand Cubic Feet) Figure Sources: Federal Energy Regulatory Commission (FERC), Form FERC-423, "Monthly Report of Cost

87

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

9 9 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1999 (Dollars per Thousand Cubic Feet) Figure

88

C:\ANNUAL\VENTCHAP.V8\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

8 8 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 0.00-1.99 2.00-2.99 3.00-3.99 4.00-4.99 5.00-5.99 6.00-6.99 7.00+ 16. Average Price of Natural Gas Delivered to U.S. Residential Consumers, 1997 (Dollars per Thousand Cubic Feet) Figure

89

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

2001 2001 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." 28. Average Price of Natural Gas Delivered to U.S. Onsystem Residential Consumers, 2001 (Dollars per Thousand Cubic Feet) Figure 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK Note: Commercial prices include natural gas delivered for use as vehicle fuel. Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition."

90

Real-Time Cardiac Imaging at 3 Tesla K.S. NAYAK, C.H. CUNNINGHAM, J.M. SANTOS, J.M. PAULY, AND D.G. NISHIMURA  

E-Print Network (OSTI)

Real-Time Cardiac Imaging at 3 Tesla K.S. NAYAK, C.H. CUNNINGHAM, J.M. SANTOS, J.M. PAULY, AND D are shown in Figure 2. Conclusions We have demonstrated real-time cardiac imaging at 3 Tesla with high SNR

Nayak, Krishna

91

miRNAminer: a tool for homologous microRNA gene search  

E-Print Network (OSTI)

Background MicroRNAs (miRNAs), present in most metazoans, are small non-coding RNAs that control gene expression by negatively regulating translation through binding to the 3'UTR of mRNA transcripts. Previously, experimental ...

Artzi, Shay

92

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See...  

NLE Websites -- All DOE Office Websites (Extended Search)

MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4....

93

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS Location: Tribe MI-TRIBE-LAC VIEUX DESERT BAND OF LAKE SUPERIOR CHIPPEWA INDIANS MI American Recovery and Reinvestment Act: Proposed Action or Project Description The Lac Vieux Desert Tribe proposes to use funding to help with a current effort that is a collaboration of the Tribe with the Conservation Fund of Michigan, an effort that is funded by the W.K. Kellogg Foundation. The project will be conducting a feasibility study to determine the viability of using wood products from resources found on tribal lands. The study is dedicating a part of the effort to see the feasibility of providing a renewable energy source to the Tribe in the form of wood products and biomass fuels. NEPA

94

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

5 5 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 138,239,378 5.94 Pub Svc Elec and Gas Co........................ NJ 69,738,220 5.26 Southern California Gas Co ..................... CA 63,758,073 7.26 Pacific Gas and Elec Co........................... CA 58,646,965 7.84 Keyspan Energy Del Co ........................... NY 53,501,565 7.32 Consumers Energy Co ............................. MI 51,663,333 4.26 TXU Gas Distribution................................ TX 48,112,344 5.86 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 45,021,338 7.87 Con Edison Co of New York Inc............... NY 44,076,359 8.02 Michigan Consol Gas Co.......................... MI 40,342,797 5.39 Pub Svc Co of Colorado........................... CO 39,697,152 5.22 East Ohio Gas Co ....................................

95

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

2000 2000 Southern California Gas Co ..................... CA 251,452,001 8.32 Nicor Gas ................................................. IL 221,009,522 6.68 Pacific Gas and Elec Co........................... CA 211,181,852 7.98 Reliant Energy.......................................... MN,MS,TX,AR,KS,LA,MO 184,692,129 7.53 Consumers Energy Co ............................. MI 176,663,600 4.76 Michigan Consol Gas Co.......................... MI 136,124,328 5.41 Keyspan Energy Del Co ........................... NY 134,055,940 10.75 Pub Svc Elec and Gas Co........................ NJ 132,611,115 6.32 East Ohio Gas Co .................................... OH 131,187,521 7.49 Columbia Gas Dist Co.............................. KY,VA,MD,PA,OH 130,622,887 8.82 Peoples Gas Lt and Coke Co................... IL 103,856,141 8.60 Pub Svc Co of Colorado...........................

96

miR-30 Regulates Mitochondrial Fission through Targeting p53 and the Dynamin-Related Protein-1 Pathway  

E-Print Network (OSTI)

miRNAs participate in the regulation of apoptosis. However, it remains largely unknown as to how miRNAs are integrated into the apoptotic program. Mitochondrial fission is involved in the initiation of apoptosis. It is not yet clear whether miRNAs are able to regulate mitochondrial fission. Here we report that miR-30 family members are able to regulate apoptosis by targeting the mitochondrial fission machinery. Our data show that miR-30 family members can inhibit mitochondrial fission and the consequent apoptosis. In exploring the underlying molecular mechanism, we identified that miR-30 family members can suppress p53 expression. In response to the apoptotic stimulation, the expression levels of miR-30 family members were reduced, whereas p53 was upregulated. p53 transcriptionally activated the mitochondrial fission protein, dynamin-related protein-1 (Drp1). The latter conveyed the apoptotic signal of p53 by initiating the mitochondrial fission program. miR-30 family members inhibited mitochondrial fission through suppressing the expression of p53 and its downstream target Drp1. Our data reveal a novel model in which a miRNA can regulate apoptosis through targeting the

Jincheng Li; Stefan Donath; Yanrui Li; Danian Qin; Bellur S. Prabhakar; Peifeng Li

2009-01-01T23:59:59.000Z

97

Roles of the MicroRNA miR-31 in tumor metastasis and an experimental system for the unbiased discovery of genes relevant for breast cancer metastasis  

E-Print Network (OSTI)

In these studies, the microRNA miR-31 was identified as a potent inhibitor of breast cancer metastasis. miR-31 expression levels were inversely associated with the propensity to develop metastatic disease in human breast ...

Valastyan, Scott J. (Scott John)

2010-01-01T23:59:59.000Z

98

DEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE  

E-Print Network (OSTI)

or their account to any unaffiliated company, group, or individual without our Customer's permission. Our SecurityDEPENDENT CHILD NAME (LAST) (FIRST) (M.I.) SUFFIX SEX MALE FEMALE SOCIAL SECURITY NUMBER BIRTH DATE SECURITY NUMBER BIRTH DATE FULL-TIME HIRE DATE COVERAGE EFFECTIVE DATE STATUS Active COBRA Retiree

Reynolds, Albert C.

99

Organic scintillation detector response simulation using non-analog MCNPX-PoliMi  

Science Conference Proceedings (OSTI)

Organic liquid scintillation detectors are valuable for the detection of special nuclear material since they are capable of detecting both neutrons and gamma rays. Scintillators can also provide energy information which is helpful in identification and characterization of the source. In order to design scintillation based measurement systems appropriate simulation tools are needed. MCNPX-PoliMi is capable of simulating scintillation detector response; however, simulations have traditionally been run in analog mode which leads to long computation times. In this paper, non-analog MCNPX-PoliMi mode which uses variance reduction techniques is applied and tested. The non-analog MCNPX-PoliMi simulation test cases use source biasing, geometry splitting and a combination of both variance reduction techniques to efficiently simulate pulse height distribution and then time-of-flight for a heavily shielded case with a {sup 252}Cf source. An improvement factor (I), is calculated for distributions in each of the three cases above to analyze the effectiveness of the non-analog MCNPX-PoliMi simulations in reducing computation time. It is found that of the three cases, the last case which uses a combination of source biasing and geometry splitting shows the most improvement in simulation run time for the same desired variance. For pulse height distributions speedup ranging from a factor 5 to 25 is observed, while for time-of-flights the speedup factors range from 3 to 10. (authors)

Prasad, S.; Clarke, S. D.; Pozzi, S. A.; Larsen, E. W. [Univ. of Michigan, 2355 Bonisteel Blvd., Ann Arbor, MI 48109 (United States)

2012-07-01T23:59:59.000Z

100

File:USDA-CE-Production-GIFmaps-MI.pdf | Open Energy Information  

Open Energy Info (EERE)

MI.pdf MI.pdf Jump to: navigation, search File File history File usage Michigan Ethanol Plant Locations Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(1,275 × 1,650 pixels, file size: 310 KB, MIME type: application/pdf) Description Michigan Ethanol Plant Locations Sources United States Department of Agriculture Related Technologies Biomass, Biofuels, Ethanol Creation Date 2010-01-19 Extent State Countries United States UN Region Northern America States Michigan External links http://www.nass.usda.gov/Charts_and_Maps/Ethanol_Plants/ File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 16:16, 27 December 2010 Thumbnail for version as of 16:16, 27 December 2010 1,275 × 1,650 (310 KB) MapBot (Talk | contribs) Automated bot upload

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


101

AMENDMENT OF SOLICITATION/MODIFICATlON OF CONTRACT MI54 I See Block 16C I  

National Nuclear Security Administration (NNSA)

MI54 I MI54 I See Block 16C I REQ. NO. Babcock & Wilcox Technical Services Pantex, LLC PO Box 30020 Amarillo, TX 79120 2. AMENDMENTIMODIFICATION NO. 1 3. EFFECTIVE DATE 1 4. REQUlSlTlONlPURCHASE 1 5. PROJECT NO. (If a ~ ~ l i c a b l e ) l.CoNTRACTIDCODE ~ . . U.S. Department of Energy National Nuclear Security Administration Service Center Property and M&O Contract Support Department P.O. Box 5400 Albuquerque, NM 87185-5400 I I 9B. DATED (SEE ITEM 1 1 ) PAGE 1 OF 2 PAGES 6. ISSUED BY CODE 1 7. ADMINISTERED BY (If other than Item 6 ) CODE I - - - - U.S. Department of Energy National Nuclear Security Administration Manager, Pantex Site Office P.O. Box 30030 Amarillo, TX 79120 10A. MODIFICATION OF CONTRACTIORDER NO. 1 I 8. NAME AND ADDRESS OF CONTRACTOR (No., street, county, state, ZIP Code)

102

MINOS+: a Proposal to FNAL to run MINOS with the medium energy NuMI beam  

Science Conference Proceedings (OSTI)

This is a proposal to continue to expose the two MINOS detectors to the NuMI muon neutrino beam for three years starting in 2013. The medium energy setting of the NuMI beam projected for NO{nu}A will deliver about 18 x 10{sup 20} protons-on-target during the first three years of operation. This will allow the MINOS Far Detector to collect more than 10,000 charged current muon neutrino events in the 4-10 GeV energy range and provide a stringent test for non-standard neutrino interactions, sterile neutrinos, extra dimensions, neutrino time-of-flight, and perhaps more. In addition there will be more than 3,000 neutral current events which will be particularly useful in extending the sterile neutrino search range.

Tzanankos, G.; /Athens U.; Bishai, M.; Diwan, M.; /Brookhaven; Escobar, C.O.; Gomes, R.A.; Gouffon, P.; /Campinas State U. /Goias U. /Sao Paulo U.; Blake, A.; Thomson, M.; /Cambridge U.; Patterson, R.B.; /Caltech; Adamson, P.; Childress, S.; /Fermilab /IIT, Chicago /Los Alamos /Minnesota U. /Minnesota U., Duluth /Bhubaneswar, NISER /Iowa State U.

2011-05-01T23:59:59.000Z

103

Related Links | Building Energy Codes Program  

NLE Websites -- All DOE Office Websites (Extended Search)

Related Links Related Links Regional Energy Efficiency Organizations MEEA NEEP NEEA SEEA SWEEP SPEER Midwest Energy Efficiency Alliance (MEEA) IL, IN, IA, KS, KY, ND, NE, MI, MN, MO, OH, SD, WI The Midwest Energy Efficiency Alliance (MEEA) is a collaborative network advancing energy efficiency in the Midwest to support sustainable economic development and environmental preservation. MEEA raises awareness, facilitates energy efficiency programs and strengthens policy across the nine-state region. MEEA brings together a respected network of members, partners, board and staff, and inspires others to create new technologies, new products and new ways of thinking when it comes to energy efficiency. Codes Contact Isaac Elnecave Senior Policy Manager ielnecave@mwalliance.org phone: (312)784-7253

104

Wind Program: Stakeholder Engagement and Outreach  

Wind Powering America (EERE)

Outreach Outreach Printable Version Bookmark and Share The Stakeholder Engagement and Outreach initiative of the U.S. Department of Energy's Wind Program is designed to educate, engage, and enable critical stakeholders to make informed decisions about how wind energy contributes to the U.S. electricity supply. Highlights Resources Wind Resource Maps State Activities What activities are happening in my state? AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Installed wind capacity maps. Features A image of a house with a residential-scale small wind turbine. Small Wind for Homeowners, Farmers, and Businesses Stakeholder Engagement & Outreach Projects

105

Annual Energy Outlook 2012  

Gasoline and Diesel Fuel Update (EIA)

2 2 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2012

106

Assumptions to the Annual Energy Outlook 2007 Report  

Gasoline and Diesel Fuel Update (EIA)

clothes drying, ceiling fans, coffee makers, spas, home security clothes drying, ceiling fans, coffee makers, spas, home security systems, microwave ovens, set-top boxes, home audio equipment, rechargeable electronics, and VCR/DVDs. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric appliances. The module's output includes number Energy Information Administration/Assumptions to the Annual Energy Outlook 2007 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central

107

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2007 (Million Cubic Feet) Nigeria Algeria 37,483 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports.

108

Tritium transport in the NuMI decay pipe region - modeling and comparison with experimental data  

DOE Green Energy (OSTI)

The NuMI (Neutrinos at Main Injector) beam facility at Fermilab is designed to produce an intense beam of muon neutrinos to be sent to the MINOS underground experiment in Soudan, Minnesota. Neutrinos are created by the decay of heavier particles. In the case of NuMI, the decaying particles are created by interaction of high-energy protons in a target, creating mostly positive pions. These particles can also interact with their environment, resulting in production of a variety of short-lived radionuclides and tritium. In the NuMI beam, neutrinos are produced by 120 GeV protons from the Fermilab Main Injector accelerator which are injected into the NuMI beam line using single turn extraction. The beam line has been designed for 400 kW beam power, roughly a factor of 2 above the initial (2005-06) running conditions. Extracted protons are bent downwards at a 57mr angle towards the Soudan Laboratory. The meson production target is a 94 cm segmented graphite rod, cooled by water in stainless tubes on the top and bottom of the target. The target is followed by two magnetic horns which are pulsed to 200 kA in synchronization with the passage of the beam, producing focusing of the secondary hadron beam and its daughter neutrinos. Downstream of the second horn the meson beam is transported for 675 m in an evacuated 2 m diameter beam (''decay'') pipe. Subsequently, the residual mesons and protons are absorbed in a water cooled aluminum/steel absorber immediately downstream of the decay pipe. Some 200 m of rock further downstream ranges out all of the residual muons. During beam operations, after installation of the chiller condensate system in December 2005, the concentration of tritiated water in the MINOS sump flow of 177 gpm was around 12 pCi/ml, for a total of 0.010 pCi/day. A simple model of tritium transport and deposition via humidity has been constructed to aid in understanding how tritium reaches the sump water. The model deals with tritium transported as HTO, water in which one hydrogen atom has been replaced with tritium. Based on concepts supported by the modeling, a dehumidification system was installed during May 2006 that reduced the tritium level in the sump by a factor of two. This note is primarily concerned with tritium that was produced in the NuMI target pile, carried by air flow into the target hall and down the decay pipe passageway (where most of it was deposited). The air is exhausted through the existing air vent shaft EAV2 (Figure 1).

Hylen, J.; Plunkett, R.; /Fermilab

2007-03-01T23:59:59.000Z

109

http://www.ornl.gov/Procurement.PDF  

NLE Websites -- All DOE Office Websites (Extended Search)

93 93 1. All Grade 5 and Grade 8 fasteners of foreign origin which do not bear any manufacturer's headmarks: Grade 5 Grade 8 2. Grade 5 fasteners with the following manufacturers' headmarks: J Jinn Her (TW) KS Kosaka Kogyo (JP) J KS 3. Grade 8 fasteners with the following manufacturers' headmarks: A Asahi Mfg (JP) KS Kosaka Kogyo (JP) A KS NF RT NF Nippon Fasteners (JP) RT Takai Ltd (JP) H Hinomoto Metal (JP) FM Fastener Co (of JP) H FM J M MS KY M Minamida Sieybo (JP) KY Kyoei (JP) MS Minato Kogyo (JP) J Jinn Her (JP) E Hollow Infasco Co. (CA TW JP YU) Triangle (sizes greater than 1/2-in dia) UNY E Daiei (JP) UNY Unytite (JP) 4. Grade 8.2 fasteners with the following headmarks: KS Kosaka Kogyo (JP) KS 5. Grade A325 Fasteners (Bennett Denver Target only) with the following headmarks: A325 KS Kosaka Kogyo (JP)

110

Horn Operational Experience in K2K, MiniBooNE, NuMI and CNGS  

E-Print Network (OSTI)

This paper gives an overview of the operation and experience gained in the running of magnetic horns in conventional neutrino beam lines (K2K, MiniBooNE, NuMI and CNGS) over the last decade. Increasing beam power puts higher demands on horn conductors but even more on their hydraulic and electrical systems, while the horn environment itself becomes more hostile due to radiation. Experience shows that designing horns for remote handling and testing them extensively without beam become prerequisites for successful future neutrino beam lines.

Pardons, A

2008-01-01T23:59:59.000Z

111

Welcome to the Efficient Windows Collaborative  

NLE Websites -- All DOE Office Websites (Extended Search)

Window Selection Tool: New Construction Windows Window Selection Tool: New Construction Windows The Window Selection Tool will take you through a series of design conditions pertaining to your design and location. It is a step-by-step decision-making tool to help determine the most energy efficient window for your house. SELECT LOCATION: AK Anchorage AK Fairbanks AL Birmingham AL Mobile AR Little Rock AZ Flagstaff AZ Phoenix AZ Tucson CA Arcata CA Bakersfield CA Daggett CA Fresno CA Los Angeles CA Red Bluff CA Sacramento CA San Diego CA San Francisco CO Denver CO Grand Junction CT Hartford DC Washington DE Wilmington FL Daytona Beach FL Jacksonville FL Miami FL Tallahassee FL Tampa GA Atlanta GA Savannah HI Honolulu IA Des Moines ID Boise IL Chicago IL Springfield IN Indianapolis KS Wichita KY Lexington KY Louisville LA Lake Charles LA New Orleans LA Shreveport MA Boston MD Baltimore ME Portland MI Detroit MI Grand Rapids MI Houghton MN Duluth MN Minneapolis MO Kansas City MO St. Louis MS Jackson MT Billings MT Great Falls NC Raleigh ND Bismarck NE Omaha NH Concord NJ Atlantic City NM Albuquerque NV Las Vegas NV Reno NY Albany NY Buffalo NY New York OH Cleveland OH Dayton OK Oklahoma City OR Medford OR Portland PA Philadelphia PA Pittsburgh PA Williamsport RI Providence SC Charleston SC Greenville SD Pierre TN Memphis TN Nashville TX Brownsville TX El Paso TX Fort Worth TX Houston TX Lubbock TX San Antonio UT Cedar City UT Salt Lake City VA Richmond VT Burlington WA Seattle WA Spokane WI Madison WV Charleston WY Cheyenne AB Edmonton MB Winnipeg ON Toronto PQ Montreal SELECT HOUSE TYPE:

112

DOE/EIA-0131(96) Distribution Category/UC-960 Natural Gas  

Gasoline and Diesel Fuel Update (EIA)

ID ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Interstate Movements of Natural Gas in the United States, 1996 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL KY (T) MA ME (T) AL LA MA NH (T) AL MO (T) MA NJ (T) AL SC MD DC CT RI RI MA DE MD VA DC MA CT (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 906,407 355,260 243,866 220 384,311 576,420 823,799 842,114 27,271 126,012 133 602,841 266 579,598 16,837 268,138 48,442 182,511 219,242 86,897 643,401 619,703 8,157 937,806 292,711 869,951 12,316 590,493 118,256

113

San Juan Montana Thrust Belt WY Thrust Belt Black Warrior  

U.S. Energy Information Administration (EIA) Indexed Site

San San Juan Montana Thrust Belt WY Thrust Belt Black Warrior Paradox - San Juan NW (2) Uinta- Piceance Paradox - San Juan SE (2) Florida Peninsula Appalachian- NY (1) Appalachian OH-PA (2) Appalachian Eastern PA (3) Appalachian Southern OH (4) Appalachian Eastern WV (5) Appalachian WV-VA (6) Appalachian TN-KY (7) Piceance Greater Green River Eastern OR-WA Ventura Williston Williston NE (2) Williston NW (1) Williston South (3) Eastern Great Basin Ventura West, Central, East Eastern OR-WA Eastern Great Basin Appalachian Denver Florida Peninsula Black Warrior W Y T h ru st B e lt Powder River Paradox- Uinta- Grtr Green River MT Thrust Belt Powder River North (1) Powder River South (2) Denver North (1) Denver South (3) Denver Middle (2) TX CA MT AZ ID NV NM CO IL OR UT KS WY IA NE SD MN ND OK FL WI MO AL WA GA AR LA MI IN PA NY NC MS TN KY VA OH SC

114

T-1025 IU SciBath-768 detector tests in MI-12  

SciTech Connect

This is a memorandum of understanding between the Fermi National Accelerator Laboratory (Fermilab) and the experimenters of Department of Physics and Center for Exploration of Energy and Matter, Indiana University, who have committed to participate in detector tests to be carried out during the 2012 Fermilab Neutrino program. The memorandum is intended solely for the purpose of recording expectations for budget estimates and work allocations for Fermilab, the funding agencies and the participating institutions. it reflects an arrangement that currently is satisfactory to the parties; however, it is recognized and anticipated that changing circumstances of the evolving research program will necessitate revisions. The parties agree to modify this memorandum to reflect such required adjustments. Actual contractual obligations will be set forth in separate documents. The experimenters propsoe to test their prototype 'SciBat-768' detector in the MI-12 building for 3 months (February-April) in Spring 2012. The major goal of this effort is to measure or limit the flux of beam-induced neutrons in a far-off-axis (> 45{sup o}) location of the Booster Neutrino Beamline (BNB). This flux is of interest for a proposed coherent neutral-current neutrino-argon elastic scattering experiment. A second goal is to collect more test data for the SciBath-768 to enable better understanding and calibration of the device. The SciBath-768 detector successfully ran for 3 months in the MINOS Underground Area in Fall 2011 as testbeam experiment T-1014 and is currently running above ground in the MINOS service building. For the run proposed here, the experiments are requesting: space in MI-12 in which to run the SciBath detector during February-April 2012 while the BNB is operating; technical support to help with moving the equipment on site; access to power, internet, and accelerator signals; and a small office space from which to run and monitor the experiment.

Tayloe, Rex; Cooper, R.; Garrison, L.; Thornton, T.; Rebenitsch, L.; /Indiana U.; DeJongh, Fritz; Loer, Benjamin; Ramberg, Erik; Yoo, Jonghee; /Fermilab

2012-02-11T23:59:59.000Z

115

Validation of the MCNPX-PoliMi Code to Design a Fast-Neutron Multiplicity Counter  

Science Conference Proceedings (OSTI)

Many safeguards measurement systems used at nuclear facilities, both domestically and internationally, rely on He-3 detectors and well established mathematical equations to interpret coincidence and multiplicity-type measurements for verifying quantities of special nuclear material. Due to resource shortages alternatives to these existing He-3 based systems are being sought. Work is also underway to broaden the capabilities of these types of measurement systems in order to improve current multiplicity analysis techniques. As a part of a Material Protection, Accounting, and Control Technology (MPACT) project within the U.S. Department of Energy's Fuel Cycle Technology Program we are designing a fast-neutron multiplicity counter with organic liquid scintillators to quantify important quantities such as plutonium mass. We are also examining the potential benefits of using fast-neutron detectors for multiplicity analysis of advanced fuels in comparison with He-3 detectors and testing the performance of such designs. The designs are being developed and optimized using the MCNPX-PoliMi transport code to study detector response. In the full paper, we will discuss validation measurements used to justify the use of the MCNPX-PoliMi code paired with the MPPost multiplicity routine to design a fast neutron multiplicity counter with liquid scintillators. This multiplicity counter will be designed with the end goal of safeguarding advanced nuclear fuels. With improved timing qualities associated with liquid scintillation detectors, we can design a system that is less limited by nuclear materials of high activities. Initial testing of the designed system with nuclear fuels will take place at Idaho National Laboratory in a later stage of this collaboration.

J. L. Dolan; A. C. Kaplan; M. Flaska; S. A. Pozzi; D. L. Chichester

2012-07-01T23:59:59.000Z

116

PMC42, a breast progenitor cancer cell line, has normal-like mRNA and miRNA transcriptomes  

E-Print Network (OSTI)

normal breast epithelium, and PMC42, a breast cancer cell line that retains progenitor pluripotency allowing in-culture differentiation to both secretory and myoepithelial fates. In contrast, only PMC42 exhibits a normal-like miRNA expression profile. We...

Git, Anna; Spiteri, Inmaculada; Blenkiron, Cherie; Dunning, Mark J; Pole, Jessica C M; Chin, Suet-Feung; Wang, Yanzhong; Smith, James C; Livesey, Frederick J; Caldas, Carlos

2008-06-27T23:59:59.000Z

117

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 15, 1999 Place Time Name Group Group  

E-Print Network (OSTI)

Erdmann 30-39F 7 245 20:23.8 Paul Gee 50-59M 32 246 20:24.6 John Wool 40-49M 42 247 20:28.8 Lynette Levy (1.86 mi) October 15, 1999 page 8 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance

118

Microsoft Word - Gage-KS.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Intercomparisons of Cloud Observations Intercomparisons of Cloud Observations from the AL S-band Profiler and the ETL K-band Millimeter-Wave Cloud Radar on the R/V Ronald H. Brown during Nauru99 K. S. Gage and D. A. Carter National Oceanic and Atmospheric Administration Aeronomy Laboratory Boulder, Colorado P. E. Johnston and C. R. Williams Cooperative Institute for Research in Environmental Sciences University of Colorado Boulder, Colorado M. Ryan Science Technology Corporation Boulder, Colorado D. Hazen and B. W. Orr National Oceanic and Atmospheric Administration Environmental Technology Laboratory Boulder, Colorado Introduction Nauru99 took place in the western and central Pacific during June and July 1999. During Nauru99, a diverse suite of instruments was located on the research vessel (R/V) Ronald H. Brown to measure cloud

119

Ks-BAND DETECTION OF THERMAL EMISSION AND COLOR CONSTRAINTS TO CoRoT-1b: A LOW-ALBEDO PLANET WITH INEFFICIENT ATMOSPHERIC ENERGY REDISTRIBUTION AND A TEMPERATURE INVERSION  

SciTech Connect

We report the detection in Ks-band of the secondary eclipse of the hot Jupiter CoRoT-1b from time series photometry with the ARC 3.5 m telescope at Apache Point Observatory. The eclipse shows a depth of 0.336 +- 0.042% and is centered at phase 0.5022{sup +0.0023}{sub -0.0027}, consistent with a zero eccentricity orbit (e cos omega = 0.0035{sup +0.0036}{sub -0.0042}). We perform the first optical to near-infrared multi-band photometric analysis of an exoplanet's atmosphere and constrain the reflected and thermal emissions by combining our result with the recent 0.6, 0.71, and 2.09 mum secondary eclipse detections by Snellen et al., Gillon et al., and Alonso et al. Comparing the multi-wavelength detections to state-of-the-art radiative-convective chemical-equilibrium atmosphere models, we find the near-infrared fluxes difficult to reproduce. The closest blackbody-based and physical models provide the following atmosphere parameters: a temperature T = 2460{sup +80}{sub -160} K; a very low Bond albedo A{sub B} = 0.000{sup +0.081}{sub -0.000}; and an energy redistribution parameter P{sub n} = 0.1, indicating a small but nonzero amount of heat transfer from the day to nightside. The best physical model suggests a thermal inversion layer with an extra optical absorber of opacity kappa{sub e} = 0.05 cm{sup 2} g{sup -1}, placed near the 0.1 bar atmospheric pressure level. This inversion layer is located 10 times deeper in the atmosphere than the absorbers used in models to fit mid-infrared Spitzer detections of other irradiated hot Jupiters.

Rogers, Justin C. [Department of Physics and Astronomy, Johns Hopkins University, 366 Bloomberg Center, 3400 N. Charles Street, Baltimore, MD 21218 (United States); Apai, Daniel [Space Telescope Science Institute, 3700 San Martin Drive, Baltimore, MD 21218 (United States); Lopez-Morales, Mercedes [Department of Terrestrial Magnetism, Carnegie Institution of Washngton, 5241 Broad Branch Rd. NW, Washington, DC 20015 (United States); Sing, David K. [UPMC Univ Paris 06, CNRS, Institut d'Astrophysique de Paris, 98bis boulevard Arago, F-75014 Paris (France); Burrows, Adam, E-mail: rogers@pha.jhu.ed [Department of Astrophysical Sciences, Princeton University, Peyton Hall, Princeton, NJ 08544 (United States)

2009-12-20T23:59:59.000Z

120

Proposal to perform a high - statisics neutrino scattering experiment using a fine - grained detector in the NuMI Beam  

SciTech Connect

The NuMI facility at Fermilab will provide an extremely intense beam of neutrinos for the MINOS neutrino-oscillation experiment. The spacious and fully-outfitted MINOS near detector hall will be the ideal venue for a high-statistics, high-resolution {nu} and {bar {nu}}-nucleon/nucleus scattering experiment. The experiment described here will measure neutrino cross-sections and probe nuclear effects essential to present and future neutrino-oscillation experiments. Moreover, with the high NuMI beam intensity, the experiment will either initially address or significantly improve our knowledge of a wide variety of neutrino physics topics of interest and importance to the elementary-particle and nuclear-physics communities.

Morfin, J.G.; /Fermilab; McFarland, K.; /Rochester U.

2003-12-01T23:59:59.000Z

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


121

fcmlbig - Energy Information Administration  

U.S. Energy Information Administration (EIA)

256821 TX Freeman-Martin 256852 MI Freeman-Redding 256914 WV Freemansburg 256945 IL Freemanspur 256976 KS Freemeyer 257007 CA Fremont Landing 257038 OK Freeny

122

Other Participants 1999 | U.S. DOE Office of Science (SC)  

Office of Science (SC) Website

MI Shawnee Mission South High School , Shawnee Mission , KS Skyline High School , Idaho Falls, ID Smoky Hill High School, Aurora, CO St. James High School , Montgomery , AL...

123

Figure 11. Shale gas proved reserves by selected states, wet after ...  

U.S. Energy Information Administration (EIA)

Figure 11 Shale_History_Summary state Alabama AL Arkansas AR CA Colorado CO Kentucky KY Louisiana LA Michigan MI Montana MT North Dakota ND NM Oklahoma OK Pennsylvania

124

regionalmaps  

Gasoline and Diesel Fuel Update (EIA)

Specific LNG Terminals Specific LNG Terminals Generic LNG Terminals Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Specific LNG Terminals Generic LNG Terminals Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana

125

regionalmaps  

Gasoline and Diesel Fuel Update (EIA)

LNG Imports LNG Imports Pacifi c (9) Moun tain (8) CA (12) AZ/N M (11) W. North Centr al (4) W. South Centr al (7) E. South Centr al (6) E. North Centr al (3) S. Atlan tic (5) FL (10) Mid. Atlan tic (2) New Engl. (1) W. Cana da E. Cana da MacK enzie Alask a Cana da Offsh ore and LNG Mexic o Baha mas Primary Flows Secondary Flows Pipeline Border Crossing Figure 6. Coal Supply Regions Source: Energy Information Administration. Office of Integrated Analysis and Forecasting WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE IA KS MI AZ NM 500 0 SCALE IN MILES APPALACHIA Northern Appalachia Central Appalachia Southern Appalachia INTERIOR NORTHERN GREAT PLAINS Eastern Interior Western Interior Gulf Lignite Dakota Lignite Western Montana Wyoming, Northern Powder River Basin Wyoming, Southern Powder River Basin Western Wyoming

126

Mitsubishi iMiEV: An Electric Mini-Car in NREL's Advanced Technology Vehicle Fleet (Fact Sheet)  

DOE Green Energy (OSTI)

This fact sheet highlights the Mitsubishi iMiEV, an electric mini-car in the advanced technology vehicle fleet at the National Renewable Energy Laboratory (NREL). In support of the U.S. Department of Energy's fast-charging research efforts, NREL engineers are conducting charge and discharge performance testing on the vehicle. NREL's advanced technology vehicle fleet features promising technologies to increase efficiency and reduce emissions without sacrificing safety or comfort. The fleet serves as a technology showcase, helping visitors learn about innovative vehicles that are available today or are in development. Vehicles in the fleet are representative of current, advanced, prototype, and emerging technologies.

Not Available

2011-10-01T23:59:59.000Z

127

Search for the decay B^+ \\to K_S^0 K_S^0 \\pi ^+  

SciTech Connect

The authors search for charmless decays of charged B mesons to the three-body final state K{sub S}{sup 0}K{sub S}{sup 0}{pi}{sup +}. Using a data sample of 423.7 fb{sup -1} collected at the {Upsilon}(4S) resonance with the BABAR detector, corresponding to (465.1 {+-} 5.1) x 10{sup 6} B{bar B} pairs, they find no significant signal and determine a 90% confidence level upper limit on the branching fraction of 5.1 x 10{sup -7}.

Aubert, B.; Bona, M.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Lopez, L.; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Cahn, R.N.; Jacobsen, R.G.; /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /Frascati /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Karlsruhe U., EKP /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT, LNS /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /INFN, Naples /Naples U. /INFN, Naples /INFN, Naples /Naples U. /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /Pennsylvania U. /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison

2009-02-23T23:59:59.000Z

128

U.S. Energy Information Administration | Annual Energy Outlook 2011  

Gasoline and Diesel Fuel Update (EIA)

4 4 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT

129

U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

2 2 Regional maps Figure F7. Coal demand regions Figure F7. Coal Demand Regions CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT 16. PC 15. ZN 12. WS 11. C2 9. AM 5. GF 8. KT 4. S2 7. EN 6. OH 2. YP 1. NE 3. S1 10. C1 KY,TN 8. KT 16. PC AK,HI,WA,OR,CA 10. C1 CT,MA,ME,NH,RI,VT OH 1. NE 3. S1 4. S2 5. GF 6. OH 7. EN AL,MS MN,ND,SD IA,NE,MO,KS TX,LA,OK,AR MT,WY,ID CO,UT,NV AZ,NM 9. AM 11. C2 12. WS 13. MT 14. CU 15. ZN WV,MD,DC,DE 2. YP Region Content Region Code NY,PA,NJ VA,NC,SC GA,FL IN,IL,MI,WI Region Content Region Code 14. CU 13. MT

130

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

SciTech Connect

A bioreactor landfill cell with 1.2-acre footprint was constructed, filled, operated, and monitored at Northern Oaks Recycling and Disposal Facility (NORDF) at Harrison, MI. With a filled volume of 74,239 cubic yards, the cell contained approximately 35,317 tons of municipal solid waste (MSW) and 20,777 tons of cover soil. It was laid on the slope of an existing cell but separated by a geosynthetic membrane liner. After the cell reached a design height of 60 feet, it was covered with a geosynthetic membrane cap. A three-dimensional monitoring system to collect data at 48 different locations was designed and installed during the construction phase of the bioreactor cell. Each location had a cluster of monitoring devices consisting of a probe to monitor moisture and temperature, a leachate collection basin, and a gas sampling port. An increase in moisture content of the MSW in the bioreactor cell was achieved by pumping leachate collected on-site from various other cells, as well as recirculation of leachate from the bioreactor landfill cell itself. Three types of leachate injection systems were evaluated in this bioreactor cell for their efficacy to distribute pumped leachate uniformly: a leachate injection pipe buried in a 6-ft wide horizontal stone mound, a 15-ft wide geocomposite drainage layer, and a 60-ft wide geocomposite drainage layer. All leachate injection systems were installed on top of the compacted waste surface. The distribution of water and resulting MSW moisture content throughout the bioreactor cell was found to be similar for the three designs. Water coming into and leaving the cell (leachate pumped in, precipitation, snow, evaporation, and collected leachate) was monitored in order to carry out a water balance. Using a leachate injection rate of 26 30 gal/yard3, the average moisture content increased from 25% to 35% (wet based) over the period of this study. One of the key aspects of this bioreactor landfill study was to evaluate bioreactor start up and performance in locations with colder climate. For lifts filled during the summer months, methane generation started within three months after completion of the lift. For lifts filled in winter months, very little methane production occurred even eight months after filling. The temperature data indicated that subzero or slightly above zero (oC) temperatures persisted for unusually long periods (more than six months) in the lifts filled during winter months. This was likely due to the high thermal insulation capability of the MSW and the low level of biological activity during start up. This observation indicates that bioreactor landfills located in cold climate and filled during winter months may require mechanisms to increase temperature and initiate biodegradation. Thus, besides moisture, temperature may be the next important factor controlling the biological decomposition in anaerobic bioreactor landfills. Spatial and temporal characterization of leachate samples indicated the presence of low levels of commonly used volatile organic compounds (including acetone, methyl ethyl ketone, methyl isobutyl ketone, and toluene) and metals (including arsenic, chromium, and zinc). Changes and leachate and gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

131

Genome-wide analysis reveals rapid and dynamic changes in miRNA and siRNA sequence and expression during ovule and fiber development in allotetraploid cotton (Gossypium hirsutum L)  

E-Print Network (OSTI)

CAGCCAAGGAUGACUUGCCGG 10 Class III HD-Zip proteins 11 Hemebp TC128553 (-) (class III HD-Zip protein 8) Gh-miR165/166ES810681 (-) (class III HD-Zip protein 5) Gh-miR165/166 639-

2009-01-01T23:59:59.000Z

132

Journal of Proteomics & Bioinformatics- Open Access 1 www.omicsonline.com Research Article JPB/Vol. 1/October 2008 Application of Computational Tools for Identification of miRNA  

E-Print Network (OSTI)

Copyright: 2008 George PDC, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. MicroRNAs (miRNAs) are a class of small non-protein-coding RNAs that play important regulatory roles by targeting for cleavage or translational repression and involved in diverse biological functions. Accumulation of large amount of biological data indicates that miRNAs can function as tumor suppressors and oncogenes. Mutation, misexpression, and altered mature miRNA processing are implicated in carcinogenesis and tumor progression. Common single-nucleotide polymorphisms (SNPs) in miRNAs may change their property through altering miRNA expression and/or maturation, and thus they may have an effect on thousands of target mRNAs, resulting in diverse functional consequences. In this work we used computational tools to predict the functional role of mRNAs targeted by miRNA in colon cancer genes. We have presented a method which allows the use of PupaSuite, UTRscan and miRBase as a pipeline for the prediction of miRNA and their target, and evaluated the functional role of mRNA in colon cancer.

Their Target Snps; George Priya Doss C; Dike Ip; Rao Sethumadhavan

2008-01-01T23:59:59.000Z

133

Recent acquisition of imprinting at the rodent Sfmbt2 locus correlates with insertion of a large block of miRNAs  

E-Print Network (OSTI)

in this region. These transcripts represent a very narrow imprinted gene locus. We also demonstrate that rat Sfmbt2 is imprinted in extraembryonic tissues. An interesting feature of both mouse and rat Sfmbt2 genes is the presence of a large block of mi...

Wang, Qianwei; Chow, Jacqueline; Hong, Jenny; Ferguson-Smith, Anne C; Moreno, Carol; Seaby, Peter; Vrana, Paul; Miri, Kamelia; Tak, Joon; Chung, Eu Ddeum; Mastromonaco, Gabriela; Cannigia, Isabella; Varmuza, Susannah

2011-04-21T23:59:59.000Z

134

Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platform (Seventh Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting 2012)  

Science Conference Proceedings (OSTI)

Julien Tremblay from DOE JGI presents "Evaluation of Multiplexed 16S rRNA Microbial Population Surveys Using Illumina MiSeq Platorm" at the 7th Annual Sequencing, Finishing, Analysis in the Future (SFAF) Meeting held in June, 2012 in Santa Fe, NM.

Tremblay, Julien [DOE JGI

2012-06-01T23:59:59.000Z

135

A study of muon neutrino disappearance with the MINOS detectors and the NuMI neutrino beam  

SciTech Connect

This thesis presents the results of an analysis of {nu}{sub {mu}} disappearance with the MINOS experiment, which studies the neutrino beam produced by the NuMI facility at Fermi National Accelerator Laboratory. The rates and energy spectra of charged current {nu}{sub {mu}} interactions are measured in two similar detectors, located at distances of 1 km and 735 km along the NuMI beamline. The Near Detector provides accurate measurements of the initial beam composition and energy, while the Far Detector is sensitive to the effects of neutrino oscillations. The analysis uses data collected between May 2005 and March 2007, corresponding to an exposure of 2.5 x 10{sup 20} protons on target. As part of the analysis, sophisticated software was developed to identify muon tracks in the detectors and to reconstruct muon kinematics. Events with reconstructed tracks were then analyzed using a multivariate technique to efficiently isolate a pure sample of charged current {nu}{sub {mu}} events. An extrapolation method was also developed, which produces accurate predictions of the Far Detector neutrino energy spectrum, based on data collected at the Near Detector. Finally, several techniques to improve the sensitivity of an oscillation measurement were implemented, and a full study of the systematic uncertainties was performed. Extrapolating from observations at the Near Detector, 733 {+-} 29 Far Detector events were expected in the absence of oscillations, but only 563 events were observed. This deficit in event rate corresponds to a significance of 4.3 standard deviations. The deficit is energy dependent and clear distortion of the Far Detector energy spectrum is observed. A maximum likelihood analysis, which fully accounts for systematic uncertainties, is used to determine the allowed regions for the oscillation parameters and identifies the best fit values as {Delta}m{sub 32}{sup 2} = 2.29{sub -0.14}{sup +0.14} x 10{sup -3} eV{sup 2} and sin{sup 2} 2{theta}{sub 23} > 0.953 (68% confidence level). The models of neutrino decoherence and decay are disfavored at the 5.0{sigma} and 3.2{sigma} levels respectively, while the no oscillation model is excluded at the 9.4{sigma} level.

Marshall, John Stuart; /Cambridge U.

2008-06-01T23:59:59.000Z

136

U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

1 Regional maps Figure F4. Oil and gas supply model regions Figure F4. Oil and Gas Supply Model Regions Atlantic WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA...

137

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

,833 ,833 35 Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2009 (Million Cubic Feet) Norway Trinidad/ Tobago Trinidad/ Tobago Egypt Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 111,144 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates

138

AEOSup ltr to Dear Customer  

Gasoline and Diesel Fuel Update (EIA)

WA WA OR CA ID NV UT AZ NM CO WY MT ND SD NE KS OK TX MN IA MO AR LA WI IL KY IN OH WV TN MS AL GA SC NC VA PA NY VT ME NH MA RI CT NJ DE MD D.C. FL MI Electricity Supply Regions 1 ECAR 2 ERCOT 3 MAAC 4 MAIN 5 MAPP 6 NY 7 NE 8 FL 9 STV 10 SPP 11 NWP 12 RA 13 CNV 13 11 12 2 10 5 9 8 1 6 7 3 AK 15 14 H I 14 AK 15 H I Figure 2. Electricity Market Module (EMM) Regions 1. ECAR = East Central Area Reliability Coordination Agreement 2. ERCOT = Electric Reliability Council of Texas 3. MACC = Mid-Atlantic Area Council 4. MAIN = Mid-America Interconnected Network 5. MAPP = Mid-Continent Area Power Pool 6. NY = Northeast Power Coordinating Council/ New York 7. NE = Northeast Power Coordinating Council/ New England 8. FL = Southeastern Electric Reliability Council/ Florida 9. STV = Southeastern Electric Reliability Council /excluding Florida 10. SPP

139

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

6 6 (Million Cubic Feet) Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 42,411 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2006 253,214 690,780 634,185 658,523 134,764 63,063 526,726 121,049 34,531 492,655 101,101 23,154 40,113 1,496,283 68,601

140

U.S. Energy Information Administration | Annual Energy Outlook 2013  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2013 Annual Energy Outlook 2013 Source: U.S. Energy Information Administration, Office of Energy Analysis. U.S. Energy Information Administration / Annual Energy Outlook 2010 213 Appendix F Regional Maps Figure F1. United States Census Divisions Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Source: U.S. Energy Information Administration, Office of Integrated Analysis and Forecasting. Appendix F Regional Maps Figure F1. United States Census Divisions U.S. Energy Information Administration | Annual Energy Outlook 2013

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


141

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value

142

Microsoft Word - figure_14.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 14. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2010 (Million Cubic Feet) Norway India Trinidad/ Tobago Egypt Yemen Japan Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 53,122 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada Gulf of Mexico Canada Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates based on historical data. Energy Information

143

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act Inventory map reflects the non-federally owned SNF and HLW covered by the Nuclear Waste Policy Act 2 Metric Tons Heavy Metal (MTHM) 3 Based on actual data through 2002 , as provided in the RW-859, and projected discharges for 2003-2010 which are rounded to two significant digits. Reflects trans-shipments as of end-2002. End of Year 2010 SNF & HLW Inventories 1 Approximately 64,000 MTHM 2 of Spent Nuclear Fuel (SNF) 3 & 275 High-Level Radioactive Waste (HLW) Canisters CT 1,900 TX 2,000 MD 1,200 VT 610 RI MT WY NE 790 SD ND OK KS 600 TX 2,000 LA 1,200 AR 1,200 IA 480 MN 1,100 WI 1,300 KY TN 1,500 MS 780 AL 3,000 GA 2,400 FL 2,900 NC 3,400 VA 2,400 WV OH 1,100 PA 5,800 ME 540 NJ 2,400 DE MI 2,500 MA 650 NH 480 IN SC 3,900 CO MO 670 IL 8,400 NY 3,300 CA 2,800 AZ 1,900 NM OR 360 NV UT WA 600 ID < 1 Commercial HLW 275 Canisters (~640 MTHM)

144

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

18 18 Energy Information Administration / Natural Gas Annual 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 0 1 2 3 4 5 6 7 T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o A l a b a m a K a n s a s A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 1997 1998 1999 2000 2001 2001 16. Marketed Production of Natural Gas in Selected States, 1997-2001 Figure Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI

145

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Canada United Arab Emirates Australia Australia Trinidad Qatar Malaysia Canada Mexico Interstate Movements of Natural Gas in the United States, 1999 (Volumes Reported in Million Cubic Feet) Supplemental Data From Volume To From Volume To (T) AL TX MA NH CT RI MD DC DE MD RI MA MA CT VA DC (T) Trucked Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." E I A NERGY NFORMATION DMINISTRATION 837,902 415,636 225,138 232 308,214 805,614 803,034 800,345 685 147 628,589 9,786 790,088 17,369 278,302 40,727 214,076 275,629 51,935 843,280 826,638 9,988 998,603 553,440 896,187 11,817 629,551 98,423

146

Buildings Energy Data Book: 3.9 Educational Facilities  

Buildings Energy Data Book (EERE)

6 6 2010 Regional New Construction and Renovations Expenditures for Public K-12 Schools ($Million) Region New Schools Additions Renovation Total Region 1 (CT, MA, ME, NH, RI, VT) Region 2 (NJ, NY, PA) Region 3 (DE, MD, VA, WV) Region 4 (KY, NC, SC, TN) Region 5 (AL, FL, GA, MS) Region 6 (IN, MI, OH) Region 7 (IL, MN, WI) Region 8 (IA, KS, MO, NE) Region 9 (AR, LA, OK, TX) Region 10 (CO, MT, ND, NM, SD, UT, WY) Region 11 (AZ, CA, HI, NV) Region 12 (AK, ID, OR, WA) Total Source(s): School Planning & Management, 16th Annual School Construction Report, Feb. 2011 p. CR3 8,669.5 3,074.1 2,796.8 14,540.4 1,605.4 407.3 275.2 2,287.9 258.2 181.8 158.1 598.1 1,653.9 479.6 387.8 2,521.2 548.2 130.9 93.3 772.4 309.3 206.1 135.3 650.7 217.6 231.4 187.8 636.8 1,338.0 327.6 175.9 1,841.4 359.6 286.3 278.9 924.8

147

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

1 1 55 0 2 4 6 8 10 Residential Onsystem Commercial Onsystem Industrial Onsystem Vehicle Fuel Electric Utilities Dollars per Thousand Cubic Feet 0 30 60 90 120 150 180 210 240 270 300 330 Dollars per Thousand Cubic Meters 1997 1998 1999 2000 2001 25. Average Price of Natural Gas Delivered to Consumers in the United States, 1997-2001 Figure Note: Prices are calculated from onsystem sales. Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition" and Federal Energy Regulatory Commission (FERC), Form FERC- 423, "Monthly Report of Cost and Quality of Fuels for Electric Plants." Energy Information Administration / Natural Gas Annual 2001 56 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA

148

Microsoft Word - NGAMaster_State_TablesNov12.doc  

Gasoline and Diesel Fuel Update (EIA)

WA WA MT ID OR WY ND SD CA NV UT CO NE KS AZ NM OK TX MN WI MI IA IL IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Japan Mexico Mexico Algeria Canada Canada Canada Canada Canada Canada Canada Algeria Mexico Trinidad Canada Canada Nigeria Oman Qatar Trinidad Gulf of Mexico Gulf of Mexico Gulf of Mexico Canada Trinidad Trinidad Gulf of Mexico Malaysia 13,623 Figure 8. Interstate Movements of Natural Gas in the United States, 2003 (Million Cubic Feet) Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Energy Information Administration / Natural Gas Annual 2003 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 366,224 655,731 666,614 633,960 144,284 43,869 536,776 63,133 36,848

149

C:\ANNUAL\VENTCHAP.V8\NewNGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

6 6 0.00-1.99 2.00-3.99 4.00-5.99 6.00-7.99 8.00-9.99 10.00-11.99 12.00+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK 27. Average City Gate Price of Natural Gas in the United States, 2001 (Dollars per Thousand Cubic Feet) Figure Sources: Energy Information Administration (EIA), Form EIA-857, "Monthly Report of Natural Gas Purchases and Deliveries to Consumers." 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." Constant dollars: Prices were converted to 2001 dollars using the chain-type

150

Residential Demand Module  

Gasoline and Diesel Fuel Update (EIA)

and clothes drying. In addition to the major equipment-driven and clothes drying. In addition to the major equipment-driven end-uses, the average energy consumption per household is projected for other electric and nonelectric Energy Information Administration/Assumptions to the Annual Energy Outlook 2006 19 Pacific East South Central South Atlantic Middle Atlantic New England West South Central West North Central East North Central Mountain AK WA MT WY ID NV UT CO AZ NM TX OK IA KS MO IL IN KY TN MS AL FL GA SC NC WV PA NJ MD DE NY CT VT ME RI MA NH VA WI MI OH NE SD MN ND AR LA OR CA HI Middle Atlantic New England East North Central West North Central Pacific West South Central East South Central South Atlantic Mountain Figure 5. United States Census Divisions Source:Energy Information Administration,Office of Integrated Analysis and Forecasting. Report #:DOE/EIA-0554(2006) Release date: March 2006

151

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

Egypt Figure 13. Net Interstate Movements, Imports, and Exports of Natural Gas in the United States, 2008 (Million Cubic Feet) Norway Trinidad/ Tobago Interstate Movements Not Shown on Map From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 45,772 WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico C a n a d a C a n a d a Canada Canada Canada Canada Canada Canada Canada i i N g e r a Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," the Office of Fossil Energy, Natural Gas Imports and Exports, and EIA estimates.

152

Green Power Network: Can I Buy Green Power in My State?  

NLE Websites -- All DOE Office Websites (Extended Search)

Can I Buy Green Power in my State? Community Renewable Energy Development Consumer Protection Large Purchasers of Green Power Can I Buy Green Power in My State? Click on your state below to find out which organizations offer green power in your state. The results will include utility green pricing programs, retail green power products offered in competitive electricity markets, and renewable energy certificate (REC) products sold separate from electricity. For additional information about these distinct products, see our Overview of Green Power Markets. Map of the United States. AK AL AR AZ CA CO CT DC DE FL GA HI IA ID IL IN KS KY LA MA MD ME MI MN MO MS MT NC ND NE NH NJ NM NV NY OH OK OR PA RI SC SD TN TX UT VA VT WA WI WV WY Alabama Alaska Arizona Arkansas California Colorado Connecticut Connecticut Delaware Delaware Florida Georgia Hawaii Idaho Illinois Indiana Iowa Kansas Kentucky Louisiana Maine Maryland Maryland Massachusetts Massachusetts Michigan Minnesota Mississippi Missouri Montana Nebraska Nevada New Hampshire New Hampshire New Jersey New Jersey New Mexico New York North Carolina North Dakota Ohio Oklahoma Oregon Pennsylvania Rhode Island Rhode Island South Carolina South Dakota Tennessee Texas Utah Vermont Vermont Virginia Washington West Virginia Wisconsin Wyoming Washington, DC

153

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

Supply Supply 17 Energy Information Administration / Natural Gas Annual 1999 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 1999 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1995-1999 Figure T e x a s L o u i s i a n a O k l a h o m a N e w M e x i c o W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a A l l O t h e r S t a t e s 0 1 2 3 4 5 6 7 Trillion Cubic Feet Billion Cubic Meters 95 96 97 98 99 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity

154

Microsoft Word - figure_13.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 (Million Cubic Feet) 24,891 2,895 Nigeria WA M T I D OR W Y ND SD C A N V UT CO NE KS AZ NM OK TX MN WI MI IA I L IN OH MO AR MS AL GA TN KY FL SC NC WV MD DE VA PA NJ NY CT RI MA VT NH ME LA HI AK Mexico Algeria C a n a d a C a n a d a Canada Canada Canada Canada Canada Algeria Canada Canada N i g e r i a O m a n Qatar Gulf of Mexico Gulf o f M e x i c o Gulf of Mexico Canada Gulf of Mexico Malaysia 2,986 Sources: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and the Office of Fossil Energy, Natural Gas Imports and Exports. Energy Information Administration / Natural Gas Annual 2005 Supplemental Data From Volume To From Volume To CT RI RI MA MA CT VA DC MD DC 335,380 634,982 664,318 612,297 125,202 33,223 531,868 103,624

155

Microsoft Word - Figure_14_15.doc  

Gasoline and Diesel Fuel Update (EIA)

5 5 0.00-2.49 2.50-4.49 4.50-6.49 6.50-8.49 8.50-10.49 10.50+ WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DC NC SC GA AL MS LA FL HI AK DE 0 2 4 6 8 10 1980 1982 1984 1986 1988 1990 1992 1994 1996 1998 2000 2002 2004 Dollars per Thousand Cubic Feet 0 40 80 120 160 200 240 280 320 360 Dollars per Thousand Cubic Meters Constant Dollars Nominal Dollars Figure 14. Average Price of Natural Gas Delivered to Residential Consumers, 1980-2004 Figure 15. Average City Gate Price of Natural Gas in the United States, 2004 (Dollars per Thousand Cubic Feet) Sources: Nominal dollars: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." Constant dollars: Prices were converted to 2004 dollars using the chain-type price indexes for Gross Domestic Product

156

Approach to Recover Hydrocarbons from Currently Off-Limit Areas of the Antrim Formation, MI Using Low-Impact Technologies  

SciTech Connect

The goal of this project was to develop and execute a novel drilling and completion program in the Antrim Shale near the western shoreline of Northern Michigan. The target was the gas in the Lower Antrim Formation (Upper Devonian). Another goal was to see if drilling permits could be obtained from the Michigan DNR that would allow exploitation of reserves currently off-limits to exploration. This project met both of these goals: the DNR (Michigan Department of Natural Resources) issued permits that allow drilling the shallow subsurface for exploration and production. This project obtained drilling permits for the original demonstration well AG-A-MING 4-12 HD (API: 21-009-58153-0000) and AG-A-MING 4-12 HD1 (API: 21-009-58153-0100) as well as for similar Antrim wells in Benzie County, MI, the Colfax 3-28 HD and nearby Colfax 2-28 HD which were substituted for the AG-A-MING well. This project also developed successful techniques and strategies for producing the shallow gas. In addition to the project demonstration well over 20 wells have been drilled to date into the shallow Antrim as a result of this project's findings. Further, fracture stimulation has proven to be a vital step in improving the deliverability of wells to deem them commercial. Our initial plan was very simple; the 'J-well' design. We proposed to drill a vertical or slant well 30.48 meters (100 feet) below the glacial drift, set required casing, then angle back up to tap the resource lying between the base to the drift and the conventional vertical well. The 'J'-well design was tested at Mancelona Township in Antrim County in February of 2007 with the St. Mancelona 2-12 HD 3.

James Wood; William Quinlan

2008-09-30T23:59:59.000Z

157

NONPROFIT ORG DETROIT, MI  

E-Print Network (OSTI)

films (Richard Spontak) B.S., U of Maryland, College Park BASF Stephanie T. Sullivan Functional); electrochemical reaction engineering; electrocatalysis, batteries and fuel cells. [fedkiw@eos.ncsu.edu] Michael C technologies (batteries, capacitors), ionic liquids, lignocellulosic biomass pretreatment and conversion

Berdichevsky, Victor

158

Orion Mark Graf University of Kansas, Lawrence, KS 2010-Present  

E-Print Network (OSTI)

Distributions, Origins, and their Association with Y-chromosome Markers in the Aleutian Archipelago Advisor) "Surname Distributions and their Association with Y-chromosome Markers in the Aleutian Islands" Human in the Aleutian Archipelago: Evidence from Y- chromosome markers and historical accounts" Poster presentation

Peterson, Blake R.

159

Overexpression of miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production  

NLE Websites -- All DOE Office Websites (Extended Search)

miR156 miR156 in switchgrass (Panicum virgatum L.) results in various morphological alterations and leads to improved biomass production Chunxiang Fu 1 , Ramanjulu Sunkar 2 , Chuanen Zhou 1 , Hui Shen 3,4 , Ji-Yi Zhang 3,4 , Jessica Matts 2 , Jennifer Wolf 1 , David G. J. Mann 4,5 , C. Neal Stewart Jr 4,5 , Yuhong Tang 3,4 and Zeng-Yu Wang 1,4, * 1 Forage Improvement Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 2 Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK, USA 3 Plant Biology Division, The Samuel Roberts Noble Foundation, Ardmore, OK, USA 4 BioEnergy Science Center, Oak Ridge, TN, USA 5 Department of Plant Sciences, University of Tennessee, Knoxville, TN, USA Received 10 October 2011; revised 8 December 2011; accepted 12 December 2011. *Correspondence (Tel 1-580-224 6830; fax 1-580-224 6802; email zywang@noble.org) Re-use

160

Event Images from ArgoNeuT: Mini LArTPC Exposure to Fermilab's NuMI Beam Project  

DOE Data Explorer (OSTI)

ArgoNeuT is a joint NSF/DOE R&D project at Fermilab to expose a small-scale liquid argon time projection chamber (LArTPC) to the NuMI neutrino beam. Liquid argon detectors are an exciting class of neutrino experiments because they can provide bubble chamber quality images and excellent background rejection. In these detectors, neutrinos passing through a large volume of argon interact with an argon atom, producing light and ionization particles. An electric field within the detector causes these charged particles to drift through the volume of argon, leaving a path of ionization electrons. As they drift, the ionization electrons induce current in two wire planes and are collected at a third plane. Measurement of the signals created within the wires, the position of the wires within the planes, the drift velocity of the ionization particles, and time of drift (from scintillation light or elsewhere) provides all the information needed for 3D reconstruction of the event. ArgoNeuT's neutrino source is the NuMI (Neutrinos at the Main Injector) beam. The beam passes through the MINOS (Main Injector Neutrino Oscillation search) near and far detectors, positioned at 1 km and 735 km from the target at Fermilab. ArgoNeuT is located at Fermilab upstream of the MINOS near detector, and is calibrated using muons that traverse the chamber and penetrate several layers into MINOS[Copied with editing from http://t962.fnal.gov/index.html]. A small selection of event images are made available.

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


161

U.S. Energy Information Administration | Annual Energy Outlook...  

Gasoline and Diesel Fuel Update (EIA)

Annual Energy Outlook 2012 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT...

162

U.S. Energy Information Administration | Annual Energy Outlook...  

Annual Energy Outlook 2012 (EIA)

3 Regional maps Figure F6. Coal supply regions WA ID OR CA NV UT TX OK AR MO LA MS AL GA FL TN SC NC KY VA WV WY CO SD ND MI MN WI IL IN OH MD PA NJ DE CT MA NH VT NY ME RI MT NE...

163

File:EIA-Appalach7-TN-KY-BOE.pdf | Open Energy Information  

Open Energy Info (EERE)

Kentucky and Tennessee By 2001 BOE Reserve Class Kentucky and Tennessee By 2001 BOE Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 18.57 MB, MIME type: application/pdf) Description Appalachian Basin, Kentucky and Tennessee By 2001 BOE Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Kentucky, Tennessee File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 17:43, 20 December 2010 Thumbnail for version as of 17:43, 20 December 2010 5,100 × 6,600 (18.57 MB) MapBot (Talk | contribs) Automated bot upload

164

File:EIA-Appalach7-TN-KY-GAS.pdf | Open Energy Information  

Open Energy Info (EERE)

Kentucky and Tennessee By 2001 Gas Reserve Class Kentucky and Tennessee By 2001 Gas Reserve Class Size of this preview: 463 × 599 pixels. Other resolution: 464 × 600 pixels. Full resolution ‎(5,100 × 6,600 pixels, file size: 18.6 MB, MIME type: application/pdf) Description Appalachian Basin, Kentucky and Tennessee By 2001 Gas Reserve Class Sources Energy Information Administration Authors Samuel H. Limerick; Lucy Luo; Gary Long; David F. Morehouse; Jack Perrin; Robert F. King Related Technologies Oil, Natural Gas Creation Date 2005-09-01 Extent Regional Countries United States UN Region Northern America States Kentucky, Tennessee File history Click on a date/time to view the file as it appeared at that time. Date/Time Thumbnail Dimensions User Comment current 17:44, 20 December 2010 Thumbnail for version as of 17:44, 20 December 2010 5,100 × 6,600 (18.6 MB) MapBot (Talk | contribs) Automated bot upload

165

appalachian studies uniVeRsitY OF KentucKY  

E-Print Network (OSTI)

% of kentucky's electricity. Approximately 78% of kentucky's coal is mined in eastern kentucky. eastern kentucky miners make up 84% of the state's coal mining work force.* *Kentucky Coal Association The cre-1884 Ashland Coal & Iron Railway Co. Mines Ledger, 1888-1889 EDUCATION AND LITERACY Country Life Schools

Kim, Mi-Ok

166

Mountain Association for Community Economic Development- How$martKY On Bill Financing Energy Efficiency Program  

Energy.gov (U.S. Department of Energy (DOE))

Four rural utility cooperatives in Eastern Kentucky (Big Sandy RECC, Fleming-Mason RECC, Grayson RECC, and Jackson Energy) work with MACED to provide energy retrofits as part of utility service...

167

GE Appliance Park Louisville, KY Plant Wide Assessment Final Report October 25th, 2007  

SciTech Connect

Used a team of experts to analyze and model major systems at a large industrial appliance manufacturer. During the data gathering stage, the team specifically looked for baselining the efficiency of the systems as well as developing short term and longer term efficiency projects. Electrical distribution, Compressed air generation and thermal heat recovery for the production facility and front office heating and cooling optimization were all baselined during the study.

Chandon Rao; Richard Urschel

2007-10-25T23:59:59.000Z

168

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" Natural Gas Marketed Production ",35,"Monthly","9/2013","1/15/1973" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","ng_prod_whv_a_epg0_vgm_mmcf_m.xls" ,"Available from Web Page:","http://www.eia.gov/dnav/ng/ng_prod_whv_a_epg0_vgm_mmcf_m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.gov" ,,"(202) 586-8800",,,"12/19/2013 6:54:27 AM" "Back to Contents","Data 1: Natural Gas Marketed Production " "Sourcekey","N9050US2","N9050FX2","N9050AL2","N9050AK2","N9050AZ2","N9050AR2","N9050CA2","N9050CO2","N9050FL2","N9050IL2","N9050IN2","N9050KS2","N9050KY2","N9050LA2","N9050MD2","N9050MI2","N9050MS2","N9050MO2","N9050MT2","N9050NE2","N9050NV2","N9050NM2","N9050NY2","N9050ND2","N9050OH2","N9050OK2","N9050OR2","N9050PA2","N9050SD2","N9050TN2","N9050TX2","N9050UT2","N9050VA2","N9050WV2","N9050WY2"

169

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

6 6 Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:

170

C:\Annual\VENTCHAP.V8\NGA02.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Energy Information Administration / Natural Gas Annual 2002 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s C a l i f o r n i a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2001 2002 2001 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2001-2002 Figure None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN W VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2002 (Million Cubic Feet) Figure GOM = Gulf of Mexico Sources:

171

untitled  

Gasoline and Diesel Fuel Update (EIA)

21. Domestic Crude Oil First Purchase Prices 21. Domestic Crude Oil First Purchase Prices (Dollars per Barrel) Year Month U.S. Average PAD District I PAD District II U.S. Average Less AK North Slope Average NY PA WV Average IL IN KS KY MI NE 1978 ..................... 9.00 9.56 12.25 W 14.72 14.48 11.91 13.81 13.70 13.20 13.73 11.86 11.40 1979 ..................... 12.64 13.01 14.30 W 24.13 23.35 18.33 23.49 23.28 21.57 22.55 14.47 18.13 1980 ..................... 21.59 22.65 22.66 W 37.46 36.92 30.12 35.78 35.91 34.20 34.98 23.54 30.60 1981 ..................... 31.77 33.71 35.22 W 36.03 35.63 35.63 36.03 36.07 35.80 35.90 35.74 35.32 1982 ..................... 28.52 30.43 31.77 30.91 30.77 29.98 31.65 31.69 31.66 30.79 31.19 31.80 30.98 1983 ..................... 26.19 28.00 28.32 28.19 28.28 27.27 29.17 29.12 29.06 28.45 28.60 28.93 28.58 1984 ..................... 25.88

172

C:\ANNUAL\VENTCHAP.V8\NGAla1109.vp  

Gasoline and Diesel Fuel Update (EIA)

0 0 Energy Information Administration / Natural Gas Annual 2000 NJ WY AK AL CA AR CO CT DE FL GA HI ID KS IL IN IA IA KY LA ME MI MA MD MN MS MT MO NE ND OH NV NM NY NH NC OK OR PA RI SC SD TN TX UT VT WA WV WI AZ VA DC Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly Quantity and Value of Natural Gas Report," and the United States Minerals Management Service. None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001 and over 4. Marketed Production of Natural Gas in the United States, 2000 (Million Cubic Feet) Figure 5. Marketed Production of Natural Gas in Selected States, 1996-2000 Figure T e x a s L o u i s i a n a N e w M e x i c o O k l a h o m a W y o m i n g C o l o r a d o K a n s a s A l a b a m a A l a s k a C a l i f o r n i a O t h e r S t a t e s 0 1 2 3 4 5 6 7 0 30 60 90 120 150 180 Trillion Cubic Feet Billion Cubic Meters 1996 1997 1998 1999 2000 Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly

173

untitled  

Gasoline and Diesel Fuel Update (EIA)

Table 18. Domestic Crude Oil First Purchase Prices Table 18. Domestic Crude Oil First Purchase Prices (Dollars per Barrel) Year Month U.S. Average PAD District I PAD District II U.S. Average Less AK North Slope Average NY PA WV Average IL IN KS KY MI NE 1983 ..................... 26.19 28.00 28.32 28.19 28.28 27.27 29.17 29.12 29.06 28.45 28.60 28.93 28.58 1984 ..................... 25.88 27.59 27.76 27.70 27.71 26.90 28.62 28.76 28.72 27.99 28.24 28.54 27.83 1985 ..................... 24.09 25.74 25.88 25.19 25.05 24.35 25.94 26.90 26.82 25.33 26.20 26.16 25.42 1986 ..................... 12.51 14.13 14.76 16.03 15.77 14.68 14.30 14.70 14.55 14.02 14.20 14.61 13.70 1987 ..................... 15.40 16.83 16.52 17.40 17.43 16.56 17.42 17.53 17.49 17.37 17.19 17.63 17.08 1988 ..................... 12.58 13.97 14.21 W 15.26 14.35 14.65 14.79 14.78 14.55 14.58 14.92 14.08 1989 .....................

174

Microsoft Word - Figure_3_4.doc  

Gasoline and Diesel Fuel Update (EIA)

7 7 None 1-15,000 15,001-100,000 100,001-200,000 200,001-500,000 500,001-and over WA ID MT OR CA NV UT AZ NM CO WY ND SD MN WI NE IA KS MO TX IL IN OH MI OK AR TN WV VA KY MD PA WI NY VT NH MA CT ME RI NJ DE DC NC SC GA AL MS LA FL HI AK GOM 0 1 2 3 4 5 6 7 T e x a s G u l f o f M e x i c o N e w M e x i c o O k l a h o m a W y o m i n g L o u i s i a n a C o l o r a d o A l a s k a K a n s a s A l a b a m a A l l O t h e r S t a t e s Trillion Cubic Feet 0 30 60 90 120 150 180 Billion Cubic Meters 2002 2003 2002 Figure 4. Marketed Production of Natural Gas in Selected States and the Gulf of Mexico, 2002-2003 Figure 3. Marketed Production of Natural Gas in the United States and the Gulf of Mexico, 2003 (Million Cubic Feet) GOM = Gulf of Mexico Sources: Energy Information Administration (EIA), Form EIA-895, "Monthly and Annual Quantity and Value of Natural Gas Report," and the United States Mineral Management

175

pmm.vp  

U.S. Energy Information Administration (EIA) Indexed Site

1 1 U.S. Energy Information Administration/Petroleum Marketing Monthly December 2013 Table 18. Domestic Crude Oil First Purchase Prices (Dollars per Barrel) Year Month U.S. Average PAD District I PAD District II U.S. Average Less AK North Slope Average NY PA WV Average IL IN KS KY MI NE 1985 .............. 24.09 25.74 25.88 25.19 25.05 24.35 25.94 26.90 26.82 25.33 26.20 26.16 25.42 1986 .............. 12.51 14.13 14.76 16.03 15.77 14.68 14.30 14.70 14.55 14.02 14.20 14.61 13.70 1987 .............. 15.40 16.83 16.52 17.40 17.43 16.56 17.42 17.53 17.49 17.37 17.19 17.63 17.08 1988 .............. 12.58 13.97 14.21 W 15.26 14.35 14.65 14.79 14.78 14.55 14.58 14.92 14.08 1989 .............. 15.86 17.13 17.16 W 18.15 17.18 18.04 18.36 18.37 18.18 18.36 18.06 17.36 1990 .............. 20.03 21.57 22.06 23.32 23.00 22.16 22.88 23.36 23.46 23.21 23.20

176

A large liquid argon time projection chamber for long-baseline, off-axis neutrino oscillation physics with the NuMI beam  

Science Conference Proceedings (OSTI)

Results from neutrino oscillation experiments in the last ten years have revolutionized the field of neutrino physics. While the overall oscillation picture for three neutrinos is now well established and precision measurements of the oscillation parameters are underway, crucial issues remain. In particular, the hierarchy of the neutrino masses, the structure of the neutrino mixing matrix, and, above all, CP violation in the neutrino sector are the primary experimental challenges in upcoming years. A program that utilizes the newly commissioned NuMI neutrino beamline, and its planned upgrades, together with a high-performance, large-mass detector will be in an excellent position to provide decisive answers to these key neutrino physics questions. A Liquid Argon time projection chamber (LArTPC) [2], which combines fine-grained tracking, total absorption calorimetry, and scalability, is well matched for this physics program. The few-millimeter-scale spatial granularity of a LArTPC combined with dE/dx measurements make it a powerful detector for neutrino oscillation physics. Scans of simulated event samples, both directed and blind, have shown that electron identification in {nu}{sub e} charged current interactions can be maintained at an efficiency of 80%. Backgrounds for {nu}{sub e} appearance searches from neutral current events with a {pi}{sup 0} are reduced well below the {approx} 0.5-1.0% {nu}{sub e} contamination of the {nu}{sub {mu}} beam [3]. While the ICARUS collaboration has pioneered this technology and shown its feasibility with successful operation of the T600 (600-ton) LArTPC [4], a detector for off-axis, long-baseline neutrino physics must be many times more massive to compensate for the low event rates. We have a baseline concept [5] based on the ICARUS wire plane structure and commercial methods of argon purification and housed in an industrial liquefied-natural-gas tank. Fifteen to fifty kton liquid argon capacity tanks have been considered. A very preliminary cost estimate for a 50-kton detector is $100M (unloaded) [6]. Continuing R&D will emphasize those issues pertaining to implementation of this very large scale liquid argon detector concept. Key hardware issues are achievement and maintenance of argon purity in the environment of an industrial tank, the assembly of very large electrode planes, and the signal quality obtained from readout electrodes with very long wires. Key data processing issues include an initial focus on rejection of cosmic rays for a surface experiment. Efforts are underway at Fermilab and a small number of universities in the US and Canada to address these issues with the goal of embarking on the construction of industrial-scale prototypes within one year. One such prototype could be deployed in the MiniBooNE beamline or in the NuMI surface building where neutrino interactions could be observed. These efforts are complementary to efforts around the world that include US participation, such as the construction of a LArTPC for the 2-km detector location at T2K [7]. The 2005 APS neutrino study [1] recommendations recognize that ''The development of new technologies will be essential for further advances in neutrino physics''. In a recent talk to EPP2010, Fermilab director P. Oddone, discussing the Fermilab program, states on his slides: ''We want to start a long term R&D program towards massive totally active liquid Argon detectors for extensions of NOvA''. [8]. As such, we are poised to enlarge our R&D efforts to realize the promise of a large liquid argon detector for neutrino physics.

Finley, D.; Jensen, D.; Jostlein, H.; Marchionni, A.; Pordes, S.; Rapidis, P.A.; /Fermilab; Bromberg, C.; /Michigan State U.; Lu, C.; McDonald, T.; /Princeton U.; Gallagher, H.; Mann, A.; Schneps, J.; /Tufts U.; Cline, D.; Sergiampietri, F.; Wang, H.; /UCLA; Curioni, A.; Fleming, B.T.; /Yale U.; Menary, S.; /York U., Canada

2005-09-01T23:59:59.000Z

177

SAS Output  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012" Coal Consumers in the Manufacturing and Coke Sectors, 2012" "Company Name","Plant Location" "Top Ten Manufacturers" "American Crystal Sugar Co","MN, ND" "Archer Daniels Midland","IA, IL, MN, ND, NE" "Carmeuse Lime Stone Inc","AL, IL, IN, KY, MI, OH, PA, TN, VA, WI" "Cemex Inc","AL, CA, CO, FL, GA, KY, OH, TN, TX" "Dakota Gasification Company","ND" "Eastman Chemical Company","TN" "Georgia-Pacific LLC","AL, GA, OK, VA, WI" "Holcim (US) Inc","AL, CO, MD, MO, MT, OK, SC, TX, UT" "NewPage Corporation","MD, MI, WI" "U S Steel Corporation","AL, IN, MI, MN"

178

U.S. Energy Information Administration | Annual Coal Report 2012  

U.S. Energy Information Administration (EIA) Indexed Site

Coal Consumers in the Manufacturing and Coke Sectors, 2012 Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Table 25. Coal Consumers in the Manufacturing and Coke Sectors, 2012 U.S. Energy Information Administration | Annual Coal Report 2012 Company Name Plant Location Top Ten Manufacturers American Crystal Sugar Co MN, ND Archer Daniels Midland IA, IL, MN, ND, NE Carmeuse Lime Stone Inc AL, IL, IN, KY, MI, OH, PA, TN, VA, WI Cemex Inc AL, CA, CO, FL, GA, KY, OH, TN, TX Dakota Gasification Company ND Eastman Chemical Company TN Georgia-Pacific LLC AL, GA, OK, VA, WI Holcim (US) Inc AL, CO, MD, MO, MT, OK, SC, TX, UT NewPage Corporation MD, MI, WI U S Steel Corporation AL, IN, MI, MN Other Major Manufacturers Ash Grove Cement Co

179

Building America Top Innovations Hall of Fame Profile … High Performance Without Increased Cost: Urbane Homes, Louiseville KY  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Urbane's first Urbane's first home, built for $36 per ft 2 in 2008, incorporated both energy efficiency and strategies to reduce building costs. The home won two EnergyValue Housing Awards, and homebuyers began seeking out the builder for energy-efficient, high-quality homes. Building America field projects that demonstrated minimal or cost-neutral impacts for high-performance homes have significantly influenced the housing industry to apply advanced technologies and best practices. In 2006, the U.S. Department of Energy's Building America program set a goal of proving that cost-neutral energy savings of 40% over code were possible at a production scale for new home builders in every U.S. climate zone. Between 2005 and 2010, Building America research partners worked with 34 builders to

180

Tatyana V. Wilds, Most Pure Heart of Mary School, Topeka, KS  

E-Print Network (OSTI)

in San Francisco Stalin, Churchill/Attlee meet in Potsdam US drops Atomic Bomb on Hiroshima and Nagasaki) Churchill's "Iron Curtain" speech in Fulton, Missouri 1949 Soviets detonate their first Atomic Bomb in the Cold War. For example, what if Truman had not fired General Macarthur and he had decided to drop bombs

Peterson, Blake R.

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


181

# workstation-ks.cfg # version 1.0.0 2011-09-30 # Copyright ...  

Science Conference Proceedings (OSTI)

... 9 (Rows 2 - 6) volgroup vgroup1 pv.01 logvol ... row 134) -sysklogd rsyslog # Post-install commands # Some post-installation configuration can ...

2013-05-30T23:59:59.000Z

182

KS-REPORT(7-24-87} The Eigenvalue Problem for an N-Sector Ring  

E-Print Network (OSTI)

\\.., -.. ·~.t~ -..-7. -..-.. ~ -,.. -')It · · ... ,.- J ·· ··· 5 ·· ··· :-O' ··· ··· leee -7. 10 · ttl L(H · ,01

Kemner, Ken

183

Search for Lepton Flavour Violating Decays Tau -> l Ks with the BABAR Detector  

SciTech Connect

We present the search for the lepton flavour violating decay {tau} {yields} lK{sup 0}{sub s} with the BaBar experiment data. This process and many other lepton flavour violating {tau} decays, like {tau} {yields} {mu}{gamma} and {tau} {yields} lll, are one of the most promising channel to search for evidence of new physics. According to the Standard Model and the neutrino mixing parameters, branching fractions are estimated well below 10{sup -14}, but many models of new physics allow for branching fractions values close to the present experimental sensitivity. This analysis is based on a data sample of 469fb{sup -1} collected by BABAR detector at the PEP-II storage ring from 1999 to 2007, equivalent to 431 millions of {tau} pairs. the BABAR experiment, initially designed for studying CP violation in B mesons, has demonstrated to be one of the most suitable environments for studying {tau} decays. The tracking system, the calorimeter and the particle identification of BABAR, together with the knowledge of the {tau} initial energy, allow an extremely powerful rejection of background events that, for this analysis, is better than 10{sup -9}. Being {tau} {yields} lK{sup 0}{sub s} a decay mode without neutrinos, the signal {tau} decay can be fully reconstructed. Kinematical constraints are used in a fit that provides a decay tree reconstruction with a high resolution. For this analysis MC simulated events play a decisive role for estimating the signal efficiency and study the residual background. High statistics MC sample are produced simulating detector conditions for different periods of data collection, in order to reduce any discrepancies with the data. When discrepancies can not be removed, we perform studies to compute a correction factor or an estimation of systematic errors that need to be included in the final measurement. A significant improvement of the current result can be reached only with a higher statistics and, therefore, with a new collider providing a luminosity from 10 to 100 times more than PEP-II. A new detector, with improved performance and able to collect data in a high background environment, is also requested to fully exploit the capability of such amount of data. In fact, only keeping the efficiency and the background as similar as possible to present ones, we will be able to scale almost linearly the estimated upper limit according to the luminosity. The strong potential of improvement for the search of lepton flavour violation {tau} decays makes the building of such a machine highly desirable.

Cenci, Riccardo; /SLAC

2009-03-20T23:59:59.000Z

184

Search for CP Violation in the Decay D+/- to Ks pi+/-  

SciTech Connect

We report on a search for CP violation in the decay D{sup {+-}} {yields} K{sub S}{sup 0}{pi}{sup {+-}} using a data set corresponding to an integrated luminosity of 469 fb{sup -1} collected with the BABAR detector at the PEP-II asymmetric energy e{sup +}e{sup -} storage rings. The CP-violating decay rate asymmetry A{sub CP} is determined to be (-0.44 {+-} 0.13(stat) {+-} 0.10(syst))%, consistent with zero at 2.7 {sigma} and with the standard model prediction of (-0.332 {+-} 0.006)%. This is currently the most precise measurement of this parameter.

del Amo Sanchez, P.; Lees, J.P.; Poireau, V.; Prencipe, E.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Martinelli, M.; /INFN, Bari /Bari U.; Milanes, D.A.; /INFN, Bari; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Brown, D.N.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G.; Osipenkov, I.L.; /UC, Berkeley; Koch, H.; Schroeder, T.; /Ruhr U., Bochum /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UC, Riverside /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /Frascati /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /Indian Inst. Tech., Guwahati /Harvard U. /Harvey Mudd Coll. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa State U. /Iowa State U. /Johns Hopkins U. /Paris U., VI-VII /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Royal Holloway, U. of London /Louisville U. /Mainz U., Inst. Kernphys. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /INFN, Naples /Naples U. /NIKHEF, Amsterdam /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /Rostock U. /Rutherford /DAPNIA, Saclay /SLAC /South Carolina U. /Southern Methodist U. /Stanford U., Phys. Dept. /SUNY, Albany /Tel Aviv U. /Tennessee U. /Texas Nuclear Corp., Austin /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U. /Victoria U. /Warwick U. /Wisconsin U., Madison

2011-08-22T23:59:59.000Z

185

Demonstration Assessment of Light-Emitting Diode (LED) Parking Lot Lighting in Leavenworth, KS  

SciTech Connect

This report describes the process and results of a demonstration of solid-state lighting (SSL) technology in a commercial parking lot lighting application, under the U.S. Department of Energy (DOE) Solid-State Lighting Technology GATEWAY Demonstration Program. The parking lot is for customers and employees of a Walmart Supercenter in Leavenworth, Kansas and this installation represents the first use of the LED Parking Lot Performance Specification developed by the DOEs Commercial Building Energy Alliance. The application is a parking lot covering more than a half million square feet, lighted primarily by light-emitting diodes (LEDs). Metal halide wall packs were installed along the building facade. This site is new construction, so the installed baseline(s) were hypothetical designs. It was acknowledged early on that deviating from Walmarts typical design would reduce the illuminance on the site. Walmart primarily uses 1000W pulse-start metal halide (PMH) lamps. In order to provide a comparison between both typical design and a design using conventional luminaires providing a lower illuminance, a 400W PMH design was also considered. As mentioned already, the illuminance would be reduced by shifting from the PMH system to the LED system. The Illuminating Engineering Society of North America (IES) provides recommended minimum illuminance values for parking lots. All designs exceeded the recommended illuminance values in IES RP-20, some by a wider margin than others. Energy savings from installing the LED system compared to the different PMH systems varied. Compared to the 1000W PMH system, the LED system would save 63 percent of the energy. However, this corresponds to a 68 percent reduction in illuminance as well. In comparison to the 400W PMH system, the LED system would save 44 percent of the energy and provide similar minimum illuminance values at the time of relamping. The LED system cost more than either of the PMH systems when comparing initial costs. However, when the life-cycle costs from energy and maintenance were factored into the scenario, the LED system had lower costs at the end of a 10-year analysis period. The LED system had a 6.1 year payback compared to the 1000W PMH system and a 7.5 year payback versus the 400W PMH system. The costs reflect high initial cost for the LED luminaire, plus more luminaires and (subsequently) more poles for the LED system. The other major issue affecting cost effectiveness was that Leavenworth, Kansas has very low electricity costs. The melded rate for this site was $0.056 per kWh for electricity. However, if the national electricity rate of $0.1022/kWh was used the payback would change to between four and five years for the LED system. This demonstration met the GATEWAY requirements of saving energy, matching or improving illumination, and being cost effective. The project also demonstrated that the Commercial Building Energy Alliance (CBEA) specification works in practice. Walmart appreciated having an entire site lighted by LEDs to gain more experience with the technology. Walmart is reviewing the results of the demonstration as they consider their entire real estate portfolio.

Myer, Michael; Kinzey, Bruce R.; Curry, Ku'uipo

2011-05-06T23:59:59.000Z

186

Search for Lepton Flavour Violating Decays tau- to l- Ks with the BaBar experiment  

SciTech Connect

A search for the lepton flavor violating decays {tau}{sup -} {yields} l{sup -} K{sub S}{sup 0} (l = e or {mu}) has been performed using a data sample corresponding to an integrated luminosity of 469 fb{sup -1}, collected with the BABAR detector at the SLAC PEP-II e{sup +}e{sup -} asymmetric energy collider. No statistically significant signal has been observed in either channel and the estimated upper limits on branching fractions are {Beta}({tau}{sup -} {yields} e{sup -} K{sub S}{sup 0}) < 3.3 x 10{sup -8} and {Beta}({tau}{sup -} {yields} {mu}{sup -}K{sub S}{sup 0}) < 4.0 x 10{sup -8} at 90% confidence level.

Aubert, B.; Bona, M.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Lopez, L.; Palano, A.; Pappagallo, M.; /INFN, Bari /Bari U.; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Cahn, R.N.; Jacobsen, R.G.; /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /INFN, Ferrara /INFN, Ferrara /Ferrara U. /Frascati /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /INFN, Genoa /INFN, Genoa /Genoa U. /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Karlsruhe U., EKP /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT, LNS /McGill U. /INFN, Milan /Milan U. /INFN, Milan /INFN, Milan /Milan U. /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /INFN, Naples /Naples U. /INFN, Naples /INFN, Naples /Naples U. /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /INFN, Padua /Padua U. /INFN, Padua /INFN, Padua /Padua U. /Paris U., VI-VII /Pennsylvania U. /INFN, Perugia /Perugia U. /INFN, Pisa /Pisa U. /INFN, Pisa /Pisa, Scuola Normale Superiore /INFN, Pisa /Pisa U. /INFN, Pisa /Princeton U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /INFN, Rome /Rome U. /INFN, Rome /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /INFN, Turin /Turin U. /INFN, Trieste /Trieste U. /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison

2009-01-06T23:59:59.000Z

187

Measurement of Time-Dependent CP Asymmetry in B0 --> KS pi0 gamma Decays  

SciTech Connect

The authors measure the time-dependent CP asymmetry in B{sup 0} {yields} K{sub S}{sup 0}{pi}{sup 0}{gamma} decays for two regions of K{sub S}{sup 0}-{pi}{sup 0} invariant mass, m(K{sub S}{sup 0}{pi}{sup 0}), using the final BABAR data set of 467 x 10{sup 6} B{bar B} pairs collected at the PEP-II e{sup +}e{sup -} collider at SLAC. They find 339 {+-} 24 B{sup 0} {yields} K*{sup 0}{gamma} candidates and measure S{sub K*{gamma}} = -0.03 {+-} 0.29 {+-} 0.03 and C{sub K*{gamma}} = -0.14 {+-} 0.16 {+-} 0.03. In the range 1.1 < m(K{sub S}{sup 0}{pi}{sup 0}) < 1.8 GeV/c{sup 2} they find 133 {+-} 20 B{sup 0} {yields} K{sub S}{sup 0}{pi}{sup 0}{gamma} candidates and measure S{sub K{sub S}{sup 0}{pi}{sup 0}{gamma}} = -0.78 {+-} 0.59 {+-} 0.09 and C{sub K{sub S}{sup 0}{pi}{sup 0}{gamma}} = -0.36 {+-} 0.33 {+-} 0.04. The uncertainties are statistical and systematic, respectively.

Aubert, Bernard; Bona, M.; Karyotakis, Y.; Lees, J.P.; Poireau, V.; Prencipe, E.; Prudent, X.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Lopez, L.; Palano, Antimo; Pappagallo, M.; /Bari U. /INFN, Bari; Eigen, G.; Stugu, Bjarne; Sun, L.; /Bergen U.; Abrams, G.S.; Battaglia, M.; Brown, D.N.; Cahn, Robert N.; Jacobsen, R.G.; /LBL, Berkeley /Birmingham U. /Ruhr U., Bochum /Bristol U. /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UCLA /UC, Riverside /UC, San Diego /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /Ferrara U. /INFN, Ferrara /Frascati /Genoa U. /INFN, Genoa /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa U. /Iowa State U. /Johns Hopkins U. /Karlsruhe U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /Consorzio Milano Ricerche /INFN, Milan /Mississippi U. /Montreal U. /Mt. Holyoke Coll. /Napoli Seconda U. /INFN, Naples /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /Padua U. /INFN, Padua /Paris U., VI-VII /Pennsylvania U. /Perugia U. /INFN, Perugia /INFN, Pisa /Princeton U. /Banca di Roma /Frascati /Rostock U. /Rutherford /DSM, DAPNIA, Saclay /South Carolina U. /SLAC /Stanford U., Phys. Dept. /SUNY, Albany /Tennessee U. /Texas U. /Texas U., Dallas /Turin U. /INFN, Turin /Trieste U. /INFN, Trieste /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison

2008-10-20T23:59:59.000Z

188

 

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

KY Kentucky Total Sum City, County, and SEO Allocations KY Kentucky Total Sum City, County, and SEO Allocations All $ 25,382,500 KY Kentucky State Energy Office $ 10,427,000 KY Bowling Green City $ 585,600 KY Covington City $ 188,500 KY Florence City $ 126,400 KY Frankfort City $ 132,100 KY Henderson City $ 123,100 KY Hopkinsville City $ 143,600 KY Lexington-Fayette City $ 2,753,800 KY Louisville/Jefferson City $ 7,000,400 KY Owensboro City $ 557,200 KY Richmond City $ 145,600 KY Boone County $ 368,100 KY Bullitt County $ 289,900 KY Campbell County $ 351,600 KY Hardin County $ 426,500 KY Kenton County $ 465,200

189

KENTUCKY - Energy Information Administration  

U.S. Energy Information Administration (EIA)

beech fork school db martin ky 159 004679 n 1941 beech grove mclean ky 149 051681 o 1948 beech grove east mclean ky 149 051712 o 1950

190

Microsoft Word - MI.01-8.doc  

Office of Legacy Management (LM)

ORNL/RASA-96/7 ORNL/RASA-96/7 Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray S. P. McKenzie R. F. Carrier C. A. Johnson ORNL/RASA-96/7 LIFE SCIENCES DIVISION Environmental Restoration and Waste Management Non-Defense Programs (Certification Documentation Review, Investigation, and Completion: Internal Activity No. 14B477101) Independent Radiological Verification Survey Results for the Remedial Action Performed at the Former Bridgeport Brass Company Facility, Adrian, Michigan (AD001V) M. E. Murray, S. P. McKenzie, R. F. Carrier and C. A. Johnson Date Final issued - August 2002 Date Draft issued - July 1997

191

MI ROPYROLIZER FOR RAPID IOIDENTIFI ATION  

POTENTIAL APPLI ATIONS Agribusiness: Crop Testing & Verification Bio-fuels: Plants/Algae Lipid Content Homeland & International Security: Bio-Agent ...

192

MI 3 --Seite 1 Pinkal / Siekmann / Benzmuller  

E-Print Network (OSTI)

Differentialgleichungen (bis 2/2000), Dozentur f¨ur Wissenschaftliches Rechnen, Institut f¨ur Wissenschaftliches Rechnen, Grundausstattung Dr. Gerd Kunert, Professur Wissenschaftliches Rechnen, Grundausstattung Dr. Michael The?¨ur Modellprobleme in Gebieten mit Kanten, betrachtet. #12;A3 Meyer/Jung 7 Im Arbeits- und Ergebnisbericht 1996

Benzmüller, Christoph - FR 6.2

193

Detroit, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

6 2007 2008 2009 2010 2011 View History Pipeline Volumes 0 81 753 21 79 19 1996-2011 Pipeline Prices -- 8.28 6.58 4.53 8.37 5.17 1996-2011...

194

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

Monthly Annual Download Series History Download Series History Definitions, Sources & Notes Definitions, Sources & Notes Show Data By: Data Series Area 2007 2008 2009 2010 2011...

195

Marysville, MI Natural Gas Exports to Canada  

Gasoline and Diesel Fuel Update (EIA)

9,158 8,756 14,925 22,198 41,964 42,866 1996-2012 Pipeline Prices 7.77 7.48 4.85 4.87 4.48 3.18 1996...

196

Detroit, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

22,904 27,220 43,980 44,275 43,690 50,347 1996-2012 Pipeline Prices 6.88 8.37 4.01 4.69 4.26 3.10...

197

Measurement of $D^0-overline{D}^0$ mixing parameters using $D^0 \\to K_S^0 \\pi^ \\pi^-$ and $D^0 \\to K_S^0 K^ K^-$ decays  

Science Conference Proceedings (OSTI)

We report a direct measurement of D{sup 0}-{bar D}{sup 0} mixing parameters through a time-dependent amplitude analysis of the Dalitz plots of D{sup 0} {yields} K{sub S}{sup 0}{pi}{sup +}{pi}{sup -} and, for the first time, D{sup 0} {yields} K{sub S}{sup 0}K{sup +}K{sup -} decays. The low-momentum pion {pi}{sub s}{sup +} in the decay D*{sup +} {yields} D{sup 0}{pi}{sub s}{sup +} identifies the flavor of the neutral D meson at its production. Using 468.5 fb{sup -1} of e{sup +}e{sup -} colliding-beam data recorded near {radical}s = 10.6 GeV by the BABAR detector at the PEP-II asymmetric-energy collider at SLAC, we measure the mixing parameters x = [1.6 {+-} 2.3 (stat.) {+-} 1.2 (syst.) {+-} 0.8 (model)] x 10{sup -3}, and y = [5.7 {+-} 2.0 (stat.) {+-} 1.3 (syst.) {+-} 0.7 (model)] x 10{sup -3}. These results provide the best measurement to date of x and y. The knowledge of the value of x, in particular, is crucial for understanding the origin of mixing.

del Amo Sanchez, P.; Lees, J.P.; Poireau, V.; Prencipe, E.; Tisserand, V.; /Annecy, LAPP; Garra Tico, J.; Grauges, E.; /Barcelona U., ECM; Martinelli, M.; Palano, A.; Pappagallo, M.; /Bari U. /INFN, Bari; Eigen, G.; Stugu, B.; Sun, L.; /Bergen U.; Battaglia, M.; Brown, D.N.; Hooberman, B.; Kerth, L.T.; Kolomensky, Yu.G.; Lynch, G.; Osipenkov, I.L.; Tanabe, T.; /LBL, Berkeley /UC, Berkeley /Birmingham U. /Ruhr U., Bochum /British Columbia U. /Brunel U. /Novosibirsk, IYF /UC, Irvine /UC, Riverside /UC, Santa Barbara /UC, Santa Cruz /Caltech /Cincinnati U. /Colorado U. /Colorado State U. /Dortmund U. /Dresden, Tech. U. /Ecole Polytechnique /Edinburgh U. /Ferrara U. /INFN, Ferrara /Frascati /Columbus Supercond., Genova /INFN, Genoa /Indian Inst. Tech., Guwahati /Harvard U. /Heidelberg U. /Humboldt U., Berlin /Imperial Coll., London /Iowa State U. /Iowa State U. /Johns Hopkins U. /Orsay, LAL /LLNL, Livermore /Liverpool U. /Queen Mary, U. of London /Royal Holloway, U. of London /Louisville U. /Mainz U., Inst. Kernphys. /Manchester U. /Maryland U. /Massachusetts U., Amherst /MIT /McGill U. /Consorzio Milano Ricerche /INFN, Milan /Mississippi U. /Montreal U. /Napoli Seconda U. /INFN, Naples /NIKHEF, Amsterdam /Notre Dame U. /Ohio State U. /Oregon U. /Padua U. /INFN, Padua /Paris U., VI-VII /Perugia U. /INFN, Perugia /INFN, Pisa /Princeton U. /Banca di Roma /INFN, Rome /Rostock U. /Rutherford /DAPNIA, Saclay /SLAC /South Carolina U. /Southern Methodist U. /Stanford U., Phys. Dept. /SUNY, Albany /Tel Aviv U. /Tennessee U. /Texas U. /Texas U., Dallas /Turin U. /INFN, Turin /Trieste U. /INFN, Trieste /Valencia U., IFIC /Victoria U. /Warwick U. /Wisconsin U., Madison

2011-08-19T23:59:59.000Z

198

Mycologia, 96(4), 2004, pp. 866878. 2004 by The Mycological Society of America, Lawrence, KS 66044-8897  

E-Print Network (OSTI)

66044-8897 Two new Ophiostoma species with Sporothrix anamorphs from Austria and Azerbaijan Dilzara N with Sporothrix anamorphs recently collected in Austria and Azerbaijan. The isolates were charac- terized based and Azerbaijan. Growth at 25 C and morphology revealed some differences between the two groups, and supported

199

Mycologia, 96(3), 2004, pp. 548557. 2004 by The Mycological Society of America, Lawrence, KS 66044-8897  

E-Print Network (OSTI)

exorientia. Rhizoidaceae structurae absentes. Stip- ites erectus, pallide brunnei vel atro-brunnei, 1

200

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

1-07 0 1-07 0 USS Honolulu (SSN 718) and Locals 280 miles from North Pole PROGRAM RECORD * Program founded in 1948 * 5,800 reactor- years of safe operations * 136,000,000 miles safely steamed * 103 operating naval reactors * Welcomed in over 150 ports worldwide and 50 countries BROAD RESPONSIBILITIES * Research, Development, Design * Acquisition, Specification, Construction, Testing * Operation, Training, Maintenance * Overhaul, Refueling, Disposal * Reactor Safety, Radiological Controls, Environmental Safety, Occupational Health * Security, Nuclear Safeguards, Transportation * Administration (Public Information) NAVAL NUCLEAR PROPULSION PROGRAM TEC 1-07 1 WA OR ID MT ND SD WY NE MN WI IA IL MI IN OH KY

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


201

Agriculture and Natural Resources Family and Consumer Sciences 4-H Youth Development Community and Economic Development COOPERATIVE EXTENSION SERVICE UNIVERSITY OF KENTUCKY COLLEGE OF AGRICULTURE, LEXINGTON, KY, 40546  

E-Print Network (OSTI)

.S. gasoline supply is a blend of at least 10 percent ethanol. Bio- dieselisanotherbiofuelthatisbecoming more to heat a home or co-firing bales of biomass with coal in power plants to create electricity. Biomass also

Hayes, Jane E.

202

,"Kentucky Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050KY3","N3010KY3","N3020KY3","N3035KY3","N3045KY3" "Date","Natural Gas Citygate Price in Kentucky (Dollars per Thousand Cubic Feet)","Kentucky Price of...

203

NGA98fin5.vp  

Gasoline and Diesel Fuel Update (EIA)

8 8 Southern California Gas Co ..................... CA 269,739,909 7.31 Pacific Gas and Elec Co........................... CA 224,402,286 6.32 Northern Illinois Gas Co ........................... IL 196,608,329 4.63 Consumers Pwr Co .................................. MI 153,128,350 4.92 Columbia Gas Dist Co.............................. OH,KY,PA,MD 138,064,908 7.21 Pub Svc Elec and Gas Co........................ NJ 126,142,540 6.61 Michigan Consol Gas Co.......................... MI 125,456,377 5.35 East Ohio Gas Co .................................... OH 117,574,196 6.21 Peoples Gas Lt and Coke Co................... IL 89,685,006 6.81 Atlanta Gas Lt Co ..................................... GA 89,103,601 6.69 Lone Star Gas Co..................................... TX 84,559,915 5.95 Brooklyn Union Gas Co............................ NY

204

Northern Illinois Gas Co IL  

Gasoline and Diesel Fuel Update (EIA)

Northern Northern Illinois Gas Co ............................ IL 254,574,988 4.60 Southern California Gas Co ...................... CA 233,632,354 6.89 Columbia Gas Dist Co............................... OH,KY,PA,MD 196,322,935 6.64 Pacific Gas and Elec Co............................ CA 190,864,262 5.83 Consumers Pwr Co ................................... MI 188,587,672 4.81 Michigan Consol Gas Co........................... MI 160,809,168 5.16 East Ohio Gas Co ..................................... OH 146,802,045 5.44 Pub Svc Elec and Gas Co......................... NJ 140,712,209 6.62 Peoples Gas Lt and Coke Co.................... IL 126,356,925 6.40 Brooklyn Union Gas Co............................. NY 106,349,594 9.43 Atlanta Gas Lt Co ...................................... GA 106,075,815 6.66 Lone Star Gas Co......................................

205

C:\ANNUAL\VENTCHAP.V8\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

4 4 Con Edison Co. of New York Inc.............. NY 88,830,005 5.25 Pub Svc Elec and Gas Co........................ NJ 70,705,783 5.28 Columbia Gas Dist Co.............................. OH,KY,PA,MD 63,746,659 7.11 Southern California Gas Co ..................... CA 57,000,043 6.63 Minnegasco .............................................. MN 55,213,151 4.69 Pacific Gas and Elec Co........................... CA 54,854,821 6.15 Entex Div of Noram Energy Corp ............. LA,MS,TX 51,551,370 5.31 Consumers Pwr Co .................................. MI 50,657,354 4.44 Michigan Consol Gas Co.......................... MI 50,589,626 5.55 Northern Illinois Gas Co ........................... IL 47,159,304 5.26 Pub Svc Co. of Colorado.......................... CO 46,479,502 3.88 East Ohio Gas Co .................................... OH 41,561,614 5.92

206

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

3 3 Con Edison Co of New York Inc............... NY 102,311,001 3.84 Pub Svc Elec and Gas Co........................ NJ 73,839,186 3.05 Southern California Gas Co ..................... CA 62,380,076 5.55 Pacific Gas and Elec Co........................... CA 58,692,831 6.82 Keyspan Energy Del Co ........................... NY 53,162,984 6.07 Minnegasco .............................................. MN 52,910,769 4.25 Entex Div of Noram Energy Corp ............. TX,LA,MS 47,337,378 4.81 Lone Star Gas Co..................................... TX 45,843,050 4.67 Consumers Energy Co ............................. MI 45,391,308 4.50 Michigan Consol Gas Co.......................... MI 41,336,416 5.38 Pub Svc Co of Colorado........................... CO 39,230,403 4.47 Columbia Gas Dist Co.............................. KY,PA,MD,OH 35,550,535 6.78

207

NGA_99fin.vp  

Gasoline and Diesel Fuel Update (EIA)

Energy Information Administration / Natural Gas Annual 1999 Southern California Gas Co ..................... CA 275,767,714 6.50 Pacific Gas and Elec Co........................... CA 234,195,449 6.61 Nicor Gas ................................................. IL 211,147,988 4.71 Consumers Energy Co ............................. MI 167,318,229 4.89 Michigan Consol Gas Co.......................... MI 134,432,032 5.42 Pub Svc Elec and Gas Co........................ NJ 133,426,119 6.86 East Ohio Gas Co .................................... OH 127,141,913 5.81 Keyspan Energy Del Co ........................... NY 125,709,092 9.79 Columbia Gas Dist Co.............................. KY,PA,MD,OH 121,011,064 7.32 Peoples Gas Lt and Coke Co................... IL 98,758,164 6.77 Pub Svc Co of Colorado........................... CO 84,115,032 5.28

208

C:\ANNUAL\VENTCHAP.V8\NGA.VP  

Gasoline and Diesel Fuel Update (EIA)

3 3 Northern Illinois Gas Co ........................... IL 241,353,299 5.25 Southern California Gas Co ..................... CA 237,581,205 7.28 Pacific Gas and Elec Co........................... CA 191,919,171 6.12 Consumers Pwr Co .................................. MI 178,690,154 4.80 Columbia Gas Dist Co.............................. OH,KY,PA,MD 178,512,589 7.64 Michigan Consol Gas Co.......................... MI 152,111,213 5.59 East Ohio Gas Co .................................... OH 147,197,186 6.36 Pub Svc Elec and Gas Co........................ NJ 138,404,765 7.58 Peoples Gas Lt and Coke Co................... IL 113,561,765 6.96 Lone Star Gas Co..................................... TX 100,079,759 6.13 Atlanta Gas Lt Co ..................................... GA 96,381,162 7.41 Brooklyn Union Gas Co............................

209

Pub Svc Elec  

Gasoline and Diesel Fuel Update (EIA)

Pub Pub Svc Elec and Gas Co......................... NJ 81,712,678 5.82 Columbia Gas Dist Co............................... OH,KY,PA,MD 76,048,915 5.95 Con Edison Co. of New York Inc............... NY 69,809,658 5.99 Consumers Pwr Co ................................... MI 58,661,306 4.46 Pacific Gas and Elec Co............................ CA 57,793,522 5.67 Minnegasco ............................................... MN 57,154,912 4.57 Southern California Gas Co ...................... CA 54,772,058 6.16 Michigan Consol Gas Co........................... MI 53,635,433 5.16 Entex Div of Noram Energy Corp.............. LA,TX,MS 49,485,836 4.80 Northern Illinois Gas Co ............................ IL 48,165,624 4.62 Pub Svc Co. of Colorado........................... CO 47,339,959 3.51 Atlanta Gas Lt Co ......................................

210

Midcontinent Interactive Digital Carbon Atlas and Relational Database (MIDCARB)  

NLE Websites -- All DOE Office Websites (Extended Search)

MIDCONTINENT INTERACTIVE DIGITAL CARBON ATLAS AND MIDCONTINENT INTERACTIVE DIGITAL CARBON ATLAS AND RELATIONAL DATABASE (MIDCARB) Timothy R., Carr (tcarr@kgs.ukans.edu; 785-864-2135) Scott W. White (whites@kgs.ukans.edu; 785-864-2135) Kansas Geological Survey, University of Kansas Lawrence, KS 66047-3726 Lawrence H. Wickstrom (larry.wickstrom@dnr.state.oh.us; 614-265-6598) Ohio Department of Natural Resources, Division of Geological Survey, Columbus, OH 43224-1362 James A., Drahovzal (drahovzal@kgs.mm.uky.edu; 859-257-5500) Kentucky Geological Survey, University of Kentucky, Lexington, KY 40506-0107 Beverly Seyler (seyler@isgs.uiuc.edu; 217-244-2389) Illinois State Geological Survey, Champaign, IL 61820 John, A. Rupp (rupp@indiana.edu; 812-855-1323) Indiana Geological Survey, Indiana University, Bloomington, IN 47405-2208

211

EIA - Natural Gas Pipeline Network - Largest Natural Gas Pipeline Systems  

U.S. Energy Information Administration (EIA) Indexed Site

Interstate Pipelines Table Interstate Pipelines Table About U.S. Natural Gas Pipelines - Transporting Natural Gas based on data through 2007/2008 with selected updates Thirty Largest U.S. Interstate Natural Gas Pipeline Systems, 2008 (Ranked by system capacity) Pipeline Name Market Regions Served Primary Supply Regions States in Which Pipeline Operates Transported in 2007 (million dekatherm)1 System Capacity (MMcf/d) 2 System Mileage Columbia Gas Transmission Co. Northeast Southwest, Appalachia DE, PA, MD, KY, NC, NJ, NY, OH, VA, WV 1,849 9,350 10,365 Transcontinental Gas Pipeline Co. Northeast, Southeast Southwest AL, GA, LA, MD, MS, NC, NY, SC, TX, VA, GM 2,670 8,466 10,450 Northern Natural Gas Co. Central, Midwest Southwest IA, IL, KS, NE, NM, OK, SD, TX, WI, GM 1,055 7,442 15,874 Texas Eastern Transmission Corp.

212

FC Master List.vp:CorelVentura 7 - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

022306 Appalachian KY 159 Martin Alias for: (063516) Big Sandy[ALTER] 022306 Appalachian KY 195 Pike Alias for: (116230) Canada DBS[ALTER] 024081 Argo KY 195 Pike 1956 N

213

Success Story Harshaw Trane and Hardin County Schools  

NLE Websites -- All DOE Office Websites (Extended Search)

Story Service and Product Provider Partner Customer Harshaw Trane Hardin County Schools 12700 Plantside Drive 65 W. A. Jenkins Road Louisville, KY 40299 Elizabethtown, KY...

214

U.S. DEPARTMENT OF ENERGY - NETL CATEGORICAL EXCLUSION (CX) DESIGNATIO...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

L. Duvall 042009-043012 Kentucky KY Rev2 - Kentucky Energy Efficiency Program for Schools (KEEPS) Helps KY school districts reduce energy consumption & operating expenses....

215

Statewide Systematic Evaluation of Sudden, Unexpected Infant Death Classification: Results from a National Pilot Project  

E-Print Network (OSTI)

of Public Health, University of Kentucky, 333 Waller Ave. ,and Biostatistics, University of Kentucky, Lexington, KY,of Public Health, University of Kentucky, Lexington, KY, USA

Walsh, Sabrina L.; Kryscio, Richard; Holsinger, James W.; Krous, Henry F.

2010-01-01T23:59:59.000Z

216

Energy Department Announces Student Teams, New Location for Solar...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Calgary (Calgary, Alberta, Canada) University of Louisville, Ball State University and University of Kentucky (Louisville, Ky.; Muncie, Ind.; and Lexington, Ky.) University...

217

Construction of the NuMI underground laboratory facilities  

SciTech Connect

At Fermilab, a 4000-ft long underground complex has recently been constructed for a high-energy physics experiment. The complex is sited up to 350 ft, below grade principally in bedrock. The rock excavations were mined by TBM and drill and blast methods and supported by a combination of rock bolts, dowels and shotcrete. Water control was achieved using a combination of pre- and post-excavation grouting, drainage systems, drip shielding and air desiccation measures.

Laughton, Christopher; Bruen, Michael P

2003-01-01T23:59:59.000Z

218

St. Clair, MI Natural Gas Pipeline Exports to Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

59,044 56,015 56,094 66,775 52,380 65,815 66,723 2012 62,390 62,442 72,035 61,364 66,456 54,973 52,240 66,101 67,443 61,205 62,762 65,084 2013 56,510 52,567 58,126 43,917...

219

Fuel Economy of the 2013 Mitsubishi i-MiEV  

NLE Websites -- All DOE Office Websites (Extended Search)

the Mobile Version of This Page Automatic (A1) Electricity Compare Side-by-Side EV EPA Fuel Economy Miles per Gallon Personalize Electricity* 112 Combined 126 City 99 Highway...

220

A FUNDAMENTAL REAKTHROUGH IN HEAT TRANSFER TE HNOLOGY FOR MI ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2011-4637P ONTA T INFORMATION

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


221

Marysville, MI Natural Gas Imports by Pipeline from Canada  

U.S. Energy Information Administration (EIA)

U.S. Natural Gas Imports by Point of Entry (Volumes in Million Cubic Feet, Prices in Dollars per Thousand Cubic Feet)

222

Alternative Uses for Vacant Land in Detroit, MI.  

E-Print Network (OSTI)

??Detroit is situated in a historically productive lake plain in the Great Lakes region of the Midwestern United States. Geographic centrality, access to rail and (more)

Yun, Michael

2008-01-01T23:59:59.000Z

223

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography Chemical sensing TE HNOLOGI AL ENEFITS Small and portable No monitoring needed High accuracy with as low as

224

MI ROFA RI ATED FIELD ALI RATION ASSEM LY  

Remote sensing Gas chromatography ... remote sensors. The Field Calibration Assembly is designed at a small scale for incorporation into the intake

225

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1996  

E-Print Network (OSTI)

gold mines in the United States. Five new mines came into production in 1997: Placer Dome's Pipeline and South Pipeline deposits in Crescent Valley in Lander County (part of the Cortez Mines complex Mountain Mine, 484,430 oz; Placer Dome's Cortez Gold Mines (including Pipeline), 407,973 oz; Independence

Tingley, Joseph V.

226

NEVADA BUREAU OF MINES AND GEOLOGY SPECIAL PUBLICATION MI-1994  

E-Print Network (OSTI)

Laboratory System, Accession Summary Report T0701789, 2007. [14] B. Stager, A. Ruegamer, Tonopah Test Ranges a herd of 250 were found dead in the northwestern Nevada Test and Training Range (NTTR) in southern collected in February 2008 at the Nevada Testing and Training Range. Units in per mil (%). Sample d15 N NO3

Tingley, Joseph V.

227

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4,338 5,323 4,952 3,361 3,295 2,761 2,838 2,182 2,061 2,644 3,085 5,122 2012 6,067 6,721 3,354 3,404 2,923 1,986 2,475...

228

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.85 4.76 4.36 4.62 4.73 4.70 4.74 4.75 4.21 3.83 3.85 3.79 2012 3.29 3.05 2.61 2.35 2.68 2.64 3.07 3.16 3.14 3.60 3.93...

229

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 1,408 2,674 212 579 179 606 34 642 270 1,367 826 1,150 2012 326 264 147 899 1,654 1,086 217 801 1,053 1,472 121 61 2013...

230

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.95 5.33 2013 3.80 4.50 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure...

231

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.36 2.55 2.26 2.30 2000's 3.74 4.57 3.03 5.47 6.47 8.12 7.61 6.88 8.37 4.01 2010's 4.69 4.26...

232

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 3,465 2,693 3,676 3,988 3,357 3,437 765 3,916 4,318 4,473 4,851 4,752 2012 5,562 5,372 5,253 3,745 3,354 2,811 2,935 3,822...

233

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 14,901 11,501 10,925 7,671 2000's 6,171 405 1,948 2,514 1,117 0 0 81 753 21 2010's 79 19 - No...

234

Detroit, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Annual Energy Outlook 2012 (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.75 2.51 2.43 2.51 2000's 3.82 9.34 3.56 5.96 6.27 -- -- 8.28 6.58 4.53 2010's 8.37 5.17 - No...

235

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.71 4.55 4.42 4.87 4.86 4.93 4.77 4.76 4.38 4.25 3.90 3.76 2012 3.32 2.95 2.71 2.49 2.42 2.74 3.14 3.24 3.03 3.42 3.93...

236

Marysville, MI Natural Gas Pipeline Exports to Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 638 5,286 3,377 691 2000's 5,320 3,651 NA 811 4,455 5,222 3,483 9,158 8,756 14,925 2010's 22,198...

237

St. Clair, MI Natural Gas Pipeline Imports From Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.04 3.16 2.07 2.62 2000's 4.45 4.54 3.19 5.84 6.50 9.93 7.44 6.97 10.03 5.10 2010's 4.97 4.29...

238

Detroit, MI Natural Gas Pipeline Exports to Canada (Dollars per...  

Annual Energy Outlook 2012 (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 4.72 4.58 4.22 4.51 4.66 4.73 4.55 4.45 4.19 3.92 3.79 3.60 2012 3.14 2.95 2.61 2.33 2.50 2.62 3.08 3.12 2.99 3.41 4.13...

239

Detroit, MI Natural Gas Pipeline Exports to Canada (Million Cubic...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 30,410 31,080 24,908 25,049 2000's 36,007 35,644 7,431 19,737 40,030 40,255 22,156 22,904 27,220...

240

St. Clair, MI Natural Gas Exports to Canada  

Annual Energy Outlook 2012 (EIA)

7 2008 2009 2010 2011 2012 View History Pipeline Volumes 9,633 9,104 6,544 5,591 5,228 3,531 1996-2012 Pipeline Prices 6.97 10.03 5.10 4.97 4.29 2.63 1996-2012...

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


241

St. Clair, MI Natural Gas Pipeline Imports From Canada (Million ...  

U.S. Energy Information Administration (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec; 2011: 123: 237: 33: 91: 238: 1,469: 571: 38: 1,605: 552: 270: 2012: 51: 42: 2,029: 475: 370: 52: 45: 69: 221 ...

242

Marysville, MI Natural Gas Pipeline Exports to Canada (Dollars...  

U.S. Energy Information Administration (EIA) Indexed Site

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 2.97 2.36 2.17 2.47 2000's 2.91 3.92 NA 5.06 6.83 7.92 7.36 7.77 7.48 4.85 2010's 4.87 4.48 3.18...

243

Marysville, MI Natural Gas Pipeline Imports From Canada (Dollars...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 3.48 2.17 2.06 2000's NA NA 3.95 -- 7.80 -- 7.07 7.59 8.59 3.80 2010's 4.44 4.42 2.99...

244

Marysville, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Decade Year-0 Year-1 Year-2 Year-3 Year-4 Year-5 Year-6 Year-7 Year-8 Year-9 1990's 10 1,827 135 2000's NA NA 74 0 303 0 24 876 2,252 5,651 2010's 5,694 9,946 8,099...

245

Detroit, MI Natural Gas Pipeline Imports From Canada (Million...  

Gasoline and Diesel Fuel Update (EIA)

Year Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec 2011 8 11 2013 16 140 - No Data Reported; -- Not Applicable; NA Not Available; W Withheld to avoid disclosure of...

246

ENERGY SURETY MI ROGRID - Home - Energy Innovation Portal  

Emergency Response Alternate Energy and Power Supply TE HNOLOGI AL ENEFITS Risk Assessment assists in planning and analysis of potential risks

247

miR290-5p and miR292-5p Activate the Immunoglobulin kappa Locus  

E-Print Network (OSTI)

empty vector control or Doxycycline-inducible Blimp1 cDNA,presence of ethanol or Doxycycline (1:5000, 16hr). Data wasCCA CCT GGT ACT GCG ACT C Doxycycline Experiments pFG12-TRE-

Garcia, Patty Bertha

2012-01-01T23:59:59.000Z

248

Molecular Cell STAT3 Activation of miR-21 and miR-181b-1  

E-Print Network (OSTI)

cells via a positive feedback loop involving NF-kB, Lin28, let-7, and IL-6. We identify differentially, respectively, inhibit PTEN and CYLD tumor suppressors, leading to increased NF-kB activity required to maintain

Bulyk, Martha L.

249

Adherence to Scheduled Sessions in a Randomized Field Trial of Case Management: The Criminal JusticeDrug Abuse Treatment Studies Transitional Case Management Study  

E-Print Network (OSTI)

Alcohol Research, University of Kentucky, Lexington, KY, USAAlcohol Studies; University of Kentucky, Center on Drug and

2009-01-01T23:59:59.000Z

250

Housing, Credit Constraints, and Macro Stability: The Secondary Mortgage Market and Reduced Cyclicality of Residential Investment  

E-Print Network (OSTI)

of Business & Economics University of Kentucky Lexington, KYBusiness & Economics, University of Kentucky, Lexington, KY

Peek, Joe; Wilcox, James A.

2006-01-01T23:59:59.000Z

251

Measurement of Branching Fractions and CP Asymmetries in B -> wK Decays and First Evidence of CP Violation in B0 -> wKS0  

E-Print Network (OSTI)

We present a measurement of the branching fractions and charge-parity (CP) violating parameters in B --> omega K decays. The results are obtained from the final data sample containing 772 million BBbar pairs collected at the {\\Upsilon}(4S) resonance with the Belle detector at the KEKB asymmetric-energy e+e- collider. We obtain the branching fractions, B(B0 --> omega K0) = (4.5+/- 0.4 (stat) +/- 0.3 (syst)) x 10^-6, B(B+ --> omega K+) = (6.8 +/- 0.4 (stat) +/- 0.4 (syst)) x 10^-6, which are in agreement with their respective current world averages. For the CP violating parameters we obtain, A (B0 --> omega K0S) = -0.36 +/- 0.19 (stat) +/- 0.05 (syst), S (B0 --> omega K0S) = +0.91 +/- 0.32 (stat) +/- 0.05 (syst), A (B+ --> omega K+) = -0.03 +/- 0.04 (stat) +/- 0.01 (syst), where A and S represent the direct and mixing-induced CP asymmetry, respectively. We find no evidence of CP violation in the decay channel B+ --> omega K+; however, we obtain the first evidence of CP violation in the B0 --> omega K0 decay channel at the level of 3.1 standard deviations.

V. Chobanova; J. Dalseno; C. Kiesling; I. Adachi; H. Aihara; D. M. Asner; V. Aulchenko; T. Aushev; T. Aziz; A. M. Bakich; A. Bala; Y. Ban; K. Belous; B. Bhuyan; A. Bobrov; G. Bonvicini; A. Bozek; M. Bra?ko; T. E. Browder; D. ?ervenkov; V. Chekelian; A. Chen; B. G. Cheon; K. Chilikin; R. Chistov; K. Cho; Y. Choi; D. Cinabro; M. Danilov; Z. Doleal; Z. Drsal; D. Dutta; K. Dutta; S. Eidelman; S. Esen; H. Farhat; J. E. Fast; T. Ferber; V. Gaur; N. Gabyshev; S. Ganguly; A. Garmash; R. Gillard; Y. M. Goh; B. Golob; J. Haba; K. Hayasaka; X. H. He; Y. Horii; Y. Hoshi; W. -S. Hou; Y. B. Hsiung; H. J. Hyun; T. Iijima; K. Inami; A. Ishikawa; Y. Iwasaki; T. Iwashita; I. Jaegle; T. Julius; J. H. Kang; E. Kato; H. Kawai; T. Kawasaki; D. Y. Kim; H. J. Kim; J. B. Kim; J. H. Kim; M. J. Kim; Y. J. Kim; K. Kinoshita; J. Klucar; B. R. Ko; P. Kody; S. Korpar; P. Krokovny; B. Kronenbitter; T. Kuhr; T. Kumita; A. Kuzmin; J. S. Lange; S. -H. Lee; J. Li; Y. Li; L. Li Gioi; J. Libby; D. Liventsev; P. Lukin; D. Matvienko; K. Miyabayashi; H. Miyake; H. Miyata; R. Mizuk; G. B. Mohanty; A. Moll; N. Muramatsu; R. Mussa; E. Nakano; M. Nakao; Z. Natkaniec; M. Nayak; E. Nedelkovska; C. Ng; N. K. Nisar; S. Nishida; O. Nitoh; S. Ogawa; S. Okuno; P. Pakhlov; G. Pakhlova; C. W. Park; H. Park; H. K. Park; T. K. Pedlar; T. Peng; R. Pestotnik; M. Petri?; L. E. Piilonen; M. Ritter; M. Rhrken; A. Rostomyan; H. Sahoo; T. Saito; Y. Sakai; L. Santelj; T. Sanuki; V. Savinov; O. Schneider; A. J. Schwartz; D. Semmler; K. Senyo; O. Seon; M. E. Sevior; M. Shapkin; T. -A. Shibata; J. -G. Shiu; B. Shwartz; A. Sibidanov; F. Simon; Y. -S. Sohn; S. Stani?; M. Stari?; M. Steder; K. Sumisawa; T. Sumiyoshi; U. Tamponi; G. Tatishvili; Y. Teramoto; K. Trabelsi; M. Uchida; T. Uglov; Y. Unno; S. Uno; C. Van Hulse; P. Vanhoefer; G. Varner; K. E. Varvell; A. Vinokurova; V. Vorobyev; M. N. Wagner; C. H. Wang; M. -Z. Wang; P. Wang; M. Watanabe; Y. Watanabe; K. M. Williams; E. Won; H. Yamamoto; Y. Yamashita; S. Yashchenko; Z. P. Zhang; V. Zhilich; V. Zhulanov; A. Zupanc

2013-11-26T23:59:59.000Z

252

Print http://us.mg4.mail.yahoo.comfneo/launch?.rand=deOsgk04ks40i Subject: Re: [s-w-h] Solar verses wind efficiency  

E-Print Network (OSTI)

& Pltry Sci-AS-PHD PHD ANA 11ANP 11ANPPHD Animl Sci & Pltry Sci-PS-PHD PHD ANA 11ANS 11ANSMR Animal Sci

253

Modeling Solid-Particle Erosion of Ductile Alloys B.F. LEVIN, K.S. VECCHIO, J.N. DuPONT, and A.R. MARDER  

E-Print Network (OSTI)

hardening **HASTELLOY and STELLITE are trademarks of Stoody Deloro Stel- lite, Inc., Industry, CA. HAYNES.removal. Only a few attempts have been made to measure the STELLITE**-6, and 316L SS) and commercially pure Cu repre- variation in mechanical properties. The Stellite-6 alloy con- sent a measure of energy absorbed

DuPont, John N.

254

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" 9 Appliances in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Appliances",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Cooking Appliances" "Stoves (Units With Both" "an Oven and a Cooktop)"

255

Utility-Scale Smart Meter Deployments, Plans & Proposals  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

edisonfoundation.net/IEE edisonfoundation.net/IEE Utility-Scale Smart Meter Deployments, Plans & Proposals April 2010 Utility State Target Number of Meters Notes Resources AEP 1 IN, KY, MI, OH, OK, TX, VA, WV 5,000,000 AEP plans on deploying smart meters to all customers within their service territory and have deployed 10,000 meters to customers in South Bend, IN, and are presently deploying another 700,000 to AEP-Texas customers. Timing for the remaining deployments will depend on specific conditions in each of the seven operating company subsidiaries. AEP Corporate Sustainability Report 2009 2 Allegheny Power MD, PA, WV 700,000 Allegheny launched pilots in Morgantown, WV and Urbana, MD to test smart meters and thermostats (1,140 meters installed). In PA, Act 129 (2008)

256

Louisville, KY Led by Debbie Grusenmeyer (Extension Associate/ PRO-DAIRY Youth Specialist) and Matt Young (Cornell Animal Science '02) a team of New York 4-H youth recently won the National 4-H  

E-Print Network (OSTI)

) and Matt Young (Cornell Animal Science '02) a team of New York 4-H youth recently won the National 4-H Dairy Quiz Bowl Championship title for the 10th time. The 33rd annual North American Invitational 4-H Dairy Quiz Bowl Contest was held at the North American International Livestock Exposition in Louisville

Keinan, Alon

257

file://C:\Documents%20and%20Settings\rma\My%20Documents\CSEQ\we  

NLE Websites -- All DOE Office Websites (Extended Search)

Full data base of agricultural experiments used in this study. Full data base of agricultural experiments used in this study. Site ID 1 Tillage 2 Crop 3 Fertilizer (kg/ha/yr) Sample year Sampling Depth (cm) Depth increment (cm) 4 SOC (%) 4 SOC (g/m^2) KY01 n/a sod n/a 1975 0-5 5 2.70 KY01 n/a sod n/a 1975 5-15 10 1.39 KY01 n/a sod n/a 1975 15-30 15 0.79 KY01 n/a sod n/a 1980 0-5 5 3.81 KY01 n/a sod n/a 1980 5-15 10 1.73 KY01 n/a sod n/a 1980 15-30 15 0.90 KY01 n/a sod n/a 1989 0-5 5 3.11 KY01 n/a sod n/a 1989 5-15 10 1.41 KY01 n/a sod n/a 1989 15-30 15 1.11 KY01 CT corn 0 1975 0-5 5 1.33 KY01 CT corn 0 1975 5-15 10 1.24 KY01 CT corn 0 1975 15-30 15 0.68 KY01 CT corn 0 1980 0-5 5 1.25 KY01 CT corn 0 1980 5-15 10 1.38 KY01 CT corn 0 1980 15-30 15 0.78 KY01 CT corn 0 1989 0-5 5 1.31 KY01 CT corn 0 1989 5-15 10 1.55

258

U.S. DEPARTMENT OF ENERGY - NETL CATEGORICAL EXCLUSION (CX) DESIGNATIO...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Kentucky EE SEP ARRA PMC 2009 Vicki L. Duvall 042009-043012 Kentucky KY Rev2 Green Bank of KY Revolving loan program for EE measures in buildings. Corrected NEPA determination...

259

UTILITYID","UTILNAME","STATE","YEAR","MONTH","RES_REV (Thousand...  

U.S. Energy Information Administration (EIA) Indexed Site

City of","KY",91,1,907,15235,455,6879,1517,26862,55,774,2934,49750 5748,"Electric Energy Inc","KY",91,1,0,0,0,0,12926,698742,0,0,12926,698742 6708,"Frankfort City...

260

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","11292013" ,"Excel File Name:","n9050ky2a.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn9050ky2a.htm" ,"Source:","Energy Information...

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


261

UTILITYID","UTILNAME","STATE","YEAR","MONTH","RES_REV (Thousand...  

U.S. Energy Information Administration (EIA) Indexed Site

","KY",97,1,45204,811671,10520,195006,19029,468302,729,14444,75483,1489422 5748,"Electric Energy Inc","KY",97,1,0,0,0,0,14568,813077,0,0,14568,813077 7604,"Green River Electric...

262

FetterGroup: Award Recipient for the ENERGY STAR Challenge for...  

NLE Websites -- All DOE Office Websites (Extended Search)

Award Recipient for the ENERGY STAR Challenge for Industry FetterGroup Headquarters Facility 700 Locust Lane Louisville, KY 40217 Fetter was founded in Louisville, KY in 1888, and...

263

DOE Solar Decathlon: 2009 University of Kentucky  

NLE Websites -- All DOE Office Websites (Extended Search)

logo on the left chest. Behind the team is a promotional sign for the s*ky blue house. Kentucky team members say their s*ky blue house is designed by Kentucky but for the...

264

JOURNALOF NEUROPHYSIOLOGY Vol. 76, No. 2, August 1996. Printed in U.S.A.  

E-Print Network (OSTI)

;GERVAIS, KLEINFELD. DELANEY, AND GELPERIN Depol. 0 - .Ww,t) F(KY) Hyperpol. 12 3456 7 Spatial Uniform

Kleinfeld, David

265

Superalloy Recycling 1976-1986  

Science Conference Proceedings (OSTI)

NY, Princeton,. KY ........ Spectrum Alloys Inc., Los Angeles, CA ........................ Stoody Deloro Stellite,. Inc., Industry,. CA ................... Suissman and Blumenthal,

266

Is U3Ni3Sn4 best described as near a quantum critical point?  

E-Print Network (OSTI)

and Astronomy, University of Kentucky, Lexington, KY 40506-76SF00098. Work at the University of Kentucky was supported

Booth, C.H.; Shlyk, L.; Nenkov, K.; Huber, J.G.; De Long, L.E.

2003-01-01T23:59:59.000Z

267

Predicting the Service-Life of Concrete Structures Exposed to ...  

Laval University CEMENTITIOUS MATERIALS FOR WASTE TREATMENT, ... KY) Questions? Multi-ionic model. Transport properties Modeling the effect of ...

268

Tuesday Morning Sessions - TMS  

Science Conference Proceedings (OSTI)

February 6, 1996 Location: Anaheim Convention Center. Session Chairperson: James G. Morris, 175 Anderson Hall, University of Kentucky, Lexington, KY...

269

Wednesday Afternoon Sessions  

Science Conference Proceedings (OSTI)

Program Organizer: Professor James G. Morris, Chemical & Materials Engineering, Director, Light Metals Research Labs., University of Kentucky, Lexington, KY...

270

Technology Commercialization Showcase 2008: Office of the ...  

South Dakota State University, Brookings, SD. Cornell University, Ithaca, NY. University of Tennessee, Knoxville, TN. ... KY) Mascoma (Monroe County, ...

271

SEMIPERMEA LE MEM RANES FOR MI ROMA HINED SILI ON SURFA ES 5 US ...  

co-fabricated filtration system for enhancement of ... increases functionality and integration of micro ... for the U.S. Department of Energys National Nuclear ...

272

Bioreactor Landfill Research and Demonstration Project Northern Oaks Landfill, Harrison, MI  

DOE Green Energy (OSTI)

gaseous sample characteristics correlated with enhanced biological activity and increase in temperature. Continued monitoring of this bioreactor landfill cell is expected to yield critical data needed for start up, design, and operation of this emerging process.

Zhao, Xiando; Voice, Thomas; and Hashsham, Syed A.

2006-08-29T23:59:59.000Z

273

ANRV286-MI60-17 ARI 25 May 2006 23:56 The Bacterial  

E-Print Network (OSTI)

Molecular Genetics and Microbiology, University of Texas, Austin, Texas 78712-0231; email: philipl energy-transducing membranes (133). It is widespread within the microbial world and in plants. Homologs

Georgiou, George

274

UCRL-MI-224010 ARM-06-012 ARM's Support for GCM Improvement:...  

NLE Websites -- All DOE Office Websites (Extended Search)

updrafts. Because the total mass of water condensed into clouds is controlled by thermodynamics, a greater number of droplets for the same mass of cloud water means that the...

275

May All Good Things Gather Here: Life, Religion and Marriage in a Mi nyag Tibetan Village  

E-Print Network (OSTI)

;#15; #29;#31;#3;#14;#12; 3 #11;#5;#12;#6;#3;#20; #8;#20; #31;#6;#7; #29;#7;#5;8#16;#11;#3; #14; #15;#7;#5;#14;#3;#19;#5;#17;.#7;#5; #5;#14; #14;#5;#7;#8; #5;#7;#8;#11;#12; #6;#5;#20;#5;9 : ?@AB@A : >C?DEFGH@AB@A : CIH@AB@A : EKDLMAB@A : N...

Bkra shis bzang po

2012-01-01T23:59:59.000Z

276

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

May ________. A vistas la pornografa. Primera Hora, 22la medida contra la pornografa. El Nuevo Da, 13 Junecomunicacin contra la pornografa. El Nuevo Da, 16 May

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

277

Classes Are Starting Soon! Prof"..roMI Photography G,aph~ o..,rgn  

E-Print Network (OSTI)

Simone Gori and Val HamburQer, then atthe UnOiersily of FreiburQ in Germany, is a noyel Yariation ofthe .... S~deshows > Mind~Br'" Combiml1iOll of the RO'il1illU_liKed_lilies ""d Enigma Gori and HamburQer

278

Superfund Record of Decision (EPA Region 5): Wash King Laundry, Baldwin, MI, March 1993  

SciTech Connect

This decision document presents the selected remedial action for the Wash King Laundry Superfund site in Baldwin, Pleasant Plains Township, Michigan. The groundwater remedial action consists of the following: groundwater monitoring; deed restrictions; and groundwater extraction with physical/chemical treatment. The lagoon remedial action consists of the following: excavation of contaminated sediments and soils and off-site disposal.

1993-03-01T23:59:59.000Z

279

Characterization of UNUSUAL LATERAL ORGANS : a miRNA regulated F-Box protein  

E-Print Network (OSTI)

between ULO and the HD-ZIP proteins in planta. Anotherof homodomain-leucine zipper (HD-Zip) proteins. Plant SignalKANADI and class III HD-Zip gene families regulate embryo

Smith, Peter Thomas

2009-01-01T23:59:59.000Z

280

Integrated modeling within a Hydrologic Information System: An OpenMI based approach  

Science Conference Proceedings (OSTI)

This paper presents a prototype software system for integrated environmental modeling that provides interoperability between the Consortium of Universities for the Advancement of Hydrologic Science, Inc. (CUAHSI) Hydrologic Information System (HIS) and ... Keywords: Data management, Environmental management, Integrated modeling, Systems analysis

Anthony M. Castronova; Jonathan L. Goodall; Mehmet B. Ercan

2013-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


281

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn  

E-Print Network (OSTI)

Puertorriquea. Humacao, Puerto Rico: Editorial Furidi,and Colonization of Puerto Rico, 1493-1599. San Juan: Centroand U.S. Imperialism in Puerto Rico. Berkeley: University of

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

282

"Orgulloso de mi Casero y de Quien Soy": Race, Place, and Space in Puerto Rican Reggaetn.  

E-Print Network (OSTI)

??My dissertation examines entanglements of race, place, gender, and class in Puerto Rican reggaetn. Based on ethnographic and archival research in San Juan, Puerto Rico, (more)

Rivera, Petra Raquel

2010-01-01T23:59:59.000Z

283

Ruofan Wu, Hieu Pham Trung Nguyen and Zetian Mi INTRODUCTION TO LEDs  

E-Print Network (OSTI)

-in-a-Wire Light Emitting Diodes and Prevention Method Nano-electronic Devices and Materials, Electrical Computer., Efficiency droop in nitride-based light-emitting diodes. Physica Status Solidi a-Applications and Materials history. Nature Photonics 2007, 1 (4), 189-192. [4] Holonyak, N., Is the light emitting diode (LED

Barthelat, Francois

284

Informa(on and Resources Water Quality and Mi/ga/on: Bifenthrin and Fipronil  

E-Print Network (OSTI)

strategy, Pesticides fluxes, Surface water, Vineyard Introduction The intensive use of pesticides for crop on the mobilisation of pesticides and total fluxes in surface water. Moreover, the effect of the sampling strategy ranged from 1.0 to 60 g. Effect of sampling strategy on the estimation of pesticides fluxes in the river

Hammock, Bruce D.

285

Nitrate-responsive miR393/AFB3 regulatory module controls root system architecture in  

E-Print Network (OSTI)

Universidad Católica de Chile, Santiago 8331010, Chile; b Department of Plant and Soil Sciences, Delaware activated cell sorter (FACS) and extracted total RNA as described previously (9). KNO3 treat- ment induced

Green, Pamela

286

Technical Section: CHuMI viewer: Compressive huge mesh interactive viewer  

Science Conference Proceedings (OSTI)

The preprocessing of large meshes to provide and optimize interactive visualization implies a complete reorganization that often introduces significant data growth. This is detrimental to storage and network transmission, but in the near future could ... Keywords: Interactive visualization, Large meshes, Lossless compression, Out-of-core

Clment Jamin; Pierre-Marie Gandoin; Samir Akkouche

2009-08-01T23:59:59.000Z

287

LAT HING MI RO OPTI AL SWIT H - Home - Energy Innovation ...  

owned subsidiary of Lockheed Martin Corporation, for the U.S. Department of Energys National Nuclear Security Administration. SAND # 2013-10084P

288

DOE Solar Decathlon: University of Kentucky: Constructing a 3D Textbook  

NLE Websites -- All DOE Office Websites (Extended Search)

s*ky blue and the Administration Building on the University of Kentucky campus. s*ky blue and the Administration Building on the University of Kentucky campus. Enlarge image s*ky blue returned to the University of Kentucky for further research and monitoring. (Courtesy of Stephen Patton) Who: University of Kentucky What: s*ky blue House Where: The University of Kentucky Administration Drive Lexington, KY 40506 Map This House Public tours: Visit the s*ky blue Web site for updates on public tours. Solar Decathlon 2009 University of Kentucky: Constructing a 3D Textbook After competing in the U.S. Department of Energy Solar Decathlon 2009, s*ky blue returned home to the University of Kentucky (UK). It was reconstructed in front of the Administration Building on the campus' main lawn-a location that juxtaposes the university's oldest building with one

289

NETL: NEPA Categorical Exclusions - July 2011 to September 2011  

NLE Websites -- All DOE Office Websites (Extended Search)

1 to September 2011 1 to September 2011 Archive (November 2009 - July 2011) ARRA Date Title Recipient Name Location DOE/NETL Sponsors N 9/30/2011 IGCC Affordability and Availability (Houston) General Electric Company Houston, TX FE/Gasification Division N 9/30/2011 IGCC Affordability and Availability (Schenectady) General Electric Company Schenectady, NY FE/Gasification Division Y 9/30/2011 Geothermal Incentive Program Connecticut Wallingford, CT EE/PMC/IPOD Y 9/29/2011 Midwest Region Alternative Fuels Project Metropolitan Energy Center Kansas City, KS EE/PMC/PVT Y 9/28/2011 Ohio Advanced Transportation Partnership/Roush CleanTech LPG Conversions of Frito Lay Vehicles Clean Fuels Ohio Plymouth Twp., MI EE/PVT/Clean Cities Y 9/28/2011 Ohio Advanced Transportation Partnership/Frito Lay Columbus Propane Fueling Infrastructure Clean Fuels Ohio Columbus, OH EE/PVT/Clean Cities

290

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" 9 Computers and Other Electronics in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Computers and Other Electronics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Computers" "Number of Computers" 0,27.4,6.7,4.7,1.1,1.1,0.6,2,2,0.6,1,0.5

291

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" 9 Fuels Used and End Uses in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Fuels Used and End Uses",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Fuels Used for Any Use" "Electricity",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8

292

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" HC4.9 Televisions in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Televisions",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Televisions" "Number of Televisions" 0,1.5,0.3,0.2,"Q","Q","Q","Q",0.1,"Q","Q","Q"

293

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" 9 Structural and Geographic Characteristics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" "Structural and Geographic Characteristics",,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" ,,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Urban and Rural2" "Urban",88.1,19.9,14.6,4.1,2.9,1.8,5.8,5.3,1.6,2.4,1.4

294

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" 9 Household Demographics of Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Household Demographics",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Household Members" "1 Person",31.3,7.4,5.1,1.4,1,0.6,2.1,2.3,0.6,1.1,0.6

295

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Water Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,,,,,"IA, MN, ND, SD" "Water Heating",,,,"IL","MI","WI","IN, OH",,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Number of Storage Tank Water Heaters" 0,2.9,0.4,0.3,"Q","Q","Q","Q",0.1,"Q","Q","Q"

296

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" 9 Air Conditioning in Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" ,,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Air Conditioning",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Air Conditioning Equipment" "Use Air Conditioning Equipment",94,22.4,15,4.3,3.1,1.8,5.9,7.4,2.3,3.4,1.7

297

" Million Housing Units, Final"  

U.S. Energy Information Administration (EIA) Indexed Site

9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" 9 Space Heating in U.S. Homes in Midwest Region, Divisions, and States, 2009" " Million Housing Units, Final" ,,"Midwest Census Region" " ",,,"East North Central Census Division",,,,,"West North Central Census Division" ,,,"Total East North Central",,,,,"Total West North Central" ,"Total U.S.1 (millions)" ,,"Total Midwest",,,,," IN, OH",,,"IA, MN, ND, SD" "Space Heating",,,,"IL","MI","WI",,,"MO",,"KS, NE" "Total Homes",113.6,25.9,17.9,4.8,3.8,2.3,7,8.1,2.3,3.9,1.8 "Space Heating Equipment" "Use Space Heating Equipment",110.1,25.8,17.8,4.7,3.8,2.3,7,8.1,2.3,3.9,1.8

298

The male germ cell gene regulator CTCFL is functionally different from CTCF and binds CTCF-like consensus sites in a nucleosome composition-dependent manner  

E-Print Network (OSTI)

2010, 3:19. 15. Nativio R, Wendt KS, Ito Y, Huddleston JE,2008, Page 20 of 21 17. Wendt KS, Yoshida K, Itoh T, Bando

2012-01-01T23:59:59.000Z

299

Microsoft Word - Mar EA w Jun Apps  

NLE Websites -- All DOE Office Websites (Extended Search)

Office 5020 Tuttle Creek Blvd Manhattan, KS 66502 USFWS Ecological Services Mike LeValley Project Leader 2609 Anderson Ave Manhattan, KS 66502 FAA, ATO Obstruction Evaluation...

300

Expect  

Science Conference Proceedings (OSTI)

... 9, No. 3, R&D Publications, Lawrence, KS, March, 1991. Libes ... 9, No. 1, R&D Publications, Lawrence, KS, January 1991. Libes ...

2013-05-17T23:59:59.000Z

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


301

Integration of Molecular Networks in the Shoot Apical Meristem that Controls Floral Specification in Arabidopsis thaliana  

E-Print Network (OSTI)

lycopersicum_miR156b Solanum_lycopersicum_miR156c Sorghum_bicolor_miR156a Sorghum_bicolor_miR156b Sorghum_bicolor_miR156c Sorghum_

Lal, Shruti

2011-01-01T23:59:59.000Z

302

U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

KY-County-Kenton KY-County-Kenton Location: County Kenton KY American Recovery and Reinvestment Act: Proposed Action or Project Description: Conduct energy efficient retrofits to county buildings-retrofits would include direct digital controls to county facilities, investigate connecting facilities to a web-based controls monitoring system, add "smart" local controls, upgrade aging primary controls, add night temperature setbacks and other energy savings strategies; electrical upgrades; HVAC upgrades/replacements; building envelope improvements which

303

Open Data Sites | Data.gov  

NLE Websites -- All DOE Office Websites (Extended Search)

Kentucky - Open Door Kentucky: http:opendoor.ky.govtransparencyPagesdefault.aspx Kenya - Kenya: http:opendata.go.ke Louisiana - Louisiana: http:wwwprd.doa.louisiana.gov...

304

Schmidt  

NLE Websites -- All DOE Office Websites (Extended Search)

Carbon Sequestration Program Charles E. Schmidt National Energy Technology Laboratory Regional Partnerships in Terrestrial Carbon Sequestration Lexington, KY November 6-7, 2001...

305

CX-000554: Categorical Exclusion Determination | Department of...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

CX-000554: Categorical Exclusion Determination Ogallala Substation KY1A Transformer Replacement CX(s) Applied: B4.6 Date: 11162009 Location(s): Ogallala, Nebraska...

306

Stanley  

NLE Websites -- All DOE Office Websites (Extended Search)

and Conservation: An NGO Perspective Lexington, KY November 6, 2001 Carbon Sequestration and Conservation: An NGO Perspective National Energy Technology Laboratory November 6, 2001...

307

2 [ABB  

E-Print Network (OSTI)

Version 1.116 Title word cross-reference (?1, 1) [MY65]. (0, 1) [GS72a]. (b, k) [AC84]. (E,kx,ky) [ZVW + 11].

Nelson H. F. Beebe

2013-01-01T23:59:59.000Z

308

2 [ABB  

E-Print Network (OSTI)

Version 1.115 Title word cross-reference (?1, 1) [MY65]. (0, 1) [GS72a]. (b, k) [AC84]. (E,kx,ky) [ZVW + 11].

Nelson H. F. Beebe

2013-01-01T23:59:59.000Z

309

2 [ABB  

E-Print Network (OSTI)

Version 1.113 Title word cross-reference (?1, 1) [MY65]. (0, 1) [GS72a]. (b, k) [AC84]. (E,kx,ky) [ZVW + 11].

Nelson H. F. Beebe

2013-01-01T23:59:59.000Z

310

Experiments with Oval: A Radically Tailorable Tool for Cooperative Work  

E-Print Network (OSTI)

-333), Cambridge, MA 02139; email: malone@eagle.mit. edu; K.-Y. Lai, McKinsey & Company, 18/F Two Exchange Square

311

Browse wiki | Open Energy Information  

Open Energy Info (EERE)

200 Fair Oaks L., 2nd Floor, Frankfort, KY, 40601 + IncentiveContDept Department for Environmental Protection + IncentiveContDiv Division of Waste Management + Incentive...

312

Browse wiki | Open Energy Information  

Open Energy Info (EERE)

200 Fair Oaks Ln., 2nd Floor, Frankfort, KY, 40601 + IncentiveContDept Department for Environmental Protection + IncentiveContDiv Division of Waste Management + Incentive...

313

Upcoming Natural Gas Storage Facilities.  

U.S. Energy Information Administration (EIA)

Kentucky Energy Hub Project Orbit Gas Storage Inc KY Leader One Gas Storage Project Peregrine Midstream Partners WY Tricor Ten Section Storage Project

314

Final_Tech_Session_Schedule_and_Location.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

IN, KY * Unique - smallest region, single geology (1 basin and 1 stratigraphic column) * History of oil production, interest in EOR, background familiarity with drilling, mining,...

315

Department of Energy Honors 50 ENERGY STAR Partners that Saved...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Mass.) The Saunders Hotel Group (Boston, Mass.) Servidyne Systems, LLC (Atlanta, Ga.) Toyota Motor Manufacturing North America Inc. (Erlanger, Ky.) Transwestern Commercial...

316

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SCNGO FY1324 months Gary Covatch Erlanger, KY Cost-Effective Treatment of Flowback & Produced Water via an Integrated Precipitative Supercritical P Provide oversight of UV...

317

Building and Fire Publications  

Science Conference Proceedings (OSTI)

... (ASHRAE). October 6-8, 1996, Baltimore, MD, ASHRAE, Atlanta, GA, Teichman, KY, Editor(s), 139-150 pp, 1996. Keywords: ...

318

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

259 Cherry Blossom Way, Georgetown, KY I-75 Green Corridor Project Install retail biofuel (E85) fueling infrastructure along the Interstate 75 corridor. 02 16 2010 Steven W....

319

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- 92013 2291 Elkhorn Dr, Lexington, KY I-75 Green Corridor Project Install retail biofuel (E85) fueling infrastructure along the Interstate 75 corridor. 02 16 2010 Steven W....

320

Regioselective Synthesis of the Tricyclic Core of Lateriflorone  

E-Print Network (OSTI)

, S.-G.; Sng, V. H. L.; Wu, X.-H.; Sim, K.-Y.; Tan, B. H. K.; Pereira, J. T.. Goh, S. H. Tetrahedron

Theodorakis, Emmanuel

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


321

Insurance Coverage for Biomedical & Traditional  

E-Print Network (OSTI)

) S.-G. Gao, V. H. L. Sng, X.-H. Wu, K.-Y. Sim, B. H. K. Tan, J. T. Pereira and S. H. Goh, Tetrahedron

Peterson, Blake R.

322

Slide 1  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Radiation Specialist Course Louisville Fire Department Fire Training Center Louisville, KY, March 4-8, 2013 J. Curt Pendergrass, PhD Supervisor, Radioactive Materials Section...

323

Translation Services  

Science Conference Proceedings (OSTI)

... of commercial products within NIST web pages is for information only; it ... 812 East Market Street Suite 201 Louisville, KY 40206 Phone: 502-213 ...

324

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Electric Appliances EE BETD 2009 Paul Giles x4811 Pgh. 7110 - 63012 Louisville, KY Advanced Magnetic Refrigerant Materials GE Appliance will assist GE Global Research in...

325

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DE-FE0000699 University of Kentucky FE DE-FE0000699 315 10 Donald Krastman 5110 -10112 Lexington, Fayette County, KY COMPUTATIONAL FLUID DYNAMICS (CFD) ANALYSIS DENSITY...

326

24 Universities Receiving Funding to Train Next Generation of...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Bradley University Peoria, IL 999,981 Indiana University Indianapolis, IN 1,323,532 University of Kentucky Research Foundation Lexington, KY 1,500,000 University of...

327

Microsoft Word - ARRA - University Training - Table.docx  

NLE Websites -- All DOE Office Websites (Extended Search)

University CO04 Novel Oxygen Carriers for Coal-Fueled Chemical Looping Combustion Western Kentucky University KY02 Numerical Modeling of Geomechanical Processes Related to CO 2...

328

Press Room - Presentations - U.S. Energy Information ...  

U.S. Energy Information Administration (EIA)

The Council of State Governments Spring Conference Lexington, KYMay 29, 2008 ... The University of Calgary Calgary, AlbertaApril 15, 2008

329

ARM - Participants  

NLE Websites -- All DOE Office Websites (Extended Search)

Delaware, Newark, DE University of Denver, Denver, CO University of Georgia, Athens, GA University of Kentucky, Lexington, KY University of Hawaii at Manoa, Honolulu, HI...

330

Texture and Grain Boundary Evolutions of Continuous Cast and ...  

Science Conference Proceedings (OSTI)

Jiantao Liu Department of Chemical & Materials Engineering University of Kentucky, Lexington, KY 40506-0046. ABSTRACT. Industrially produced hot bands of...

331

Incremental and Encoding Formulations for Mixed Integer ...  

E-Print Network (OSTI)

Apr 1, 2013 ... aTepper School of Business, Carnegie Mellon University, 5000 Forbes Ave., ...... sis, University of Kentucky, Lexington, KY, USA, 1998.

332

NETL: News Release - Kentucky Research Foundation Signs $9 Million...  

NLE Websites -- All DOE Office Websites (Extended Search)

Will Make Commercial Use of Coal Combustion Byproduct WASHINGTON, DC - A team led by the University of Kentucky Research Foundation of Lexington, Ky., recently signed an agreement...

333

NETL: News Release - Fuels, Carbon Sequestration, Advanced Power...  

NLE Websites -- All DOE Office Websites (Extended Search)

duration: 24 months; Total award value: 6,250,000) Environmental and Water Resources The University of Kentucky Research Foundation, Lexington, Ky., will investigate large-volume...

334

DOE Solar Decathlon: 2009 Find Out What Happened to the Houses...  

NLE Websites -- All DOE Office Websites (Extended Search)

Arizona SEED pod Arizona University of Illinois at Urbana-Champaign Gable Home Illinois University of Kentucky s*ky blue House Kentucky University of Louisiana at Lafayette...

335

High Temperature Deformation Behavior of Cast Alloy 718  

Science Conference Proceedings (OSTI)

Currently with University of Kentucky, Lexington, KY. Superalloys 718,625,706 and Various Derivatives. Edited by E.A. Loria. The Minerals, Metals &Materials...

336

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FE0000699 University of Kentucky FE 315 10 Donald Krastman 5110 -10112 Lexington, Fayette County, KY CHEMICAL STABILIZATION OF FINE COAL WASTE: ELIMINATION OF SLURRY...

337

Minfang Yeh  

NLE Websites -- All DOE Office Websites (Extended Search)

(SFE) in Nuclear Waste Reprocessing. Curriculum Vitae Education Ph.D in Chemistry, University of Kentucky, Lexington, KY. M.S. in Chemistry, Eastern Michigan University,...

338

Formation of a Simple Cognitive Map by Rats  

E-Print Network (OSTI)

Thomas R. Zentall University of Kentucky, U.S.A. Cognitiveof Psychology, University of Kentucky, Lexington, KY 40506-was in accordance with University of Kentucky institutional

Singer, Rebecca A.; Abroms, Benjamin D.; Zentall, Thomas R.

2006-01-01T23:59:59.000Z

339

Center for Nanophase Materials Sciences (CNMS) - CNMS Research  

NLE Websites -- All DOE Office Websites (Extended Search)

Oak Ridge National Laboratory, Oak Ridge, TN 37831 (USA) 3-Department of Chemistry, University of Kentucky, Lexington, KY 40506 (USA) 4-Department of Chemistry, University of...

340

USDA, DOE to Invest up to $18.4 million for Biomass Research...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

research and analyze lignin as a facilitator during saccharification by brown rot fungi. University of Kentucky Research Foundation (KY) - up to 999,964 Grant Purpose: To develop...

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


341

NETL: News Release - NETL Technologies Earn Prestigious R&D 100...  

NLE Websites -- All DOE Office Websites (Extended Search)

preparations of the sorbent has been demonstrated in cooperation with Sud-Chemie of Louisville, Ky., using NETL- developed technology. Thief Process for the Removal of...

342

BFRL: HVAC&R - Publications  

Science Conference Proceedings (OSTI)

... International Appliance Technical Conference , March 2002 , Lexington, KY - March 01 ... These tests included two small units a ducted 1.75 kW (0.5 ...

343

Wednesday Morning Sessions  

Science Conference Proceedings (OSTI)

... ARCO Aluminum, Inc., 2900 First National Tower, P.O. Box 32860, Louisville, KY 40232 ... Comparison of a single- step versus two- step (controlled cooling)...

344

Strategic Standardization  

Science Conference Proceedings (OSTI)

... Program Strategic Standardization Curriculum (CMGT 564 - 2010) ... com. Curriculum ks eport, 1992), Grading (Research paper, ...

2012-12-03T23:59:59.000Z

345

Atliekinio fosfogipso panaudojimas sunki?j? metal? immobilizacijai nuotek? dumble ir dumblo-dirvoemio miiniuose.  

E-Print Network (OSTI)

??Nuotek? dumble esan?i? sunki?j? metal? neigiam? poveik? aplinkai bei mogaus sveikatai galima sumainti apribojant metal? judrum? aplinkoje. Magistro darbe tiriamas sunki?j? metal? judrumas ir j? (more)

Puodi?nas,; Marius

2009-01-01T23:59:59.000Z

346

Creative Reconstruction in the City: An Analysis of Art, Shrinking, and the Story of the American Dream in Detroit, MI.  

E-Print Network (OSTI)

??A right to the city is a human right that is overlooked in American cities. Cities reflect humanity in collective form, but are manipulated by (more)

Marotta, Stephen J.

2011-01-01T23:59:59.000Z

347

1996 Department of Energy pre-freshman enrichment program at GMI Engineering and Management Institute, Flint, MI  

SciTech Connect

This document reports on a summer program to encourage students to pursue scientific or engineering professions. The topics of the report include a description of the recruitment program, selection criteria for participants, workshops, nine follow up activities, research projects and student`s presentation, and field trips. Course descriptions and schedule are included as appendices.

1996-12-31T23:59:59.000Z

348

I Volume 5, Number 2 Spring 1992 A Ne\\izsletter for the RLE Community at MI'T  

E-Print Network (OSTI)

:l XI:~ri:l Ticchi. Inq~tiriesmay he ;~ddrcsscdto: RLE undercurrents Rescarcli Lahor:ltory of Electrc

349

Volume 2, Number 2 June 1989 A Nelr-sletter for the KL,t.: Communitv at MI'1'  

E-Print Network (OSTI)

Lahoratory of Electrc~nicsfor the RLE community at MIT. The following individuals contributed their time ancl

350

Advanced composites III: expanding the technology; Proceedings of the Third Annual Conference, Detroit, MI, Sept. 15-17, 1987  

Science Conference Proceedings (OSTI)

The present conference discusses topics in the design features and methods, manufacturing processes, secondary fabrication techniques, and materials science aspects of advanced composites. Attention is given to composite structural armor for ground combat vehicles, composite structures for automotive energy management, CAD/CAM of braided preforms for advanced composites, composite automobile bumper beams, preforming for structural applications, the three-dimensional braiding of thermoplastic composite preforms, and recent advancements in tooling technology. Also discussed are instrument-grade MMCs for imaging IR guidance systems, automated tape layup of a vertical stabilizer fin, the mechanical properties of thermoplastic matrix composites, surface chemistry and adhesion of SMCs, fiber-matrix bonding, and hybrid yarns for high performance thermoplastic composites.

Not Available

1987-01-01T23:59:59.000Z

351

LBNL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 2002 Place Time Name Group Group  

E-Print Network (OSTI)

37 192 19:28.7 John Wool 40-49 men 48 193 19:32.4 Jaimin Wan page 7 HISTORY OF LBNL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS 1st

352

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 11, 1996 Dummy first body page  

E-Print Network (OSTI)

-59 59 668 34:20.7 Seung-yu Rah 30-39 157 669 34:21.4 John Wool 40-49 120 670 34:25.6 Manny Gonzalez 30:42.8 Pete Valerio HISTORY OF LBL RUNAROUND WINNERS

353

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 14, 1990 Place Time Name Group Group  

E-Print Network (OSTI)

:56.4 John Wool 30­39 105 483 30:00.0 David O'Neill ) Group Time Name Overall Place Place 1 24:24.3 John Magee 373 2 25:41.9 Edward Lofgren 400 HISTORY OF LBL

354

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 22, 1995 Dummy first body page  

E-Print Network (OSTI)

198 16:04.7 Alan Meier 40-49 30 199 16:05.7 John Wool 40-49 31 200 16:07.5 Ginny Lackner 50-59F 1 201 Don Krieger Frances Mann Peter Morley Bob Shilling HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION

355

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) October 10, 1997 Place Time Name Group  

E-Print Network (OSTI)

Larnon, Frank 50-59 13 156 15:17.4 157 15:18.0 Bartholomew, J 50-59 14 158 15:18.4 Wool, John 40-49 18 159 15 Time Name Group Group Place HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN

356

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 15, 1989 Envel. Time Name Group Group  

E-Print Network (OSTI)

40-49 8 67 12:51.4 Desiderio Kovar Wool 30-39 20 69 12:56.7 Antoine Mensch Envelope Place Number 1 21:59.8 John L. Magee 354 2 26:14.8 Ed Lofgren 427 HISTORY OF LBL RUNAROUND WINNERS

357

LBL RUNAROUND RESULTS 2.95 km (1.84 mi) September 16, 1988 Envelope Time Name Group Group  

E-Print Network (OSTI)

120 14:08.2 Z. Mei 30-39 26 121 14:09.5 John Wool 30-39 27 122 14:10.3 Timothy Edberg 30-39 28 123 14 Time Name Envelope Place Number 1 30:14.0 Peter Endt 447 HISTORY OF LBL RUNAROUND WINNERS Year Distance

358

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 11, 1992 Place Time Name Group Group  

E-Print Network (OSTI)

14:26.2 Barry Freifeld Wool 30-39 39 122 14:28.2 Ken Woolfe 40-49 18 123 14 Williams HISTORY OF LBL RUNAROUND WINNERS AND PARTICIPATION Year Distance MEN WOMEN PARTICIPANTS

359

I Volume 7, Number 2 Spring 1994 A Newsleccer for the RLE Communitv at MI'I'  

E-Print Network (OSTI)

Robert J. Birgeneau, Dean of the School of Science and a principal investigator in RLE's Surfaces has his blue belt in karate. Seventh grader Amanda's bowl~ngteam competed in the state finals

360

Corrosion mechanisms of low level vitrified radioactive waste in a loamy soil M.I. Ojovan1  

E-Print Network (OSTI)

Topic: Briefings by environmental groups, industry groups, pub- lic policy groups, and state, is the central authority responsi- ble for evaluating and supervising the nuclear industry's research and 1.95 meters in diameter. It is fabricated from forged steel with a stainless steel coating. The cask

Sheffield, University of

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


361

Informa(on and Resources Prac&ces for Mi&ga&ng Urban Pes&cide Runoff  

E-Print Network (OSTI)

. Producers can then use these records to analyze the effectiveness of past pesticide applications a documentation system for determining crop replant, rotation and #12;Pesticide Recordkeeping 2 prePI-20 Pesticide Recordkeeping 1 Michael Aerts, O. Norman Nesheim, and Frederick M. Fishel2 1

Hammock, Bruce D.

362

Microsoft Word - Sample Abstract and Format Instructions.doc  

NLE Websites -- All DOE Office Websites (Extended Search)

Dearborn, MI 48128, Wayne State University 2 , Department of Physics and Astronomy, Detroit, MI 48202, Kettering University 3 , Flint, MI 48504, University of Paris-Sud 4 ,...

363

Language Assimilation Today: Bilingualism Persists More Than in the Past, But English Still Dominates  

E-Print Network (OSTI)

Somerset- Hunterdon, NJ Detroit, MI Table 2 Childrens homeSomerset- Hunterdon, NJ Detroit, MI Bergen-Passaic, NJSomerset- Hunterdon, NJ Detroit, MI Appendix Table 2

Alba, Richard

2004-01-01T23:59:59.000Z

364

Former Worker Program - Defunct Beryllium Vendor Screening Program  

NLE Websites -- All DOE Office Websites (Extended Search)

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Wolverine Tube Division (Detroit, MI); National Beryllia (Haskell, NJ);...

365

Beryllium Vender Screening Program | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(Springdale, CT); Gerity-Michigan Corporation (Adrian, MI); Revere Copper and Brass (Detroit, MI); Speedring Systems, Inc. (Detroit, MI); Wolverine Tube Division...

366

Worksheet  

U.S. Energy Information Administration (EIA) Indexed Site

1982,2,50022,3,"KY",8,"S",6,1,05002,1,"BIT",7,7,1881,12285,1.44,10.8,241.1,,1,01,05002 1982,2,50022,3,"KY",8,"S",6,1,05002,1,"BIT",7,7,5028,12186,1.12,12.7,241.1...

367

Worksheet  

U.S. Energy Information Administration (EIA) Indexed Site

1983,6,50782,1726,"KY",8,"S",3,26, 115,1,"BIT",1,1,2900,12457,0.79,9.15,241.1,,1,07,13193 1983,6,50782,1726,"KY",8,"S",3,26, 116,1,"BIT",1,1,800,12356,0.84,8.63,232...

368

Regional Partnerships in Terrestrial Carbon Sequestration  

NLE Websites -- All DOE Office Websites (Extended Search)

Regional Partnerships in Terrestrial Carbon Sequestration Regional Partnerships in Terrestrial Carbon Sequestration November 6-7, 2001 Lexington, Kentucky Robert Addington AEI Incorporated 2000 Ashland Drive Ashland, KY 41101 Phone: 606-928-3433 Email: crystalj@aeiresources.com Jim Amonette MSIN K8-96 Pacific Northwest National Laboratory P.O. Box 999 Richland, WA 99352 Phone: 509-3765565 Email: jim.amonette@pnl.gov Patrick Angel Area Office Manager U.S. Department of Interior Office of Surface Mining P.O. Box 1048 London, KY 40741 Phone: 606-878-6440 Email: pangel@osmre.gov Hugh Archer Commissioner Kentucky Dept of Natural Resources 663 Teton Trail Frankfort, KY 40601 Phone: 502-564-2184 Email: hugh.archer@mail.state.ky.us Victor Badaker Mining Engineering Dept. University of Kentucky MML Bldg. Lexington, KY 40546 Phone: 859-257-3818

369

--No Title--  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Michigan Total Sum City, County, and SEO Allocations All 76,601,500 MI Michigan State Energy Office 19,599,600 MI Ann Arbor City 1,243,400 MI Battle Creek City 545,100...

370

Non-traumatic Shoulder Dislocation  

E-Print Network (OSTI)

of Emergency Medicine, Detroit, MI Supervising SectionFord Hospital, 2799 W. Grand Blvd, Detroit, MI 48201. Email

Manteuffel, Jacob

2009-01-01T23:59:59.000Z

371

Whither the Keiretsu, Japan's Business Networks? How Were They Structured? What Did They Do? Why Are They Gone?  

E-Print Network (OSTI)

Construction Nippon Flour Mills Kirin Brewery Oji PaperSa Textile NIPPON FLOUR MILLS Mi Food TORAY INDUSTRIES Mi

Lincoln, James R.; Shimotani, Masahiro

2009-01-01T23:59:59.000Z

372

Epigenetic Alterations in High and Low LET Radiation Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the unstable clones. Among these, altered miRNA expression could be validated by qRT-PCR for mmu-miR-466g, hsa-miR-30a and hsa- miR-195. Hsa-miR-30a and hsa-miR-195 were...

373

Workbook Contents  

U.S. Energy Information Administration (EIA) Indexed Site

,"Next Release Date:","11292013" ,"Excel File Name:","n9050ks2a.xls" ,"Available from Web Page:","http:tonto.eia.govdnavnghistn9050ks2a.htm" ,"Source:","Energy Information...

374

Microsoft PowerPoint - Post-2014 August 25, 2011 Proposed Allocations...  

NLE Websites -- All DOE Office Websites (Extended Search)

Summer Winter Summer Winter Summer Kilowatthours Winter Kilowatthours Summer Kilowatts Winter Kilowatts Jetmore, KS 458,186 301,817 280 201 S * Pomona, KS 355,544 254,634*...

375

Slide 1  

NLE Websites -- All DOE Office Websites (Extended Search)

in KS - Deep Saline Arbuckle Aquifer in south-central KS - Select depleted mature oil fields Start Date - Dec 2009 No CO 2 will be injected in this 3-year project. C e n t...

376

The Use of Trust Regions in Kohn-Sham Total Energy Minimization  

E-Print Network (OSTI)

of the KS total energy optimization problem, which has beenthe original total energy minimization problem is. Secondly,the KS total energy minimiza- tion problem as min E total (

Yang, Chao; Meza, Juan C.; Wang, Lin-wang

2006-01-01T23:59:59.000Z

377

ARM - Instrument - nwsupa  

NLE Websites -- All DOE Office Websites (Extended Search)

: NWS profiles at Dodge City, KS with 1-second resolution 01snwsupaoun : NWS profiles at Oklahoma City, OK with 1-second resolution 01snwsupatop : NWS profiles at Topeka, KS with...

378

Agricultural expansion induced by biofuels: Comparing predictions of market?equilibrium models to historical trends  

E-Print Network (OSTI)

KS Tyson. An overview of biodiesel and petroleum diesel lifecally maize ethanol and biodiesel from vegetable oils are

Rajagopal, Deepak

2011-01-01T23:59:59.000Z

379

SGI Proprietary Eine Einfhrung in die Benutzung der SGI Altix  

E-Print Network (OSTI)

distribution of application memory pages across nodes: % dlook ls anaconda-ks.cfg install.log install

Sanderson, Yasmine

380

Tolerance Limits  

Science Conference Proceedings (OSTI)

... LIMITS Y ** *** 2-SIDED NORMAL TOLERANCE LIMITS: XBAR +- K*S REFERENCE--CRC HANDBOOK, PAGES 32-35 ...

2010-12-06T23:59:59.000Z

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


381

Table 25  

Gasoline and Diesel Fuel Update (EIA)

89 89 Table 25 Created on: 1/3/2014 3:10:33 PM Table 25. Natural gas home customer-weighted heating degree days, New England Middle Atlantic East North Central West North Central South Atlantic Month/Year/Type of data CT, ME, MA, NH, RI, VT NJ, NY, PA IL, IN, MI, OH, WI IA, KS, MN, MO, ND, NE, SD DE, FL, GA, MD, DC, NC, SC, VA, WV November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0 November to November Normal 702 665 758 841 442 2012 751 738 772 748 527 2013 756 730 823 868 511 % Diff (normal to 2013) 7.7 9.8 8.6 3.2 15.6 % Diff (2012 to 2013) 0.7 -1.1 6.6 16.0 -3.0

382

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FOA-0000028 FOA-0000028 Prime: Cascade Sierra Solutions EE DE-EE0002613 PMC/PVT 2011 John Jason Conley 07/2011 - 02/20/2014 Multiple sites, Multiple states Interstate Electrification Improvement (SUMMARY CX) Install truck stop electrification hardware at multiple (30) truck stops nationwide. Locations in UT, IA, NM, WY, AZ, MO, VA, MA, MI, TX, AL, WA, CA, NC, NY, MT, FL, KS. 08 17 2011 John Jason Conley Digitally signed by John Jason Conley DN: cn=John Jason Conley, o=DOE, ou=NETL, email=John.Conley@netl.doe.gov, c=US Date: 2011.08.17 13:25:08 -04'00' 10 18 2011 john ganz Digitally signed by john ganz DN: cn=john ganz, o=netl, ou=environmental compliance division, email=john.ganz@netl.doe.gov, c=US Date: 2011.10.18 13:52:43 -04'00' Sub: Shorepower Technologies. Funded by DE-FOA-0000028, "Recovery Act - Transportation

383

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

Science Conference Proceedings (OSTI)

The principal objective of the study was to test a new analytical technique, Solid-Phase Microextraction (SPME), for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. This involved measuring the effectiveness of SPME to extract hydrocarbons under controlled conditions in the laboratory. As part of the study, a field demonstration was undertaken to assess the validity and usefulness of the laboratory results. Presented in this quarterly report is the condensed version of the Case History and Well Summary for the Bear Lake area in Manistee County, Michigan. The full version will be in the annual report. The condensed case history presents the important technical details regarding the geochemistry and horizontal lateral for Bear Lake, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan

2003-04-01T23:59:59.000Z

384

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

The geochemical sampling team collected additional 148 samples at Vernon Field along 5 new traverses. Most of the locations were sampled for three types of analyses: microbial, iodine and enzyme leach; no results from the second batch of samples were available in time for this report. In addition to the sampling, a study was begun on the feasibility of collecting and analyzing hydrocarbon gases (C1-C8) directly. Although several companies offer these services, the cost ($200-300/sample w/o sampling fee) is high, on par with the cost of a 3D seismic survey, and may not include the raw data. However direct sampling of reservoir gases collecting in the soil appear to offer the best approach and should be included in this study. It would probably work well at Vernon Field. It may be possible to lower costs considerably; initial estimates of $20/sample for GCMS (Gas Chromatography--mass spectrometry) analysis are attractive and might induce to Michigan producers to include soil surveys in their routine field work-ups. A complete set of digital data was assembled for Vernon Field and nearby locations. The set consists of well locations, formation top picks, lithologies and scanned images of driller's reports and scout tickets. Well logs are still being located. The annual meeting for the Class Revisit work group is tentatively scheduled for the week of March 1-7 in Tampa, Fl. By that time all of the geochemical data will be available and final decisions regarding drilling can be made.

James R. Wood; T.J. Bornhorst; S.D. Chittichk; William B. Harrison; W. Quinlan

2001-01-01T23:59:59.000Z

385

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

A principal goal of the Budget Period I was to demonstrate that surface geochemistry could be used to locate bypassed hydrocarbons in old fields. This part of the program was successful. A surface geochemical survey, employing 5 different techniques, was carried out in the Spring and Summer of 2000 and a demonstration well, the State Vernon & Smock 13-23 HD1 (permit number: PN 53945) was drilled in Vernon Township, Isabella County, Michigan in the late fall of 2000. A demonstration well was selected and drilled based on geologic considerations and surface geochemistry. Over 460 soil samples were collected and analyzed over the drill site. A good anomaly was detected near the proposed well site and the demonstration well, the Smock 13-23, was drilled to a depth of 3157 feet by November 17, 2000. Two laterals were drilled, and hydrocarbons were located in a zone approximately 175 feet in length. However, it was determined that the pay zone was too small and difficult reservoir conditions (water production) prevented putting the well in production. The Smock 13-23 was shut in and abandoned January 15, 2001. A post-mortem determined that the main reason the well was not economic was because the zone was nearly completely flushed by earlier recovery operations. The post mortem also revealed the presence of an unmapped shale plug crossing the first lateral. It appears that this shale was detected by the geochemical survey, but its significance was not appreciated at the time. It is possible that sections of the well were faulty, ''porposing'' up and down so as to create water blockages. We are continuing to use the Vernon Field and the demonstration well to calibrate the geochemical data. Eventually, this study may provide a standard site that can be used to test and calibrate geochemical anomalies, something that does not presently exist. A postmortem report on the well, including the geology and geochemistry used to site the well, is presented in Appendix I. Five geochemical techniques have been tested in Phase I. These include surface iodine, microbial, enzyme leaching, soil gas and subsurface iodine. We are most comfortable with the results of the microbial surveys but feel that direct measurement of soil gas is the best method if analytical difficulties can be overcome. The reason the microbial surveys are presently favored is because they provide a logical, consistent picture that is easy to interpret and easy to explain. This in turn is because the microbial anomaly is manifested as an ''apical'' as opposed to an ''edge'' or ''halo'' anomaly. Several lessons were learned during Phase I activities. The main one was that surface geochemistry could locate anomalies over old fields such as Vernon. We also learned that horizontal drilling has advantages and disadvantages in situations such as this. On the plus side, it does provide a means to probe for pockets of bypassed oil, but it is expensive relative to vertical (or slant wells?) and is difficult to control in a narrow pay zone. We tentatively conclude that horizontal wells do not provide a cost-effective solution in this setting and suggest that geochemical anomalies be investigated via a single vertical well or multiple vertical wells.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan; E. Taylor

2001-07-31T23:59:59.000Z

386

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTRY, MI  

Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. A major part of the remaining project will focus on using surface geochemistry to delineate prospects. A Niagaran reef field geochemical survey, the Bagley Prospect area in Otsego County, Michigan is scheduled to take place this summer. Previous wells drilled in Bagley Prospect area in the early 1970's and in place in late 2002 and early 2003 resulted in discoveries and numerous hydrocarbon shows in the Brown Niagaran reservoir interval. The Bagley region is still considered an area of interest by the industry and appears ripe for a geochemical survey. Our industry partner is interested in a possible test in the Bagley prospect because subsurface geophysical and geological interpretation indicates the presence of structures. Anomalous production and pressure data further suggest the region is not yet well understood and should not be considered mature. The most recent well, the Bagley 1-22A sidetrack, was unsuccessful at locating a new reef culmination to the south of the original vertical well and did not encounter hydrocarbon shows. The sidetrack and well were plugged and abandoned. The proposed geochemical survey will concentrate on areas away from the Bagley 1-22A to the north and west but will include the entire prospect so that the existing data can be used in interpretations. Bagley appears to offer a unique combination of potential and data for a geochemical study that focuses on looking for new oil in an area that has exhausted traditional geologic and geophysical methods. The Bear Lake pinnacle reef trend in Manistee County, Michigan, is also scheduled for further geochemical work this summer. Industry interest, mostly by small companies, is picking up in this area and it is also ripe for targeted geochemical surveys for the same reasons cited above.

James R. Wood; A. Wylie; W. Quinlan

2004-04-01T23:59:59.000Z

387

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

Science Conference Proceedings (OSTI)

One of the main objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, several field demonstrations were undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The important observations from each of these field demonstrations are briefly reviewed in this annual report. These demonstrations have been successful in identifying the presence or lack of hydrocarbons in the subsurface and can be summarized as follows: (1) The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path of the State Springdale & O'Driscoll No.16-16 horizontal demonstration well in Manistee County, Michigan. The well was put on production in December 2003. To date, the well is flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which is a good well in Michigan. Reserves have not been established yet. Two successful follow-up horizontal wells have also been drilled in the Springdale area. Additional geochemistry data will be collected in the Springdale area in 2004. (2) The surface geochemistry sampling in the Bear Lake demonstration site in Manistee County, Michigan was updated after the prospect was confirmed and production begun; the original subsurface and seismic interpretation used to guide the location of the geochemical survey for the Charlich Fauble re-entry was different than the interpretation used by the operator who ultimately drilled the well. As expected, the anomaly appears to be diminishing as the positive (apical) microbial anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. (3) The geochemical sampling program over the Vernon Field, Isabella County, Michigan is now interpreted as a large negative anomaly associated with the entire field. The results of the State Smock horizontal well and the Bowers 4-25 well confirmed the lack of additional recoverable hydrocarbons in the Vernon Field. (4) The surface geochemistry data showed a strong anomaly in the Myrtle Beach, Burke County, North Dakota area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the geological and geophysical data; the microbial values here were the highest we have observed. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling, however, a pipeline has not yet been completed that would allow the wells to be placed into production. We also present in this annual report the results of recent efforts to map carbonate facies tracts in the middle Devonian Dundee and Rogers City Limestones using gamma ray, bulk density, and photoelectric effect geophysical well log amplitudes. This work was undertaken to identify fairways for exploration in the Dundee and Rogers City where surface geochemical techniques could then be used to screen potential leads.

James R. Wood; A. Wylie; W. Quinlan

2004-04-01T23:59:59.000Z

388

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

Two major accomplishments resulted from Phase I. One is the success of the surface geochemistry program, which collected over 800 samples from the site of the 1st demonstration well in Vernon Field and has pretty well provided us with the tools to delineate favorable ground from unfavorable. The second is the recent detailed mapping of the Central Michigan Basin that for the first time revealed the presence of at least two major faults that control the location of many of the reservoirs in the Michigan Basin. These faults were located from structure maps obtained by contouring the surface of the Dundee Formation using top picks from 9861 wells in 14 counties. Faults were inferred where the contour lines were most dense (''stacked'').

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan

2001-10-31T23:59:59.000Z

389

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

The fault study continues to find more faults and develop new techniques to visualize them. Data from the Dundee Formation has been used to document 11 major faults in the Michigan Basin which have now been verified using data from other horizons. These faults control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new GC laboratory is now functional and has been fully staffed as of December. The annual project review was held March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer. A request was made to extend the scope of the project to include the Willison Basin. A demonstration well has been suggested in Burke County, N. Dakota, following a review of 2D seismic and surface geochem. A 3D seismic survey is scheduled for the prospect.

James R. Wood; T.J. Bornhorst; William B. Harrison; W. Quinlan

2002-04-01T23:59:59.000Z

390

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

In this reporting period, we extended the fault study to include more faults and developed new techniques to visualize the faults. We now have used data from the Dundee Formation to document 11 major faults in the Michigan Basin and are in the process of reviewing data from other horizons. These faults appear to control the locations of many of the large anticlinal structures in the Michigan Basin and likely controlled fluid movements as well. The surface geochemistry program is also moving along well with emphasis on measuring samples collected last sampling season. The new laboratory is now functional and has been fully staffed as of December. The annual project review has been set for March 7-9 in Tampa, Florida. Contracts are being prepared for drilling the Bower's prospects in Isabella County, Michigan, this spring or summer.

James R. Wood; T.J. Bornhorst; S.D. Chittick; William B. Harrison; W. Quinlan

2002-01-01T23:59:59.000Z

391

Role of microRNA?155 in dendritic cells and macrophages MiR?155 directly targets PU.1 and IL13R1.  

E-Print Network (OSTI)

??In search of genes differentially expressed between M1 (pro?Th1 or pro?inflammatory) and M2 (pro?Th2 or pro?tolerogenic) macrophages, BIC (microRNA 155 hosting gene) was found up (more)

Martinez?Nunez, Rocio Teresa

2010-01-01T23:59:59.000Z

392

1. (P) M.I. Ojovan, W.E. Lee. New Developments in Glassy Nuclear Wasteforms. Nova Science Publishers, New York, 131p. (2007).  

E-Print Network (OSTI)

xxx Keywords: A. Intermetallics, miscellaneous B. Phase diagrams B. Thermodynamic and thermochemical in the Vienna ab-initio simulation package (VASP) [27]. We used the generalized gradient approximation (GGA, Lamoreaux RH. Molybdenum: physicochemical properties of its compounds and alloys. I. thermochemical

Ojovan, Michael

393

Summary of the EPRI Early Event Analysis of the Fukushima Daiichi Spent Fuel Pools Following the March 11, 2011 Earthquake and Tsuna mi in Japan  

Science Conference Proceedings (OSTI)

Damage to the Fukushima Daiichi Unit 4 reactor building observed on March 15, 2011, initially generated confusion and concern throughout the nuclear industry. The reactor had been defueled approximately 100 days prior to the March 11 earthquake and tsunami; therefore, any explosion in Unit 4 could not be linked to a recently operating reactor within that unit. With the full core in the spent fuel pool, suspicions immediately turned to hydrogen generated by oxidation of overheating spent fuel cladding fol...

2012-05-31T23:59:59.000Z

394

Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

converting any H 2 gas produced to water) and measuring thefor the tritium produced in pore water of the fractured rockfor the tritium produced in pore water of the fractured rock

2006-01-01T23:59:59.000Z

395

LBL RUNAROUND RESULTS 3.00 km (1.86 mi) September 16, 1994 Place Time Name GroupGroup Place Time Name GroupGroup  

E-Print Network (OSTI)

-49 8 30 11:56.7 Dan Gheng Wool 40-49 1 89 13 of the participants. The official number of finishers was 780, including babies in strollers page 7 #12;HISTORY OF LBL

396

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR; VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The main news this reporting period is the confirmed discovery of producing hydrocarbons at the State Springdale & O'Driscoll No.16-16 demonstration well in Manistee County. This well was spudded in late November, tested and put on production in December 2003. To date it is flowing nearly 100 barrels of liquid hydrocarbons per day, which is a good well in Michigan. Reserves have not been established yet. The surface geochemistry sampling at the Springdale demonstration site will be repeated this spring after the well has been on production for several months to see if the anomaly pattern changes. We expect that the anomaly will diminish as the original positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir. This is the behavior that we observed at the Bear lake demonstration well reported last quarter.

James R. Wood; A. Wylie; W. Quinlan

2004-01-01T23:59:59.000Z

397

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

In this reporting period two main accomplishments stand out. The Springdale task is in play in the northern Michigan Basin and the geochemical survey work over the Springdale prospect continued to progress. We still need to characterize the play in terms of the type of trap (basal reef diagenetic (?)) and its relation to the well documented pinnacle reef play. Also, we have become aware that Capac Field in the southern reef trend (Figure 1) is a possible analog to Springdale and so will be looking more closely at the literature on that field, particularly the work by Bowers (1987). Future work is directed toward further defining the Springdale project via more wells and examination and characterization of well cuttings. One to two more geochemical surveys are planned, one this spring and a final one in early fall. Based on current oil prices and Springdale production as of January 2005, an ROI, (defined as Total liquids revenue, $5.45m/DOE support, $1.45m) better than 3.75. This does not include gas revenues, which have not yet been calculated.

James R. Wood; A. Wylie; W. Quinlan

2005-04-01T23:59:59.000Z

398

USING RECENT ADVANCES IN 2ND SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

Science Conference Proceedings (OSTI)

Three horizontal wells have been completed (St. Springdale & Trezil 9-15 HD, St. Springdale 13-14 HD, St. Springdale & Stedronsky 10-15 HD) and three more wells were spudded (St. Springdale & CSX 2-22 HD, St. Springdale & Mann 9-21 HD and St. Springdale 7-22 HD) in the Springdale play this past reporting period. All are horizontal wells in the Brown Niagaran. This brings the total wells in the play to 12 with seven wells contributing to a total daily production exceeding 350 bbls/day. Data from these wells has been converted from drillers logs (footage calls) and converted to Michigan GeoRef coordinates and plotted. The Gamma Ray data along the well bore was available since it was used to steer the tool during drilling and this data was superimposed on the well trajectories in an effort to help distinguish pay zones from unproductive rock. One new geochemical survey was conducted over the projected surface path of the State Springdale & Stedronsky 14-15 HD and a final project survey was planned over one of the unsurveyed wells. This will bring the total surveyed wells to five and should provide enough data to determine if the idea of only sampling along the well bore is a sound strategy.

James R. Wood; A. Wylie; W. Quinlan

2005-06-30T23:59:59.000Z

399

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

Science Conference Proceedings (OSTI)

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, plans were finalized for additional surface geochemical sampling in the new Springdale Prospect field demonstration in Manistee County, Michigan. Plans were also developed to acquire additional surface geochemical data in the vicinity of the Bagley Prospect area in Otsego County, Michigan. The main news this reporting period is the continued success in the Springdale demonstration area. The State Springdale & O'Driscoll No.16-16 and the State Springdale & Herban 12-16 horizontal demonstration wells in Manistee County, Michigan are both flowing nearly 100 barrels of liquid hydrocarbons per day plus gas, which are good wells in Michigan. Reserves have not been established yet. A third horizontal well, the State Springdale & Wilburn 1-21 HD has been drilled and is waiting on completion. Two more horizontal wells have been permitted in the Springdale area by our industry partner.

James R. Wood; A. Wylie; W. Quinlan

2004-07-01T23:59:59.000Z

400

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Springdale prospect area in Manistee County, Michigan. The samples were taken along the trace of the proposed horizontal wells. The samples are presently being analyzed and the results will be reported in the next quarterly report. The main news this reporting period is that the Springdale prospect area in Manistee County, Michigan, continues to see drilling activity. Our industry partner, Jordan Development Company, LLC, is permitting additional horizontal wells following their success in the prospect area.

James R. Wood; A. Wylie; W. Quinlan

2004-12-31T23:59:59.000Z

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


401

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

SciTech Connect

Presented in this quarterly report is the Case History and Well Summary for the Vernon Field demonstration project in Isabella County, Michigan. This new case history and well summary format organizes and presents the technical and historical details of the Vernon Field demonstration, as well as the field demonstration results and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and will be used on all subsequent field demonstrations as they near completion. Planning for the annual project meeting in Tampa, Florida has begun. This meeting will be held March 7-9, 2003 at the same site as the last three meetings. The goals of this project were to: (1) test the use of multi-lateral wells to recover bypassed hydrocarbons and (2) to access the potential of using surface geochemistry to reduce drilling risk. Two new demonstration wells, the State-Smock and the Bowers 4-25, were drilled to test the Dundee Formation at Vernon Field for bypassed oil. Neither well was commercial, although both produced hydrocarbon shows. An extensive geochemical survey in the vicinity of Vernon Field, covering much of Isabella County, has produced a base map for interpretation of anomalies in Michigan. Several potential new anomalies were discovered that could be further investigated.

James R. Wood; W. Quinlan

2003-01-01T23:59:59.000Z

402

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, a new field demonstration, Springdale Prospect in Manistee County, Michigan was begun to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a fair-to-good microbial anomaly that may indicate the presence of a fault or stratigraphic facies change across the drilling path. The surface geochemistry sampling at the original Bear Lake demonstration site was updated several months after the prospect was confirmed and production begun. As expected, the anomaly appears to be diminishing as the positive (apical) anomaly is replaced by a negative (edge) anomaly, probably due to the pressure draw-down in the reservoir.

James R. Wood; W. Quinlan

2003-10-01T23:59:59.000Z

403

Functional miRNA regulation of metastatic genes promotes tumor cell dissemination in non-small cell and small cell lung carcinomas  

E-Print Network (OSTI)

Tumor progression, from initiation to advanced metastatic disease, requires the orchestration of a diverse group of cell-intrinsic and extrinsic factors. This multifactorial disease is promoted by an accumulation of genetic ...

Blat, Irene Catherine

2013-01-01T23:59:59.000Z

404

Energetics of gas-driven limnic and volcanic eruptions Department of Geological Sciences, The University of Michigan, Ann Arbor, MI 48109-1063, USA  

E-Print Network (OSTI)

and when equilibrium is reached between the gas and liquid phases Natural silicate melts often contain two.3. Dynamics of reversible gas-driven eruptions through a fluid medium Because buoyancy plays an important roleEnergetics of gas-driven limnic and volcanic eruptions Y. Zhang* Department of Geological Sciences

Zhang, Youxue

405

Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

from three different sources (fractured rock, concrete, and+Rock Concentration, no Decay, Rock Source Concentration,Decay, Rock Source Mass Storage, no Decay, Rock Source Mass

2006-01-01T23:59:59.000Z

406

50,000-Watt AM Stations IA | MB | MI | MN | NE | ND | ON | SD | WI | Station News | Owners | TV Captures | Links  

E-Print Network (OSTI)

2) and the concentration of 65Cu2+ estimated by the speciation model WHAM (1.0 (28)), we could]e^ equals zero and that [65 Cu2+ ] was constant (i.e., nominal [65 Cu2+ ] ) 5.2-µg L-1). That is, WHAM the speciation model WHAM (28) assuming that the lake water has a pH near 8 (30), a dissolved organic carbon

Allen, Gale

407

Mobility of Tritium in Engineered and Earth Materials at the NuMI Facility, Fermilab: Progress report for work performed between June 13 and September 30, 2006  

E-Print Network (OSTI)

nontritium-bearing drilling fluid during the coring process,nontritium-bearing drilling fluid during the coring process,cores be drilled with drilling fluid spiked with a tracer.

2006-01-01T23:59:59.000Z

408

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI.  

SciTech Connect

The principal objective of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. As part of the project, a field demonstration was undertaken to assess the validity and usefulness of the microbial surface geochemical technique. The surface geochemistry data showed a strong anomaly in the Myrtle Beach area that would justify drilling by itself and even more so in conjunction with the structural interpretation from the 3D seismic data. The Myrtle Beach geochemical survey indicated a good to excellent prospect which was confirmed by drilling. Presented in this quarterly report is the Case History and Well Summary for the Myrtle Beach area in Burke County, North Dakota. This case history presents the important technical details regarding the geochemistry and the two vertical wells that are part of this field demonstration, and the applicability of these results to other demonstration projects. This format could be duplicated for other demonstration projects and is being used on all subsequent field demonstrations as they near completion.

James R. Wood; W. Quinlan

2003-07-01T23:59:59.000Z

409

AND FINANCIAL 2011 Edition | EConoMiC And FinAnCiAL PRoFiLE oF QUBEC  

E-Print Network (OSTI)

ENERGY AGENCY. SOURCE: HYDRO-QU?BEC, COMPARISON OF ELECTRICITY PRICES IN MAJOR NORTH AMERICAN CITIES renewable energy, hydro-electricity in particular. It supports the development of wind power through its Energy Strategy 2006-2015, Hydro-Québec is actively pursuing development of Québec's hydroelectric

Rosei, Federico

410

USING RECENT ADVANCES IN 2D SEISMIC TECHNOLOGY AND SURFACE GEOCHEMISTRY TO ECONOMICALLY REDEVELOP A SHALLOW SHELF CARBONATE RESERVOIR: VERNON FIELD, ISABELLA COUNTY, MI  

SciTech Connect

One of the principal objectives of this demonstration project is to test surface geochemical techniques for detecting trace amounts of light hydrocarbons in pore gases as a means of reducing risk in hydrocarbon exploration and production. During this reporting period, microbial samples were collected from the Trusty Steed prospect area in Grand Traverse County, Michigan. The samples were analyzed using the Microbial Oil Surveying Technique (MOST) technique and revealed only a local (1-point) anomaly. A decision to resample over that point is pending, but drilling has been postponed for the time being. The main news this reporting period is that in the Bear Lake area, northwest Michigan, Federated Oil & Gas Properties' Charlich-Fauble 2-9HD horizontal lateral, has cumulative production of more than 72,000 barrels of oil and is still producing 50 to 75 bopd from a Silurian Niagaran reef reservoir eighteen months after the well was completed. Surface geochemical surveys conducted in the demonstration area were consistent with production results although the ultimate decision to drill was based on interpretation of conventional subsurface and 2D seismic data. The surface geochemical techniques employed were Solid Phase MicroExtraction (SPME) and MOST. The geochemical results have been submitted to World Oil for publication. New geochemical surveys are planned for November in the Springdale quadrangle in Manistee County, Michigan. These surveys will concentrate on sampling over the trace of the proposed horizontal wells rather than a broad grid survey.

James R. Wood; A. Wylie; W. Quinlan

2004-10-01T23:59:59.000Z

411

U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Frankfort, KY Frankfort, KY Proposed Action Description: Frankfort, KY proposes to replace the roof on city hall with an energy efficient roof. The city hall is listed on the on the Historic Register. This ex determination is conditioned on the submission of documentation of the KY SHPO approval of the particular rood replacement on this city hall to the DOE. No physical war!< on the project may begin until the DOE has reviewed and accepted such documentation. The no extraordinary conditions determination is dependent on meeting this condition. Categorical Exclusion(s) Applied: 85.1 - Actions to conseNe energy or water For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, including the full text of each categorical exclusion, see Subpart D of 10 CFR Part 102 1.

412

Black Hawk Lake Fresno River  

E-Print Network (OSTI)

Black Hawk Lake Fresno River R D 4 0 0 RD 415 HWY41 RD 207 REVISRD YO SEM ITE SP RINGS P KY LILLEY County Rosedale Ranch Revis Mountain Daulton Spring Red Top Lookout Buford Mountain Black Hawk Lake

Wang, Zhi

413

Mechanical modeling and transient anti-plane fracture analysis for ...  

Science Conference Proceedings (OSTI)

Mar 13, 2008 ... Armored Force Engineering, No. 21, Du Jia Kan, Chang. Xin Dian, Beijing 100072, P.R. China e-mail: LYDbeijing@163.com. Y.-D. Li K.Y. Lee...

414

Synoptic Overview of RACORO  

NLE Websites -- All DOE Office Websites (Extended Search)

March 31 st , 2009 Louisville, KY Synoptic Overview * What is going on with the weather? * The following slides will give some insight into why the weather has been so...

415

Categorical Exclusion Determinations: Nebraska | Department of...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

16, 2009 CX-000554: Categorical Exclusion Determination Ogallala Substation KY1A Transformer Replacement CX(s) Applied: B4.6 Date: 11162009 Location(s): Ogallala, Nebraska...

416

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

to Sept 30, 2013 Lexington, KY 40506-0286 Post-Combustion CO2 Capture for Existing PC Boilers by Self-Concentrating Amine Absorbent The primary objective of this project is to...

417

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

KY - Work is ongoing at the Paducah Gaseous Diffusion Plant (PGDP) to raze a 65,000-square-foot facility known as the C-340 Metals Plant, which was used to make uranium metal...

418

Summary - Building C-400 Thermal Treatment Remedial Design Report...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Paducah, KY EM Project: Building C400 Thermal Treatment ETR Report Date: August 2007 ETR-8 United States Department of Energy Office of Environmental Management (DOE-EM) External...

419

U.S. DEPARTMENT OF ENERGY - NETL CATEGORICAL EXCLUSION (CX) DESIGNATIO...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

SEP ARRA PMC 2009 Vicki L. Duvall 042009-043012 Kentucky KY Rev2 Green and Healthy Schools Program (GHS) Improve knowledge base about energy & related environmental topics for...

420

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

nes-ten-or-more-miles-long-new Article Paducah Community Chronicles Site History in New Book PADUCAH, Ky. - Members of the Paducah Citizens Advisory Board (CAB) spearheaded the...

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


421

A Basic Overview of the Former Worker Medical Screening Program...  

NLE Websites -- All DOE Office Websites (Extended Search)

KY 42001 Phone: (270) 442-3789, (270) 566-4489 or 1(888) 241-1199 Missouri Kansas City Plant Production workers ORAUNSSP Phone: 1(866) 812-6703 Mallinckrodt & Weldon Spring...

422

Figure 23. Average price of natural gas delivered to U.S. commercial...  

Annual Energy Outlook 2012 (EIA)

Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA FL NJ AL...

423

Microsoft Word - figure_22.doc  

Gasoline and Diesel Fuel Update (EIA)

Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA FL NJ AL...

424

Microsoft Word - figure_21.doc  

Annual Energy Outlook 2012 (EIA)

of Natural and Supplemental Gas Supply and Disposition," and Form EIA-910, "Monthly Natural Gas Marketer Survey." IN OH TN WV VA KY MD PA NY VT NH MA CT ME RI DE DC NC SC GA...

425

Microsoft Word - figure_23.doc  

Annual Energy Outlook 2012 (EIA)

11.00+ Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." IN OH TN WV VA KY MD PA NY VT NH MA...

426

Microsoft Word - figure_23.doc  

Gasoline and Diesel Fuel Update (EIA)

Source: Energy Information Administration (EIA), Form EIA-176, "Annual Report of Natural and Supplemental Gas Supply and Disposition." IN OH TN WV VA KY MD PA NY VT NH MA...

427

Page not found | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

ohaarticlessummary-decisions-july-29-2013-august-2-2013 Article Paducah Demolition Debris Shipped for Disposition PADUCAH, Ky. - Twenty-eight rail cars filled with debris from...

428

EA-1642S: Small-Scale Pilot Plant for the Gasification of Coal...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

642S: Small-Scale Pilot Plant for the Gasification of Coal and Coal-Biomass Blends and Conversion of Derived Syngas to Liquid Fuels via Fischer-Tropsch Synthesis, Lexington, KY...

429

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

092013 249 W. Cumberland Gap, Corbin, KY I-75 Green Corridor Project Install retail biofuel (E85) fueling infrastructure along the Interstate 75 corridor. 02 16 2010 Steven W....

430

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EE PMC 2010 Vicki Duvall 2009-2012 Fancy Farm, Kentucky KY On Farm EE and RE Partnership Market Title -- 98 kW Photovaltaic Electricity Generation Willett Farms, Inc --...

431

Categorical Exclusion Determinations: B4.6 | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

16, 2009 CX-000554: Categorical Exclusion Determination Ogallala Substation KY1A Transformer Replacement CX(s) Applied: B4.6 Date: 11162009 Location(s): Ogallala, Nebraska...

432

Kentucky DOE-EPSCoR Program  

SciTech Connect

The KY DOE EPSCoR Program included efforts to impact positively the pipeline of science and engineering students and to establish research, education and business infrastructure, sustainable beyond DOE EPSCoR funding.

Stencel, J.M.; Ochsenbein, M.P.

2003-04-14T23:59:59.000Z

433

THE TOTAL SYNTHESIS OF INDOLOCARBAZOLE NATURAL PRODUCTS K252c, (+)-K252a, (+)-RK-286c, (+)-MLR-52,  

E-Print Network (OSTI)

and T. Sevenet, J. Nat. Prod., 2000, 63, 441­446. 7 S.-G. Cao, V. H. L. Sng, X.-H. Wu, K.-Y. Sim, B. H

Stoltz, Brian M.

434

Stability of Nanomaterials  

Science Conference Proceedings (OSTI)

... that the increased Cu-Nb interface surface disrupts internal-stress relaxation ... and against Radiation: Xinghang Zhang1; Y. Chen1; D. Bufford1; K.Y. Yu1; .... the nanocrystalline range (exposures at temperatures in the range...

435

Journal of Computer and System Sciences 78 (2012) 11271141 Contents lists available at SciVerse ScienceDirect  

E-Print Network (OSTI)

as other models like HMM [5]. For example, experimental results [10] show that the usage of a PFSA with General Electric, Louisville, KY, United States. 0022-0000/$ ­ see front matter © 2012 Elsevier Inc. All

Ray, Asok

436

NETL: News Release - DOE Funds 21st Year of University Student...  

NLE Websites -- All DOE Office Websites (Extended Search)

Technology for Controlling Pyrite Oxidation Vasilios P. Evangelou Agronomy Department University of Kentucky Lexington, KY 40506-0091 139,782 21,986 The Scale-up of Large...

437

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FE0000699 University of Kentucky FE DE-FE0000699 315 10 Donald Krastman 5110 -10112 Lexington, Fayette County, KY BENEFICIATION OF FINE SIZE POWDER RIVER BASIN COAL Evaluate a...

438

Energy Department Announces Awards to Projects Advancing Innovative...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

the performance of the system. DOE Investment: 1,000,000 Recipient Cost-Share: 391,000 University of Kentucky Research Foundation (Lexington, Ky.) - The project will investigate...

439

NETL: News Release - DOE Selects 7 Research Proposals to Help...  

NLE Websites -- All DOE Office Websites (Extended Search)

fly ash left as a residue of coal combustion easier to re-use as a cement replacement. University of Kentucky Research Foundation, Lexington, KY, to develop a better...

440

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

DE-FE0000699 University of Kentucky FE DE-FE0000699 315 10 Donald Krastman 5110 -10112 Lexington, Fayette County, KY Dewatering of Fine Coal Pellets Demonstrating the...

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


441

Final_Tech_Session_Schedule_and_Location.xls  

NLE Websites -- All DOE Office Websites (Extended Search)

1 Kentucky Geological Survey, 228 Mining and Mineral Resources Building, University of Kentucky, Lexington, KY 40506-0107, Phone: 859-257-5500, Fax: 859-257-1147 2...

442

Accumulation and Metabolism of Halogenated Compounds in Sea Turtles  

E-Print Network (OSTI)

Lexington: The University of Kentucky Press, 35-46. JewellLexington, KY: The University of Kentucky Press, xi- xxx.Lexington: The University of Kentucky Press, 35-46. Jaspers

Richardson, Kristine Lynn

2010-01-01T23:59:59.000Z

443

Carbon Sequestration on Surface Mine Lands  

NLE Websites -- All DOE Office Websites (Extended Search)

Graves 1 , J.M. Ringe 1 , J.W. Stringer 1 and J.A 2 . Thompson 1 Department of Forestry, University of Kentucky, Lexington, KY 40546, 2 Department of Soil Science, North Carolina...

444

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

FE0000699 University of Kentucky FE DE-FE0000699 315 10 Donald Krastman 5110 -10112 Lexington, Fayette County, KY DEVELOPMENT OF STRATEGIES TO MINIMIZE THE RELEASE OF TOXIC...

445

Former Worker Medical Screening Program - Paducah Gaseous Diffusion...  

NLE Websites -- All DOE Office Websites (Extended Search)

Jim Frederick Co-Principal Investigator: Steven Markowitz, MD Toll-free Telephone: (888) 241-1199 Local Outreach Office: James Harbison 2525 Cairo Road Paducah, KY 42001 Website:...

446

Solid Sorbents for CO2 Capture from Precombustion Gas Streams  

NLE Websites -- All DOE Office Websites (Extended Search)

Morgantown, WV 26507 304-285-4458 george.richards@netl.doe.gov PROjeCT PARTNeRS Sd-Chemie Inc. (Louisville, KY) Carnegie Melon University (Pittsburgh, PA) COST Total estimated...

447

Demolition, Groundwater Cleanup Highlight Paducah's 2013 Accomplishmen...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

boxed in a container for on-site storage at Paducah. PADUCAH, Ky. - Work to remove two aging, inactive structures and clean up a leading source of groundwater contamination marked...

448

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Drilling, Inc. FE Buckman Project SCNGO FY11 Gary Covatch 12 months Bowling Green, KY Jet Drilling With Energized Fluids Upgrade of Buckman Jet Drilling system to higher horsepower...

449

Epigenetic Alterations in High and Low LET Radiation Induced...  

NLE Websites -- All DOE Office Websites (Extended Search)

of the unstable clones. Among these, altered miRNA expression could be validated by qRT-PCR for mmu-miR-466g, hsa-miR-30a and hsamiR- 195. Hsa-miR-30a and hsa-miR-195 were...

450

,"Michigan Natural Gas Summary"  

U.S. Energy Information Administration (EIA) Indexed Site

1: Prices" "Sourcekey","N3050MI3","N3010MI3","N3020MI3","N3035MI3","N3045MI3" "Date","Natural Gas Citygate Price in Michigan (Dollars per Thousand Cubic Feet)","Michigan Price of...

451

Applications in the Nuclear Industry for Thermal Spray Amorphous Metal and Ceramic Coatings  

E-Print Network (OSTI)

Science & Technology 2007, Detroit, MI, Sept. 16 20, 2007,2007, Sept. 1620, 2007, Detroit, MI, American CeramicExhib. , Sept. 1620, 2007, Detroit, MI, American Ceramic

Blink, J.; Farmer, J.; Choi, J.; Saw, C.

2009-01-01T23:59:59.000Z

452

_MainReport  

NLE Websites -- All DOE Office Websites (Extended Search)

Vehicle Usage Number of trips 773,602 Total distance traveled (mi) 5,558,155 Avg trip distance (mi) 7.2 Avg distance traveled per day when the vehicle was driven (mi) 30.2 Avg...

453

Computational Enhancements in Low-Rank Semidefinite ...  

E-Print Network (OSTI)

Jul 12, 2004 ... curvature condition necessary for L-BFGS, to be more efficient than the WP linesearch if the ... The precise condition ..... (Mi D)Mi, Mi := AiR.

454

Tradeoffs between Costs and Greenhouse Gas Emissions in the Design of Urban Transit Systems  

E-Print Network (OSTI)

mi) Maintenance emissions (g/veh-mi) Total emissions (g/veh-mi) Total emissions (g/veh-km) Comments 15,300 Based onfrom Chester (2008); emissions from EIO-LCA (CMU 2012) 1,841

Griswold, Julia Baird

2013-01-01T23:59:59.000Z

455

Energy Information Administration/Oil and Gas Field Code ...  

U.S. Energy Information Administration (EIA)

mississippi union 01-26n-9w grand traverse mi 055 003557 n 1969 union 02-26n-9w grand traverse mi 055 006252 n 1973 union 03-26n-9w grand traverse mi ...

456

Service/Product Provider  

NLE Websites -- All DOE Office Websites (Extended Search)

816 Maple St. 738 E. Gull Lake Dr. Three Rivers, MI 49093 Augusta, MI 49012 Business: Steam, air & hot water systems Business: Pharmaceutical manufacturing Tom Henry, Director of...

457

Fermilab Today  

NLE Websites -- All DOE Office Websites (Extended Search)

experiments with approximately 25 hours and 51 minutes of luminosity - NuMI off due to power supply - MI transformer replaced Monday evening - Store established Tuesday morning...

458

Subsidized Housing and Neighborhood Change  

E-Print Network (OSTI)

97 Figure 3-6a Detroit, MI PMSA Neighborhood Quintile98 Figure 3-6b Detroit, MI PMSA Neighborhood Quintileinterviewing from the Detroit Area Study. Neighborhood

Wilson, Florence Louise

2011-01-01T23:59:59.000Z

459

DOE - Office of Legacy Management -- General Motors Co - Flint...  

Office of Legacy Management (LM)

Motors Co - Flint - MI 07 FUSRAP Considered Sites Site: GENERAL MOTORS CO. (MI.07 ) Eliminated from further consideration under FUSRAP Designated Name: Not Designated Alternate...

460

E Pluribus...Separation: Deepening Double Segregation for More Students  

E-Print Network (OSTI)

TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-TX Detroit-Ann Arbor-Flint, MI Philadelphia-Wilmington-

Orfield, Gary; Kucsera, John; Siegel-Hawley, Genevieve

2012-01-01T23:59:59.000Z

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


461

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

MI Clean Energy Coalition - Michigan Green Fleets This CX form is for installing propane refueling infrastructure at one site in MI. This CX is for project selected under...

462

NETL: Oil & Natural Gas Technologies Reference Shelf - Presentation on CO2  

NLE Websites -- All DOE Office Websites (Extended Search)

CO2 Sequestration Potential of the North Michigan Silurian Reef CO2 Sequestration Potential of the North Michigan Silurian Reef CO2 Sequestration Potential of the North Michigan Silurian Reef Authors: Brian Toelle, Chaoqing Yang (speaker), and Tracee Imai, Schlumberger Ltd. Venue: Eastern Section of the American Association of Petroleum Geologists 2007 Annual Meeting, Lexington, KY, September 16–18, 2007 (http://www.uky.edu/KGS/esaapg07/ [external site]). Abstract: The Northern Silurian Reef trend of the Michigan Basin was developed within the stratigraphic unit historically referred to as the Niagaran Brown. Within the past few years this unit was renamed the Guelph Formation. Over 700 reefs make up this trend, with some of these being over 300 acres in size and having produced more than 5 million barrels of oil. Estimates of the total amount of hydrocarbons produced for the entire trend have been reported to be as much as nearly a half a billion barrels. The U.S. Department of Energy has funded a study of an ongoing enhanced oil recovery project being conducted on a reef within this trend and entailing CO2 injection. The Charlton 30/31 reef, located in Otsego County, MI, like many other reefs in the play, was discovered and developed during the 1970s and 1980s. This field has completed its primary production phase, during which six wells produced 2.6 million of the field’s estimated 7 million barrels of oil in place. This reservoir is characterized as a low-porosity, low-permeability limestone matrix with irregular dolomitized intervals providing a secondary network of higher porosity and permeability, which controls fluid flow throughout the reservoir. The estimated average porosity in this reef is just slightly over 6 percent. As part of this study, the reservoir attributes identified at the Charlton 30/31 reef were extended to the entire Northern Reef Trend in order to determine its CO2 sequestration capacity. Additionally, the potential oil recovery has been estimated.

463

Paper accepted for presentation at the 11th Int. Conf. on Coal Science (ICCS-11),  

E-Print Network (OSTI)

. Lackner, K.S.; Butt, D.P.; Wendt, C.H., 1997. Magnesite disposal of carbon dioxide. 22. international.P.; Lackner, K.S.; Wendt, C.H., et al, 1998. The kinetics of binding carbon dioxide in magnesium carbonate. 23. Ziock, H.; Lackner, K.S.; Butt, D.P.; Wendt, C.H., 1999. The need and options available for permanent CO

Zevenhoven, Ron

464

Project Overview  

NLE Websites -- All DOE Office Websites (Extended Search)

Modeling CO Modeling CO 2 Sequestration in Saline Aquifer and Depleted Oil Reservoir to Evaluate Regional CO 2 Sequestration Potential of Ozark Plateau Aquifer System, South-Central Kansas" W. Lynn Watney and Jason Rush, Joint PIs, and team members -- Saibal Bhattacharya 1 , John Doveton, Aadish Gupta, Mina Fazelalavi, Evan Franseen, Rick Miller, David Newell, Marios Sophocleous, Debrah Stewewart, Dan Suchy, John Victorine, Jianghai Xia 2 - Kansas Geological Survey, Lawrence, KS Dana Wreath, Randy Koudele, Bill Lamb -BEREXCO LLC, Wichita, KS (Wellington Industry Partner) Robert Goldstein, Breanna Huff, Bradley King, Jennifer Roberts, Aimee Scheffer, George Tsoflias, Ayrat Sirazhiev - Department of Geology, University of Kansas, Lawrence, KS Tom Hansen - Bittersweet Energy, Inc., Wichita, KS

465

Major DOE Biofuels Project Locations  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

(St. Joseph, MO) Abengoa Biochemica Agricultural Residue (Hugoton, KS) DOE Joint Bioenergy Institute (Berkeley, CA) DOE Great Lakes Bioenergy Research Center (Madison, WI) DOE...

466

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Region Alternative Fuels Project Activities include purchase of six hybrid electric diesel powered vehicles for student transportation in Kansas City, KS. This CX is for one...

467

NETL: PPII - Integration of Low-NOx Burners with an Optimization...  

NLE Websites -- All DOE Office Websites (Extended Search)

Integration of Low-NOx Burners with an Optimization Plan for Boiler Combustion - Project Brief PDF-72KB Sunflower Electric Power Corp., Garden City, Finney County, KS PROJECT...

468

Catherine Cooksey  

Science Conference Proceedings (OSTI)

... 2007-present, NIST, Gaithersburg, MD. Education: Ph.D. University of Washington, Seattle, WA. BS University of Kansas, Lawrence, KS. Contact. ...

2013-04-12T23:59:59.000Z

469

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

- 8242012 Manhattan, KS PAX Cooling Cycle Develop and demonstrate a water based, non-vapor compression cooling system for multiple climate control systems 01 11 2011 Paul...

470

NETL: Oil & Natural Gas Technologies Reference Shelf - Presentation  

NLE Websites -- All DOE Office Websites (Extended Search)

in Kansas Author: Stan McCool, University of Kansas Center for Research Venue: Tertiary Oil Recovery Projects 18th Improved Oil Recovery Conference, Wichita, KS, April 12,...

471

The State of Organizing in Midwestern First Suburbs Commentary  

E-Print Network (OSTI)

Cleveland, Columbus, Detroit, Milwaukee, Minneapolis, andCleveland; Columbus, OH; Detroit; Kansas City, KSMO;Number 1: Winter 2006 Dayton Detroit Kansas City Minneapolis

Puentes, Robert

2006-01-01T23:59:59.000Z

472

NETL F 451.1-1/1 Categorical Exclusion (CX) Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

6126 Parallel, Kansas City, KS Midwest Region Alternative Fuels Project Install CNG Fast and Slow Fill Refueling Infrastructure and Electric Recharging Infrastructure. Grant ID:...

473

Ocean Informatics Monograph. Ocean Informatics Initiative: an Ethnographic Study (2002-2006). Part 2: Appendices  

E-Print Network (OSTI)

Scientific Digital Delivery Ocean Informatics: Shaun HaberResearch Publications about the Ocean Informatics initiativeF. and K.S. Baker (2011). Ocean Informatics Monograph (2002-

Millerand, Florence; Baker, Karen S

2011-01-01T23:59:59.000Z

474

Clostridium thermocellum ATCC27405 transcriptomic, metabolomic...  

NLE Websites -- All DOE Office Websites (Extended Search)

11. Lynd LR, Weimer PJ, van Zyl WH, Pretorius IS: Microbial cellulose utilization: Fundamentals and biotechnology. Microbiol Mol Biol Rev 2002, 66:506. 577. 12. Rani KS,...

475

Corn and weed interactions with nitrogen in dryland and irrigated environments.  

E-Print Network (OSTI)

??Corn yield potential is limited by water deficit stress and limited soil nitrogen. Field and greenhouse experiments were conducted near Manhattan, KS in 2005 and (more)

Ruf, Ella Kathrene

2007-01-01T23:59:59.000Z

476

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

EE0005447 The Goodyear Tire & Rubber Company EE PMCPVT 2012 10012011 to 09302014 Adrienne L. Riggi Topeka, Shawnee Co., KS A System for Automatically Maintaining Pressure in...

477

U.S. DEPARTMENT OF ENERGY - NETL CATEGORICAL EXCLUSION (CX) DESIGNATIO...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Sumner Co, KS Modeling CO2 Sequestration in Saline Aquifer and Depleted Oil Reservoir to Evaluate Regional CO2 Sequestration Potential of Ozark Plateau Aquifer System,...

478

U.S. DEPARTMENT OF ENERGY - NETL CATEGORICAL EXCLUSION (CX) DESIGNATIO...  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Wichita, KS Modeling CO2 Sequestration in Saline Aquifer and Depleted Oil Reservoir to Evaluate Regional CO2 Sequestration Potential of Ozark Plateau Aquifer System, South-Central...

479

H13: Massive Crystallization in FeSiNbBCu Alloys under Rapid ...  

Science Conference Proceedings (OSTI)

... at the extreme limits of heating rates (~100-200 K/s) and observed the dramatic changes in ... Coupling Magnetism to Electricity in Multiferroic Heterostructures.

480

Appendix E: Public Involvement  

NLE Websites -- All DOE Office Websites (Extended Search)

List Tribal Historic Preservation Office Attn: Deanne Bahr Sac and Fox Nation of Missouri 1322 US Hwy 75 Powhattan, KS 66527 Tribal Historic Preservation Office Attn: Karen...

Note: This page contains sample records for the topic "ks ky mi" from the National Library of EnergyBeta (NLEBeta).
While these samples are representative of the content of NLEBeta,
they are not comprehensive nor are they the most current set.
We encourage you to perform a real-time search of NLEBeta
to obtain the most current and comprehensive results.


481

ANNUAL REPORT BUREAU OF COMMERCIAL FISHERIES  

E-Print Network (OSTI)

Submerged plants. 8 Radioactivity in the estuarine environment 9 Fallout radioactivity in mollus ks . 9 Fallout radioactivity in fishes ". 11 Biogeochemistry program. . . . . . . . . . . 13 Oyster

482

The effect of mindset on assimilative and contrastive social comparison outcomes and body image  

E-Print Network (OSTI)

Psychology, 25, 70-79. Beauregard, K.S. , & Dunning, D. (bias in self-ratings (e.g. ,Beauregard & Dunning, 1997),

Wanic, Rebekah Amelie

2011-01-01T23:59:59.000Z

483

Positional Value and Linguistic Recursion  

Science Conference Proceedings (OSTI)

metaphors of ''killing'' or ''destroying,'' such as hanana, vadha, ks.aya. Those .... Pan.ini's grammar,3 composed perhaps sometime around the fifth century BC,.

484

Publications of Ronald F. Boisvert  

Science Conference Proceedings (OSTI)

... Areas, in Quantum Communications and Quantum Imaging VI (RE Meyers, Y. Shih, and KS Deacon, eds.), Proceedings of the SPIE 7092, Article ...

2012-09-04T23:59:59.000Z

485

Construction Metrology and Automation Publications  

Science Conference Proceedings (OSTI)

... Cheok, G., S., Saidi, KS, and Franaszek, M., [2009], "Target Penetration of Laser-Based 3D Imaging Systems," Proceedings SPIE 21st Annual ...

2011-12-23T23:59:59.000Z

486

ADAPTIVE REGULARIZED SELF-CONSISTENT FIELD ITERATION ...  

E-Print Network (OSTI)

the minimization of the KS total energy functional with respect to .... The second term denotes local ionic potential energy, where the diagonal matrix. Vion is the...

487

Microsoft PowerPoint - WAPA Transmission Developments in NM ...  

NLE Websites -- All DOE Office Websites (Extended Search)

authorities: NM, CO, WY, KS, ND, UT, SD & ID Tasked with planning and financing of transmission lines within their respective states RETA has the additional requirement that...

488

NETL F 451.1/1-1, Categorical Exclusion Designation Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

Ellis County, KS Characterization of Sites for Near Miscible CO2 Applications to Improve Oil Recovery in Arbuckle... Perform a single-well partitioning tracer test to measure...

489

The Bowersock Mills and Power Company 1874  

NLE Websites -- All DOE Office Websites (Extended Search)

Hydroelectric Energy The Bowersock Mills and Power Co., Lawrence, KS Hydroelectric Energy Potential for U.S. BMPC Plant At Forefront of Development Curve "In our estimates...

490

New ATP Awards Announced in 2001  

Science Conference Proceedings (OSTI)

... Through Silent Sound and Clean Water Uncopiers, Inc., Manhattan, KS Design ... Requested ATP funds: $2,000 K (est.); Total project budget: $2,311 ...

2011-10-19T23:59:59.000Z

491

ATP Project Brief - 00-00-4403  

Science Conference Proceedings (OSTI)

... Sponsor: Uncopiers, Inc. 6923 Redbud Drive Manhattan, KS 66503-9123: Project Performance Period: 9/1/2001 - 8/31/2004; ...

492

Acknowledgments  

Science Conference Proceedings (OSTI)

...Tim Webber, IPG Photonics, Oxford, MA Frank Brennan, Trumpf, Plymouth, MI Rainer Uhlig, ABB, Fort Collins, CO Jim Cann, Rofin Sinar, Plymouth, MI Urban Widén, Permanova, Mölndal, Sweden Robert Borgstrom, Precitec, New Hudson, MI Scott Green, LT Ultra, New Hudson, MI Mike...

493

Supporting Information Evolution of Dendritic Platinum Nanosheets  

E-Print Network (OSTI)

87131. 3 Toyota Technical Center, Toyota Motor Engineering & Manufacturing North America, Ann Arbor, MI

Shelnutt, John A.

494

Civil Works Fact Sheets  

E-Print Network (OSTI)

HAMILTON DAM, FLINT RIVER, FLINT, MI ............................................ LRD-19 HOLES CREEK, WEST

US Army Corps of Engineers

495

MicroRNA expression in canine mammary cancer  

E-Print Network (OSTI)

MicroRNAs (miRNAs) play a vital role in differentiation, proliferation and tumorigenesis by binding to messenger RNAs (mRNA) and inhibiting translation. To initiate an investigation into the identification of miRNAs in the domestic dog, an emerging model for human disease, a comparison of the human and canine genetic databases was conducted. The bioinformatics work revealed significant conservation of miRNA genes between the two species. Proof of principle experiments, including serial dilutions and sequencing, were performed to verify that primers made to amplify human mature miRNAs can be used to amplify canine miRNAs, providing that the mature sequences are conserved. TaqMan Real-time RT-PCR, a sensitive and specific method, was used to isolate the first miRNA mature products from canine tissues. The expression levels of miR-17-3p, miR-17-5p, miR-18, miR-19a, miR-19b, miR-20, and miR-92 were evaluated in five canine tissues (heart, lung, brain, kidney, and liver). Because miRNAs have been found to act as both tumor suppressors and oncogenes in several different cancers, expression patterns of ten miRNAs (miR-15a, miR-16, miR-17-5p, miR-21, miR-29b, miR-125b, miR-145, miR-155, miR-181b, let-7f) known to be associated with human breast cancer were compared between malignant canine mammary tumors (n=6) and normal canine mammary tissue (n=10). Resulting data revealed miR-29b and miR-21 to have a statistically significant (p<0.05) up-regulation in cancerous samples. Overall expression patterns showed nine of the ten miRNAs follow the same pattern of expression in the domestic dog as the human, while the miR-145 expression does not show a difference between the normal and cancerous samples.

Boggs, Rene' Michelle

2008-05-01T23:59:59.000Z

496

,"Kentucky Natural Gas Underground Storage Capacity (MMcf)"  

U.S. Energy Information Administration (EIA) Indexed Site

Monthly","9/2013" Monthly","9/2013" ,"Release Date:","12/12/2013" ,"Next Release Date:","1/7/2014" ,"Excel File Name:","n5290ky2m.xls" ,"Available from Web Page:","http://tonto.eia.gov/dnav/ng/hist/n5290ky2m.htm" ,"Source:","Energy Information Administration" ,"For Help, Contact:","infoctr@eia.doe.gov" ,,"(202) 586-8800",,,"12/12/2013 5:30:13 PM" "Back to Contents","Data 1: Kentucky Natural Gas Underground Storage Capacity (MMcf)" "Sourcekey","N5290KY2" "Date","Kentucky Natural Gas Underground Storage Capacity (MMcf)" 37271,219914 37302,219914 37330,219914 37361,219914

497

Energy Efficiency and Conservation Block Grant Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

KY-City-Owensboro KY-City-Owensboro Location: City Owensboro KY American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Administration costs related to energy efficiency and conservation strategy implementation, 2) replacement of windows in City Public Works Administration Building, 3) install bus shelters to encourage and increase ridership on public transit system, and 4) remove and replace light ballasts and lamps in City Hall Building. Conditions: None Categorical Exclusion(s) Applied: A9, A11, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21 This action would not: threaten a violation of applicable statutory, regulatory, or permit requirements for environment, safety, and health,

498

Energy Efficiency and Conservation Block Grant Program  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

KY-City-Owensboro KY-City-Owensboro Location: City Owensboro KY American Recovery and Reinvestment Act: Proposed Action or Project Description: 1) Administration costs related to energy efficiency and conservation strategy implementation, 2) replacement of windows in City Hall Building, and 3) install bus shelters to encourage and increase ridership on public transit system. Conditions: None Categorical Exclusion(s) Applied: A9, A11, B2.5, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21 This action would not: threaten a violation of applicable statutory, regulatory, or permit requirements for environment, safety, and health, including DOE and/or Executive Orders; require siting, construction, or major expansion of waste storage, disposal, recovery, or

499

CX-008402: Categorical Exclusion Determination | Department of Energy  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

02: Categorical Exclusion Determination 02: Categorical Exclusion Determination CX-008402: Categorical Exclusion Determination Granby Pumping Plant Switchyard - Transformer Protective Barrier Walls CX(s) Applied: B4.6 Date: 05/04/2012 Location(s): Colorado Offices(s): Western Area Power Administration-Rocky Mountain Region Western Area Power Administration (Western) will add two protective barrier walls between power transformers KY1A, KY2A, and KY3A to prevent damage to one another in the event of catastrophic failure by anyone of the three transformers. The principal components of work include constructing two barrier walls and supporting foundations in between each of the existing transformers. CX-008402.pdf More Documents & Publications CX-009235: Categorical Exclusion Determination CX-009410: Categorical Exclusion Determination

500

U.S. Department of Energy NEPA Categorical Exclusion Determination Form  

Energy.gov (U.S. Department of Energy (DOE)) Indexed Site

KY-County-Bullitt KY-County-Bullitt Location: County Bullitt KY American Recovery and Reinvestment Act: Proposed Action or Project Description 1) Development of an energy efficiency and conservation strategy (completed), 2) retrofit the Annex building (1979) by installation of a new roof structure and roof with attic ventilation, addition of new attic insulation, and replacement of the HVAC system with a more energy efficient system, 3) replacement of the inaccurate natural gas meter at the Community Action/Red Cross Building, 4) retrofit the pumps and controls for five sanitary sewer lift stations Conditions: None Categorical Exclusion(s) Applied: A9, A11, B2.5, B5.1 *-For the complete DOE National Environmental Policy Act regulations regarding categorical exclusions, see Subpart D of 10 CFR10 21